Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Atypical roles for campylobacter jejuni AA-ABC transporter components PAQP and PAQQ in bacterial stress.. 2008

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata


ubc_2008_fall_lin_ann_en-ju.pdf [ 1.92MB ]
JSON: 1.0066912.json
JSON-LD: 1.0066912+ld.json
RDF/XML (Pretty): 1.0066912.xml
RDF/JSON: 1.0066912+rdf.json
Turtle: 1.0066912+rdf-turtle.txt
N-Triples: 1.0066912+rdf-ntriples.txt

Full Text

ATYPICAL ROLES FOR CAMPYLOBACTER JEJUNIAA-ABC TRANSPORTER COMPONENTS PAQP AND PAQQ IN BACTERIAL STRESS TOLERANCE AND PATHOGEN-HOST CELL DYNAMICS by Ann En-Ju Lin B.Sc. Honours, The University of British Columbia, 2006 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies (Microbiology and Immunology) THE UNIVERSITY OF BRITISH COLUMBIA (VANCOUVER) AUGUST, 2008 © Ann En-Ju Lin, 2008 ABSTRACT Campylobacterjejuni is a human pathogen that causes severe diarrhea! disease. However, our understanding of C. jejuni virulence mechanisms and survival during disease and transmission remains limited. Amino acid ATP Binding Cassette (AA-ABC) transporters in C. jejuni have been proposed as being important for bacterial physiology and pathogenesis. We have investigated a novel AA-ABC transporter system, encoded by cj0467-9, by generating targeted deletions of cj0467 (membrane transport component) and cj0469 (ATPase component) in C. jejuni 81-176. Analyses described herein have led us to designate these genes paqP and paqQ, respectively [pathogenesis-ssociated glutamine (q) ABC transporter permease () and ATPase (Q)]. We found that loss of either component resulted in amino acid uptake defects, most notably diminished glutamine uptake. Both zXpaqP and ApaqQ mutants also exhibited a surprising but significant increase in short-term intracellular survival in macrophages and epithelial cells. Levels of resistance to a series of environmental and in vivo stresses were examined. Both mutants were hyper-resistant to aerobic and oxidative stress, and while ApaqP was also hyper-resistant to heat and osmotic shock, ApaqQ was more susceptible than wild-type to the latter two stresses. Annexin-V staining coupled with fluorescence microscopy revealed that macrophages infected with the ApaqP and ZipaqQ mutants underwent a lower level of apoptosis than cells infected with wild-type bacteria. Macrophages infected with the mutant strains exhibited a transient decrease in ERK activation compared to wild type-infected macrophages, potentially explaining the reduced apoptosis phenotype. The ApaqP mutant did not exhibit a defect for short or longer term mouse colonization, consistent with its increased stress survival and diminished host cell damage phenotypes. Collectively, these results demonstrate a unique correlation between an AA-ABC transporter with bacterial stress tolerance, intracellular survival, host cell damage, and host signal transduction in response to pathogen infection. 11 TABLE OF CONTENTS Title Page i Abstract ii Table of Contents iii List of Tables vi List of Figures vii Abbreviations viii Acknowledgements ix DEDICATION X 1.0 INTRODUCTION 1 1.1 Campylobacterfejuni- History and epidemiology 2 1.2 Campylobacteriosis 3 1.2.1 Symptoms 3 1.2.2 Medical sequelae 3 1.2.3 Treatment 4 1.3 Morphology and characteristics 4 1.4 Metabolism 5 1.4.1 Amino acid metabolism in C. jejuni 5 1.4.2 Glutamine metabolism and pathogenesis 6 1.4.3 Glutamine contributes to host cell survival 7 1.5 ATP Binding Cassette (ABC) transporters 7 1.5.1 AA-ABC tranposrter structures 7 1.5.2 ABC transporter functions 11 1.5.3 AA-ABC transporters serve as pathogenesis determinants in C. jejuni 12 1.5.4 AA-ABC transporters serve as pathogenesis determinant in other pathogens ... 12 1.6 Physiology and stress response 13 1.6.1 Heatstress 13 1.6.2 Aerobic stress 14 1.6.3 Oxidative (reactive oxygen species) stress 14 1.6.4 Osmotic stress 15 1.7 Host-pathogen interaction 16 1.7.1 Host epithelial cell colonization and invasion 16 1.7.2 Toxin. 18 1.7.3 Apoptosis 18 1.8 Host cell signaling 19 1.8.1 MAPK signaling pathway 19 1.8.2 MAPK dependent signaling activation in C. jejuni infected cells 19 1.8.3 Inflammatory response 20 1.9 Objective and hypothesis 21 2.0 MATERIALS AND METHODS 22 2.1 Bacterial strains, cell lines, media and growth conditions 23 2.2 Construction of Campylobacterjejuni 8 1-176 /paqP and ApaqQ targeted deletion mutants 23 2.3 Complementation of ApaqP deletion mutant 24 2.4 RNA extraction and reverse transcript- PCR (RT-PCR) analysis 25 2.5 Southern blot hybridization 25 2.6 Amino acid transport assays 26 2.7 Cell infection assay for colonization, invasion, intracellular survival and gentamicin MIC determination 27 2.8 In vivo colonization using a mouse model 28 2.9 Oxidative, aerotolerance, heat stress and osmotic stress survival assays 28 2.10 Cellular apoptosis and viability detection 29 2.11 Cell lysate preparation and Western blotting 29 2.12 Additional phenotypic assays 30 3.0 RESULTS 34 3.1 Overview 35 3.2 cj0467-9 encodes a putative amino acid (AA) ABC transporter 36 3.3 Construction of targeted, non-polar cj0467 and cj0469 disruption strains 37 3.4 The ApaqP and ApaqQ C. jejuni mutants are defective for L-glutamine 39 uptake and moderately defective for uptake of other amino acids iv 3.5 C. jejuni zSpaqP and ApaqQ increase short-term intracellular survival in 41 R.AW264.7 macrophage, 1NT407 epithelial cells and Caco-2 intestinal epithelial cells. 3.6 No significant difference between the ApaqP mutant and WT C. jejuni 44 colonization are observed in vivo using a mouse infection model. 3.7 ApaqP and ApaqQ C. jejuni mutants exhibit increase resistance to limited 46 C02, aerobic conditions. 3.8 ApaqP and ApaqQ C. jejuni mutants exhibit an increase in resistance to organic hydroperoxide t-BOOH, but not inorganic peroxides H20 and paraquat 48 3.9 Tolerance to heat and osmotic stress is differentially altered with A paqP and ApaqQ 50 3.10 Macrophages infected with C. jejuni ApaqP and ApaqQ exhibit reduced apoptosis and ERK activation compared to macrophages infected with WT bacteria 52 3.11 A summary of phenotypes for which iXpaqP and ApaqQ mutants were not significantly different from the wild-type strain 57 3.12 WT C. jejuni and mutants exhibit similar tolerance to heat shock and pH stresses 61 4.0 DISCUSSION AND CONCLUSIONS 65 5.0 FUTURE DIRECTIONS 74 REFERENCES 78 V LIST OF TABLES Table 3.1 Phenotypes that were indistinguishable between ApaqP, z.paqQ mutants andWT C. jejuni 81-176 58 Table 3.2 Antimicrobial susceptibility test 60 vi LIST OF FIGURES Figure 1.1 Schematic diagram of a bacterial ABC transporter 10 Figure 3.1 Generation of non-polar, single insert 4aqP and 4aqQ disruption strains .... 38 Figure 3.2 4aqP and 4aqQ mutants exhibit reduced levels of glutamine 40 and glutamate uptake relative to WT. Figure 3.3 4aqP and 4aqQ mutants exhibit a statistically significant increase in 42 short-term intracellular survival in macrophages and epithelial cells Figure 3.4 ApaqP is not defective for mouse colonization in vivo 45 Figure 3.5 4aqP and paqQ are more resistant to aerobic stresses than WT 47 Figure 3.6 zpaqP mutant exhibits a significant increase in resistance to tert-butyl hydroperoxide (t-BOOH) but not to hydrogen peroxide (H20)or paraquat .... 49 Figure 3.7 The 4aqP mutant is more resistant to heat and osmotic stress while the IXpaqQ mutant is more sensitive than WT 51 Figure 3.8 4aqP and 4aqQ infected cells showed decreased levels of apoptosis and ERK activation compared to WT infected cells 54 Figure 3.9 4aqP and 4paqQ infected Caco-2 and 1NT407 epithelial cells showed similar ERK and INK activities as WT infected cells 56 Figure 3.10 4paqP and I.paqQ mutants survive similarly to WT C. jejuni in rich or minimal media 59 Figure 3.11 4aqP and 4aqQ mutants exhibit similar survival as the WT strain under anaerobic conditions over time 60 Figure 3.12 4aqP and 4paqQ mutants do not exhibit a motility defect in 0.4% agar 62 Figure 3.13 Rate of GGT activity in I.paqP and 4paqQ mutants does not significantly deviate from WT C:jejuni 62 Figure 3.14 zSpaqP and i.paqQ mutants exhibit similar protein secretion profile as WT C. jejuni 63 Figure 3.15 4aqP and i.aqQ mutants and WT C. jejuni survive similarly in minimal essential media supplemented with L-glutamine 64 vii ABBREVIATIONS ApaqP C. jejuni pathogenesis associated glutamine trans5orter permease mutant ApaqPc C. jejuni pathogenesis associated glutamine transporter permease complement ApaqQ C.jejuni pathogenesis associated glutamine transporter ATPase mutant z\spoT C. jejuni spoT mutant AA amino acid ABC ATP Binding Cassette Amp ampicillin ATP adenosine 5’-triphosphate bp base pair BSA Bovine serum albumin CAT chioramphenicol acetyl transferase CDT Cytolethal Distending Toxin C. jejuni Campylobacterjejuni CFUs colony forming units Cm chioramphenicol CV crystal violet DAPI 4’ ,6-Diamidino-2-phenylindole DMEM Dulbecco modified Eagle Media DNA deoxyribonucleic acid dH2O distilled water ECL enhanced chemiluminescence E. coli Escherichia coli EDTA Ethylene diamine tetraacetic acid ERK Extracellular signal-regulated kinase GBS Guillain-Barré syndrome GGT gamma glutamyl transferase gln L-glutamine GPCR G-protein coupled receptor H pylon Helicobacter pylon HRP Horseradish peroxide IL interleukin 1NT407 human intestinal 407 Jnk c-Jun NH2-terminal kinase Kan kanamycin kDa kilodalton LB Luria-Bertani LOS Lipo-oligosaccharide LPS Lipo-oligosaccharide MAPK Mitogen activated protein kinase MEM Minimal Essential Media MH Muller Hinton MIC Minimum Inhibitory Concentration MOl multiplicity of infection NEAA non-essential amino acid NF-icB Nuclear factor kappa B OD600 Optical density at 600nm PBS phosphate buffered saline viii r.,p.m. revolutions per minute RTK Receptor Tyrosine kinase SDS-PAGE Sodium Dodecyl Sulphate Polyacrylamide Gel t-BOOH tert-butyl hydroperoxide TBST Tris-Buffered Saline Tween-20 TCA tricholoracetic acid TLR toll-like receptor UI uninfected WI wild-type ix ACKNOWLEDGEMENTS I offer my enduring gratitude and sincere thanks to my supervisor, Dr. Erin Gaynor, for her constant encouragement and support. Her positive and cheerful attitude as well as helpful guidance throughout my studies have allowed me to work productively yet pleasantly in the lab during the past two years. I very much appreciate her incredible enthusiasm and patience in offering direction and insights at each stage of my project. This has truly been a wonderful learning experience for me. I would also like to thank members of the Cvitkovitch lab from the University of Toronto for their kindness and hospitality during the 2 weeks when I was in Toronto performing the amino acid transport assay experiment. I am especially grateful to Kirsten Krastel and Dr. Dennis Cvitkovitch, not only for their extreme enthusiasm and hospitality, but also for helping me with the assays and data interpretations. I also thank Rhonda Hobb and Dr. Stuart Thompson from the Medical College of Georgia for performing the in vivo mouse infections. I thank Dr. Michael Gold from our department for kindly providing the MAPK antibodies. Sincere thanks to my thesis committee members, Dr. Bruce Vallance and Dr. Bill Mohn. A huge thank you to each and everyone in the Gaynor lab, past and present, for creating a positive, energetic and entertaining work environment, which made everyday at the lab fun and enjoyable. Particularly, I would like to thank Mizue Naito, my partner in fighting off the world of diarrheal diseases, for being a great friend in and out of the lab. I also thank Dr. Emilisa Frirdich, who I always share a good laugh with discussing various kinds of issues, lab related or not. Grad school has never been dull for a day with their presence. I have to offer my deepest thanks to my family, particularly my mom and dad, as well as my friends, for their continuous support. Especially, I have to thank Dr. Mm Liu, for being a great listener, and being like a sister anyone would only dream to have. Her compassion, wisdom advice and constant encouragement have helped me tremendously through the past few years of my life. I would also like to thank Karen Chang, Karen To and Mila Chou, my dearest and loyal friends, for being supportive since our undergraduate and high school years; I would not have made it through without them. Finally, I would like to thank the Canadian Institutes of Health Research (CIHR) and Michael Smith Foundation for Health Research (MSFHR) for funding my research stipend, as well as CIHR, the MSFHR, and the Burroughs Welicome Fund for supporting my research activities. x DEDICATION ¶Th my unck creng - my inspirer in science, wño is no longer wit/i us. xi 1.0 INTRODUCTION 1 1.1 CAMPYLOBACTER JEJUNI- HISTORY AND EPIDEMIOLOGY Campyiobacterjejuni is a highly prevalent bacterial pathogen that causes human gastroenteritis (Young et al., 2007). Campylobacter spp. were first observed in 1886 by Escherich in the colons of neonates. However, it was not until 1968 that Dekeyser, Buzier and colleagues first isolated Campylobacter spp. from the feces of a human diarrheic patient (Butzler, 2004) . By the mid- 1 970s, Campylobacter spp. were recognized as important human pathogens. Currently, Campylobacter spp. are ranked as the most common bacterial cause of diarrheal illnesses in developed countries (Blaser, 1997). With an estimated 400 million cases per year worldwide (Girard et al., 2006), Campylobacter spp. affect more individuals than E. coil 0157, Saimoneiia spp, and Shigelia spp. combined (Blaser et ai., 1983). For instance, of the population in North America and Western Europe are infected each year, with approximately 3 million people infected in the United States alone (Mead et al., 1999). The genus Campylobacter contains 17 species, including C. hyointestinaiis, C. ianienae, C. sputorum, C. mucosalis, C. concisus, C. curvus, C. rectus, C. gracilis, C. showae, C. hominis, C. lan, C. insuiaenigrae, C. canadensis, C. upsaliensis, C. heiveticus, C. coli, and C. jejuni (Debruyne et al., 2008). Although several of these cause diarrheal disease, Campyiobacterjejuni is estimated to account for 90% of reported cases of diarrheal campylobacteriosis (Mead et ai., 1999). C. jejuni is a zoonotic organism that exists as a commensal in chickens and other avian species (Beery et al., 1988); hence, infection of chickens with C. jejuni typically does not lead to diarrhea. This commensal relationship is thought to account for the fact that the main source of human C. jejuni infection is via consumption of contaminated poultry or cross-contamination of other food with raw poultry juice. In addition, high carriage rates of C. jejuni have been identified in Canadian geese and migratory ducks, suggesting that wild birds may play a role in spreading C. jejuni in the environment (Pacha et ai., 1988). Other routes of human C. jejuni infection are also of a primary zoonotic nature and include ingestion of water contaminated by 2 fecal runoff and ingestion of unpasteurized milk (Young et al., 2007; Blaser et al., 1983). The latter two also account for the majority of large-scale Campylobacteriosis outbreaks. 1.2 CAMPYLOBACTERIOSIS 1.2.1 Symptoms Upon infection, C. jejuni predominantly colonizes the jejunum, ileum and the colon in humans (Allos and Blaser, 1995). The infectious dose for C. jejuni can be quite low, with some strains colonizing with an approximate 200 bacteria/dose (Blaser, 1997). Clinical symptoms often appear within 4 days and are characterized by profuse, often bloody diarrhea, acute abdominal pain, fever, malaise, nausea, and vomiting (Allos et al., 1998; Blaser et al., 1983). The acute illness usually lasts for 2-5 days, and patients typically recover fully. However, approximately 25% of patients experience a relapse. Complications of infection can also include intestinal hemorrhage, haemolytic uraemic syndrome, or inflammation of abdominal lymph nodes, also known as mesenteric adenitis (Allos et al., 1998). 1.2.2 Medical Sequelae Acute C. jejuni infections usually resolve by 10-14 days. In some cases, longer- term medical sequelae can occur, including reactive arthritis, Guillain-Barré Syndrome (GBS), which is the primary cause of acute ascending bilateral paralysis, and Miller Fisher Syndrome, a non-paralytic rare variant of GBS (Humphrey et al., 2007). GBS is an autoimmune disorder in which antibodies are produced against the myelin sheath that surrounds the axons of the peripheral nerves. This inhibits effective signal transmission resulting in acute paralysis. Although the exact cause of GBS still remains unknown, a 3 large majority of GI3S cases have been associated with prior C. jejuni infection (13-39% of cases) (Yu et iii., 2006). C. jejuni Iipo-oligosaccharide (LOS) closely resembles the peripheral nerve ganglioside, GM1 (Yu et al., 2006), and during C. jejuni infection, antibodies produced against C. jejuni LOS may cross-react with GM 1, thereby inducing GBS. GBS symptoms usually manifest 1-3 weeks after the resolution of enteritis symptoms (Butzler, 2004). 1.2.3 Treatment Although acute C. jejuni infection is often self-limiting and typically resolves within 2 weeks, antimicrobial agents are sometimes required for more severe, complicated or systemic infection. Currently, macrolides such as erythromycin and fluororquinolones such as ciprofloxacin are the most common antibiotics prescribed for uncomplicated C. jejuni infection (Nachamkin, 2001). Furthermore, antibiotics have also been incorporated to feedings of chicks to lower C. jejuni colonization. Unfortunately, reports describing the emergence of antimicrobial-resistant C. jejuni have increased since the late l980s (Moore et al., 2001). Although a few candidate vaccines have been developed (Girard et al., 2006), an effective vaccine is still unavailable. Vaccine development has been challenging due to the complex nature of C. jejuni surface antigens, including several polysaccharide structures conferring multiple serotype combinations. 