UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Roles of the DOG-1 and JRH-1 helicase-like proteins in DNA repair in Caenorhabditis elegans Youds, Jillian L. 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2007_spring_youds_jillian.pdf [ 10.76MB ]
Metadata
JSON: 24-1.0066819.json
JSON-LD: 24-1.0066819-ld.json
RDF/XML (Pretty): 24-1.0066819-rdf.xml
RDF/JSON: 24-1.0066819-rdf.json
Turtle: 24-1.0066819-turtle.txt
N-Triples: 24-1.0066819-rdf-ntriples.txt
Original Record: 24-1.0066819-source.json
Full Text
24-1.0066819-fulltext.txt
Citation
24-1.0066819.ris

Full Text

Roles of the DOG-1 and JRH-1 helicase-like proteins in DNA repair in Caenorhabditis elegans by Jillian L . Youds B.Sc., Simon Fraser University, 2003 A THESIS S U B M I T T E D IN P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R OF P H I L O S O P H Y in The Faculty of Graduate Studies (Medical Genetics) T H E U N I V E R S I T Y OF B R I T I S H C O L U M B I A December, 2007 © Jillian L . Youds, 2007 ABSTRACT Helicases perform vital roles in the cell by unwinding D N A to make it accessible for the essential processes o f replication, transcription and repair. In Caenorhabditis elegans, the D O G - 1 helicase-like protein is required for polyG/polyC-tract (G/C-tract) maintenance, as dog-l animals have a mutator phenotype characterized by deletions that initiate in G/C-tracts. DOG-1 may unwind secondary structures that form in polyguanine D N A during lagging strand replication. In order to more completely understand the role of dog-1, genetic interactors were identified, dog-1 functionally interacts with the him-6/BLM helicase. Absence of recombinational repair-implicated proteins in the dog-1 background, including H I M - 6 / B L M , R A D - 5 1 , B R D - 1 / B A R D 1 and H I M - 9 / X P F , as well as the trans-lesion synthesis polymerases polKMD po/7 increased the frequency of animals with G/C-tract deletions, indicating that these pathways are important mechanisms for repair at G/C-tracts in the absence of D O G - 1 . These data support the hypothesis that persisting D N A secondary structures can cause replication fork stalling, which can be resolved by deletion-free or deletion-prone mechanisms. D O G - 1 has highest sequence identity to human B R 1 P 1 / F A N C J , which is mutated in patients from the Fanconi Anemia (FA) subgroup J. D N A damage sensitivity experiments indicated that, like chicken F A N C J cells, dog-1 mutants were not significantly sensitive to D N A damage from X-ray or UV-irradiation, but were extremely hypersensitive to the D N A interstrand cross-linking agent UVA-act ivated trimethylpsoralen. Thus, D O G - 1 appears to have a conserved role in cross-link repair and is the C. elegans F A N C J homolog. Characterization of the dog-1/FANCJ-relatsd helicase, Jrh-1, revealed that mutants for this putative helicase are moderately sensitive to cross-linking agents, dog-1 jrh-1 double mutants displayed a synthetic lethal phenotype characterized by excessive recombination intermediates and mitotic catastrophe in the germline. However, absence of JRH-1 did not have any effect on G/C-tract deletions, indicating that JRH-1 does not have a redundant function with D O G - 1 at G/C-tracts. Absence of JRH-1 reduced the fitness of eTl and nTl translocation hétérozygotes, but not translocation homozygotes, jrh-1 was synthetically lethal with him-6/BLM and with the endonuclease mus-81, suggesting a possible role for JRH-1 in regulating the balance between different types of repair. TABLE OF CONTENTS Abstract i i Table of contents i i i List of tables v i i List of figures v i i i List of abbreviations x Acknowledgements x i i i Co-authorship statement x iv C H A P T E R 1 : Introduction 1.1 Pathways for D N A repair 1 1.1.1 Double strand break repair 2 1.1.2 Mismatch repair 4 1.1.3 Nucleotide excision repair 5 1.1.4 Lesion bypass 6 1.1.5 Interstrand cross-link repair 8 1.2 Helicases involved in D N A repair 11 1.2.1 The RecQ helicases 11 1.2.2 The Srs2 helicase 15 1.3 C. elegans as a model for the study of D N A repair 16 1.4 PolyG/polyC-tracts and the DOG-1 helicase-like protein in C. elegans 18 1.5 Thesis objectives 19 C H A P T E R 1 R E F E R E N C E S 20 C H A P T E R 2: dog-l and repair of G/C-tracts in C. elegans 2.1 Introduction 28 2.2 Materials and Methods 29 2.2.1 Worm lysis and P G R detection oidog-l(gklO) 29 2.2.2 Construction of double mutant strains 30 2.2.3 D A P I staining and measurement of mitotic zone nuclei 31 2.2.4 The vab-1 G/C-tract deletion assay 31 2.2.5 R N A i feeding method for the translesion synthesis polymerases 33 i i i 2.3 Results 34 2.3.1 dog-1 functionally interacts with him-6/BLM. 34 2.3.2 Increased G/C-tract deletions in dog-1; him-6 38 2.3.3 Homologous recombination is required for G/C-tract stability in dog-1 mutants...42 2.3.4 Translesion synthesis is required for G/C-tract stability in dog-1 mutants 44 2.3.5 Nucleotide excision repair and non-homologous end-joining are not essential for repair at G/C-tracts 45 2.3.6 Base pair mutations frequently flank the G/C-tract deletions 46 2.4 Discussion 48 2.4.1 dog-1 is l ikely to function during repHcation 48 2.4.2 Homologous recombination and translesion synthesis are required for genome stability in dog-1 animals 49 2.4.3 H I M - 6 could function in RAD-51-dependent or -independent pathways 52 2.4.4 Loss of N E R or N H E J does not affect deletion formation 53 2.4.5 A model for repair at G/C-tracts 54 C H A P T E R 2 R E F E R E N C E S 57 C H A P T E R 3: dog-1 is the C. elegans BRIPl/FANCJ homolog 3.1 Introduction 62 3.2 Materials and Methods 63 3.2.1 Measuring apoptosis in the C. elegans germline by S Y T 0 1 2 staining 63 3.2.2 D N A damage sensitivity assay - X-ray treatment 63 3.2.3 D N A damage sensitivity assay - UVC-irradiat ion treatment 64 3.2.4 D N A damage sensitivity assay - trimethylpsoralen+UVA treatment 64 3.2.5 D A P I staining following T M P + U V A treatment 66 3.3 Results 67 3.3.1 dog-1 is the reciprocal bes t -BLAST of human BRIPl/FANCJ 67 3.3.2 dog-1 animals have increased D N A damage-induced apoptosis in the germline....69 3.3.3 dog-1 animals are sensitive to D N A interstrand cross-hnking agents 71 3.3.4 dog-1 mutants display evidence of repair defects after cross-linking treatment 74 3.4 Discussion 77 3.4.1 Phenotypes o f the dog-1 mutant suggest D N A damage under normal conditions...77 3.4.2 DOG-1 is the C. elegans B R I P l / F A N C J homolog 78 3.4.3 Implications of sequence conservation between DOG-1 and B R I P l / F A N C J 78 3.4.4 Relationship of D O G - l / F A N C J to the F A pathway 81 3.4.5 How does the role for dog-1 in I C L repair relate to G/C-tracts? 82 3.4.6 Future experiments with dog-1 83 C H A P T E R 3 R E F E R E N C E S 85 C H A P T E R 4: Characterization of the DOG- l /FANCJ- re l a t ed helicase JRH-1 4.1 Introduction 87 4.2 Materials and Methods 88 4.2.1 S Y T O 1 2 staining 88 4.2.2 D N A damage sensitivity experiments 88 4.2.3 D A P I staining 88 4.2.4 Ant i -RAD-51 antibody staining 89 4.2.5 Strains and strain constructions 90 4.2.6 Measuring meiotic recombination 92 4.3 Results 93 4.3.1 jrh-1 is a member of the dog-1 family and encodes a helicase-like protein 93 4.3.2 Phenotypes of jrh-1 mutant animals 95 4.3.3 jrh-1 mutants are not sensitive to D N A damage induced by U V C or X-ray irradiation 96 4.3.4 jrh-1 mutants are moderately sensitive to D N A interstrand cross-linking agents...97 4.3.5 Loss of JRH-1 function is synthetically lethal in the absence of DOG-1 99 4.3.6 JRH-1 is not required for G/C-tract stability 102 4.3.7 jrh-1 dog-1 animals show extensive RAD-51 foci in the mitotic germline 102 4.3.8 Loss of function of JRH-1 in eTl translocation hétérozygotes 104 4.3.9 Meiotic recombination is increased in jrh-1 mutants 108 4.3.10 him-6/BLM and mus-81 functionally interact with jrh-1 110 4.4 Discussion 113 4.4.1 Phenotypes of jrh-1 mutant animals support a role in replication or repair 113 4.4.2 JRH-1 is required for repair in the absence of DOG-1 115 4.4.3 Absence of JRH-1 specifically affects eTl and nTl translocation hétérozygotes. .! 16 4.4.4 JRH-1 might have a function similar to the yeast helicase Srs2 120 4.4.5 A role for JRH-1 at telomeres? 122 C H A P T E R 4 R E F E R E N C E S 124 C H A P T E R 5: General Discussion 5.1 C elegans as a model to study interstrand cross-link repair 128 5.2 A potential role for human B R I P l / F A N C J at G-rich D N A 129 5.3 The DOG- l /FANCJ- r e l a t ed helicase, JRH-1 , functions in D N A repair 130 5.4 A n extended model for repair at G/C-tracts in the dog-1 mutant 131 5.5 Future studies on DOG-1 and the DOG-1 helicase-like proteins 134 C H A P T E R 5 R E F E R E N C E S 136 A P P E N D I X 1: Primer sequences 138 LIST OF TABLES Table 1.1: Main pathways for D N A repair and the proteins involved 2 Table 2.1: Phenotypes of N 2 , dog-1, him-6 and dog-1; him-6 animals 36 Table 2.2: Average nuclei and largest nuclei sizes in N2 , dog-1, him-6, and dog-1; him-6 animals 38 Table 2.3: Deletions observed in the vab-1 G/C-tract in various repair mutants in the dog-1 background 41 Table 2.4: Sequences around vab-1 G/C-tract deletion breakpoints 47 Table 4.1 : Frequency of dog-1 and jrh-1 single mutant and jrh-1 dog-1 double mutant animals with vab-1 G/C-tract deletions 102 Table 4.2: Viabil i ty of eTl/dpy-18; eTl/unc-46 and eTl/eTl with and without jrh-1 (tml866).106 Table 4.3: Meiotic recombination frequency in the absence of JRH-1 110 Table 4.4: Phenotypes ofjrh-1, him-6 and jrh-1; him-6 animals I l l Table 4.5: Phenotypes ofjrh-1 and mus-81 single mutants and jrh-1 mus-81 double mutants...! 12 LIST OF FIGURES Figure 1.1 : A speculative model for interstrand cross-link repair by the Fanconi anemia pathway 10 Figure 1.2: Proposed roles for Mus81, Sgsl and Srs2 in repair 13 Figure 1.3: Schematic of the C. elegans germline 17 Figure 2.1: Viabil i ty of independent lines oï dog-1, him-6 and dog-1; him-6 animals 35 Figure 2.2: Germline mitotic zones of N 2 , dog-1, him-6, and dog-1; him-6 animals 37 Figure 2.3: The vab-1 deletion assay 39 Figure 2.4: A model for repair of secondary structures forming at G/C-tracts 55 Figure 3.1 : Protein sequence alignment of C. elegans DOG-1 and human B R I P l / F A N C J 67 Figure 3.2: Conserved domains of C. elegans D O G - 1 , G. gallus B R I P l and H. sapiens BRIP1.68 Figure 3.3: Phylogram showing the estimated evolutionary relationship between human B R I P l / F A N C J , chicken B R I P l / F A N C J , C. elegans D O G - 1 , human N H L l , chicken R T E L , and C. elegans F25H2.13 69 Figure 3.4: Number of SYT012-stained corpses in N 2 , dog-1 and dog-1 cep-1 animals 70 Figure 3.5: Sensitivity of N 2 and dog-1 animals to UVC-irradiation and X-ray treatment 71 Figure 3.6: Embryonic survival in the progeny of N 2 and dog-1 animals following no treatment, U V A only, T M P only or T M P + U V A treatment 72 Figure 3.7: Variability between trials of T M P + U V A treatment 73 Figure 3.8: Sensitivity of N 2 and dog-1 animals to T M P + U V A treatment 74 Figure 3.9: Number of SYT012-stained corpses in N 2 and dog-1 animals under normal conditions and N 2 and dog-1 animals 24 hours after D N A cross-linking with T M P + U V A treatment 75 Figure 3.10: D A P I stained N 2 and dog-1 mutant germlines after T M P + U V A treatment 76 Figure 4.1: Phylogram of genes in the dog-1 and RecQ helicase families 93 Figure 4.2: Comparison of the domain structure of DOG-1 and JRH-1 94 Figure 4.3: jrh-1 gene structure 95 Figure 4.4: Number of SYT012-stained apoptotic corpses in N 2 and jrh-1 mutant animals 96 Figure 4.5: Sensitivity of N 2 and jrh-1 animals to UVC-irradiat ion and X-ray treatment 97 Figure 4.6: Embryonic survival in the progeny of N2 and jrh-1 animals following no treatment, U V A only, T M P only or cross-linking by T M P + U V A treatment 98 Figure 4.7: Sensitivity of N 2 , dog-1 and jrh-1 animals to T M P + U V A treatment 99 Figure 4.8: Comparison of N 2 and jrh-1 dog-1 double mutant animals 100 Figure 4.9: Comparison of whole D A P I stained N2 , dog-1, jrh-1 and jrh-1 dog-1 double mutant germlines 101 Figure 4.10: Mitotic zones of D A P I stained N2 , dog-1, jrh-1 and jrh-1 dog-1 double mutant germlines 101 Figure 4.11: R A D - 5 1 staining of jrh-1 dog-1 and hT2 dog-1/jrh-1 dog-1 controls 104 Figure 4.12: Competition assay oï eTl/dpy-18; eTl/unc-46 and jrh-1; eTl/dpy-18; eTl/unc-46 animals 107 Figure 4.13: Competition assay of nTl/+; nTl/dpy-U and jrh-1; nTl/+; nTl/dpy-11 animals.108 Figure 4.14: Fitness of 20 lines of N 2 , him-6 and jrh-1 single mutants and jrh-1; him-6 double mutants I l l Figure 4.15: Mode l for the affect of JRH-1 absence on eTl hétérozygotes 118 Figure 5.1: A n extended model for repair of replication forks stalled at G/C-tract secondary structures 134 LIST OF ABBREVIATIONS A T Ataxia Telangiectasia A T L - 1 C. elegans Ataxia Telangiectasia-Like A T L D Ataxia Telangiectasia-Like Disorder A T M Ataxia Telangiectasia Mutated A T R Ataxia Telangiectasia Related B A C H B R C A 1-interacting C-terminal Helicase B A R D B R C A 1-Associated R I N G Domain BCH-1 C. elegans B A C H 1-related (also known as JRH-1 and SPAR-1) B L A S T Basic Local Alignment Search Tool B L M B L o o M syndrome protein B R C A Breast Cancer Associated BRC-1 C. elegans B R C A l homolog BRD-1 C. elegans B A R D l homolog B R I P l BRCAl-Interact ing Protein B S A Bovine Serum Albumin CEP-1 C. Elegans P53 homolog CS Cockayne Syndrome D A P I 4'-6-DiAmidino-2-PhenylIndole D N A - P K c s DNA-Prote in Kinase catalytic subunit DOG-1 C. elegans Deletions O f Guanine D P Y C elegans Dumpy E R C C l Excision Repair Cross-Complementing F A Fanconi Anemia F A N C Fanconi Anemia protein F A A P Fanconi Anemia-Associated Protein FCD-2 C elegans F A N C D 2 homolog F E N Flap EndoNuclease G F P Green Fluorescent Protein G G - N E R Global Genome Nucleotide Excision Repair H J Holliday Junction H I M High Incidence of Males H R R Homologous Recombination Repair I C L Interstrand Cross-Link IPTG IsoPropyl-beta-D-ThioGalactopyranoside JRH-1 C. elegans D O G - l / F A N C J - R e l a t e d Helicase (also known as B C H - 1 and SPAR-1) L B Luria-Bertani Media LIG4 Ligase 4 M S H MutS Homolog M L H M u t L Homolog N G M Nematode Growth Media P M S PostMeiotic Segregation increased M M R Mismatch Repair M R E Meiotic REcombination homolog M R N M R E 1 1 / R A D 5 0 / N B S 1 complex M R T C. elegans M o R T a l geririline N B S Nijmedgen Breakage Syndrome N E R Nucleotide Excision Repair N H L Novel Helicase-Like N H E J Non-Homologous End-Joining PBS Phosphate Buffered Saline P C N A Proliferating Ce l l Nuclear Antigen P C R Polymerase Chain Reaction P V L C. elegans Protruding VuLvae RAD-51 RADia t ion sensitivity abnormal R F C Replication Factor C R N A i R N A interference R P A Replication Protein A R P M Revolutions Per Minute R T E L Regulator TElomere Length S C E Sister Chromatid Exchange S D S A Synthesis Dependent Strand Annealing SGS Suppressor Growth Slow SPAR-1 C. elegans SuPressor Aberrant Recombination (also known as BCH-1 and JRH-1) SRS Suppressor Rad Six ssDNA single stranded D N A T C - N E R Transcription Coupled Nucleotide Excision Repair TFIIH Transcription Factor II H T I L L I N G Targeting Induced Local Lesions in Genomes T L S Trans-Lesion Synthesis T M P TriMethylPsoralen TRF Telomere Repeat Factor T T D TrichoThiDystrophy U N C C. elegans UNCoordinated V A B C. elegans Variable ABnormal W R N WeRNer syndrome protein X P Xeroderma Pigmentosum X P - V Xeroderma Pigmentosum-Variant X R C C X-ray Repair Cross-Complementing ACKNOWLEDGEMENTS The work completed in this thesis could not have been accomplished without the support of multiple individuals, who I wish to acknowledge here. I would like to thank A n n Rose for her excellent supervision and guidance throughout the past four years. I am in debt to Nigel O ' N e i l for sharing his knowledge and ideas and for his mentorship in all aspects of this project. Thanks to all members of the Rose lab for their support, discussions and general positive presence in the lab, and especially to Shir Hazir for pouring all those plates. Thanks also to collaborators Simon Boulton, Louise Barber and Jordan Ward for sharing data and discussing ideas. I would like to recognize my supervisory committee members, Peter Lansdorp, Don Riddle and Hugh Brock for contributing their time and ideas to this project. Also, I would like to acknowledge Don Riddle, David Bail l ie , Phi l Hieter and K i r k McManus, Don Moerman and Mark Edgley and their laboratories for sharing lab equipment. I am grateful for financial support from the Natural Sciences and Engineering Research Council, the Michael Smith Foundation for Health Research and the National Cancer Institute of Canada. Finally, I wish to thank Ngan Huynh and my parents and family for their continued love, encouragement and support. CO-AUTHORSHIP STATEMENT A version of Chapter 2 of this thesis has already been published: Youds JL , O ' N e i l N J , Rose A M (2006) Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173(2): 697-708. The experiments reported in the published manuscript were designed by J L Y , N J O and A M R . Experiments were carried out by J L Y . J L Y wrote the paper, which was edited by N J O and A M R . CHAPTER 1: Introduction The accurate transmission of genetic information is in a delicate balance between maintaining genome stability and allowing for mutational events that drive evolution. D N A repair pathways function in the preservation of genome integrity by detecting damage, removing lesions and restoring the D N A sequence. A s lesions in the D N A can arise frequently from both endogenous and exogenous sources, and mutations can be heritable, D N A repair genes are particularly important in ensuring faithful copying of D N A during replication. If the D N A is not accurately replicated and transmitted, birth defects, neurological disorders, premature aging, and development of cancer can resuh (Vinson & Hales, 2002; M i r k i n , 2006; Woodruff & Thompson, 2003; Andressoo etal, 2006; Hoeijmakers, 2001). 1.1 Pathways for DNA repair When damage to the D N A occurs, a specific series of events takes place. First, the damage must be detected and the D N A damage checkpoint activated. The checkpoint functions to halt the cell cycle until the damage can be repaired and the cell cycle can be resumed. Two central components of the D N A damage checkpoint are the kinases A T M (Ataxia Telangiectasia Mutated) and A T R (Ataxia Telangiectasia mutated and Rad3-related; Harrison & Haber, 2006). A T M responds to double strand breaks, whereas A T R responds to lesions that generate single- stranded D N A , such as stalled replication forks (Harrison & Haber, 2006). Downstream of the D N A damage checkpoint, a series of transducers and effectors function to either repair the damage or execute apoptosis. There are multiple pathways that can carry out repair, and the effectors that complete the repair depend upon the type of D N A lesion that is present. The following sections describe the general mechanisms and components of the major repair pathways relevant to the work described in this thesis (Table 1.1). Lesion Repair Pathway Proteins Involved Double strand breaks Double strand breaks Nucleotide mismatches, insertion/deletions Bulky adducts, photoproducts Homologous recombination repair Non-homologous end-joining Mismatch repair Nucleotide excision repair Replication fork stalls Translesion synthesis ATM, MREl 1/NBS1/RAD50, RAD51, RAD52, RAD54, RFA, BRCAl, BARDl, BLM, BRCA2 KU70/80, Artemis, DNA-PKcs, LIG4/XRCC4, BRCAl, SlRTl MSH2, MSH3, MSH6, MLHl, PMSl, PMS2, FENl XPA, XPB, XPC/HHR23B, XPD, XPF/ERCCl, XPG, L1G1,CSA CSB, DDBl POLii, POLi, P O L k , POLÇ R E V l Interstrand cross-links, replication fork blocking lesions Interstrand cross-link ATR, FANCA, FANCB, FANCC, FANCD1/BRCA2, repair FANCD2, FANCE, FANCF. FANCG, FANCI, FANCJ/BRIPl, FANCL, FANCM, FANCN/PALB2, BRCAl, BLM, XPF/ERCCl, TOPOnitt, FAAPlOO, MREl 1/NBS1/RAD50, TLS pols Tablel.l: A list of several of the main pathways for D N A repair and many of the proteins involved in these pathways. Mechanisms for these pathways are described in the text that follows. 1.1.1 Double strand break repair Double strand breaks can occur as a result of exogenous agents, such as ionizing radiation, or by endogenous causes, such as reactive oxygen species or when D N A containing a single strand break is replicated (Scott & Pandita, 2006). Furthermore, double strand breaks are intentionally created during meiosis. Therefore, double strand breaks are a common lesion and must be managed effectively in order to prevent chromosomal instability. Two main pathways exist to repair double strand breaks: homologous recombination repair and non-homologous end- jommg. There are several double strand break repair deficiencies in humans that are characterized by various genome instability phenotypes such as cancer predisposition, immunodeficiency and/or developmental defects. These include Ataxia Telangiectasia (AT) and Seckel syndrome, which are caused by defects in the checkpoint proteins A T M and A T R , respectively (Canman & L i m , 1998; O 'Dr iscol l et al, 2003; reviewed in Scott & Pandita, 2006). Defects in these proteins result in difficulty recognizing the D N A damage and transducing signals in response to the damage (Scott & Pandita, 2006). Ataxia Telangiectasia-like disorder ( A T L D ) and Nijmegen Breakage syndrome (NBS) are caused by mutations in the M R E l 1 and N B S l components of the M R E l 1/RAD50/NBS1 complex ( M R N complex), which functions in the early detection of the break, as well as in double strand break end processing (Taylor et al, 2004; Matsuura et al, 1998). Mutations in components of the two pathways that carry out double strand break repair are also causes for human diseases. One subtype of the cancer susceptibility syndrome Fanconi anemia is caused by defects in homologous recombination repair in the absence F A N C D 1 / B R C A 2 . L I G 4 syndrome, which is characterized by developmental delay, skin abnormalities and cellular radiosensitivity, is caused by mutation in ligase4 that results in faulty non-homologous end-joining (Scott & Pandita, 2006). The homologous recombination repair (HRR) pathway functions to repair breaks using a homologous sequence as a template. This type of repair occurs primarily during replication, in S- and G2-phase, and is promoted by B R C A l (reviewed in Wyman & Kanaar, 2006; Powell & Kachnic, 2003). H R R takes place when single-stranded 3 ' D N A overhangs are generated; this process involves the M R N complex. The R A D 5 1 recombinase loads onto the single-stranded D N A end and is stabilized by B R C A 2 (Esashi et al, 2007; Davies & Pellegrini, 2007); this facilitates the invasion of the template strand, creating a branched structure resembling a Holliday junction (HJ). The H J can be resolved to give crossover or non-crossover outcomes, and different mechanisms and enzymes might be used for H R R depending on the structure of the broken D N A ends (Wyman & Kanaar, 2006). Because it uses a template for repair, H R R is generally error-free. In non-homologous end-joining (NHEJ), the other main pathway for double strand break repair, blunt D N A ends or ends with small complementary overhangs are pieced together. N H E J might be the main pathway for double strand break repair during the G1-phase of the cell cycle, when no sister chromatid is available for H R R (reviewed in Burma et al, 2006). Prior to N H E J , D N A end processing can occur depending on the presence of gaps or end-blocking groups; end processing can involve various enzymes, such as Artemis (Burma et al., 2006). During N H E J , the K U 7 0 / K U 8 0 heterodimer recognizes and binds the D N A end, then recruits D N A - P K c s (Feldmann et al, 2000; Walker et al, 2001). A s a kinase, the active D N A - P K c s activates and recruits Ligase I V / X R C C 4 , which is responsible for ligation of the D N A ends (Martin & MacNe i l l , 2002; Burma et al, 2006). Although N H E J repairs breaks with high efficiency, it tends to be error-prone because it does not use a template for repair. N H E J is associated with gross chromosomal rearrangements that can result from the joining of improper D N A ends (Varga & Apian, 2005). However, some studies have suggested that B R C A l might function in N H E J to reduce its mutagenic potential (Bau et al., 2004; Zhuang et al., 2006). 1.1.2 Mismatch repair Base substitutions and small insertion-deletion mismatches can occur in the D N A as a result of errors introduced by the D N A polymerase. The D N A mismatch repair ( M M R ) pathway is the main mechanism that acts in repair of substitutions and insertion-deletions. Mutations in components of the M M R pathway can lead to microsatellite instability that is characteristic of hereditary non-polyposis colorectal cancer and various sporadic cancers (Hoeijmakers, 2001). M M R is initiated when P C N A recruits the M M R proteins to the site of the damage. The M S H 2 / M S H 6 heterodimer binds to single base mismatches or insertion deletion mismatches, while the M S H 2 / M S H 3 heterodimer binds insertion deletion mismatches up to 16 nucleotides long (reviewed in Kunkel & Erie, 2005). M L H 1 / P M S 2 and M L H l / P M S l interact with the M S H complexes, also participating in the repair (Kunkel & Erie, 2005). The new strand of D N A containing the error is excised and resynthesized; several proteins are implicated in these steps, including polymerase ô, R P A , R F C , and exonucleases such as F E N l (Hoeijmakers, 2001 ; Kunkel & Erie, 2005). Several of the mismatch repair proteins, including M L H l and M L H 3 are reported to be involved in both M M R and meiotic recombination, as least in yeast (Wang et al., 1999). 1.1.3 Nucleotide excision repair Bulky adducts induced by chemicals and photoproducts caused by UV-irradiation are among the lesions repaired by the nucleotide excision repair pathway (NER) . Defects in N E R proteins cause Xeroderma Pigmentosum (XP), Cockayne syndrome (CS), and tricothiodystrophy (TTD; reviewed in de Boer & Hoeijmakers, 2000). X P is characterized by skin cancer predisposition due to extreme photosensitivity, while CS and T T D patients display a spectrum of neurological abnormalities as a consequence of N E R deficiency (de Boer & Hoeijmakers, 2000). Two sub-pathways of N E R exist: these are global genome repair ( G G - N E R ) and transcription coupled repair ( T C - N E R ) . G G - N E R acts on lesions throughout the genome, whereas T C - N E R is triggered by lesions that block the transcription of genes that are actively being transcribed (de Boer & Hoeijmakers, 2000). Lesions that distort the D N A helix are recognized and bound by the X P C / H H R 2 3 B complex in the early steps of G G - N E R (Sugasawa et al, 1998). The stalled R N A polymerase could be a signal for T C - N E R that is recognized by C S B and X P G , which might function in recruiting TFI IH to remodel the transcription bubble before T C - N E R can be carried out (Sarker et al, 2005). In both G G - N E R and T C - N E R , X P A functions in an early step, where it might verify the damage or orchestrate other proteins, such as R P A , and the TFI IH and E R C C l / X P F complexes in the repair process (de Boer & Hoeijmakers, 2000). The D N A helix around the site of the lesion is locally unwound to allow access by the repair machinery; this might involve the X P B and X P D helicases that are associated with the TFIIH complex (Evans et al, 1997). X P G and E R C C l / X P F are involved in excision either side of a 24-32 nucleotide sequence containing the lesion (O'Donovan et al, 1994; Sijbers et al, 1996; de Boer & Hoeijmakers, 2000). D N A synthesis occurs across the gap, and this involves polymerases ô and s, along with other replication factors (Shivji et al, 1995). N E R is completed when the newly synthesized D N A is ligated, likely by D N A ligase I (Barnes et al, 1992). 