Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Effects of sequential Campylobacter jejuni 81-176 lipooligosaccharide core truncations on stress survival… Naito, Mizue 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


24-ubc_2008_fall_naito_mizue.pdf [ 1.81MB ]
JSON: 24-1.0066962.json
JSON-LD: 24-1.0066962-ld.json
RDF/XML (Pretty): 24-1.0066962-rdf.xml
RDF/JSON: 24-1.0066962-rdf.json
Turtle: 24-1.0066962-turtle.txt
N-Triples: 24-1.0066962-rdf-ntriples.txt
Original Record: 24-1.0066962-source.json
Full Text

Full Text

Effects Of Sequential Campylobacterjejuni 81-176 Lipooligosaccharide Core Truncations On Stress Survival And Pathogenesis  by Mizue Naito B. Sc., University of Toronto, 2006  A THESIS SUBMITTED TN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES (Microbiology and Immunology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) August, 2008 © Mizue Naito, 2008  ABSTRACT Campylobacterjejuni, a Gram-negative enteric pathogen, is the leading cause of bacterial gastroenteritis in the developed world. A C. jejuni strain 8 1-176 transposon library was used to screen for mutants over-producing a calcofluor white (CFW)-reactive polymer implicated in biofilm formation. This identified two lipooligosaccharide (LOS) core mutants: one defective for a two-domain glycosyltransferase (lgtF), and the other defective in a heptosyltransferase (waaF). To determine if other LOS core mutants displayed a similar phenotype, and to explore other biological outcomes of step-wise LOS truncations on C. jejuni stress resistance and pathogenesis, mutant strains defective for GaiT and CstII were also constructed. Silver stain and mass spectrometry analyses confirmed the sequential truncation of sialic acid (AcstII), galactose (AgalT), two glucoses (AlgtF), and heptose II (AwaaF). While the AlgtF and AwaaF mutants exhibited enhanced biofilm formation and iXlgtF displayed increased sensitivity to complement killing, no effect for these phenotypes and only modest alterations in CFW reactivity were seen with partial outer core truncations. Deletion of LgtF had no effect on mouse colonization in vivo, or on invasion and intracellular survival in epithelial cells in vitro. In contrast, the AwaaF mutant exhibited a significant defect in intracellular survival in vitro. Interestingly, the mutants exhibited stepwise increases in susceptibility to the antimicrobial peptide LL-37, with /waaF and AlgtF being more susceptible and AgalT and &stII being more resistant than wild type. In contrast, all of the mutants were highly susceptible to polymyxin B. This is the first report of C. jejuni susceptibility to LL-37 and of LOS affecting polymyxin B resistance. Each of these appears to be independent of overt effects on outer membrane protein expression, membrane stability, or surface hydrophobicity. Together, our data indicate that the length and specific  11  moieties of the LOS play important roles in C. jejuni biology, and suggest a dynamic interplay of the LOS with other stress resistance factors.  111  TABLE OF CONTENTS ABSTRACT  ii  TABLE OF CONTENTS  iv  LIST OF TABLES  vii  LIST OF FIGURES  viii  LIST OF ABBREVIATIONS  ix  ACKNOWLEDGEMENTS  xi  CHAPTER 1. Introduction  1  1.1 Campylobacterjejuni  1  1.2 Clinical Symptoms and Disease of C. jejuni  2  1.2.1 Transmission  2  1.2.2 Clinical Pathology  2  1.2.3 Post-infectious Complications  3  1.3 Epidemiology of C. jejuni  4  1.4 Antimicrobial Treatment and Resistance  5  1.5 Genomics of C. jejuni  6  1.6 Molecular Mechanisms of Campylobacter Pathogenesis  7  1.6.1 Lipooligosaccharide  8  1.6.2 Capsule  10  1.6.3 Flagella  10  1.6.4 Protein Glycosylation  11  1.6.5 Iron Uptake  12  1.6.6 Cytolethal Distending Toxin  13  1.6.7 Adherence, Invasion, and Host Cell Responses  13  1.7 Bioflim Formation  15  1.8 CFW Reactivity and LOS Truncations  16  CHAPTER 2. Materials and Methods 2.1 Bacterial strains and growth conditions  18 18  iv  2.2 Random in vitro transposon mutagenesis of C. jejuni using the mariner transposon  19  2.2.1 Purification of MBP-Himarl  19  2.2.2 in vitro transposon mutagenesis  20  2.3 Calcofluor-white (CFW) screening  21  2.4 Transposon mapping via random PCR  21  2.5 Construction of z\galT, AwaaF, Awaa V, &stII and complemented strains LxgalT-c and AlgtF-c, and brtls:.waaV  23  2.6 C. jejuni lipooligosaccharide analysis by PAGE  26  2.7 Isolation of LOS and mass spectrometry analysis  26  2.8 Biofilm formation assay and quantification  27  2.9 Serum sensitivity assay  27  2.10 Sensitivity to antimicrobial peptides, SDS, and EDTA  28  2.11 Adherence, invasion, and intracellular survival in vitro in 1NT407 and Caco-2 cells  28  2.12 Mouse colonization  29  2.13 MATS hydrophobicity assay  29  2.14 Autoagglutination assay  30  2.15 Fractionation of C. jejuni to isolate outer and inner membrane proteins  30  2.16 Membrane protein profiling using silver and coomassie dye  31  2.17 Statistical Analysis  31  CHAPTER 3. Results  32  3.1 Isolation and construction of LOS core mutants of Campylobacterjejuni 81-176  32  3.2 Confirmation of LOS core disruption in a step-wise manner; i\waaF does not express the inner core glucose residue 3.3 Bioflim formation is enhanced in the complete absence of the outer core  37 38  3.4 The outer core sugars are important in protecting C. jejuni from complement mediated killing 3.5 AwaaF is defective for intracellular survival in vitro  40 43  3.6 Pathogenic phenotypes that are unaltered with LOS truncations: lgtF deletion does v  not affect mouse colonization in vivo; LOS core truncation does not impact autoagglutination  43  3.7 Step-wise truncations in the LOS core result in tiled sensitivities to antimicrobial peptides  46  3.8 Outer membrane stability, hydrophobicity, and general protein profiles are not overtly altered in LOS outer core mutants CHAPTER 4. Discussion  47 51  4.1 Discussion of Results  51  4.2 Future Directions  59  REFERENCES  62  APPENDICES  80  Appendix A. Transposon mapping of CFW-hyperfluorescent C. jejuni 8 1-176 transposon mutants  80  Appendix B. Transposon mapping of CFW-hypofluorescent C. jejuni 81-176 transposon mutants  81  vi  LIST OF TABLES  CHAPTER 2 Table 2.1  Strains used in this study  18  Table 2.2  Primers used for transposon mapping  22  Table 2.3  Primers used for fine mapping  23  Table 2.4  Primers used for the construction of knockout and complemented strains  25  CHAPTER 3 Table 3.1  Minimum inhibitory concentrations of LL-37, polymyxin B, SDS, and EDTA  towards C. jejuni 81-176 and LOS outer core mutants  47  APPENDIX Appendix A  Transposon mapping of CFW-hyperfluorescent C. jejuni 81-176 transposon  mutants Appendix B  80  Transposon mapping of CFW-hypofluorescent C. jejuni 81-176 transposon  mutants  81  vii  LIST OF FIGURES  CHAPTER 1 Figure 1.1  Structure of the core region of C. jejuni 81-176 lipooligosaccharide  9  CHAPTER 3 Figure 3.1  C. jejuni 81-176 lipooligosaccharide core transferase mutants  Figure 3.2  WaaV is not affected by the intergenic insertion of the brtls solo transposon.... 34  Figure 3.3  Stepwise sequential truncations of the C. jejuni lipooligosaccharide core  35  Figure 3.4  Growth is unaltered in LOS core mutants  39  Figure 3.5  Complete loss of outer core sugar residues results in increased biofilm  33  formation Figure 3.6  40  Hypersensitivity to complement-mediated killing occurs with loss of outer  core  42  Figure 3.7  AwaaF is defective for intracellular survival in vitro  Figure 3.8  Loss of outer core sugar residues does not affect mouse colonization in vivo or  44  autoagglutination  45  Figure 3.9  Surface hydrophobicity is unaffected with LOS core truncations  Figure 3.10  Outer membrane profile of C. jejuni and the various outer core mutants have no  obvious significant differences  49  50  viii  LIST OF ABBREVIATIONS  ABC BHI  bovine serum albumin  —  CAT  chloramphenicol acetyltransferase  —  column buffer  —  CDT  cytolethal distending toxin  —  CFU  colony forming units  —  CFW CPS CV  Brain Heart Infusion  —  BSA  CB  ATP binding cassette  —  —  calcofluor white  capsular polysaccharide  —  crystal violet  —  DNA  deoxyribonucleic acid  —  DTT dithiothreitol -  EA-OTLC-MS electrophoresis-assisted open-tubular liquid chromatography mass spectrometry -  EDTA GBS lBS  —  ethylene diaminetetraacetic acid  Guillain-Barré syndrome  —  irritable bowel syndrome  —  IL interleukin -  IPTG LB  —  LOS  —  Luria-Bertani lipooligosaccharide  —  LPS  lipopolysaccharide  —  MATS Mbp MR  MOl NOD NPN  —  microbial adhesion to solvents  mega base pairs  —  Mueller-Hinton  —  MIC  isopropyl beta-D- I -thiogalactopyranoside  —  minimum inhibitory concentration  multiplicity of infection  —  —  —  PAGE  nucleotide-binding oligomerization domain l-N-phenylnaphthylamine  —  polyacrylamide gel electrophoresis  ix  PAMP PBS  —  PCR  —  phosphate buffered saline  —  polymerase chain reaction  P1-lBS  —  PNAG PRR  —  RNA SDS  —  UV  —  poly-N-acetylglucosamine  ribonucleic acid sodium dodecyl sulfate transmission electron microscopy  —  —  post infectious irritable bowel syndrome  pattern recognition receptors  —  TWB TLR  —  —  TEM  pathogen-associated molecular patterns  transposase wash buffer  Toll-like receptors  ultra violet  x  ACKNOWLEDGEMENTS  First, I would like to express my gratitude to my supervisor, Dr. Erin Gaynor. She has been a wonderful mentor, and provided guidance as well as many opportunities to grow and mature as a scientist. Further, she was always kind and understanding and made me feel welcome for discussion of any topic. I would also like to thank the Gaynor lab members, past and present. I especially would like to thank Ann Lin for always making me giggle with her silliness, Emilisa Frirdich for providing me with a lot of scientific advice and guidance as well as a good laugh, and Mark Pryjma for being supportive and ridiculous at the same time. My lab experience and life in Vancouver would not have been the same without them. I would like to thank my committee members, Dr. Yossef Av-Gay and Dr. David Speert for their scientific advice throughout my career as a Master’s student. Also, Dr. Michel Gilbert has provided me with numerous advice, and my project would not be the same without him. I would also like to thank Dr. Monika Dzieciatkowska for performing the mass spectrometry analyses, and Dr. Stuart Thompson for performing the mouse colonization experiments. Niall Filewod, Dr. R.E.W. Hancock, Kelly MacDonald, and Dr. David Speert has also provided me with reagents to certain experiments, and their generosity is also very much appreciated. I would finally like to thank my family and friends for their continued support outside of the laboratory. I would like to especially thank my fantastic mother, and my friends Aprile Manjoo, Irme Chan, the G-unit members (Zhu Juan Li, Jessica Shiu, Stephen Mack, Chris Lam), Lea Constan, and Calvin Adams for being awesome and making my life always fun and exciting.  xi  CHAPTER 1- INTRODUCTION  1.1.  Campylobacterjejuni Campylobacterjejuni, a Gram-negative enteric pathogen, is the leading cause of bacterial  gastroenteritis in the developed world, affecting more people than Escherichia coli 0157 :H7 and Salmonella species combined (Altekruse et al., 1999). C. jejuni belongs to the -proteobacteria class, in the order Campylobacteriales, which also includes the genera Helicobacter and Wolinella (Young et al., 2007). Campylobacter cells are mostly spiral rods from 0.5 to 5 im long and 0.2 to 0.8 tm wide. Most species are motile, with a characteristic cork-screw motion via a monotrichous flagellum on one or both poles. There are currently 17 species in the Campylobacter genus: C. hyointestinalis, C. lanienae, C. sputorum, C. mucosalis, C. concisus, C. curvus, C. rectus, C. gracilis, C. showae, C. hominis, C. lan, C. insulaenigrae, C. canadensis, C. upsaliensis, C. helveticus, C. coli, and C. jejuni (Debruyne et al., 2008). C. jejuni is the most important human enteropathogen among the Campylobacter species. Like most Campylobacter species, it is highly motile and has a monotrichous flagellum at both ends. It is also a microaerophile, requiring lower than normal atmospheric oxygen levels; C. jejuni is normally cultured in atmosphere containing 3% to 12% (v/v) oxygen and 5% to 15% (v/v) carbon dioxide (Kelly, 2008). Despite having a small genome size of only 1.7 Mbp, it contains many efficient and genes and enzymes that allow C. jejuni to survive various environments and stresses to become a successful human pathogen.  1  1.2  Clinical Symptoms and Disease of C. jejuni 1.2.1. Transmission C. jejuni is a commensal organism of poultry and other avian species and has reservoirs  in various other animals and also in water. Generally, C. jejuni colonizes the gastrointestinal tract of poultry in high numbers and is passed between other poultry via the oral-fecal route (Young et al., 2007). Other animals such as sheep and cattle also commonly harbour C. jejuni in their gastrointestinal tract, and thus are important reservoirs through which the bacteria can be transmitted to humans (Kwan et al., 2008; Stanley and Jones, 2003). C. jejuni can also survive in water, and it can associate and survive within certain protozoans, such as the amoeba Acanthamoeba castellanii (Snelling et a!., 2008). Thus, humans can be infected by C. jejuni directly via the consumption of contaminated water and animal products, including unpasteurized milk and improperly cooked meat.  1.2.2. Clinical Pathology Acute C. jejuni infection causes watery to bloody diarrhea, fever, and vomiting, and can be fatal to the elderly, young infants, and immunocompromised individuals. Clinically, Campylobacter enteritis can not be distinguished from other bacterial intestinal infections (e.g. salmonellosis or shigellosis), and a definitive diagnosis can only be made by detection of the bacteria in the feces (Blaser and Engberg, 2008). Clinical symptoms depend on the virulence of the infecting strain, the dose of infection, and the susceptibility of the patient. For instance, individuals with previous Campylobacter infections due to habitual consumption of raw milk may not experience any symptoms compared to those individuals without a similar history of prior exposure (Blaser et a!., 1987).  2  In human infections, C. jejuni will normally colonize the jejunum and the ileum, followed by infection of the colon (Blaser and Engberg, 2008). The infectious dose of C. jejuni is generally low, with doses as low as 500 CFUs able to establish a human infection (Black et al., 1988). The incubation period ranges from 18 hours to 8 days and is inversely related to bacterial dose (Allos et al., 1998). Patients can continue to excrete the bacteria in their fecal matter for several weeks after they have clinically recovered, but long-term carriage has only been observed in immunocompromised patients (Blaser and Engberg, 2008).  1.2.3. Post-infectious Complications Severe medical sequelae have been associated with C. jejuni infections, including Guillain-Barré syndrome, reactive arthritis, and postinfectious irritable bowel syndrome (PI-IBS) (Lindsay, 1997; Spiller, 2007). Direct spread of C. jejuni from the gastrointestinal tract has also been linked to hepatitis, cholecystitis, pancreatitis, renal and urinary tract disease, nephritis, peritonitis, and septic abortion (Allos, 2001; Blaser and Engberg, 2008). Guillain-Barré syndrome (GBS) is a form of acute neuromuscular flaccid paralysis. Depending on the detection system used, anywhere from 25 to 80% of GBS patients have previously been infected by C. jejuni (Schmidt-Ott et a!., 2006). It is currently believed that molecular mimicry between lipooligosaccharides (LOS) in C. jejuni and gangliosides in peripheral nerves plays a crucial role in the development of GBS. A recent study showed that 73% of GBS-related C. jejuni strains expressed LOS with gangliosides mimics (Godschalk et a!., 2007). Despite the strong association of cross-reactive antibodies with C. jejuni LOS and gangliosides, evidence also suggests that in a small percentage of cases, other unknown  3  mechanisms may also play a role in Campylobacter-associated GBS (Godschalk et al., 2007; Jacobs et al., 2008). Campylobacter-associated reactive arthritis occurs in about 1 to 5% of those infected (Pope et al., 2007). Ankles, knees, wrists, and the small joints of the hands and feet are most commonly affected (Hannu et a!., 2004). The duration of arthritis varies from a few weeks to at most a year, but full recovery is the norm. There is not much known about the mechanism of Campylobacter-associated reactive arthritis, but a lipooligosaccharide biosynthesis gene cluster A has been identified as a potential marker for an increased risk of developing the disease (Blaser and Engberg, 2008). Irritable bowel syndrome (IBS) is a common disorder associated with abdominal pain, excessive intestinal gas, variable bowel habits, and abdominal bloating. lBS sometimes follows an episode of acute gastroenteritis, and is known as postinfectious lBS (PI-IBS)(Rhodes and Wallace, 2006). P1-lBS has been associated with various enteric infections such as Salmonella and Shigella infections, and evidence suggests that Campylobacter infections also contribute to P1-lBS in about 5 to 20% of infected individuals (Dunlop et al., 2003; Marshall et al., 2006). Certain strains may also be associated with the probability of developing P1-lBS. For instance, C. jejuni strains that were toxigenic to HEp-2 cells (human epithelial cell line) were found to be more commonly isolated from patients who developed P1-lBS (Thornley eta!., 2001).  1.3  Epidemiology of C. jejuni In developed countries, Campylobacter infection is the most common cause of bacterial  gastroenteritis, and the cause of 5 to 15% of all diarrheal illnesses worldwide (Altekruse et al., 1999; Olson et al., 2008). C. jejuni is estimated to be the cause of 90% of reported  4  campylobacteriosis cases, and 5% of food-related deaths (Mead et a?., 1999). In Canada, based on surveillance from 1996 to 1999, campylobacteriosis rates were anywhere from 10 to over 60 per 100 000 depending on the province (Public Health Agency Of Canada, 2003).  