1.3 MORPHOLOGY AND CHARACTERISTICS C. jejuni is a spiral, Gram-negative bacillus that is 0.2-0.9 .tm wide, 0.5-5.0 im long. It belongs to the epsilon class of proteobacteria, in the order of Campylobacteriaceae, together with the genera Helicobacter, Wolinella, Sulfurospirillum, Acrobacter and Dehalospirillum. These species typically have small genomes of 1.6-2.0 megabases (Young et al., 2007; Thomas 4 et a!., 1999). The complete genome sequences have been deduced for the C. jejuni strains NCTC 11168, RM1221, 8 1-176 and 269.97 isolated from human blood culture. The genome size may vary slightly depending on the strain; for instance, C. jejuni NCTC 11168 has 1633 protein encoding genes, and C. jejuni 81-176 has 1748 protein encoding genes according to the National Microbial Pathogen Data Resource Center ( As a naturally competent species, C. jejuni is able to take up DNA from the environment. With a flagellum at each end, C. jejuni is highly motile and often exhibits rapid darting and spinning motions (Young et a!., 2007). Campylobacter is a difficult organism to culture, due to its unique growth requirements. As a fastidious microaerophilic organism, it survives optimally under 12% CO2 and 6% 02 conditions and requires complex nutrients for optimal survival (Garenaux et a!., 2008; Park, 2002). Because C. jejuni is asaccharolytic and lacks a unidirectional enzyme, 6-phospho-fructokinase, in the glycolytic pathway, it cannot metabolize glucose and instead depends on amino acids for both carbon and energy sources (Guccione eta!., 2008; Muller eta!., 2005). 1.4 METABOLISM 1.4.1 Amino acid metabolism in C. jejuni Amino acids (AAs) are essential nutrients required by C. jejuni for growth and survival (Guccione et a!., 2008; Muller et a!., 2005; Velayudhan and Kelly, 2002). As the most important carbon and energy resource, AAs thus contribute to the synthesis of numerous enzymes and metabolites including fatty acids, nucleic acids, proteins and other amino acids as well as organic acids, which can serve as metabolic substrates for the TCA cycle. Previous studies identified asparagine, aspartate, glutamine, glutamate, serine and proline as the major energy sources in C. jejuni strain NCTC 11168 (Guccione 5 et al., 2008; Leon-Kempis Mdel et al., 2006). It is clear that as these AAs can be readily catabolized and act as precursors for the formation of organic acids such as pyruvate, fumarate, and succinate, which directly feed into the trichioracetic (TCA) cycle, serving as electron donors and/or acceptors essential for respiration. It was previously shown that glutamine, also the major nitrogen donor in C. jejuni, is rapidly utilized at a significantly higher rate than glutamate (Westfall et al., 1986). 1.4.2 Glutamine metabolism and pathogenesis Aside from being primary energy sources for growth and survival, AAs and their derivate also contribute to pathogenesis in several bacterial pathogens (Guccione et al., 2008; Barnes et al., 2007; Shibayama et al., 2007; Tullius et al., 2003; Smirnova et al., 2001). Recently, an enzyme involved in glutamine metabolism was associated with bacterial stress responses and host-pathogen interactions in both Helicobacterpylori and C. jejuni (Barnes et al., 2007; Shibayama et al., 2007). Gamma-glutamyl transpeptidase (GGT) in H pylon is involved in the hydrolysis of extracellular glutamine or glutathione (GSH) into glutamate for subsequent uptake and is involved in the induction of host cell apoptosis and in vivo colonization (Shibayama et al., 2007). In C. jejuni, GOT is involved in H20resistance, host cell apoptosis, intracellular survival, and colonization of chicks and mice (Barnes et al., 2007; Hofreuter et al., 2006). GSH also functions as an antioxidant that protects E. coli from oxidative damage and osmotic shock (Smirnova et al., 2001). In addition, glutamine synthetase, GinA, in Mycobacterium tuberculosis, has also been shown to be essential for virulence, as a AglnA mutant is avirulent in vivo and unable to survive within human macrophages in vitro (Tullius et al., 2003). These studies highlight the importance of AA homeostasis and its potential role in bacterial 6 pathogenesis. However, details describing the molecular mechanisms of how AA metabolism is linked to pathogenesis remain largely unknown and await investigation. 1.4.3 Glutamine contributes to host cell survival While little is known about glutamine metabolism in bacteria and how it contributes to pathogenesis, the effect of glutamine on signaling processes in eukaryotic cells has been characterized. Intracellular glutamine modulates heat shock protein (Hsp) expression and reactive oxygen species (ROS) levels in cells such as enterocytes, or intestinal epithelilal cells, and promotes lymphocyte cell proliferation as well as suppressing cell death (Phanvijhitsiri et al., 2006; Wischmeyer et al., 2003; Chang et al., 2002; Chang et aL, 1999). Moreover, apoptosis in intestinal epithelial cells is prevented by the presence of intracellular L-glutamine (Larson et al., 2007; Nakamura and Hagen, 2002). Specifically, a study showed that L-glutamine is able to inhibit H pylon-induced apoptosis in enterocytes, suggesting an anti-cytotoxic activity of glutamine in the stomach (Nakamura and Hagen, 2002). 1.5 ATP BINDING CASSETTE (ABC) TRANSPORTERS 1.5.1 AA-ABC Transporter Structures To effectively utilize AAs for energy production, AAs must be actively transported from the external environment into the C.jejuni cytosol across the cytoplasmic membrane barrier. This process is predominantly mediated by ABC (ATP Binding Cassette) transporters, a superfamily composed of proteins found in both prokaryotes and eukaryotes. ABC uptake transporters are typically comprised of three functional domains: a permease, an ATPase, and a substrate-binding protein (Fig. 1.1). 7 While the permease and ATPase comprise the core of an ABC transporter and, in bacteria, are typically encoded by genes in the same operon, the substrate-binding domain is usually encoded by a gene encoded elsewhere on the genome (Muller et al., 2005; Hekstra and Tommassen, 1993). In bacteria, a functional transporter usually contains a homodimer of a single transmembrane polypeptide or a heterodimer of two distinct polypeptides (Saurin et al., 1999). Each of the hydrophobic permease components typically forms 6 putative alpha-helical integral transmembrane polypeptide segments, which shuttle the substrate across the bacterial membrane. The hydrophilic ATPase component is typically formed by two monomers and resides in either the periplasm or the cytoplasm. The catalytic pocket for ATP hydrolysis to provide energy for transfer of the substrate into the bacterial cytoplasm is only produced by cooperation between the two monomers. In contrast to the permease domain, the ATPases show a high degree of sequence similarity and identity across the ABC family, implying a conserved structure and function for these domains (Garmory and Titball, 2004; Jones and George, 1999). Specifically, these proteins contain three highly conserved motifs: (1) Walker A, a glycine-rich loop; (2) Walker B, a hydrophobic domain, at the ATP binding site, and (3) C-motif, (LSGGWW/RJKWR), also known as the peptide linker, which is found in all ABC transporters. This motif is located immediately N-terminal to the Walker B motif and is the site of mutations which severely impair function in many ABC transporters. It is also interesting to note that the peripheral substrate binding protein and ATP binding protein can be promiscuous and therefore free to interact with other transporter systems. Previous studies have shown that in the absence of a binding protein, certain transporter systems may couple with other periplasmic-binding proteins or ATP binding proteins to achieve high efficiency uptake (Forward et al., 1997; Schlosser et al., 1997; 8 Wilken et al., 1996; Hekstra and Tommassen, 1993), suggesting that these ABC transporter components are not always confined ex1usive1y to a single system. 9 Periplasm Cytoplasm Figure 1.1. Schematic diagram of a bacterial ATP Binding Casette (ABC) transporter. An ABC transporter is composed of two alpha-helical transmembrane proteins and an ATP-binding protein, which are encoded by genes in the same operon. A periplasmic substrate binding protein encoded by a gene outside of this operon is often coupled to this system Periplasmic binding protein Integral ‘—transmembrane ATP binding domains 10 1.5.2 ABC Transporter Functions ABC transporters play an essential role in most bacteria due to their ability to rapidly mediate nutrient uptake for energy and survival (Higgins, 1992). Through ATP dependent active transport, nutrients such as sugars or amino acids can be accumulated within bacteria against a concentration gradient (Dippel and Boos, 2005). Although the exact mechanism remains unclear, it is proposed that once loaded with a specific substrate, the substrate binding protein is able to dock on the external domain of the permease protein to initiate ATP binding to the ATPase. This triggers simultaneous conformational change between the permease and ATPase to open the channel, and ATP hydrolysis to facilitate active transport of the substrate into the cytoplasm against the concentration gradient. In addition to importing nutrients for consumption, ABC transporters may also export substances from the bacterial cytoplasm (Nikaido, 2002). Previous studies have shown that ABC transporters participate in virulence protein secretion (Holland et al., 2005) as well as the efflux of hydrophobic compounds, some of which exert antimicrobial activities (Quinn et al., 2007; Elkins and Beenken, 2005). Bacterial ABC transporters have also been proposed to regulate other processes, such as modifying signal transduction pathways (Matsuo 2003). For instance, the oligopeptide permease of the Bacillus Subtilius ABC transporter stimulates competence development and the initiation of sporulation by importing signaling peptides. Therefore, ABC transporters have been shown to affect bacterial virulence by several different means. 11 1.5.3 AA-ABC transporters serve as pathogenesis determinants in C. jejuni It is estimated that C. jejuni harbours 30 complete ABC transporter systems, both importers and exporters (Kelly, 2008). Although it is difficult to deduce the substrates for each transporter system, it is predicted that most of these systems are responsible for AA and organic acid transport, since C. jejuni utilizes AAs as a primary carbon source (Guccione et al., 2008). Several AA-ABC transporter system components already identified in C. jejuni include a glutamate/aspartate-binding protein (Peb 1) (Leon Kempis Mdel et al., 2006), a cysteine-binding protein (CjaA) (Muller et al., 2005), and a serine transporter protein (SdaC) (Velayudhan et al., 2004). Peb 1, CjaA and SdaC all participate in C. jejuni virulence (Leon-Kempis Mdel et al., 2006; Muller et al., 2005; Velayudhan et al., 2004). Pebi is currently the best characterized AA-ABC transporter component and has been suspected to function as a surface antigen and adhesin. It contains two predicted sequences for signal peptidases I and II binding, and therefore can serve as both a surface exposed adhesin and a periplasmic solute. Absence of Pebi attenuates infection both in vitro and in vivo (Muller et al., 2007; Leon-Kempis Mdel et al., 2006; Muller et al., 2005). Similarly, CjaA may act as a surface antigen involved in host cell adhesion (Muller et al., 2005). SdaC participates in serine uptake and is also important for virulence in vivo (Velayudhan et al., 2004). 1.5.4 AA-ABC transporters serve as pathogenesis determinants in other pathogens ABC transporters in other bacterial pathogens act as virulence determinants. For instance, the ATP binding protein (G1nQ) of a glutamine transporter in Group B Streptococcus is involved in host cell surface adhesion and in vivo virulence (Tamura et al., 2002). A putative polypeptide ABC transporter system in Salmonella, encoded by the 12 yefABEF operon, also serves as a virulence factor, since deletion of the ATPase component inhibits the ability of these bacteria to proliferate within host cells (Eswarappa et al., 2008). Several ABC transporter components in Brucella are also important for virulence both in vitro and in vivo (Castaneda-Roldan et al., 2006; Rosinha et al., 2002). 1.6 PHYSIOLOGY AND STRESS RESPONSE C. jejuni needs to traverse unfavourable external environments and overcome various challenges posed during the transmission process to establish infection and cause disease. Several stress response proteins enable C.jejuni to survive and respond to external stimuli such as oxidative, aerobic, osmotic, heat and acid stresses. 1.6.1 Heat stress C. jejuni replicates within a temperature range of approximately 32°C- 47°C (Garenaux et al., 2008; Park, 2002). However, its optimal temperature is between 3 7°C- 42°C, which spans the average body temperature of humans (37°C) and avian species (42°C). C. jejuni is often acquired through ingestion of undercooked poultry, where it has likely survived both heating and cooling processes during handling. C. jejuni harbours several heat shock proteins (Hsps) which are often induced as a result of a thermal stress response (Murphy et al., 2006). DnaJ, DnaK, GroEL, and C1pB are the major Hsps associated with thermo-tolerance in C. jejuni. Expression of some Hsps can also increase in response to other stresses such as aerobic and oxidative or osmotic stresses (Murphy et al., 2006). For instance, the endoprotease HtrA and the acyltransferase HtrB are Hsps of C. jejuni induced during aerobic, osmotic and oxidative shocks in addition to heat stress (Phongsisay et al., 2007; Brondsted et al., 2005). Other stress regulators such as RacRS, a two-compoenent signal transduction regulator system, and orthologues of HrcA and 13 HspR, have also been proposed to associate with thermo-regulation (Alter and Scherer, 2006). More recently, polyphosphate (poly P) and the two-component system sensor kinase Cj 1226c, have also been identified to participate in hyper-osmotic stress resistance (Candon et al., 2007; Svensson and Gaynor, manuscript submitted). 1.6.2 Aerobic stress As a capnophilic and microaerophilic organism, C. jejuni is sensitive to high levels of oxygen and has an optimal growth environment of 12% CO2 and 6% 02 (Murphy et al., 2006). Hence, it is generally sensitive to the level of oxygen in the atmosphere, which is approximately 21%. However, C. jejuni uses several strategies to tolerate aerobic stress (Jones et aL, 1993). In addition to inducing heat shock proteins such as HtrA and HtrB as described above, C. jejuni utilizes the stringent response to counter high02/low CO2 stress (Gaynor et al., 2005) and also produces proteins to facilitate the removal of reactive oxygen species (ROS), which are generated as a result of aerobic metabolism. 1.6.3 Oxidative (reactive oxygen species) stress As previously mentioned, C. jejuni encounters ROS stresses as a result of aerobic respiration. However, C. jejuni is also challenged by high levels of oxidative stress inside hosts and inside epithelial cells and macrophages, since ROS such as superoxide, hydrogen peroxide and other organic hydroperoxides are frequently produced by host cells as a defense mechanism to cause bacterial cell injury (van Vliet et al., 2002; Day et al., 2000). C.jejuni expresses several oxidative stress response enzymes to remove ROS. Superoxide dismutase (SodB), catalase (KatA) and alkyl hydroxide reductase (AhpC) are 14 the three major proteins identified in C.jejuni to inactivate ROS. The iron-containing SodB is proposed to provide the first line of defense during exposure of C. jejuni to air since it has been shown to degrade superoxide anions and oxygen radicals such as dioxygens into hydrogen peroxide and oxygen (Purdy eta!., 1999; Pesci eta!., 1994; Purdy and Park, 1994). KatA is essential for hydrogen peroxide resistance as it converts peroxide into water and oxygen (Day et a!., 2000; Mongkolsuk eta!., 1998). The iron- regulated AhpC is important specifically for resistance to toxic hydroperoxide intermediates such as cumene and tert-butyl hydroperoxide, but not inorganic peroxides such as hydrogen peroxide (Stead and Park, 2000; Baillon eta!., 1999). 1.6.4 Osmotic stress Sensitivity to hyper-osmotic stress often arises during transmission processes such as food processing, desiccation and salt water survival. C. jejuni exhibits a lower tolerance to osmotic stress compared to other food-borne bacterial pathogens (Alter and Scherer, 2006). Factors contributing to osmotic stress responses have not been investigated in detail, and only three genes to date have been identified as being associated with hyper-osmotic stress resistance: htrB (Phongsisay et a!., 2007), ppkl (encodes polyphosphate kinase 1) (Candon et a!., 2007) and cj]226c (encodes a two component system sensor kinase) (Svensson and Gaynor, manuscript submitted). Each of these genes is important for survival in hyper-osmotic conditions. 