1.1.4 Lesion bypass Any lesion that interferes with the progress of the replication fork can either be repaired before replication resumes, or the damaged site can be bypassed and repaired after replication is complete. A s D N A damage is constantly occurring and repair can be a slow process that does not always fully complete, lesion bypass is an important mechanism for overcoming replication fork blockages (Lehmarm, 2006). When lesions occur on the lagging strand, one possible outcome is that a gap might be left in the Okazaki fragment that corresponds to the site of the lesion, and the gap can be repaired after replication is complete by post-replication repair pathways (West et al, 1981). There are also several means to bypass replication fork blocking lesions that do not leave gaps in the nascent D N A strand; these include replication fork regression followed by template switching and translesion synthesis. A stalled replication fork may be regressed in order to facilitate the bypass of a lesion that blocks the fork. Fork regression involves the unwinding of the newly synthesized D N A from the parental strands and the re-pairing of the two nascent strands together to form a 4-way D N A junction (Higgins et al, 1976; Grompone et al, 2004; Flores et al, 2001). The pairing o f the two nascent strands might allow lesion bypass through template switching, as the longer nascent strand could act as a template for the other nascent strand to replicate past damage that is present on the parental strand (Higgins et al, 1976). Following bypass, the D N A junction must be reset in order for replication to continue. Fork resetting is suggested to occur by way of helicases, such as those in the RecQ family, that could branch migrate Holliday junction-type structures to reset the fork without homologous recombination (Constantinou et al, 2000; Karow et al, 2000). The RecQ helicases have multiple roles in repair that w i l l be discussed in greater detail in section 1.2.1. Alternatively, fork resetting might occur through cleavage of the D N A junction by structure-specific endonucleases such as Mus81 (Whitby et al, 2003). Mus81 can cleave a range of abnormal structures that might form when replication is blocked, including branched substrates, pseudoreplication forks and D-Ioops (Whitby et al, 2003; Hollingsworth & B r i l l , 2004). In addition, Mus81 might be involved in synthesis dependent strand annealing (SDSA) , where it could cleave the protruding 3' D N A end, thus preventing the D N A end from reinvading the donor duplex and by doing so, would avoid the formation of a homologous recombination repair intermediate that could be resolved as a crossover (Robert et al, 2006). Furthermore, Mus81 is synthetically lethal with the RecQ helicase Sgsl in yeast, and this lethality is dependent on the recombination protein R a d S l , indicating that Mus81 acts on some type of homologous recombination intermediate on which Sgsl also acts (Fabre et al, 2002; Whitby et al, 2003). Although the exact roles of Mus81 are still under debate, it appears to rescue stalled replication forks, and may also generate meiotic crossovers in yeast (Hollingsworth & B r i l l , 2004). Damage bypass can also be carried out by the translesion synthesis (TLS) polymerases, which include the Y-family polymerases Polt], Poh, P o I k and R e v l , as well as the B family polymerase PolÇ (Sweasy et al., 2006). The T L S polymerases have active sites with open structures that allow the accommodation of altered bases, but cause these polymerases to be error-prone, unlike the normal replicative polymerases (Lehmann, 2006). Different polymerases can act on different lesions. For example, Polr] catalyzes synthesis past cyclobutane dimers that are induced by UV-irradiation (Gibbs et al, 2005); mutations in Polt) cause Xeroderma Pigmentosum-variant ( X P - V ) due to defects in the ability to bypass UV-induced lesions (Sweasy et a/., 2006). On the other hand, PolÇ and R e v l are required for bypass of 6-4 photoproducts (Nakajima et al, 2004; Gibbs et al, 2005). During replication, the T L S polymerases associate with the polymerase sliding clamp P C N A (Kannouche et al., 2004; Lehmaim, 2006). When the replication fork encounters damage, P C N A becomes modified by ubiquitylation (Hoege et al, 2002), and this event might stabilize the association of the T L S polymerases with P C N A , thereby facilitating polymerase switching that allows bypass of the lesion (Bienko et al, 2005; Lehmann, 2006). 1.1.5 Interstrand cross-link repair D N A interstrand cross-links are one of the most toxic types of damage because cross- links prevent the separation of the two D N A strands of the double helix, thereby blocking replication and transcription. The pathway that carries out the removal of interstrand cross-links is known as the Fanconi pathway, based on the identification of a syndrome characterized by defects in this pathway. Fanconi anemia (FA) is a rare cancer susceptibility syndrome associated with various congenital abnormalities, including skeletal malformations, renal abnormalities and hematological problems (Levitus et al, 2006). Individuals with F A commonly exhibit chromosomal instability and are predisposed to developing various types of cancers, including acute myeloid leukemia and squamous cell carcinomas (Venkitaraman, 2004). Because of a high incidence of bone marrow failure and cancer development, the average life expectancy for F A patients is less than 20 years (Levitus et al, 2006). Currently, 13 F A complementation groups are known, including A , B , C, D 1 / B R C A 2 , D2, E , F, G , I, J / B R I P l , L , M and N / P A L B 2 (Taniguchi & D'Andrea, 2006; Reid et al, 2007). A different gene is defective in each complementation group, which is likely one reason why the clinical phenotypes of the disease are somewhat heterogeneous. The largest subgroup of F A patients has defects in the F A N C A gene, followed by F A N C C and F A N C G (Levitus et al, 2006). On the cellular level, F A cells are highly sensitive to agents that cause D N A interstrand cross-links (ICLs), but are not hypersensitive to other types of D N A damaging agents, although a few groups have reported some controversial sensitivity to ionizing radiation (Levitus et al, 2006; Bigelow etal, 1979; Carreau et al, 1999; Garcia-Higuera et al, 2001). A key protein in the F A pathway is F A N C D 2 . In response to detection of D N A cross- links by A T R , which recognizes replication fork stalling caused by the cross-link, F A N C D 2 and F A N C I , which make up the ID complex, are monoubiquitylated by the F A core complex (reviewed in Thompson, 2005; Niedemhofer et al, 2005; Smogorzewska et al 2007). The F A core complex is made up of proteins from multiple complementation groups, including F A N C A , F A N C B , F A N C C , F A N C E , F A N C F , F A N C G , F A N C M , F A N C L , as well as the FA-associated protein F A A P l O O ; the complex also associates with the Bloom's syndrome protein B L M and TOPIIIa (reviewed in Thompson, 2005 and Niedemhofer et al, 2005; Gurtan & D'Andréa, 2006). Monoubiquitylation of the ID complex appears to be central to this pathway because it causes F A N C D 2 and F A N C I to be recruited to D N A repair foci, where F A N C D 2 interacts with other repair proteins including B R C A l , F A N C D 1 / B R C A 2 and the M R E l 1/RAD50/NBS1 (MRN) complex (Gurtan & D'Andrea, 2006). The XPF/ERCCl endonuclease might be involved in cross-link unhooking, or excision of the cross-link (Levitus et ai, 2006). The FA pathway is further complicated by interactions with other repair pathways. Potentially involved with the FA proteins in cross-link repair are the translesion synthesis polymerases, which might act to repair the ssDNA gap opposite the partially excised cross-link, and the homologous recombination proteins, which might be required to restart the replication fork following removal of the cross-link (Levitus et al, 2006). While the function of the FA core complex is becoming clearer, the components of the pathway and mechanism acting downstream of FANCD2 are not well known (Figure 1.1). Figure 1.1: A speculative model for interstrand cross-link repair by the Fanconi anemia pathway (adapted from Thompson [2005], Niedernhofer et al. [2005], and Levitus et al. [2006]). One effector protein thought to act downstream of FANCD2 is the helicase BRIPl/FANCJ, also known as BACHl (Levitus et al, 2006). Patients from Fanconi anemia complementation group J have biallelic mutations in BRIPl/FANCJ (Le\\tus et al, 2005), while individuals with monoallelic BRIPI/FANCJ mutations have increased susceptibility to breast cancer (Seal et al, 2006). Based on the Fanconi anemia phenotype and studies of BRIPl/FANCJ chicken cell lines (Bridge et al, 2005), B R I P l / F A N C J is thought to have a role in the repair of interstrand cross-links. Data from chicken cell lines indicating that F A N C D 2 foci formation is not affected by the absence of B R I P l / F A N C J has led to the proposal that B R I P l / F A N C J functions downstream of F A N C D 2 (Bridge etal, 2005). However, B R I P l F A N C C double mutant cells did not show epistasis in cross-link sensitivity; rather, the double mutants had greater sensitivity to cisplatin treatment than B R I P l / F A N C J or F A N C C single mutants (Bridge et al, 2005). This raises the possibility that B R I P l / F A N C J might function in a pathway parallel to the core complex and F A N C D 2 . Furthermore, it is not known on what substrates B R I P l / F A N C J acts, or with which proteins it interacts. While much is known about the F A core complex and F A N C D 2 , there are many questions remaining regarding effector proteins and how the F A pathway removes interstrand cross-links. 1.2 Helicases involved in DNA repair Helicases play a major role in D N A metabolism, with functions that range from replication to recombination to transcription. Helicases are implicated in multiple processes that preserve genome integrity, including nucleotide excision repair, homologous recombination repair, cross-link repair and telomere maintenance. Several of the main repair helicases are described in the following section. 1.2.1 The RecQ helicases The RecQ helicases are a related group of evolutionarily conserved helicases that function in multiple roles in D N A repair and genome stability. In yeast there is a single RecQ helicase, while in humans there are five known RecQ helicases. In Saccharomyces cerevisiae, absence of the RecQ helicase Sgsl causes sensitivity to hydroxyurea treatment, indicating a role 11 during replication (Frei & Gasser, 2000). Sgsl is required for the stable association of polymerases a and s at stalled replication forks, suggesting that Sgsl might function in resolving aberrantly paired structures at stalled replication forks to allow polymerases to access single- stranded D N A (Cobb et al, 2003). Sgsl mutants show a 2.5-fold increase in spontaneous crossover, suggesting that this protein contributes to preventing crossover outcomes of repair (Robert et al, 2006). Similar to human B L M , Sgsl might process homologous recombination intermediates through a mechanism termed double Holliday junction dissolution that leads to non-recombinational outcomes (Bennett et al, 1999; Karow et al, 2000; W u & Hickson, 2003; Liberi et al, 2005). Sgsl has a synthetic slow growth or lethal phenotype together with several genes impUcated in repair, including Mus81 and Srs2, suggesting that Sgsl might resolve repair intermediates that other endonucleases or helicases can also resolve (Figure 1.2; Khakhar et al, 2003). Mus81-dependent repair D-loop repair intermediate Sgsl/BLM-dependent repair (double Holliday junction dissolution) Synthesis dependent strand annealing (Srs2) Srs2 MusSI - X A*— Mus81 l^Dk^ K. Figure 1.2: Proposed roles for Mus81, Sgsl and Srs2 in repair leading to non-recombinational outcomes. MusSl cleaves double Holliday junctions, while Sgsl can unwind the same substrate, together with Top3, by double Holliday junction dissolution. Srs2 removes RadSl from the invading DNA filament to promote synthesis dependent strand annealing (SDSA). MusSI might also function in SDSA to cleave the overhanging 3' DNA end. Figure adapted from Osman & Whitby (2007) and Lorenz & Whitby (2006). Mutations in three of the five human RecQ helicases cause Bloom's syndrome (BLM), Werner's syndrome (WRN), and Rothmund-Thomson syndrome {RECQ4; Mankouri & Hickson, 2004). These syndromes have some overlapping characteristics and are associated with predisposition to cancer and/or premature aging (Khakhar et ai, 2003). Bloom's syndrome is characterized by growth retardation, sunlight sensitivity and predisposition to cancer (Cheok et al, 2005), whereas Werner's syndrome phenotypes include slow growth, premature aging and predisposition to sarcomas (Bohr, 2005). BLM cells display an approximately 10-fold elevation in frequency of sister chromatid exchanges (SCEs), suggesting that B L M functions to suppress these types of events (Ell is et ai, 1999; Mankouri & Hickson, 2004). B L M can unwind a variety of different D N A structures, including forked D N A duplexes, Holliday junction recombination intermediates and G - quadruplex D N A (Mohaghegh et al, 2001; Sun et al, 1998; Cheok et al, 2005). B L M also catalyzes regression of a model replication fork, which might be an early step in the response to replication fork stalling (Machwe et al, 2006). B L M interacts with the recombination protein RAD51 as well as with the single-stranded binding protein R P A and the topoisomerase TOPIIIa , which catalyses the strand passage of D N A to alter its topology (Cheok et al, 2005; W u et al, 2000; W u & Hickson, 2003). Together, B L M and TOPIIIa function in a process known as double Holliday junction dissolution, whereby homologous recombination repair intermediates are resolved into non-crossover outcomes, explaining the elevated SCEs observed in BLMCQWS (Wu & Hickson, 2003). WRN cells show an increased frequency of chromosomal rearrangements, such as translocations and deletions (Bachrati & Hickson, 2003; Baynton et al, 2003). Like B L M , W R N can unwind blunt duplexes containing single-stranded bubbles, synthetic Holliday junctions and G-quadruplex D N A structures (Mohaghegh et al, 2001 ; Sun et al, 1998); W R N can also catalyze replication fork regression in vitro (Machwe et al., 2006). W R N interacts with R A D 5 2 and N B S l , both of which function in homologous recombination (Baynton et al, 2003; Cheng et al, 2004). W R N also associates with the KU70/80 heterodimer, which functions in non-homologous end-joining (Cooper et al, 2000). Therefore, W R N might have roles in two pathways for double strand break repair, and defects in these pathways in the absence of W R N might explain the chromosomal rearrangements observed in WRN CQWS (Bohr, 2005). The roles for W R N in double strand break repair appear to be related to a function in telomere maintenance. Both B L M and W R N physically and functionally interact with the telomere repeat binding factor TRF2 (Opresko et al, 2002), and these RecQ helicases might function in homologous recombination repair pathways that elongate telomere ends (Bohr, 2005). W R N is required for the efficient lagging strand synthesis of G-rich D N A at telomeres, further supporting an important role for W R N at telomeres (Crabbe et al, 2004). 1.2.2 The Srs2 helicase Along with the RecQ helicases, several other helicases also play significant roles in repair during replication. One of these is Srs2, a helicase thus far only identified in yeast. Similar to Sgs l , S. cerevisiae Srs2 has an important role in preventing hyper-recombination, as srs2 mutants show a 4-fold increase in spontaneous crossovers (Macris & Sung, 2005; Robert et al, 2006). Srs2 may prevent homologous recombination repair by channeling recombination repair intermediates into the Rad6-mediated post-replication repair pathway (Macris & Sung, 2005). In vitro, Srs2 interacts with the Rad51 recombinase and dislodges Rad51 from single-stranded D N A , thereby acting as an anti-recombinase (Krejci et al, 2003; Veaute et al, 2003). Specifically, Srs2 might channel repair intermediates into the synthesis-dependent strand- annealing pathway (SDSA) by dissociating the invading D N A strand from the D-loop recombination intermediate (Figure 1.2; Ira et al, 2003). Srs2 also physically interacts with sumoylated form of the polymerase processivity factor P C N A , which is associated with the replication fork (Hoege et al, 2002; Pfander et al, 2005). This interaction links Srs2 to the replication fork, suggesting a role in preventing unwanted homologous recombination as a means for repair during replication. 1.3 C. elegans as a model for the study of DNA repair A s D N A repair pathways are very complex, one means to begin to understand these pathways is to study a model organism, such as Caenorhabditis elegans. C elegans is one of the most well-characterized model organisms. The nematode eats bacteria and can be cultured without difficulty on small petri plates; thus, it is inexpensive and easy to maintain, and requires little space. The nematode takes only three days to develop from egg to fertile adult, and both hermaphrodites and males exist, making genetic manipulation relatively quick and easy. Furthermore, each adult produces 300 progeny, allowing large populations for experiments. Because the nematode has been used as a model organism since the 1970s, there are numerous resources available to aid in research, and many methods for working with the organism have already been established. The genetics of C. elegans is an especially powerful tool. There are many knockout mutants available from the Caenorhabditis Genetics Centre, and genetic interactions in the nematode can be easily assayed by making double mutants and observing the phenotypes o f the animals. The ease of generating double mutant strains is a great advantage of C. elegans as a model system, as it takes only a few weeks to make double mutants i f the single mutant strains are available. Many methods to study D N A replication and repair in C. elegans focus on the germline (Gartner et al., 2004). The germline is an excellent tool for the study of repair because of the manner in which it is structured. The germline is organized in a temporal-spatial manner such that nuclei can be observed as they progress from mitosis into and through the various stages of meiosis from distal to proximal regions. The germline begins at the distal tip, where nuclei undergo mitosis in the mitotic zone, which acts as the stem cell compartment for the germline. Beyond the mitotic zone, nuclei progress into the transition zone, where meiosis begins, and nuclei can be observed with a characteristic crescent shape. Nuclei then progress into the pachytene stage of meiosis, followed by diplotene and diakinesis, where the highly condensed D N A can be observed as six bivalents that correspond to the homologous chromosome pairs. Following diakinesis, the nuclei cellularize to become oocytes and fertilization occurs (Figure 1.3). Distal Tip litotic Zone Transition Zone 1 I 1 r Meiotic Pachytene Oogenesis Early Embryos Spermatheca Figure 1.3: Schematic of the C. elegans germline. Damaged D N A results in visible changes in the C. elegans germline. For example, in response to D N A damage in the mitotic nuclei, the S-phase checkpoint w i l l arrest these nuclei in order to allow time for repair to occur before replication proceeds (Ahmed et al., 2001). S-phase arrest results in visibly enlarged nuclei and fewer total nuclei in the mitotic zone (Ahmed et al., 2001). Damaged nuclei can also undergo apoptosis in the germline, and apoptotic nuclei can be observed in pachytene at the bend region of the gonad (Gartner et al., 2004). In addition, fragmented chromosomes and chromatin bridges, as well as other damage can also be observed throughout the germline, allowing for the evaluation of defects in any D N A repair mutant. c elegans is particularly useful for the study of D N A repair because many of the repair proteins and pathways present in human cells are conserved in the nematode. For example, the tumor suppressor p53, which is the most frequently mutated gene in human cancers (Attardi, 2005), has been identified in C. elegans as cep-I (Schumacher et al., 2001; Deny et al, 2001). The BRCAl and BRCA2 genes implicated in familial breast cancer also have orthologs in C. elegans, known as brc-1 and brc-2 (Boulton et al., 2004; Martin et al., 2005). Multiple repair helicases are conserved in C. elegans, including him-6/BLM, wrn-l/WRN, Y50D7A.2/XPD and rcq-5/RECQ5, among others (Boulton etal, 2002; O ' N e i l & Rose, 2006; vmw.wormbase.org). Furthermore, pathways including homologous recombination repair, non-homologous end- joining, mismatch repair, nucleotide excision repair and interstrand cross-link repair are conserved mechanisms for repair in C. elegans (O 'Ne i l & Rose, 2006; CoUis et al, 2006). For example, Meyer et al (2007) have shown that the repair o f UVC- induced lesions is kinetically and genetically similar to the repair process in humans. 1.4 polyG/polyC-tracts and the DOG-1 helicase-like protein in C. elegans Aside from being a model for the study of repair, C. elegans has been useful in defining novel functions for genes involved in replication and repair. In C. elegans, the DOG-1 helicase- like protein has been shown to play a role in genome maintenance at polyG/polyC-tracts (G/C- tracts; Cheung et al, 2002). Cheung et al (2002) reported that dog-l(gklO) mutants displayed a mutator phenotype whereby certain mutant phenotypes frequently appeared. Mapping of several of the visible notched head mutations showed that deletions beginning in the G/C-tract in the vab-1 gene were responsible for the phenotype. Examination of a number o f other G/C-tracts in the genome revealed that approximately half of the G/C-tracts greater than 18 nucleotides in length had deletions in the absence of DOG-1 (Cheung et al, 2002). Single stranded G-rich D N A might form secondary structures, such as G-quadruplex, that might create blockages and cause replication fork stalling or collapse (Arthanari and Bolton, 2001; Woodford et al, 1994). G-rich D N A sequences with the potential to form D N A secondary structures are prevalent in the C. elegans and human genomes (Todd et al. 2005), and occur at telomeres, meiotic recombination hotspots, and gene promoters, among other sites (Simonsson 2001; Maizels, 2006). The C. elegans genome contains 396 G/C-tracts of 18 or more consecutive guanines (www.wormbase.org), suggesting that there are many sites that are potentially vulnerable to deletions in the absence of D O G - 1 . The G/C-tract deletions observed by Cheung et al (2002) in dog-1 mutants were typically a few hundred base pairs long, and initiated in the 3' end of the G - tract, extending upstream for various distances. Based on this data, Cheung et al (2002) proposed that DOG-1 might be involved in unwinding D N A secondary structures that occur in tracts of 18 or more guanines during lagging strand replication, dog-1 was also identified as the C. elegans gene most similar to human BRIPl (Cheung et al., 2002), which has since been identified as the F A gene F^A^CJ(Levitus et al, 2005; Bridge et al, 2005). 1.5 Thesis objectives The goals of the work documented in this thesis were as follows: 1. ) Use dog-1 as a tool to determine the repair pathways that function at replication forks stalled by G/C-tract secondary structures in C. elegans. 2. ) Investigate the role o f DOG-1 in D N A repair in C. elegans. 