1.4  Antimicrobial Treatment and Resistance C. jéjuni infections are generally self-limiting, and no specific treatment is required in  most cases other than fluid and electrolyte replacement due to diarrhea and vomiting. There is little role for antimicrobial therapy in most cases since a patient will likely be recovered or showing signs of recovery by the time a bacteriological diagnosis has been made (Blaser and Engberg, 2008). However, individuals who have unusually severe infections, those who have a systemic infection, and those who are immunocompromised will benefit from antimicrobial therapy. For Campylobacter infections, macrolides such as erythromycin are the drugs of choice. For instance, a Campylobacter outbreak in a day care in Israel was successfully controlled using erythromycin (Ashkenazi et a?., 1987). Fluoroquinolones such as ciprofloxacin were also preferred drugs when they first appeared, however a rapid increase in Campylobacter resistance towards fluoroquinolones is now evident. For instance, one study found that in Hong Kong, 86% of human C. jejuni isolates were quinolone resistant (Chu et a?., 2004). The use of fluoroquinolones as growth promoters in food animals and in the veterinary industry is thought to be accelerating the resistance of Campylobacter towards these drugs (Alfredson and Korolik, 2007). Fluoroquinolone antimicrobials function by interacting with DNA gyrase and topoisomerase IV, and trap the enzymes on the DNA by forming stable complexes. This results  5  in double-stranded breaks in the bacterial DNA leading to the organism’s death (Drlica, 1999). Fluoroquinolone resistance in Campylobacter is due to modification of DNA gyrase and/or topoisomerase IV, efflux, modifications in membrane permeability, and decreased enzyme expression (Payot et al., 2006; Zhang and Plummer, 2008). Macrolides target the 50S subunit of the bacterial ribosome and inhibit protein translation (Poehlsgaard and Douthwaite, 2005). Macrolide resistance in Campylobacter has been attributed to target modification and efflux (Kurincic eta?., 2007; Payot eta?., 2006). The development of macrolide resistance in Campylobacter is less prevalent than fluoroquinolone resistance (Zhang and Plummer, 2008).  1.5  Genomics of C. jejuni In 2000, the first C. jejuni strain (NCTC 11168) was sequenced but was shown to lack  classical virulence factors, such as homologues to certain adhesins, invasins, bacterial toxins, and pathogenicity islands (Bereswill and Kist, 2003; Parkhill et a?., 2000). Since then, four fully sequenced and annotated C. jejuni genomes have been published, and the original annotation of NCTC 11168 has been updated (Fouts eta!., 2005; Fouts eta?., 2007; Gundogdu eta!., 2007; Hofreuter et a?., 2006;. Poly et a?., 2007b). The highly virulent strain 81-176, originally isolated from a diarrheal outbreak associated with raw milk consumption (Korlath et a?., 1985), is one of the fully sequenced strains (Hofreuter et a?., 2006). This strain was found to possess several genes not found in other strains such as NCTC 11168 and RM1221 that may contribute to its virulence. For instance, genes involved in electron transport, respiratory pathways, and potassium uptake were identified as specific to 81-176, and several of these genes were found to contribute to the ability of this strain to colonize the intestinal tract of mice (Hofreuter et a?., 2006). Strain 81-176 also possesses two previously sequenced plasmids, pTet and pVir (Bacon  6  et al., 2002; Batchelor et a!., 2004). Studies on the correlation of pVir with increased virulence in C. jejuni have been conflicting: for instance, a study in Canada showed a strong correlation between the presence of pVir and bloody diarrhea, but a study in Holland revealed none (Louwen et al., 2006; Tracz et al., 2005). Strain variability is also conferred via several hypervariable regions which have been found in all sequenced C. jejuni genomes to date. These regions are generally found in genes encoding the biosynthesis or modification of C. jejuni surface structures such as the lipooligosaccharide (LOS), flagella, and capsular polysaccharide, all of which participate in C. jejuni pathogenesis and, presumably, immune system evasion (Champion et al., 2008; Parkhill eta!., 2000; Young et al., 2007). The hypervariable regions allow C. jejuni to express an astonishing diversity of surface structures which no doubt aids in the organism’s pathogenic characteristics.  1.6  Molecular Mechanisms of Campylobacter Pathogenesis Despite its prevalence, relatively little is known about C. jejuni biology and pathogenesis,  particularly compared to other enteric pathogens such as E. coil and Salmonella species. This has historically been due to the organism’s fastidious growth requirements, initial difficulties in traditional methods of genetic manipulations, and the current lack of a tractable small animal model of virulence (Crushell et a?,, 2004). However, due to the recent sequencing of several C. jejuni genomes and improvements in scientific techniques and methodologies, the mechanisms of C. jejuni pathogenesis are slowly becoming elucidated.  7  1.6.1. Lipooligosaccharide Lipopolysaccharide (LPS), found in the outer leaflet of the outer membrane in Gramnegative bacteria, is composed of three distinct regions: the lipid A membrane anchor, the core oligosaccharide, which is subdivided into a conserved inner core (generally among species) and a more diverse outer core, and the 0-antigen, comprised of a polymer of polysaccharide repeats. Mucosal pathogens such as C. jejuni, Yersiniapestis, and Neisseria gonorrhoeae express a form of LPS known as lipooligosaccharide (LOS), which lacks the 0-antigen repeats (Frirdich and Whitfield, 2005; Jacques, 1996; Preston et al., 1996). The LOS outer cores of C. jejuni strains are highly diverse due to differences in monosaccharide linkage and composition (Poly and Guerry, 2008). This is in part due to gene content variation in the LOS biosynthetic loci, which in turn may also be due to recombinant and lateral gene transfer. Furthermore, phase variation of the LOS outer core due to homopolymeric tracts, gene inactivation due to deletions or insertions of single or multiple bases, and mutations leading to glycosyltransferases with different acceptor specificities have also been shown to cause variation in the C. jejuni LOS core (Gilbert et a!., 2008). The structure of the LOS inner and outer core in C. jejuni strain 8 1-176, and the genes involved in addition of each sugar residue are shown in Figure 1.1. As with LPS, LOS participates in the pathogenesis of numerous infectious bacteria: LOS acts as an endotoxin, is important for adherence to cells, both of eukaryotic and prokaryotic origin, and is key to outer membrane stability and protection from environmental stresses (Albiger et al., 2003; Frirdich and Whitfield, 2005; Kanipes et a!., 2004; Kanipes et a!., 2007; Plant et a!., 2006; Zarantonelli et a!., 2006). Furthermore, antibodies generated against certain LOS structures are known to cross react with human gangliosides due to molecular mimicry; this  8  cgtA  gaiT  IgtF  waaF  Petn  i  4116  GaINAc-f3(1 ,4)-GaI-f3(1 ,4)-GIc-f3(1 ,2) Heplkx-(1 ,3)-Hepkx-(1 ,5)-Kdo 3 4 cstil lgtF -÷ I I waaC 2 1 GIcf3 NeuAcc —  Outer core  Inner core  Figure 1.1. Structure of the core region of C. jejuni 81-176 lipooligosaccharide.  The core residues are separated into the lipid A-proximal inner core, and the lipid A-distal outer core. Transferase genes responsible for the addition of each sugar residue are indicated in blue. Abbreviations: Ga1NAc, N-acetyl-galactosamine; NeuAc, N-acetyl-neuraminic acid (sialic acid); Gal, galactose; Glc, glucose; Hep, heptose; Petn, phophoethanolamine; Kdo, 2-keto-3deoxymannooctulosonic acid.  9  cross-reactivity has been hypothesized as the causative agent of autoimmune diseases like Guillain-Barré syndrome (Nachamkin et al., 1998; Perera et al., 2007).  1.6.2. Capsule C. jejuni expresses a highly variable capsular polysaccharide (CPS), the structure of which has been determined for several strains (Gilbert et al., 2007; St Michael et al., 2002; Szymanski et al., 2003). Variation in the capsule structure has been attributed to variation in capsule locus gene content, leading to distinct serotype-specific capsule structures, as well as phase variation and 0-methyl phosphoramidate modification (Karlyshev et al., 2005a; Young et al., 2007). The biological role of CPS in C. jejuni is also variable, and CPS seems to be important for serum resistance, adherence and invasion into epithelial cells, and colonization in ferrets and chicks (Bachtiar et al., 2007; Bacon et a?., 2001; Jones et a?., 2004). Furthermore, the CPS is the major determinant in the Penner serotyping method (Poly and Guerry, 2008).  1.6.3. Flagella C. jejuni expresses a monotrichous flagellum at both ends of the cell. These flagella mediate its motility that is required for the organism to swim through the mucous lining of the gut and colonize the underlying intestinal epithelial cells, and are thus crucial to pathogenesis (Guerry, 2007). The C. jejuni flagellum is composed of a major flagellin, encoded byflaA, and a minor flagellin, flaB, which are regulated by a 54 promoters, respectively a 28 and -dependent (Guerry et a?., 1991; Nuijten et a?., 1990). The formation of flagella, however, requires the temporal coordination of expression of approximately 40 to 50 flagellar genes. Further,  10  Campylobacter flagellar biosynthesis also involves post-translational 0-linked glycosylation (Hendrixson, 2008). The flagella are thought to be involved in a variety of aspects of C. jejuni pathogenesis beyond motility. For instance, the C. jejuni flagellar apparatus is thought to function as a secretion system that secretes non-flagellar proteins that may modulate virulence. The Cia (Campylobacter invasion antigens) proteins are thought to be secreted through this system upon contact with eukaryotic cells and in the presence of factors such as bile, and a strain deleted for ciaB was found to have a 50-fold reduction in invasion in vitro (Konkel et al., 1999). The FspA protein was also found to be secreted through the flagella filament, though its role in C. jejuni pathogenesis has yet to be determined (Poly et a!., 2007a). In a microarray study, many C. jejuni flagellar genes were also found to be co-regulated with virulence factors (Carrillo et al., 2004). Although many of the co-regulated gene products’ functions are unclear, evidence suggests that some of the products are indeed involved in Campylobacter virulence; for instance, a mutant strain of the gene Cj 0977, regulated by the a 28 promoter, had reduced invasion capabilities in vitro (Goon et a!., 2006). Finally, autoagglutination of C. jejuni is known to be mediated by glycans on the flagella, as a strain 81-176 mutant lacking the acetamidino form of pseudaminic acid on the flagella failed to autoagglutinate (Guerry et a?., 2006).  1.6.4. Protein Glycosylation There are two protein glycosylation systems in C. jejuni: the 0-linked glycosylation system that modifies serine or threonine residues on flagellin, and the N-linked glycosylation system that modifies asparagine residues on many proteins (Young et a?., 2007).  11  The flagellin in strain 81-176 is glycosylated with pseudaminic acid or its derivatives at up to 19 sites. The 0-linked glycosylation of flagellin is necessary for the proper assembly of the flagellar filament (Goon eta!., 2003; Thibault eta!., 2001). Furthermore, defects in 0-linked glycosylation result in loss of motility, decrease in adherence and invasion in vitro, as well as decreased virulence in ferrets in vivo (Guerry et a!., 2006). The N-linked glycosylation system, encoded by the pgl genes, is conserved in all C. jejuni strains, suggesting a fundamental role in the biology of C. jejuni (Karlyshev et a!., 2005b; Szymanski et a!., 1999). Strains with mutations in the pgl genes have reduced adherence and invasion into 1NT407 epithelial cell lines and are also defective in natural competence (Larsen et a!., 2004). Other N-linked glycosylation mutants have also shown a reduction of colonization in mouse and chick models (Kakuda and DiRita, 2006; Karlyshev et a!., 2004; Szymanski et a!., 2002; Young et a?., 2007). Also, most proteins that are modified by the pgl genes are predicted to be periplasmic (Young et a?., 2002).  1.6.5. Iron Uptake Iron plays an important role in metabolism in all organisms, including C. jejuni. However, the availability of free iron inside mammalian and avian hosts is extremely limited (Stintzi et a?., 2008). Thus, many bacteria produce and secrete siderophores that chelate ferric iron from their hosts. However, no such genes have yet been described in C. jejuni. Instead, C. jejuni seem to utilize siderophores produced by other bacteria in the gut (Poly and Guerry, 2008); for instance, the enterobactin, produced by Escherichia coli and other mammalian and avian intestinal microflora, is able to bind to the C. jejuni CfrA membrane receptor, and a cfrA mutant was dramatically reduced in its ability to colonize the avian intestine (Palyada et a!., 2004). C.  12  jejuni has also been shown to utilize heme and hemoglobin via the ChuABCD system (Ridley et a!., 2006), and uptake of ferrous iron occurs via the FeoB protein (Naikare et a!., 2006). Mutants offeoB were impaired in intracellular survival in intestinal cells in vitro, and colonization of piglets and chickens in vivo. These study show that both ferric and ferrous iron is required for Campylobacter survival in various hosts.  1.6.6. Cytolethal Distending Toxin Cytolethal distending toxin (CDT) is a tripartite AB toxin where CdtA and CdtC make up the binding component and CdtB is the active subunit that is transported into the nucleus where it induces double strand breaks in the host DNA and arrests the cell in the G2 phase of the cell cycle (Lara-Tejero and Galan, 2001, 2002). The role of CDT in the pathogenesis of C. jejuni and the development of diarrheal disease in the host, however, is still unclear. CDT is known to be responsible for the secretion of interleukin (IL)-8, but CDT-independent stimulation of IL-8 also exists (Hickey et a!., 2000). Furthermore, CDT deficient mutants were shown to colonize chicks just as well as wild type strains (Biswas et a!., 2006).  1.6.7. Adherence, Invasion, and Host Cell Responses C. jejuni initially colonizes the small bowel and eventually moves towards the large intestine. After colonization of the mucus lining of the gut, C. jejuni adheres to the intestinal epithelial cells using a number of different adhesins (Poly and Guerry, 2008). Annotations of sequenced C. jejuni strains show a lack of pilus-like open reading frames, and an actual pilus like structure has not been identified in C. jejuni (Fouts et a!., 2005; Gaynor et a?., 2001; Parkhill  13  et al., 2000; Wiesner et al., 2003). Instead C. jejuni seems to adhere to host cells via several proteins. CadF is a major surface protein that binds fibronectin, located on the basolateral side of epithelial cells (Konkel eta!., 1997). CadF is required for maximal binding and invasion in vitro and shows reduced colonization in chicks in vivo (Monteville et a!., 2003; Ziprin et a!., 1999). Furthermore, CadF has been shown to be critical in the activation of Raci and Cdc43 in 1NT407 cells (Krause-Gruszczynska et al., 2007). JlpA is a surface exposed lipoprotein that has been shown to bind the heat shock protein Hsp90c that is localized to the surface of HEp-2 epithelial cells. Binding of JlpA to Hsp9Oa activates NF-id3 and p38 mitogen-activated protein (MAP) kinase, which contributes to proinflammatory responses (Jin et al., 2001; Jin et a!., 2003). Another lipoprotein, CapA, is a possible adhesin, and CapA mutants were shown to have decreased adherence to Caco-2 epithelial cell lines and decreased colonization in chicks (Ashgar et a!., 2007). Surprisingly, some putative adhesins are localised to the periplasm. Pebi is one such protein, and pebi mutants are poor colonizers of mice (Pei eta!., 1998). However, Pebl is a homologue of amino acid ATP-binding cassette (ABC) transporters, and has been shown to bind both aspartate and glutamate with high affinity; pebi mutants show auxotrophy towards these amino acids (Leon-Kempis Mdel et a!., 2006). Thus, the colonization defect may be due to impaired amino acid transport function. The glycoprotein Cj 1496 is another periplasmic protein that shows a decrease in adherence levels in epithelial cells in vitro when the gene is mutated (Kakuda and DiRita, 2006). C. jejuni is considered to be an invasive species, though the mechanism of uptake into epithelial cells remains to be fully elucidated. For instance, one study suggested that C. jejuni is  14  internalized into intestinal epithelial cells in a microtubule-dependent and in an actin independent manner (Oelschlaeger et al., 1993), while other studies suggested that invasion occurs via caveolae (Hu et aL, 2006b; Wooldridge et al., 1996). Also, evidence suggests that after internalization into intestinal epithelial cells, C. jejuni resides within a membrane-bound compartment (Kiehibauch et al., 1985; Russell and Blake, 1994). Recently, C. jejuni was shown to survive within intestinal epithelial cells by deviating from the canonical endocytic pathway, thus avoiding delivery into lysosomes (Watson and Galan, 2008). Innate recognition of pathogens by plants and animals occurs through a family of pattern recognition receptors (PRR) which recognize pathogen-associated molecular patterns (PAMPs) on the microorganisms (Takeda and Akira, 2005; Werts et al., 2006). Toll-like receptors (TLR5) are the most extensively studied PRRs. Studies suggest that TLR4, which recognizes bacterial LPS, can be activated by C. jejuni LOS and trigger cytokine release (Hu et aL, 2006a). On the other hand, TLR5, which normally recognizes conserved residues on bacterial flagellin, is unable to recognize C. jejuni flagellin and is not activated (Andersen-Nissen et al., 2005; Watson and Galan, 2005). C. jejuni is also impaired in activating TLR9, which recognizes unmethylated CpG motifs, due to the low G+C content in the C. jejuni genome (Dalpke et al., 2006). In a recent study, however, the cytoplasmic PRR nucleotide-binding oligomerization domain (NOD) 1, which recognizes components of peptidoglycan, was found to be important in the innate response towards C. jejuni in the intracellular environment (Zilbauer et a?., 2007).  