15 1.7 HOST-PATHOGEN INTERACTIONS 1.7.1 Host epithelial cell colonization, invasion, and intracellular survival. To establish an infection, C. jejuni must first colonize the intestinal epithelium. This involves traversing the mucus layer of the gastrointestinal tract and attaching to intestinal epithelial cells. C. jejuni harbours several surface adhesion factors that enable attachment to host cell surface receptors, leading to colonization. F1aA (flagellin), Peb 1 (an ABC transporter periplasmic substrate binding protein component that also serves as a surface adhesin) (Pei et a!., 1998), CadF (Campylobacter adhesion to fibronectin) (Konkel eta!., 2005), and J1pA (a lipoprotein) (Jin eta!., 2001) interact with host cell surface proteins during infection. Lipooligosaccharide (LOS), another maj or surface molecule found on the outer leaflet of the Cj outer membrane, has an endotoxic property and is involved in host cell adhesion (Fry et a!., 2000). Although C. jejuni is often considered an extracellular pathogen, it may invade host cells via a caveolae and microtubule dependent but actin-independent process following initial colonization (Watson and Galan, 2008; Oelschlaeger et a!., 1993). Both transcellular and paracellular translocation are evident during Cf infection (Monteville and Konkel, 2002; Bras and Ketley, 1999; Oelschlaeger eta!., 1993; Konkel eta!., 1992), and the detailed mechanism of the internalization process remains an area of debate. Once C. jejuni invades host cells, it is able to survive within the cells. Although the intracellular fate of C. jejuni remains unclear, this bacterial pathogen utilizes mechanisms that allow it to survive within host cells (Candon et a!., 2007; Mihaljevic et a!., 2007; Naikare eta!., 2006; Gaynor eta!., 2005; Day eta!., 2000; Oelschlaeger eta!., 1993; Kiehibauch et a!., 1985). While an early study suggested that C. jejuni survives in a vacuole mononuclear phagocytes (Kiehlbauch et a!., 1985), a more recent study using 16 intestinal epithelial cells showed that C. jejuni sustains intracellular survival by preventing fusion of this vacuole, subsequently named the Campylobacter-containing vacuole (CCV), with the lysosome (Watson and Galan, 2008). While C. jejuni can survive intracellularly within intestinal epithelial cells, survival within macrophages has continued to remain controversial. Using electron microscopy and colony-forming unit (CFU) assays, previous studies have shown that following phagocytosis, C. jejuni is capable of both short- and long-term intracellular survival within cultured J77A. 1 murine macrophages, 28SC human monocytes, and peritoneal macrophages from BALB/c mice (up to 1 0 CFU by day 6) (Hickey et a?., 2005; Day et a?., 2000; Kiehlbauch et al., 1985). However, other studies using C57BL/6 murine bone marrow derived macrophages and macrophages derived from human peripheral monocytes have made contradicting observations, suggesting C. jejuni is rapidly killed in 24 hours following phagocytosis by these macrophages as it is being delivered to the lysosome (Watson and Galan, 2008; Wassenaar et a?., 1997; Myszewski and Stern, 1991). C. jejuni interactions with dendritic cells (DC5) have not been investigated in detail. DCs are important in both the innate and adaptive immune responses to microbial pathogens. DCs play an important role during infection of enteric pathogens such as Salmonella enteric serovar Typhimurium, H pylon and Shigellaflexineri, where release of various cytokines is induced (Kranzer et a?., 2004; Edgeworth et al., 2002; Marriott et al., 1999; Medzhitov and Janeway, 1997). To date, only one study has described C. jejuni interaction with DCs, where it was found that 99% of internalized C. jejuni were killed within 24 hr, and no cytotoxicity effect was induced (Hu et a?., 2006). 17 1.7.2 Toxin Campylobacter produces several virulence factors that alter host cellular activities, one of which is a multi-subunit toxin termed cytolethal distending toxin (CDT). CDT is also produced by several other bacterial pathogens such as Salmonella enterica serovar Typhi, Shigeila dystenteriae, E. coil, Actinobacilius actinomycetemcomitans, and enterohepatic Helicobacter spp. (Smith and Bayles, 2006). It is encoded by 3 highly conserved genes, cdtA, cdtB, cdtC: CdtA and CdtC function as dimeric subunits forming a complex with CdtB, and CdtB functions as a DNase I like protein that triggers DNA double-strand breaks (Lara-Tejero and Galan, 2000). Using purified CDT protein, the CDT was shown to cause apoptosis and cell death in eukaryotic cells, prevent dephosphorylation of the cyclin B1/cdc2 protein kinase complex, and elicit eukaryotic cell cycle arrest in the G2/M transition phase prior to mitosis (Lara-Tejero and Galan, 2000). 1.7.3 Apoptosis Apoptosis, or programmed cell death, is characterized by chromatin condensation and DNA fragmentation. Since CDT is produced by C. jejuni, and C. jejuni causes apoptosis in host cells, it has been postulated that CDT is the primary factor responsible for inducing apoptosis in C. jejuni-infected cells (Ceelen et al., 2006; Smith and Bayles, 2006). However, a recent study suggested that apoptosis is not dependent upon the presence of CDT, since infection of T84 intestinal epithelial cells with a CDT mutant did not yield a reduced cytotoxic effect compared to WT infection (Kalischuk et al., 2007). Additionally, it was proposed that C. jejuni may also cause necrotic cell death via a CDT- independent pathway (Kalischuk et ai., 2007). Necrotic cells, unlike apoptotic cells, rapidly lose plasma membrane integrity after the death stimulus. 18 Although C. jejuni CDT has been shown to induce apoptosis in the human monocytic cell line THP-1 (Hickey and Guerry, 2005 IAI), another study showed that a proteinase K- and heat-stable component of C. jejuni is also capable of stimulating apoptosis (Siegesmund et a!., 2004). Experiments by the same group further suggested that Cia (Campylobacter invasion antigens) proteins contribute to apoptosis in THP-l macrophages (Siegesmund et al., 2004). Detailed mechanisms underlying apoptosis in both epithelial cells and macrophages during C. jejuni infection remain to be investigated. 1.8 HOST CELL SIGNALING 1.8.1 MAPK signaling pathway One feature of C. jejuni pathogenesis is the stimulation of host cell signal transduction events to trigger an inflammatory response in addition to apoptosis (Borrmann eta?., 2007; Ru eta?., 2006; Rickey eta?., 2005; MacCallum eta?., 2005; Watson and Galan, 2005; Siegesmund et a?., 2004). The MAPK (mitogen-activated protein kinase) family plays an important role in mediating signal transduction and is activated by a wide range of environmental stimuli via different cell surface receptors such as toll-like receptors (TLR), G-protein coupled receptors (GPCR), integrin, receptor tyrosine kinases (RTK), and calcium ion channels (Schorey and Cooper, 2003). There are three maj or MAPK families in mammals, the extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase (JNK) and the p38 kinases, all of which lead to subsequent gene expression changes important for regulating diverse cellular activities such as proliferation, differentiation and apoptosis in response to external stimuli (Shan et a?., 2007; Galindo eta?., 2004). 19 1.8.2 MAPK dependent signaling activation in C. jejuni infected cells C. jejuni infection in 1NT407 human epithelial cells as well as Caco-2 and T84 human intestinal epithelial cells has been shown to trigger ERK 1/2, JNK and p38 kinase phosphorylation (Chen et a!., 2006; Hu et a!., 2006; MacCallum et a!., 2005; Watson and Galan, 2005). Furthermore, several lines of evidence from work on other organisms have shown that pathogen-induced ERK activation in macrophages is important for apoptosis induction (Fettucciari et a!., 2003; Tang eta!., 1998; Xia et a!., 1995), and lipopolysaccharide (LPS) has been identified as a virulence factor responsible for MAPK stimulation in monocytes and macrophages (Thomas eta!., 2006; MacCallum et al., 2005; Guha and Mackman, 2001; Ruckdeschel et a!., 1997). 1.8.3 Inflammatory response Campylobacter infection often stimulates a series of immune responses in host cells, resulting in inflammation. Activation of a proinflammatory cytokine, interleukin (IL)-8, is a hallmark of C. jejuni pathogenesis. IL-8 is important for the recruitment of other immune cells including DCs, macrophages and neutrophils, which interact with C. jejuni to cause the host mucosal inflammatory response, which is critical for the generation of diarrhea. IL-8 production in host epithelial cells may be stimulated via a CDT-dependent or -independent process. While CDT contributes to IL-8 secretion in the 1NT407 cell line (Hickey, 2000), it was found that both IL-8 and NF-KB (nuclear factor- KB) activation are initiated through an ERK-dependent MAPK signaling pathway in cultured T84 epithelial cells 8 hours post-infection (Watson and Galan, 2005). Other pro-inflammatory cytokines such as IL-lcL/f3, IL-6, IL-8 and tumor necrosis factor alpha (TNF-a) are also induced in monocytic and epithelial cells (Young et a!., 2007; Hickey et 20 al., 2005; Siegesmund et al., 2004; Jones et al., 2003), and IL-1, IL-6, IL-8, IL-b, IL- 12, interferon-gamma (IFN-’y) and TNF-cL, are also activated in infected DCs (Hu et al., 2006). 1.9 OBJECTIVE AND HYPOTHESIS In a previous study, we found that transcription of the putative C. jejuni AA-ABC transporter system encoded by cj0467-9 was induced during in vitro infection of 1NT407 cells (Gaynor et al., 2005), suggesting a role for these genes in pathogenesis. Our objective in this study was to investigate the biological function(s) of this system. We hypothesize that if the cj0467-9 encoded AA-ABC transporter expression level is increased during cellular infection, then absence of this system will alter C. jejuni physiology and pathogenesis. 21 I 2.1 BACTERIAL STRAINS, CELL LINES, MEDIA AND GROWTH CONDITIONS Campylobacterjejuni 81-176 wild type (WT) and mutants were cultured in Mueller Hinton (MH) broth (Oxoid Ltd, Hampshire, England) or agar supplemented with 1 Ojig/ml of vancomycin and 5 ig/ml of trimethoprim (MHTV) in a microaerobic and capnophilic (hereafter referred to as microaerobic for simplicity) environment at 37°C. Microaerobic environments were generated using Oxoid CampyGen gas packs in an enclosed container or a tn-gas incubator with 6% 02 and 12% CO2. C. jejuni 81-176 mutants zXpaqP (cj0467) and zXpaqQ (cj0469) were cultured in the same condition with the addition of 50 ig/m1 of kanamycin (kan). For overnight broth cultures, freshly growing plates of bacteria were inoculated into MH broth to a starting optical density at 600 nm (0D600)of approximately 0.004. The flasks were placed in an enclosed jar under microaerobic conditions and grown at 37°C shaking at 200 r.p.m. All E. coli DH5a strains were grown in Luria Bertani (LB) agar or broth at 37°C. RAW264.7 and 1NT407 cells were cultured at 37°C in humidified air with 5% CO2. RAW264.7 cells were maintained in Dulbecco modified Eagle Media (DMEM) (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS) (Gibco) while 1NT407 were maintained in Minimal Essential Media (MEM) (Gibco) supplemented with 10% FBS and Caco-2 cells were maintained in DMEM with 1% non-essential amino acid (NEAA) and 10% FBS. 2.2 CONSTRUCTION OF CAMPYLOBACTER JEJUNI 81-176 APAQP AND APAQQ TARGETED DELETION MUTANTS To construct the ApaqP (cj0467) and ApaqQ (cj0469) mutant strains in C. jejuni 81-176, the target genes were amplified by PCR from C. jejuni chromosomal DNA prepared using a DNA extraction kit (Promega, Nepean, CA), with primers paqPFl (5’- TCTAGAGAAGATGGAGAAATTTTG-3’) and paqPRl (5’- 23 TCTAGAACACCACAAAAAGCCAT-3’), as well as paqQFl (5’- TCTAGATCCTTGCAGAGTATTC-3’) and paqQRl (5’- TCTAGATACCAACTGAGCTAAACC-3’), yielding 1.3 kb and 1.2 kb fragments, respectively, with XbaI sites at the flanking regions. The PCR products were purified (Qiagen, Mississauga, ON) and cloned into the pGEM®-T vector (Promega); these constructs were designated pGEM paqF and pGEM-paqQ. Restriction digestion was performed using the enzymes HindIII for paqP and MscI with BamHI for paqQ, to remove approximately 400 bp from paqP and 290 bp from paqQ. A non-polar aphA-3 cassette encoding kanamycin resistance (KanR) was digested from the pUC18K2 plasmid (Menard et al., 1993) using the enzymes HindIII or MscI and BamHI, and ligated to the digested pGEM-paqP and pGEM-paqQ vectors, creating suicide vectors carrying the ApaqP: .aphA-3 and ApaqQ: .aphA-3 deletion constructs. Following selection and amplification in E. coli DH5ct, the mutagenic plasmids were purified from DH5a using a Qiagen Midi-prep kit and transformed into C. jejuni 81-176 WT by natural transformation or by electroporation as previously described (Candon et al., 2007). As pGEM®-T is a suicide vector in C. jejuni, colonies recovered from MHTV+ kan plates should represent stable chromosomal integrants resulting from double cross-over homologous recombination. Genomic DNA from several mutant clones was prepared using the Wizard Genomic DNA kit (Promega). The resulting mutants were designated ApaqP and ApaqQ. Insertional inactivation of the paqP and paqQ genes via KanR cassette insertion was verified by PCR and sequencing analysis as well as Southern blot analysis. 2.3 COMPLEMENTATION OF APAQP DELETION MUTANT Generation of a re-constituted WT strain of C. jejuni, designated ApaqPc, was achieved by natural transformation of the t\paqP mutant with the pRRC-paqF plasmid, carrying a 24 chloramphenicol resistance gene. To create the pRRC-paqP construct, the paqP fragment was obtained from pGEM-paqP by XbaI digestion. This fragment was subsequently inserted into the pRRC vector carrying a chioramphenicol resistant cassette, resulting in the pRRC-paqP construct (paqF: . CAT). The pRRC delivery vector contains the C. jejuni 1 6S and 28S rRNA genes (Karlyshev and Wren, 2005) and provides a means to express genes, driven by the CAT promoter, at a heterologous chromosomal location in C. jejuni. This vector was delivered to the zXpaqP train via natural transformation, as previously described (Candon et al., 2007). Colonies carrying the paqP: CAT fragment were tested for sensitivity to chloramphenicol by plating on MR agar plates containing 20 ig/m1 of chloramphenicol and 50 of kanamycin. Sequencing and PCR amplification using the paqP primer set confirmed the selected colonies to be reconstituted WT strains carrying the recombinant paqF gene. 2.4 RNA EXTRACTION AND REVERSE TRANSCRIPT- PCR (RT-PCR) ANALYSIS C. jejuni RNA isolation was performed as previously described (Gaynor et al., 2005). Reverse transcription of the purified RNA was performed using Super Script II Mix and Random Primer (Invitrogen, Burlington, ON) followed by purification using the Qiagen PCR purification kit. The purified cDNA products were PCR amplified for nssR using primers nssRFl (5’ AGAACTTTTATCTAGTGTAGG-3’) and nssRR 1 (5’ -CGTCCTTAAATCTAATGC-3’), and tuf using primers tufFi (5’- GCGTGGTATTACTATTGCTAC -3’) and tufRi. (5’- TCGAAGTCAGTGTGTGGAG-3’). RNA was confirmed as DNA-free by RT-PCR. 2.5 SOUTHERN BLOT HYBRIDIZATION Genomic DNA was isolated using a DNA isolation kit as described above. For each Southern blot, 100 ng of DNA from each strain was digested by EcoRV, which cuts in the middle of the KanR cassette but does not cut either paqP or paqQ. DNA was separated on a 25 0.75% agarose gel and directly blotted onto PVDF membranes using 0.25 N NaOH and 0.75 M NaCl as the transfer solution according to the manufacturer’s instruction in the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Applied Science, Mannheim, Germany). All probes were non-radioactively labeled using this kit. The paqP fragment was obtained by digesting the pGEM-paqP plasmid with XbaI while the paqQ fragment was obtained by digesting the pGEM-paqQ plasmid with XbaI and MscI. The resulting fragments were denatured by heating at 99°C for 10 mm and placed on ice. Hexanucleotides, DIG and Kienow were added to the denatured fragment and incubated overnight at 37°C as described in the DIG-kit. The blot was hybridized with these probes and visualized using enhanced chemiluminescence (ECL) (Perkin Elmer, Waltham, MA). Insertion of the KanR cassette into paqP and paqQ should result in the generation of two smaller probe-reactive fragments (due to EcoRV digestion of the KanR cassette) rather than the larger WT-sized fragment. In the case of /paqQ, only one smaller fragment is readily visible at the exposure shown. 2.6 AMINo ACID TRANSPORT ASSAYS C. jejuni cells were grown for 15 hr to mid-log growth phase in 15 ml of MH broth. Cultures were harvested by centrifugation, washed twice in M9 minimal media (90.2 mM Na2HPO4,22.0 mM KH2PO4,8.56 mM NaCl, 18.7 mM NH4C1, 2 mM MgSO4,22.2 mM glucose, 10 iM CaC12,pH7.4), and re-suspended in the same medium, to an approximate 0D600 of 1.0. The re-suspension was kept on ice for no longer than 4 hr. An aliquot of 150 il of the cell suspension was added to 1.5 ml of M9 minimal medium containing 0.5% (v/v) lactic acid (Sigma-Aldrich, Oakville, ON), and was allowed to equilibrate by incubating at 37°C for 3 mm. The assay was then initiated by the addition of 5 M of the[‘4C]-labelled amino acid (6.9- 9.36 GBq mmoF’) (Perkin Elmer). Samples (0.1 ml) were withdrawn at the indicated time points, 26 collected by vacuum filtration through 0.22 jim membrane filters (Millipore Corp., Billerica, MA), and washed twice with M9 minimal media. Sample filters were then immersed in Filter- Count scintillation cocktail (Fisher Scientific, Ontario, Canada) and counted in a Beckman CoulterTM scintillation counter. Transporter activity was expressed as nMoles of amino acid transported, mg dry cells, min1 2.7 CELL INFECTION ASSAY FOR COLONIZATION, INVASION, INTRACELLULAR SURVIVAL AND GENTAMICIN MIC DETERMINATION [NT407 cells (a human intestinal epithelial cell line), RAW264.7 cells (a murine macrophage cell line) or Caco-2 cells (human intestinal epithelial cell lines) were seeded into 24 well tissue culture plates at semi-confluency (.-. 5x10 cells/mi) and allowed to grow for approximately 20 hr prior to infection. Mid-log phase WT and C. jejuni mutants from overnight shaking cultures were added to pre-warmed MEM or DMEM, which was used to infect the cells at an MOP-- 200 for 3 hr. The cells were then washed 3 times with PBS to remove any unbound bacteria. To assay adhesion, 1 ml of 1% Triton X-100 in PBS was added to some of the wells for 5 mm to disrupt the cells; the samples were plated on MH agar, and grown for 48 hr at 37°C in a microaerobic condition. To assay invasion, fresh media supplemented with 10% FBS and 150 jig/ml of gentamicin were added to the cells and incubated at 37°C for 2 hr before washing and treating with Triton as described. Next, to assay short-term intracellular survival, fresh media supplemented with 10% FBS containing 10 jig /ml gentamicin for an additional 4 hr before washing and treating with Triton X-l00 (the 9 hr post-infection time point). Finally, to assay long-term intracellular survival, cells were left in 10 jig/mI gentamicin for an additional 15 hr (or 24 hr after initial infection) before being subjected to washes and Triton X-1 00 treatment. Gentamicin susceptibility of each strain was tested by determining the minimum inhibitory concentration (MIC) using an E-test® strip (AB Biodisc). 27 2.8 IN VIVO COLONIZATION USING A MOUSE MODEL The in vivo study was performed by Rhonda Hobbs from our collaborator, Dr. Stuart Thompson’s laboratory in the Medical College of Georgia. BALB/cByJ mice from Jackson. Laboratories (Bar Harbor, ME) were housed at the animal care centre at the Medical College of Georgia, with seven mice per experimental group. Each mouse was infected with 5 x i09 CFU WT or ApaqP C. jejuni via oral gavage as previously described (Pajaniappan et al., 2008). C. jejuni shed in fecal pellets from each mouse at 7, 14,19, 28 and 35 days post-infection, were homogenized and enumerated on MR agar containing 5% (v/v) sheep’s blood and 20 ig/ml cefoperazone, 10 jig/mi vancomycin and 2 jig/mI amphotericin B (CVA). The level of detection was 1 x 102 CFU/g fecal pellet. All animal treatments were carried out in accordance with NIH guidelines for the care and use of laboratory animals, using procedures approved by the Medical College of Georgia Institutional Care and Use Committee. 