3. ) Characterize the function of the dog-1/FANCJ-vdatcd helicase JRH-1 in D N A repair in C. elegans. Chapter 1 References Andressoo JO, Hoeijmakers J H , & Mitchell JR (2006) Nucleotide excision repair disorders and the balance between cancer and aging. Cell Cycle 5: 2886-2888 Arthanari H & Bolton P H (2001) Functional and dysfunctional roles of quadruplex D N A in cells. Chem Biol 8: 221-230 Attardi L D (2005) The role of p53-mediated apoptosis as a crucial anti-tumor response to genomic instability: lessons from mouse models. Mutat Res 569: 145-157 Bachrati C Z & Hickson ID (2003) RecQ helicases: suppressors of tumorigenesis and premature aging. Biochem J 374: 577-606 Barnes D E , Tomkinson A E , Lehmann A R , Webster A D , & Lindahl T (1992) Mutations in the D N A ligase I gene of an individual with immunodeficiencies and cellular hypersensitivity to DNA-damaging agents. Cell 69: 495-503 Bau DT, Fu Y P , Chen ST, Cheng T C , Y u JC, W u P E , & Shen C Y (2004) Breast cancer risk and the D N A double-strand break end-joining capacity of nonhomologous end-joining genes are affected by B R C A l . Cancer Res 64: 5013-5019 Baynton K , Otterlei M , Bjoras M , von Kobbe C, Bohr V A , & Seeberg E (2003) W R N interacts physically and functionally with the recombination mediator protein R A D 5 2 . J Biol Chem 278: 36476-36486 Bennett RJ , Keck J L , & Wang JC (1999) Binding specificity determines polarity of D N A unwinding by the Sgs l protein of S. cerevisiae. J Mol Biol 289: 235-248 Bienko M , Green C M , Crosetto N , Rudolf F, Zapart G , Coul l B , Kannouche P, Wider G , Peter M , Lehmann A R , Hofmarm K , & Dikic I (2005) Ubiquitin-binding domains in Y-family polymerases regulate translesion synthesis. Science 310: 1821-1824 Bigelow S B , Rary J M , & Bender M A (1979) G2 chromosomal radiosensitivity in Fanconi's anemia. Mutat Res 63:189-199 Bohr V A (2005) Deficient D N A repair in the human progeroid disorder, Werner syndrome. Mutat Res 577: 252-259 Boulton SJ, Martin JS, Polanowska J, H i l l D E , Gartner A , & Vida l M (2004) B R C A l / B A R D l orthologs required for D N A repair in Caenorhabditis elegans. Curr Biol 14: 33-39 Bridge W L , Vandenberg CJ , Franklin RJ , & Hiom K (2005) The B R I P l helicase functions independently of B R C A l in the Fanconi anemia pathway for D N A crosslink repair. Nat Genet 37: 953-957 Burma S, Chen B P , & Chen D J (2006) Role of non-homologous end joining (NHEJ) in maintaining genomic integrity. DNA Repair (Amst) 5: 1042-1048 Canman C E & L i m D S (1998) The role of A T M in D N A damage responses and cancer. Oncogene 17: 3301-3308 Carreau M , A l o n N , Bosnoyan-Collins L , Joenje H , & Buchwald M (1999) Drug sensitivity spectra in Fanconi anemia lymphoblastoid cell lines of defined complementation groups. Mutat Res 435: 103-109 Cheng W H , von Kobbe C, Opresko P L , Arthur L M , Komatsu K , Seidman M M , Carney JP, & Bohr V A (2004) Linkage between Werner syndrome protein and the M r e l 1 complex via N b s l . J BiolChem 279:21169-21176 Cheok C F , Bachrati C Z , Chan K L , Ra l f C, Wu L , & Hickson ID (2005) Roles of the Bloom's syndrome helicase in the maintenance of genome stability. Biochem Sac Trans 33: 1456-1459 Cheung I, Schertzer M , Rose A , & Lansdorp P M (2002) Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich D N A . Nat Genet 31: 405-409 Cobb JA, Bjergbaek L , Shimada K , Frei C, & Gasser S M (2003) D N A polymerase stabilization at stalled replication forks requires M e c l and the RecQ helicase Sgsl. EMBO J 22: 4325-4336 Collis SJ, Barber L J , Ward JD, Martin JS, & Boulton SJ (2006) C. elegans F A N C D 2 responds to replication stress and functions in interstrand cross-link repair. DNA Repair (Amst) 5: 1398-1406 Constantinou A , Tarsounas M , Karow JK, Brosh R M , Bohr V A , Hickson ID, & West SC (2000) Werner's syndrome protein ( W R N ) migrates Holliday junctions and co-localizes with R P A upon replication arrest. EMBO Rep 1: 80-84 Cooper M P , Machwe A , Orren D K , Brosh R M , Ramsden D , & Bohr V A (2000) K u complex interacts with and stimulates the Werner protein. Genes Dev 14: 907-912 Crabbe L , Verdun R E , Haggblom CI , & Karlseder J (2004) Defective telomere lagging strand synthesis in cells lacking W R N hehcase activity. Science 306: 1951-1953 Davies O R & Pellegrini L (2007) Interaction with the B R C A 2 C terminus protects R A D 5 1 - D N A filaments from disassembly by B R C repeats. Nat Struct Mol Biol de Boer J & Hoeijmakers J H (2000) Nucleotide excision repair and human syndromes. Carcinogenesis 21: 453-460 Deny W B , Putzke A P , & Rothman J H (2001) Caenorhabditis elegans p53: role in apoptosis, meiosis, and stress resistance. Science 294: 591-595 Ell is N A , Proytcheva M , Sanz M M , Ye T Z , & Gemian J (1999) Transfection of B L M into cultured bloom syndrome cells reduces the sister-chromatid exchange rate toward normal. Am J Hum Genet (iS: 1368-1374 Esashi F, Galkin V E , Y u X , Egelman E H , & West SC (2007) Stabilization of R A D 5 1 nucleoprotein filaments by the C-terminal region of B R C A 2 . Nat Struct Mol Biol 14: 468-474 Evans E , Moggs J G , Hwang JR, Egly J M , & Wood R D (1997) Mechanism of open complex and dual incision formation by human nucleotide excision repair factors. EMBOJW. 6559-6573 Fabre F, Chan A , Heyer W D , & Gangloff S (2002) Alternate pathways involving Sgsl/Top3, M u s S l / Mms4, and Srs2 prevent formation of toxic recombination intermediates from single- stranded gaps created by D N A replication. Proc Natl Acad Sci USA 99: 16887-16892 Feldmann E , Schmiemann V , Goedecke W, Reichenberger S, & Pfeiffer P (2000) D N A double- strand break repair in cell-free extracts from Ku80-deficient cells: implications for K u serving as an alignment factor in non-homologous D N A end joining. Nucleic Acids Res 28: 2585-2596 Flores M J , Bieme H , Ehrl ich SD, & Michel B (2001) Impairment of lagging strand synthesis triggers the formation of a R u v A B C substrate at replication forks. EMBO J 20: 619-629 Frei C & Gasser S M (2000) RecQ-like helicases: the D N A replication checkpoint connection. J Cell Sci 113 (Pt 15): 2641-2646 Garcia-Higuera I, Taniguchi T, Ganesan S, Meyn M S , Timmers C, Hejna J, Grompe M , & D'Andrea A D (2001) Interaction of the Fanconi anemia proteins and B R C A l in a common pathway. Mol Cell 7: 249-262 Gartner A , MacQueen A J , & Villeneuve A M (2004) Methods for analyzing checkpoint responses in Caenorhabditis elegans. Methods Mol Biol 280: 257-274 Gibbs PE , McDonald J, Woodgate R, & Lawrence C W (2005) The relative roles in vivo of Saccharomyces cerevisiae Pol eta, Pol zeta, R e v l protein and Pol32 in the bypass and mutation induction of an abasic site, T-T (6-4) photoadduct and T-T cis-syn cyclobutane dimer. Genetics 169: 575-582 Grompone G , Ehrl ich D , & Miche l B (2004) Cells defective for replication restart undergo replication fork reversal. EMBO Rep 5: 607-612 Gurtan A M & D'Andrea A D (2006) Dedicated to the core: understanding the Fanconi anemia complex. DNA Repair (Amst) 5: 1119-1125 Harrison JC & Haber JE (2006) Surviving the breakup: the D N A damage checkpoint. Annu Rev Genet 40:209-235 Higgins N P , Kato K , & Strauss B (1976) A model for replication repair in mammalian cells. J Mol Biol 101:417-425 Hoege C, Pfander B , Moldovan G L , Pyrowolakis G , & Jentsch S (2002) RAD6-dependent D N A repair is linked to modification of P C N A by ubiquitin and S U M O . Nature 419: 135-141 Hoeijmakers J H (2001) Genome maintenance mechanisms for preventing cancer. Nature 411: 366-374 Hollingsworth N M & B r i l l S J (2004) The M u s S l solution to resolution: generating meiotic crossovers without HoUiday junctions. Genes Dev 18: 117-125 Ira G , Maikova A , Liberi G , Foiani M , & Haber JE (2003) Srs2 and Sgsl-Top3 suppress crossovers during double-strand break repair in yeast. Cell 115: 401-411 Kannouche P L , Wing J, & Lehmann A R (2004) Interaction of human D N A polymerase eta with monoubiquitinated P C N A : a possible mechanism for the polymerase switch in response to D N A damage. Mol Cell 14: 491-500 Karow J K , Constantinou A , L i JL , West SC, & Hickson ID (2000) The Bloom's syndrome gene product promotes branch migration of Holliday junctions. Proc Natl Acad Sci USA 91: 6504- 6508 Khakhar R R , Cobb J A , Bjergbaek L , Hickson ID, & Gasser S M (2003) RecQ hehcases: multiple roles in genome maintenance. Trends Cell Biol 13: 493-501 Krejci L , Van Komen S, L i Y , Vil lemain J, Reddy M S , Kle in H , Ellenberger T, & Sung P (2003) D N A helicase Srs2 disrupts the Rad51 presynaptic filament. Nature 423: 305-309 Kunkel T A & Erie D A (2005) D N A mismatch repair. Annu Rev Biochem 74: 681-710 Lehmann A R (2006) Translesion synthesis in mammalian cells. Exp Cell Res 312: 2673-2676 Levitus M , Joenje H , & de Winter JP (2006) The Fanconi anemia pathway o f genomic maintenance. Cell Oncol 28: 3-29 Liberi G , Maffioletti G , Lucca C, Chiolo I, Baryshnikova A , Cotta-Ramusino C, Lopes M , Pellicioli A , Haber JE , & Foiani M (2005) Rad51-dependent D N A structures accumulate at damaged replication forks in sgsl mutants defective in the yeast ortholog of B L M RecQ helicase. Genes Dev 19: 339-350 Lorenz A & Whitby M C (2006) Crossover promotion and prevention. Biochem Soc Trans 34: 537-541 Machwe A , Xiao L , Groden J, & Orren D K (2006) The Werner and Bloom syndrome proteins catalyze regression of a model replication fork. Biochemistry 45: 13939-13946 Macris M A & Sung P (2005) Multifaceted role of the Saccharomyces cerevisiae Srs2 helicase in homologous recombination regulation. Biochem Soc Trans 33: 1447-1450 Maizels N (2006) Dynamic roles for G4 D N A in the biology of eukaryotic cells. Nat Struct Mol Biol 13: 1055-1059 Mankouri H W & Hickson ID (2004) Understanding the roles of RecQ helicases in the maintenance of genome integrity and suppression of tumorigenesis. Biochem Soc Trans 32: 957- 958 Martin JS, Winkelmann N , Petalcorin M I , Mcllwrai th M J , & Boulton SJ (2005) R A D - 5 1 - dependent and -independent roles of a Caenorhabditis elegans BRCA2-related protein during D N A double-strand break repair. Mol Cell Biol 25: 3127-3139 Matsuura S, Tauchi H , Nakamura A , Kondo N , Sakamoto S, Endo S, Smeets D , Solder B , Belohradsky B H , Der Kaloustian V M , Oshimura M , Isomura M , Nakamura Y , & Komatsu K (1998) Positional cloning of the gene for Nijmegen breakage syndrome. Nat Genet 19: 179-181 Meyer J N , Boyd W A , Azzam G A , Haugen A C , Freedman J H , Van Houten B (2007) Decline of nucleotide excision repair capacity in aging Caenorhabditis elegans. Genome Biol 8(5): R70. Mi rk in S M (2006) D N A structures, repeat expansions and human hereditary disorders. Curr Opin Struct Biol 16:351-358 Mohaghegh P, Karow J K , Brosh Jr RM,Jr , Bohr V A , & Hickson ID (2001) The Bloom's and Werner's syndrome proteins are D N A structure-specific helicases. Nucleic Acids Res 29: 2843- 2849 Nakajima S, Lan L , Kanno S, Takao M , Yamamoto K , Eker A P , & Yasui A (2004) U V light- induced D N A damage and tolerance for the survival of nucleotide excision repair-deficient human cells. J Biol Chem 279: 46674-46677 Niedemhofer L J , Lalai A S , & Hoeijmakers J H (2005) Fanconi anemia (cross)linked to D N A repair. Cell 123: 1191-1198 O'Donovan A , Davies A A , Moggs JG , West SC, & Wood R D (1994) X P G endonuclease makes the 3' incision in human D N A nucleotide excision repair. Nature 371: 432-435 O'Driscoll M , Ruiz-Perez V L , Woods C G , Jeggo P A , & Goodship J A (2003) A splicing mutation affecting expression of ataxia-telangiectasia and Rad3-related protein (ATR) results in Seckel syndrome. Nat Genet 33: 497-501 O 'Ne i l N J & Rose A M (2006) D N A repair. WormBook doi/10.1895/wormbook. 1.54.1, http://wvvw.wormbook.org Opresko P L , von Kobbe C, Laine JP, Harrigan J, Hickson ID, & Bohr V A (2002) Telomere- binding protein T R F 2 binds to and stimulates the Werner and Bloom syndrome helicases. J Biol Chem 277:41110-41119 Osman F & Whitby M C (2007) Exploring the roles of M u s S l - E m e l / M m s 4 at perturbed replication forks. DNA Repair (Amst) 6: 1004-1017 Pfander B , Moldovan G L , Sacher M , Hoege C, & Jentsch S (2005) SUMO-modif ied P C N A recruits Srs2 to prevent recombination during S phase. Nature 436: 428-433 Powell S N & Kachnic L A (2003) Roles of B R C A l and B R C A 2 in homologous recombination, D N A replication fidelity and the cellular response to ionizing radiation. Oncogene 22: 5784- 5791 Reid S, Schindler D , Hanenberg H , Barker K , Hanks S, Kalb R, Neveling K , Kel ly P, Seal S, Freund M , Wurm M , Batish SD, Each FP, Yetgin S, Neitzel H , Arif f in H , Tischkowitz M , Mathew C G , Auerbach A D , Rahman N (2007) Biallelic mutations in P A L B 2 cause Fanconi anemia subtype F A - N and predispose to childhood cancer. Nat Genet 39(2): 162-4 Robert T, Dervins D , Fabre F, & Gangloff S (2006) M r c l and Srs2 are major actors in the regulation of spontaneous crossover. EMBO J 25: 2837-2846 Sarker A H , Tsutakawa SE, Kostek S, N g C, Shin DS , Peris M , Campeau E , Tainer J A , Nogales E , & Cooper P K (2005) Recognition of R N A polymerase II and transcription bubbles by X P G , C S B , and TFIIH: insights for transcription-coupled repair and Cockayne Syndrome. Mol Cell 20: 187-198 Schumacher B , Hofmann K , Boulton S, & Gartner A (2001) The C. elegans homolog of the p53 tumor suppressor is required for D N A damage-induced apoptosis. Curr Biol 11: 1722-1727 Scott SP & Pandita T K (2006) The cellular control of D N A double-strand breaks. J Ce// Biochem 99: 1463-1475 Seal S, Thompson D , Renwick A , Elliott A , Kel ly P, Barfoot R, Chagtai T, Jayatilake H , Ahmed M , Spanova K , North B , McGuffog L , Evans D G , Eccles D , Breast Cancer Susceptibility Collaboration ( U K ) , Easton D F , Stratton M R , & Rahman N (2006) Truncating mutations in the Fanconi anemia J gene BRIP] are low-penetrance breast cancer susceptibility alleles. Nat Genet 38: 1239-1241 Shivji M K , Podust V N , Hubscher U , & Wood R D (1995) Nucleotide excision repair D N A synthesis by D N A polymerase epsilon in the presence of P C N A , R F C , and R P A . Biochemistry 34: 5011-5017 Sijbers A M , de Laat W L , Ar i za R R , Biggerstaff M , Wei Y F , Moggs JG , Carter K C , Shell B K , Evans E , de Jong M C , Rademakers S, de Rooij J, Jaspers N G , Hoeijmakers J H , & Wood R D (1996) Xeroderma pigmentosum group F caused by a defect in a structure-specific D N A repair endonuclease. Cell 86: 811-822 Simonsson T (2001) G-quadruplex D N A structures-variations on a theme. Biol Chem 382: 621- 628 Sugasawa K , N g J M , Masutani C, Iwai S, van der Spek PJ, Eker A P , Hanaoka F, Bootsma D , & Hoeijmakers J H (1998) Xeroderma pigmentosum group C protein complex is the initiator of global genome nucleotide excision repair. Mol Cell 2: 223-232 Smogorzewska A , Matsuoka S, Vinciguerra P, McDonald E R 3rd, Hurov K E , Luo J, Ba l l i f B A , Gygi SP, Hofmann K , D'Andrea A D , Elledge S J (2007) Identification of the F A N C I protein, a monoubiquitylated F A N C D 2 paralog required for D N A repair. Cell 129(2):289-301. Sun H , Karow J K , Hickson ID, & Maizels N (1998) The Bloom's syndrome helicase unwinds G4 D N A . J Biol Chem 273: 27587-27592 Sweasy JB, Lauper J M , & Eckert K A (2006) D N A polymerases and human diseases. Radiât Res 166:693-714 Taniguchi T & D'Andrea A D (2006) Molecular pathogenesis of Fanconi anemia: recent progress. 5/00^/107:4223-4233 Taylor A M , Groom A , & Byrd PJ (2004) Ataxia-telangiectasia-like disorder (ATLD)- i ts clinical presentation and molecular basis. DNA Repair (Amst) 3: 1219-1225 Thompson L H , Hinz J M , Yamada N A , & Jones N J (2005) H o w Fanconi anemia proteins promote the four Rs: replication, recombination, repair, and recovery. Environ Mol Mutagen 45: 128-142 Todd A K , Johnston M , & Neidle S (2005) Highly prevalent putative quadruplex sequence motifs in human D N A . Nucleic Acids Res 33: 2901-2907 Varga T & Apian P D (2005) Chromosomal aberrations induced by double strand D N A breaks. DNA Repair (Amst) 4: 1038-1046 Veaute X , Jeusset J, Soustelle C , Kowalczykowski SC, Le Cam E , & Fabre F (2003) The Srs2 helicase prevents recombination by disrupting Rad51 nucleoprotein filaments. Nature 423: 309- 312 Venkitaraman A R (2004) Tracing the network connecting B R C A and Fanconi anaemia proteins. Nat Rev Cancer 4: 266-276 Vinson R K & Hales B F (2002) D N A repair during organogenesis. Mutat Res 509: 79-91 Walker JR, Corpina R A , & Goldberg J (2001) Structure of the K u heterodimer bound to D N A and its implications for double-strand break repair. Nature 412: 607-614 Wang TF , Kleckner N , & Hunter N (1999) Functional specificity o f M u t L homologs in yeast: evidence for three Mlhl-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction. Proc Natl Acad Sci U SA 96: 13914-13919 West SC, Cassuto E , & Howard-Flanders P (1981) Mechanism of E. coli RecA protein directed strand exchanges in post-replication repair of D N A . Nature 294: 659-662 Whitby M C , Osman F, & Dixon J (2003) Cleavage of model replication forks by fission yeast M u s S l - E m e l and budding yeast MusS l -Mms4 . J Biol Chem 278: 6928-6935 Woodford K J , Howel l R M , & Usdin K (1994) A novel K(+)-dependent D N A synthesis arrest site in a commonly occurring sequence motif in eukaryotes. J Biol Chem 269: 27029-27035 Woodruff R C & Thompson JN,Jr (2003) The role of somatic and germline mutations in aging and a mutation interaction model of aging. J Anti Aging Med 6: 29-39 Wormbase website: www.wormbase.org. Release WS178, August 2007 W u L , Davies S L , North PS, Goulaouic H , Riou JF, Turley H , Gatter K C , & Hickson ID (2000) The Bloom's syndrome gene product interacts with topoisomerase III. J Biol Chem 275: 9636- 9644 W u L & Hickson ID (2003) The Bloom's syndrome helicase suppresses crossing over during homologous recombination. Nature 426: 870-874 Wyman C & Kanaar R (2006) D N A double-strand break repair: all's well that ends wel l . Annu Rev Genet 40: 363-383 Zhuang J, Zhang J, Willers H , Wang H , Chung J H , van Gent D C , Hallahan D E , Powell S N , & X i a F (2006) Checkpoint kinase 2-mediated phosphorylation of B R C A l regulates the fidelity o f nonhomologous end-joining. Cancer Res 66: 1401-1408 CHAPTER 2^ dog-1 and repair of G/C-tracts in C. elegans 2.1 Introduction Previous work by Cheung et al. (2002) described a role for the dog-1 gene in maintenance of polyG/polyC-tracts (G/C-tracts) throughout the C. elegans genome. Cheung et al (2002) proposed that DOG-1 unwinds secondary structures in poly guanine D N A during lagging strand synthesis, as in the absence of D O G - 1 , a mutator phenotype characterized by deletions that initiate in polyguanine tracts is observed. Persisting secondary structures might cause replication fork stalling in dog-1 mutants, which could lead to sequence loss i f the secondary structures are not resolved by some alternative means in the absence of D O G - 1 . Many possibilities exist for G/C-tract resolution in the absence of D O G - 1 . Other helicases such as those in the RecQ family might directly unwind the secondary structure, or the polyguanine structure might cause replication fork stalling, which could require homologous recombination to repair and restart the fork. If the stalled fork leads to a double strand break, either the homologous recombination repair or non-homologous end-joining pathways might be employed for repair. Alternatively, the secondary structure might be bypassed using a translesion synthesis polymerase, or the structure could be treated as a bulky adduct that is repaired through the nucleotide excision repair pathway. The aim of the experiments described in this chapter was to examine the possible interaction of dog-1 with genes involved in repair, and to understand which repair pathways are required for G/C-tract maintenance in the absence of D O G - 1 . ' A version of this chapter has been published, see: Youds J L , O ' N e i l N J & Rose A M (2006) Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173(2): 697-708. 2.2 Materials and Methods 2.2.1 Worm lysis and PCR detection of dog-1 (gklO) A l l worm strains were handled as described previously (Brenner, 1974) and were grovra at 20°C unless otherwise indicated. The strain VC13 dog-1 (gklO) is a knockout allele of dog-1, containing a 2030bp deletion beginning in exon 2 and extending into exon 9, where a premature stop codon is introduced (Cheung et al, 2002). In constructing all double and triple mutant strains, dog-1 (gklO) was detected by single worm lysis and P C R of the dog-1 gene by the following method. Individual worms were picked into tubes, prepared with 5\i\ lysis buffer ( l O m M T r i s - H C l , 5 0 m M K C l , 2 .5mM M g C b , 0.45% NP40, 0.45% Tween20, 0.01% gelatin, lOOiLig/ml Proteinase K ) , and incubated at -70°C for 10 minutes, 56°C for 1 hour, then 95°C for 15 minutes to inactivate the ProteinaseK enzyme. P C R reagents were added directly to the prepared D N A to make a 25^1 reaction with the following components: I X P C R buffer (50mM Tris p H 8.3, 5 0 m M K C l , 3 5 ^ M Na2HP04, 0.05% Tween-20), 2 .0mM M g C b , 0.25mM each dNTP, 0 .4mM each primer dogL2, dogR2 and dogM2 (see Appendix 1 for primer sequences) and 1 unit of Taq polymerase (Invitrogen, New England Biolabs). P C R was carried out under the following conditions: 94 °C for 4 minutes followed by 34 cycles of 94°C for 30 seconds, 55°C for 30 seconds and 72°C for 1 minute 30 seconds, and a final elongation step of 72''C for 10 minutes. P C R products were visualized by electrophoresis on 1% agarose gel stained with ethidium bromide. Gels were imaged using a GelDoc 2000 imager (Biorad). Primers dogL2 and R2 are located external to the gklO deletion, while dogM2 is located within the region deleted in gklO. In wild type animals, dogM2 and L 2 produce a 604bp product, while dogR2 and L 2 produce a 3003bp product, which was rarely observed because the smaller band was preferentially amplified. In gklO animals, the dogM2 primer has no recognition site because it is located in the deleted region, and the dogR2 and L2 primers produce a product that is 203Obp shorter than the wi ld type product (due to the gklO deletion), resulting in a 972bp band. Animals heterozygous for the gklO deletion were detected by the presence of both the 604bp wi ld type and 972bp gkJO P C R products. 2.2.2 Construction of double mutant strains The strains used in this chapter include: V C 1 3 dog-1 (gklO), CB1479 him-6 (el423), VC193 him-6 (ok412), V C 1 7 4 wrn-l(gk99), VC655 brd-1 (gk297), T J l cep-1 (gkl38), CB1487 him-9 (el487), T G 9 dpy-13(el84) rad-51 (lg8701)/nTl[let-?(m435)], RB864x;7a-7 (ok698), RB873 lig-4 (ok716), RB964 cku-80 (ok861) and TM\29%fcd-2(tml298). To prevent the accumulation of mutations in the mutator background, dog-1 (gklO) was routinely crossed to N 2 males and the dog-1 deletion was resegregated multiple times. In each case, the homozygous presence o f the gklO deletion was verified by P C R , as described in section 2.2.1. In constructing all double and triple mutant strains, dog-1 (gklO) males were crossed to the strain containing the mutant gene of interest. Double heterozygous progeny were allowed to self-fertilize, and their progeny were plated individually. After laying for 48 hours, these animals were lysed, the lysates split into 2 tubes, and P C R s were carried out to test for the homozygous presence of dog-1 (gklO) and homozygous mutation of the gene o f interest. In all cases except for him-6(el423) and him-9(el487), two external and one internal primers were designed in order to detect deletion alleles of the strains listed above (see Appendix 1 for primer sequences). In the case of him-9(el487), homozygous him-9 animals were detected by the high incidence of males (Him) phenotype among progeny, as well as a set of PCRs . him-9(el487) is a large rearrangement involving the mab-3 gene on chromosome II (N . O ' N e i l , p. communication), and can be detected by the absence of P C R product with the use of primers N O N 5 0 and 53 (where a product is detected in wi ld type animals), and the presence of P C R product with the use of primers N O N 5 0 and 87 (where no product is detected in wi ld type animals). In the case of the point mutation him-6(el423), homozygous him-6 animals were detected by the H i m phenotype among progeny. 2.2.3 DAPI staining and measurement of mitotic zone nuclei One day prior to staining, L4 stage animals were picked onto fresh plates and allowed to age 24 hours. One-day old adults were picked into 10^1 of M 9 buffer in a watch-glass and 200)j.l of 150nM 4',6-diamidino-2-phenylindole dihydrochloride (DAPI ; Sigma) in ethanol was added. The animals were placed in the dark and allowed to incubate for 1 hour. Animals were destained by soaking in M 9 buffer overnight at 4°C in a humid chamber. DAPI-stained animals were mounted on 3% agarose slides and viewed at 40X magnification on a Zeiss Axioscope fluorescent microscope. A Retiga 2000R camera (Qimaging) and Openlab 4.0.2 software (Improvision) was used to image the germlines. Using the measure tool in Adobe Photoshop 7.0, the width of individual nuclei in the mitotic region (extending from the distal tip to the first transition zone nuclei) of each gonad arm was measured. For each mitotic region, ten randomly chosen nuclei were measured and in addition, the single largest nucleus was measured. 2.2.4 The vab-1 G/C-tract deletion assay The occurrence of G/C-tract deletions in all single, double and triple mutants was measured by P C R amplification of the G/C-tract located within the vab-1 gene on chromosome II. L4-stage animals o f the genotype of interest were picked to fresh plates 24 hours before D N A preparation. D N A o f individual worms was prepared by the method described in section 2.2.1. G/C-tracts were amplified in each animal by a nested P C R assay modified from Cheung et al. (2002). External P C R reactions were carried out in 25^1 volumes, containing I X G - P C R buffer (50mM Tris p H 8.3, 35^M Na2HP04, 0.05% Tween-20), 2 .0mM M g C b , 0.25mM eacii dNTP and 0.4mM of eacli primer external primer (vabNl and vabN2, see appendix 1 for sequences). The external P C R program was 94 °C for 4 minutes followed by 34 cycles of 94°C for 30 seconds, 58°C for 30 seconds and 72°C for 1 minute 30 seconds, and a final elongation step of 72°C for 10 minutes. One microlitre of D N A from the external reaction was used as the template for a second internal P C R . The internal P C R reagents were the same as those used for the external P C R , except internal primers (152 and 153, see appendix 1) were used in place of the external primers. The internal P C R program was the same as the external program, except primers were annealed at 62°C and the extension time was 1 minute. P C R products were electrophoresed on 1% agarose gels and stained with S Y B R Green (Molecular Probes) for nucleic acid visualization. Gels were imaged using a Gel Doc 2000 (Bio-Rad). Selected deletions were sequenced (Nucleic A c i d and Protein Services, U B C ) in order to confirm specific amplification of the sequence of interest and the presence of deletions initiating at the G/C-tract. A second G/C-tract was tested to determine whether the increased deletion formation observed in the double and triple mutants was specific to the vab-1 G/C-tract; this second G / C - tract is located within the cosmid R144 on chromosome III. The R144 G/C-tract was P C R amplified using the primers 398 and 399 (see Appendix 1). The R144 G/C-tract P C R program was 94 °C for 4 minutes followed by 34 cycles of 94°C for 30 seconds, 62°C for 30 seconds and 72°C for 1 minute 30 seconds, and a final elongation step of 72°C for 10 minutes. R144 G / C - tract P C R products were visualized in the same manner as those for the vab-1 G/C-tract. A 4.4- fold increase in deletions was observed in dog-1; him-9 animals (18 deletions in 125 individuals) compared to dog-1 animals (4 deletions in 123 individuals), indicating that the increased instability is not specific to the vab-1 G/C-tract, but also occurs at other G/C-tracts. 2.2.5 RNAi feeding method for the translesion synthesis polymerases Single colonies ofE. coli containing the F53A3.2 ipolr]; www.wormbase.org) and F22B7.6 (pol/c, www.wormbase.org) R N A i constructs were grown overnight in L B medium with 50|j.g/mL ampicillin and 12.5jj.g/mL tetracycline. 60)̂ 1 of the concentrated culture was added drop-wise to N G M plates containing 50|Lig/mL ampicillin, 12.5)^g/mL tetracycline and 0 .5mM IPTG. The next day, L4-stage animals were placed on the plates to feed and were transferred to fresh R N A i plates every 2 days. F l progeny were picked to fresh R N A i plates at the L4-stage and were lysed as 1-day old adults 24 hours later for G/C-tract P C R . 