1.7.  Bioflim Formation Most bacterial species exist in the environment as a multicellular layer of bacteria  surrounded by a matrix of extracellular polymeric substances (O’Toole et a?., 2000). Although  15  there has been no evidence of C. jejuni biofllm formation in vivo, numerous reports show C. jejuni forms biofilms on various inert surfaces (Joshua et al., 2006; Lehtola et al., 2006; McLennan et al., 2008; Reeser et at., 2007). Bioflims most likely facilitate survival of C. jejuni in various stressful conditions such as the aquatic environment. Expression of flagella and the flagellar export apparatus appears to be a requirement in biofilm formation in C. jejuni, based on proteomic analyses of planktonic and bioflim-grown cells, as well as biofilms analyses of flagellar mutants (Kalmokoff et al., 2006). This is in contrast to biofilm formation by other bacterial species, where flagellar expression is generally reduced or turned off once biofilm formation has been established (Kalmokoff et al., 2006; Pruss et a!., 2006; Reeser et at., 2007). Other proteins which were enhanced in the proteomic analyses include those involved in general and oxidative stress responses, certain adhesins like Pebi, and proteins involved in energy generation and catabolic functions. A recent study showed that biofilm formation in C. jejuni can correlate with the organism’s reactivity to calcofluor-white (CFW), a fluorescent dye that binds J3-1,3 and -1,4 carbohydrate linkages (McLennan et a!., 2008). The nature of C. jejuni reactivity to CFW has yet to be determined, but may be due to a novel exopolysaccharide that is independent of both capsule and the LOS.  1.8  CFW Reactivity and LOS Truncations In order to further explore the basis underlying the CFW reactivity described above  (McLennan et at., 2008), a C. jejuni transposon library constructed in strain 81-176 was used to identify mutants that were hyperreactive to calcofluor white (CFW). Somewhat surprisingly, two LOS core mutants, AlgtF and AwaaF*, were isolated as CFW-hyperreactive. LgtF was  16  recently identified as a two-domain glycosyltransferase, responsible for the transfer of glucoses on both heptose residues of the LOS core, and WaaF is a heptosyltransferase, responsible for the transfer of the second heptose of the inner core (Hepil) (Figure 1 1) (Kanipes et al., 2007; .  Oldfield et al., 2002). This discovery led us to question whether other core LOS mutants might also exhibit a CFW-hyperreactive phenotype, and whether other key biological and pathogenesis-related aspects might also be affected. To complete our repertoire of strain 81-176 LOS core truncation mutants, we constructed a mutant strain deleted for Ga1T and utilized a CstII mutant kindly provided by Dr. Michel Gilbert (NRC, Ottawa). GalT is a galactosyltransferase, transferring a galactose to the outer core, while CstII transfers a sialic acid to the galactose added by GaiT (Figure 1.1) (Chiu et a!., 2004; Kanipes et a!., 2007). We also constructed a targeted /xwaaF mutant since the transposon mutant (AwaaF*) was an intergenic insertion, and used this targeted knockout strain for further studies. We then undertook a comprehensive analysis of these sequentially truncated LOS core mutants, including LOS silver stain and mass spectrometry assessments, as well as assays for biofilm formation, sensitivity to complement-mediated killing, polymyxin B and LL-37 antimicrobial peptide susceptibility, intracellular survival in vitro, mouse colonization in vivo, autoagglutination, and potential changes in surface hydrophobicity, stability, and outer membrane protein expression. Collectively, our studies demonstrate that the length of the LOS core impacts several important aspects of C. jejuni pathogenesis and stress resistance, most notably when the outer core has been abolished. Work to date suggests that these biological effects are independent of overt changes in membrane stability, surface hydrophobicity, and expression of outer membrane proteins.  17  CHAPTER 2- MATERIALS AND METHODS  2.1  Bacterial strains and growth conditions. C. jejuni strain 81-176, originally isolated from a raw milk outbreak of  campylobacteriosis (Korlath et al., 1985), was the wild type strain for these studies. All strains were routinely grown on Mueller-Hinton (MH; Oxoid) agar or broth supplemented with vancomycin (10 ig/mL) and trimethoprim (5 under microaerobic and capnophilic conditions (6% 02 and 12% C0 ). E. coli DH5cL was used for plasmid construction, and was 2 grown on Luria-Bertani broth (LB; Sigma) at 37 °C. When necessary, media were supplemented with kanamycin (50 g/mL), chioramphenicol (30 ig/mL), or ampicillin (100 jtglmL). C. jejuni mutant strains used in this study are listed in Table 2.1 and their construction is described below.  Table 2.1 Strains used in this study. Strains  Relevant Characteristics  Reference  DH5ci 2pir pFalcon  solo kanamycinR transposon  (Hendrixson et al., 2001)  DH5cL 2.pir pEnterprise  picard chloramphenicolR transposon (Hendrixson et al., 2001)  TB 1 with pMALC9  Himarl transposase cloned as a maltose  E. coli strains -  -  binding protein fusion in pMAL-cri; ampicillinR  (Akerley and Lampe, 2002)  cstll: :aphA-3  This study  C. feluni strains iXcstll  18  Strains  Relevant Characteristics  Reference  iXgalT  galT. :aphA-3  This study  txlgtF  igtF::Tnpicard  This study  AwaaF  waaF: :aphA-3  This study  zXgalT-c  gaiT: :aphA-3; galT+  This study  AlgtF-c  lgtF::Tnpicard; lgtF+  This study  2.2  Random in vitro transposon mutagenesis of C. jejuni using the mariner transposon. 2.2.1  Purification of MBP-Himarl  The MBP-Himarl transposase was purified according to a modified protocol from Akerley and Lampe (Akerley and Lampe, 2002) and instructions from the manufacturer (pMAL Protein Fusion and Purification System Instruction Manual; NEB). An overnight culture of E. coil TB 1 containing the plasmid pMALC9 grown in LB and ampicillin (100 jig/mi) at 37 °C was subcuitured 1/50 into 100 mL fresh LB containing ampicillin and 0.2% (w/v) glucose and growth at 37 °C was continued. Glucose is needed to repress amylase expression in E. coil that may interfere with binding to the amylose column. At an approximate 0D 600 of 0.5, protein expression was induced with 0.3 mM IPTG and incubation was continued for 2 h. Bacterial cells were harvested by centrifugation and frozen until needed. The cell pellet was then resuspended in column buffer (CB; mM Tris-HC1 (pH 7.4), 200 mM NaC1, 1 mM EDTA) and sonicated for 2 mm (10 sec pulse ON / 10 sec pulse OFF). The cellular debris was removed by centrifugation for 10 mm at 13 000 rpm and protease inhibitors (Roche complete, mini EDTA-free protease inhibitor cocktail tablets) were added to the supematant.  19  The amylose resin (NEB) was prepared by washing with transposase wash buffer (TWB; 20 mM Tris-HC1 (pH 7.4), 200 mM NaC1, 1 mM EDTA, 2 mM DTT, 10 % glycerol), as described by the manufacturer. The lysate was diluted to a final volume of 5 mL using CB. The amylase resin was added to the lysate and incubated shaking overnight at 4 °C. The resin and lysate were then added to an empty 5 mL column (Qiagen) and the flow through collected by gravity flow. The column was washed 4 times with 2 mL TWB. A total of 0.4 mL of transposase elution buffer (TEB; 20 mM Tris-HC1 (pH 7.4), 200 mM NaC1, 1 mM EDTA, 2 mM DTT, 10 % glycerol, 10 mM maltose) was added to the column, incubated for 5 mm and the elution fraction containing the purified transposase was collected. The transposase was aliquoted in 10 jil volumes and frozen at -80 °C. Protein concentration was determined by Bradford assay (Biorad) (previous concentration was 0.16 mg/mL) and purity was assessed by SDS-PAGE.  2.2.2  in vitro transposon mutagenesis  In vitro transposition reactions were performed as described by Hendrixon et al. and Akerley and Lampe (Akerley and Lampe, 2002; Hendrixson eta!., 2001). The transposition buffer (total volume of 80 jiL) contained 10 % glycerol, 25 mM HEPES pH 8.0, 250 jig/mL BSA, 1 mM DTT, 100mM NaC1, and 5 mM MgCl 2 to which 2 jig C. jefuni 81-176 genomic DNA, 1 jig pFalcon or pEnterprise, and 0.5 jig transposase was added. The transposase was added last to initiate the reaction. The transposition reaction was incubated at 28 °C for 4 h. The DNA was purified from the reaction mixture using Qiagen DNeasy columns according to the manufacturer’s instructions. The gaps at the transposon-chromosomal DNA junctions were repaired by treatment with DNA polymerase I, large (Klenow; NEB) and then T4 DNA ligase (NEB). The DNA from the ligation reaction was dialyzed on a 0.025 micron hydrophobic filter  20  floating on dH O for 20 mm and then transformed by natural transformation into C. jejuni 812 176. Kanamycin-resistant (solo transposon) and chloramphenicol-resistant (picard transposon) clones were selected on MR plates supplemented with the appropriate antibiotics. Approximately 3 000  —  4 000 single colonies from each round of mutagenesis were directly  harvested from the plates. A total of 4 rounds of mutagenesis was carried out to construct the library. To confirm random transpo son insertion, 10 of the colonies from each of the solo and picard transposon libraries were screened by Southern analyses (data not shown). Construction of the transposon library was done by Dr. Emilisa Frirdich.  2.3  Calcofluor white (CFW) screening. An overnight culture of C. jejuni 81-176 wild type, 81-176::solo transposon library, and  81-176::picard transposon library strains were back-diluted to an 0D 600 of 0.3. Serial dilutions were made, and 100 tL of the 1 0 dilution were plated on Brain Heart Infusion (BHI; BD) agar plates with 0.002% CFW (Fluorescent brightener 28, Sigma), and incubated for 2 days. Plates were observed under long-wave UV light, and mutant colonies that were hyper-fluorescent relative to the wild type were picked and patched onto MH agar plates and incubated for 1 day. The bright colonies were then re-patched onto BHI agar plates with 0.002% CFW, incubated for 2 days, and fluorescence was confirmed under UV light.  2.4  Transposon mapping via random PCR. DNA flanking the transposon insertion sites was amplified using the CEKG technique  described by Salama et al. (Salama et al., 2004). Table 2.2 lists primer sequences used for the random PCR. First, the primers CEKG2A, CEKG2B, or CEKG2C were used with the mariner-2  21  primer or mariner-3 primer to amplify transposon flanking sites. A second PCR was then performed using the primers CEKG4 and mariner-IR- 1. The amplicons were purified and sequenced using the primer MarOut3. Fine mapping to determine the precise location of the transposon for AwaaF* and AlgtF was done by sequencing the insert region amplified using the primers brti-Tn-F and brtl-Tn-R for /XwaaF* and brt28-Tn-F and brt28-Tn-R for A]gtF (Table 2.3).  Table 2.2 Primers used for transposon mapping. Primer Name  Sequence (5’ to 3’)  CEKG2A  GGCCACGCCTCGACTAGTACN1’1’JNNNNNNAGAG  CEKG2B  GGCCACGCGTCGACTAGTACNN1’ThJN1\II’1ACGCC  CEKG2C  GGCCACGCGTCGACTAGTACN1’NNNGATAT  Mariner-2  *  TCTTGAAGGGAACTATGTTGA  Mariner-3  *  AATACTAGCGACGCCATCTA  CEKG4 JR-i  *  MarOut3 *  GGCCACGCGTCGACTAGTAC GGACTTATCAGCCAACCTG *  CCGGGGACTTATCAGCCAACC  These primers were designed by Dr. E. Frirdich.  22  Table 2.3 Primers used for fine mapping. Primer Name  Sequence (5’ to 3’)  brt 1-Tn-F  GGAAATTCTTTAAAAAGTGCTGTGG  brtl -Tn-R  CTTCGCCGTAACTCAAACGC  brt28-Tn-F  GCTCAATTTGGGATTGATTGTTT  brt28-Tn-R  CAAGGCTTTCATGCACTAAATTATC  2.5  Construction of EgalT, AwaaF, Awaa V, AcstII and complemented strains AgalT-c  and ElgtF-c, and brtls::waaV. All of the primers used in this section are outlined in table 2.4. For the construction of z\galT, the gaiT gene was PCR amplified from 81-176 genomic DNA using the primers galT-F and galT-R and cloned into the commercial vector pGEM-T (Promega). Inverse PCR was performed on the resulting vector using the primers pGEM-galT-F and pGEM-galT-R. The resulting amplicon and the plasmid pUC 1 8K-2 (Menard et al., 1993), carrying the aphA-3 gene that encodes a non-polar kanamycin resistance cassette, were each digested with XbaI and KpnI enzymes, and ligated to form the plasmid pGEM-gaiT-K. This plasmid was delivered into 81-176 via natural transformation, and txgalT mutants were isolated. The AwaaF and AwaaV mutant were constructed in the same manner as z\galT, except the initial primers used were waaF-F and waaF-R for z\waaF, and waaV-F and waaV-R for z\waaV. Inverse PCR was performed using the primers pGEM-waaF-F and pGEM-waaF-R for z\waaF, and pGEM-waaV-F and pGEM-waaV-R for AwaaV. The AcstII mutant was constructed by Dr. Michel Gilbert’s group as a control for a previous study. Briefly, the cstll gene from C. jejuni strain ATCC 43446 was amplified in two  23  stages using the primers, CJ-131 (5’- CTTAGGAGGTCATATGAAAAAAGTTATTATTGC TGGAAATG -3’), CJ-269 (5’- CAATTCCCGAGAGCTCAATTTCTTTGGTACCTAGGGC  -  3’), CJ-132 (5’- CCTAGGTCGACTTATTTTCCTTTGAAATAATGCTTTATATC -3’), and CJ-268 (5’- GCCCTAGGTACCAAAGAAATTGAGCTCTCGGGAATTG -3’). CJ-131 and 269 were the primers used to amplify the 5’ region of cstll, and CJ- 132 and 268 were the primers used to amplify the 3’ region of cstll. This was done to insert KpnI and Sad sites in the middle of the gene. A final PCR using CJ- 131 and CJ- 132 was performed to amplif’ the full length cstll gene containing two restriction sites in the middle, an NdeI site at the 5’ end, and a Sail site at the 3’ end. The amplicon was then inserted into the plasmid pCWori+(-lacZ), giving the plasmid pCST-60. The aphA-3 gene, encoding a kanamycin resistance cassette was introduced into pCST-60 using the KpnI and Sad sites. The resulting plasmid, designated pCST-72, was electroporated into C. jejuni strain 81-176, and AcstII colonies were isolated. Positive clones were verified using PCR and sequencing. For complemented strains, the gaiT gene was PCR amplified from 81-176 genomic DNA using the primers, pR-galT-F and pR-galT-R, and the igtF gene was amplified using the primers, pR-lgtF-F and pR-lgtF-R. The resulting gaiT and igtF amplicons were digested with the XbaI enzyme and ligated into XbaI-digested pRRC [kindly provided by Brendan Wren and Andrey Karlyshev (Karlyshev and Wren, 2005)] and pRRK (kindly provided by Julian Ketley; similar to pRRC, with aphA-3 replacing the CAT cassette), respectively, to produce pRRC-galT and pRRK-igtF plasmids. Plasmids were naturally transformed into the respective mutants, AgalT and AigtF, and recombination was confirmed via PCR analysis. The pRRC and pRRK plasmids are used to integrate DNA expressed from the CAT or aphA-3 promoter into rRNA spacer regions as described (Karlyshev and Wren, 2005).  24  The waaV gene was inserted into the brt]s transposon mutant’s chromosome to obtain brtls.:waaV. The pRRC vector was used, as described above, with the primers pR-waaV-F and pR-waaV-R for the initial amplification of the waaV gene.  Table 2.4 Primers used for the construction of knockout and complemented strains. Primer Name  Sequence (5’ to 3’)  galT-F  GATGTTTTAATCGGTATTTCAACCAGT  galT-R  GATCTTTTCATCACAAATGACAGTGG  waaV-F  GACAAGAGGGTTTTGAAATTTTAGC  waaV-R  CACCCTATAGATAGAATCAGCACTGC  waaF-F  TGTACAAAGGCATCAAAACAAAGC  waaF-R  GAGCCTATAATCATCCTAGAAGATGA  pGEM-galT-F  GAGGTACCTTAGCATCAATAGCCTTAAAGAAAAT  pGEM-galT-R  GTTCTAGACTCCTCTTTTACTAAAGACAACAGATATT  pGEM-waaV-F  GAGGTACCGCAAAGTGCCTAAATTTTCTTC  pGEM-waaV-R  GTTCTAGACATAAAAAGACTCTCCAAAGAGTTTT  pGEM-waaF-F  CTGGTACCTCGATCTTACCAAGTTCTTTGCG  pGEM-waaF-R  TATCTAGATTTACTCAAACTTCACCTTGGCAA  pR-gaiT-F  GTCTAGACATAGATGAGGGTTTTTAATGAAAGT  pR-galT-R  ATCTAGAACCTGCCCTTTAAAACACCAC  pR-lgtF-F  GTCTAGATACAAGGGTGCAAAATGAATCTAAA  pR-lgtF-R  ATCTAGAGACGCTGTTAAACATTCTCTCAAAT  pR-waaV-F  GACTTCTAGATTAACAAAATTTAGGAAAAATATGCC  25  Primer Name  Sequence (5’ to 3’)  pR-waaV-R  GTCTAGATCAATTTCCTACTATAATCCAAATAAACTT  2.6  C. jejuni lipooligosaccharide analysis by PAGE. LOS samples were prepared from whole-cell lysates using a modified method described  by Hitchcock and Brown (Hitchcock and Brown, 1983). Briefly, cells were resuspended in lysis buffer (2% SDS, 4% 3-mercaptoethanol, 10% glycerol, 1.0 M Tris (pH 6.8), bromophenol blue) and heated for 5 minutes at 95 °C. Samples were then treated with proteinase K and incubated overnight at 55 °C. For silver stain analyses, LOS preparations were heated for 5 minutes at 95 °C and were separated via 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). 10 tL of samples were loaded with the equivalent of final cell 0D 600 of 5.0. The resulting gels were stained with silver as described previously (Tsai and Frasch, 1982), and developed with Biorad Silver Stain Developer (Bio-rad).  2.7  Isolation of LOS and mass spectrometry analysis. C. jejuni strains were first dehydrated using ethanol and acetone. First, 1/2 plate of  confluent cells were resuspended in 0.3 mL of PBS. 1 mL of 100% ethanol was then added, mixed, and allowed to let stand for 1 hr at room temperature. Cells were then centrifuged, washed twice in 100% ethanol, twice in acetone, and allowed to air dry. The intact LOS of the C. jejuni strains were prepared and analyzed by electrophoresis assisted open-tubular liquid chromatography mass spectrometry (EA-OTLC-MS) as described  26  previously (Dzieciatkowska et al., 2007). Mass spectrometry analysis was performed by Dr. Michel Gilbert and Dr. Monika Dzieciatkowska.  2.8  Biofllm formation assay and quantification. The ability of C. jejuni strains to form bioflims was assayed using a modified version of a  previously described methods (McLennan et al., 2008; O’Toole and Kolter, 1998). Briefly, 100 iL of overnight culture diluted to 0D 600 0.002 were inoculated into 96-well microtitre polypropylene plates, and incubated for 24, 48, 72, or 96 hours at 37 °C under microaerobic conditions. At the specified time points, 25 jiL of 1% crystal violet (CV) solution in 100% ethanol was added to the wells, and incubated at room temperature for 15 minutes. The wells were then rinsed thoroughly with distilled water 5 times. Biofilms were quantified by dissolving the remaining CV with a solution composed of 30% methanol and 10% acetic acid. The absorbance was measured at 550 nm using a spectrophotometer (Thermo Electron Co.).  