2.9 OXIDATIVE, AEROTOLERANCE, HEAT STRESS AND OSMOTIC STRESS SURVIVAL ASSAYS To assay oxidative stress, C. jejuni from an overnight culture in MR broth was inoculated into fresh MR broth to an 0D600 0.6; 1 ml of this culture was subsequently added to each well of a 24-well plate. Tert-butyl hydroperoxide, also known as t-BOOH (Sigma Aldrich) and hydrogen peroxide, H20or paraquat (Sigma Aldrich) were made in MR broth at various concentrations. 1 ml of the oxidative agent was added to C. jejuni cultures and incubated for 30 mm at 37°C in microaerobic conditions before harvesting for CFU enumeration. Aerotolerance was examined by diluting C. jejuni grown to mid-log phase in MR broth to an initial 0D600 0.004 in fresh MR broth and incubated in shaking culture at 200 r.p.m and 37°C in atmospheric conditions. To assess limited CO2 stress and heat stress, mid-log phase bacteria were serially diluted, spotted onto MH agar plates, and incubated at 37°C in a 5% CO2 incubator, or 45°C in 28 microaerobic conditions. Osmotic stress was examined by spotting the dilutions onto MH agar plates supplemented with 0.17 M NaC1 and incubated at 37°C in a microaerobic environment. 2.10 CELLULAR APOPTOSIS AND VIABILITY DETECTION Annexin-Vstaining. RAW264.7 cells were plated at semi-confluency on cover-slips in 24-well plates and cultured for 24 hr before infecting with C. jejuni followed by gentamicin treatment as described above. At the end of 9 hr infection (with gentamicin treatment as described previously in intracellular survival assay), cells were washed 3 times with PBS and stained with Annexin-V fluorescein and propidium iodide according to manufacturer’s instructions (Roche Applied Sciences). Annexin-V labeling was visualized using a Nikon eclipse TE2000 microscope (Nikon Instruments Inc., Mississauga, ON) fitted with appropriate filter sets for detecting fluorescence. The total cell number was approximated by counting cells at 6 different fields under DIC (Differential Interference Contrast). Percentage of cell death was calculated by dividing the number of annexin-stained cells by total number of cells. DI4PI staining and immunoflorescence. Following infection, RAW264.7 cells were washed and fixed as described by Guttman et. al. (Guttman et al., 2007a). Cellular nuclei were labeled with 4’,6-Diamidino-2-phenylindole (DAPI) and mounted using Vectashield (Vector Labs, Burlington, ON). Relative cell viability was fluorescently quantified by counting DAPI stained cell nuclei in multiple randomly selected fields in a similar manner as previously described by Barnes et. al. (Barnes et al., 2007). Cells exhibit fragmented and condensed nuclei or have lifted off the plate are considered non-viable therefore were not enumerated for viability. 2.11 CELL LYSATE PREPARATION AND WESTERN BLOTTING RAW264.7 cells were grown on 150 mm tissue culture dishes and infected at an MOl 200 for 9 hr. Cells were washed 3 times with PBS containing 1mM CaC12 and 1mM MgC12 29 followed by treatment with RIPA lysis buffer (150 mM NaC1, 50 mM Tris pH 7.4, 5 mM EDTA, 1% Nonidet P-40, 1% deoxycholic acid, 1% SDS) for 10 mm on ice. Western blotting was performed according to Guttman et. al. (Guttman et al., 2007b). Briefly, equal amounts of total proteins were loaded and separated on 10% SDS-polyacrylamide gels and transferred to PVDF membranes (Bio-Rad Laboratories, Mississauga, ON). Membranes were blocked with 4% skim milk and washed in Tris-buffered saline with 0.1% Tween-20 (TBST) 3 times for 5 mm each. Primary mouse anti-phospho-ERK1/2 antibody (Cell Signaling Technology, Beverly, MA) was used at a dilution of 1:2000 and rabbit anti-ERK antibody (Santa Cruz Biotechnology, Santa Cruz, CA) was used at a 1:2000 dilution (0.1g/m1). Rabbit anti-phospho-JNK (Thr183/Tyr185) antibody (Cell Signaling Technology) and rabbit anti-INK1 antibody (Santa Cruz Biotechnology) were used at a 1:1000 dilution. After washing, a horseradish peroxidase (HRP)-conjugated secondary antibody (Cell Signaling Technology) was used at 1:5000 for labeling. Signals were detected by ECL (Perkin Elmer). 2.12 ADDITIONAL PHENOTYPIC ASSAYS Microaerobic growth in MH broth. C. jejuni were grown microaerobically at 37°C in MR broth to mid-log phase overnight. Bacteria were diluted to an 0D600 of 0.0 land placed under microaerobic conditions at 37°C, shaking at 200 r.p.m.; serial dilutions of cultures were made and colony forming units (CFUs) were measured over time by plating on MR agar plates. Minimal media survivaL Strains were grown as described above and diluted to an 0D600 of 0.02. Cultures were in MEM at 37°C shaking at 200 r.p.m. under microaerobic condition and CFUs were measured over time by plating serially diluted cultures onto MH agar plates. - 30 Anaerobic survivaL Log phase bacteria grown as described above were diluted to an 0D600 of 0.01. Cultures were placed under anaerobic conditions using an Anaero-GasPak (Oxoid), at 37°C, shaking at 200 r.p.m. CFUs were measured as described. Motility. Log phase C. jejuni were diluted to 0D600 0.02 and 1il stabbed of each strain into MH agar plates that contained 0.4% agar. Migration of the cells from the point of inoculation was analyzed following 24 hr of incubation at 37°C under microaerobic conditions. Low iron conditions. Log phase bacteria were diluted to an 0D600 of 0.1, and 100 jil of each strain was evenly spread on a MH agar plate. Disks containing desferal (Fe3chelator) and dipyridyl (Fe2chelator) at 40 mM were placed on the cell lawns and incubated at 37°C for 24 hr before measuring the zone of inhibition. Antimicrobial susceptibility test. Log phase bacteria were diluted to 0D600 of 0.1, and 100 jiL of each strain was evenly spread on a MH agar plate. Disks containing erythromycin, nalidixic acid and amikacin were placed on the cell lawns and incubated at 37°C for 24 hr before measuring the zone of inhibition. Heat Shock. C. jejuni from an overnight culture was inoculated into MR media to an 0D600 of 0.2 and placed at 55°C for 5 mm or 15 mm before cooling on ice. Serial dilutions of cultures were made and spotted onto agar plates. CFUs were measured followed by 48 hr of incubation under 37°C microaerobic conditions. pH sensitivity. C. jejuni from an overnight culture was diluted to 0D600 of 0.0005 and 0.002, and serial dilutions were inoculated onto MH agar plates at different pHs: pH 4.0, 5.0, 6.0, 7.0, 8.0 and 9.0. CFUs were measured after 48 hours of incubation under 37°C microaerobic conditions. Nutrient Deprivation assay. Overnight C. jejuni cultures were resuspended to 0D600 of 0.015 in 1 Oml MEM supplemented with 1% non-essential amino acids and incubated in 37°C shaking 31 cultures in the absence or presence of 40 mM L-glutamine. Bacterial growth was assessed at various time intervals by optical density at 600 nm analyses and CFU enumeration. Glutamine rescue assay. RAW264.7 and 1NT407 cells were grown to semi-confluency on cover-slips in 24 well plates as described above. Log-phase C. jejuni were diluted to OD600 0.02 in DMEM or MEM with 10% FBS in the absence or presence of 20mM L-glutamine. The cells were infected with C. jejuni (2 ml per well) for 9 hours. At the end of the infection, cells were washed with three times with PBS, fixed with 3% paraformaldehyde for 15 minutes at room temperature, washed once with PBS, and permealized with 0.2% Triton X-l00 for 5 minutes at room temperature. Finally, the cells were washed and stained with DAPI for visualization of cellular nuclei on the microscope. Gamma-glutamyl transferase (GGT) assay. The GGT assay protocol was adapted from Barnes (Barnes et al., 2007). Briefly, log-phase C. jejuni from overnight cultures were centrifuged at lO,000xg for 5 mm. Pellets were resuspended in 3 ml of 1M Tris-EDTA buffer (pH 8) and cells were disrupted using an ultra-sonicator (Ultrasonic Processor SL, Misonix Incorporated) at setting 3 for 10 times at 10 sec each. Lysed bacteria were centrifuged at 13,000 r.p.m, for 5 mm at 4°C and supernatants were collected for a Bradford assay to determine protein concentration. GGT reagent (Pointe Scientific, Inc. Canton, MI) was reconstituted in 10 ml dH2O according to the instruction protocol. Bacterial lysates were diluted by 1/10 in dH2O and 10 jil was added to 190 p.! pre-warmed GGT reagent in a 96 well microtire plate. The assay was incubated at 37°C and absorbance was measured at 405 nm at various time points. Protein secretion profile. 100 ml of log-phase C. jejuni from overnight culture was centrifuged at 10,000 x g for 5 mm. The supernatant was filtered using 0.22 p.m filter, and a 1/10 volume of 100% trichloracetic acid (TCA) (w/v) (Sigma Aldrich) was added to the supernatant for overnight precipitation at 4°C. The suspension was centrifuged at 9800xg for 30 mm and the 32 pellets were re-suspended in 200 pi of lx SDS-PAGE sample buffer and subjected to 16.5% SDS-PAGE. Briefly, the gel was fixed for 1 hour in fixing solution (40: 5: 55 solution of 95% ethanol/acetic acid! distilled water (v/v)), treated with oxidizing solution (0.7% periodic acid in fixing solution (v/v)) for 5 mill, followed by three washes with dH2O, 10 mm each. Next, the gel was stained with fresh silver staining reagent (20 mM NaOH, 0.67% AgNO3,1.33% NH4O in dH2O (v/v)) with gentle shaking. Finally, the gel was washed with distilled water 3 times for 10 minutes, and developing solution (Bio-Rad Silver Stain Developer) was added to the gel for 10 minutes before adding the stop solution (5% acetic acid and 10% ammonium pesulfate in dH2O). 33  3.1 Overview AA-ABC transporter systems in C. jejuni and other pathogenic organisms act as virulence factors during cellular infections (Leon-Kempis Mdcl et al., 2006; Muller et al., 2005; Tamura et al., 2002). In a previous study, we observed increased transcription of cj0467-9, which encodes a putative AA-ABC transporter, during in vitro infection of INT407 cells, suggesting a role for these genes in pathogenesis. This led us to explore the role of the Ci 0467-9 AA-ABC transporter system and its connection with host cells during the infection process. As both the integral membrane protein, or permease, and ATP binding protein/ATPase components are frequently required to produce a functional AA-ABC transporter (Nikaido, 2002), we generated non-polar mutations in both the Cj0467 (PaqP) permease and the Cj0469 (PaqQ) ATPase, using a highly invasive C. jejuni 81-176 strain, to ensure a comprehensive analysis of the system’s functions (rationale for the “Paq” designation is described below). Both mutants were tested for their tolerance in environmental stresses which can be often encountered in vitro or in vivo, amino acid transport to explore the system’s biochemical function, and its roles in the pathogen-host cell interaction. 35 3.2 cj0467-9 encodes a putative amino acid (AA) ABC transporter The putative AA-ABC transporter system encoded by cj0467-9 is highly conserved and occurs in the same genomic context among C. jejuni strains, as described in CampyDB (!campydb). For simplicity, we have referred to the cj0467-9 gene numbers as annotated for strain NCTC 11168, although our studies were performed using the invasive strain 81-176. Cj0467-9 is annotated as Cjj0492-4 in the 81-176 strain (campyDB). cj0467 and cj0468 are predicted to encode integral membrane proteins, with Cj0467 exhibiting 33% identity to the E. coil glutamine ABC transporter permease GlnP, and Cj0468 exhibiting 26% identity to the E. coil G1tJ permease (campyDB). cj0469 is predicted to encode an ATP binding protein with 55% identity to the Bacillus subtiiis glutamine ABC transporter ATP binding protein G1nQ (campyDB). National Centre for Biotechnology Information BLAST and Archael and Bacterial ABC transporter database searches also showed that Cj0467 and Cj0468 are similar to GlnP (approximately 43% identity), while Cj0469 is highly similar to GInQ (approximately 60% identity) in Streptococcus pneumoniae, Pseudomonas spp., and Helicobacter spp. Cj0467 and Cj0469 also exhibit homology to other likely C. jejuni AA-ABC transport components, including two uncharacterized proteins putatively annotated as G1nP (Cj0940c) and GInQ (Cj0902) based on slightly higher initial BLAST search homologies (Cj0940c: 37.5% identity to E. coli GlnP; Cj0902: 56.2% identity to Bacillus stearothermophilus G1nQ). To avoid confusion with these previously annotated genes, and as our data (described below) indicate that Cj0467 and Cj0469 participate not only in glutamine transport but also in other important biological processes, we have designated them PaqP and PaqQ, respectively [pathogenesis-associated glutamine (q) ABC transporter permease (E) and ATPase (Q)]. 36 3.3 Construction of targeted, non-polar IpaqP and tpaqQ disruption strains To investigate the role of this AA-ABC transporter system in C. jejuni, paqF and paqQ were individually disrupted using a non-polar kanamycin resistance (KanR) cassette, aphA-3 (Figure 3.1 A). PCR, sequencing, and Southern blot analyses confirmed that the resultant mutants, hereafter referred to as /paqP and ApaqQ, harboured disruptions in the appropriate genes (Figure 3.1 B, and data not shown). To verify that Kan’ insertion into both paqP and paqQ was non-polar, RT-PCR was used to confirm that nssR and tufwere transcribed in both mutant strains (Figure 3. 1C), and that paqQ was transcribed in the ApaqP strain (data not shown). 37 A B Figure 3.1. Generation of non-polar, single insert ApaqP and zXpaqQ disruption strains. (A) Genomic organization of the cj0467, cj0468 and cj0469 genes, encoding a putative AA-ABC transporter system. The aphA-3 cassette encoding kanamycin resistance was used to create insertion-deletions in cj0467 (paqF) and cj0469 (paqQ) genes by double crossover homologous recombination. The resultant mutant strains are designated ApaqP and ApaqQ. (B) Southern blots of EcoRV-digested genomic DNA using paqP and paqQ probes confirm that the target gene in each mutant was disrupted. (C) Reverse transcription PCR (RT-PCR) was performed to assay transcription of genes upstream of ApaqF (nssR) and downstream of zXpaqQ (tuf) in the deletion strains. paqP paqQ CL7-+ aphA-3 aphA-3 C PCR Strain RT 1.5kb 10kb 0,5 kb nssR WT ApaqP +- + - tuf WT ApaqP t.paqQ +- +- +- — — Probe paqP paqQ Strain WT e.paqP WT z.paqQ 8.0kb— 6.0 kb——-— 5.0 kb— 4.0kb— 3.0kb— 38 3.4 The ApaqP and ApaqQ C.jejuni mutants are defective for L-glutamine uptake and moderately defective for uptake of other amino acids To investigate the functionality of PaqP and PaqQ, transport assays were performed using different radioactively labeled AAs. Based on strong homology to G1nP and GlnQ and bioinformatics analyses described above, together with a previous report suggesting that this AA-ABC system may participate in cysteine transport (Muller et al., 2005), WT C. jejuni and the two mutants were grown to mid-log phase and assayed for rates of uptake of[‘4C]-L-glutamine, [‘4C]-L-glutamate, [14C] -L-aspartate and [‘4C]-L-cysteine. Both mutants exhibited a significant defect for glutamine uptake: at 1 mi glutamine transport levels of both /spaqF (-4.97 nmol/minlmg dry weight) and /xpaqQ (-4.66 nmol/minlmg dry weight) mutants were <50% that of the WT strain (—4.12 nmol/minlmg dry weight) (Figure 3.2A). An intermediate defect was observed for glutamate uptake (Figure 3.2B), while much smaller decreases in cysteine and aspartate uptake were observed (Figure 3.2C, 3.2D). This suggests that this AA-ABC transporter system has high affinity for glutamine but also appears to transport other amino acids to a lesser extent. The complemented ApaqPc strain partially restored glutamine uptake, as a two tailed t test did not show a statistically significant difference between WT and z\ paqFc (Figure 3 .2E). 39 A -t •1> -U U) E 0 E •1) U) B — EpaqP ApaqQ glutamate 0 1 2 Time (minutes) 3 C glutamine uptake at 1 minute * * WT • zpaqP --. tpaqQ cysteine 5 6 -.- WT • ApaqP tpaqQ aspartate D Time (minutes) U) -o U) E 0 C U) I :1. t E I I 11’U). , 1.0’ 0.9’ 0.8 ____ 0 U) E 0,6 __ E 0.4’ _____ WT tpaqP ApaqPc tpaqQ __ Strains j 4 Time (minutes) Figure 3.2. zXpaqP and zspaqQ mutants exhibit reduced levels of glutamine and other amino acid uptake relative to WT. C. jejuni 81-176 WT (square, solid line), ApaqP (circle, dashed line) and ApaqQ (triangle, dotted line) mutants were grown microaerobically, shaking in MH broth, for 1 5hr to early log phase (— 0.3 0D600/ml), then harvested and assayed for high affinity transport of (A) [‘4C] L- glutamine, (B) [‘4C] L-glutamate, (C) [‘4C] L- cysteine, or (D) [‘4C] L aspartate at a final concentration of 5 1iM. Samples were taken either every 30 sec, 1 mm or 2 mm. (E) ApaqP and ApaqQ both showed statistically significant differences in glutamine uptake compared to WT, while the ApaqP complemented strain ApaqPc showed no statistically significant difference in glutamine uptake compared to WT. Rate of uptakes were determined from three separate biological replicate cultures, with duplicate samples harvested for each strain at each time point. The asterisk (*) represents statistical significance (p < 0.05) using a two-tailed t-test. Each experiment was performed in triplicates (n=3) and the result is a representation of three separate experiments. —a— o 40 3.5 C. jejuni z\paqP and tpaqQ exhibit increased short-term intracellular survival in RAW264.7 macrophages, 1NT407 epithelial cells, and Caco-2 intestinal epithelial cells In a previous microarray analysis, we observed an increase in levels of cj0467-9 mRNA in C. jejuni during 1NT407 cell infections (Gaynor et al., 2005). Thus, we were interested in exploring whether this system might influence the interaction of C. jejuni with host cells. RAW264.7 murine macrophages as well as 1NT407 and Caco-2 human epithelial cells were infected with WT, zXpaqF, and /xpaqQ strains and assayed for adherence, invasion, and intracellular survival using a gentamicin protection assay. No significant differences in cell adherence, invasion or long-term intracellular survival at 24 hr were observed for the mutants compared to the WT strain (Figure 3.3). However, short-term intracellular survival (9 hr post- infection) of both ApaqP and ApaqQ mutants was up to 20-fold higher than WT in RAW264.7 cells (Figure 3.3A) and approximately 10-fold higher than WT in 1NT407 cells (Figure 3.3B). Human intestinal Caco-2 epithelial cells were also tested, and similar results were observed (Figure 3.3 C). Both WT and mutant strains were equally susceptible to gentamicin by E-test strip analyses (MIC 1.5 ig/ml), suggesting that the elevated short-term intracellular survival level of the mutants was nOt due to differences in gentamicin resistance. The level of intracellular survival at 9 hours post-infection was also examined for the ApaqPc complement strain, and was found to be similar to the ApaqP mutant (data not shown). 