2.3 Results 2.3.1 dog-1 functionally interacts with him-6/BLM Because the RecQ hehcases B L M and W R N can unwind G-quadruplex (G4) D N A in vitro (Huber et al, 2002; Mohaghegh et al, 2001 ; Sun et al, 1998), it was asked whether loss of function of the C. elegans 5 Z M ortholog, him-6 (Wicky et al., 2004) or PFZ/V homolog, wrn-1 (Lee et al, 2004), would exacerbate the phenotype of dog-1 mutant animals, dog-1; wrn-1 animals had normal viability; however, dog-1; him-6 animals displayed reduced viability. To explore the interaction between these two genes, the fitness of dog-1; him-6 double mutants was assayed by maintaining independent lines of the animals at 20°C and 25 °C, as higher temperatures intensify the effects of genome stability mutants in C. elegans (Ahmed & Hodgkin, 2000). Each generation, a single L4-stage animal was transferred to a fresh plate, and a line was scored as inviable when the parent worm was sterile or only laid inviable embryos. A t both 20°C and 25°C, dog-1 mutants survived fairly well, with only 3 of 20 lines becoming sterile by the lO"' generation at 20°C and 5 of 20 lines becoming sterile in 10 generations at 25°C. A decline in viability was observed for him-6 animals in which 8 of 20 lines became sterile at 20°C, and 19 of 20 lines became sterile by the lO"^ generation at 25 °C, in accordance with data from Grabowski et al (2005). A t 20°C, 18 out of 20 lines of dog-1; him-6 animals had become sterile by the lO"" generation (Figure 2.1 A ) . The decline in viability was exacerbated when dog- I; him-6 animals were grovm at 25 °C, as all 20 lines had become sterile by the 4"" generation (Figure 2.IB). Thus, dog-1; him-6 double mutants exhibit reduced fitness that is much more severe than either of the single mutants. 0 5 10 Generat ion Generat ion Figure 2.1: Viabili ty of independent lines of dog-1, him-6 and dog-1; him-6 animals at A ) 20°C and B) 25°C. Figure adapted from Youds et al (2006). To examine these double mutants in more detail, the progeny of dog-1; him-6 and dog-1; wrn-1 animals were scored for viability, embryonic lethality, brood size and the frequency of spontaneous males (which are X O compared to X X hermaphrodites). The high incidence of males (Him) phenotype is a result of frequent losses of a whole or part of one X chromosome, and is often observed in D N A damage checkpoint or repair mutants (van Haaften et al, 2004). dog-1; wrn-1 animals had normal viability and did not show elevated levels of embryonic lethality or males. However, dog-1; him-6 double mutants had significantly fewer viable progeny than him-6 animals (t-test p=2.45' '°) and fewer viable progeny than would be expected for an additive effect of the two genes (average number of viable progeny observed was 28, compared to 47 expected; Table 2.1 ). The average brood size of the double mutants was no different from the expected (average brood size observed was 185 compared to 194 expected; Table 2.1), and the reduction in viable progeny could be accounted for by increased embryonic lethality (average percent embryonic lethality observed was 73% compared to 53% expected; Table 2.1). In dog-1; him-6 broods there was a significantly higher percentage of male progeny than in him-6 broods (t-test p=2.89"''); the incidence of males was also higher than expected for an additive effect of the two genes (average percent males observed was 20% compared to 13%) expected; Table 2.1). Genotype Percent Total Brood Percent Percent Males Viable Size Embryonic Progeny Lethality N2 (n-15) 99.9 ± 0.05 271 ± 13 0.1 ± 0 . 0 5 0.2 ± 0.07 dog-1 (n=37) 9 7 . 1 ± 0 . 9 239 ± 7 2.9 ± 0.9 0.2 ± 0.07 him-6 (n=--43) 46.9± 2.0 220 ± 11 53.1 ± 2 . 0 12.6 ± 0 . 6 dog-1; him-6 (n=41) 27.6± 1.8 1 8 5 ± 13 72.5 ± 1.8 19 .7± 1.1 Table 2.1: Phenotypes o f N 2 , dog-1, him-6 and dog-1; him-6 animals, n represents the number of parent worms whose progeny were scored. A l l values are ± standard error of the mean. Table adapted from Youds et al. (2006). To further examine the dog-1; him-6 animals, the vital dye S Y T 0 1 2 was used to observe levels of apoptosis in the single and double dog-1; him-6 mutants. A s reported in section 3.3.2, 0.8 ± 0.2 (n=44 gonad arms) SYT012-stained corpses per gonad arm were observed in N2 animals, and an average o f 3.3 ± 0.2 (n=77) corpses were observed in dog-1 mutants. In him-6 single mutants, an average of 4.7 ± 0.3 (n=47) SYT012-stained corpses were present per gonad arm, similar to findings reported by Grabowski et al. (2005). K i m et al. (2005) have shown that the elevated levels of apoptosis in him-6(ell04) animals are dependent on the cep-l/p53- controlled D N A damage checkpoint. In dog-1; him-6 animals, an average of 4.0 ± 0.3 (n=46) corpses were present per gonad arm, indicating that no more cells are undergoing apoptosis in the double mutant than in either of the single mutants. To investigate the basis of the dog-1; him-6 phenotype with respect to replication, D N A in the germline mitotic zone of dog-1; him-6 animals was visualized by D A P I staining. In C. elegans, the germline nuclei undergo mitosis in a syncytium in the distal region of the gonad. These nuclei are spatially separated from the more proximal germ nuclei undergoing the early stages of meiosis by a region known as the transition zone, in which nuclei transitioning from mitosis to meiosis have a characteristic crescent shape. When genotoxic stress is present in the mitotic zone, the D N A damage checkpoint w i l l arrest nuclei, presumably in order to allow repair to occur and replication to complete (Gartner et al, 2000). This S-phase arrest is characterized by enlarged nuclei and an overall reduction in the number of nuclei within the germline mitotic region (Ahmed et al., 2001; Garcia-Muse & Boulton, 2005). A severe mitotic arrest, in which there are only a few very large nuclei that occupy the space of the entire mitotic zone, is observed in mutants such as atl-l/ATR or after treatment with genotoxic agents (Garcia-Muse & Boulton, 2005; Ahmed et al, 2001); this was not the case in dog-1; him-6 animals. However, mitotic nuclei were clearly enlarged in dog-1; him-6 animals when compared to N 2 , dog-1 or him-6 (Figure 2.2). N2 dog-1 Figure 2.2: Germline mitotic zones of A ) N2 , B) dog-1, C) him-6, and D) dog-1; him-6 animals. Figure adapted from Youds et al. (2006). In order to quantify the size of germline mitotic nuclei in dog-1; him-6 animals, measurements of the average diameter of nuclei within the mitotic regions of N 2 animals, dog-1 and him-6 single mutants and dog-J; him-6 double mutants were made. N 2 and dog-J animals had similar average mitotic nuclei sizes (Table 2.2; t-test p=0.30). Consistent with him-6 having a role in replication, him-6 animals had a significantly larger average mitotic nuclei size than N 2 animals (Table 2.2; p=0.00086). However, the average size of nuclei in the mitotic region of dog-1; him-6 animals was significantly larger than N 2 animals or either of the single mutants (Table 2.2; p=l .66e" ' l p=1.37e"'^, p=5.76e"'^ in t-tests w i t h N 2 , dog-I, and him-6, respectively). When the diameter of the single largest nucleus in each mitotic zone was measured to determine the average largest nucleus size, N 2 and dog-] animals had similar average largest nucleus sizes (Table 2.2; p=0.14). him-6 animals had a slightly greater average largest nucleus size (Table 2.2; p=0.0013 in t-test with N2). Again, the average size of the largest nucleus in dog-]; him-6 mitotic regions were much larger than those in N2 animals or dog-] or him-6 single mutants (Table 2.2; p=1.60e"'\ p=1.96e''^ p=2.60e"" in t-tests w i t h N 2 , dog-l, and him-6, respectively). The larger size of mitotic nuclei in dog-]; him-6 animals was interpreted to be a response to replicative stress in dog-]; him-6 double mutants. Genotype Average Nuclei Size Average Largest (itm) Nucleus Size ()xm) N2 (n=26) 3 . 1 4 ± 0 . 1 0 4.04 ± 0.08 dog-1 (n-26) 3.21 ± 0 . 0 9 4.19 ± 0 . 0 6 him-6 (n=24) 3 . 3 8 ± 0 . 1 0 4.40 ± 0.07 dog-]; him-6 (n=23) 4.29 ± 0 . 1 4 6 . 1 2 ± 0 . 1 5 Table 2.2: Average nuclei and largest nucleus sizes in N2 , dog-], him-6, and dog-]; him-6 animals, n refers to the number of mitotic zones in which nuclei were measured. Ten nuclei were measured per mitotic zone. A l l values are ± standard error of the mean. Table adapted from Youds et al. (2006). 2.3.2 Increased G/C-tract deletions in dog-1; liim-6 animals Previously, DOG-1 was shown to function in the maintenance of G/C-tracts. as deletions initiating at these tracts were observed in dog-1 mutants (Cheung et al., 2002). Therefore, it was 38 tested whether or not the decreased viability and replicative stress in dog-1: him-6 animals might be explained by an overlapping function of DOG-1 and H l M - 6 in processing G-rich D N A during replication. If this were the case, G/C-tract deletions would be expected in him-6 animals, and an increased number o f deletions would be observed in dog-1; him-6 animals compared to dog-1 single mutants. The assay for G/C-tract deletions is PCR-based, using sets of nested primers to ensure specific amplification of the G/C-tract of interest. For the assay, the G/C-tract adjacent to exon 5 of the vab-1 gene located on chromosome II was chosen (Figure 2.3 A , B) . This tract was previously shown to delete in some dog-1 animals (Cheung et al., 2002). ^Vhole single animals were used for the assay, and as animals have differences in germline proliferation that are dependent on age, G/C-tract amplification was performed only on 1-day old aduhs. B y this means, approximately the same number of cells was sampled in each animal. Deletions were consistently detected in the vab-1 G/C-tract in 11% of dog-1 animals assayed, thus allowing the straightforward identification of increases or decreases in the number of animals with deletions of this particular G/C-tract in a repair mutant background (Figure 2.3 D). 1 2 3 4 5 6 7 8 9 !0 vab-1 t H — • 0 ~—Qr-~-nt- —Q — O 1 f1--S 1 I exon 5 ^ ^og-i ^ _> I 1 1 2 3 4 5 8 7 6 9 10 I 1kb doj?-1, œpaïf mutant 5 Figure 2.3: The vab-1 deletion assay. A ) Structure of the vab-1 gene. B) Position of the G / C - tract (black box) is just left of exon 5. External and internal primers are indicated by arrows. C) A typical G/C-tract deletion brings the primers closer together to produce a smaller P C R product. D) A sample of the deletions observed by electrophoresis on agarose gel. Deletions were present in 11% of dog-1 mutants. The frequency of animals with deletions increased when mutations in repair genes, such as him-6, were introduced into the dog-1 background. Figure adapted from Youds et al. (2006). Based on the lack o f genetic interaction between dog-] and wrn-l, it was not expected that an elevated number of animals with deletions would be observed for dog-]; wrn-] double mutants compared to dog-] single mutants. In fact, dog-]; wrn-] animals showed only a small, non-significant increase in the number of animals with deletions relative to dog-] mutants (Table 2.3). When him-6 mutants were tested for G/C-tract delefions, none were detected, suggesting that H I M - 6 does not function specifically to unwind G-rich D N A secondary structures in the presence of D O G - 1 . However, the number of dog-]; him-6 animals with deletions was increased 3.2-fold over the number of dog-] animals with deletions (Table 2.3). This suggests that in the absence of dog-] function, H I M - 6 prevents the formation of deletions initiating in G/C-tracts. Genotype Number Number Percentage p-value in Fold of with of Animals t-test with Increase Animals Deletions with dog-1 Relative to Assayed Deletions dog-1 dog-1 228 26 11.4 1.0 wrn-1 108 2 1.9 dog-1; wrn-1 103 20 19.4 0.32 ' 1.7 him-6 100 0 0 dog-1; him-6 157 58 36.9 0.0094' 3.2 dpy-13 rad-51 102 1 0.98 dog-1; dpy-13 rad-51 179 84 46.9 0.00012' 4.1 him-9 108 0 0 dog-1; him-9 178 65 36.5 0.0027' 3.2 dog-1; him-9; dpy-13 rad-51 108 57 52.8 0.17" 4.6 dog-1; him-9; him-6 212 116 42.6 0.66" 3.7 brd-1 101 2 2.0 dog-1; brd-1 121 44 36.4 0.0018' 3.2 dog-1; him-9; brd-1 100 42 42.0 0.98" 3.7 cep-1 102 0 0 dog-1; cep-1 107 33 30.8 0.0040' 2.7 fcd-2 120 0 0 dog-1; fcd-2 150 50 33.3 0.0032' 2.9 poh] ( R N A i ) 100 0 0 dog-1; polr/(RNAi) 108 28 25.9 0.0020' 2.3 polK(KN Ai) 121 1 0.82 dog-IpoliciRN Ai) 101 27 26.7 0.025' 2.3 xpa-1 119 0 0 dog-1; xpa-1 95 15 15.7 0 .70 ' 1.4 cku-80 66 0 dog-1; cku-80 54 6 11.1 0 .95 ' 1.0 lig-4 90 0 dog-1; lig-4 53 8 15.1 0.72 ' 1.3 Table 2.3: Deletions observed in the vab-1 G/C-tract in various repair mutants in the dog-1 background. Number with deletions is the number of individual animals that showed one or more deletions in the vab-1 G/C-tract as determined by P C R . ' represents p-value in t-test with dog-1. " represents p-value in t-test with dog-1; him-9. t-tests against other applicable double mutants did not give significant p-values. Table adapted from Youds et al. (2006). 2.3.3 Homologous recombination is required for G/C-tract stability in dog-1 mutants The finding that absence of H I M - 6 in the dog-1 mutant background leads to an increase in the number of animals with G/C-tract deletions led to the question of whether other pathways function to prevent G/C-tract deletions. To test i f homologous recombination repair might be involved in the maintenance of G/C-tracts in dog-1 mutants, dog-1; dpy-13 rad-51 mutants were constructed. The dpy-13 mutation was used as a phenotypic marker to identify rad-51 homozygotes. R A D - 5 1 is the C. elegans homolog of the bacterial R e c A protein, which has a crucial role in homologous recombination (Rinaldo et al., 1998). In C. elegans, rad-51 has a maternal effect lethal phenotype. Therefore, dpy-13 rad-51 homozygotes that had segregated from dpy-13 rad-51 hétérozygotes were selected and assayed for deletions. Deletions were very rare in dpy-13 rad-51 animals. The number of animals with deletions in dog-1; dpy-13 rad-51 mutants was increased more than 4-fold over the number in dog-1 single mutants (Table 2.3). The number of animals with deletions was also assayed in him-9 and dog-1; him-9 double mutants, him-9 is the ortholog of the human XPF gene (N. O ' N e i l , unpublished data), which is implicated in homologous recombination in yeast and in gene targeting in mammalian cells, as well as in cross-link repair (Klein, 1988; Niedernhofer et al, 2001 ; Niedernhofer et al., 2004; Sargent etal, 2000; Schiestl & Prakash, 1988; Schiestl & Prakash, 1990). N o deletions were observed in him-9 single mutants. The number of animals with deletions in dog-1; him-9 double mutants was increased 3.2-fold over dog-1 single mutants (Table 2.3). These results suggest that both HIM-9 and R A D - 5 1 function in the maintenance of G/C-tracts in dog-1 animals. While these data support a role for homologous recombination in repair at G/C-tracts in dog-1 animals, this pathway apparently is not sufficient to prevent deletions altogether. To test whether R A D - 5 1 and HIM-9 function in the same pathway, a dog-1; him-9; dpy- 13 rad-51 mutant was constructed and these animals were assayed for the occurrence of vab-1 G/C-tract deletions. These mutants exhibited a number of deletions similar to those in dog-1; dpy-13 rad-51 animals (Table 2.3), indicating that RAD-51 and H I M - 9 function in the same pathway. To determine i f H I M - 6 might also function in homologous recombination or act in a separate pathway, dog-1; him-9; him-6 triple mutants were constructed. The triple mutants had increased numbers o f animals with deletions relative to both dog-1; him-9 and dog-1; him-6 (Table 2.3). However, the variability of the number of animals with deletions in individual experiments with dog-1; him-9; him-6 ranged from 25.7% to 68.4%), resulting in a high t-test value. The variation in the number o f animals with deletions measured in the dog-1; him-9; him- 6 triple mutant was much greater than in any other single, double or triple mutant. Because of this, it was difficult to assess whether H I M - 9 and H I M - 6 function in the same or different pathways to suppress G/C-tract deletions in dog-1 mutants. B R C A l and B A R D l have been implicated in the homologous recombinational repair response to stalled replication forks in mammalian cell lines (Scully et al, 1997; Scully et al., 2000). Thus, it was investigated whether brd-1, the ortholog of human BARDl (Boulton et al, 2004), might be involved in repair at G/C-tracts in dog-1 mutants. The number of animals with deletions in dog-1; brd-1 was elevated 3.2-fold over the number of dog-1 animals with deletions (Table 2.3). Construction of a dog-1; brd-1; dpy-13 rad-51 mutant was attempted in order to determine whether or not brd-1 was epistatic to rad-51, but these animals were not viable. However, in dog-1; brd-1; him-9 triple mutants, the number of animals with G/C-tract deletions was not significantly different from the number with deletions in either the dog-1; him-9 or dog- 1; brd-1 strains (Table 2.3). Based on this data, the inviability of the dog-1; brd-1; dpy-13 rad- 51 mutant was not interpreted to indicate that BRD-1 and R A D - 5 1 function in separate repair pathways; rather, checkpoint or other functions of BRD-1 might be required in the absence of R A D - 5 1 . These results, taken with others, suggest that B R D - 1 , R A D - 5 1 and H I M - 9 function in homologous recombination repair at G/C-tracts in dog-1 animals. Evidence from mammalian cell lines has shown that p53 localizes to sites of stalled replication forks, where it is proposed to modulate homologous recombination repair (Sengupta et al, 2003; Yang et al, 2002). Thus, the effect of absence of the C. elegans p53 ortholog C E P - 1 on deletions in the dog-1 background was tested. The number of animals with deletions observed in dog-1 cep-1 double mutants was elevated 2.7-fold over the number in dog-1 animals (Table 2.3). This resuh could suggest that CEP-1 is also involved in G/C-tract maintenance in absence of D O G - 1 . However, it is possible that the increase in the number of animals with deletions might be due to reduced apoptosis of cells with damage in the absence of C E P - 1 . A s part of its role in interstrand cross-link repair, a central component of the Fanconi repair pathway, F A N C D 2 , has been suggested to stabilize stalled replication forks (reviewed in Thompson et al, 2005). I f replication fork stalling occurs in the absence of D O G - 1 , there might be a need for fork stabilization. Therefore, the effect of absence of the C. elegans homolog of FANCD2,fcd-2 (Dequen et al, 2005; Collis et al, 2006), in the dog-1 background was tested. In fcd-2 mutants, no G/C-tract deletions were observed. However, a 2.9-fold increase in the number of animals with deletions was observed in dog-1; fcd-2 double mutants compared to dog- 1 single mutants (Table 2.3), suggesting that F C D - 2 also has a role in deletion-free repair in the absence of D O G - 1 . 2.3.4 Translesion synthesis is required for G/C-tract stability in dog-1 mutants Polymerases alternative to the typical replicative polymerases are frequently involved in lesion bypass to allow continued replication past various types of D N A damage (Lehmann, 2002; Prakash et al, 2005). In particular, polr| and p o k accumulate at replication forks stalled by D N A damage (Bergoglio et al, 2002; Kannouche et al, 2001 ; Kannouche et al, 2003). A n apparent question was whether these polymerases might also function at G/C-tracts in dog-1 mutants. Because there are currently no translesion synthesis mutants available in C. elegans, R N A i was used to knock-down polr] and p o k in the dog-1 background and the presence of G / C - tract deletions was assayed. Deletions were rarely observed inpolr^ orpolK(KHA\) control animals, but were observed in 25.9% of dog-1; polrj ( R N A i ) and 26.7%> of dog-1; polK ( R N A i ) animals; both o f these were significant increases over the number of dog-1 animals with deletions (Table 2.3). A third translesion synthesis polymerase, rev-1, which preferentially incorporates a C opposite template G (Prakash et al, 2005), also exists in C. elegans and is implicated at stalled forks (Mukhopadhyay et al, 2004). However, the embryonic lethal rev- i ( R N A i ) phenotype prevented the application of the assay. 2.3.5 Nucleotide excision repair and non-homologous end-joining are not essential for repair at G/C-tracts If G/C-tract secondary structures that persist in the absence of DOG-1 are detected as bulky lesions on the D N A , the structures might be repaired through the nucleotide excision repair (NER) pathway, which is the primary pathway for removal of bulky adducts. Therefore, it was assayed whether N E R might play roles in either preventing or causing deletions at G/C- tracts in absence of D O G - 1 . The role of N E R in repair of G/C-tracts in the dog-1 background was assayed using an xpa-1 mutant, which is the ortholog of human XPA (Park et al, 2002). X P A has an essential role in N E R . The dog-1 xpa-1 double mutant was constructed; these animals did not exhibit a number of deletions significantly different from dog-1 single mutants (15.8%); p=0.70; Table 2.3), indicating that N E R is not a principal means for G/C-tract maintenance. A s an alternative to G/C-tract secondary structures being treated as bullcy lesions, it is possible that the structure causes replication fork stalling that leads to double strand breakage after a subsequent round of replication. In this instance, the double strand break could be repaired through either the homologous recombination repair or non-homologous end-joining (NHEJ) pathways. To test whether or not N H E J might be active at G/C-tracts in the dog-1 background, mutations in lig-4 and cku-80 were utilized; these genes are homologs of the mammalian N H E J genes DNA ligase IV and Ku80 (Daley et al., 2005). In dog-1; lig-4 and dog- 1; cku-80 double mutants, the number o f animals with deletions was not significantly different than the number observed in dog-1 single mutants (15.1%, p=0.72; 11.1%, p=0.95, respectively; Table 2.3). Furthermore, each of the dog-1; lig-4 and dog-1; cku-80 double mutant strains appeared to be healthy. These data indicate that N H E J is not a key mechanism for deletion-free repair or deletion formation at G/C-tracts. However, this does not preclude the involvement of other components of the N E R or N H E J pathways in the homologous recombination repair that is clearly required for genome stability in absence of D O G - 1 . 2.3.6 Base pair mutations frequently flank the G/C-tract deletions The above data indicate that each of the genes him-6, rad-51, him-9, brd-1, cep-1, fcd-2, polfj. and jDo/Arhave roles in preventing deletions at G/C-tracts in the absence o f dog-1. However, the mechanism by which the deletions are formed is unknown. During the course of the investigation, 30 of the deletions that were detected in the G/C-tract assay were sequenced (selected sequences are shown in Table 2.4). Nine of the sequenced deletions contained one or more base pair mutations within a few bases of the deletion site. In most cases, the mutations were single base pair changes, but multiple base pair changes and base pair deletions were also observed. These base pair mutations occurred with the same frequency in dog-1 single mutants (4 out of 15 deletions) as in homologous recombination repair mutants in the dog-1 background (5 out of 15 deletions). This observation suggests that a mutagenic mechanism is involved in the formation of small deletions in dog-1 single mutants and that the same mechanism acts more frequently when other repair pathways, such as homologous recombination repair, are impaired. Genotype Deletion sequence Deletion sequence of animal left of break right of break wild type ^ ^ ^ g a a a c c c c c c c c c c c c c c c c c c c c a t ^^''''tggtatcaaaacgtctggcgagtgcg dog-1 g a a a c c c c c c c c c ( 2 3 3 b p d e l e t i o n ) t a g t a t c a a a a c g t c t g g c g a g t g c g wild type "'™^gaaaccccccccccccccccccccat ̂ ^ ^ ^ ^ g a a t g g t t c g t g t a t t c c g a a t g c g t dog-1 gaaac (163bp d e l e t i o n ) g a a t g g t t c g t g t a t t c c g a a t g c g t wild type ^^'"'^gaaaccccccccccccccccccccat ^ ^ ^ ^ ' t a c t t c c g a c c a c a a g t t a c c g g g c c dog-1; brd-1 g a a a c c c c c (108bp d e l e t i o n ) t a c - - c - g a c c a c a a g t t a c c g g g c c wild type ^*™'gaaaccccccccccccccccccccat ^ * ^ ' * c t t g t c t a c t t c c g a c c a c a a g t t a c dog-1; brd-1 g a a a c c c c c c c c ( l O l b p d e l e t i o n ) g t t g t c t a c t t c c g a c c a c a a g t t a c wild type "*™^gaaaccccccccccccccccccccat ^'"''^agaaaattatacaactatgcctgaat dog-1; him-9 g a a a c c c c c c (334bp d e l e t i o n ) a g a a a a t t a t a c a a c t a t g c c t g a a t wild type ^*™'gaaaccccccccccccccccccccat ^ ^ ^ ' ^ a a c t t g t c t a c t t c c g a c c a c a a g t t dog-1; him-9 g a a a c c c c c c c c (96bp d e l e t i o n ) a a c t t g t c t a c t t c c g a c c a c a a g t t wild type ^^™^gaaaccccccccccccccccccccat "^'^''caagttaccgggccaaaagagactga dog-1 ; dpy-13 rad-51 gaca {126bp d e l e t i o n ) c a a g t t a c c g g g c c a a a a g a g a c t g a wild type ^*™'gaaaccccccccccccccccccccat g t g g a t a t t c t c a a a t t g c c g a t t c g dog-1; dpy-13 rad-51 g a a a c c c c c c (271bp d e l e t i o n ) g t g g a t a t t c t c a a a t t g c c g a t t c g Table 2.4: Sequences around vab-1 G/C-tract deletion breakpoints. Genotype of animal indicates that from which vab-1 G/C-tract deletion was isolated. W i l d type sequence is shovra above for each deletion. Deletion sequence is shown below with deletion size in brackets. Superscripts indicate the sequence location within the cosmid. Mismatches are indicated by holding. Table adapted from Youds et al. (2006). 2.4 Discussion 2.4.1 DOG-1 is likely to function during replication Genomic instability such as that observed in the dog-1 mutant can have several causes, including defects during replication or transcription. For example, Chavez and Aguilera (1997) showed that blocks in transcriptional elongation in yeast HPRl mutants are responsible for genomic instability associated with deletions between direct repeats. More recently, L i and Manley (2005) reported that genome stability can be affected by the absence of the protein splicing factor A S F / S F 2 because R N A : D N A hybrids form on the nontemplate strand of transcribed genes, leading to rearrangements. Several lines of evidence suggest that DOG-1 functions during replication and that the deletions observed in dog-1 mutants occur during replication and are not transcription-based. First, microarray analysis showed that dog-1 was expressed at 7.67-fold higher levels in wild type animals compared to glp-4 animals (which lack virtually all germline cells), indicating that dog-1 expression is enriched in the germline, where nuclei in the mitotic region are constantly undergoing replication (Reinke et al, 2000). Second, the observed deletions always initiate in the G/C-tract and extend in the same direction, suggesting a mechanism for deletion formation that could be related to lagging strand replication (Cheung et al, 2002). Deletions occur at G/C-tracts that are located at intergenic sites as well as within introns, suggesting that the deletions are not dependent on transcription (Cheung et al, 2002). The data presented here shows that loss of both DOG-1 and H I M - 6 results in elevated levels of embryonic lethality in the progeny of dog-1; him-6 animals. Such an interaction between dog-1 and him-6 would be expected i f these two genes have some parallel or overlapping function. Similar to dog-1, him-6 has elevated expression in the germline (Reinke et al, 2000), and K i m et al. (2005) have shown that it functions in cells undergoing active replication and division, including the mitotic germline stem nuclei and early embryonic cells. Further supporting a role for DOG-1 during replication, enlarged germline mitotic nuclei were observed in dog-1; him-6 animals, suggesting replicative stress. Finally, results from the G / C - tract deletion assay demonstrate that homologous recombination repair and translesion synthesis polymerase genes, which function during replication (Barbour & Xiao , 2003; Lehmann, 2002; Lundin et al, 2003; Prakash et al, 2005; Saleh-Gohari et al, 2005), play an important role in preventing G/C-tract deletions in the dog-1 mutant. Thus, it is probable that the c?og-7-dependent deletions are formed during or immediately following replication. 