2.9  Serum sensitivity assay. Sensitivity to complement-mediated killing was assayed by a slightly modified method of  Guerry et al. (Guerry et a!., 2000). Overnight bacterial cultures were diluted in PBS to a concentration of 106 cfu/mL and incubated in pooled human serum (10% serum as final concentration) for 40 or 80 minutes at 37 °C under microaerophilic conditions. At the specified time points, bacterial survival was assessed by serial dilution and CFU enumeration on MH plates. Strains were also incubated with pooled human serum that was heat-inactivated at 60 °C for 1 hour as a control.  27  2.10  Sensitivity to antimicrobial peptides, SDS, and EDTA. The minimum inhibitory concentrations (MIC) of the strains towards LL-37, polymyxin  B (Sigma), sodium dodecyl sulfate (SDS; Fisher Scientific), and ethylene diaminetetraacetic (EDTA; Sigma), were determined using a microtitre broth dilution method (Lin et al., 2002), in MH broth and an initial inoculum of 106 cells/mL (back-diluted from an overnight culture). Polypropylene microtitre plates, containing bacterial strains with the various substances, were incubated for 48 hours at 37 °C under microaerobic conditions, and dilutions were spotted on MH plates for survivability. LL-37 was kindly provided by Dr. R.E.W. Hancock.  2.11  Adherence, invasion, and intracellular survival in vitro in 1NT407 and Caco-2 cells. Bacterial infections in vitro in 1NT407 and Caco-2 cell lines were performed as  previously described (Gaynor et al., 2005). Briefly, infection was initiated at a multiplicity of infection (MOl) of 100 on confluent TNT4O7 or Caco-2 monolayers, seeded 24 hrs prior to infection into 24-well plates. The experiment was conducted in triplicate. Bacteria were allowed to adhere and invade for 3 hrs prior to the addition of gentamicin (150 ig/mL) for 2 hrs to kill extracellular bacteria. Invaded bacteria were assayed following the 2 hrs gentamicin killing. For long-term intracellular survival, the initial gentamicin treatment was removed after 2 hrs of killing, and a fresh media containing a lower concentration of gentamicin (10 ig/mL) was added. After an additional 19 hrs, intracellular bacteria were harvested by disrupting the epithelial cells by osmotic lysis with sterile distilled water, and a 27G syringe for physical disruption. Bacterial enumeration was performed at specific time points via cfulmL counts on MH plates.  28  2.12  Mouse colonization. BALB/cByJ mice from Jackson Laboratories (Bar Harbor, ME) were housed at the  animal care centre at the Medical College of Georgia, with seven mice per experimental group. Each mouse was infected with 5 x 1 0 CFU wild type or AlgtF C. jejuni via oral gavage as previously described (Pajaniappan et al., 2008). C. jejuni shed in fecal pellets from each mouse at 7, 14, 19, 28, and 35 days post-infection, were homogenized and enumerated on MH agar containing 5% (v/v) sheep’s blood and 20 mg/mi cefoperazone, 10 mg/mi vancomycin and 2 mg/mi amphotericin B (CVA). The level of detection was 1 x 102 CFU/g fecal pellet. All animal treatments were carried out in accordance with NIH guidelines for the care and use of laboratory animals, using procedures approved by the Medical College of Georgia Institutional Care and Use Committee. Mouse colonization experiments were performed by Dr. Rhonda Hobbs and Dr. Stuart Thompson (Medical College of Georgia).  2.13  MATS hydrophobicity assay. The microbial adhesion to solvents (MATS) was measured using a previously described  method, with slight modifications (Beiion-Fontaine, 1996). Briefly, 1.2 mL of bacterial cells with an initial optical density at 600 nm of 0.1(Ao) were vortexed for 2 minutes with 0.2 mL of hexadecane (Sigma). The mixture was allowed to stand 15 mm to ensure complete phase separation. The aqueous phase was then removed, and the optical density measured at 600 nm ). The percentage of microbial adhesion to hexadecane was calculated as (1 Ai/Ao) x 100. 1 (A -  29  2.14  Autoagglutination assay. The degree of autoagglutination was measured as described previously (Guerry et a!.,  2006). Briefly, overnight cultures of C. jejuni strains were washed and diluted in PBS to make an optical density of 1.0 at 600 nm. 1.5 mL of the cells were inoculated in glass tubes and were allowed to sit at room temperature under microaerobic conditions for 18 to 24 hrs. The optical density at 600 nm of the top layer of the tubes were measured. The drop in 0D 600 readings from the initial readings indicates the level of autoagglutination of the strains.  2.15  Fractionation of C. jejuni to isolate outer and inner membrane proteins. The inner and outer membranes were isolated using a modified fractionation method  described previously (Leon-Kempis Mdel et al,, 2006). Overnight cultures of each C. jejuni strain were normalized to the same 0D 600 and harvested by centrifugation at 6000g for 25 mm at 4 °C. 10 mL of ST buffer (20% sucrose, 30 mM Tris-HC1 pH 8.0) was added and resuspended at room temperature. EDTA was added to a final concentration of 1 mM and shaken for 10 mm at room temperature. The cells were then centrifuged at 8000g for 10 mm and pellets were resuspended in 5 mL of ice cold 10 mM Tris-HC1 (pH 8.0) and stirred for 10 mm at 4 °C. The cell suspension was centrifuged at 1 5000g for 5 minutes at 4 °C to separate the periplasm from the cytoplasm and the membranes. The pellet, containing the cytoplasm and the membranes, was resuspended in 2.5 mL of ice cold Tris-HC1 (pH 8.0), and sonicated  ( ) three times for 30  seconds. The suspension was then centrifuged at 1 3000g for 10 mm at 4 °C. The supernatant was then spun at l00000g for 1 hr at 4 °C. The pellet, containing both the inner and outer membranes, were washed several times in ice cold 10 mM Tris-HC1 (pH 8.0), and resuspended in 100 1 iL of 10 mM HEPES (pH 7.4). 100 1 iL of 2% sodium N-lauroylsarkosinate in 10 mM  30  HEPES (pH 7.4) was added and incubated at room temperature with occasional mixing for 30 mm. The membranes were separated by centrifugation at 15600g for 30 mm at 4 °C. The supernatant contains the inner membrane, and the pellet, containing the outer membrane, was washed and resuspended in 100 iL HEPES (pH 7.4).  2.16  Membrane protein profiling using silver and coomassie dye. Outer and inner membrane proteins were separated by 12% SDS-PAGE, and either  stained using silver or Coomassie Brilliant Blue R-250 dye (EMD Biosciences). The silver staining procedure is described above. For coomassie staining, gels were stained in 0.25% coomassie in a solution of 40% methanol and 10% acetic acid for 1.5 hours at room temperature. The gels were then de-stained overnight in 40% methanol and 10% acetic acid solution.  2.17  Statistical analysis. Results obtained were compared for statistical significance by using a two-tailed unpaired  student’s t-test. P values of less than 0.03 were used (see Figure legends for specific values).  31  CHAPTER 3- RESULTS  3.1  Isolation and construction of LOS core mutants of Campylobacterjejuni 81-176. C. jejuni transposon libraries constructed using solo and picard transposons, as described  in Materials and Methods, were screened for mutants that exhibited hyper-reactivity to calcofluor white (CFW), a fluorescent dye that binds 13-1,3 and 13-1,4 carbohydrate linkages on bacterial surfaces (Wood, 1980). CFW hyper-reactivity in C. jejuni was previously shown to correlate with increased bioflim formationand the up-regulation of an unknown polysaccharide (McLennan et al., 2008). Several CFW hyper-reactive mutants were selected for transposon mapping using a random PCR technique (Appendix A), and two mutants with transposon insertions in the LOS core biosynthetic locus, lgtF and waaF (initially named brt28 and brtls, respectively), were selected for further study. LgtF is a two-domain glycosyltransferase responsible for the addition of 13-1,4 glucose to HepI and 13-1,2 glucose on Hepil core residues, while WaaF is a heptosyltransferase responsible for the addition of Hepil onto HepI (Figure 1.1) (Kanipes et al., 2007; Oldfield et al., 2002). Figure 3.1 A illustrates the transposon insertion sites for both AlgtF and I\waaF* mutants; specifically, apicard transposon harbouring the chioramphenicol acetyltransferase (CAT) gene was inserted within the first of two glycosyltransferase domains in z\lgtF, and a solo transposon harbouring the kanamycin resistance cassette was inserted intergenically between the waaF and waaV genes in ixwaaF*. AwaaF* exhibited a significant defect in LOS mobility by SDS-PAGE analysis (Figure 3.2A), and mass spectrometry analyses confirmed loss of WaaF function in this mutant strain (Figure 3.3 B). In contrast, a waaV targeted knockout strain had no defect in LOS expression based on mass spectrometry (data not shown) and silver stain analyses (Figure 3.2A), and waaV  32  A  AIgtF (brt28)  AwaaF* (brtls)  B  AgaiT  AwaaF  AcstII  Figure 3.1. C. jejuni 81-176 Iipooligosaccharide core transferase mutants. (A) lgtF, located downstream of waaM, was disrupted by the picard transposon, which contains a chioramphenicol resistance gene cassette encoding chioramphenicol acetyltransferase (CAT). The insertion was within the first of two glycosyltransferase domains in this gene. The solo transposon, encoding a kanamycin resistance gene cassette (Kan’) was inserted intergenically between the waaV and waaF genes. (B) gaiT is located downstream of and in the reverse orientation to waaF. The aphA-3 gene encoding kanamycin resistance was used to replace a 446 bp region of the gaiT gene, including approximately 75% of the single glycosyltransferase domain within the gene. The aphA-3 gene was also used to replace a 556 bp region of the waaF gene, including approximately 75% of the single heptosyltransferase domain within the gene. The cstll mutant was constructed by Dr. Gilbert’s group, via an insertion of aphA-3 within cstll.  33  A  81-1 76  1\waaF* AwaaV  B  81-176  zXwaaF* brtls::waaV  Figure 3.2. WaaV is not affected by the intergenic insertion of the brtls solo transposon.  (A) C. jejuni strains were harvested after 24 h of growth, normalized to a final 0D 600 of 5.0, and prepared for LOS analyses. LOS was separated by 412% gradient SDS-PAGE and visualized with silver stain. A targeted knockout of waaV does not show the same LOS defect as the AwaaF* transposon mutant. (B) The waaV gene is unable to rescue the LOS defect of the ZwaaF* transposon mutant.  34  A  81-176  iXcstll  AgaiT  txIgtF  AwaaF  81-176 AigtF-c AgaiT-c  Figure 3.3. Stepwise sequential truncations of the C. jejuni lipooligosaccharide core. (A) C. jejuni strains were harvested after 24 h of growth, normalized to a final 0D 600 of 5.0, and prepared for LOS analysis. LOS was separated on 15% SDS-PAGE and visualized with silver stain. Complemented strains show restoration of full length LOS cores.  35  Petn  B  6‘  81-176  GaINAc.43(1 4)-GaI-p(1 ,4)-GIc-13(i ,2)-Heplkz-(i ,3)-HepIcL-(1 ,5)-Kdo 4 3  NeuAca  G1c13 Petn 6  txcstII  GaI-f3(1 ,4)-GIc-(1 ,2)-HepIIc-(1 ,3)-Hephx-(1 ,5)-Kdo 4  G1c13  Petn 6  A gaiT  GIc-13(1 ,2)-HepIIcL-(1 ,3)-Hepla-(1 ,5)-Kdo 4  G1c13  Petn 6  AIgtF  HepIIc-(i ,3)-HepIcL-(1 ,5)-Kdo  Petn 6  AwaaF, AwaaP  HepIc-(1,5)-Kdo  Figure 3.3. Stepwise sequential truncations of the C. jejuni lipooligosaccharide core. (B) Mass spectrometry analysis of LOS core samples. The 81-176 parental strain shows the full sugar moieties of the LOS inner and outer core. The final N-acetyl-galactosamine (shown in grey) is phase variable, and is phased-off this wild type strain. The AcstII analysis was performed and reported previously. Complemented strains were found to express the full LOS core of the parental strain (not shown). Abbreviations: GalNAc, N-acetyl-galactosamine; NeuAc, N-acetyl-neuraminic acid (sialic acid); Gal, galactose; Gic, glucose; Hep, heptose; Petn, phophoethanolamine; Kdo, 2-keto-3 -deoxymannooctulosonic acid.  36  complementation did not rescue the LOS defect found in AwaaF* (Figure 3.2B). Thus, this strain exhibits waaF-related LOS defects; nevertheless, it is designated with an asterisk to differentiate it from a targeted knockout strain discussed below (designated as simply AwaaF). To explore a possible connection between the LOS core moieties, CFW-reactivity, biofilms, and other pathogenic aspects, we constructed a gaiT mutant and obtained a cstll mutant for inclusion in our study. Furthermore, a targeted waaF mutant was also constructed since the AwaaF* transposon mutant contained an intergenic insertion, and may have affected the waaV gene in certain experiments. CstII is a sialyltransferase responsible for the transfer of sialic acid to the galactose of the outer core, while GaiT is responsible for the transfer of this galactose to the outer core (Figure 1.1) (Chiu et al., 2004; Kanipes et al., 2007). Figure 3.1 B illustrates the location of the gaiT and waaF genes and their disruption by the non-polar kanamycin cassette encoded by aphA-3. For AlgtF and AgaiT, respective complemented strains AigtF-c and AgaiT-c were also constructed using the pRRK and pRRC systems. These vectors were designed specifically for C. jejuni and allow for integration of desired genes into a non-coding conserved spacer region of any of the three rRNA gene clusters of the chromosome (Karlyshev and Wren, 2005). Complemented strains were confirmed using PCR.  3.2  Confirmation of LOS core disruption in a step-wise manner; AwaaF does not  express the inner core glucose residue. To verify the various LOS core disruptions, the LOS profiles of all mutants and the complemented AgaiT-c and AlgtF-c strains were analyzed by SDS-PAGE and silver staining (Figure 3.3A). Each mutant displayed faster migrating LOS species than the wild type,  37  indicative of truncations, with AcstII, AgaiT, AigtF, and AwaaF expressing decreasing lengths of LOS species in a step-wise manner, as predicted. Complemented strains exhibited full restoration of full-length LOS molecules. The nature of the LOS truncations was also confirmed via mass spectrometry; Figure 3 .3B illustrates the major core species expressed by each mutant strain. The parental strain 81-176 was also analyzed, and the terminal N-acetylgalactosamine (in grey) was found to be phased off, a phenomenon not uncommon in this strain of C, jejuni (Guerry et al., 2002). The mutant strains produced truncated molecules, as expected: AcstII lacked the sialic acid (NeuAc) that is normally cL-linked to the galactose, AgaiT lacked all sugar residues beyond and including galactose, and AigtF lacked all outer core sugar residues and the glucose of the inner core. Interestingly, the AwaaF mutant did not express any sugar residues beyond HepI, which differs from the previously published mass spectrometry analysis of AwaaF, where the 3-glucose remained linked to HepI (Kanipes et a?., 2004). Our AwaaF* transposon mutant also did not express the glucose on HepI. The LOS structures of the complemented strains were also analyzed via mass spectrometry and found to be identical to the parental strain (data not shown).  3.3  Bioflim formation is enhanced in the complete absence of the outer core. Prior to determining potential pathogenic traits of the core sugar mutants, the general  growth of each mutant was assessed. All of the mutants grew comparably to the wild type strain, both by absorbance measurements at 600 rim and by viable count enumeration (Figure 3.4A, B). C. jejuni has previously been shown to form bioflims on various surfaces (Kalmokoff et a?., 2006; McLennan et a?., 2008; Murphy et a?., 2006; Reeser et a?., 2007). A bioflim quantification assay was performed on the three outer core mutants and monitored for 3 days  38  A -A-  81-176 AcstII  --e- AgalT --.—  -‘-  I 0—’  I  0  B  10  I  20  I  30 40 time (hr)  I  I  50  60  10 I.0x10  MgtF AwaaF  —81176 —-A— AcstII --e- AgalT --.— IgtF  I .OxIO° • 9  8 ‘1.OxlO° ---  AwaaF  I .0x10° 7 1000000 0  I  I  10  20  I  I  30 40 time (hr)  I  I  50  60  Figure 3.4. Growth is unaltered in LOS core mutants.  (A) Growth was assayed in MH broth via absorbance readings at 600 nm using a spectrophotometer. Points are representative of three independent assays. (B) Growth was measured by counting colony forming units on MH plates and calculating cfu!mL. Points are means derived from triplicate readings and are representative of three independent assays.  39  (Figure 3.5). AlgtF and AwaaF exhibited significantly enhanced bioflim forming abilities compared to wild type, which was evident from 48 hours of incubation. In contrast, the other two mutants, z\cstll and z\galT, did not show any differences in bioflim formation from wild type. The AlgtF complemented strain, AlgtF-c, exhibited bioflim formation comparable to the parental strain. Since the AlgtF and AwaaF mutants were isolated in a CFW hyper-reactivity screen, a trait which is also associated with hyper-biofilm formation (McLennan et al., 2008), we assessed the CFW reactivity of AcstII and AgalT. Despite their normal bioflim forming characteristics, AcstII displayed modest hypo-reactivity to CFW, while modest hyper-reactivity was seen with AgaiT (data not shown).  3.4  The outer core sugars are important in protecting C. jejuni from complement-  mediated killing. The sensitivity of the various LOS mutant strains to complement-mediated killing was tested using pooled human serum. The AlgtF mutant displayed a significantly increased sensitivity to complement, while sensitivities of AgaiT and AcstII were comparable to the parental strain (Figure 3.6). Complementation of AlgtF almost fully rescued its serum sensitivity. This indicates that the presence of the outer core, and most importantly the first glucose f3-linked to Hepli, is important in protecting C. jejuni from the host complement system. To date, the sensitivity of AwaaF towards human serum has not been tested.  40  *  0.6’  I  0.5’ *  0.4  *  *  0.3’ 0.2’  :: n4th fiR ri fl 1  181-176  lAcstII I lAgalT AIgtF AwaaF I::::::I IIgtF:_(  time (d)  Figure 3.5. Complete loss of outer core sugar residues results in increased bioflim formation. Bacterial bioflim formation on polypropylene plates was measured by crystal violet staining. Crystal violet was dissolved in 30% methanol and 10% acetic acid solution and quantified using absorbance readings at 550 nm. Bars are means derived from triplicate readings, and are representative of three independent assays. Asterisks indicate statistically significant differences from wild type (P <0.01).  