41 A RAW2641 ‘ 1.0x109 D 1.Oxl 08 tOxi Q7 1.Oxl 1,0x106 i.OxlG4 B 1NT407 ApaqP N1 EpaqQ i.0x109 t0x10 1.0x107 1.0x106 C, 1.0x105 (V 10x104 C, 1,OxlO’ 1.0x10 1.0x10 C, a, Ca I— a) C) 1.Oxl Q4 * — IVT %% * - ApaqP -iSpaqQ 1.0x108 1.0x108 0 ‘: 1.0x106 rx 1.0x105 tOxlO4 1.OxlO’ tOxlO6 D Ci 0 1.Ox10 a, C, 1.0x103 Ca iOxlO’ e * Time (h) ‘4 a a * -- Time (h) ‘A EpaqQVJT ApaqP Strains C WT ApaqQlspaqP Strains Caco-2 EpaqP -tpaqQ I I 7 8 9 10 *1.0x106 1.o1o i.0x106 I 1 I I I I 123456 Time (h) * F, AI 1pqP ApaqQ Strains 42 Figure 3.3. ApaqP and z\paqQ mutants exhibit a statistically significant increase in short- term intracellular survival in macrophages and epithelial cells 9 hr post-infection. WT (filled), ApaqP (striped) and ApaqQ (white) C. jejuni were grown overnight in MR shaking broth to log phase. (A) A murine macrophage cell line, RAW264.7, and (B) a human epithelial cell line, 1NT407, and (C) Caco-2, a human intestinal epithelial cell line, were infected with bacteria at an MOT 200. After 3 hr, the cells were washed with PBS and treated with 150 jig/mi of gentamicin for an additional 2 hr to kill extracellular bacteria before washing the cells and adding fresh media with 10 jig/ml gentamicin; after an additional 4 hr, intracellular bacteria were recovered and plated for CFU enumeration. All experiments included triplicate infections for each strain for each time point. The asterisk (*) represents statistical significance (p <0.05) using a two-tailed t-test. This result is a representative experiment of three separate repeats. 43 3.6 No significant differences between the 4paqP mutant and WT C. jejuni colonization were observed in vivo using a mouse infection model. To evaluate whether the enhanced in vitro intracellular survival of the AA-ABC mutants might also reflect a survival difference in vivo, we infected BALB/cByJ mice with WT and z\paqP mutant strains according to a previously established mouse colonization model (Pajaniappan et al., 2008; Pei et al., 1998). Colonization was monitored for seven to 35 days. zXpaqP mutant C. jejuni colonization levels did not significantly differ from the WT at any given time point (Figure 3.4). It should be noted that although WT C. jejuni colonized the mouse intestinal tract at a significant and high level up to 28 days, this and other tractable animal models do not consistently trigger inflammation and thus can only assay colonization, not virulence (Chang and Miller, 2006; Hendrixson and DiRita, 2004). 44 1 xl 012 Day7 Dayl4 Dayl9 Day28 Day35 . 1 x101 _____ • • A •.• cop •• Co - 1x100 °“D • 0 1X1009. :. 00 • •. 00 lxlQ°8 0 . . lxlO°7 0 0 lxlO°6- . 0 05 0iXi’.i •. 0 > .0 . 1x10°- 0 . 0 0 • lxiO°3 • 0 c 1 xlO°2 limit of detection lxi 001 1 xlO°° i I I I I WT LpaqP WT bpaqP WT EipaqP WT zpaqP WT ApaqP Strains Figure 3.4. IpaqP is not defective for mouse colonization in vivo. WT (solid circle) and the ApaqP mutant (open circle) C. jejuni colonized BALB/cByJ mice at a similar level from day 7 up to day 35 post-infection. The dashed line indicates the level of detection, which was 1 x 102 CFU/g fecal pellet. Values on the x-axis represent mice with no detectable colonization. This experiment was performed by Rhonda Hobbs from the Thompson Lab in the Medical College of Georgia. 45 3.7 z\paqP and 4paqQ C. jejuni mutants exhibit increased resistance to limited CO2 and aerobic conditions. To survive successfully throughout the pathogenesis cycle, C. jejuni must overcome a multitude of environmental stresses in both extracellular and intracellular environments (Mihaljevic et al., 2007). As a microaerophilic organism, C. jejuni requires elevated levels of CO2 for normal growth and is sensitive to atmospheric levels of 02. To examine whether mutation of this AA-ABC transporter influenced the growth of C. jejuni under sub-optimal gas conditions, mid-log phase bacteria were serially diluted, spotted onto MH agar, and allowed to grow in a 5% (vs. ideal 12%) CO2 environment. Under these conditions, both the z\paqP and ApaqQ mutants grew better than the WT strain (Figure 3.5A). To specifically evaluate aerobic sensitivity, WT and mutant C. jejuni were grown microaerobically in broth culture, shifted to normal aerobic atmospheric conditions, and assayed for survival after 4-6 hrs by CFU enumeration. Consistent with the CO2 growth observations, both mutants exhibited sustained survival under aerobic conditions compared to the WT strain (Figure 3.5B). 46 A 5% CO WT ApaqP ApaqQ B —E . D LL DC..) Cl) 5c: 0 aerobic survivaJ WT tpaqP zXpaqQ Figure 3.5. zXpaqP and zXpaqQ are more resistant to aerobic stresses than WT. (A) Log phase cultures grown microaerobically were serially diluted, plated and incubated in a 5% CO2 incubator at 37°C overnight. (B) Log phase cultures WT (solid), ApaqP (striped), and ApaqQ (white), grown microaerobically, were shifted to normal atmospheric oxygen conditions for 4 and 6 hr before being serially diluted, plated and incubated under microaerobic conditions for 2 days for CFU enumeration. Error bar represents assay replicates (n=3) of bacteria recovered at each time point. This result is a representative experiment of three separate repeats. The asterisk (*) indicates a statistically significant difference between the mutants and WT (p<O.O5). serial lO4old dilutions * * * r 4. 6 Time (hour) 47 3.8 i\paqP and tpaqQ C. jejuni mutants exhibit an increase in resistance to organic hydroperoxide tBOOH, but not inorganic peroxides H20and paraquat. 02- and C02-related stress responses are often closely associated with other oxidative stress responses in C. jejuni (Alter and Scherer, 2006; Baillon et al., 1999). We thus investigated whether loss of this AA-ABC transporter system in C. jejuni might also influence responses to other oxygen derivatives such as reactive oxygen species (ROS). WT, ApaqP and ApaqQ mutant C. jejuni were treated for 30 mm with hydrogen peroxide (H20), an inorganic peroxide frequently generated by macrophages as a defense mechanism to eradicate intramacrophage pathogens (Alter and Scherer, 2006), or tert-butyl hydroperoxide (t-BOOH), an organic peroxide also generated by host cells (Baillon et al., 1999). While neither mutant exhibited altered sensitivity to H20 or paraquat (Figure 3.6A, 3.6B), both displayed increased resistance to t BOOH (Figure 3.6C). ApaqP in particular was found to exhibit higher t-BOOH resistance than WT at a statistically significant level. Although ApaqQ did not exhibit a statistically significant difference relative to WT, experimental repeats consistently showed a higher t-BOOH tolerance of zxpaqQ relative to WT. Together, our data indicate that disruption of this AA-ABC system impacts aerobic and ROS sensitivity in C. jejuni. 48 A B Paraq uat _E —.-tpaqP -.ApaqQ Concentration (mM) 10 tert-butyl hydroperoxide —.-ApaqP “r.tpaqQ 0.01 0.00 01)1 0.02 01)3 1104 Concntratien (mF Figure 3.6. The ApaqP mutant exhibits a significant increase in resistance to tert-butyl hydroperoxide (t-BOOH) but not to hydrogen peroxide (11202) or paraquat. WT (square), ApaqP (circle) and ApaqQ (triangle) were treated with (A) H20,(B) paraquat, or (C) t-BOOH at various concentrations and incubated microaerobically at 37°C for 30 minutes before being harvested for CFU enumeration. All samples were taken in triplicates at each concentration. The asterisk (*) represents statistical significance (p-value <0.05) using a two-tailed t-test. Hydrogen peroxide 10 ApaqP >LL .a 0 0.1 0.01 0.001 0.0001 0.0 0.5 1.0 1.5 2.0 Concentration (mM) C 49 3.9 Tolerance to heat and osmotic stress is differentially altered in .‘ipaqP and zipaqQ mutants To examine if the ApaqP and /ipaqQ mutants exhibit other stress tolerance alterations, the mutants were also subjected to heat and osmotic stress assays. To test heat tolerance, mid-log phase bacteria were diluted to 0D600 0.2 in MH broth, and serial dilutions were spotted onto MR agar and grown under microaerobic conditions at 45°C, a mild heat stress condition for C. jejuni (Phongsisay et al., 2007; Brondsted et at., 2005; Park, 2002; Konkel et at., 1998). As a control, cultures were harvested and plated at 37°C (Figure 3.7A). While ApaqP exhibited an approximate 10-fold increase in heat stress resistance compared to WT, ApaqQ was approximately 10-fold more sensitive to heat stress than WT (Figure 3 .7B). Similar results were obtained when the strains were subjected to growth under osmotic stress using MR agar with 0.17 M NaC1: the ApaqP mutant exhibited increased resistance to osmotic stress compared to WT, while the ApaqQ mutant was more sensitive to NaC1 (Figure 3.7C). 50 A serial 10-fold dilutions 37°C B 45°C C 37°C with O.17M NaCI WT ApaqP ApaqQ WT ApaqP ApaqQ LpaqPc Figure 3.7. The zXpaqP mutant is more resistant to hçat and osmotic stress while the txpaqQ mutant is more sensitive than WT. Overnight bacterial cultures were serially diluted from an initial concentration of 0D600 O.2. (equivalent to approximately 1x109 cfu!ml) and grown microaerobically for 2 days at (A) 37°C and (B) 45°C on MR agar to assess the response to heat stress, or at (C) 37°C on MR agar supplemented with O.17M NaCl to assess the response to osmotic stress. This result is a representation of more than three separate repeats. 51 3.10 Macrophages infected with C. jejuni txpaqP and ApaqQ exhibit reduced apoptosis an( ERK activation compared to macrophages infected with WT bacteria. The observations described above suggested that the enhanced intracellular survival of the zXpaqP and zXpaqQ mutants can at least partly be attributed to enhanced or altered bacterial stress tolerance. As host cell death results in detachment of the cells from the tissue culture surface and a resultant loss of C. jejuni inside those cells from the intracellular survival assay counts, we hypothesized that the observed increase in intracellular survival of the mutants might also reflect increased host cell survival. To investigate this, we separately monitored levels of host cell apoptosis and cell viability using Annexin-V Fluor and DAPI staining, followed by visualization using fluorescent microscopy. Cells were also stained with anti-Campylobacter jejuni antibody to ensure infection (data not shown). Cell viability levels were assessed by counting the number of cell nuclei remaining on the cover-slip that were neither condensed nor fragmented following infection. Consistent with previous findings in THP- I human macrophages (Siegesmund et al., 2004), apoptosis was induced in WT C. jejuni-infected RAW264.7 cells (Figure 3.8A). However, apoptosis was significantly reduced in zXpaqP- and z\paqQ-infected cells compared to WT-infected cells (Figure 3.8A), by 66% and 55%, respectively (Figure 3.8B). The ratio of viable cells in WT-infected RAW264.7 cells relative to uninfected cells was approximately 30% less than that of the zXpaqF- and ApaqQ- infected cells (Figure 3.8C). Finally, to explore if reduced levels of apoptosis observed in ApaqP- and ApaqQ infected RAW264.7 macrophages correlated with altered host cell signal transduction pathways, we examined phosphorylation of several MAP kinases known or suspected to be induced upon C. jejuni infection (Chen et al., 2006; MacCallum et al., 2005; Watson and Galan, 2005). We found that ERK phosphorylation levels in RAW264.7 macrophages infected with either ApaqP or ApaqQ were severely diminished compared to WT-infected cells at 9 hr post-infection (Figure 3.8D). In contrast, iNK and p38 phosphorylation levels were similar in macrophages infected 52 with WT and mutant strains, as were p-ERK levels at time points where the mutants did not exhibit invasion or intracellular survival differences from WT (Figure 3.8D, and data not shown). Levels of phospho-ERK INT407 or Caco-2 epithelial cells infected with either ApaqP or ApaqQ were also similar to those observed for WT-infected cells (Figure 3.9). These data indicate that this AA-ABC transporter system participates in ERK activation in C. jejuni-infected macrophages. 53 kDa 60 50 40 60 50 40 kDa DIC Annexin-V B * 3.0% V >, 1.0% xa C 0.0% C A UI WT bpaqP ApaqQ D * I ml ApaqP ApaqQ Strains * I * I Cli, ‘— l_ LO. a,— .Dø UI WTApaqPApaqQ UI WT ApaqP ApaqQ Strains UI WTApaqPApaqQ _,__ p-ERK1/2 ERK F* p-JNK2/3[•* p-JNK1 40 JNK 54 Figure 3.8. ApaqP and ApaqQ infected cells showed decreased levels of apoptosis and ERK activation compared to WT infected cells. (A) C. jejuni infected RAW264.7 cells were stained with Armexin-V fluorescein to visualize apoptotic cells at 9 hr post-infection with gentamcin treatment as mentioned in materials and methods. Frames shown are one representative view of several different frames. Scale bar= 5 jiM. (B) Percentage of Annexin-V stained cells per total number of cells at i OX magnification. Error bar represents counts from several random fields. (C) C. jejuni infected RAW264.7 cells were stained with DAPI and cellular viability was assessed by counting cellular nuclei per random field. Error bar represents numbers of DAPI counts from a multiple random fields. (D) Phospho-ERK levels were induced at the 9 hr time point in WT but not ApaqP and zpaqQ-infected RAW264.7 cells. ERK1/2 phosphorylation (42 and 44 kDa) was detected by Western blot using anti-phospho-p44/42 MAPK (Thr202/Tyr204) antibody. The membrane was stripped and reprobed with anti-ERK antibody to assess total ERK protein levels as a control. JNK phosphorylations (46k Da and 54 kDa) were detected using Western blot using anti-phospho-SAPKIJNK (Thri 83/Tyr 185) antibody. The membrane was stripped and re-probed with anti-JNK1 antibody to assess total iNK protein level as a control. This is one representative experiment of three separate repeats. 55 A B 1NT407 Caco2 UI Wt ApaqP ApaqQ UI WT ApaqP tpaqQ kDa kDa 60— 50 50 40— p-ERK1/2 30— 20— kDa kDa 60—i 50— _____ 40— RK 40_ 30 30— _______ __ 20— _____________ C 1NT407 UI WT ipaqP zpaqQ kDa 60— 50 40— — p-JNK 30— kDa 40 JNK 30_ Figure 3.9. ApaqP and zXpaqQ infected Caco-2 and 1NT407 epithelial cells show similar p ERK and p-JNK levels as WT infected cells. 1NT407 and Caco-2 cells were infected with WT and mutant C. jejuni for 9 hr before being harvested for cell lysate preparation. 56 3.11 A summary of phenotypes for which ApaqP and ApaqQ mutants were not sinificantIy different from the WT strain. In order to understand the role of the AA-ABC system in bacterial stress tolerance, several additional phenotypic tests related to physiological stresses were examined in the ApaqP and ApaqQ strains. These included bacterial growth under microaerobic conditions, survival in minimal media or minimal media supplemented with serum, survival under anaerobic and low iron conditions, as well as antimicrobial susceptibility, pH stresses, heat shock, motility and bioflim formation. To assess if the mutants exhibited any difference in their ability to survive in minimal media +1- additional glutamine, glutamine was added to MEM and survival was monitored over time. In addition, to test if glutamine supplementation rescued host cell viability during C. jejuni infection, a glutamine rescue assay was performed by supplementing the culture medium with excess glutamine during infection, and cells were stained with DAPI to assess host cell viability. Finally, levels of protein secretion and GGT activity in WT and mutants were also examined (Table 3.1) 57 Table 3.1. Phenotypes that were indistinguishable between 4paqP, ApaqQ mutants and WT C. jejuni8l-176 - PHENOTYPE COMMENTS FIGURE/TABLE Microaerobic growth No statistical significant difference (MH broth) between WT and mutants Figure 3.1 OA Minimal media survival No statistical significant difference (MEM) between WT and mutants Figure 3.1 OB Rich media survival (DMEM+ 10% heat-inactivated No statistical significant difference FBS) between WT and mutants Figure 3.IOC Anaerobic growth curve (MR No statistical significant difference broth) between WT and mutants Figure 3.1 1 Low iron conditions (desferal No significant difference between and dipyridyl) WT and mutants Table 3.2 No significant difference between Antimicrobial agents WT and mutants Table 3.2 Lethal at pH4, pH5, pH9. Optimal growth atpH6 andpH7. No statistical significant difference pH sensitivity test (MR agar) between WT and mutants Not shown 5 minute treatment showed identical results from untreated samples shown 55°C Heat shock in Figure 3.7A Not shown No difference between WT and Motility mutants Figure 3.12 No statistical significant difference GOT assay between WT and mutants Figure 3.13 Supplementation of glutamine to RAW264.7 and 1NT407 cells during WT C. jejuni infection did not show Glutamine rescue assay any difference in DAPI staining from (Infection in DMEM+10% FBS cells without glutamine -1+ 40mM glutamine) supplementation. Not shown Protein secretion No significant difference between (Culture supernatant) WT and mutants Figure 3.14 Nutrient deprivation assay No significant difference between (Survival in MEM-/+ 40mM WT and mutants in optical density or glutamine) CFU measurement. Figure 3.15 58 A l.0x10° — WT 80 B Time(h) 1.0c10’ :. L0x10 1.0x10 1.0x10 ) 5 10 15 20 25 Time (h) C 1.0x10° - wr - .paqP ApaqQ D U Time (h) Figure 3.10. ApaqP and ApaqQ mutants survive similarly to WT C. jejuni in rich or minimal media. (A) Shaking culture in MH broth at a starting optical density of 0D600 0.006 and (B) MEM at a starting optical density of OD600 0.02 (C) DMEM with 10% heat-inactivated FBS at a starting optical density ofOD600=0.02. 