2.4.2 Homologous recombination and translesion syntliesis are required for genome stability in dog-1 animals Several reports have indicated that homologous recombination functions at stalled or collapsed replication forks to carry out error-free repair (Barbour & Xiao , 2003; Lundin et al, 2003; Saleh-Gohari et al, 2005). The data presented here show that homologous recombination- associated proteins function at G/C-tracts in C. elegans dog-1 mutants. Absence of the R A D 5 1 , X P F and B A R D l homologs, R A D - 5 1 , H I M - 9 and B R D - 1 in the dog-1 background led to an increase in the number of animals with G/C-tract deletions, suggesting that these three proteins promote deletion-free repair at G/C-tracts. Epistasis experiments place B R D - 1 , RAD-51 and HIM-9 in the same repair pathway. In C. elegans, as in mammals, CEP- l /p53 is required for D N A damage-induced apoptosis (Derry et al, 2001 ; Schumacher et al, 2001). Recent mammalian studies have suggested that p53 can also modulate homologous recombination repair during replication (Sengupta et al, 2003; Sengupta & Harris, 2005). This modulation of repair might be related to the ability of p53 to recognize mismatches within heteroduplex, and thereby suppress erroneous repair (Dudenhoffer et al, 1998; Y u n et al, 2004), or to its ability to regulate the processing of Holliday junctions by B L M (Yang et al, 2002). A 2.7-fold increase was observed in the number of dog-l cep-1 animals with deletions compared to dog-1 animals. This could be interpreted to suggest that CEP-1 promotes maintenance of G/C-tracts in dog-1 mutants. However, data documented in section 3.3.2 shows that CEP-1-mediated apoptosis is increased in dog-1 mutants. Based on this data, another possible interpretation is that more deletions were observed i n dog-I cep-1 animals because CEP-1 was not present to activate apoptosis in cells with D N A damage resulting from absence of D O G - 1 . Therefore, the individual animals sampled might have contained cells with deletions that would normally have undergone apoptosis, thus leading to higher numbers of animals with deletions. This is unlikely to be the case because i f it were, the assay should have produced a noticeable increase in germline deletions in which no wi ld type P C R band was visible (i.e., all cells in the entire animal having the same deletion), compared to animals that are mixed populations of deletions and wi ld type sequence. However, the possibility that reduced apoptosis is the reason for the elevated frequency of dog-1 cep-1 animals with deletions cannot be ruled out. In addition to the homologous recombination repair-implicated genes, mutation offcd-2 in the dog-I background led to an increase in deletion frequency, fcd-2 is the C. elegans homolog of human FANCD2, and the monoubiquitylated F C D - 2 protein is reportedly recruited to sites of stalled replication forks and interstrand cross-links (Dequen et al., 2005; Collis et al., 2006). Using the G/C-tract deletion assay, the frequency of deletions in dog-1; fcd-2 mutants was similar to the frequencies detected in homologous recombination repair mutants in the dog-1 background. In humans, F A N C D 2 functions in interstrand cross-link repair (reviewed in Levitus et al., 2006), and also responds to D N A replication stress following treatment with hydroxyurea or aphidicolin (Howlett et al., 2005). Following D N A damage, F A N C D 2 becomes monoubiquitylated and colocalizes with homologous recombination repair proteins RAD51 and B R C A l at sites o f damage (Taniguchi et al., 2002); this F A N C D 2 activity might help to stabilize the replication fork to allow repair through error-free processes such as homologous recombination repair (reviewed in Thompson et ai, 2005). There are indications that F A N C D 2 might promote homologous recombination repair, as reduced levels of homology-directed repair are observed in the absence of F A N C D 2 , though the reduction in recombination repair is small compared to that observed in the absence of R A D 5 1 (Nakanishi et al, 2005). In C. elegans, FCD-2 might play a similar role in promoting homologous recombination repair in response to replication stress. The finding of increased number of animals with deletions in dog-1; fcd-2 could be explained by reduced, though not eliminated, homologous recombination repair in the absence of F C D - 2 . However, no functional linkage between F C D - 2 and the homologous recombination repair pathway has been demonstrated in C. elegans, as the gene has only recently been characterized in this organism. Therefore, it is equally possible that replication forks stalled by G/C-tract secondary structures could be repaired through F C D - 2 as part of a pathway that is separate from the homologous recombination repair machinery. In either case, the increased deletions observed in dog-1 ; fcd-2 animals suggest that F C D - 2 is involved in deletion-free repair at G/C-tracts. The G/C-tract deletion assay was also used to test whether translesion synthesis is required for genome stability in dog-1 mutants. Knock-down of either polrjor pol/cin the dog-1 background increased the number of animals with deletions. Recent reports have shown that polrj, in addition to a function in translesion synthesis, interacts with R A D 5 1 and has the ability to extend D-loops as part of the reinitiation of D N A synthesis by homologous recombination repair (Kawamoto et al., 2005; Mcllwraith et al., 2005). Thus, the role of polrj'm dog-1 mutants might be related to its function in homologous recombination. It is possible that the increase in the number of animals with deletions observed in dog-1; polrj ( R N A i ) and dog-1 ; polK {KHM) animals was not as high as the number seen in homologous recombination mutants in the dog-1 51 background because R N A i was used to knock-down these polymerases. Therefore, low levels o f the polîj and poltc gene products might have been present. 2.4.3 HIM-6 could function in RAD-51-dependent or -independent pathways The role for H I M - 6 at the replication fork is not clearly defined, as H I M - 6 might function either to unwind G/C-tract secondary structures or to resolve stalled forks through a R A D - 5 1 dependent or independent mechanism in dog-] mutants. In vitro, B L M preferentially unwinds G4 D N A , suggesting that it might prevent replication fork stalling by unwinding these structures in vivo (Huber et al., 2002; Mohaghegh et al., 2001 ; Sun et al., 1998). Because no G/C-tract deletions were observed in him-6 animals, it can be concluded that in the presence of D O G - 1 , HIM-6 does not play a key role in unwinding G/C-tract secondary structures. However, it is possible that H I M - 6 might unwind these structures when DOG-1 is absent. It has also been proposed that B L M plays a role in replication fork restoration by catalyzing branch migration to prevent the need for homologous recombination repair (Karow et al., 2000). In addition, B L M interacts with R A D 5 1 (Wu et al., 2001), and can act on recombination intermediates such as Holliday junctions in vitro (Karow et al., 2000; W u & Hickson, 2003). B L M may resolve these intermediates through a non-recombinational mechanism termed double Holliday junction dissolution, whereby exchange of flanking sequences is prevented (Wu & Hickson, 2003). Wicky et al. (2004) proposed that H I M - 6 functions downstream of R A D - 5 1 in C. elegans. The findings presented here show that the number of G/C-tract deletions in dog-I; him-6 animals was increased, indicating that deletion-free repair is compromised in the double mutants. dog-I; him- 9; him-6 triple mutants had highly variable viability and numbers of animals with deletions, in contrast to other single, double and triple mutants. This variability made it difficult to conclusively assign a role to H I M - 6 , as epistasis in the frequency of animals with deletions was unclear. H I M - 6 might function downstream of RAD-51 to resolve G/C-tract repair intermediates through a non-recombinational mechanism, similar to B L M in human cells. Another possibility is that HIM-6 functions in a separate pathway that promotes fork restoration independent of RAD-51 in dog-I mutants. In S. cerevisiae, the H I M - 6 / B L M homolog Sgsl may have both R A D 5 1 dependent and independent roles ( l i & B r i l l , 2005). One further clue to the role of him-6 in C. elegans is the finding that him-6 has a genetic interaction with dog-I, as evidenced by the synthetic sick phenotype and replication stress observed in dog-1; him-6 double mutants. Other homologous recombination repair mutants, such as brd-I and him-9, together with the dog-1 mutant were healthy, indicating that no functional interaction was present. However, absence of any o f the homologous recombination repair genes or him-6 in the dog-1 background led to elevated numbers of animals with deletions. Thus, him-6 has an interaction with dog-I that is different from the genes in the homologous recombination repair pathway. This suggests that him-6 has roles in common with homologous recombination repair, such as preventing deletion formation through a RAD-51 dependent mechanism, and also independent from R A D - 5 1 , such as preventing replication stress, possibly by stabilizing the replication fork across repetitive sequences or resolving stalled forks through a RAD-51 independent mechanism. Therefore, it is likely that H I M - 6 functions in multiple roles in C. elegans, as Sgs l does in S. cerevisiae. This interpretation could explain the unclear epistasis in the number of animals with deletions observed for dog-1; him-9; him-6 triple mutants. 2.4.4 Loss of N E R or N H E J does not affect deletion formation Neither N E R nor N H E J are required for preventing deletions when DOG-1 is absent because the number of animals with deletions did not increase when essential elements of these mechanisms were knocked out. Although N E R and N H E J do not appear to play important roles at G/C-tracts in dog-J mutants, components of the N E R and N H E J pathways might function to maintain genome stability in dog-1 animals. It is well-established that certain components of repair pathways can function in different repair mechanisms. For instance, X P F / RadlO is a component of the N E R pathway, but is also involved in the trimming of non-homologous ends from double strand breaks during synthesis-dependent strand annealing in yeast (Ivanov & Haber, 1997) and functions in cross-link repair in mammalian cell lines (Hoy et al., 1985; Kuraoka et al., 2000). The finding that absence of the C. elegans X P F homolog HIM-9 in the dog-1 background elevates the frequency of animals with G/C-tract deletions, but that absence of X P A - 1 does not change the frequency of animals with deletions illustrates the point that while N E R is not specifically involved in G/C-tract maintenance, other genes that act in multiple pathways including N E R are involved. Though neither N E R nor N H E J appear to be the main mechanisms for preventing deletions at G/C-tracts, it is entirely possible that other components of these pathways do function in repair at G/C-tracts through other pathways such as homologous recombination repair. 2.4.5 A model for repair at G/C-tracts Because DOG-1 appears to function during replication and both homologous recombination and translesion synthesis are required for genome stability in the absence of D O G - 1 , a likely scenario is that persisting G/C-tract secondary structures can lead to replication fork stalling in dog-1 mutants. DOG-1 could be the primary means for preventing replication fork stalling by unwinding secondary structures, and in the absence of D O G - 1 , homologous recombination repair or translesion synthesis can carry out repair and allow replication to proceed (Figure 2.4). H I M - 6 may act downstream of R A D - 5 1 , resolving repair intermediates to give non-recombinational outcomes, but it is also possible that H I M - 6 functions to repair the stalled fork through a RAD-51 independent mechanism, or H I M - 6 might function in both of these roles. Mutagenic repair, which results in the observed small deletions, occurs at a low frequency in the absence of D O G - 1 , but when both DOG-1 and the deletion-free repair pathways are impaired, the deletion-generating mechanism functions more frequently. G-rich D N A secondary structure forms during replication / \ no D O G - 1 present : a l ternat ive structure resolved repai r of s ta l led fork requ i red by D O G - 1 / \ deletion-prone repair deletion-free repair (mechanism unknown) / \ ^ X \ t rans- lesion replication fork synthesis resolution by HIM-6 RAD-51 HIM-9 recombinat ional outcome HIM-6 non-recombinat ional ou tcome Figure 2.4 A model for repair of secondary structures forming at G/C-tracts. Normally, DOG-1 would be present to unwind the secondary structure, but in its absence, the secondary structure persists, causing replication fork stalling. The stalled fork can be repaired in a deletion-free manner through translesion synthesis by either polti or p o k , or through homologous recombination repair, involving B R D - 1 , R A D - 5 1 , H I M - 9 and possibly HIM-6 . H I M - 6 might also carry out deletion-free repair through a RAD-51 independent mechanism. Alternatively, the deletion-prone repair pathway might act through an unknown mechanism to restore the replication fork, leaving a deletion at the site of the secondary structure. Figure adapted from Youds etal. (2006). O f the deletions obtained in the G/C-tract deletion assay, 30 were sequenced and about one-third of these had base pair mutations within a few bases of the deletion site. The base pair mutations occurred with equal frequency in dog-] single mutants as in homologous recombination repair mutants in the dog-1 baclcground, suggesting that the deletions are formed by the same mechanism in dog-1 mutants as in the absence of both DOG-1 and homologous recombination. The deletions might occur through this mutagenic mechanism when secondary structures persist due to the absence of DOG-1 and homologous recombination repair and/or translesion synthesis are unable to repair the stalled fork. None of the repair genes tested in the G/C-tract deletion assay led to a decrease in the frequency of animals with deletions relative to the dog-1 frequency; therefore, the pathway for deletion formation remains unknown. Because none of the pathways tested were responsible for deletion formation, it is likely that the deletions are formed through a mechanism that is directly linked to replication. For instance, the deletions could be formed i f a gap in the lagging strand occurs opposite the secondary structure, followed by joining of the ends opposite the gap. This type of mechanism would account for the variable size of the deletions, as the size of the gap might vary depending on the location of the secondary structure within the lagging strand Okazaki fragment, and whether there are other replication fork stalls nearby. The data presented in this chapter shows that him-6 and other homologous recombination repair-implicated genes, including brd-1/BARDl, rad-51/RAD51, him-9/XPF, and the translesion synthesis polymerases polrj and polK, as well as cep-l/p53 and fcd-2/FANCD2 promote deletion- free repair in the absence of D O G - 1 . When any of HIM-6 , R A D - 5 1 , H I M - 9 , B R D - 1 , polri, p o k , CEP-1 or F C D - 2 are impaired in the dog-1 background, animals exhibit an increase in small deletions initiating in G/C-tracts. These findings underscore the utility of C. elegans for the study of D N A repair, as individual animals can be assayed to measure the contribution of various repair pathways to genome stability, and highlight the multiple layers of repair that are present in cells to maintain genome integrity. Chapter 2 References Ahmed S, A l p i A , Hengartner M O , & Gartner A (2001) C. elegans R A D - 5 / C L K - 2 defines a new D N A damage checkpoint protein. Curr Biol 11: 1934-1944 Ahmed S & Hodgkin J (2000) M R T - 2 checkpoint protein is required for germline immortality and telomere replication in C elegans. Nature 403: 159-164 Barbour L & Xiao W (2003) Regulation of alternative replication bypass pathways at stalled replication forks and its effects on genome stability: a yeast model. Mutat Res 532: 137-155 Bergoglio V , Bavoux C , Verbiest V , Hoffmann JS, & Cazaux C (2002) Localisation of human D N A polymerase kappa to replication foci. J Cell Sci 115: 4413-4418 Boulton S J, Martin JS, Polanowska J, H i l l D E , Gartner A , & Vida l M (2004) B R C A l / B A R D l orthologs required for D N A repair in Caenorhabditis elegans. Curr Biol 14: 33-39 Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77: 71-94 Chavez S & Aguilera A (1997) The yeast H P R l gene has a functional role in transcriptional elongation that uncovers a novel source of genome instability. Genes Dev 11: 3459-3470 Cheung I, Schertzer M , Rose A , & Lansdorp P M (2002) Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich D N A . Nat Genet 31: 405-409 Collis SJ, Barber L J , Ward JD, Martin JS, & Bouhon SJ (2006) C. elegans F A N C D 2 responds to replication stress and functions in interstrand cross-link repair. DNA Repair (Amst) 5: 1398-1406 Daley J M , Palmbos P L , W u D , & Wilson T E (2005) Nonhomologous end joining in yeast. Annu Rev Genet 39: 431-451 Dequen F, St-Laurent JF, Gagnon S N , Carreau M , Desnoyers S (2005) The Caenorhabditis elegans FancD2 ortholog is required for survival following D N A damage. Comp Biochem Physiol B Biochem Mol Biol 141(4): 453-60 Deny W B , Putzke A P , & Rothman J H (2001) Caenorhabditis elegans p53: role in apoptosis, meiosis, and stress resistance. Science 294: 591-595 Dudenhoffer C, Rohaly G , W i l l K , Deppert W, & Wiesmuller L (1998) Specific mismatch recognition in heteroduplex intermediates by p53 suggests a role in fidelity control of homologous recombination. Mol Cell Biol 18: 5332-5342 Garcia-Muse T & Boulton SJ (2005) Distinct modes of A T R activation after replication stress and D N A double-strand breaks in Caenorhabditis elegans. EMBOJ24: 4345-4355 Gartner A , Milstein S, Ahmed S, Hodgkin J, & Hengartner M O (2000) A conserved checkpoint pathway mediates D N A damage-induced apoptosis and cell cycle anest in C. elegans. Mol Cell 5: 435-443 Gerring S L , Spencer F , & Hieter P (1990) The C H L 1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G 2 / M . £ M 5 0 J 9 : 4347-4358 Grabowski M M , Svrzikapa N , & Tissenbaum H A (2005) Bloom syndrome ortholog HIM-6 maintains genomic stability in C. elegans. Mech Ageing Dev 126: 1314-1321 Howlett N G , Taniguchi T, Durkin SG, D'Andrea A D , & Glover T W (2005) The Fanconi anemia pathway is required for the D N A replication stress response and for the regulation of common fragile site stability. Hum Mol Genet 14: 693-701 Hoy C A , Thompson L H , Mooney C L , & Salazar EP (1985) Defective D N A cross-link removal in Chinese hamster cell mutants hypersensitive to bifunctional alkylating agents. Cancer Res 45: 1737-1743 Huber M D , Lee D C , & Maizels N (2002) G4 D N A unwinding by B L M and Sgslp: substrate specificity and substrate-specific inhibition. Nucleic Acids Res 30: 3954-3961 Ii M & B r i l l S J (2005) Roles of SGS 1, M U S 8 1 , and R A D 5 1 in the repair of lagging-strand replication defects in Saccharomyces cerevisiae. Curr Genet 48: 213-225 Ivanov E L & Haber JE (1995) R A D l and R A D I O , but not other excision repair genes, are required for double-strand break-induced recombination in Saccharomyces cerevisiae. Mol Cell 5 / 0 / 15:2245-2251 Kannouche P, Broughton B C , Volker M , Hanaoka F, Mullenders L H , & Lehmann A R (2001) Domain structure, localization, and function of D N A polymerase eta, defective in xeroderma pigmentosum variant cells. Genes Dev 15: 158-172 Kannouche P, Fernandez de Henestrosa A R , Coul l B , Vida l A E , Gray C, Zicha D , Woodgate R, & Lehmann A R (2003) Localization of D N A polymerases eta and iota to the replication machinery is tightly co-ordinated in human cells. EMBO J 22: 1223-1233 Karow JK, Constantinou A , L i J L , West SC, & Hickson ID (2000) The Bloom's syndrome gene product promotes branch migration of Holliday junctions. Proc Natl Acad Sci U SA 91: 6504- 6508 Kawamoto T, Arak i K , Sonoda E , Yamashita Y M , Harada K , Kikuch i K , Masutani C, Hanaoka F, Nozaki K , Hashimoto N , & Takeda S (2005) Dual roles for D N A polymerase eta in homologous D N A recombination and translesion D N A synthesis. Mol Cell 20: 793-799 K i m Y M , Yang I, Lee J, & Koo HS (2005) Deficiency of Bloom's syndrome protein causes hypersensitivity of C elegans to ionizing radiation but not to U V radiation, and induces p53- dependent physiological apoptosis. Mol Cells 20: 228-234 Kle in H L (1988) Different types of recombination events are controlled by the R A D l and R A D 5 2 genes of Saccharomyces cerevisiae. Genetics 120: 361-1)11 Kuraoka I, Kobertz W R , A r i z a RR, Biggerstaff M , Essigmann J M , & Wood R D (2000) Repair of an interstrand D N A cross-link initiated by E R C C l - X P F repair/recombination nuclease. J Biol Chem 275:26632-26636 Lee SJ, Yook JS, Han S M , & K o o HS (2004) A Werner syndrome protein homolog affects C. elegans development, growth rate, life span and sensitivity to D N A damage by acting at a D N A damage checkpoint. Development 131: 2565-2575 Lehmann A R (2002) Replication of damaged D N A in mammalian cells: new solutions to an old problem. Mutat Res 509: 23-34 Levitus M , Joenje H , & de Winter JP (2006) The Fanconi anemia pathway of genomic maintenance. Cell Oncol 28: 3-29 L i X & Manley JL (2005) Inactivation of the SR protein splicing factor A S F / S F 2 results in genomic instability. Cell 122: 365-378 Lorenz A & Whitby M C (2006) Crossover promotion and prevention. Biochem Soc Trans 34: 537-541 Lundin C, Schultz N , Arnaudeau C , Mohindra A , Hansen L T , & Helleday T (2003) R A D 5 1 is involved in repair of damage associated with D N A replication in mammalian cells. J Mol Biol 328:521-535 Mcllwraith M J , Vaisman A , L i u Y , Fanning E , Woodgate R, & West SC (2005) Human D N A polymerase eta promotes D N A synthesis from strand invasion intermediates of homologous recombination. Mol Cell 20: 783-792 Mohaghegh P, Karow J K , Brosh Jr RM,J r , Bohr V A , & Hickson ID (2001) The Bloom's and Werner's syndrome proteins are D N A structure-specific helicases. Nucleic Acids Res 29: 2843- 2849 Mukhopadhyay S, Clark D R , Watson N B , Zacharias W, & McGregor W G (2004) R E V l accumulates in D N A damage-induced nuclear foci in human cells and is implicated in mutagenesis by benzo[a]pyrenediolepoxide. Nucleic Acids Res 32: 5820-5826 Nakanishi K , Yang Y G , Pierce A J , Taniguchi T, Digweed M , D'Andrea A D , Wang Z Q , & Jasin M (2005) Human Fanconi anemia monoubiquitination pathway promotes homologous D N A repair. Proc Nad Acad Sci U S A 102: 1110-1115 Niedernhofer L J , Essers J, Weeda G , Beverloo B , de Wit J, Muijtjens M , Odijk H , Hoeijmakers JH , & Kanaar R (2001) The structure-specific endonuclease E r c c l - X p f is required for targeted gene replacement in embryonic stem cells. EMBO J 20: 6540-6549 Niedernhofer L J , Odijk H , Budzowska M , van Drunen E , Maas A , Theil A F , de Wit J, Jaspers N G , Beverloo H B , Hoeijmakers J H , & Kanaar R (2004) The structure-specific endonuclease E r c c l - X p f is required to resolve D N A interstrand cross-link-induced double-strand breaks. Mol Cell Biol 24: 5776-5787 Park H K , Yook JS, K o o HS, Choi IS, & A h n B (2002) The Caenorhabditis elegans X P A homolog of human X P A . Mol Cells 14: 50-55 Prakash S, Johnson R E , & Prakash L (2005) Eukaryotic translesion synthesis D N A polymerases: specificity of structure and function. Annu Rev Biochem 74: 317-353 Reinke V , Smith H E , Nance J, Wang J, Van Doren C , Begley R, Jones SJ, Davis E B , Scherer S, Ward S, & K i m S K (2000) A global profile of germline gene expression in C elegans. Mol Cell 6:605-616 Rinaldo C , Ederle S, Rocco V , & L a Volpe A (1998) The Caenorhabditis elegans R A D 5 1 homolog is transcribed into two alternative m R N A s potentially encoding proteins of different sizes. Mol Gen Genet 260: 289-294 Saleh-Gohari N , Bryant H E , Schultz N , Parker K M , Cassel T N , & Helleday T (2005) Spontaneous homologous recombination is induced by collapsed replication forks that are caused by endogenous D N A single-strand breaks. Mol Cell Biol 25: 7158-7169 Sargent R G , Meservy JL , Perkins B D , K i l b u m A E , Intody Z , Adair G M , Nairn R S , & Wilson J H (2000) Role of the nucleotide excision repair gene E R C C l in formation of recombination- dependent rearrangements in mammalian cells. Nucleic Acids Res 28: 3771-3778 Schiestl R H & Prakash S (1990) R A D I O , an excision repair gene of Saccharomyces cerevisiae, is involved in the R A D l pathway of mitotic recombination. Mol Cell Biol 10: 2485-2491 Schiestl R H & Prakash S (1988) R A D l , an excision repair gene of Saccharomyces cerevisiae, is also involved in recombination. Mol Cell Biol 8: 3619-3626 Schumacher B , Hofmann K , Boulton S, & Gartner A (2001) The C. elegans homolog of the p53 tumor suppressor is required for D N A damage-induced apoptosis. Curr Biol 11: 1722-1727 Scully R, Chen J, Ochs R L , Keegan K , Hoekstra M , Feunteun J, & Livingston D M (1997) Dynamic changes o f B R C A l subnuclear location and phosphorylation state are initiated by D N A damage. Cell 90: 425-435 Scully R, Puget N , & Vlasakova K (2000) D N A polymerase stalling, sister chromatid recombination and the B R C A genes. Oncogene 19: 6176-6183 Sengupta S & Harris C C (2005) p53: traffic cop at the crossroads o f D N A repair and recombination. Nat Rev Mol Cell Biol 6: 44-55 Sengupta S, Linke SP, Pedeux R, Yang Q, Famsworth J, Garfield S H , Valerie K , Shay JW, El l is N A , Wasylyk B , & Harris C C (2003) B L M helicase-dependent transport of p53 to sites of stalled D N A replication forks modulates homologous recombination. EMBOJ22: 1210-1222 Sun H , Karow J K , Hickson ID, & Maizels N (1998) The Bloom's syndrome helicase unwinds G4 D N A . J Biol Chem 273: 27587-27592 Taniguchi T, Garcia-Higuera I, Andreassen PR, Gregory R C , Grompe M , & DAndrea A D (2002) S-phase-specific interaction of the Fanconi anemia protein, F A N C D 2 , with B R C A l and R A D 5 1 . 