41  —.—81-176 —*-- zCstII  o81-176(HK)  AcstII (HK) —.—Agafl -.Agarr(HK) —.— !JgtF AIgtF (HK) AgaIT-c AgaIT-c (HK) --x-- AIgtF-c AIgtF-c (HK) b-  ---  10000000  1000000 -J  time (mm)  Figure 3.6. Hypersensitivity to complement-mediated killing occurs with loss of the LOS outer core.  Strains were incubated in PBS with 10% human serum, or 10% heat-killed human serum (control). Recovery of cells in cfu/mL was measured at time 0, 40, and 80 minutes of exposure to the serum. Points are means derived from triplicate readings and are representative of three independent assays. AlgtF was found to be significantly different from the wild type strain (P  <  0.002).  42  3.5  AwaaF is defective for intracellular survival in vitro. It was previously shown that the iXwaaF mutant is not defective for invasion into 1NT407  cells (Kanipes et al., 2007). Our AwaaF mutant also did not exhibit a difference in invasion compared to wild type (Figure 3.7). However, we found that the AwaaF mutant was severely defective for intracellular survival, and was almost unrecoverable after 19 h of intracellular survival in both 1NT407 and Caco-2 cell lines (Figure 3.7 and data not shown).  3.6  Pathogenic phenotypes that are unaltered with LOS truncations: lgtF deletion does  not affect mouse colonization in vivo; LOS core truncation does not impact autoagglutination. The AlgtF mutant was previously shown to have no defect in invasion, which was also true for our AlgtF mutant [(Kanipes et a?,, 2007); data not shown]. In order to see if the lack of invasion and intracellular survival defects for AlgtF in vitro would translate in vivo, or whether the increase in complement sensitivity observed for &gtF might correlate with a colonization defect, we tested AlgtF in a mouse colonization model, and the amount of fecal shedding in the mice was determined (Figure 3.8A). Although AlgtF colonization in BALB/cByJ mice was slightly below that of the wild type strain, there were no significant defects in short or longerterm colonization for this mutant, indicating that the LOS outer core is not required for colonization. Autoagglutination of Gram-negative pathogens has previously been associated with virulence (Menozzi et aL, 1994; Misawa and Blaser, 2000). In C. jejuni, autoagglutination has been linked with flagellin, flagellar glycosylation and quorum sensing (Guerry et a?., 2006; Jeon et a?., 2003; Misawa and Blaser, 2000). Autoagglutination of the mutants was assayed to  43  —  0  VziInvasion Intracellular  L.  d) 0_  Figure 3.7. AwaaF is defective for intracellular survival in vitro. A gentamicin protection assay was performed on z\waaF and AlgtF in the human epithelial cell line, Caco-2. The AwaaF mutant did not exhibit significant differences from wild type for cell invasion but was significantly impaired for intracellular survival. Vertically striped bars represent relative percent recovery of invaded C. jejuni (3 hrs of infection followed by 2 hrs of gentamicin killing), and grey bars represent relative percent recovery after 19 hrs of intracellular survival following the gentamicin killing. The figure is a representative of three independent experiments performed in Caco-2 cells, as well as those performed on another human epithelial cell line, 1NT407.  44  Day7  1. Ox 10 12  A  Day 14  Day 19  Day 28  Day 35  A  1 1.OxlO’  AA  AAA  AAA  ° 1 1.0x10 --  9 2 1.OxlO°  A A  AA  A  8 1.OxlO° U .  A  A  6 1.OxlO° a a U  A  7 1.OxlO° A  AA  5 1.OxlO°  AA A  A  1.0x1O°  A  A  a  A  A  3 1.OxlO°  A  1 .Oxl 002 1 1.OxlO° WT  M9tF  WT  IgtF  WT  AIgtF  WT  MgtF  WT  IgtF  Strains  0.07  B  0.06 0.05 0 0  0.03 0.02 0.01 0.00  =11  GG  S Ira in s Figure 3.8. Loss of outer core sugar residues does not affect mouse colonization in vivo or autoagglutination. (A) Colonization of AlgtF in vivo was performed in BALB/cByJ mice. Seven mice were used per strain, each with an initial inoculum of 5 x 1 O CFU of bacteria. C. jejuni shed in fecal pellets were enumerated using CFU counts on days 7, 14, 19, 28, and 35 post-infection. (B) Settling of cells due to autoagglutination was determined by measuring the optical density of the PBS into which the cells had been inoculated. No significant differences in autoagglutination were found between the LOS core mutants.  45  determine if the LOS has any role in this phenomenon in C. jejuni (Figure 3.8B). All strains had no significance difference in autoagglutination compared to the parental strain.  3.7  Step-wise truncations in the LOS core result in tiled sensitivities to antimicrobial  peptides. Since the LOS is a major component of the C. jejuni cell wall, the mutants’ sensitivity to antimicrobial peptides that target the cell wall structure was determined. The peptide LL-37 is a member of the cathelicidin family, and is expressed by human neutrophils and epithelial tissues (Brogden, 2005). LL-37 has been shown to bind bacterial LPS with high affinity and neutralize its biological activity (Chromek et al., 2006; Cirioni et a!., 2006), but to our knowledge had not yet been tested for against C. jejuni. Polymyxin B activity on the various mutants was also tested. Polymyxin B is a cyclic cationic peptide that also has the ability to neutralize bacterial endotoxins (Bhor et a!., 2005). The minimum inhibitory concentrations (MIC) of polymyxin B and LL-37 on C. jejuni and the LOS mutants are shown below in Table 3.1. Complemented strains had MIC levels comparable to wild type (not shown). The wild type strain of C. jejuni was found to have an MIC of 5.68 j.ig/mL for LL-37. Surprisingly, AcstII had a greater than 2-fold increase in MIC levels than the wild type strain. Step-wise decreases in MIC levels were seen with mutants lacking sequential sugar moieties of the outer core, with zXwaaF exhibiting an approximate 4-fold decrease in MIC compared to wild type. For polymyxin B, the wild type MIC was 3.13 tg/mL, which was comparable to that found in the literature (Alciba et a!., 2006). Polymyxin B had the opposite effect on the various mutants, with the lowest MIC level of 0.06 found for AcstII, a 1.5-fold increase in MIC level for Aga!T and a further 1.5-fold increase in MIC level for  46  zXlgtF. Overall, all of the LOS truncation mutants were found to be at least 15-fold more sensitive to polymyxin B than the parental strain.  Table 3.1. Minimum inhibitory concentrations of LL-37, polymyxin B, SDS, and EDTA towards C. jejuni 81-176 and LOS outer core mutants. Strain 81l76a  LL-37 (J.LgImL) 5.68  Polymyxin B (JLg/mL) 3.13  SDS (mglmL) 248  EDTA (mg/mL) 0.015  AcstII  12.13  0.06  157  0.015  galT  8.08  0.09  157  0.015  AlgtF  2.40  0.16  157  0.015  AwaaF  1.42  0.21  157  0.015  a  AgalT-c and AlgtF-c had MIC levels equivalent to 8 1-176.  3.8  Outer membrane stability, hydrophobicity, and general protein profiles are not  overtly altered in LOS outer core mutants To explore potential outer membrane disruptions that might help account for the phenotypes observed, we first tested outer membrane stability of the mutants by assaying sensitivities to the detergent sodium dodecyl sulfate (SDS) and the chelating agent ethylene diaminetetraacetic acid (EDTA) (Table 3.1). A slight but insignificant increase in sensitivity towards SDS was seen to the same extent in all mutants compared to the wild type, and no change was seen for EDTA sensitivity.  47  To determine if cell surface hydrophobicity was altered in the outer core mutants, the microbial adhesion to solvents (MATS) assay (BellonFontaine et a!., 1996) was employed, with hexadecane as the apolar solvent (Figure .9). The percent adhesion to hexadecane for the .  parental strain and all outer core mutants were found to range from 10.6% to 12.4%, while the inner core mutant AwaaF averaged 28.2%, but this difference from wild type was not considered to be statistically significant. Finally, the general outer membrane protein profiles of the various strains were compared by separating the proteins via 12% SDS-PAGE followed by visualization by silver stain (data not shown) and coomassie dye (Figure 3.10). Neither staining method showed any noticeable differences in protein expression amongst the strains. The inner membrane proteins were also loaded as a control, and differences in band intensities were also not seen.  48  45. 4O  81-176  AcstII • AgalT tsIgtF z\waaF  C)  ° 3O 25• 20• ca  10•  AIgtF  AwaaF  strains  Figure 3.9. Surface hydrophobicity is unaffected with LOS core truncations. Surface hydrophobicity of C. jejuni was determined by measuring bacterial adhesion to the non polar solvent, hexadecane. The % adhesion to hexadecane ranged from 10.6% to 28.2%, but none were found to be statistically significantly different from the wild type strain.  49  kD —  ..  b —  —  —  —  _4  15—— —  Lanes: 1  2  3  4  5  6  7  8  9  10  11  12  Figure 3.10. Outer membrane profile of C. jejuni and the various outer core mutants have no obvious significant differences.  Samples were harvested from 24 hours of growth and normalized based on 0D 600 readings and total protein concentration. Outer membrane (OM) and inner membrane (TM) proteins were isolated, separated on 12% SDS-PAGE, and stained using Coomassie. Lanes: 1. PageRuler Plus protein ladder (Fermentas) 2. 81-176 (OM) 3. iXcstll(OM) 4. AgalT(OM) 5. AlgtF (OM) 6. AwaaF(OM) 7. PageRuler Plus protein ladder (Fermentas) 8. 8 1-176 (TM) 9. AcstII(IM) 10. AgalT(IM) 11. zVgtF(IM) 12. iXwaaF(JJVT).  50  CHAPTER 4- DISCUSSION  4.1  Discussion of Results. In this study, we have investigated the biological effects of step-wise LOS truncations on  survival and pathogenesis aspects of C. jejuni. As willbe discussed, previous work exploring the consequences of single LOS mutations in a variety of C. jejuni strains has established that the LOS is generally important for pathogenesis and that the effect of LOS truncations can vary from strain to strain. In this work, we have directly compared several sequential LOS core mutants in the highly invasive and pathogenic strain, 8 1-176. The simultaneous analysis of each of these mutants has allowed us to delineate differential defects associated with loss of specific sugar residues of the LOS. A bacterial biofilm is defined as a community of bacterial cells that are attached to an abiotic or biotic surface, and encased in a self-synthesized matrix of extracellular polymeric substances (Donlan and Costerton, 2002). It is well established that biofilms play a substantial role in various infectious diseases (Moreau-Marquis et al., 2008; Paju and Scannapieco, 2007). Further, bacterial cells within a biofilm have certain advantageous characteristics over those in the planktonic state, including the ability to resist various antibiotics and host immune responses (Nadell et al., 2008). We have shown that amongst our repertoire of LOS core mutants, the only mutants that displayed a difference in bioflim formation from the wild type were z\lgtF and AwaaF, which exhibited a hyper-biofilm forming phenotype. This result was consistent with the correlation seen previously between increased biofilm formation and CFW hyper-reactivity (McLennan et al., 2008). Interestingly, the two other outer core mutants, i\cstll and AgalT, did not display altered biofilm phenotypes, despite having modestly altered reactivity to CFW  51  relative to the parental strain. CFW-reactivity in C. jejuni has been attributed to an yet uncharacterized surface polysaccharide (McLennan eta!., 2008). The LOS truncations of the mutants may also exert their own independent effects on bioflim formation, as is the case with other bacteria (Ren et a!., 2007), and thus the relationship between CFW-reactive polysaccharides and biofilms may be more complex than previously predicted. For instance, the increase in bioflim formation by AlgtF and AwaaF may be due to several factors, including: (a) newly exposed sugar residues of the inner core may increase aggregation between C. jejuni cells and/or binding to polypropylene surfaces, (b) truncations to the LOS may allow for the exposure of other outer membrane associated factors acting as adhesins, or (c) unknown factors (e.g. the CFW-reactive polysaccharide) may be up-regulated in response to the loss of the full LOS outer core, similar to the up-regulation of colanic acid exopolysaccharide in E. coli triggered by disruptions to the LPS (Parker et a?., 1992), which in turn allows for increased bioflim formation in order to help the mutants survive environmental stresses. Biofilm formation is a complex and dynamic process, and can be attributed to a contribution of numerous extracellular factors making it difficult to determine the exact effect the LOS may have on biofilm formation. For instance, in other bacteria, poly-N-acetylglucosamine (PNAG) expression correlates with bioflim formation in Staphylococcus epidermidis, S. aureus, and Actinobacillus plueropneumoniae, although PNAG-deficient strains have also been shown to exhibit a strong bioflim phenotype (Izano et a?., 2008a; Izano eta!., 2008b; Kropec eta!., 2005; O’Gara, 2007). Other known factors include extracellular DNA, adhesins such as Peb4 in C. jejuni, and glycosylation of surface proteins (Asakura et a?., 2007; Rice et a!., 2007; Wu et a?., 2007). Here, we have demonstrated an unexpected inverse correlation between LOS truncation and biofilm formation in C. jejuni, but the numerous factors that may potentially be involved suggests that the specific  52  role of LOS cores in biofilm formation may be indirect and will require significant further investigation to elucidate. The host complement system is a central component of the innate immune system, and is one of the first lines of defence against human pathogens. Complement activation can occur via three distinct pathways, including the lectin pathway where carbohydrate ligands on the surfaces of pathogens are recognized by pattern-recognition receptors such as mannose-binding lectin (MBL) (Lambris et al., 2008). MBL has been shown to bind Neisseria meningitidis more strongly when the LOS is truncated (Jack et al., 1998), indicating a role for LOS in resistance to the host complement system. In this study, we observed a dramatic increase in C. jejuni susceptibility to human complement when the LOS outer core was abolished. Although the exact mechanism of this hypersensitivity has yet to be determined, this phenomenon may be due to a stronger MBL association with the newly exposed sugar residues. Nonetheless, our results clearly demonstrate that the outer core plays an important role in protecting C. jejuni 81-176 from complement-mediated killing, as is the case with many other pathogens such as Moraxella catarrhalis and Yersiniapestis (Knirel et al., 2007; Peng et a!., 2007). Invasion into human intestinal epithelial cells in vitro by a variety of LOS core mutants have previously been studied by a number of groups. For instance, a AcgtA mutant in strain 81176 was found to adhere to 1NT407 cells in a comparable manner as its parental strain, but was more enhanced in its invasive properties (Guerry et a!., 2002). In addition, the genes cgtB and wiaN (encoding putative 13-1 ,3-galactosyltransferases in the LOS biosynthetic locus) were more strongly associated with strains that were highly invasive in Caco-2 cells in vitro, and in strains that were better able to colonize the chicken gut in vivo (Muller et a!., 2007). Our AwaaF mutant was not defective for invasion of either 1NT407 and Caco-2 cell lines, but exhibited a striking  53  intracellular survival defect. The presence of the second heptose may thus have a protective effect on C. jejuni intracellular survival, since the z\lgtF mutant did not share the same defect. It should be noted that our wild type strain lacks the terminal N-acetylgalactosamine (Ga1NAc) due to phase variation in the cgtA gene. In strain 81-176, slip strand mismatch recombination occurs at a relatively high frequency in cgtA, which affects the expression of this gene (Guerry et al., 2002). Nonetheless, this strain exhibits similar invasion characteristics to those published for 81176 strains from other labs, with comparably wild-type levels of invasion and colonization (Kanipes et al., 2004; Szymanski et al., 2002). There can be a good correlation between C. jejuni invasion in vitro and colonization in vivo (Hanel et al., 2004). In our study, we tested the ability of iXlgtF to colonize the mouse gastrointestinal tract, since this mutant expressed the most truncated LOS core without displaying any change in its invasive properties in vitro. Its colonization properties were also found to be unaffected. However, this seemingly sensible relationship does not hold true in all cases; a galE (later renamed gne) deletion mutant was able to colonize chickens at the same level as its parental strain despite a significant reduction in its ability to adhere and invade 1NT407 cells (Fry et al., 2000). It was later determined that the gne gene product also plays a role in C. jejuni capsule formation and N-linked glycosylation, which may in part explain the lack of correlation (Bematchez et al., 2005). Nonetheless, these and other studies show that LOS is indeed an important factor in both invasion and colonization, but other factors such as certain periplasmic proteins and the glycosylation of membrane-associated proteins, as well as capsule are also involved (Kakuda and DiRita, 2006; Szymanski et al., 2002). The loss of LOS core sugar residues had no effect on autoagglutination activity. In C. jejuni, autoagglutination has been linked with flagellin, flagellar glycosylation, and quorum  54  sensing (Guerry et a!., 2006; Jeon et at., 2003; Misawa and Blaser, 2000). Although there are no prior reports of LOS association with autoagglutination in C. jejuni, LPS mutants of a peanut plant bacterium, Bradyrhizobium sp. (Arachis) have been shown to correlate with autoagglutination activities (Bhattacharya et a!., 2002). Our results show that LOS core sugars are not involved in autoagglutination activities