59 1.0x108 Figure 3.11. LspaqP and ApaqQ mutants exhibit similar survival as the WT strain under anaerobic conditions over time. Log phase C. jejuni were diluted to 0D600 -0.03 in MH broth. Cultures were placed in a sealed jar with an Anaero-GasPak, and incubated at 37°C, shaking at 200 r.p.m. Serial dilutions of cultures were made at each time point and spotted onto agar plates for CFU enumeration. Table 3.2. Antimicrobial Susceptibility test. Using diffusion discs, the zone of inhibition diameter was recorded (mm). Antimicrobial Type agent Amount WT 4pagP ApagQ Iron chelator Dipyridyl 0.4j.imol 10 11 10 Iron chelator Desferal 0.4pmol R* R R Aminoglycoside Amikacin 30ig 27 25 30 Fluoroquinolone Nalidixic Acid 30ig 38 38 38 Macrolide Erythromycin l5jig 40 40 40 Resistant, no zone of inhibition. D U C.) cu U) Cu I C.) Cu 1.0x107 1.0x106 1.0x105 1.0x104 1.0x103 1.0x102 1.0x10 1.OxlO° 1.0x10 1.0x102 —.— WT — ApaqP e•ApaqQ 0 10 20 30 40 50 60 70 80 Time (h) 60 3.12 WT and mutant C. jejuni exhibit similar tolerance to heat shock and pH stresses. To test tolerance to heat shock, log phase bacteria were diluted in MH broth and heated at 55°C for 5 mm or 15 mm before harvesting the bacteria for serial dilutions and microaerobic growth for 2 days at 37°C for CFU enumeration. While no bacteria were recovered from the 15 mm time point, the number of CFU recovered from the bacteria treated for 5 mm was identical to the untreated sample (Figure 3.7A). No differences were observed among the strains. To assess tolerance to a range of pH (pH 4-. pH 9), log phase bacteria were diluted and spotted onto MR agar at different pHs. All C. jejuni strains exhibited optimal growth under neutral, or slightly acidic environments (pH 6-7), and were sensitive to acidic (pH 4, 5) and basic (pH 9) conditions. No differences were observed between WT and mutants. 61 Figure 3.12. ApaqP and ApaqQ mutants do not exhibit a motility defect in 0.4% agar. Log phase C. jejuni were diluted to 0D600 - 0.02 and 1 l of each strain stabbed into MR agar plates containing 0.4% agar. Migration of the cells from the point of inoculation was analyzed following 24 hr of incubation at 37°C under microaerobic conditions. The experiment was performed in 3 replicates. 2.00 1.75 1.00• 0 10 5;, Figure 3.13. Rates of GGT activity in ApaqP and tipaqQ mutants do not significantly deviate from WT C. jejuni. Absorbance was measured at 405nm at a 10 mm interval. International unit (U/ml) measurements were obtained by multiplying the absorbance reading by 2.211 according to the manufacture’s protocol. Protein concentrations (mg/ml) of each bacterial lysate sample were measured using a Bradford assay. The experiment was performed in replicates (n=10), and this is one representative experiment of three separate repeats. —.--WT —.- iXpaqP --h-- EpaqQ 0 0• C C., C 0(3 1.25 C Cu C 0.75 C I C) C I I I 10 20 30 Time (Minutes) 62 kDa 95 72- 55 36— 17— Figure 3.14. ApaqP and t’paqQ mutants exhibit a similar protein secretion profile as WT C. jejuni. Culture supernatants were collected from overnight C. jejuni cultures, and proteins were prepared for TCA precipitation and SDS-PAGE silver staining. ApaqP ApaqQ 28 — 63 AD LI.. C) ci) 0 C) Cu a) C) cu B E 0 0 Cø >% 0 C a) Cu U 0. 0 Time (hr) — WT (MEM+gln) EpaqP (MEM+gln) ‘ tpaqQ (MEM+gln) —a--WT(MEM) -a-- zpaqP(MEM) .-e EpaqQ (MEM) C Time (hr) MEM (-Gin) MEM (+GIn) O.Q. WT FiI. ,paqP ApaqQ paqPc WT ApaqP ApaqQ ApaqPc Strains Figure 3.15. zXpaqP and ApaqQ mutants and WT C. jejuni survive similarly in minimal essential media supplemented with L-glutamine. Log phase C. jejuni were grown in 1 Oml MEM with 1% NEAA supplement in the absence or presence of 40 mM L-glutamine. Bacteria were grown microaerobically under shaking conditions and cultures were harvested at each time point and diluted for (A) CFU enumeration or (B) Absorbance reading at 600nm. (C) Final cell yields after 24 hr microaerobic growth in MEM minimal medium only or with glutamine. Cells were measured at 600 nm. No significant difference was observed between the WT and mutant strains. The experiment was performed in triplicate and repeated 3 times. 64 O (l C ON C riD C C. jejuni pathogenesis depends on the organism’s ability to survive diverse conditions encountered in the external environment, in the intestinal tract, and inside epithelial and immune system cells. External stresses frequently challenging C. jejuni include heat, osmotic, oxidative, and aerobic stress as well as nutrient limitation. Growing evidence also indicates that C. jejuni can survive intracellularly within host enterocytes and macrophages (Watson and Galan, 2008; Young et al., 2007; Day et al., 2000), suggesting that C. jejuni must also tolerate intracellular stresses for sustained survival. However, specific factors promoting intracellular bacterial survival and triggering host cell signal transduction pathways remain largely unknown. In this study, we have investigated the biological and pathogenesis-related roles of a putative C. jejuni AA-ABC transporter originally annotated as Cj0467-9. As both the integral membrane protein, or permease, and ATP binding proteinlATPase components are frequently required to produce a functional AA-ABC transporter (Nikaido, 2002), we generated non-polar mutations in both the Cj0467 (PaqP) permease and the Cj0469 (PaqQ) ATPase to ensure a comprehensive analysis of the system’s functions. Bioinformatics analyses predicted this AA ABC system to be a glutamine ABC transporter with high homology to glutamine ABC transporters in Helicobacter, Streptococcus and Pseudomonas spp.; a previous study also suggested that this system may be a putative cysteine ABC transporter coupled to CjaA, a cysteine substrate binding protein (Muller et al., 2005). Our amino acid transport assays indicate that the transporter does not exhibit specificity exclusively for a single amino acid, since both ApaqF and i\paqQ mutants were defective for the uptake of glutamine, glutamate, cysteine and asparate. Nevertheless, glutamine appeared to be a preferred substrate, since both mutants exhibited a more severe decrease in glutamine uptake compared to the other amino acids. We observed some residual glutamine transport in the ApaqP and ApaqQ mutants (Figure 3.2), and preliminary glutamine uptake competition assays performed on the z\paqF and ApaqQ mutants (unpublished observations) likewise indicate that that there is likely a redundant mechanism for 66 glutamine transport in C. jejuni. This notion is supported by the previous annotation of cjO94Oc and cj0902 as glnP and glnQ which, fike paqP and paqQ, are present in all sequenced strains of C. jejuni (Pearson et al., 2007; Hofreuter et al., 2006; Parkhill et al., 2000) Our previously published microarray analysis identifying a significant increase in levels of cj0467-9 mRNA during 1NT407 cell infection (Gaynor et at., 2005) suggested a potential role for this AA-ABC transporter in C. jejuni pathogenesis. Infection assays using 1NT407 cells, Caco-2 cells and RAW264.7 macrophages revealed no significant differences in adhesion, invasion, or long-term intracellular survival at 24 hr for the ApaqP and ApaqQ mutants compared to WT. Mouse colonization levels were likewise similar for C. jejuni WT and mutant- infected animals, at both shorter- and longer-term time points. Surprisingly, however, an apparent increase in short-term intracellular survival was observed for the ApaqP and ApaqQ mutants in 1NT407, Caco-2 and RAW264.7 infected cells 9 hr post-infection. This is in contrast to observations for other genes identified in the aforementioned microarray cluster as up- regulated during cell infection: both AspoT and pVir mutants are diminished for invasion (Gaynor et al., 2005; Bacon et al., 2002; Bacon et at., 2000), and AspoT is also defective for intracellular survival (Gaynor et at., 2005). Our findings also deviate from previous studies on the C. jejuni Peb 1 asparatate/glutamate binding protein mutant (Leon-Kempis Mdcl et al., 2006; Pei et al., 1998), as well as a Group B Streptococcus glutamine ABC transporter AglnQ mutant (Tamura et al., 2002), where significant infection defects were observed both in vitro and in vivo. One initial hypothesis to explain the enhanced intracellular survival of the ApaqP and ApaqQ mutants was that they may be more resilient to stresses occurring inside cells. For instance, the intracellular environment will have different 02 and CO2 levels than the intestinal tract or the external environment. Furthermore, as a defense mechanism, host epithelial cells and macrophages produce oxygen derivatives and reactive oxygen species (ROS) to generate a 67 highly oxidative environment (Baillon et a!., 1999; Purdy et at., 1999; Shepherd, 1986). Consistent with this hypothesis, the zXpaqP and ApaqQ mutants exhibited an increased ability to grow in a sub-optimal CO2 environment, as well as an increased resistance to aerobic and t BOOH organic peroxide stresses. Interestingly, it was recently shown that a gamma glutamyl transpeptidase (GGT)-deficient C. jejuni mutant (Aggt) exhibited increased invasion efficiency concomitant with increased H20 resistance (Barnes et at., 2007). GGT is involved in the degradation of glutathione to amino acids or peptides in the gamma glutamyl cycle, and glutathione has been previously implicated in resistance to oxidant-mediated killing in eukaryotes (Shi et at., 1993; Tate and Meister, 1981). Although a connection between our observations and GGT is plausible, particularly given the involvement of related molecules (i.e., amino acids such as glutamine) in both pathways, several lines of evidence suggest that our AA ABC transporter system affects stress responses independent of GGT: our mutants were not hyper-resistant to H20 (Figure 3.6), a Aggt mutant was previously found to be defective for mouse colonization (Hofreuter et a!., 2006), and there was no apparent alteration of GOT activity in our mutant strains (Figure 3.14). The aerobic, CO2. and oxidative stress phenotypes of /ipaqP and ApaqQ are also distinct from those observed in an AnssR mutant, even though nssR (cj0466), which is involved in nitrosative stress response regulation (Elvers et a!., 2005), is directly upstream of and likely co-transcribed with paqP and paqQ. Although little is known about aerotolerance and CO2 stress survival in C. jejuni, the stringent response, which is modulated by the spoT gene, has also been shown to be up-regulated during cell infections, and was found to be important for both low CO2 and high 02 stress survival (Gaynor et a!., 2005). C. jejuni also harbours a multitude of oxidative stress regulators to target a specific type of ROS. For instance, while H20 is readily degraded by catalase (Day et a!., 2000), organic peroxides such as t-BOOH are degraded by alkyl hydroperoxide reductase, known as AhpC (Klancnik et at., 2006). It is 68 possible that PaqP and PaqQ are involved in this organic peroxide degradation pathway through means yet to be identified, or that this AA-ABC transporter system participates in oxidative stress tolerance by a novel mechanism. Previous studies in Salmonella typhimurium and C. jejuni suggested that cross-talk exists between oxidative and heat or osmotic stress responses (Phongsisay et al., 2007; Andersen et al., 2005; Brondsted et al., 2005; Rychlik and Barrow, 2005; Stead and Park, 2000; Lee etal., 1995). Since an increase in oxidative stress resistance was observed in both z\paqP and ApaqQ mutants, we suspected that these mutants may also exhibit an increased resistance to heat and salt treatments. As predicted, the zXpaqP permease mutant likewise tolerated heat and osmotic stresses better than WT; however, the paqQ ATPase mutant was unexpectedly more sensitive than WT to both heat and osmotic stresses. Thus, although both components are important for amino acid uptake, and participate in host cell interactions and oxidative/aerobic stress responses, they appear to exhibit differential functions in thermoregulation and osmoregulation. Although similar observations have not previously been reported, and thus no literature is currently available to help account for this phenomenon, several hypotheses may explain why loss of a permease or ATPase could have different consequences on specific aspects of bacterial physiology. For instance, as soluble proteins, ATPases harbor a certain level of promiscuity (Wyckoff et al., 1999; Schlosser et al., 1997; Wilken et al., 1996; Hekstra and Tommassen, 1993). Thus, an ATPase may couple with other ABC transporter systems in the absence of a functional permease, while a system that has lost ATPase function but retains functional permease proteins may be at least partially rescued by another ATP binding protein. This hypothesis is also consistent with the high degree of homology (52.9% identity) observed between PaqQ and Cj0902/GlnQ. Alternatively, absence of an ATPase may result in reduced AlP consumption, causing a general disruption in energy balance. Another possible interpretation is that the PaqP permease and PaqQ ATPase may exert distinct effects on gating 69 small solutes or metabolites important for balancing the membrane electropotential gradient, which has been associated with osmoregulation and shock resistance in E. coli (Berger and Heppel, 1974). Extensive future studies will be required to distinguish between these possibilities. In addition to characterizing physiological differences between the C. jejuni mutants, we also investigated if this AA-ABC transporter system might alter host cell viability, thereby also affecting the number of viable bacteria (CFU5) recovered in the intracellular survival assay. Interestingly, RAW264.7 cells (but not 1NT407 cells) infected with mutants exhibited approximately 30% higher viability than cells infected with WT bacteria at the short-term intracellular survival time point. Consistent with the cell viability data, ApaqF- and A.paqQ infected RAW264.7 macrophages also displayed a significantly lower level of apoptosis, or programmed cell death, as assayed by Annexin-V staining. Several previous reports have also made tangible connections between host cell cytotoxicity and specific C. jejuni virulence factors, although the literature varies considerably depending on C. jejuni strain and host cell type used. For instance, one study reported that apoptosis of 28SC monocytes induced by infection with C. jejuni strain 81-176 was dependent on cytolethal distending toxin (CDT) (Hickey et a!., 2005), a DNase-like molecule that causes host cell cycle arrest (Lara-Tejero and Galan, 2000; Whitehouse et a!., 1998). However, another study reported that apoptosis of THP- 1 monocytes by C. jejuni strain F3801 1 was CDT- and lipooligosaccharide (LOS)-independent [in contrast to LPS observations for other pathogens (Guiney, 2005; Navarre and Zychlinsky, 2000)] and instead involved secreted C. jejuni Cia proteins (Siegesmund et a!., 2004; Konkel et a!., 1999). A third study reported that T84 enterocytes underwent oncosis (not apoptosis) in response to C. jejuni infection that was dependent on the C. jejuni strain used (i.e., more invasive strains were more oncotic) as well as the F1aAB flagellins, but was independent of CDT (Kalischuk et a!., 2007). We have not observed any obvious differences in secreted protein profiles between our WT and ApaqP or ApaqQ mutant strains (Figure 3.15). Nonetheless, it will be very interesting to 70 explore, in future work, potential connections between our findings and those described in the above studies. To explore mechanisms underlying the effect of this AA-ABC transporter system on macrophage apoptosis, we next investigated whether several host cell MAP kinase proteins exhibited altered phosphorylation profiles in WT compared to mutant-infected cells. Each MAPK signaling molecule investigated is essential for eukaryotic cell growth and survival (Shan et al., 2007; Schorey and Cooper, 2003). C. jejuni has been shown to activate these signaling pathways, which in turn leads to significant downstream effects, including cytokine production and host cell damage (Chen et al., 2006; MacCallum et al., 2005; Watson and Galan, 2005). Interestingly, deletion ofpaqP orpaqQ in C. jejuni abrogated ERK phosphorylation in RAW264.7 cell infections at the same short-term intracellular survival time point assayed for cell viability (Figure 7C). In contrast, WT, /xpaqP, and zXpaqQ elicited similar ERK activation profiles during TNT4O7 and Caco-2 epithelial cell infections, and during later infection timepoints in RAW264.7 cells (Figure 3.9 and data not shown). INK and p38 kinase, which participate in different MAPK signaling pathways, also displayed no significant differences in phosphorylation between WT and mutant-infected RAW264.7 cells. Our observation that this AA-ABC transporter system participates in ERK activation during macrophage infection was an unexpected and novel finding. It is also interesting to hypothesize that this may at least partially contribute to our observed PaqP- and PaqQ-induced macrophage apoptosis. The role of ERK activity in apoptosis has been controversial. Some studies have proposed that ERK is important for cell proliferation, survival and anti-apoptosis (Huang et al., 2007; Larson et al., 2007; Marin-Kuan et al., 2007). However, other studies have revealed that ERK activation contributes to cisplatin-induced apoptosis in HeLa and A549 cells and hydrochloric-inomenine-induced apoptosis in RAW264. 7 cells (Xaus et al., 2001; Wang et al., 2000) as well asH20-induced apoptosis in intestinal epithelial cells (Zhou et al., 2005). 