5 W 100: 2414-2420 Thompson L H , Hinz J M , Yamada N A , & Jones N J (2005) How Fanconi anemia proteins promote the four Rs: replication, recombination, repair, and recovery. Environ Mol Mutagen 45: 128-142 van Haaften G , Plasterk R H , & Tijsterman M (2004) Genomic instability and cancer: scanning the Caenorhabditis elegans genome for tumor suppressors. Oncogene 23: 8366-8375 Wicky C, A l p i A , Passannante M , Rose A , Gartner A , & Muller F (2004) Multiple genetic pathways involving the Caenorhabditis elegans Bloom's syndrome genes him-6, rad-51, and top- 3 are needed to maintain genome stability in the germ line. Mol Cell Biol 24: 5016-5027 Wormbase website: www.wormbase.org. Release WS178, August 2007 Wu L , Davies S L , Levitt N C , & Hickson ID (2001) Potential role for the B L M helicase in recombinational repair via a conserved interaction with RAD51. J Biol Chem 276: 19375-19381 Wu L & Hickson ID (2003) The Bloom's syndrome helicase suppresses crossing over during homologous recombination. Nature 426: 870-874 Yang Q, Zhang R, Wang X W , Spillare E A , Linke SP, Subramanian D , Griffith JD, L i J L , Hickson ID, Shen JC, Loeb L A , Mazur SJ, Appella E , Brosh RM,J r , Karmakar P, Bohr V A , & Hanis C C (2002) The processing of Holliday junctions by B L M and W R N helicases is regulated hyp53. J Biol Chem 277: 31980-31987 Youds JL , O'Nei l N J , & Rose A M (2006) Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173: 697-708 Yun S, Lie-A-Cheong C, & Porter A C (2004) Discriminatory suppression of homologous recombination by p53. Nucleic Acids Res 32: 6479-6489 CHAPTER 3^ dog-1 is the C. elegans BRIPl/FANCJ homolog 3,1 Introduction The human gene most similar to dog-1 is BRlPl. Patients with the cancer susceptibility syndrome Fanconi Anemia (FA) in subgroup J have mutations in BRIPl/FANCJ (Bridge et al, 2005; Levitus et al, 2005; Levran et al, 2005). The main diagnostic characteristic of F A is an extreme hypersensitivity to agents that cause D N A interstrand cross-links, indicating a role for the F A proteins in repair of cross-links. In accordance with a function in cross-link repair, BRIPl/FANCJ chicken cell lines are specifically sensitive to D N A cross-linking agents, but are not sensitive to other types of D N A damage (Bridge et al, 2005). If dog-1 were the C. elegans BRIPl/FANCJ homolog, dog-1 mutants should show a similar D N A damage sensitivity profile to BRIPl/FANCJ cells. A functional similarity between DOG-1 and B R I P l / F A N C J might make C. elegans a suitable model for study of the repair pathway involved in F A . Therefore, the goal of the experiments described in this chapter was to determine whether or not D O G - 1 , the B R I P l / F A N C J homolog in C. elegans, has a conserved function in interstrand cross-link repair. A version of this chapter has been submitted as part of a collaborative work: Jill ian L . Youds, Louise J. Barber, Jordan D . Ward, Spencer J. Coll is , Nigel J. O ' N e i l , Simon J. Boulton and A n n M . Rose (2007). DOG-1 is the Caenorhabditis elegans B R I P l / F A N C J homolog and functions in interstrand cross-link repair. Manuscript submitted to Molecular and Cellular Biology September 05, 2007. 3.2 Materials and Methods 3.2.1 Measuring apoptosis in the C. elegans germline by SYT012 staining L4-stage animals were picked to fresh plates 24 hours before staining. One-day o ld adults were picked into 50ul of 3 3 ^ M S Y T 0 1 2 in M 9 buffer (Molecular Probes) in eppendorf tubes and incubated for 3 hours in the dark. After incubation, animals were destained by placing them on N G M OP50 seeded plates to feed for 1 hour. After destaining, animals were placed in 2 m M levamisole on 3% agarose pads for viewing on a Zeiss Axioscope fluorescent microscope with 40X objective. The number of SYT012-stained bodies per gonad arm was counted for each animal. A l l values reported are ± standard error of the mean. 3.2.2 DNA damage sensitivity assay - X-ray treatment The sensitivity of dog-I mutants to D N A double strand breaks was measured by exposing the strain to X-rays and scoring viability. L4-stage animals were picked to fresh plates to obtain a synchronized group of animals. These animals were aged 24-hours so that animals were 1-day old adults on the day o f the experiment. In each case, dog-I was tested alongside an N 2 (wild type) control and a positive control, such as brd-I(gk297) or brc-I(okI26I), which are hypersensitive to double strand breaks. Plates of the strains to be tested, each containing approximately 20 animals, were placed face-up without lids in the X-ray machine and exposed to either 3000 or 4500 Rads of X-ray (use of X-ray machine was kindly allowed by D. Baill ie at Simon Fraser University). Control plates were not exposed to X-rays. Following treatment, the animals were allowed to recover overnight at 20°C. Animals were plated 5 per plate and allowed to lay for a 4 hour interval that was the period 22-26 hours post-treatment, then the adults were removed. The number of dead eggs versus hatching larvae was scored 24 to 48 hours after laying in order to calculate the percentage of progeny surviving the X-ray treatment. 3.2.3 DNA damage sensitivity assay - UVC-irradiation treatment The sensitivity of dog-1 animals to DNA adducts such as thymidine dimers was tested by exposing animals to UVC-irradiation and scoring viability. L4-stage animals were picked to fresh plates to obtain a synchronized population. These animals were aged 24-hours so that animals were 1-day old adults on the day of UVC-irradiation treatment. In each case, dog-1 was tested alongside an N2 (wild type) control. Plates of each genotype to be tested, containing approximately 20 animals, were placed face-up without lids equidistant from the bulbs in a UV- cross-linker (spectrolinker XL-1000, Spectronics Corporation) with 254imi bulbs (spectrolinker use was kindly allowed by D. Riddle, UBC). Animals were exposed to one of the control or test conditions: no UV, 50J UV, or lOOJ UV, and allowed to recover overnight at 20°C. Animals were plated 5 per plate and allowed to lay eggs for the 4 hour period that was 22 to 26 hours post U V C treatment. Following this, adults were removed from the plates. The number of dead eggs versus hatching larvae was scored 24-48 hours after laying and the percentage of progeny surviving U V C treatment was calculated. 3.2.4 DNA damage sensitivity assay - trimethylpsoralen+UVA treatment The sensitivity aï dog-1 mutants to DNA interstrand cross-links was measured by way of trimethylpsoralen (TMP) with U V A treatment. Initial TMP+UVA sensitivity experiments were carried out by the follov^ng protocol: prior to treatment, 3-4 healthy plates of N2 (wild type) animals and the strains to be tested were washed into 15mL falcon tubes using M9 buffer (22mM KH2PO4,22mM Na2HP04, 85mM NaCl, ImM MgS04) containing TritonXlOO (lOO^il/L). The worms were centrifiiged at ISOOrpm for 2min, and the buffer removed. M9/TritonX100 buffer was added to make the final volume 5mL per tube. A TMP stock (trioxsalen, Sigma) of 2.5mg/mL was made by adding 40mL acetone to the lOOmg bottle of TMP. Note that TMP does not dissolve well in M9 buffer, and even in acetone takes time and agitation to dissolve. Once fully dissolved, 20fil of the 2.5mg/mL T M P stock solution was added to each tube of worms in 5mL of M9/Tri tonX100 to give a final concentration of 10|ag/mL. The tubes of worms were placed on a Nutator mixer and allowed to incubate in T M P for 1 hour at room temperature in the dark. Following this, the tubes were centrifuged at ISOOrpm for 2 minutes. The T M P solution was removed using a vacuum aspirator, leaving 0.5mL of worms in liquid in each tube. To each tube, 1.5mL of M9/Tri tonX100 was added (for a total volume o f 2mL) and the animals were transferred into individual wells of 6 well-plates (2mL worms per well). Animals were exposed to U V A at 340j4.W/cm^ for 90 seconds (use of U V apparatus was courtesy of M . Edgley and D . Moerman, U B C ) . Control samples were treated only with T M P , or only with U V A , or with neither. Following U V A exposure, the animals were plated on fresh plates and allowed to recover for several hours. Young adult animals were plated 5 per plate and left overnight at 20°C. On the day following treatment, animals were plated to fresh plates and allowed to lay for a 4 hour period that was 22 to 26 hours post-treatment, after which the adult animals were removed from the plates. The number of dead eggs versus hatching larvae was scored 24-48 hours after laying in order to determine the percentage of progeny surviving the T M P + U V A treatment. Results obtained from experiments conducted by this protocol were only for a single level of cross- linking treatment. In later experiments, the T M P + U V A protocol was modified so that a range of cross- linking intensities could be tested to construct a kill-curve for cross-link sensitivity. The modified protocol was as follows: on the day prior to treatment, L4-stage animals of the genotypes of interest were picked to fresh plates in order to obtain a synchronized population. On the day o f the experiment, the 1-day old animals were washed into tubes with M9/TritonX100 buffer, as indicated above, and treated witli 10|j,g/mL T M P . A l l parts o f the protocol were the same, except that the worms were exposed to U V A at 550)iW/cm^ for 10, 20 or 30 seconds (these conditions being equal to approximately 55, 110 and 165J of U V A ) in a 50\xl volume of buffer. 3.2.5 DAPI staining following TMP+UVA treatment N 2 and dog-1 animals were exposed to T M P + U V A treatment as described at the begiiming of section 3.2.4. A few hours after treatment, young adults were picked to a separate plate and allowed to recover until 24 hours post-treatment. Animals were washed off the plates with M 9 containing TritonXlOO into eppendorf tubes and washed three times with M9/TritonX100. A s much buffer was removed as possible and 200| i l o f 150nM 4',6-diamidino- 2-phenylindole dihydrochloride (DAPI ; Sigma) in ethanol was added. The animals were placed in the dark and allowed to incubate for 1 hour. D A P I was removed and animals were washed twice in M9/Tri tonX100, then destained by soaking in I m L of M 9 buffer overnight at 4°C. DAPI-stained animals were mounted on 3% agarose slides and viewed at 4 0 X magnification on a Zeiss Axioscope fluorescent microscope. A Retiga 2000R camera (Qimaging) and Openlab 4.0.2 software (Improvision) was used to image the germlines. 3.3 Results 3.3.1 dog-1 is the reciprocal best-BLAST hit of human BRIPl/FANCJ BRIP1/FANCJ has been recognized as the human gene most similar to dog-1 (Cheung et al, 2002). In fact, DOG-1 and B R I P l / F A N C J are reciprocal bes t -BLAST hits between C. elegans and humans, with 31% identity and 50% similarity (http://www.ncbi.nlm.nih.gov/BLAST/; Figure 3.1). CeDOG-1 1 HsFANCJ 1 CeDOC-1 72 HsFANCJ 81 CeDOG ̂ 1 1 49 HsFANCJ 161 CeDOG-1 229 HsFANCJ 240 CeDOG ~ 1 309 HsFANCJ 314 CeDOG - 1 389 HsFANCJ 389 CeDOG- 1 469 HSFANCJ 4 60 CCUOC- 1 5 49 HsFANCJ 5 13 CeDOG-1 629 HsFANCJ 569 CeDOG - 1 709 HsFANCJ 636 CeDOG-1 789 HsFANCJ 714 CeDOG - 1 869 HSFANCJ 792 CeDOG 1 949 HSFANCJ 867 CeDOG- 1 HsFANCJ 947 CeDOG-1 HSFANCJ 1027 CeDOG 1 HsFANCJ 1 107 CeDOG-1 HsFANCJ 1 187 - - - - - - - - -MSSSDAFWRMF"EjNKNKGKSNlRSAFQVVKFEOPSl~STEPDDKraP[IHHElAGLMlKNPAK| M S S M W S E Y T I G C V K I Y F P Y K E | Y P S Q L A M M N S I L R G L N S K O H C L L E S P T G S G | 3 S [ 1 A L L C S A L A W O Q S L S | I R K R V Q I K N D E A D E G V S E K A YEjniMMLCVPVRVPRGLSLYSTQKLMlVKll.TM.KNS E V W I S C C C A C H S K D F Ï N N D M N Q G T S R H F N Y P S Ï P P S E ,\ LGESPl [ G T S S T C Q : , K T M IPEKTI CHWLKQYn: SBKKQASQ" iK O nYRDENDDFOVreraKR IHGFSGKTmvVFTNDrBlPLRSKVYFEPPFEEEFIEPViaVKNDKIjaEABlWEHDFTPHTPGFUPPVTLKraELEPVtagPEPV jRPLETTQgl RKRHCFgTEVHNLDAKVDSGKTVKLN - SgLEK I NSiaSPIBKPPGHCSRCCCSnKOGNSotaSSNTlfaaDHTG TtacrCLPRXRIM .sjgip KiB: K S [ AMKPRFEKAL H G V H K I S D Q H T GTRTHKQIAQI 'VKjBFSraLPSJAK I L K H I TE{gLK|aTAQSGVP - M| IRDHLERNGTVVFDMEKIJvra'rLAISyP I Q T F Q G MCKAWDHEIILVSLGKK gEQS SDHJ ARKHADlSOYfflK VVCNFNRNEKI NSAIJS 1 G C S F K S ILLDGKNGKSCYFY OLCPYFS LKACPY'i VILDEAHNIED VILDEAHNIED MLRWIRQVSTEAKÏFARGGQI DYESACKI WS(.NEMLL I L H K M T iKEraDDSILSL I V Q B R - - sHNia 1 w I rmTiTiiwigwsFsraivffii'i naNiasmvoi R N S Y I I A B F J I I snhimiawaYNnii . ! S < \ U I I S F S M [ S E N L K F O RIKraKA\'mrELDKTGIEErai,li|lIF|Drai:fflULKEFRCHLLYLraH[itL - FA[aDl.lJSsMVNNN - - IR|3KDJjE[|I.J3/\ncCSLI N V V L E A N A Ë Y J J V F R ISSANLFTSLTDPENGVDLFTPPLIPKHAAVAAS iFP- - ILQGH JI IKHN J v i O K F P E M Q Y F D A F K I K I S P I Y G K E E PSSTAl VC 1 EKWLYFQSYraGNQQjJQSTYRLN 1S I EP 1 Nmgc.rg|NH IKDADVSMS ISFGIflPRPri IRSS AGPRNMQYKEE A R E V P V I S A S 1 Q I M L K G L [ | M V L D Q L F R raJls|3SAl)l)YKl A lQUrYgWlf f l - • QIDISD AWtBADAAADCDDWKDPSMSETCHKPISECCKTTISLiWlMStaWC.srai-mFNElRSreWAISr^^ KTQJgMEraKoav ' " " [HTraLNnwvAlssI^iNGKvortmiiMwrMisiiffKsrssiïïm CLjlVLPKNK KRSRQKTAVHVLN â!GDOVtlNKDNlFAAVl..PI[WBFfflNRIOCnYRfMlSDPESS[fftC.rai MTJI 1 KYWi.sNmpAr>wrtrairsE«RvniDonna' lANHiOKNSQvwvGriGsaSKjgRNLCAHFQiîijEï- -FEraoDfav!iBli.r.i.sCW(riMsofBligaliSHKiJlËKii5 M R Q J WHNl QCMIRNSl 1. RWLS'IGL i gMKravHLV-taiRRSSELTSVMjBQFDAA 1 FTEl'SRFG AN 1 Nfflsrivn-IMFiaWaMïraa 1 flTâ XrtrKRCTgvMISV a»TSvr3flAM[E Liai, viy 11̂  I vfa|o G G E K T N - - FTBELLOvY'.ffiA 1 KYKGEKpfflAili A'ff'̂ cITBTOllSTagi HJssiiTiJNCTa -\|fi- r 1 atlsi'-fSni V KlT IROÈ EQNE K H l l I P B R QAYRALNQALGRC QAYRALNQALGRC 2MLM im ÎSLliRO IGNl.VGl ' L I L V { J ; D | F R N N P S R Y I SARVS SA So ILKSYPSIjKEFNANF 1 O H H S T Q E S A L E S L A I QRRH,\nEKAKKENFCE L S K K H O K H L N V S 1 K D R T N 1 O D N E S T L E V T S L K Y S T P P Y L L E A A S H L S P E N F V E D E A K I C V O E L QCPK11 l'KNSPLPSS11SRKEKNDPVFLEEACKAEK1V1SRSTSPTFNKQlKRVSVVSSFNSLGOYFTGK1PKAÏPELGSS Figure 3.1: Protein sequence alignment of C. elegans DOG-1 and human B R I P l / F A N C J . Identical amino acids are shown on black background, similar amino acids are shown on grey background. Sequences aligned using ClustalW 1.83 and shaded with BoxShade 3.21. The similarity between the proteins is further exemplified by the fact that C. elegans D O G - 1 , Gallus gallus B R I P l / F A N C J and Homo sapiens B R I P l / F A N C J contain the same conserved domains, including D E x D c 2 , a domain characteristic of the D E A D - I i k e helicases superfamily, D E A D _ 2 , a conserved region of a number of RAD-3- l ike DNA-binding helicases, H E L I C c 2 , which is a helicase superfamily C-terminal domain, and D i n G , a RAD-3-related helicase domain found in proteins associated with D N A replication, transcription, recombination and repair (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml; Figure 3.2). One important difference between DOG-1 and human B R I P l / F A N C J is the protein size: B R I P l / F A N C J is 1249 amino acids in length and contains 266 amino acids at its C-terminal end that do not exist in the 983 amino acid DOG-1 protein (Figure 3.2). It is the C-terminal end of human B R I P l / F A N C J that interacts with the breast cancer-associated protein B R C A l ; specifically, amino acids 988 to 993 of B R I P l / F A N C J have been shown to interact with B R C A l (Cantor et al, 2001; Shiozaki et al, 2004), and these residues are not conserved in D O G - 1 . 1 250 500 750 Caenorhaditis elegans | DExOc2 ^DExPc2 , j | HEUCc2 | OinG DinG DinG DEAD_2 ^ „ „ ^ 250 500 750 , non 175? Ga/̂ sga//os | D6xDc2 | D£xDc2 | HEUCc2 ^ j DinG DEAD_2 250 500 750 ioqO 1219 I I HEUCC2 _| I DEAD_2 Figure 3.2: Conserved domains of C. elegans D O G - 1 , G. gallus B R I P l / F A N C J and H. sapiens B R I P l / F A N C J as determined by the Conserved Domain Database (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml). Black box indicates the B R C A l - interacting region in human B R I P l / F A N C J . DinG 1 Homo sapiens , OExOc2 BRIPl I The next most similar C. elegans gene to human BRIPl/FANCJ is F25H2.13. These proteins share 27% identity and 45% similarity, indicating that F25H2.13 and B R I P l / F A N C J are less well-matched than are DOG-1 and B R I P l / F A N C J . Furthermore, phylogenetic analysis indicates that F25H2.13 is evolutionarily more similar to the human N H L and chicken R T E L proteins than it is to B R I P l / F A N C J (http://www.ebi.ac.uk/clustalw/), supporting the hypothesis that D O G - 1 , not F25H2.13, is the most likely C. elegans B R I P l / F A N C J homolog (Figure 3.3). Homo sapiens BRIPl/FANCJ — Gallus gallus BRIPt/FANCJ — Caenohabditis elegans DOG-1 — Homo sapiens NHLl — Gallus gallus RTEL — Caenohabditis elegans F25H2.13 Homo sapiens BLM Gallus gallus BLM Caenohabditis elegans HIM-6 Caenohabditis elegans HEL-1 Figure 3,3: Phylogram showing the estimated evolutionary relationship between human B R I P l / F A N C J , chicken B R I P l / F A N C J , C. elegans D O G - 1 , human N H L l , chicken R T E L , and C. elegans F25H2.13. The Bloom Syndrome proteins, human B L M , chicken B L M and C. elegans H IM-6 , as well as the C. elegans R N A helicase H E L - 1 are included as an outgroup. Phylogram created using ClustalW (http://www.ebi.ac.uk/clustalw/). 3.3.2 dog-1 animals have increased DNA damage-induced apoptosis in the germline If dog-1 is the homolog of BRIPl/FANCJ and has a role in D N A repair, it might be expected that the dog-1 (gk 10) strain would show some indication of D N A damage or stress under normal conditions. Upon initial examination, the dog-1 (gklO) strain is relatively healthy, and the only obvious difference between dog-1 and N 2 (wild type) animals is a slightly reduced brood size of 239 ± 7 for dog-1 compared to 271 ± 13 for N2 . After observing the strain over multiple generations, the mutator phenotype reported by Cheung et al. (2002) is also apparent. The mutator phenotype is evidence for defects in the ability of dog-l animals to maintain the D N A . Persisting DOG-1 substrates, such as G/C-tract secondary structures or other unrepaired intermediates, could be problematic during replication and might be detected as a type of D N A damage or lesion. To test whether or not dog-1 mutants had indications of D N A damage under normal conditions, the vital dye S Y T 0 1 2 was used to observed apoptotic corpses in the germline. In N2 (wild type) animals, an average of 0.8 ± 0.2 (n=44 gonad arms) S Y T 0 1 2 - stained corpses per gonad arm was observed, while in dog-1 animals, an average of 3.3 ± 0.2 (n=77) corpses were present per gonad arm (Figure 3.4). Thus, apoptosis is elevated in the absence of D O G - 1 . To determine whether the increased apoptosis in dog-1 mutants was the resuh of unrepaired D N A damage, a dog-1 cep-1 double mutant was constructed and S Y T 0 1 2 - stained. CEP-1 is the C. elegans p53 homolog that is required for D N A damage-induced apoptosis (Deny et ai, 2001 ; Schumacher et ai, 2001). Loss of CEP-1 abrogated the increased apoptosis observed in dog-1 mutants (0.8 ± 0.1 corpses per gonad arm [n=49]; Figure 3.4), indicating that the increased apoptosis in dog-1 animals is dependent on the D N A damage checkpoint protein C E P - 1 . Therefore, dog-1 mutants contain D N A damage that triggers the cep- 1 checkpoint. Elevated levels of apoptosis triggered by the D N A damage checkpoint might account for the reduced brood size in dog-1 mutants. E »10 < c 8-9 3 1 6-7 Of s. o 4-5 u o 2-3 È E 2 JCXXXXXXXXXX xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Ê >10 < I 6-7 I - I » Ê i 0-1 X X xxxxx xxxxxxxxxx xxxxxxxxxxxxxxxxxxxx xxxxxxx N2 dog-1 >10 B-9 £ 6-7 & 4-S e i 01 xxxxxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx dog-1 cep-1 Figure 3.4: Number of SYT012-stained corpses in N2 , dog-1 and dog-l cep-1 animals. The elevated apoptosis observed in dog-1 mutants is abrogated in the absence of CEP- l /p53 . 3.3.3 dog-1 animals are hypersensitive to DNA interstrand cross-linking agents A diagnostic cliaracteristic of F A cells is specific hypersensitivity to D N A interstrand cross-linking agents (reviewed in Levitus et al, 2006). Chicken B R I P l / F A N C J cells are highly sensitive to D N A damage in the form of interstrand cross-links, but are not sensitive to D N A lesions generated by X-ray or UV-irradiation treatment (Bridge et al, 2005). If DOG-1 is the homolog of B R I P l / F A N C J , the dog-l mutant should show a similar sensitivity to cross-linking agents. In order to test this hypothesis, a series of D N A damage sensitivity tests were carried out on the dog-1 strain. N 2 animals and dog-l mutants were exposed to 0, 50 or lOOJ of U V C - irradiation (254rmi), and embryonic survival was measured in the broods 22-26 hours following treatment, dog-l animals were no more sensitive to the U V C treatment than were N2 animals (t- test p=0.60 at 50J; p=0.28 at lOOJ; Figure 3.5). Similarly, after exposure to 0, 3000 or 4500 Rads of X-ray, dog-1 animals did not show significant hypersensitivity compared to N2 animals (p=0.28 at 3000 Rads; p=0.58 at 4500 Rads; Figure 3.5), though sensitivity was observed in the positive control strain brd-l/BARDl, as expected. D o s e of UVîMm (J) B 100 90 80 70 60 50 S 40 4) Û. 30 20 10 0 -r T 1500 3000 4 5 0 0 D o s e of X-ray (Rads) N2(wild type) dog-1 Figure 3.5: Sensitivity of N 2 and dog-l animals to A ) UVC-irradiat ion and B) X-ray treatment. Values plotted represent single experiments. N o significant difference in embryonic survival between N2 and dog-l after U V C or X-ray treatment was replicated in 3 independent experiments. Like chicken B R I P l / F A N C J cells, dog-1 mutants were not sensitive to X-ray or U V - irradiation-induced D N A damage, but these animals were sensitive to D N A cross-linking agents. Cross-linking with trimethylpsoralen and U V A ( T M P + U V A ) treatment caused significant embryonic death in dog-1 mutants compared to N2 animals. In these experiments, N 2 and dog- 1 animals were incubated in M 9 buffer containing 10)ig/ml T M P for 1 hour, then exposed to U V A at 340)aW/cm' for 90 seconds in a 2ml volume of liquid. During this treatment, the T M P intercalates with the D N A during the time that the nematodes are incubated in the T M P . Upon U V A exposure, DNA-bound T M P monoadducts are formed when a photon is absorbed, and cross-links between two nearby monoadducts are formed when a second photon is absorbed (Johnston et al, 1981). Control experiments including no treatment, U V A only and T M P only conditions indicated that dog-1 mutants were specifically sensitive to the T M P + U V A cross- linking treatment (no treatment p=0.43; U V A only p=0.18; T M P only p=0.50; T M P + U V A p=6.1xl0''^; Figure 3.6). no treatment TMP only UVA only Treatment • TmUVA 0 N 2 m dog-1 Figure 3.6: Embryonic survival in the progeny of N2 and dog-1 animals following no treatment, U V A only, T M P only or T M P + U V A treatment. T M P + U V A sensitivity experiments were carried out on 5 independent occasions, and it was determined tiiat tiie treatment leads to some variability in severity of cross-linking due to experimental conditions; for example, the activity of the T M P or the number and density of worms exposed to U V A would vary slightly between experiments. Thus, embryonic survival o f N2 animals varied somewhat between experiment trials, but in every trial, dog-1 animals were significantly hypersensitive to the treatment, compared to N2 animals (trial 1 p=0.0056; trial 2 p=0.00015; trial 3 p=5.8xlO-^; trial 4 p=3.4xl0"^; trial 5 p=6.1xl0"^ Figure 3.7). 03 > D CO O 'c o £̂ n E HI c Q) O I— 0) ÛL 9 0 8 0 7 0 6 0 5 0 4 0 3 0 2 0 1 0 0 r-i-] • mm * dog-l 3 4 T M P + U V A Trial Figure 3.7: Variability between trials of T M P + U V A treatment. Although severity of sensitivity varied between trials, dog-1 was shown to be significantly hypersensitive in all 5 trials of T M P + U V A treatment. Because of the variability in this protocol, and in order to more closely match our test conditions with those of our collaborators in the Boulton lab, the protocol was adapted slightly. A smaller, more uniform number of animals were treated in each experiment, and survival was observed at 3 different doses of U V A in order to construct a k i l l curve for the conditions. Approximately 150 animals were incubated in 10|.ig/ml T M P for 1 hour, then exposed as groups o f approximately 50 animals to U V A at 550).iW/cm^ for 10, 20 or 30 seconds (being equal to 55, 110 and 165 J of U V A ) . Similar to previous T M P + U V A treatments, significant hypersensitivity was observed in dog-1 mutants compared to N2 animals at every dose tested (p=0.0041 at 10^g/ml T M P + 55J U V A ; p=9.0xl0"'' at 10|ag/ml T M P + 1 lOJ U V A ; p=8.2xl0"' at lO^g/ml T M P + 165J U V A ; Figure 3.8). Some variability between experiments was still observed under these treatment conditions, and this may be due to the nature of T M P itself Importantly, the experiments showed that dog-1 is consistently hypersensitive to cross-linking treatment by T M P + U V A . to > 3 CO c CL 1 0 0 !!» 9 0 8 0 7 0 • 6 0 • 5 0 4 0 3 0 2 0 • 10 • 0 0 T i N2(wild type) dog-1 T ± T 1 5 0 —1— 1 0 0 —I— 1 5 0 —I 2 0 0 1 0 u g / m l T M P + D o s e of U V A (J) Figure 3.8: Sensitivity of N 2 and dog-1 animals to trimethylpsoralen/UVA ( T M P + U V A ) treatment with lO^ig/ml T M P and 55, 110 or 165J U V A . Experiments carried out by the Boulton lab also indicate that dog-1 is specifically hypersensitive to other cross-linking agents, including nitrogen mustard and cisplatin (L. Barber & S. Boulton, p. communication). 