of C. jejuni. This also correlates with the previous link found between C. jejuni autoagglutination and surface hydrophobicity (Misawa and Blaser, 2000); as our LOS mutants were also unaffected for surface hydrophobicity when assayed with hexadecane. Antimicrobial peptides are produced and released by many different cell types in various invertebrate, plant, and animal species. Although specific modes of killing differ depending on the class of peptides, all peptides are initially attracted to bacterial cell surface structures via electrostatic bonding, such as to LPS/LOS in Gram-negative bacteria, and must pass through capsular polysaccharides (if present) before attaching and inserting themselves into the membrane bilayer to form transmembrane pores (Brogden, 2005). The insertion causes membrane rupture or channel formation which leads to the death of the bacterial cell via lysis. Peptides are also known to target various intracellular machineries by crossing the cytoplamic membrane (Park et a!., 1998). Bacteria have evolved numerous mechanisms to counteract the actions of various peptides; some of these include alterations in membrane fluidity via lipid A modifications and substitutions, proteolytic degradation, efflux, and the expression or presence of capsular polysaccharides (Brogden, 2005; Campos eta!., 2004; Guo eta!., 1998; Murray et a!., 2007; Sieprawska-Lupa et at., 2004). Furthermore, LPS cores have been shown to be an important factor in conferring resistance to peptides; for instance, Yersinia enterocolitica LPS core mutants were more sensitive to polymyxin B then the wild type strain, and the inner core  55  was found to play an important role in the resistance of Burkholderia cenocepacia to various antimicrobial peptides (Loutet et a?., 2006; Skurnik et al., 1999). Also, phosphorylation of Salmonella enterica LPS core regions has been shown to confer increased resistance to polycationic antimicrobials (Yethon et al., 2000). Interestingly, we found that our sequential C. jejuni LOS truncations resulted in opposing effects on sensitivity or resistance to polymyxin B and LL-37. LL-37, a cathelicidin, kills both Gram-negative and Gram-positive bacteria by first binding to the bacterial outer surface via electrostatic interactions, followed by insertion into the cytoplasmic membrane causing leakage of the cell contents into the extracellular space (Golec, 2007). Polymyxin B has a polycationic peptide ring that binds to LPS/LOS and displaces calcium and magnesium bridges that stabilize the LPS/LOS. The fatty acid chain of polymyxin B will further interact with the LPS/LOS and insert into the membrane, leading to permeability changes and allowing for passage of extracellular and intracellular components (Zavascki et a?., 2007). Unlike LL-37, polymyxin B is active only against Gram-negative bacteria. We found that loss of the terminal sialic acid (AcstII) caused a significant increase in susceptibility of C. jejuni to polymyxin B; the MIC continued to increase as the truncations became more severe, although sensitivity of all of the mutants was much greater than the parental strain. For LL-37, the opposite effect was observed; loss of the sialic acid caused a 2.1-fold increase in resistance towards the peptide, and the MIC levels slowly decreased as the truncations became more severe, with AlgtF and z\waaF exhibiting 2.3- and 4-fold increased sensitivity to LL-37, respectively, compared to wild type. Changes in MIC of the peptides to C. jejuni were expected, since the loss of various sugar residues is likely to create changes in hydrophobicity, surface charge, and composition of the LOS. However, a hydrophobicity assay performed on the mutants showed that there were no  56  significant changes amongst the strains. Furthermore, sensitivity towards SDS and EDTA was similar for all the mutants, suggesting that the effects seen are also not due to a loss in membrane stability. While these classic assays may not detect hydrophobicity and membrane stability alterations in C. jejuni (vs. E. coil), it is also possible that the effect of LOS truncations on peptide MIC levels may be indirect. For instance, loss of core sugars may cause destabilization of membrane-bound proteins, which in turn may have a direct effect on peptide interaction with bacterial surfaces. Although we did not detect overt changes in outer membrane protein expression by the various core mutants, it is also possible that the exposure of these proteins is somewhat different due to the LOS truncations, which may be causing the phenotypic changes observed. Changes in LOS/LPS are also known to increase phospholipids in the outer leaflet of the outer membrane, which may also have an impact on the interaction of antimicrobial peptides with the bacterial surface (Frirdich and Whitfield, 2005; Heinrichs et al., 1998). A previous study on LOS core mutants of Burkhoideriapseudomaliei indicated that the mutations not only caused hypersensitivity to polymyxin B, but that the outer membrane protein profiles were altered in the core mutants (Burtnick and Woods, 1999). It was unexpected for the sensitivity of C. jejuni mutants towards polymyxin B to decrease with sequential LOS truncations and not increase, as was the case with LL-37. It may be that more severely truncated mutants upregulate modifications that confer modest protection from polymyxin B but not LL-37; however all LOS mutants were hypersensitive to polymyxin B compared to the wild type strain, indicating the importance of the LOS core in protecting C. jejuni from certain antimicrobial peptides. Furthermore, although the two antimicrobial peptides have similar modes of killing, the differences between the peptides’ ability to target Gram-positive bacteria indicate that their initial attraction and attachment towards bacterial surfaces differ. Nonetheless, the step-wise  57  increase or decrease in MIC levels with each loss of sugar residue is an interesting and novel finding. We have also shown that LL-3 7 is indeed active against C. jejuni 81-176; to our knowledge, this is the first report of C. jejuni sensitivity to LL-37, as well as the first report of the importance of C. jejuni LOS core to polymyxin B resistance. Sialylation of LOS and LPS is known to be an important virulence factor in many pathogens, where the addition of sialic acid often protects the pathogen from host defence responses including the complement system. This is also evident in another strain of C. jejuni, MSC57360 (whose LOS core composition differs from that of 8 1-176), where a AneuCI mutant lacking a sialic acid in the outer core displayed a significant increase in serum sensitivity (Fox et al., 2006; Guerry et al., 2000; Jack et al., 1998). Furthermore, LOS sialylation has also been reported to influence adherence and invasion into epithelial cells (de Vries et al., 1996). Interestingly, we found that apart from antimicrobial peptide sensitivity/resistance, removal of sialic acid from the LOS generated no effect in any of the virulence-related assays performed. It is well established, however, that sialic acid residues on the LOS of C. jejuni are the major cause of molecular mimicry that may lead to the sequelae GBS (Yuki, 2007). Thus, the role of LOS sialylation in C. jejuni 8 1-176 in pathogenesis may primarily be its GBS-inducing potential rather than stress survival and/or invasiveness. Although our LOS core truncations were found to have dramatic effects on various aspects of C. jejuni biology and pathogenesis, it remains to be determined whether the effects are a direct or indirect result of the truncations. For instance, as noted above, although we have not yet been able to detect surface hydrophobicity or gross membrane protein alterations in our mutant strains, work in other organisms has shown that severe LOS truncations exert effects on other components of the cell envelope including phospholipid and outer membrane protein  58  compositions (Frirdich and Whitfield, 2005; Heinrichs eta!., 1998; Parker et al., 1992). These complexities, as with the bioflims and CFW reactivity data, further highlight the dynamic nature of bacterial surface components and suggest that stress resistance and pathogenesis properties are likely highly multifactorial, and also likely involve compensatory changes occurring in response to mutations of factors such as specific LOS sugar residues. In summary, the various effects seen with our sequentially truncated C. jejuni strain 81176 LOS core mutants provide evidence that each component of the core provides important and distinct levels of protection and resistance while also providing a means for establishing infection and disease. The importance of LOS core variations in pathogenicity of C. jejuni is slowly being unravelled, and other pathogenic traits of the mutants are currently being investigated. The contribution of various surface components of C. jejuni and their association with LOS during pathogenesis also remains to be investigated.  4.2  Future Directions. One major follow-up study for this project would be to elucidate the mechanisms  underlying the various phenotypes seen in the LOS core mutants. Our initial analyses showed that outer membrane protein expression, membrane hydrophobicity and stability are unaltered based on our assays. However, other surface changes may have occurred such as alterations in phospholipid composition. Another possible surface structural change that may occur is the ratio of phosphates to other elements on the membrane. Investigations into the phospholipid composition as well as the phosphorylation state of each LOS mutant would provide additional insight into other biological functions that may be altered by sequential LOS sugar truncation.  59  An outer membrane permeabilization assay investigating the kinetics of 1-Nphenylnapthylamine (NPN) uptake into the membrane was attempted in C. jejuni to determine if the barrier function of the outer membrane may be perturbed in any of the mutant strains. NPN is a hydrophobic fluorophore that will fluoresce weakly in aqueous environments, but will fluoresce strongly in nonpolar/hydrophobic environments such as the cell membrane (Loh et al., 1984). Unfortunately, despite repeated attempts, this assay did not appear to work for C. jejuni, possibly due to differences in the membrane composition of C. jejuni compared to other bacteria for which the assay has been established and optimized. A similar assay can also be performed in the future using dansyl-polymyxin, a fluorescent derivative of polymyxin B (Moore et al., 1986). This experiment will show if changes to ionic sites in the LOS, such as the Mg 2 binding sites to polymyxin B, have been altered due to the LOS core truncations. This project was initiated to study the correlation of CFW-reactivity with bioflim formation in C. jejuni. As shown in Appendices A and B, many CFW-hyperreactive and CFW hyporeactive transposon mutants have been mapped. Additional mutants can be studied to further explore the mechanism underlying CFW-reactivity in C. jejuni and its correlation with pathogenic traits. Of particular interest are the CFW-hyporeactive mutants, dim4, dimlO, and dim] 7, all of which the transposon insertion occurred near or in the genes Cj]343 and Cj1344. Since 50% of the dim mutants that were mapped using random PCR had this same mutation, it would be interesting to see how this gene (or genes) causes CFW-hyporeactivity in C. jejuni. Furthermore, many more mutants have been isolated and frozen down without mapping of the transposon insertion sites. Mapping of these mutants may also provide additional insight into the connection between C. jejuni CFW reactivity, biofilms, and pathogenesis.  60  Finally, the waaV gene was also studied briefly when the gene(s) disrupted by the transposon insertion in brt]s was being determined. The role and function of WaaV in C. jejuni biology is still unclear at this time. Based on the mass spectrometry and silver stain analysis, it is clear that the waaV gene product is not involved in the transfer of sugar residues to the LOS core. The knock-out strain that was already constructed can be used to determine if this gene is active elsewhere in the biology of C. jejuni, and if it plays a role in the pathogenesis of the organism. We have demonstrated that LOS core residues are involved in various aspects of pathogenesis and stress survival in C. jejuni. The future experiments will allow for a more complete picture on the mechanisms underlying campylobacteriosis, and can also provide insight into pathogenic traits due to LOS/LPS core residues in other bacteria.  61  REFERENCES Akerley, B.J., and Lampe, D.J. (2002) Analysis of gene function in bacterial pathogens by GAMBIT. Methods Enzymol 358: 100-108. Akiba, M., Lin, J., Barton, Y.W., and Zhang,  Q.  (2006) Interaction of CmeABC and CmeDEF in  conferring antimicrobial resistance and maintaining cell viability in Campylobacter jejuni. JAntimicrob Chemother 57: 52-60. Albiger, B., Johansson, L., and Jonsson, A.B. (2003) Lipooligosaccharide-deficient Neisseria meningitidis shows altered pilus-associated characteristics. Infect Immun 71: 15 5-162. Alfredson, D.A., and Korolik, V. (2007) Antibiotic resistance and resistance mechanisms in Campylobacterjejuni and Campylobacter coli. FEMS Microbiol Lett 277: 123-132. Allos, B.M., Lippy, F.T., Carlsen, A., Washburn, R.G., and Blaser, M.J. (1998) Campylobacter jejuni strains from patients with Guillain-Barre syndrome. Emerg Infect Dis 4: 263-268. Allos, B.M. (2001) Campylobacterjejuni Infections: update on emerging issues and trends. Clin Infect Dis 32: 1201-1206. Altekruse, S.F., Stern, N.J., Fields, P.1., and Swerdlow, D.L. (1999) Campylobacterjejuni--an emerging foodborne pathogen. Emerg Infect Dis 5: 28-3 5. Andersen-Nissen, E., Smith, K.D., Strobe, K.L., Barrett, S.L., Cookson, B.T., Logan, S.M., and Aderem, A. (2005) Evasion of Toll-like receptor 5 by flagellated bacteria. Proc Nati AcadSci USA 102: 9247-9252. Asakura, H., Yamasaki, M., Yamamoto, S., and Igimi, S. (2007) Deletion of peb4 gene impairs cell adhesion and biofilm formation in Campylobacterjejuni. FEMS Microbiol Lett 275: 278-285. Ashgar, S.S., Oldfield, N.J., Wooldridge, K.G., Jones, M.A., Irving, G.J., Turner, D.P., and Ala’Aldeen, D .A. (2007) CapA, an autotransporter protein of Campylobacter jejuni, mediates association with human epithelial cells and colonization of the chicken gut. J Bacteriol 189: 1856-1865. Ashkenazi, S., Danziger, Y., Varsano, Y., Peilan, J., and Mimouni, M. (1987) Treatment of Campylobacter gastroenteritis. Arch Dis Child 62: 84-85.  62  Bachtiar, B.M., Coloe, P.J., and Fry, B.N. (2007) Knockout mutagenesis of the kpsE gene of Campylobacter jejuni 81116 and its involvement in bacterium-host interactions. FEMS Immunol Med Microbiol 49: 149-154. Bacon, D.J., Szymanski, C.M., Burr, D.H., Silver, R.P., Aim, R.A., and Guerry, P. (2001) A phase-variable capsule is involved in virulence ofCampylobacterjejuni 8 1-176. Mol Microbiol 40: 769-777. Bacon, D.J., Alm, R.A., Hu, L., Hickey, T.E., Ewing, C.P., Batcheior, R.A., Trust, T.J., and Guerry, P. (2002) DNA sequence and mutational analyses of the pVir plasmid of Campyiobacterjejuni 81-176. Infection and Immunity 70: 6242-6250. Batchelor, R.A., Pearson, B.M., Friis, L.M., Guerry, P., and Wells, J.M. (2004) Nucleotide sequences and comparison of two large conjugative plasmids from different Campylobacter species. Microbiology 150: 3507-3517. Bellon-Fontaine, M.-N., Rault, J., van Oss, C.J. (1996) Microbial adhesion to solvents. BellonFontaine, M.N., Rault, J., and vanOss, C.J. (1996) Microbial adhesion to solvents: A novel method to determine the electron-donor/electron-acceptor or Lewis acid-base properties of microbial cells. Colloids and Surfaces B-Biointerfaces 7: 47-53. Bereswill, S., and Kist, M. (2003) Recent developments in Campylobacter pathogenesis. Curr OpinlnfectDis 16: 487-491. Bernatchez, S., Szymanski, C.M., Ishiyama, N., Li, J., Jarrell, H.C., Lau, P.C., Berghuis, A.M., Young, N.M., and Wakarchuk, W.W. (2005) A single bifunctional UDP-G1cNAc/Glc 4epimerase supports the synthesis of three cell surface glycoconjugates in Campylobacter jejuni. JBiol Chem 280: 4792-4802. Bhattacharya, I., Gautam, H., and Das, H.R. (2002) Characterization of LPS mutants of peanut specific Bradyrhizobium (GN17). Glycoconjugate Journal 19: 395-402. Bhor, V.M., Thomas, C.J., Surolia, N., and Surolia, A. (2005) Polymyxin B: an ode to an old antidote for endotoxic shock. Mol Biosyst 1: 2 13-222. Biswas, D., Fernando, U., Reiman, C., Wilison, P., Potter, A., and Allan, B. (2006) Effect of cytolethal distending toxin of Campylobacter jejuni on adhesion and internalization in cultured cells and in colonization of the chicken gut. Avian Dis 50: 586-593. Black, R.E., Levine, M.M., Clements, M.L., Hughes, T.P., and Blaser, M.J. (1988) Experimental Campylobacter jejuni infection in humans. Jlnfect Dis 157: 472-479.  63  Blaser, M.J., Sazie, E., and Williams, L.P., Jr. (1987) The influence of immunity on raw milk-associated Campylobacter infection. Jama 257: 43-46. Blaser, M.J., and Engberg, J. (2008) Clinical Aspects of Campylobacterjejuni and Campylobacter coli Infections. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 99-121. Brogden, K.A. (2005) Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Microbiol 3: 23 8-250. Burtnick, M.N., and Woods, D.E. (1999) Isolation of polymyxin B-susceptible mutants of Burkholderia pseudomallei and molecular characterization of genetic loci involved in polymyxin B resistance. Antimicrob Agents Chemother 43: 2648-2656. Campos, M.A., Vargas, M.A., Regueiro, V., Liompart, C.M., Alberti, S., and Bengoechea, J.A. (2004) Capsule polysaccharide mediates bacterial resistance to antimicrobial peptides. Infect Immun 72: 7107-7114. Carrillo, C.D., Taboada, E., Nash, J.H., Lanthier, P., Kelly, J., Lau, P.C., Verhuip, R., Mykytczuk, 0., Sy, J., Findlay, W.A., Amoako, K., Gomis, S., Willson, P., Austin, J.W., Potter, A., Babiuk, L., Allan, B., and Szymanski, C.M. (2004) Genome-wide expression analyses ofCampylobacterjejuni NCTC 11168 reveals coordinate regulation of motility and virulence by fihA. JBiol Chem 279: 20327-2033 8. Champion, O.L., Al-Jaberi, S., Stabler, R.A., and Wren, B.W. (2008) Comparative Genomics of Campylobacterjejuni. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 63-71. Chiu, C.P., Watts, A.G., Lairson, L.L., Gilbert, M., Lim, D., Wakarchuk, W.W., Withers, S.G., and Strynadka, N.C. (2004) Structural analysis of the sialyltransferase CstII from Campylobacterjejuni in complex with a substrate analog. Nat Struct Mo! Biol 11: 163170. Chromek, M., Slamova, Z., Bergman, P., Kovacs, L., Podracka, L., Ehren, I., Hokfelt, T., Gudmundsson, G.H., Gallo, R.L., Agerberth, B., and Brauner, A. (2006) The antimicrobial peptide cathelicidin protects the urinary tract against invasive bacterial infection. Nat Med 12: 636-641.  64  Chu, Y.W., Chu, M.Y., Luey, K.Y., Ngan, Y.W., Tsang, K.L., and Kam, K.M. (2004) Genetic relatedness and quinolone resistance ofCampylobacterjejuni strains isolated in 2002 in Hong Kong. JClin Microbiol 42: 3321-3323. Cirioni, 0., Giacometti, A., Ghiselli, R., Bergnach, C., Orlando, F., Silvestri, C., Mocchegiani, F., Licci, A., Skerlavaj, B., Rocchi, M., Saba, V., Zanetti, M., and Scalise, G. (2006) LL 37 protects rats against lethal sepsis caused by gram-negative bacteria. Antimicrob Agents Chemother 50: 1672-1679. Crushell, E., Harty, S., Sharif, F., and Bourke, B. (2004) Enteric campylobacter: purging its secrets? Pediatr Res 55: 3-12. Dalpke, A., Frank, J., Peter, M., and Heeg, K. (2006) Activation of toll-like receptor 9 by DNA from different bacterial species. Infect Immun 74: 940-946. de Vries, F.P., van Der Ende, A., van Putten, J.P., and Dankert, J. (1996) Invasion of primary nasopharyngeal epithelial cells by Neisseria meningitidis is controlled by phase variation of multiple surface antigens. Infect Immun 64: 2998-3006. Debruyne, L., Gevers, D., and Vandamme, P. (2008) Taxonomy of the Family Campylobacteraceae. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washingdon, DC: ASM Press, pp. 3-25. Donlan, R.M., and Costerton, J.W. (2002) Biofilms: survival mechanisms of clinically relevant microorganisms. Clin Microbiol Rev 15: 167-193. Drlica, K. (1999) Mechanism of fluoroquinolone action. Curr Opin Microbiol 2: 504-508. Dunlop, S.P., Jenkins, D., Neal, K.R., and Spiller, R.C. (2003) Relative importance of enterochromaffin cell hyperplasia, anxiety, and depression in postinfectious lBS. Gastroenterology 125: 1651-1659. DzieciatkOwska, M., Brochu, D., van Belkum, A., Heikema, A.P., Yuki, N., Houliston, R.S., Richards, J.C., Gilbert, M., and Li, J. (2007) Mass spectrometric analysis of intact lipooligosaccharide: direct evidence for O-acetylated sialic acids and discovery of 0linked glycine expressed by Campylobacterjejuni. Biochemistry 46: 14704-14714. Fouts, D.E., Mongodin, E.F., Mandrell, R.E., Miller, W.G., Rasko, D.A., Ravel, J., Brinkac, L.M., DeBoy, R.T., Parker, C.T., Daugherty, S.C., Dodson, R.J., Durkin, A.S., Madupu, R., Sullivan, S.A., Shetty, J.U., Ayodeji, M.A., Shvartsbeyn, A., Schatz, M.C., Badger, J.H., Fraser, C.M., and Nelson, K.E. (2005) Major structural differences and novel  65  potential virulence mechanisms from the genomes of multiple campylobacter species. PLoSBio13: e15. Fouts, D.E., Mongodin, E.F., Puiu, D., Sebastian, Y., Miller, W.G., Mandrell, R.E., Lastovica, A.J., and Nelson, K.E. (2007) Complete Genome Sequence of Campylobacterjejuni subsp. doylei 269.97 isolated from human blood. Vol. 2008: NCBI. Fox, K.L., Cox, A.D., Gilbert, M., Wakarchuk, W.W., Li, J., Makepeace, K., Richards, J.C., Moxon, E.R., and Hood, D.W. (2006) Identification of a bifunctional lipopolysaceharide sialyltransferase in Haemophilus influenzae: incorporation of disialic acid. JBiol Chem 281: 40024-40032. Frirdich, E., and Whitfield, C. (2005) Lipopolysaccharide inner core oligosaccharide structure and outer membrane stability in human pathogens belonging to the Enterobacteriaceae. J Endotoxin Res 11: 133-144. Fry, B.N., Feng, S., Chen, Y.Y., Newell, D.G., Coloe, P.J., and Korolik, V. (2000) The galE gene of Campylobacterjejuni is involved in lipopolysaccharide synthesis and virulence. Infect Immun 68: 2594-2601. Gaynor, E.C., Ghori, N., and Falkow, S. (2001) Bile-induced ‘pili’ in Campylobacterjejuni are bacteria-independent artifacts of the culture medium. MolMicrobiol 39: 1546-1549. Ganor, E.C., Wells, D.H., MacKichan, J.K., and Falkow, 5. (2005) The Campylobacterjejuni stringent response controls specific stress survival and virulence-associated phenotypes. Mol Microbiol 56: 8-27. Gilbert, M., Mandrell, R.E., Parker, C.T., Li, J., and Vinogradov, E. (2007) Structural analysis of the capsular polysaccharide from Campylobacterjejuni RM1221. Chembiochem 8: 625631. Gilbert, M., Parker, C.T., and Moran, A.P. (2008) Campylobacterjejuni Lipooligosaccharides: Structures and Biosynthesis. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 483-504. Godschalk, P.C., Kuijf, M.L., Li, J., St Michael, F., Ang, C.W., Jacobs, B.C., Karwaski, M.F., Brochu, D., Moterassed, A., Endtz, H.P., van Belkum, A., and Gilbert, M. (2007) Structural characterization of Campylobacter jejuni lipooligosaccharide outer cores associated with Guillain-Barre and Miller Fisher syndromes. Infect Immun 75: 12451254.  66  Golec, M. (2007) Cathelicidin LL-37: LPS-neutralizing, pleiotropic peptide. Ann Agric Environ Med 14: 1-4. Goon, S., Kelly, J.F., Logan, S.M., Ewing, C.P., and Guerry, P. (2003) Pseudaminic acid, the major modification on Campylobacter flagellin, is synthesized via the Cj 1293 gene. Mo? Microbio? 50: 659-671. Goon, S., Ewing, C.P., Lorenzo, M., Pattarini, D., Majam, G., and Guerry, P. (2006) A sigma28regulated nonflagella gene contributes to virulence of Campyiobacterjejuni 81-176. Infect Immun 74: 769-772. Guerry, P., Aim, R.A., Power, M.E., Logan, S.M., and Trust, T.J. (1991) Role of two flagellin genes in Campylobacter motility. JBacteriol 173: 4757-4764. Guerry, P., Ewing, C.P., Hickey, T.E., Prendergast, M.M., and Moran, A.P. (2000) Sialylation of lipooligosaccharide cores affects immunogenicity and serum resistance of Campylobacter jejuni. Infect Immun 68: 665 6-6662. Guerry, P., Szymanski, C.M., Prendergast, M.M., Hickey, T.E., Ewing, C.P., Pattarini, D.L., and Moran, A.P. (2002) Phase variation of Campylobacterjejuni 81-176 lipooligosaccharide affects ganglioside mimicry and invasiveness in vitro. Infect Immun 70: 787-793. Guerry, P., Ewing, C.P., Schirm, M., Lorenzo, M., Kelly, J., Pattarini, D., Majam, G., Thibault, P., and Logan, S. (2006) Changes in flagellin glycosylation affect Campylobacter autoagglutination and virulence. Mo! Microbiol 60: 299-311. Guerry, P. (2007) Campylobacter flagella: not just for motility. Trends Microbio! 15: 456-46 1. Gundogdu, 0., Bentley, S.D., Holden, M.T., Parkhill, J., Dorrell, N., and Wren, B.W. (2007) Reannotation and re-analysis of the Campylobacterjejuni NCTC11 168 genome sequence. BMC Genomics 8: 162. Guo, L., Lim, K.B., Poduje, C.M., Daniel, M., Gunn, J.S., Hackett, M., and Miller, S.I. (1998) Lipid A acylation and bacterial resistance against vertebrate antimicrobial peptides. Ce?! 95: 189-198. Hanel, I., Muller, J., Muller, W., and Schulze, F. (2004) Correlation between invasion of Caco-2 eukaryotic cells and colonization ability in the chick gut in Campylobacter jejuni. Vet Microbiol 101: 75-82.  67  Hannu, T., Kauppi, M., Tuomala, M., Laaksonen, I., Kiemets, P., and Kuusi, M. (2004) Reactive arthritis following an outbreak ofCampylobacterjejuni infection. JRheumatol 31: 528530. Heinrichs, D.E., Yethon, J.A., and Whitfield, C. (1998) Molecular basis for structural diversity in the core regions of the lipopolysaccharides of Escherichia coli and Salmonella enterica. Mol Microbiol 30: 22 1-232. Hendrixson, D.R., Akerley, B.J., and DiRita, V.J. (2001) Transposon mutagenesis of Campylobacter j ejuni identifies a bipartite energy taxis system required for motility. Mol Microbiol 40: 2 14-224. Hendrixson, D.R. (2008) Regulation of Flagellar Gene Expression and Assembly. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 545-55 8. Hickey, T.E., McVeigh, Al., Scott, D.A., Michielutti, R.E., Bixby, A., Carroll, S.A., Bourgeois, A.L., and Guerry, P. (2000) Campylobacter jejuni cytolethal distending toxin mediates release of interleukin-8 from intestinal epithelial cells. Infect Immun 68: 6535-6541. Hitchcock, P.J., and Brown, T.M. (1983) Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J Bacteriol 154: 269-277. Hofreuter, D., Tsai, J., Watson, R.O., Novik, V., Altman, B., Benitez, M., Clark, C., Perbost, C., Jarvie, T., Du, L., and Galan, J.E. (2006) Unique features of a highly pathogenic Campylobacterjejuni strain. Infect Immun 74: 4694-4707. Hu, L., Bray, M.D., Osorio, M., and Kopecko, D.J. (2006a) Campylobacter jejuni induces maturation and cytokine production in human dendritic cells. Infect Immun 74: 26972705. Hu, L., McDaniel, J.P., and Kopecko, D.J. (2006b) Signal transduction events involved in human epithelial cell invasion by Campylobacterjejuni 81-176. Microb Pathog 40: 91-100. Izano, E.A., Amarante, M.A., Kher, W.B., and Kaplan, J.B. (2008a) Differential roles of poly-N acetylgiucosamine surface polysaccharide and extracellular DNA in Staphylococcus aureus and Staphylococcus epidermidis biofilms. Appi Environ Microbiol 74: 470-476. Izano, E.A., Sadovskaya, I., Wang, H., Vinogradov, E., Ragunath, C., Ramasubbu, N., Jabbouri, S., Perry, M.B., and Kaplan, J.B. (2008b) Poly-N-acetylglucosamine mediates biofilm  68  formation and detergent resistance in Aggregatibacter actinomycetemcomitans. Microb Pathog44: 52-60. Jack, D.L., Dodds, A.W., Anwar, N., Ison, C.A., Law, A., Frosch, M., Turner, M.W., and Klein, N.J. (1998) Activation of complement by mannose-binding lectin on isogenic mutants of Neisseria meningitidis serogroup B. Jlmmunol 160: 1346-1353. Jacobs, B.C., van Belkum, A., and Endtz, H.P. (2008) Guillain-Barre Syndrome and Campylobacter Infection. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 245-26 1. Jacques, M. (1996) Role of lipo-oligosaccharides and lipopolysaccharides in bacterial adherence. Trends Microbiol 4: 408-409. Jeon, B., Itoh, K., Misawa, N., and Ryu, S. (2003) Effects of quorum sensing on flaA transcription and autoagglutination in Campylobacterjejuni. Microbiol Immunol 47: 833839. Jin, S., Joe, A., Lynett, J., Hani, E.K., Sherman, P., and Chan, V.L. (2001) J1pA, a novel surfaceexposed lipoprotein specific to Campylobacter jejuni, mediates adherence to host epithelial cells. Mo! Microbiol 39: 1225-1236. Jin, S., Song, Y.C., Emili, A., Sherman, P.M., and Chan, V.L. (2003) J1pA of Campylobacter jejuni interacts with surface-exposed heat shock protein 90alpha and triggers signalling pathways leading to the activation of NF-kappaB and p38 MAP kinase in epithelial cells. Cell Microbiol 5: 165-174. Jones, M.A., Marston, K.L., Woodall, C.A., Maskell, D.J., Linton, D., Karlyshev, A.V., Dorrell, N., Wren, B.W., and Barrow, P.A. (2004) Adaptation of Campylobacterjejuni NCTC11 168 to high-level colonization of the avian gastrointestinal tract. Infect Immun 72: 3769-3776. Joshua, G.W., Guthrie-Irons, C., Karlyshev, A.V., and Wren, B.W. (2006) Bioflim formation in Campylobacter j ejuni. Microbiology 152: 387-396. Kakuda, T., and DiRita, V.J. (2006) Cj 1496c encodes a Campylobacterjejuni glycoprotein that influences invasion of human epithelial cells and colonization of the chick gastrointestinal tract. Infect Immun 74: 47 15-4723. Kalmokoff, M., Lanthier, P., Tremblay, T.L., Foss, M., Lau, P.C., Sanders, G., Austin, J., Kelly, J., and Szymanski, C.M. (2006) Proteomic analysis of Campylobacter jejuni 11168  69  bioflims reveals a role for the motility complex in biofilm formation. JBacteriol 188: 4312-4320. Kanipes, M.I., Holder, L.C., Corcoran, A.T., Moran, A.P., and Guerry, P. (2004) A deep-rough mutant ofCampylobacterjejuni 81-176 is noninvasive for intestinal epithelial cells. Infect Immun 72: 2452-2455. Kanipes, M.I., Tan, X., Akelaitis, A., Li, J., Rockabrand, D., Guerry, P., and Monteiro, M.A. (2007) Genetic Analysis of Lipo-oligosaceharide Core Biosynthesis in Campylobacter jejuni 81-176. JBacteriol. Karlyshev, A.V., Everest, P., Linton, D., Cawthraw, S., Newell, D.G., and Wren, B.W. (2004) The Campylobacterjejuni general glycosylation system is important for attachment to human epithelial cells and in the colonization of chicks. Microbiology 150: 1957-1964. Karlyshev, A.V., Champion, O.L., Churcher, C., Brisson, J.R., Jarrell, H.C., Gilbert, M., Brochu, D., St Michael, F., Li, J., Wakarchuk, W.W., Goodhead, I., Sanders, M., Stevens, K., White, B., Parkhill, J., Wren, B.W., and Szymanski, C.M. (2005a) Analysis of Campylobacter jejuni capsular loci reveals multiple mechanisms for the generation of structural diversity and the ability to form complex heptoses. Mo! Microbiol 55: 90-103. Karlyshev, A.V., Ketley, J.M., and Wren, B.W. (2005b) The Campylobacter jejuni glycome. FEMS Microbiol Rev 29: 3 77-390. Karlyshev, A.V., and Wren, B.W. (2005) Development and application of an insertional system for gene delivery and expression in Campylobacterjejuni. Appi Environ Microbiol 71: 4004-40 13. Kelly, D.J. (2008) Complexity and Versatility in the Physiology and Metabolism of Campylobacterjejuni. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 41-61. Kiehlbauch, J.A., Albach, R.A., Baum, L.L., and Chang, K.P. (1985) Phagocytosis of Campylobacter jejuni and its intracellular survival in mononuclear phagocytes. Infect Immun 48: 446-45 1. Knirel, Y.A., Dentovskaya, S.V., Bystrova, O.V., Kocharova, N.A., Senchenkova, S.N., Shaikhutdinova, R.Z., Titareva, G.M., Bakhteeva, I.V., Lindner, B., Pier, G.B., and Anisimov, A.P. (2007) Relationship of the lipopolysaccharide structure of Yersinia pestis to resistance to antimicrobial factors. Adv Exp Med Rio! 603: 8 8-96.  70  Konkel, M.E., Garvis, S.G., Tipton, S.L., Anderson, D.E., Jr., and Cieplak, W., Jr. (1997) Identification and molecular cloning of a gene encoding a fibronectin-binding protein (CadF) from Campylobacterjejuni. Mol Microbiol 24: 953-963. Konkel, M.E., Kim, B.J., Rivera-Amill, V., and Garvis, S.G. (1999) Bacterial secreted proteins are required for the internaliztion of Campylobacter jejuni into cultured mammalian cells. Mol Microbiol 32: 691-701. Korlath, J.A., Osterholm, M.T., Judy, A., Forgang, J.C., and Robinson, R.A. (1985) A pointsource outbreak of campylobacteriosis associated with consumption of raw milk. Journal ofInfectious Diseases 152: 592-596. Krause-Gruszczynska, M., Rohde, M., Hartig, R., Genth, H., Schmidt, G., Keo, T., Konig, W., Miller, W.G., Konkel, M.E., and Backert, S. (2007) Role of the small Rho GTPases Raci and Cdc42 in host cell invasion ofCampylobacterjejuni. Cell Microbiol 9: 243 1-2444. Kropec, A., Maira-Litran, T., Jefferson, K.K., Grout, M, Cramton, S.E., Gotz, F., Goldmann, D.A., and Pier, G.B. (2005) Poly-N-acetylglucosamine production in Staphylococcus aureus is essential for virulence in murine models of systemic infection. Infect Immun 73: 6868-6876. Kurincic, M., Botteldoorn, N., Herman, L., and Smole Mozina, S. (2007) Mechanisms of erythromycin resistance of Campylobacter spp. isolated from food, animals and humans. IntJFoodMicrobiol 120: 186-190. Kwan, P.S., Birtles, A., Bolton, F.J., French, N.P., Robinson, S.E., Newbold, L.S., Upton, M., and Fox, A.J. (2008) Longitudinal study of the molecular epidemiology of Campylobacterjejuni in cattle on dairy farms. Appl Environ Microbiol 74: 3626-3633. Lambris, J.D., Ricklin, D., and Geisbrecht, B.V. (2008) Complement evasion by human pathogens. Nat Rev Microbiol 6: 132-142. Lara-Tejero, M., and Galan, J.E. (2001) CdtA, CdtB, and CdtC form a tripartite complex that is required for cytolethal distending toxin activity. Infect Immun 69: 4358-4365. Lara-Tejero, M., and Galan, J.E. (2002) Cytolethal distending toxin: limited damage as a strategy to modulate cellular functions. Trends Microbiol 10: 147-152. Larsen, J.C., Szymanski, C., and Guerry, P. (2004) N-linked protein glycosylation is required for full competence in Campylobacterjejuni 81-176. JBacteriol 186: 6508-65 14.  71  Lehtola, M.J., Pitkanen, T., Miebach, L., and Miettinen, I.T. (2006) Survival of Campylobacter jejuni in potable water bioflims: a comparative study with different detection methods. Water Sci Technol 54: 57-61. Leon-Kempis Mdel, R., Guccione, E., Muiholland, F., Williamson, M.P., and Kelly, D.J. (2006) The Campylobacterjejuni PEB1a adhesin is an aspartate/glutamate-binding protein of an ABC transporter essential for microaerobic growth on dicarboxylic amino acids. Mo! Microbiol 60: 1262-1275. Lin, J., Michel, L.O., and Zhang,  Q. (2002) CmeABC functions as a multidrug efflux system in  Campylobacterjejuni. Antimicrob Agents Chemother 46: 2124-2131. Lindsay, J.A. (1997) Chronic sequelae of foodborne disease. Emerg Infect Dis 3: 443-452. Loh, B., Grant, C., and Hancock, R.E. (1984) Use of the fluorescent probe 1-Nphenylnaphthylamine to study the interactions of aminoglycoside antibiotics with the outer membrane of Pseudomonas aeruginosa. Antimicrob Agents Chemother 26: 546-551. Loutet, S.A., Flannagan, R.S., Kooi, C., Sokol, P.A., and Valvano, M.A. (2006) A complete lipopolysaecharide inner core oligosaccharide is required for resistance of Burkholderia cenocepacia to antimicrobial peptides and bacterial survival in vivo. JBacteriol 188: 2073-2080. Louwen, R.P., van Belkum, A., Wagenaar, J.A., Doorduyn, Y., Achterberg, R., and Endtz, H.P. (2006) Lack of association between the presence of the pVir plasmid and bloody diarrhea in Campylobacterjejuni enteritis. JClin Microbiol 44: 1867-1868. Marshall, J.K., Thabane, M., Garg, A.X., Clark, W.F., Salvadori, M., and Collins, S.M. (2006) Incidence and epidemiology of irritable bowel syndrome after a large waterborne outbreak of bacterial dysentery. Gastroenterology 131: 445-450; quiz 660. McLennan, M.K., Ringoir, D.D., Frirdich, E., Svensson, S.L., Wells, D.H., Jarrell, H., Szymanski, C.M., and Gaynor, E.C. (2008) Campylobacterjejuni Biofilms Up-Regulated in the Absence of the Stringent Response Utilize a Calcofluor White-Reactive Polysaccharide. JBacteriol 190: 1097-1107. Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M., and Tauxe, R.V. (1999) Food-related illness and death in the United States. Emerg Infect Dis 5: 607-625.  