71 Additionally, ERK activation in macrophages has been suggested to participate in caspase independent apoptotic signal transduction during Group B Streptococcus infection (Fettucciari et al., 2003). Activation of ERK and pro-inflammatory cytokines is also often stimulated by virulence determinants such as LPS via toll-like receptor (TLR) signaling (Thomas et al., 2006; Guha and Mackman, 2001). Future work will be required to determine if this is also the case during C. jejuni infection, However, to date there have been no connections made between C. jejuni and host cell TLR4 activation, and as noted above, at least one study suggested that C. jejuni-induced macrophage apoptosis may be LOS-independent (Siegesmund et al., 2004). Interestingly, glutamine has also been implicated as an anti-apoptotic factor. For instance, glutamine supplementation has been shown to reduce apoptosis of human intestinal epithelial cells in a maimer that may interface with the ERK activation pathway (Larson et al., 2007; Evans et al., 2005; Evans et al., 2003). Furthermore, glutamine depletion was found to elicit apoptosis in epithelial cells and immune cells such as T-cells and neutrophils (Chang et al., 2002). Thus, one working hypothesis to explain the increased host cell death observed for WT vs. ApaqF and ApaqQ mutant-infected cells is that to acquire nutrients, intracellular C. jejuni may hijack glutamine (and likely other amino acids) from host cells, and that this AA-ABC transporter system, which is up-regulated during cell infection, participates in this process. Preliminary experiments exploring glutamine supplementation during cell infections have not to date identified an effect on our C. jejuni-induced macrophage apoptosis (Figure 3.16). However, this hypothesis is consistent with our previous observations that C. jejuni requires the stringent response (spoT) and polyphosphate kinase 1 (ppkl) for both survival in low-nutrient environments and in an intracellular environment (Candon et al., 2007; Gaynor et al., 2005), as well as recent work suggesting that C. jejuni resides intracellularly in an anaerobic and likely nutrient-poor vacuole (Watson and Galan, 2008). 72 In summary, we have provided evidence that the AA-ABC transporter system components PaqP and PaqQ participate in several key aspects of C. jejuni stress survival and pathogenesis, some of which are novel not only for C. jejuni but for other bacteria as well. Our work has also created additional links between C. jejuni disease etiology, physiology, and basic metabolic processes (i.e., amino acid uptake), an increasingly emerging theme in the study of this prevalent pathogen. Future work aimed at addressing the hypotheses above as well as identifying potentially unpredicted functions for this system should yield additional insight into C. jejuni biology and pathogenesis and potentially uncover new roles for AA-ABC transporters in other bacteria as well. 73 I We have shown that PaqP and PaqQ are involved in several key aspects of C. jejuni physiology and biology. For instance, we found that in the absence of PaqP or PaqQ, C. jejuni exhibited an increased tolerance to CO2 and aerobic stress. This is in direct contrast to observations with the AspoT stringent response mutant, which exhibits an increase in sensitivity to aerobic and CO2 stresses (Gaynor et al., 2005). Thus, one ensuing hypothesis is that diminished nutrient (i.e., glutamine) uptake may cause ApaqP and ApaqQ to up-regulate the stringent response in order to survive the unfavourable nutrient-limited condition. To test this, we will first examine levels of spoT transcription in the mutants vs. WT by Real-Time quantitative PCR. Second, we will assess levels of the stringent response effector molecule guanosine tetraphosphate (ppGpp), which is synthesized by SpoT during times of nutrient stress and binds RNA polymerase to elicit global transcriptional changes to the stress condition. This will be accomplished by labeling WT and mutant strains with 32P and detecting ppGpp and its precursor pppGpp by Thin Layer Chromatography. If a deficiency in AA uptake in mutants defective for our AA-ABC transporter system activates the stringent response, then lack of PaqP or PaqQ should increase spoT transcription and/or ppGpp synthesis. We have also demonstrated that PaqP and PaqQ impact intracellular survival, host cell death, and the ERK-MAPK signaling pathway. However, it is not completely understood whether PaqP and PaqQ induce macrophage apoptosis via ERK-MAPK dependent signaling independent of or dependent on other bacterial apoptosis-inducing factors, such as the CDT. Since the CDT has been postulated as a major inducer of apoptosis in C. jejuni infected cells (Hickey et al., 2000), one future question is whether PaqP and PaqQ enhance apoptosis in a CDT-dependent or -independent manner. One approach to explore this will be to generate AcdtBtxpaqP and AcdtBzXpaqQ double knockout mutants and compare levels of apoptosis in RAW264.7 macrophages infected with WT, zXpaqP, zipaqQ, AcdtB, /cdtBApaqP, and 75 AcdtBApaqQ mutants. If CDT induces apoptosis in RAW264.7 cells in a PaqP- and PaqQ dependent manner, or vice versa, levels of apoptosis induced by all mutant strains should be similar to each other. Conversely, if PaqP and PaqQ induce apoptosis in RAW264.7 cells in a CDT-independent manner, we would expect infection with AcdtBzXpaqF or z\cdtBApaqQ double mutants to result in significantly reduced apoptosis compared to single mutant ApaqF, ApaqQ and z\cdtB-infected cells. Regardless of the outcome, this study will introduce a novel paradigm further associating this ABC transporter with pathogenesis during bacterial infection. To date, nothing has been explored regarding the correlation of PaqP and PaqQ with MAPK signaling pathways, nor is much understood about C. jejuni induction of MAP kinase activation in general. Hence, we are also interested in investigating the upstream molecular effects of PaqP and PaqQ on the activation of ERK signaling in macrophages during C. jejuni infection. One of our hypotheses is that this ABC transporter system, or another C. jejuni factor (i.e., an outer membrane protein or other cell surface component) that may be directly influenced by the transporter system, may interact with host cells and activate ERK by triggering a signal transduction cascade upon internalization (or while surviving intracellularly). An initial approach will include examining signaling molecules upstream of ERK in the MAPK pathway. MEK (Raf-MAPKIERK kinase), immediately upstream of ERK, will be the first logical candidate to examine. This will be accomplished by assessing levels of phosphorylated MEK in WT and zXpaqP and ApaqQ infected RAW264.7 cells by Western blot analysis. Next, to investigate if PaqP and PaqQ are involved in ERK-MAPK activation in a Ras-dependent manner similar to the receptor tyrosine kinases (RTKs), levels of Raf-l activation will be examined. It is understood that RTK is activated by extracellular ligands, often growth factors (such as the epidermal growth factor), and undergoes autophosphorylation. The phosphorylated tyrosine kinase receptor then recruits RasGRP to activate Ras from Ras-GDP (an inactive form) into Ras-GTP (an active 76 form). Ras is a small G protein that recruits Raf- 1, an intermediate signaling molecule that triggers a series of downstream cascades to activate ERK (Hagemanri and Blank, 2001). If PaqP and PaqQ activate ERK via a Ras and Raf- 1 dependent mechanism similar to the RTKs, it will be interesting to identify signaling molecules that may interact with PaqP and PaqQ to trigger subsequent signal cascades in the MAPK pathway. If PaqP and PaqQ are involved in the Ras/Raf- 1 dependent pathway, we will next investigate whether PaqP and PaqQ are involved in the activation of RasGRP. In addition, we will use MEKIERK inhibitor to investigate whether PaqP and PaqQ contribute to apoptosis in host cells in an ERK-dependent manner. It is expected that if PaqP or PaqQ contribute to apoptosis via ERK activation, we should observe a decrease in levels of apoptosis (or increased levels of cell viability) in the MEK!ERK inhibitor treated WT infected cells. Finally, we will examine an alternate putative glutamine ABC transporter permease GInP and ATPase G1nQ to investigate whether the observed phenotypes in ApaqP and zXpaqQ are due to shifts in AA (specifically glutamine) metabolism or by other potential effects of PaqP and PaqQ. It is hypothesized that if increased levels of intracellular survival and stress resistance are due to changes in glutamine metabolism, then AglnP and zXglnQ mutants with reduced glutamine uptake will behave similarly to the /paqP and ApaqQ strains. Furthermore, double knockout mutants AglnFApaqF and AglnQApaqQ should show an augmented phenotype in comparison to the single knockout mutants. These future experiments will enhance our knowledge of PaqP and PaqQ and yield new ideas in understanding the role of ABC transporters in bacterial pathogenesis. 77 REFERENCES Allos, B.M. and Biaser, M.J. (1995) Campylobacterjejuni and the expanding spectrum of related infections. Clin Infect Dis. 20: 1092-1099; quiz 1100-1091. Allos, B.M., Lippy, F.T., Carisen, A., Washburn, R.G. and Blaser, M.J. (1998) Campylobacter jejuni strains from patients with Guillain-Barre syndrome. Emerg Infect Dis. 4: 263-268. Alter, I. and Scherer, K. (2006) Stress response of Campylobacter spp. and its role in food processing. J Vet Med B Infect Dis Vet Public Health. 53: 351-357. Andersen, M.T., Brondsted, L., Pearson, B.M., Muiholland, F., Parker, M., Pin, C., et al (2005) Diverse roles for HspR in Campylobacterjejuni revealed by the proteome, transcriptome and phenotypic characterization of an hspR mutant. Microbiology. 151: 905-915. Bacon, D.J., Aim, R.A., Burr, D.H., Hu, L., Kopecko, D.J., Ewing, C.P., et al (2000) Involvement of a plasmid in virulence ofCampylobacterjejuni 81-176. Infect Immun. 68: 4384- 4390. Bacon, D.J., Aim, R.A., Hu, L., Hickey, T.E., Ewing, C.P., Batchelor, R.A., et al (2002) DNA sequence and mutational analyses of the pVir plasmid of Campylobacterjejuni 8 1-176. Infect Immun. 70: 6242-6250. Baillon, M.L., van Vliet, A.H., Ketiey, J.M,, Constantinidou, C. and Penn, C.W. (1999) An iron- regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative stress resistance to the microaerophilic pathogen Campylobacterjejuni. JBacteriol. 181: 4798-4804. Barnes, I.H., Bagnall, M.C., Browning, D.D., Thompson, S.A., Manning, G. and Newell, D.G. (2007) Gamma-glutamyl transpeptidase has a role in the persistent colonization of the avian gut by Campylobacterjejuni. Microb Pathog. 43: 198-207. Beery, J.T., Hugdahl, M.B. and Doyle, M.P. (1988) Colonization of gastrointestinal tracts of chicks by Campylobacterjejuni. Appl Environ Microbiol. 54: 2365-2370. Berger, E.A. and Heppel, L.A. (1974) Different mechanisms of energy coupling for the shock- sensitive and shock-resistant amino acid permeases of Escherichia coli. J Biol Chem. 249: 7747- 7755. Blaser, M.J. (1997) Epidemiologic and clinical features of Campylobacterjejuni infections. J Infect Dis. 176 Suppl 2: S103-105. Blaser, M.J., Taylor, D.N. and Feldman, R.A. (1983) Epidemiology of Campylobacterjejuni infections. Epidemiol Rev. 5: 157-176. Borrmann, E., Berndt, A., Hanel, I. and Kohler, H. (2007) Campylobacter-induced interleukin-8 responses in human intestinal epithelial cells and primary intestinal chick cells. Vet Microbiol. 124: 115-124. 78 Bras, A.M. and Ketley, J.M. (1999) Transcellular translocation ofCampylobacterjejuni across human polarised epithelial monolayers. FEMS Microbiol Lett. 179: 209-2 15. Brondsted, L., Andersen, M.T., Parker, M., Jorgensen, K. and Ingmer, H. (2005) The HtrA protease of Campylobacterjejuni is required for heat and oxygen tolerance and for optimal interaction with human epithelial cells. Appi Environ Microbiol. 71: 3205-32 12. Butzler, J.P. (2004) Campylobacter, from obscurity to celebrity. Clin Microbiol Infect. 10: 868- 876. Candon, H.L., Allan, B.J., Fraley, C.D. and Gaynor, E.C. (2007) Polyphosphate kinase 1 is a pathogenesis determinant in Campylobacterjejuni. JBacteriol. 189: 8099-8 108. Castaneda-Roldan, E.I., Ouahrani-Bettache, S., Saldana, Z., Avelino, F., Rendon, M.A., Dornand, J. and Giron, J.A. (2006) Characterization of SP41, a surface protein of Brucella associated with adherence and invasion of host epithelial cells. Cell Microbiol. 8: 1877-1887. Ceelen, L.M., Decostere, A., Ducatelle, R. and Haesebrouck, F. (2006) Cytolethal distending toxin generates cell death by inducing a bottleneck in the cell cycle. Microbiol Res. 161: 109-120. Chang, C. and Miller, J.F. (2006) Campylobacterjejuni colonization of mice with limited enteric flora. Infect Immun. 74: 5261-5271. Chang, W.K., Yang, K.D. and Shaio, M.F. (1999) Lymphocyte proliferation modulated by glutamine: involved in the endogenous redox reaction. Clin Exp Immunol. 117: 482-488. Chang, W.K., Yang, K.D., Chuang, H., Jan, J.T. and Shaio, M.F. (2002) Glutamine protects activated human T cells from apoptosis by up-regulating glutathione and Bcl-2 levels. Clin Immunol. 104: 151-160. Chen, M.L., Ge, Z., Fox, J.G. and Schauer, D.B. (2006) Disruption of tight junctions and induction of proinflammatory cytokine responses in colonic epithelial cells by Campylobacter jejuni.Infectlmmun. 74: 6581-6589. Day, W.A., Jr., Sajecki, J.L., Pitts, T.M. and Joens, L.A. (2000) Role of catalase in Campylobacterjejuni intracellular survival. Infect Immun. 68: 6337-6345. Debruyne, L., Samyn, F., De Brandt, E., Vandenberg, 0., Heyndrickx, M. and Vandamme, P. (2008) Comparative performance of different PCR assays for the identification of Campylobacter jejuni and Campylobacter coli. Res Microbiol. 159: 88-93. Dippel, R. and Boos, W. (2005) The maltodextrin system of Escherichia coli: metabolism and transport. JBacteriol. 187: 8322-833 1. Edgeworth, J.D., Spencer, J., Phalipon, A., Griffin, G.E. and Sansonetti, P.J. (2002) Cytotoxicity and interleukin- 1 beta processing following Shigella flexneri infection of human monocyte derived dendritic cells. EurJlmmunol. 32: 1464-1471. 79 Elkins, C.A. and Beenken, K.E. (2005) Modeling the tripartite drug efflux pump archetype: structural and functional studies of the macromolecular constituents reveal more than their names imply. JChemother. 17: 581-592. Elvers, K.T., Turner, S.M., Wainwright, L.M., Marsden, G., Hinds, J., Cole, J.A., et al (2005) NssR, a member of the Crp-Fnr superfamily from Campylobacterjejuni, regulates a nitrosative stress-responsive regulon that includes both a single-domain and a truncated haemoglobin. Mol Microbiol. 57: 735-750. Eswarappa, S.M., Panguluri, K.K., Hensel, M. and Chakravortty, D. (2008) The yejABEF operon of Salmonella confers resistance to antimicrobial peptides and contributes to its virulence. Microbiology. 154: 666-678. Evans, M.E., Jones, D.P. and Ziegler, T.R. (2003) Glutamine prevents cytokine-induced apoptosis in human colonic epithelial cells. JNutr. 133: 3065-3071. Evans, M.E., Jones, D.P. and Ziegler, T.R. (2005) Glutamine inhibits cytokine-induced apoptosis in human colonic epithelial cells via the pyrimidine pathway. Am JFhysiol Gastrointest Liver Physiol. 289: G388-396. Fettucciari, K., Fetriconi, I., Bartoli, A., Rossi, R. and Marconi, P. (2003) Involvement of mitogen-activated protein kinases in Group B Streptococcus-induced macrophage apoptosis. Pharmacol Res. 47: 355-362. Forward, J.A., Behrendt, M.C., Wyborn, N.R., Cross, R. and Kelly, D.J. (1997) TRAP transporters: a new family of periplasmic solute transport systems encoded by the dctPQM genes of Rhodobacter capsulatus and by homologs in diverse gram-negative bacteria. JBacteriol. 179: 5482-5493. Fry, B.N., Feng, S., Chen, Y.Y., Newell, D.G., Coloe, P.J. and Korolik, V. (2000) The galE gene ofCampylobacterjejuni is involved in lipopolysaccharide synthesis and virulence. Infect Immun. 68: 2594-2601. Galindo, C.L., Fadi, A.A., Sha, J., Gutierrez, C., Jr., Popov, V.L., Boldogh, I., et al (2004) Aeromonas hydrophila cytotoxic enterotoxin activates mitogen-activated protein kinases and induces apoptosis in murine macrophages and human intestinal epithelial cells. J Biol Chem. 279: 37597-376 12. Garenaux, A., Jugiau, F., Rama, F., de Jonge, R., Denis, M., Federighi, M. and Ritz, M. (2008) Survival of Campylobacterjejuni Strains from Different Origins Under Oxidative Stress Conditions: Effect of Temperature. Curr Microbiol. 56: 293-297. Garmory, H.S. and Titball, R.W. (2004) ATP-binding cassette transporters are targets for the development of antibacterial vaccines and therapies. Infect Immun. 72: 6757-6763. Gaynor, E.C., Wells, D.H., MacKichan, J.K. and Falkow, S. (2005) The Campylobacterjejuni stringent response controls specific stress survival and virulence-associated phenotypes. Mol Microbiol. 56: 8-27. 80 Girard, M.P., Steele, D., Chaignat, C.L. and Kieny, M.P. (2006) A review of vaccine research and development: human enteric infections. Vaccine. 24: 2732-2750. Guccione, E., Del Rocio Leon-Kempis, M., Pearson, B.M., Hitchin, E., Muiholland, F., van Diemen, P.M., et al (2008) Amino-acid dependent growth of Campylobacter jejuni: Key roles for aspartase (AspA) under microaerobic and oxygen-limited conditions and identification of AspB (Cj0762), essential for growth on glutamate. Mol Microbiol. Guha, M. and Mackman, N. (2001) LPS induction of gene expression in human monocytes. Cell Signal. 13: 85-94. Guiney, D.G. (2005) The role of host cell death in Salmonella infections. Curr Top Microbiol Immunol. 289: 13 1-150. Guttman, J.A., Kazemi, P., Lin, A.E., Vogi, A.W. and Finlay, B.B. (2007a) Desmosomes are unaltered during infections by attaching and effacing pathogens. Anat Rec (Hoboken). 290: 199- 205. Guttman, J.A., Samji, F.N., Li, Y., Deng, W., Lin, A. and Finlay, B.B. (2007b) Aquaporins contribute to diarrhoea caused by attaching and effacing bacterial pathogens. Cell Microbiol. 9: 13 1-141. Hagemann, C. and Blank, J.L. (2001) The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875. Hekstra, D. and Tommassen, J. (1993) Functional exchangeability of the ABC proteins of the periplasmic binding protein-dependent transport systems Ugp and Mal of Escherichia coli. J Bacteriol. 175: 6546-6552. Hendrixson, D.R. and DiRita, V.J. (2004) Identification of Campylobacter jejuni genes involved in conimensal colonization of the chick gastrointestinal tract. Mol Microbiol. 52: 47 1-484. Hickey, T.E., Majam, G. and Guerry, P. (2005) Intracellular survival of Campylobacterjejuni in human monocytic cells and induction of apoptotic death by cytholethal distending toxin. Infect Immun. 73: 5 194-5197. Hickey, T.E., McVeigh, A.L., Scott, D.A., Michielutti, R.E., Bixby, A., Carroll, S.A., et al (2000) Campylobacter jejuni cytolethal distending toxin mediates release of interleukin-8 from intestinal epithelial cells. Infect Immun. 68: 6535-6541. Higgins, C.F. (1992) ABC transporters: from microorganisms to man. Annu Rev Cell Biol. 8: 67- 113. Hofreuter, D., Tsai, J., Watson, R.O., Novik, V., Altman, B., Benitez, M., et al (2006) Unique features of a highly pathogenic Campylobacter jejuni strain. Infect Immun. 74: 4694-4707. Holland, I.B., Schmitt, L. and Young, J. (2005) Type 1 protein secretion in bacteria, the ABC- transporter dependent pathway (review). Mol Membr Biol. 22: 29-39. 81 Hu, L., Bray, M.D., Osorio, M. and Kopecko, D.J. (2006) Campylobacter jejuni induces maturation and cytokine production in human dendritic cells. Infect Immun. 