3.3.4 dog-1 mutants display evidence of repair defects after cross-linking treatment The dog-1 mutant hypersensitivity to interstrand cross-links detailed above could be explained by two different hypotheses. One possibility is that the checkpoint that detects D N A interstrand cross-links might not be ftinctional in dog-1 mutants. The other possibility is that the cross-link repair process itself is impaired in the absence of D O G - 1 . In order to test the activity of the D N A damage checkpoint after cross-linking treatment, S Y T 0 1 2 staining was carried out on N2 and dog-1 mutants 24 hours after T M P + U V A treatment. A s described in section 3.3.2, N2 animals under normal conditions had an average of 0.8 ± 0.2 (n=44 gonad arms) S Y T 0 1 2 - stained corpses, while dog-1 animals under normal conditions had an average of 3.3 ± 0.2 (n=77) corpses present per gonad arm. Twenty-four hours after cross-linking treatment with T M P + U V A , the average number of corpses in N2 gonad arms had increased to 2.6 ± 0.2 (n=43), while in dog-1 animals, the average number of corpses per gonad arm had increased to 5.3 ± 0.4 (n=27; Figure 3.9). X xxxxxxx xxxxxxxxxxxxxxxxxx É *10 I 8-9 I 6-7 5 4-5 I 2-3 E ê 0-1 X xxx xxxxxx xxxxxxxxxxxx xxxx N2 dog-1 xxxxxxxxx xxxxxxxxxxx xxxxxxx D § »10 I 8 - 9 I 6 -7 s. o 4-5 È 2-3 E ^ 0-1 X XX XXXXXXXX XXXXXXXXX XXX X N2 24 hrs post TMP+UVA dog-1 24 hrs post TMP+UVA Figure 3.9: Number of SYT012-stained corpses in A ) N2 and B) dog-1 animals under normal conditions and C) N 2 and D) dog-1 animals 24 hours after D N A cross-linking with T M P + U V A treatment. D N A damage-induced apoptosis is increased equally in N 2 and dog-1 animals following cross-linking. Apoptosis was increased by approximately 2 corpses per gonad arm in both N 2 and dog-1 animals 24 hours after cross-linking treatment, indicating that the D N A damage checkpoint is equally active in N 2 and dog-1 animals. Based on this data, the embryonic lethality in the progeny of dog-1 mutants after cross-linking treatment cannot be explained by defects in the D N A damage checkpoint; rather, defects in the cross-link repair process in dog-1 mutants must be the cause of lethality following T M P + U V A treatment. The germlines of N 2 and dog-1 animals were visualized with D A P I staining 24 hours after cross-linking treatment so that defects in repair could be observed. Chromatin bridges were present in the early embryos of dog-1 mutants, indicating that in these animals there is D N A bound together that becomes stretched apart when the early embryonic cells try to complete mitosis (Figure 3.10). These chromatin bridges might represent unrepaired interstrand cross- links in dog-1 mutants following D N A cross-linking, as they are not present in N 2 animals after T M P + U V A treatment, and are also not observed in N 2 or dog-1 mutants under normal conditions. These data, taken with others, support the hypothesis that dog-1 is the C. elegans homolog of human BRIPl/FANCJ, and has a conserved role in interstrand cross-link repair. A Figure 3.10: D A P I stained A ) N 2 and B) dog-1 mutant germlines 24 hours after T M P + U V A treatment. Chromatin bridges (arrows) are present in the early embryos of dog-1 but not N 2 animals. 3.4 Discussion 3.4.1 Phenotypes of the dog-1 mutant suggest DNA damage under normal conditions The G/C-tract deletion phenotype of dog-1 mutants reported by Cheung et al. (2002) is unambiguous evidence for the role of dog-1 in maintaining genome stability. The dog-1 strain also displays several additional phenotypes that are suggestive of a D N A repair mutant. Apoptosis is elevated in the germlines of dog-1 animals compared to N 2 , and is dependent on cep-l/p53, indicating that the D N A damage checkpoint is active in dog-1 mutants under normal conditions. It is likely that the D N A damage checkpoint is detecting endogenous problems associated with G/C-tracts in the absence of D O G - 1 . These might be persisting secondary structures that are difficult to resolve or repair due to local chromatin geography or the checkpoint might be activated in response to a G/C-tract deletion that has occuned in an essential gene, leading to apoptosis. The elevated apoptosis in dog-1 mutants might account for the reduced brood size observed in the strain. The dog-1 strain also shows a slightly elevated level of embryonic lethality among progeny, approximately 2.9% embryonic lethality versus 0.1%) in N 2 (reported in section 2.3.1). The potential problems at G/C-tracts described above might also be the reason for the slightly elevated level of embryonic lethality observed in the dog-1 strain. Whereas major problems at G/C-tracts might result in apoptosis in the germline, in less severe cases, the nucleus might survive to become an embryo, only to die when the stalled replication fork becomes a greater problem during the rapid cycles of replication that occur during embryonic development or when the deleted essential gene function is required in embryogenesis. Together, the G/C-tract deletion phenotype, elevated germline apoptosis and elevated embryonic lethality support a role for dog-1 in maintaining the D N A . 3.4.2 DOG-1 is the C. elegans B R I P l / F A N C J homolog Reciprocal bes t -BLAST analysis showed that DOG-1 is the C. elegans protein most similar to human B R I P l / F A N C J . The two proteins contain the same conserved domains and similar domain architecture. Furthermore, an evolutionary analysis including the next most similar C. elegans protein, F25H2.13, indicates that DOG-1 is evolutionarily most similar to B R I P l / F A N C J . In humans, a central function of B R I P l / F A N C J is to carry out I C L repair as F/ iA^CJ cells lines are extremely sensitive to ICL-inducing agents and a subset of F A patients have mutations in BRIP J/FANCJ (Levitus et al., 2005; Levran et al., 2005). It is shown here that dog-] has a conserved role in I C L repair as mutants are highly sensitive to cross-linking treatment at all doses of T M P + U V A tested. The D N A damage checkpoint is activated in dog-1 mutants after cross-linking treatment, indicating that the defect in these animals is not an inability to detect the D N A damage. Furthermore, chromatin bridges are visible in early embryos following cross-linking treatment, suggesting the presence of unrepaired cross-links in dog-1 mutants. These findings, together with the sequence similarity between DOG-1 and B R I P l / F A N C J , support the hypothesis that DOG-1 is the B R I P l / F A N C J homolog in C. elegans and has a conserved role in the repair of interstrand cross-links. Based on this data, the C. elegans dog-1 mutant might make a useful model for study of the interstrand cross-link repair pathway, which, in human cells, is extremely complex. 3.4.3 Implications of sequence conservation between DOG-1 and B R I P l / F A N C J While B R I P l / F A N C J has been identified as a Fanconi anemia protein, B R I P l / F A N C J (also referred to as B A C H l ) was first recognized as having a role in double strand break repair. The C-terminal end of human B R I P l / F A N C J interacts with B R C A l ; specifically, amino acids 988-993, and the motif Ser990-X-X-Phe993, are required for this interaction (Cantor et al., 2001 ; Shiozaki et al., 2004). Cantor et al. (2001) reported that double strand break repair was impaired by mutations in B R I P l / F A N C J that affect its ability to hydrolyze A T P , but repair was normal when a second B R I P l / F A N C J mutation that prevented binding to B R C A l was introduced. Thus, B R I P l / F A N C J appears to be involved in double strand break repair through its interaction with B R C A l . Germline mutations in B R I P l / F A N C J that affected helicase activity were detected in two patients with either early onset or familial breast cancer who did not have B R C A l or B R C A 2 mutations (Cantor et al, 2001; Cantor et al, 2004). However, multiple other studies have failed to demonstrate the involvement of B R I P l / F A N C J in n o n - B R C A l / B R C A 2 - associated familial breast cancer (Rutter et al, 2003; Karppinen et al, 2003; Luo et al, 2002; Lewis et al, 2005; Vahteristo et al, 2006), indicating that B R I P l / F A N C J germline mutations are a rare class and do not explain all those cases of familial breast cancer which are not caused by B R C A l or B R C A 2 . Several studies have shown that B R I P l / F A N C J is mutated in patients from Fanconi anemia subgroup J (Levran et al, 2005; Levitus et al, 2005; Litman et al, 2005). Clearly, germline mutations of B R I P l / F A N C J lead to a different outcome than do inherited B R C A l mutations. In fact, Peng et al (2007) have shown that the role of B R I P l / F A N C J in cross-link repair is independent of B R C A l , and requires an interaction with the mismatch repair protein M L H l that involves lysines 141 and 142 of B R I P l / F A N C J . It appears that B R I P l / F A N C J has multiple roles, both in interstrand cross-link repair and in double strand break repair in humans. Some authors have speculated that B R C A l might be functionally linked to the cross-link repair pathway through its interaction with B R I P l / F A N C J , but evidence to support this proposal has yet to be shown (Cantor & Andreassen, 2006). Recent work on chicken B R I P l / F A N C J cell lines has also been informative with respect to the function of B R I P l / F A N C J . Chicken B R I P l / F A N C J has 54% identity and 68% similarity to human B R I P l / F A N C J , and as is the case for C. elegans, the chicken and human proteins differ most at the C-terminal end (Bridge et al, 2005). Although the chicken and human proteins are similar in length, chicken B R I P l / F A N C J does not contain the Ser990-X-X-Phe993 motif that is required for B R C A l interaction (Bridge et al, 2005; Shoizaki et al, 2004). Bridge etal (2005) showed that chicken B R I P l / F A N C J cells were not significantly sensitive to double strand breaks induced by X-rays, and the cells could carry out normal homology-directed repair of an I-Scel-induced D N A double strand break. However, chicken B R I P l / F A N C J cells were highly sensitive specifically to interstrand cross-linking agents, supporting a conserved role for chicken B R I P l / F A N C J in cross-link repair but not double strand break repair (Bridge et al, 2005). The findings reported here for C. elegans mirror those observed in chicken cells. DOG-1 and B R I P l / F A N C J have 50% similarity and 31% identity, and the domain structure of the two proteins is similar, making the proteins reciprocal bes t -BLAST hits between C. elegans and humans. However, 348 amino acids at the C-terminal end of human B R I P l / F A N C J are not present in D O G - 1 . Because DOG-1 is missing the BRCAl- in te rac t ing domain, it is unlikely to interact with the C. elegans B R C A l ortholog B R C - 1 . dog-1 mutants are not significantly sensitive to X-ray treatment, indicating that there are no defects in the double strand break repair pathway in the absence of D O G - 1 , which has been shown to involve B R C - 1 / B R C A l in C. elegans (Boulton et al, 2004). Therefore, the proposed role for human B R I P l / F A N C J in double strand break repair is unlikely to be conserved in C. elegans. Conversely, the role for B R I P l / F A N C J in cross-link repair is clearly conserved in C. elegans, as dog-1 mutants are highly sensitive to agents that induce D N A cross-linking. Thus, it appears that B R I P l / F A N C J has an evolutionarily conserved role in interstrand cross-link repair (C. elegans, chicken and human), but only the human protein, containing the B R C A l interacting motif, also appears to function in double strand break repair. A s several independent studies have shown that B R I P l / F A N C J is mutated in multiple patients with Fanconi anemia (Levran et al, 2005; Levitus et al, 2005; Litman et al, 2005), it might be argued that the role for B R I P l / F A N C J in interstrand cross-link repair is more central to maintaining genome stability than is its role in double strand break repair. 3.4.4 Relationship of D O G - l / F A N C J to the F A pathway In human cells, B L M and components of the Fanconi repair pathway are functionally linked (Pichieni et al, 2004; Meetei et al, 2003; Hirano et al, 2005). B L M cells are sensitive to cross-linking agents and B L M localizes with F A N C D 2 at stalled replication forks following exposure to hydroxyurea or cross-linking treatment (Pichieni et al, 2004). Furthermore, the Fanconi core complex is required for cross-link dependent B L M phosphorylation after cross- linking treatment (Pichierri et al, 2004). Hirano et al (2005) showed that the rate of sister chromatid exchange for F A N C C B L M double mutant chicken cell lines was similar to that of B L M cells, suggesting that these two proteins are part of the same pathway. In chapter 2, a genetic interaction between dog-1 and him-6/BLM Mias described. That dog-1 and him-6/BLM show a synthetic sick phenotype in C. elegans suggests that dog-1 is somehow associated with him-6/BLM, but that the two proteins function in separate pathways. This idea is consistent with the finding of increased frequency of deletions in dog-1; him-6 animals, as both proteins appear to be able to resolve or repair G/C-tract structures, but likely do so through different means. I f H I M - 6 / B L M functions as part of the Fanconi interstrand cross-link repair pathway in C. elegans, as it does in humans, this would imply that DOG-1 functions in a separate pathway from H I M - 6 / B L M and the F A pathway. Whether human B R I P l / F A N C J functions directly as part o f or in parallel to the F A pathway remains an open question. No data is available from human cells, and data from chicken B R I P l / F A N C J cell lines is unclear. Although F A N C D 2 focus formation is normal in B R I P l / F A N C J chicken cells, which might suggest that B R I P l / F A N C J acts downstream of F A N C D 2 , interstrand cross-link sensitivity in the F A N C C F A N C J double mutant is additive, suggesting that these proteins function in parallel pathways (Bridge et al, 2005). The F A pathway is likely a complex pathway with multiple branching points, and so it may be difficult to separate and clearly identify the interactions in this pathway, particularly in higher organisms. Data from the Boulton lab indicates that in C. elegans, F C D - 2 / F A N C D 2 focus formation is not affected by the absence of D O G - 1 , and this could be interpreted to mean that DOG-1 functions either downstream or in parallel to F C D - 2 / F A N C D 2 (L. Barber & S. Boulton, p. communication). In addition, dog-1 fcd-2 double mutants show epistasis in their sensitivity to the cross-linking agent nitrogen mustard, suggesting that DOG-1 and F C D - 2 / F A N C D 2 function in the same pathway (L. Barber & S. Boulton, p. comm). This result initially appears difficult to reconcile with the finding that G/C-tract deletions are increased in dog-1; fcd-2 double mutants. One possibility is that DOG-1 has separate functions in I C L repair and at G/C-tract secondary structures. F C D - 2 / F A N C D 2 functions at stalled replication forks that may be the result of interstrand cross-links or other fork blocking lesions (Collis et al, 2006). DOG-1 might function in the F C D - 2 / F A N C D 2 pathway for I C L repair, while it functions independently from F C D - 2 / F A N C D 2 at G/C-tracts. In the absence o f D O G - 1 , F C D - 2 / F A N C D 2 could be required at replication forks stalled by G/C-tract secondary structures. Further research wi l l be required in order to determine the role of D O G - l / F A N C J relative to the F A pathway, but C. elegans holds much promise as a simplified model in understanding this pathway. 3.4.5 How does the role for dog-1 in ICL repair relate to G/C-tracts? DOG-1 has two seemingly unrelated functions in resolving secondary structures at G / C - tracts and in repairing interstrand cross-links; however, there may be some relationship between these two roles. It is possible that DOG-1 is a helicase that recognizes multiple different substrates, and acts at replication forks that are stalled by either a secondary structure or cross- linked D N A . However, it is more likely that DOG-1 has a certain type of structure that it recognizes, and there is some structural similarity between a secondary structure and cross-link or cross-link repair intermediate. The roles for DOG-1 at G/C-tracts and in I C L repair might be separate, but have a common substrate structure that is recognized by D O G - 1 . A biochemical analysis of the substrates that DOG-1 can unwind would determine whether or not this hypothesis is correct. Such experiments might measure the ability of DOG-1 to unwind G - quadruplex D N A , double stranded D N A , forked duplexes, and other structures. Regardless of whether or not a G/C-tract secondary structure and a D N A cross-link or cross-link repair intermediate are structurally similar, the finding that DOG-1 has roles both at G/C-tracts and in cross-link repair hints at a possible function for human B R I P l / F A N C J at both of these types of lesions. 3.4.6 Future experiments with dog-1 While the data presented here strongly suggests that D O G - 1 is the B R I P l / F A N C J ortholog, the ultimate proof would be to rescue the interstrand cross-link sensitivity of chicken and human BRIPl/FANCJ cell lines with dog-1 c D N A . Several additional experiments could also be carried out using dog-I to find new genes involved in replication and repair. For example, a large-scale R N A i screen for genes that are synthetic lethal with dog-1 would likely identify multiple new genes that are required for genome stability. dog-I would be a good choice for such a screen because the dog-1 (gklO) strain is quite healthy and sterile animals are rare, which would reduce the chance of finding false positives in the screen. In addition, new proteins acting in the cross-link repair pathway might be identified through a yeast two-hybrid screen with D O G - 1 , or with other components of the repair pathway, such as F A N C D 2 or B R C A 2 / F A N C D 1 . The findings reported in this chapter support a role for DOG-1 in interstrand cross-link repair that is functionally similar to the human homolog B R I P l / F A N C J . Considering that all o f the basic components of the F A pathway are conserved in C. elegans, including F A N C J , F A N C D 2 , F A N C M , and F A N C L , among others (Collis et al., 2006), the nematode could be a useful model for study o f the interstrand cross-link repair pathway with respect to F A . Furthermore, the role of DOG-1 at G/C-tracts might shed light on endogenous D N A structures as a potential contributor to genome instability in the cancer susceptibility syndrome. Chapter 3 References Boulton SJ, Martin JS, Polanowska J, H i l l D E , Gartner A , & Vida l M (2004) B R C A l / B A R D l orthologs required for D N A repair in Caenorhabditis elegans. Curr Biol 14: 33-39 Bridge W L , Vandenberg CJ , Franklin RJ , & Hiom K (2005) The B R I P l helicase functions independently of B R C A l in the Fanconi anemia pathway for D N A crosslink repair. Nat Genet 37: 953-957 Cantor S, Drapkin R, Zhang F, L i n Y , Han J, Pamidi S, & Livingston D M (2004) The B R C A l - associated protein B A C H l is a D N A helicase targeted by clinically relevant inactivating mutations. Proc Natl Acad Sci USA 101: 2357-2362 Cantor SB & Andreassen P R (2006) Assessing the link between B A C H l and B R C A l in the F A pathway. Cell Cycle 5: 164-167 Cantor S B , B e l l D W , Ganesan S, Kass E M , Drapkin R, Grossman S, Wahrer D C , Sgroi D C , Lane W S , Haber D A , & Livingston D M (2001) B A C H l , a novel helicase-like protein, interacts directly with B R C A l and contributes to its D N A repair function. Cell 105: 149-160 Cheung I, Schertzer M , Rose A , & Lansdorp P M (2002) Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich D N A . Nat Genet 31: 405-409 Collis SJ, Barber L J , Ward JD, Martin JS, & Boulton SJ (2006) C. elegans F A N C D 2 responds to replication stress and functions in interstrand cross-link repair. DNA Repair (Amst) 5: 1398-1406 Derry W B , Putzke A P , & Rothman J H (2001) Caenorhabditis elegans p53: role in apoptosis, meiosis, and stress resistance. Science 294: 591-595 Hirano S, Yamamoto K , Ishiai M , Yamazoe M , Seki M , Matsushita N , Ohzeki M , Yamashita Y M , Arakawa H , Buerstedde J M , Enomoto T, Takeda S, Thompson L H , & Takata M (2005) Functional relationships of F A N C C to homologous recombination, translesion synthesis, and B L M . £/kffiO J 24: 418-427 Johnston B H , Kung A H , Moore C B , & Hearst JE (1981) Kinetics of formation of deoxyribonucleic acid cross-links by 4'-(aminomethyl)-4,5',8-trimethylpsoralen. Biochemistry 20: 735-738 Karppinen S M , Vuosku J, Heikkinen K , AUinen M , & Winqvist R (2003) N o evidence of involvement o f germline B A C H l mutations in Finnish breast and ovarian cancer families. Eur J Cancer 39:366-371 Levitus M , Joenje H , & de Winter JP (2006) The Fanconi anemia pathway o f genomic maintenance. Cell Oncol 28: 3-29 Levitus M , Waisfisz Q, Godthelp B C , de Vries Y , Hussain S, Wiegant W W , Elghalbzouri- Maghrani E , Steltenpool J, Rooimans M A , Pals G , Arwert F, Mathew C G , Zdzienicka M Z , Hiom K , De Winter JP, & Joenje H (2005) The D N A helicase B R I P l is defective in Fanconi anemia complementation group J. Nat Genet 37: 934-935 Levran O, Attwooll C , Henry R T , Mil ton K L , Neveling K , Rio P, Batish SD, Kalb R, Velleuer E , Banal S, Ott J, Petrini J, Schindler D , Hanenberg H , & Auerbach A D (2005) The B R C A l - interacting helicase B R I P l is deficient in Fanconi anemia. Nat Genet 37: 931-933 Lewis A G , Flanagan J, Marsh A , Pupo G M , Mann G , Spurdle A B , Lindeman GJ , Visvader JE, Brown M A , Chenevix-Trench G , & Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer (2005) Mutation analysis of F A N C D 2 , B R I P l / B A C H l , L M 0 4 and S F N in familial breast cancer. Breast Cancer Res 7: R1005-16 Litman R, Peng M , Jin Z , Zhang F, Zhang J, Powell S, Andreassen PR, & Cantor SB (2005) B A C H l is critical for homologous recombination and appears to be the Fanconi anemia gene product F A N C J . Cancer Cell 8: 255-265 Luo L , L e i H , D u Q, von Wachenfeldt A , Kockum I, Luthman H , Vorechovsky I, & Lindblom A (2002) N o mutations in the B A C H l gene in B R C A l and B R C A 2 negative breast-cancer families linked to 17q22. IntJ Cancer 98: 638-639 Meetei A R , Sechi S, Wall isch M , Yang D , Young M K , Joenje H , HoatHn M E , & Wang W (2003) A multiprotein nuclear complex connects Fanconi anemia and Bloom syndrome. Mol Cell Biol 23: 3417-3426 Peng, M . , R. Litman, J. X i e , S. Sharma, R. M . Brosh Jr, and S. B . Cantor (2007) The F A N C J / MutLalpha interaction is required for correction of the cross-link response in F A - J cells. EMBO J. 26: 3238-3249 Pichierri P, Franchitto A , & Rosselli F (2004) B L M and the F A N C proteins collaborate in a common pathway in response to stalled replication forks. EMBO J 23: 3154-3163 Rutter JL , Smith A M , Davila M R , Sigurdson A J , Giusti R M , Pineda M A , Doody M M , Tucker M A , Greene M H , Zhang J, & Struewing JP (2003) Mutational analysis of the B R C A l - interacting genes Z N F 3 5 0 / Z B R K 1 and B R I P l / B A C H l among B R C A l and BRCA2-negative probands from breast-ovarian cancer families and among early-onset breast cancer cases and reference individuals. Hum Mutat 22: 121-128 Schumacher B , Hofmann K , Boulton S, & Gartner A (2001) The C. elegans homolog of the p53 tumor suppressor is required for D N A damage-induced apoptosis. Curr Biol 11: 1722-1727 Shiozaki E N , G u L , Y a n N , & Shi Y (2004) Structure of the B R C T repeats of B R C A l bound to a B A C H l phosphopepfide: implications for signaling. Mol Cell 14: 405-412 Vahteristo P, Yliannala K , Tamminen A , Eerola H , Blomqvist C , & Nevanliima H (2006) B A C H l Ser919Pro variant and breast cancer risk. BMC Cancer 6: 19 CHAPTER 4^ Characterization of the DOG-l/FANCJ-related helicase BCH-l/JRH-1 4.1 Introduction In C. elegans, there are 4 DOG-1 helicase-like proteins encoded by four genes: F33H2.1 (dog-1), F25H2.13 (jrh-l), M03C11.3 and Y50D7A.2. These genes have been implicated in genome stability and replication; Y50D7A.2 is a homolog of the X P D hehcase involved in nucleotide excision repair, M03C11.2 is a homolog of the yeast helicase C h l l , which functions in sister chromatid cohesion, and dog-1 has an important role in G/C-tract maintenance and D N A repair as the homolog of human BRIPl/FANCJ. B C H - l / J R H - 1 is most similar to the human N H L (novel helicase-like) protein, about which little is known. The mouse homolog of JRH-1 is R T E L (for regulator of telomere length), which is proposed to have a role in maintaining genome stability and telomere length (Ding et al., 2004). Loss of R T E L function results in an embryonic lethal phenotype, limiting its study in the mouse (Ding et al, 2004). Therefore, investigation was made into the function of C elegans bch-IIjrh-1, hereafter referred to as jrh-1 (for dog- l/FANCJ-relaXod helicase). Because C. elegans jrh-1 mutants are viable and the construction of double mutant strains is relatively fast and easy in the nematode, C. elegans is a useful system in which to examine genetic interactions with jrh-1. Understanding the function of this gene in C elegans w i l l add to our understanding of the functions of the DOG-1 helicase-like proteins and might shed light on the role of N H L in humans. ' A version of this chapter w i l l be submitted as part of a collaborative work with the Boulton lab in which the name spar-I w i l l be proposed for F25H2.13 (S. Boulton, p. communication). 4.2 Materials and Methods Unless otherwise indicated, the tml866 allele of jrh-1 was used for all experiments described in this chapter. 4.2.1 SYT012 staining Methods were performed as described in section 3.2.1 4.2.2 DNA damage sensitivity experiments Methods were performed as described in sections 3.2.2-3.2.4 4.2.3 DAPI staining N 2 , dog-1, jrh-1 and dog-1 jrh-1 animals were staged by picking L4-stage animals and staining 24 hours later. Animals were washed off the plates with M 9 buffer containing TritonXlOO (lOO^il/L) into microfuge tubes and washed three times with M9/TritonX100. The buffer was removed and 200\i\ o f 150nM 4',6-diamidino-2-phenylindole dihydrochloride (DAPI ; Sigma) in 95% ethanol was added. The animals were placed in the dark and allowed to incubate for 1 hour. D A P I was removed and animals were washed twice in M9/Tri tonX100, and destained by soaking in 1ml of M 9 buffer overnight at 4°C. DAPI-stained whole animals were mounted on 3% agarose slides and viewed at 40X magnification on a Zeiss Axioscope fluorescent microscope. A Retiga 2000R camera (Qimaging) and Openlab 4.0.2 software (Improvision) was used to image the germlines. Extracted germlines were prepared by the antibody staining protocol described in section 4.2.4 and imaged as above. 4.2.4 Anti-RAD-51 antibody staining On the day o f staining, 1-day old animals were picked to fresh plates. Slides were prepared by coating with poly-L-lysine solution. Animals were washed off of plates with M9/TritonX100 buffer, centrifuged at 1200rpm for 2min, then washed I X with M 9 buffer. M 9 was removed from the tubes, leaving the animals in a small volume of buffer. Worms were pipetted onto slides in 2 m M levamisole and gonads were extracted using 23-gauge needles to cut just below the pharynx. Coverslips were placed over the worms and pressed down lightly to further extrude gonads. The slides were placed onto a cold metal block in dry ice and allowed to freeze for 10 minutes. A razor blade was used to crack off coverslips, and slides were plunged into cold methanol in dry ice for 5 minutes, then cold acetone in dry ice for 5 minutes. Slides were allowed to dry following removal from the acetone. A P A B pen (Sigma) was used to outline the area of the specimens on each slide. Slides were blocked to avoid non-specific binding by incubating in P B S with 0.2% Tween20 and 3Vo Bovine Serum Albumin (BSA) for 1 hour in a humid chamber at room temperature. Slides were rinsed 3 X in P B S with 0.2% Tween20 and incubated with 50\xl of a 1:200 solution of anti-RAD-51 antibody (a gift from Adriana LaVolpe) in P B S with 3% B S A in a humid chamber overnight at 4°C. Slides were washed 3 X in P B S with 0.2% Tween20 and incubated with 50^1 o f F ITC conjugated goat anti- rabbit secondary antibody (Molecular Probes) at 1:2500 dilution in P B S with 3% B S A and 0.5|Lig/mL D A P I in a humid chamber. After 1 hour of incubation in secondary antibody, slides were washed 3 X in P B S with 0.2% Tween20, excess liquid was removed and 10^1 of D A B C O anti-fade reagent was added. Slides were covered with coverslips and viewed on a Zeiss Axioplan 2 fluorescent microscope with lOOX objective. Imaging was done with a Photometries Coolsnap H Q camera and Metamorph 6.1r6 software (Universal Imaging Corporation). 