72  Menard, R., Sansonetti, P.J., and Parsot, C. (1993) Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J Bacteriol 175: 5899-5906. Menozzi, F.D., Boucher, P.E., Riveau, G., Gantiez, C., and Locht, C. (1994) Surface-associated filamentous hemagglutinin induces autoagglutination of Bordetella pertussis. Infect Immun 62: 4261-4269. Misawa, N., and Blaser, M.J. (2000) Detection and characterization of autoagglutination activity by Campylobacterjejuni. Infect Immun 68: 6168-6175. Monteville, M.R., Yoon, J.E., and Konkel, M.E. (2003) Maximal adherence and invasion of INT 407 cells by Campylobacterjejuni requires the CadF outer-membrane protein and microfilament reorganization. Microbiology 149: 153-165. Moore, R.A., Bates, N.C., and Hancock, R.E. (1986) Interaction of polycationic antibiotics with Pseudomonas aeruginosa lipopolysaccharide and lipid A studied by using dansyl polymyxin. A ntimicrob Agents Chemother 29: 496-500. Moreau-Marquis, S., Stanton, B.A., and O’Toole, G.A. (2008) Pseudomonas aeruginosa bioflim foñnation in the cystic fibrosis airway. Puim Pharmacol Ther. Muller, J., Meyer, B., Hanel, I., and Hotzel, H. (2007) Comparison of lipooligosaccharide biosynthesis genes of Campylobacter jejuni strains with varying abilities to colonize the chicken gut and to invade Caco-2 cells. JMedMicrobiol 56: 1589-1594. Murphy, C., Carroll, C., and Jordan, K.N. (2006) Environmental survival mechanisms of the foodborne pathogen Campylobacterjejuni. JAppi Miçrobiol 100: 623-632. Murray, S.R., Ernst, R.K., Bermudes, D., Miller, S.I., and Low, K.B. (2007) pmrA(Con) confers pmrHFIJKL-dependent EGTA and polymyxin resistance on msbB Salmonella by decorating lipid A with phosphoethanolamine. J Bacteriol 189: 5161-5169. Nachamkin, I., Allos, B.M., and Ho, T. (1998) Campylobacter species and Guillain-Barre syndrome. Clin Microbiol Rev 11: 555-567. Nadell, C.D., Xavier, J.B., Levin, S.A., and Foster, K.R. (2008) The evolution of quorum sensing in bacterial biofilms. PLoS Biol 6: e14. Naikare, H., Palyada, K., Panciera, R., Marlow, D., and Stintzi, A. (2006) Major role for FeoB in Campylobacter jejuni ferrous iron acquisition, gut colonization, and intracellular survival. Infect Immun 74: 5433-5444.  73  Nuijten, P.J., van Asten, F.J., Gaastra, W., and van der Zeijst, B.A. (1990) Structural and functional analysis of two Campylobacterjejuni flagellin genes. JBiol Chem 265: 1779817804. O’Gara, J.P. (2007) ica and beyond: bioflim mechanisms and regulation in Staphylococcus epidermidis and Staphylococcus aureus. FEMSMicrobiol Lett 270: 179-188. O’Toole, G., Kaplan, H.B., and Kolter, R. (2000) Biofilm formation as microbial development. Annu Rev Microbiol 54: 49-79. O’Toole, G.A., and Kolter, R. (1998) Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol 28: 449-461. Oelschlaeger, T.A., Guerry, P., and Kopecko, D.J. (1993) Unusual microtubule-dependent endocytosis mechanisms triggered by Carnpylobacterjejuni and Citrobacter freundii. Proc NatlAcad Sci USA 90: 6884-6888. Oldfield, N.J., Moran, A.P., Millar, L.A., Prendergast, M.M., and Ketley, J.M. (2002) Characterization of the Campylobacter jejuni heptosyltransferase II gene, waaF, provides genetic evidence that extracellular polysaccharide is lipid A core independent. J Bacteriol 184: 2100-2107. Olson, C.K., Ethelberg, S., van Pelt, W., and Tauxe, R.V. (2008) Epidemiology of Campylobacterjejuni Infections in Industrialized Nations. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 163-189. Pajaniappan, M., Hall, J.E., Cawthraw, S.A., Newell, D.G., Gaynor, E.C., Fields, J.A., Rathbun, K.M., Agee, W.A., Burns, C.M., Hall, S.J., Kelly, D.J., and Thompson, S.A. (2008) A temperature-regulated Campylobacter jejuni gluconate dehydrogenase is involved in respiration-dependent energy conservation and chicken colonization. Mol Microbiol 68: 474-491. Paju, S., and Scannapieco, F.A. (2007) Oral biofilms, periodontitis, and pulmonary infections. Oral Dis 13: 508-512. Palyada, K., Threadgill, D., and Stintzi, A. (2004) Iron acquisition and regulation in Campylobacter j ejuni. J Bacteriol 186: 4714-4729.  74  Park, C.B., Kim, H.S., and Kim, S.C. (1998) Mechanism of action of the antimicrobial peptide buforin II: buforin II kills microorganisms by penetrating the cell membrane and inhibiting cellular functions. Biochem Biophys Res Commun 244: 253-257. Parker, C.T., Kloser, A.W., Schnaitman, C.A., Stein, M.A., Gottesman, S., and Gibson, B.W. (1992) Role of the rfaG and rfaP genes in determining the lipopolysaccharide core structure and cell surface properties of Escherichia coli K-12. JBacteriol 174: 25252538. Parkhill, J., Wren, B.W., Mungall, K., Ketley, J.M., Churcher, C., Basham, D., Chillingworth, T., Davies, R.M., Feitwell, T., Hoiroyd, S., Jagels, K., Karlyshev, A.V., Moule, S., Pallen, M.J., Penn, C.W., Quail, M.A., Rajandream, M.A., Rutherford, K.M., van Vliet, A.H., Whitehead, S., and Barrell, B.G. (2000) The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403: 665-668. Payot, S., Bolla, J.M., Corcoran, D., Fanning, S., Megraud, F., and Zhang,  Q. (2006)  Mechanisms of fluoroquinolone and macrolide resistance in Campylobacter spp. Microbes Infect 8: 1967-1971. Pei, Z., Burucoa, C., Grignon, B., Baqar, S., Huang, X.Z., Kopecko, D.J., Bourgeois, A.L., Fauchere, J.L., and Blaser, M.J. (1998) Mutation in the peblA locus of Campylobacter jejuni reduces interactions with epithelial cells and intestinal colonization of mice. Infect Immun 66: 93 8-943. Peng, D., Ru, W.G., Choudhury, B.P., Muszynski, A., Carlson, R.W., and Gu, X.X. (2007) Role of different moieties from the lipooligosaccharide molecule in biological activities of the Moraxella catarrhalis outer membrane. Febs J274: 53 50-5359. Perera, V.N., Nachamkin, I., Ung, H., Patterson, J.H., McConville, M.J., Coloe, P.J., and Fry, B.N. (2007) Molecular mimicry in Campylobacterjejuni: role of the lipo-oligosaccharide core oligosaccharide in inducing anti-ganglioside antibodies. FEMS Immunol Med Microbiol 50: 27-36. Plant, L., Sundqvist, J., Zughaier, S., Lovkvist, L., Stephens, D.S., and Jonsson, A.B. (2006) Lipooligosaccharide structure contributes to multiple steps in the virulence of Neisseria meningitidis. Infect Immun 74: 1360-1367. Poehlsgaard, J., and Douthwaite, S. (2005) The bacterial ribosome as a target for antibiotics. Nat Rev Microbiol 3: 870-88 1.  75  Poly, F., Ewing, C., Goon, S., Hickey, T.E., Rockabrand, D., Majam, G., Lee, L., Phan, J., Savarino, N.J., and Guerry, P. (2007a) Heterogeneity of a Campylobacter jejuni protein that is secreted through the flagellar filament. Infect Immun 75: 3859-3 867. Poly, F., Read, T., Tribble, D.R., Baqar, S., Lorenzo, M., and Guerry, P. (2007b) Genome sequence of a clinical isolate of Campylobacterjejuni from Thailand. Infect Immun 75: 3425-3433. Poly, F., and Guerry, P. (2008) Pathogenesis of Campylobacter. Curr Opin Gastroenterol 24: 2731. Pope, J.E., Krizova, A., Garg, A.X., Thiessen-Philbrook, H., and Ouimet, J.M. (2007) Campylobacter reactive arthritis: a systematic review. Semin Arthritis Rheum 37: 48-55. Preston, A., Mandrell, R.E., Gibson, B.W., and Apicella, M.A. (1996) The lipooligosaccharides of pathogenic gram-negative bacteria. Crit Rev Microbiol 22: 139-180. Pruss, B.M., Besemann, C., Denton, A., and Wolfe, A.J. (2006) A complex transcription network controls the early stages of bioflim development by Escherichia coli. JBacteriol 188: 373 1-3739. PublicHealthAgencyOfCanada (2003) Human Campylobacter Cases. In Canada Communicable Disease Report. Vol. 2008. Reeser, R.J., Medler, R.T., Billington, S.J., Jost, B.H., and Joens, L.A. (2007) Characterization of Campylobacter jejuni bioflims under defined growth conditions. Appi Environ Microbiol 73: 1908-1913. Ren, H., Dover, L.G., Islam, S.T., Alexander, D.C., Chen, J.M., Besra, G.S., and Liu, J. (2007) Identification of the lipooligosaccharide biosynthetic gene cluster from Mycobacterium marinum. Mol Microbiol 63: 1345-1359. Rhodes, D.Y., and Wallace, M. (2006) Post-infectious irritable bowel syndrome. Curr Gastroenterol Rep 8: 327-332. Rice, K.C., Mann, E.E., Endres, J.L., Weiss, E.C., Cassat, J.E., Smeltzer, M.S., and Bayles, K.W. (2007) The cidA murein hydrolase regulator contributes to DNA release and biofllm development in Staphylococcus aureus. Proc Nati Acad Sci US A 104: 8113-8118. Ridley, K.A., Rock, J.D., Li, Y., and Ketley, J.M. (2006) Heme utilization in Campylobacter jejuni. JBacteriol 188: 7862-7875.  76  Russell, R.G., and Blake, D.C., Jr. (1994) Cell association and invasion of Caco-2 cells by Campylobacter jejuni. Infect Immun 62: 3773-3779. Salama, N.R., Shepherd, B., and Falkow, S. (2004) Global transposon mutagenesis and essential gene analysis of Helicobacter pylon. JBacteriol 186: 7926-7935. Schmidt-Ott, R., Schmidt, H., Feldmann, S., Brass, F., Krone, B., and Gross, U. (2006) Improved serological diagnosis stresses the major role of Campylobacter jejuni in triggering Guillain-Barre syndrome. Clin Vaccine Immunol 13: 779-783. Sieprawska-Lupa, M., Mydel, P., Krawczyk, K., Wojcik, K., Puklo, M., Lupa, B., Suder, P., Silberring, J., Reed, M., Pohl, J., Shafer, W., McAleese, F., Foster, T., Travis, J., and Potempa, J. (2004) Degradation of human antimicrobial peptide LL-37 by Staphylococcus aureus-derived proteinases. Antimicrob Agents Chemother 48: 46734679. Skurnik, M., Venho, R., Bengoechea, J.A., and Moriyon, I. (1999) The lipopolysaccharide outer core of Yersinia enterocolitica serotype 0:3 is required for virulence and plays a role in outer membrane integrity. Mo! Microbiol 31: 1443-1462. Snelling, W.J., Stern, N.J., Lowery, C.J., Moore, J.E., Gibbons, E., Baker, C., and Dooley, J.S. (2008) Colonization of broilers by Campylobacter j ejuni internalized within Acanthamoeba castellanii. Arch Microbio! 189: 175-179. Spiller, R.C. (2007) Role of infection in irritable bowel syndrome. J Gastroentero! 42 Suppi 17: 41-47. St Michael, F., Szymanski, C.M., Li, J., Chan, K.H., Khieu, N.H., Larocque, S., Wakarchuk, W.W., Brisson, J.R., and Monteiro, M.A. (2002) The structures of the lipooligosaccharide and capsule polysaccharide of Campylobacterjejuni genome sequenced strain NCTC 11168. Eur JBiochem 269: 5119-5136. Stanley, K., and Jones, K. (2003) Cattle and sheep farms as reservoirs of Campylobacter. JApp! Microbiol 94 Suppi: 104S-113S. Stintzi, A., van Vliet, A.H., and Ketley, J.M. (2008) Iron Metabolism, Transport, and Regulation. In Campylobacter. Nachamkin, I., Szymanski, C. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 591-610. Szymanski, C.M., Yao, R., Ewing, C.P., Trust, T.J., and Guerry, P. (1999) Evidence for a system of general protein glycosylation in Campylobacterjejuni. Mo! Microbio! 32: 1022-1030.  77  Szymanski, C.M., Burr, D.H., and Guerry, P. (2002) Campylobacter protein glycosylation affects host cell interactions. Infect Immun 70: 2242-2244. Szymanski, C.M., Michael, F.S., Jarrell, H.C., Li, J., Gilbert, M., Larocque, S., Vinogradov, E., and Brisson, J.R. (2003) Detection of conserved N-linked glycans and phase-variable lipooligosaccharides and capsules from campylobacter cells by mass spectrometry and high resolution magic angle spinning NMR spectroscopy. JBiol Chem 278: 2450924520. Takeda, K., and Akira, S. (2005) Toll-like receptors in innate immunity.  mt Immunol 17:  1-14.  Thibault, P., Logan, S.M., Kelly, J.F., Brisson, J.R., Ewing, C.P., Trust, T.J., and Guerry, P. (2001) Identification of the carbohydrate moieties and glycosylation motifs in Campylobacter j ejuni flagellin. J Biol Chem 276: 34862-34870. Thornley, J.P., Jenkins, D., Neal, K., Wright, T., Brough, J., and Spiller, R.C. (2001) Relationship of Campylobacter toxigenicity in vitro to the development of postinfectious irritable bowel syndrome. Jlnfect Dis 184: 606-609. Tracz, D.M., Keelan, M., Ahmed-Bentley, J., Gibreel, A., Kowalewska-Grochowska, K., and Taylor, D.E. (2005) pVir and bloody diarrhea in Campylobacter jejuni enteritis. Emerg Infect Dis 11: 838-843. Tsai, C.M., and Frasch, C.E. (1982) A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal Biochem 119: 115-119. Watson, R.O., and Galan, J.E. (2005) Signal transduction in Campylobacterjejuni-induced cytokine production. Cell Microbiol 7: 65 5-665. Watson, R.O., and Galan, J.E. (2008) Campylobacterjejuni survives within epithelial cells by avoiding delivery to lysosomes. PLoS Pathog 4: e14. Werts, C., Girardin, S.E., and Philpott, D.J. (2006) TIR, CARD and PYRIN: three domains for an antimicrobial triad. Cell Death Differ 13: 798-8 15. Wiesner, R.S., Hendrixson, D.R., and DiRita, V.J. (2003) Natural transformation of Campylobacterjejuni requires components of a type II secretion system. J Bacteriol 185: 5408-5418. Wood, P.J. (1980) Specificity in the interaction of direct dyes with polysaccharides. Carbohydrate Research 85: 271-287.  78  Wooldridge, K.G., Williams, P.11., and Ketley, J.M. (1996) Host signal transduction and endocytosis of Campylobacter jejuni. Microb Pathog 21: 299-305. Wu, H., Zeng, M., and Fives-Taylor, P. (2007) The glycan moieties and the N-terminal polypeptide backbone of a fimbria-associated adhesin, Fap 1, play distinct roles in the bioflim development of Streptococcus parasanguinis. Infect Immun 75: 2181-2188. Yethon, J.A., Gunn, J.S., Ernst, R.K., Miller, S.I., Laroche, L., Malo, D., and Whitfield, C. (2000) Salmonella enterica serovar typhimurium waaP mutants show increased susceptibility to polymyxin and loss of virulence In vivo. Infect Immun 68: 4485-4491. Young, K.T., Davis, L.M., and Dirita, V.J. (2007) Campylobacterjejuni: molecular biology and pathogenesis. Nat Rev Microbiol 5: 665-679. Young, N.M., Brisson, J.R., Kelly, J., Watson, D.C., Tessier, L., Lanthier, P.11., Jarrell, H.C., Cadotte, N., St Michael, F., Aberg, E., and Szymanski, C.M. (2002) Structure of the Nlinked glycan present on multiple glycoproteins in the Gram-negative bacterium, Campylobacter j ejuni. J Biol Chem 277: 42530-42539. Yuki, N. (2007) Campylobacter sialyltransferase gene polymorphism directs clinical features of Guillain-Barre syndrome. JNeurochem 103 Suppl 1: 150-158. Zarantonelli, M.L., Huerre, M., Taha, M.K., and Alonso, J.M. (2006) Differential role of lipooligosaccharide of Neisseria meningitidis in virulence and inflammatory response during respiratory infection in mice. Infect Immun 74: 5506-5512. Zavascki, A.P., Goldani, L.Z., Li, J., and Nation, R.L. (2007) Polymyxin B for the treatment of multidrug-resistant pathogens: a critical review. JAntimicrob Chemother 60: 1206-1215. Zhang,  Q., and Plummer, P.J. (2008) Mechanisms of Antibiotic Resistance in Campylobacter. In Campylobacter. Nachamkin, I., Szymanski, C.M. and Blaser, M.J. (eds). Washington, DC: ASM Press, pp. 263-276.  Zilbauer,M., Dorrell, N., Elmi, A., Lindley, K.J., Schuller, S., Jones, H.E., Klein, N.J., Nunez, G., Wren, B.W., and Bajaj-Elliott, M. (2007) A major role for intestinal epithelial nucleotide oligomerization domain 1 (NOD 1) in eliciting host bactericidal immune responses to Campylobacterjejuni. Cell Microbiol 9: 2404-2416. Ziprin, R.L., Young, C.R., Stanker, L.H., Hume, M.E., and Konkel, M.E. (1999) The absence of cecal colonization of chicks by a mutant of Campylobacterjejuni not expressing bacterial fibronectin-binding protein. Avian Dis 43: 5 86-589.  79  Random PCR Random PCR Random PCR  Bright  Bright Bright Bright  Bright Bright Bright  picard (CAM)  picard (CAM)  (CAM)  picard  picard (CAM)  solo (kan)  solo (kan)  solo (kan) solo (kan)  BRT13  BRT23  BRT28  BRT39  BRT1s  BRT2s  BRT3s  00  BRT4s  Random PCR  Bright  (CAM)  picard  BRT8  Random PCR  -  —  no no  yes waaF/waa V intergenic no  no  yes lgtF  no  Random PCR Random PCR  no  no  no no no  no no  no  no  Exact Tn Insertion Mapped  Random PCR  Random PCR  Bright  (CAM)  picard  BRT7  Random PCR Random PCR Random PCR  Bright Bright Bright  picard (CAM)  picard (CAM)  BRT6  Random PCR Random PCR  Random PCR  Random PCR  Mapping Method  BRT5  Bright Bright  BRT3  picard (CAM) (CAM)  Bright  picard (CAM)  BRT2  picard  Bright  picard (CAM)  BRT1  BRT4  CFW Phenotype  Tn Inserted  Tn Mutant Designation  pVir-0002; pVir-0003 1245  pTet-00 17; pTet-00 18  I 163  CJJ8 1176-1033; CJJ8 1176-1034  CJJ8 1176-1 151; CJJ8 1 176-1 152  pTet-000 1; pTet-0002; pTet0003; CJJ81 176-1160; CJJ81 176-1161  CJJ81 176-1355 CJJ8 1176-1358 CJJ8 1176-0805; CJJ8 1176-0804; CJJ8 1176-0803 CJJ81 176-1111; CJJ81 176-1112; CJJ8 1 1 76 1 1 13  CJJ8 1176-1432 CJJ8 1176-1160 and CJJ8 11761 161  CJJ8 1176-0119; cytochrome d ubiguinol oxidase, subunit II CJJ8 1176-1 160  BLAST Result  Appendix A. Transposon mapping of CFW-hyperfluorescent C. jejuni 8 1-176 transposon mutants.  —  TOPRIM nucleotidyltransferase/hydrolase virB9; trBI Sodium/hydrogen exchanger family protein.  f31 ,4-N-acetyLgalactosaminykransferase glycosyltransferase f1 ,4-N-acetylgalactosaminyltransferase; N-acylneuraminate cytidylyltransferase MGC82361 protein putative integral membrane protein napL; napB; ferredoxin-type protein napH protein-export membrane protein secD; preprotein translocase yajC subunit; apolipoprotein N-acetyltransferase pTet repA; conserved domain protein; cpp7 31,4-N-acetylgalactosaminyltransferase; N-acylneuraminate cytidylyltransferase lipid A biosynthesis acyltransferase; glycosyLtransferase high affmity branched-chain amino acid ABC transporter, ATP-binding protein. waaV  cydB  81-176 Gene/Function Identified via Sequence Analysis of Random PCR Products  picard (CAM) picard (CAM) picard (CAM) picard (CAM) picard (CAM) picard (CAM)  DIM4  QO  D1M23  DIM17  DIM14  DIM1O  DIM7  Tn Inserted  Tn Mutant Designation  Random PCR Random PCR  Dim Dim  Random PCR  Dim Random PCR  Random PCR  Dim  Dim  Random PCR  Mapping Method  Dim  CFW Phenotype  no  no  no  no  no  Exact Tn Insertion Mapped no  CJJ8 1176-0072; CJJ8 1 176-007 1  CJJ81 176-1343; CJJ81 176-1344  CJJ81 176-pVirOO53  CJJ81 176-1343; CJJ81 176-1344  CJJ81 176-1606; CJJ81 176-1607  CJJ81 176-1343; CJJ81 176-1344  BLAST Result  Appendix B. Transposon mapping of CFW-hypofluorescent C. jejuni 81-176 transposon mutants.  sialoglycoprotease; conserved hypothetical protein uncharacterized conserved protein; putative integral membrane protein  sialoglycoprotease; conserved hypothetical protein aipha-ketoglutarate permease; A/G specific adenine glycosylase sialoglycoprotease; conserved hypothetical protein virB4  81-176 Gene/Function Identified  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items