74: 2697-2705. Huang, D., Khoe, M., Befekadu, M., Chung, S., Takata, Y., Ilic, D. and Bryer-Ash, M. (2007) Focal adhesion kinase mediates cell survival via NF-kappaB and ERK signaling pathways. Am J Physiol Cell Physiol. 292: Cl 339-1352. Humphrey, T., O’Brien, S. and Madsen, M. (2007) Campylobacters as zoonotic pathogens: a food production perspective. IntJFoodMicrobiol. 117: 237-257. Jin, S., Joe, A., Lynett, J., Hani, E.K., Sherman, P. and Chan, V.L. (2001) J1pA, a novel surface- exposed lipoprotein specific to Campylobacter jejuni, mediates adherence to host epithelial cells. Mol Microbiol. 39: 1225-1236. Jones, D.M., Sutcliffe, E.M., Rios, R., Fox, A.J. and Curry, A. (1993) Campylobacterjejuni adapts to aerobic metabolism in the environment. JMedMicrobiol. 38: 145-150. Jones, M.A., Totemeyer., S., Maskell, D.J., Bryant, C.E. and Barrow, P.A. (2003) Induction of proinflammatory responses in the human monocytic cell line THP-1 by Campylobacterjejuni. Infect Immun. 71: 2626-2633. Jones, P.M. and George, A.M. (1999) Subunit interactions in ABC transporters: towards a functional architecture. FEMS Microbiol Lett. 179: 187-202. Kalischuk, L.D., Inglis, G.D. and Buret, A.G. (2007) Strain-dependent induction of epithelial cell oncosis by Campylobacterjejuni is correlated with invasion ability and is independent of cytolethal distending toxin. Microbiology. 153: 2952-2963. Karlyshev, A.V. and Wren, B.W. (2005) Development and application of an insertional system for gene delivery and expression in Campylobacter jejuni. Appi Environ Microbiol. 71: 4004- 4013. Kelly, D.J. 2008, Complexity and versatility in the metabolism and physiology of Campylobacterjejuni (Chapter 3). In Campylobacter 3. Nachamkin I., Szymanski, C., and Blaser, M. Washington, DC: American Society for Microbiology Press, pp.41-61 (in press). Kiehibauch, J.A., Albach, R.A., Baum, L.L. and Chang, K.P. (1985) Phagocytosis of Campylobacterjejuni and its intracellular survival in mononuclear phagocytes. Infect Immun. 48: 446-45 1. Klancnik, A., Botteldoorn, N., Herman, L. and Mozina, S.S. (2006) Survival and stress induced expression of groEL and rpoD of Campylobacter jejuni from different growth phases. mt J Food Microbiol. 112: 200-207. Konkel, M.E., Mead, D.J., Hayes, S.F. and Cieplak, W., Jr. (1992) Translocation of Campylobacterjejuni across human polarized epithelial cell monolayer cultures. Jlnfect Dis. 166: 308-3 15. 82 Konkel, M.E., Kim, B.J., Rivera-Amill, V. and Garvis, S.G. (1999) Identification of proteins required for the internalization of Campylobacter jejuni into cultured mammalian cells. Adv Exp MedBiol. 473: 2 15-224. Konkel, M.E., Kim, B.J., Kiena, J.D., Young, C.R. and Ziprin, R. (1998) Characterization of the thermal stress response of Campylobacterjejuni. Infect Immun. 66: 3666-3672. Konkel, M.E., Christensen, J.E., Keech, A.M., Monteville, M.R., Kiena, J.D. and Garvis, S.G. (2005) Identification of a fibronectin-binding domain within the Campylobacterjejuni CadF protein. Mol Microbiol. 57: 1022-1035. Kranzer, K., Eckhardt, A., Aigner, M., Knoll, G., Deml, L., Speth, C., et al (2004) Induction of maturation and cytokine release of human dendritic cells by Helicobacter pylon. Infect Immun. 72: 4416-4423. Lara-Tejero, M. and Galan, J.E. (2000) A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science. 290: 354-357. Larson, S.D., Li, J., Chung, D.H. and Evers, B.M. (2007) Molecular Mechanisms Contributing to Glutamine-Mediated Intestinal Cell Survival. Am JFhysiol Gastrointest Liver Physiol. Lee, I.S., Lin, J., Hall., H.K., Bearson, B. and Foster, J.W. (1995) The stationary-phase sigma factor sigma S (RpoS) is required for a sustained acid tolerance response in virulent Salmonella typhimurium. Mol Microbiol. 17: 155-167. Leon-Kempis Mdel. R., Guccione, E., Mulholland, F., Williamson, M.P. and Kelly, D.J. (2006) The Campylobacterjejuni PEB1a adhesin is an aspartate/glutamate-binding protein of an ABC transporter essential for microaerobic growth on dicarboxylic amino acids. Mol Microbiol. 60: 1262-1275. MacCallum, A., Haddock, G. and Everest, P.H. (2005) Campylobacterjejuni activates mitogen activated protein kinases in Caco-2 cell monolayers and in vitro infected primary human colonic tissue. Microbiology. 151: 2765-2772. Marin-Kuan, M., Nestler, S., Verguet, C., Bezencon, C., Piguet, D., Delatour, T., et al (2007) MAPK-ERK activation in kidney of male rats chronically fed ochratoxin A at a dose causing a significant incidence of renal carcinoma. Toxicol Appi Pharmacol. 224: 174-181. Marriott, I., Hammond, T.G., Thomas, E.K. and Bost, K.L. (1999) Salmonella efficiently enter and survive within cultured CDI 1 c+ dendritic cells initiating cytokine expression. Eur J Immunol. 29: 1107-1115. Matsuo, M, Ueda K., Ryder, T. and Ashcroft, F. 2003, The sulfonylurea receptor: an ABC transporter that acts as an ion channel regulator, in ABC proteins form bacteria to man, Holland, I.B., Coles, SPC, Kuchler, K and Higggins, CF eds. Academic Press, London, UK, pp55l-575. Mead, P.S., Slutsker, L., Griffin, P.M. and Tauxe, R.V. (1999) Food-related illness and death in the united states reply to dr. hedberg. Emerg Infect Dis. 5: 84 1-842. 83 Medzhitov, R. and Janeway, C.A., Jr. (1997) Innate immunity: the virtues of a nonclonal system of recognition. Cell. 91: 295-298. Menard, R., Sansonetti, P.J. and Parsot, C. (1993) Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. JBacteriol. 175: 5899-5906. Mihaijevic, R.R., Sikic, M., Klancnik, A., Brumini, G., Mozina, S.S. and Abram, M. (2007) Environmental stress factors affecting survival and virulence of Campylobacter jejuni. Microb Pathog. 43: 120-125. Mongkolsuk, S., Praituan, W., Loprasert, S., Fuangthong, M. and Chamnongpol, S. (1998) Identification and characterization of a new organic hydroperoxide resistance (ohr) gene with a novel pattern of oxidative stress regulation from Xanthomonas campestris pv. phaseoli. J Bacteriol. 180: 2636-2643. Monteville, M.R. and Konkel, M.E. (2002) Fibronectin-facilitated invasion of T84 eukaryotic cells by Campylobacterjejuni occurs preferentially at the basolateral cell surface. Infect Immun. 70: 6665-6671. Moore, J.E., Crowe, M., Heaney, N. and Crothers, E. (2001) Antibiotic resistance in Campylobacter spp. isolated from human faeces (1980-2000) and foods (1997-2000) in Northern Ireland: an update. JAntimicrob Chemother. 48: 455-457. Muller, A., Leon-Kempis Mdel, R., Dodson, E., Wilson, K.S., Wilkinson, A.J. and Kelly, D,J. (2007) A bacterial virulence factor with a dual role as an adhesin and a solute-binding protein: the crystal structure at 1.5 A resolution of the PEB 1 a protein from the food-borne human pathogen Campylobacterjejuni. JMol Biol. 372: 160-171. Muller, A., Thomas, G.H., Horler, R., Brannigan, J.A., Blagova, E., Levdikov, V.M., et al (2005) An ATP-binding cassette-type cysteine transporter in Campylobacterjejuni inferred from the structure of an extracytoplasmic solute receptor protein. Mol Microbiol. 57: 143-15 5. Murphy, C., Carroll, C. and Jordan, K.N. (2006) Environmental survival mechanisms of the foodborne pathogen Campylobacterjejuni. JAppi Microbiol. 100: 623-632. Myszewski, M.A. and Stern, N.J. (1991) Phagocytosis and intracellular killing of Campylobacter jejuni by elicited chicken peritoneal macrophages. Avian Dis. 35: 750-755. Nachamkin, I. (2001) Campylobacter Enteritis and the Guillain-Barre Syndrome. Curr Infect Dis Rep.3: 116-122. Naikare, H., Palyada, K., Panciera, R., Marlow, D. and Stintzi, A. (2006) Major role for FeoB in Campylobacterjejuni ferrous iron acquisition, gut colonization, and intracellular survival. Infect Immun. 74: 5433-5444. Nakamura, E. and Hagen, S.J. (2002) Role of glutamine and arginase in protection against ammonia-induced cell death in gastric epithelial cells. Am JPhysiol Gastrointest Liver Physiol. 283: G1264-1275. 84 Navarre, W.W. and Zychlinsky, A. (2000) Pathogen-induced apoptosis of macrophages: a common end for different pathogenic strategies. Cell Microbiol. 2: 265-273. Nikaido, H. (2002) How are the ABC transporters energized? Proc Nati Acad Sci USA. 99: 9609-9610. Oelschlaeger, T.A., Guerry, P. and Kopecko, D.J. (1993) Unusual microtubule-dependent endocytosis mechanisms triggered by Campylobacterjejuni and Citrobacter freundii. Proc Natl AcadSci USA. 90: 6884-6888. Pacha, R.E., Clark, G.W., Williams, E.A. and Carter, A.M. (1988) Migratory birds of central Washington as reservoirs of Campylobacterjejuni. Can JMicrobiol. 34: 80-82. Pajaniappan, M., Hall, J.E., Cawthraw, S.A., Newell, D.G., Gaynor, E.C., Fields, J.A., et al (2008) A temperature-regulated Campylobacterjejuni gluconate dehydrogenase is involved in respiration-dependent energy conservation and chicken colonization. Mol Microbiol. 68: 474- 491. Park, S.F. (2002) The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. IntJFood Microbiol. 74: 177-188. Parkhill, J., Wren, B.W., Mungall, K., Ketley, J.M., Churcher, C., Basham, D., et a! (2000) The genome sequence of the food-borne pathogen Campylobacterjejuni reveals hypervariable sequences. Nature. 403: 665-668. Pearson, B.M., Gaskin, D.J., Segers, R.P., Wells, J.M., Nuijten, P.J. and van Vliet, A.H. (2007) The complete genome sequence of Campylobacterjejuni strain 81116 (NCTCI 1828). J Bacteriol. 189: 8402-8403. Pei, Z., Burucoa, C., Grignon, B., Baqar, S., Huang, X.Z., Kopecko, D.J., et al (1998) Mutation in the peb 1 A locus of Campylobacter jejuni reduces interactions with epithelial cells and intestinal colonization of mice. Infect Immun. 66: 93 8-943. Pesci, E.C., Cottle, D.L. and Pickett, C.L. (1994) Genetic, enzymatic, and pathogenic studies of the iron superoxide dismutase of Campylobacterjejuni. Infect Immun. 62: 2687-2694. Phanvijhitsiri, K., Musch, M.W., Ropeleski, M.J. and Chang, E.B. (2006) Heat induction of heat shock protein 25 requires cellular glutamine in intestinal epithelial cells. Am JPhysiol Cell Physiol. 291: C290-299. Phongsisay, V., Perera, V.N. and Fry, B.N. (2007) Expression of the htrB gene is essential for responsiveness of Salmonella typhimurium and Campylobacterjejuni to harsh environments. Microbiology. 153: 254-262. Purdy, D. and Park, S.F. (1994) Cloning, nucleotide sequence and characterization of a gene encoding superoxide dismutase from Campylobacter jejuni and Campylobacter coli. Microbiology. 140 (Pt5): 1203-1208. 85 Purdy, D., Cawthraw, S., Dickinson, J.H., Newell, D.G. and Park, S.F. (1999) Generation of a superoxide dismutase (SOD)-deficient mutant of Campylobacter coli: evidence for the significance of SOD in Campylobacter survival and colonization. Appi Environ Microbiol. 65: 2540-2546. Quinn, T., Bolla, J.M., Pages, J.M. and Fanning, S. (2007) Antibiotic-resistant Campylobacter: could efflux pump inhibitors control infection? JAntimicrob Chemother. 59: 1230-1236. Rosinha, G.M., Freitas, D.A., Miyoshi, A., Azevedo, V., Campos, E., Cravero, S.L., et al (2002) Identification and characterization of a Brucella abortus ATP-binding cassette transporter homolog to Rhizobium meliloti ExsA and its role in virulence and protection in mice. Infect Immun. 70: 5036-5044. Ruckdeschel, K., Machold, J., Roggenkamp, A., Schubert, S., Pierre, J., Zumbihl, R., et al (1997) Yersinia enterocolitica promotes deactivation of macrophage mitogen-activated protein kinases extracellular signal-regulated kinase-1/2, p38, and c-Jun NH2-terminal kinase. Correlation with its inhibitory effect on tumor necrosis factor-alpha production. JBiol Chem. 272: 15920-15927. Rychlik, I. and Barrow, P.A. (2005) Salmonella stress management and its relevance to behaviour during intestinal colonisation and infection. FEMSMicrobiol Rev. 29: 1021-1040. Saurin, W., Hofnung, M. and Dassa, E. (1999) Getting in or out: early segregation between importers and exporters in the evolution of ATP-binding cassette (ABC) transporters. J Mol Evol. 48: 22-41. Schiosser, A., Kampers, T. and Schrempf, H. (1997) The Streptomyces AlP-binding component MsiK assists in cellobiose and maltose transport. JBacteriol. 179: 2092-2095. Schorey, J.S. and Cooper, A.M. (2003) Macrophage signalling upon mycobacterial infection: the MAP kinases lead the way. Cell Microbiol. 5: 133-142. Shan, L., He, P. and Sheen, J. (2007) Intercepting host MAPK signaling cascades by bacterial type III effectors. Cell Host Microbe. 1: 167-174. Shepherd, V.L. (1986) The role of the respiratory burst of phagocytes in host defense. Semin Respir infect. 1:99-106. Shi, M., Gozal, E., Choy, H.A. and Forman, H.J. (1993) Extracellular glutathione and gamma glutamyl transpeptidase prevent H202-induced injury by 2,3-dimethoxy-1,4-naphthoquinone. Free Radic Biol Med. 15: 57-67. Shibayama, K., Wachino, J., Arakawa, Y., Saidijam, M., Rutherford, N.G. and Henderson, P.J. (2007) Metabolism of glutamine and glutathione via gamma-glutamyltranspeptidase and glutamate transport in Helicobacter pylon: possible significance in the pathophysiology of the organism. Mol Microbiol. 64: 3 96-406. Siegesmund, A.M., Konkel, M.E., Kiena, J.D. and Mixter, P.F. (2004) Campylobacterjejuni infection of differentiated THP- 1 macrophages results in interleukin 1 beta release and caspase 1-independent apoptosis. Microbiology. 150: 56 1-569. 86 Smirnova, G.V., Krasnykh, T.A. and Oktyabrsky, O.N. (2001) Role of glutathione in the response of Escherichia coli to osmotic stress. Biochemistry (Mosc). 66: 973-978. Smith, J.L. and Bayles, D.O. (2006) The contribution of cytolethal distending toxin to bacterial pathogenesis. Crit Rev Microbiol. 32: 227-248. Stead, D. and Park, S.F. (2000) Roles of Fe superoxide dismutase and catalase in resistance of Campylobacter coli to freeze-thaw stress. Appl Environ Microbiol. 66: 3110-3112. Tamura, G.S., Nittayajarn, A. and Schoentag, D.L. (2002) A glutamine transport gene, glnQ, is required for fibronectin adherence and virulence of group B streptococci. Infect Immun. 70: 2877-2885. Tang, P., Sutherland, C.L., Gold, M.R. and Finlay, B.B. (1998) Listeria monocytogenes invasion of epithelial cells requires the MEK- I /ERK-2 mitogen-activated protein kinase pathway. Infect Immun. 66: 1106-1112. Tate, S. S. and Meister, A. (1981) gamma-Glutamyl transpeptidase : catalytic, structural and functional aspects. Mol Cell Biochem. 39: 357-368. Thomas, C., Hill, D.J. and Mabey, M. (1999) Morphological changes of synchronized Campylobacterjejuni populations during growth in single phase liquid culture. Lett Appi Microbiol. 28: 194-198. Thomas, K.E., Galligan, C.L., Newman, R.D., Fish, EN. and Vogel, S.N. (2006) Contribution of interferon-beta to the murine macrophage response to the toll-like receptor 4 agonist, lipopolysaccharide. JBiol Chem. 281: 31119-31130. Tullius, M.V., Harth, G. and Horwitz, M.A. (2003) Glutamine synthetase GlnAl is essential for growth of Mycobacterium tuberculosis in human THP- 1 macrophages and guinea pigs. Infect Immun. 71: 3927-3936. van Vliet, A.H., Ketley, J.M., Park, S.F. and Penn, C.W. (2002) The role of iron in Campylobacter gene regulation, metabolism and oxidative stress defense. FEMS Microbiol Rev. 26: 173-186. Velayudhan, J. and Kelly, D.J. (2002) Analysis of gluconeogenic and anaplerotic enzymes in Campylobacterjejuni: an essential role for phosphoenolpyruvate carboxykinase. Microbiology. 148: 685-694. Velayudhan, J., Jones, M.A., Barrow, P.A. and Kelly, D.J. (2004) L-serine catabolism via an oxygen-labile L-serine dehydratase is essential for colonization of the avian gut by Campylobacterjejuni. Infect Immun. 72: 260-268. Wang, X., Martindale, J.L. and Holbrook, N.J. (2000) Requirement for ERK activation in cisplatin-induced apoptosis. JBiol Chem. 275: 3943 5-39443. 87 Wassenaar, T.M., Engeiskirchen, M., Park, S. and Lastovica, A. (1997) Differential uptake and killing potential of Campylobacterjejuni by human peripheral monocytes/macrophages. Med Microbiol Immunol. 186: 139-144. Watson, R.O. and Galan, J.E. (2005) Signal transduction in Campylobacter jejuni-induced cytokine production. Cell Microbiol. 7: 65 5-665. Watson, R.O. and Galan, J.E. (2008) Campylobacter jejuni survives within epithelial cells by avoiding delivery to lysosomes. FLoS Fathog. 4: e14. Westfall, H.N., Rollins, D.M. and Weiss, E. (1986) Substrate utilization by Campylobacterjejuni and Campylobacter coli. Appi Environ Microbiol. 52: 700-705. Whitehouse, C.A., Balbo, P.B., Pesci, E.C., Cottle, D.L., Mirabito, P.M. and Pickett, C.L. (1998) Campylobacter jejuni cytolethal distending toxin causes a G2-phase cell cycle block. Infect Immun. 66: 1934-1940. Wilken, S., Schmees, G. and Schneider, E. (1996) A putative helical domain in the Ma1K subunit of the ATP-binding-cassette transport system for maltose of Salmonella typhimurium (Ma1FGK2) is crucial for interaction with Ma1F and Ma1G. A study using the LacK protein of Agrobacterium radiobacter as a tool. Mol Microbiol. 22: 655-666. Wischmeyer, P.E., Vanden Hoek, T.L., Li, C., Shao, Z., Ren, H., Riehm, J. and Becker, L.B. (2003) Glutamine preserves cardiomyocyte viability and enhances recovery of contractile function after ischemia-reperfusion injury. JPENJFarenter Enteral Nutr. 27: 116-122. Wyckoff, E.E., Valle, A.M., Smith, S.L. and Payne, S.M. (1999) A multifunctional ATP-binding cassette transporter system from Vibrio cholerae transports vibriobactin and enterobactin. J Bacteriol. 181: 7588-7596. Xaus, J., Comalada, M., Valledor, A.F., Cardo, M., Herrero, C., Soler, C., et al (2001) Molecular mechanisms involved in macrophage survival, proliferation, activation or apoptosis. Immunobiology. 204: 543-550. Xia, Z., Dickens, M., Raingeaud, J., Davis, R.J. and Greenberg, M.E. (1995) Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science. 270: 1326-133 1. Young, K.T., Davis, L.M. and Dirita, V.J. (2007) Campylobacterjejuni: molecular biology and pathogenesis. Nat Rev Microbiol. 5: 665-679. Yu, R.K., Usuki, S. and Ariga, T. (2006) Ganglioside molecular mimicry and its pathological roles in Guillain-Barre syndrome and related diseases. Infect Immun. 74: 65 17-6527. Zhou, Y., Wang, Q., Evers, B.M. and Chung, D.H. (2005) Signal transduction pathways involved in oxidative stress-induced intestinal epithelial cell apoptosis. Pediatr Res. 58: 1192- 1197. 88


Citation Scheme:


Usage Statistics

Country Views Downloads
China 2 5
United States 1 1
Japan 1 0
City Views Downloads
Beijing 2 5
Mountain View 1 1
Tokyo 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}


Share to:


Related Items