4.2.5 Strains and strain constructions The strains used in this chapter include KR3499 dpy-11 unc-42, KR342 dpy-18 unc-25, KR180 dpy-17 unc-36, FX1866 jrh-1 (tml866), VC13 dog-l(gklO), L M 9 9 smn-l(ok355) VhT2[bli-4(e937) Is48] (I;III), BC2200 eTl[unc-36j/dpy-18; eTl[unc-36]/unc-46, KR4145 nTl/+{\W); nTl/dpy-ll{V\ \C50^acl-3(ok726) IV/nTl fqls51j {IY;Y), VC193 him-6(ok412) and FX1937 mus-81(tml937). For the jrh-1 dog-1, jrh-1 mus-81, and jrh-1; him-6 double mutant strains, the hT2 balancer was used to maintain the strains as heterozygous for jrh-1 (in the cases ofjrh-1 dog-1 and jrh-1; him-6) and heterozygous for both jrh-1 and mus-81 (in the case o f jrh-1 mus-81) because the strains could not be maintained as homozygotes due to severe sickness/lethality. hT2 is a balanced translocation of chromosomes I and III and was used to balance genes on chromosome I. hT2[gfp] dog-1 (gkl0)/jrh-l(tml866) dog-1 (gklO) V C 1 3 dog-l(gklO) males were created by heat-shocking the strain at 30°C for 6 hours. dog-1 (gklO) males were crossed to F X 1866jrh-1 (tml866) hermaphrodites. Putative cross progeny were allowed to self fertilize and their progeny were plated individually. P C R was used to verify animals of the genotype jrh-l(tml866) dog-l(gklO)/+ dog-l(gklO). N 2 males were crossed to L M 9 9 smn-l(ok355) VhT2[bli-4(e937) Is48] (I;III) hermaphrodites in order to generate hT2[bli-4(e937) Is48]/+ males. The hT2 translocation in this strain is marked by the presence of a G F P insertion ils48), which can be observed on a G F P microscope as G F P expression in the pharynx of animals with the translocation. GFP-expressing hT2[bli-4(e937) Is48]/+ males were crossed to jrh-1 (tml866) dog-1 (gklO)/+ dog-1 (gklO) hermaphrodites. G F P - expressing progeny o f this cross were plated individually and allowed to lay for 48 hours. Adults were picked off these plates after laying, and were lysed and tested for the heterozygous presence of jrh-1 (tml866) and dog-1 (gklO). From any plates testing positive, GFP-expressing progeny were plated individually, allowed to lay for 48 hours, then adults were tested for the homozygous presence of dog-1 (gklO) in order to obtain the strain hT2[gfp] dog-1 (gklO)/jrh- l(tml866) dog-l(gklO). The same method was used to construct hT2[gfp]/jrh-l(tml866); him- 6(ok412). jrh-1; eTl[unc-36]/dpy-18; eTl[mc-36]/unc-46 BC2200 males of genotype eTl[unc-36]/dpy-18; eTl[unc-36]/unc-46 were mated to FX1866jrh-l(tml866) hermaphrodites. F l males of genotype jrh-l/+; dpy-18/+; unc-46/+ were crossed to jrh-l/+; eTl[unc-36]/+; eTl[unc-36]/+ hermaphrodites. L4-stage progeny of this cross were plated individually and allowed to lay for 48 hours and then were lysed. P C R was used to determine the presence of the jrh-1 (tml866) homozygous deletion among the animals. The presence of eTl[unc-36]/dpy-18; eTl[unc-36]/unc-46 was confirmed by observation of wi ld type, Dpy-18 Unc-46 and Unc-36 phenotypes in the progeny. A similar method was used to construct the jrh-1; nTl[gfp]/+; nTl/dpy-U strain, using G F P expression in the pharynx [qls517 as a marker for nTl. hT2[gfp]/jrh-l(tml866) mus-81 (tml937) FX1937 mus-81 (tml937) males were crossed to FX1866 jrh-1 (tml866) hermaphrodites. Putative cross progeny were allowed to self and 100 of their progeny were plated individually. P C R was used to find animals of the genotype jrh-1 (tml866) mus-81 (tml 937)/jrh-l (tml866) +. N 2 males were crossed to L M 9 9 smn-l(ok355) yhT2[bli-4(e937) Is48] (I;III) hermaphrodites in order to obtain hT2[bli-4(e937) Is48]/+ males. GFP-expressing hT2[bli-4(e937) Is48]/+ males were crossed to jrh-l(tml866) mus-81(tml937)/jrh-l(tml866) + hermaphrodites. G F P - expressing progeny o f this cross were plated individually and allowed to lay for 48 hours, as which time adults were removed, lysed and tested for the heterozygous presence o f jrh- l(tml866) and mus-81 (tml937). 4.2.6 Measuring meiotic recombination The frequency of meiotic recombination was measured in the intervals between dpy-11 and unc- 42, dpy-18 and unc-25, and dpy-17 and unc-36. Individual animals of genotype dpy unc/+ + and jrh-1; dpy unc/+ + were plated and transferred daily for four days. In each of the broods, the number of wild-types, DpyUnc, Dpys and Unes were scored. Recombination frequency (p) was calculated using the equation: p=l-(l-2(RyT))^ Where: R=numbers o f recombinants=2(largest recombinant class) T=total progeny=4/3 (number of wild-types + 1 recombinant class) The map distance was calculated as pxlOO. Confidence intervals for each recombination frequency were calculated using the statistics of Crow and Gardner (1959). 4.3 Results 4.3.1 jrh-1 is a member of the dog-1 family and encodes a helicase-like protein The C. elegans dog-1 gene family contains four genes: dog-1, F25H2.13, Y50D7A.2 and M 0 5 C / / . 2 (Figure 4.1). F33H2.1 {dog-1) - F25H2.13 {jrh-1) Y50D7A.2 (unassigned) M03C11.2 (unassiqne 103C 1.2 g d) T04A11.6 {him-6) dog-1 helicase-like family RecQ helrcase family Figure 4.1: Phylogram of genes in the dog-1 and RecQ helicase families. dog-1 is essential for G/C-tract maintenance in C. elegans (Cheung et al, 2002). Y50D7A.2 is an XPD- l ike gene, suggesting a possible role in nucleotide excision repair (www.wormbase.org). M03C11.2 is similar to the yeast C h l l helicase, which is thought to function in sister-chromatid cohesion and has a role in maintaining genome integrity following D N A damage (Gerring et al, 1990; Spencer et al, 1990; Skibbens, 2004; Laha et al, 2006). N o viable mutants were available for either Y50D7A.2 or M03C11.2. F25H2.13 was chosen for further study as mutants in the gene were viable, and the gene had not been studied in C. elegans. F25H2.13 and DOG-1 are closely related, having 29% amino acid identity and 48% similarity (http://www.ncbi.nlm.nih.gov/BLAST/). F25H2.13 has been named bch-1 for BACHl-xdaXea, and is also known as jrh-1 for dog-l/FANCJ-rdated helicase. There are three domains in common between JRH-1 and DOG-1 : D i n G , a RAD-3-related helicase domain, H E L I C c 2 , which is a helicase superfamily C-terminal domain, and DExDc2, the D E A D - l i k e helicases superfamily domain that contains a D E A H - b o x . Despite their similar domains, the two proteins have different structure (Figure 4.2). DOG-1 contains an additional domain, D E A D _ 2 , which is a conserved region found in R A D - 3 - l i k e DNA-binding helicases and is not present in JRH-1 . 1 250 600 750 F33H2.1 ( D O G - 1 ) | DExDc2 DExDc2 | | HËLICc2 DinG DinG DinG DEAD 2 1 250 500 750 F25H2 . 13 { JRH -1 ) l DExDc2 i H E U C c 2 | 983 DinG Figure 4.2: Comparison of the domain structure of DOG-1 and JRH-1 . Both proteins contain domains that are characteristic of helicases, as determined by the Conserved Domain Database (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml). The human gene most similar to jrh-1 is NHL. JRH-1 and N H L share 34% identity and 53%) similarity (http://www.ncbi.nlm.nih.gov/blast/). Currently, there are no published reports on NHL function in human cells. The mouse gene most similar is RTEL, an essential gene that is proposed to fimction in the regulation of telomere length (Ding et al, 2004). In C. elegans, the jrh-l(tml866) mutant is a deletion of 1346bp begiiming in the first intron and extending into intron 5, including most of the DExDc2 domain and the DEAH-box . The tml866 deletion causes the sequence beyond the deletion to be out of the normal reading frame and introduces a stop codon in exon 6 (Figure 4.3). Therefore, tmlS66 is likely to be a null allele of jrh-1. irh-1(tm1866) Figure 4.3: jrh-] gene structure, showing the location and result of the tml866 deletion. The location of the vc8 point mutation is indicated by an arrow. Gene structure adapted from www.wormbase.org. A second allele of Jrh-1 was generated by T I L L I N G (Targeting Induced Local Lesions in Genomes; Gilchrist et al., 2006). This allele is a point mutation, known as vc8, which is a cytosine to thymine change at nucleotide 1165; this mutation causes a serine to phenylalanine change at amino acid 265 (a conserved residue). The jrh-1 (vc8) and jrh-1 (tml866) mutants are viable, though both have reduced viability. 4.3.2 Phenotypes of jrh-1 mutant animals In examining the jrh-1 (tml866) strain, several phenotypes were observed, jrh-1 mutant animals have a reduced brood size, with an average progeny number of 68 ± 12 (n=20), which is approximately 4-fold lower than wild type. The animals also display a slow growth phenotype, and take approximately 4.5 days to develop from egg to gravid adult at 20°C, compared to 3.5 days forN2 animals. In addition, 21 percent (12 out o f 56) of jrh-1 mutants display a protruding vulva phenotype (Pvl), a phenotype that can be caused by unrepaired D N A damage (Weidhaas et al., 2006). These phenotypes might suggest a possible role for jrh-1 during replication or repair. If jrh-1 mutants contain unrepaired D N A damage, an increase in apoptosis would be observed in the germline as described in Chapter 3. In order to test whether or not jrh-1 mutant animals display elevated apoptosis that could be due to the presence of unrepaired D N A damage, the vital dye S Y T O 12 was used. Apoptosis was measured as described previously (Youds et al, 2006 and Chapter 3 of this thesis). N2 animals had an average of 0.8 ± 0.2 SYT012-stained corpses per gonad arm (n=44). jrh-1 animals had a significantly higher average o f 2.5 ± 0.3 SYT012-stained corpses (n=57; Figure 4.4). Thus, jrh-1 mutant animals have elevated apoptosis in the germline. The dependence of the elevated apoptosis on the p53 ortholog cep-1 was not tested due to the tight genetic linkage of jrh-1 to cep-1 on chromosome I, which made it difficult to construct the double mutant. xxxxxxxxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Ê < -a ro c o 3 J3 3 >10 8-9 6-7 4-5 2-3 0-1 X xxxx xxxxxxxxxxx xxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxx N2 jrh-1 Figure 4.4: Number of SYT012-stained apoptotic corpses in A ) N 2 and B) jrh-l mutant animals under normal conditions. 4.3.3 jrh-1 mutants are not sensitive to DNA damage induced by U V C or X-ray irradiation Because DOG-1 has a role in repair of D N A interstrand cross-links, one possibility was that JRH-1 might also function in D N A repair. In order to test for a role in repair, jrh-1 mutants were tested for sensitivity to D N A damage in the form of bulky photoproducts (induced by UVC-irradiation) and double strand breaks (induced by X-rays). N 2 and jrh-1 mutant animals were exposed to the D N A damaging agents and sensitivity was measured by scoring embryonic survival 22 to 26 hours following exposure to each agent, jrh-1 mutants were not significantly sensitive to treatments of 50 or lOOJ of UVC-irradiation, compared to N 2 animals (t-test p=0.76 at 50J U V C ; p=0.16 at lOOJ U V C ; Figure 4.5A). Similarly, no significant difference in embryonic survival was observed between jrh-1 and N 2 animals treated with 3000 or 4500Rads of X-ray irradiation (p=0.13 at 3000Rads X-ray; p=0.97 at 4500Rads X-ray; Figure 4.5B). These results indicate that JRH-1 does not function in the repair of bulky adducts or double strand breaks. D o s e of UV254nm (J) B 100 90 80 • 70 • 6 0 • 50 • S 40 • 2 a. 30 • 20 • 10 • 0 0 N2 —é^ jrh-1 -r — 1 1 — 3000 4 5 0 0 1500 D o s e of X- ray (Rads ) Figure 4.5: Sensitivity of N 2 and jrh-1 animals to A ) UVC-irradiat ion and B) X-ray treatment. Values plotted represent single experiments. N o significant difference in embryonic survival between N 2 and jrh-1 after U V C or X-ray treatment was replicated in 3 independent experiments. 4.3.4 jrh-1 mutants are moderately sensitive to DNA interstrand cross-linking agents DOG-1 was shown to function specifically in interstrand cross-link repair (Chapter 3 of this thesis); therefore, JRH-1 was also tested for a role in cross-link repair. Two slightly different protocols were used to assess the sensitivity of jrh-1 mutant animals to interstrand cross-linking agents (described in section 3.2.4). Trimethylpsoralen (TMP) was used together with both low and high powers of U V A . When jrh-1 animals were exposed to 10|ig/ml T M P followed by 90 seconds of U V A at 340)jW/cm^ in a 2ml volume of buffer, no significant sensitivity to control or cross-linking treatment was observed, compared to N2 (no treatment p=0.08; U V A only p=0.15; T M P only p=0.83; T M P + U V A p=0.08; Figure 4.6). CD 100 > 90 CO 80 o 70 ' c o 60- 50 - E 4 0 - lU 30- c 20 1 O i _ Q) 10 Q. 0- no treatment UVA only TMP only Trea tmen t 0N2 Ujrf)-1 TMPi-UVA Figure 4.6: Embryonic survival in the progeny of N2 and jrh-1 animals following no treatment, U V A only, T M P only or cross-linking by T M P + U V A treatment. jrh-1 mutants were also treated for interstrand cross-link sensitivity using a range of higher U V A power in order to construct a kill-curve. In these experiments,yr/j-7 animals were exposed to lO^g/ml T M P followed by 10, 20 or 30 seconds of U V A at a power of 550(aW/cm^ in a 50jil volume of buffer (being approximately equal to 55J, 1 lOJ and 165J U V A ) . A t this higher power, jrh-1 did not show significant sensitivity to U V A only, compared to N 2 animals (p=0.63 at 1 lOJ U V A only). However, jrh-1 was significantly sensitive to the higher doses of cross- linking treatment (p=0.03 at lO^g/ml T M P + 55J U V A ; p=0.006 at 10)ig/ml T M P + 1 lOJ U V A ; p=0.009 at 10|ag/ml T M P + 165J U V A ; Figure 4.7). 10 - u 1 1 1 1 1 0 50 100 150 2 0 0 10ug/ml T M P + D o s e of U V A (J) Figure 4.7: Sensitivity of N 2 , dog-1 and jrh-1 animais to trimethylpsoralen with U V A ( T M P + U V A ) treatment with 10|xg/ml T M P and 55, 110 or 165J U V A . jrh-1 is significantly sensitive at higher doses of cross-linking treatment. Unlike dog-1 mutant animals, which are highly sensitive to cross-linking,7>A-7 animals show moderate sensitivity to T M P + U V A treatment, and only when the treatment uses a higher power of U V A . jrh-1 appears to be sensitive only when high levels of cross-linking are present, suggesting that it might play a minor role in cross-link repair. 4.3.5 Loss of JRH-1 function is synthetically lethal in the absence of DOG-1 The phenotypes of jrh-1 mutant animals and the results of the D N A damage sensitivity experiments described above suggested a possible role for jrh-1 in D N A repair. In order to test whether or not jrh-1 might function in D N A repair at stalled replication forks, the dog-1 mutant was utilized. Replication fork stalling is proposed to occur in dog-1 mutants as a result of persisting G/C-tract secondary structures (Youds et al., 2006). If JRH-1 were required for repair at stalled replication forks, a genetic interaction might be expected between jrh-1 and dog-1. The hT2 balancer, which heterozygously maintains jrh-1, was used to construct the jrh-1 dog-1 double mutant. The dog-1 single mutant animals were healthy, while jrh-1 animals were somewhat sick and slow growing, but could be maintained without difficulty, jrh-1 dog-1 double mutants grew to adulthood, but did not lay any eggs, resulting in complete sterility in the absence of both of these genes. Double mutants segregated from the hT2[gfp] dog-1/ jrh-1 dog- 1 balanced strain also displayed protruding vulvae (Pvl) with 100% penetrance, which is a synergistic enhancement of the Pv l phenotype rarely observed in dog-1 mutants and present in only 20%) of jrh-1 single mutants (Figure 4.8). Thus, the double mutant is a synthetic lethal with an enhanced P v l phenotype. Figure 4.8: Comparison of A ) N 2 and B) jrh-1 dog-1 double mutant. The uterus is indicated by small arrows, and the vulva by the arrowhead. Absence of embryos in the uterus and protruding vulva can be observed in jrh-1 dog-1. One explanation for the synthetic lethality of jrh-1 dog-1 animals is that JRH-1 is essential for repair at replication forks that stall in the absence of D O G - 1 . To look for evidence of defects during replication, double mutant germlines were visualized with D A P I staining, dog- 1 and jrh-1 single mutant germlines were similar to those of wi ld type animals, but jrh-1 dog-1 germlines displayed severe defects. The double mutant germlines were underproliferated, and had fragmented chromosomes and enlarged mitotic nuclei, the latter of which are indicative of an activated replication checkpoint (Ahmed et al, 2001; Figures 4.9 and 4.10). Figure 4.9: Comparison of whole D A P I stained A ) N 2 , B) dog-1, C) jrh-1 and D) jrh-1 dog-1 double mutant germlines. Massive proliferation defects are evident in jrh-1 dog-1. Figure 4.10: Mitotic zones of D A P I stained A ) N2, B) dog-1, C) jrh-1 and D) jrh-1 dog-1 double mutant germlines. The reduced number of enlarged mitotic nuclei in jrh-1 dog-1 indicate activation of the mitotic replication checkpoint. Germline replication defects were so severe in jrh-1 dog-1 that the transition zone was not observed and no nuclei progressed into meiosis, leading to the sterile phenotype observed in the double mutants. These data indicate that in the absence of both of these helicase-like proteins germline replication has fatal consequences. When neither protein is present, mitotic catastrophe results. 4.3.6 JRH-1 is not required for G/C-tract stability DOG-1 has been shown to be required to prevent G/C-tract deletions (Cheung et al, 2002), and the frequency o f deletions in dog-l mutants is increased in the absence of homologous recombination repair (Youds et al, 2006). Could defects at G/C-tracts cause the synthetic lethality observed in jrh-l dog-l mutants? In the absence of D O G - 1 , secondary structures are proposed to form, some of which might be resolved by JRH-1 . In the absence of both DOG-1 and J R H - 1 , an increased number of replication blockages at G/C-tracts might result in the mitotic arrest observed. To test this, the frequency of G/C-tract deletions in jrh-l and jrh- l dog-1 animals was determined using the assay for deletions at the \ah-l G/C-tract (Youds et al, 2006; section 2.2.4). N o deletions were observed in jrh-1 single mutants. Nor was there a significant difference in the frequency of jrh-1 dog-l animals with deletions compared to dog-1 single mutants, using either jrh-1 allele (point mutation vcS or tml866 deletion; Table 4.1). Thus, dog-l and jrh-l do not have redundant roles at G/C-tracts. Genotype Deletion Number of p-value in t-test Frequency animals tested with dog-1 dog-1 11.4 228 jrh-1 (tml866) 0 100 jrh-1 (tml866) dog-1 6.9 116 0.30 jrh-1 (vc8) dog-1 12.5 112 0.81 Table 4.1: Frequency o f dog-l and jrh-l single mutant and jrh-1 dog-1 double mutant animals with vab-l G/C-tract deletions. 4.3.7 Jrh-1 dog-1 animals show extensive RAD-51 foci in the mitotic germline A more likely explanation for the synthetic lethality between jrh-1 and dog-1 mutants is that JRH-1 is required for D N A repair at replication forks stalled due to G/C-tract secondary structures occurring in the absence of D O G - 1 . In this case, jrh-1 dog-1 animals would show signs of D N A damage caused by incomplete repair o f stalled forks, such as breaks or persisting repair intermediates. In order to investigate whether or not jrh-1 dog-1 double mutants had increased D N A damage, anti-RAD-51 antibody was used to stain jrh-1 dog-1 animals. RAD-51 is the C. elegans R e c A homolog required for strand invasion during double strand break (homologous recombination) repair and during meiotic recombination (Rinaldo et al, 1998 & 2002). R A D - 5 1 foci are observed rarely in the mitotic zone of the germline of wild type animals. Foci appear beginning in the transition zone, where R A D - 5 1 localizes to sites of meiotic double strand breaks during late zygotene to early pachytene; the foci gradually disappear in late pachytene as the double strand breaks are repaired (Alp i et al, 2003). When anti-RAD-51 was used to stain dog-1 and jrh-1 single mutants, a few rare foci in the mitotic zone, and many foci beginning in the transition zone and persisting into late pachytene were observed, as expected (Figure 4.11 A , C) . Similar staining was observed in the control strain, hT2 dog-l/jrh-1 dog-1. However,y>/z-7 dog-1 double mutant animals displayed extensive R A D - 51 foci throughout the mitotic zone arrested nuclei (Figure 4.1 I B , D). The abnormal RAD-51 staining pattern indicates that an excess of homologous recombination repair intermediates are present in the mitotic zones of jrh-1 dog-1 animals. AhT2 dog-1/jrh-1 dog-1 control B jrh-1 dog-1 ChT2 dog-1/jrh-1 dog-1 mitotic zone D jrh-1 dog-1 mitotic zone Figure 4.11: Anti-RAD-51 staining of A) hT2 dog-1/jrh-1 dog-1 controls and B) jrh-1 dog-1 germlines. Mitotic zones of C) hT2 dog-l/jrh-1 dog-1 controls and D) jrh-1 dog-1 show excessive RAD-51 foci in the mitotic zones of jrh-1 dog-1 animals, but not in hT2 dog-l/jrh-1 dog-1 control animals. DAPI is shown in green, anti-RAD-51 is shown in red. 4.3.8 Loss of function of JRH-1 in eTl translocation hétérozygotes Homologous recombination repair of double strand breaks during meiosis requires the presence of a homolog. In the case of the translocation eTl (II1;V), the right arm of chromosome 111 is exchanged with the left arm of chromosome V and homolog pairing for those regions is prevented during meiosis (Rosenbluth & Baillie, 1981 ; Edgley et al, 1995). Thus, it is expected that homologous recombination repair of meiotic double strand breaks will not occur in the translocated regions. Therefore, other repair mechanisms must act at meiotic double strand breaks that occur within the translocated portions of the chromosomes. To explore the effect of absence of JRH-1 on repair of the translocated chromosomes, a strain containingjV/?-/ and eTl along with visible markers for chromosomes III and V was constructed. The eTl strain used was BC2200, which has the genotype eTl[unc-36]/dpy-18(III); eTl[unc-36J/unc-46(V), where eTl is marked by a mutation in unc-36 caused by the translocation breakpoint. The strain segregates with a ratio of 4 wi ld types (translocation hétérozygotes) to 1 dpy-18; unc-46 (DpyUnc homozygotes) to 1 eTl [unc-36] (Unes that are eTl homozygotes). It quickly became evident that when the jrh-1 mutation was present, the strain had an unusual phenotype. Within a few generations in the jrh-1 background, the homozygotes, dpy-18; unc-46 and unc-36 animals, out- competed the wi ld type translocation hétérozygotes. Repeat experiments with several different constructions of the jrh-l; eTl/dpy-18; eTl/unc-46 strain always produced the same result. In the control BC2200 strain, the homozygotes never out-competed the translocation hétérozygotes. Under normal conditions, homozygote animals should never out-compete the translocation hétérozygote animals because the translocation hétérozygotes are more prevalent in the progeny of the heterozygous eTl strain. Therefore, segregants from the jrh-1; eTl/dpy-18; eTl/unc-46 strain were scored in order to examine brood size and viability. The brood size of jrh-1; eTl/dpy-18; eTl/unc-46 animals was smaller than expected (observed average of 36 eggs laid per animal, compared to 45 expected). However, the brood size of jrh-1; eTl/eTl animals was slightly greater than expected (observed average of 56 eggs laid per animal, compared to 49 expected). Thus, the absence of JRH-1 synergistically reduced the brood size of the eTl translocation hétérozygotes, but not of eTl translocation homozygotes (Table 4.2). Genotype Total brood per animal Percent o F eggs reaching adulthood Number of adult progeny per animal N2 271 99.9 271 jrh-1 68 86.0 58 eTl/dpy-18; eTl/unc-46 180 47.1 85 eTl/eTl 194 96.9 188 jrh-1; eTl/dpy-18; eTl/imc-46 36 40.3 15 jrh-1: eTl/eTl 56 77.2 43 Table 4.2: Viabil i ty oï eTl/dpy-18; eTl/unc-46 and eTl/eTl with and without jrh-1 (tml866). The affect of the jrh-1 mutation on eTl translocation hétérozygotes was further examined using a competition assay, in which multiple lines of eTl/dpy-18; eTl/unc-46 and jrh-1; eTl/dpy-18; eTl/unc-46 animals were maintained by serially transferring a piece of agar containing multiple animals ("chunking out" the crowded plate) and observing the transfer at which no heterozygous animals could be observed on the plate. W i l d type heterozygous animals survived in all 20 lines of eTl/dpy-18; eTl/unc-46 throughout the experiment. However, in lines of jrh-1; eTl/dpy-18; eTl/unc-46 animals, wild type hétérozygotes were quickly out-competed by eTl [unc-36] and dpy-18; unc-46 homozygotes. W i l d type hétérozygotes were out-competed by homozygous animals in all 20 lines after 9 serial transfers oï jrh-1; eTl/dpy-18; eTl/unc-46 (Figure 4.12). - * jrh-1: eT1/dpy-18; eT1/unc-46 —m— eT1/dpy-18, eT1/unc-46 i — - 0 1 1 2 3 4 5 6 7 8 9 Number of Serial Transfers Figure 4.12: Competition assay of eTl/dpy-18; eTl/unc-46 and jrh-1; eTl/dpy-18; eTl/unc-46 animals. In order to test whether or not the affect of absence of JRH-1 on translocation hétérozygotes was general, and not specific to the eTl translocation, a second translocation was used. The strain jrh-1; nTI/+ (IV); nTl/dpy-11 (V) was constructed and compared to the control strain nTl/+; nTl/dpy-11 in a competition experiment similar to that carried out with eTl. Unlike eTl, homozygous nTl is lethal while dpy-11 is healthy, so it was not surprising that heterozygous animals were no longer present on 12 of 20 nTl/+; nTl/dpy-11 control plates after 8 serial transfers. Nevertheless, heterozygous animals were more quickly out-competed in lines of jrh-1; nTl/+; nTl/dpy-11 animals, similar to the observations for eTl translocation hétérozygotes in the absence of JRH-1 (Figure 4.13). 18 -j 16 -I 14 - 12 ^ o o in 0) c « 10 3 0 N S s. 1 8 i [ 6 - 4 2 n I- 16 - 3 « 10- c • jrh-1: nT1/+; nTVdpy-11 -*—nTi/+; nT1/dpy-11 0 2 3 4 5 6 7 8 Number of Serial Transfers Figure 4.13: Competition assay of nTI/+; nTl/dpy-U and jrh-l; nTl/+; nTl/dpy-11 animals. In translocation lieterozygotes, lack of meiotic crossing-over in the region of the translocation has been attributed to the lack of paired homologs. In the experiments described here, those individuals (translocation hétérozygotes) lacking a paired homolog to repair from had reduced viability relative to individuals with a homolog. Thus, it would appear that defects in jrh-1 mutant strains are made worse by the absence o f a homolog to repair from, implicating JRH-1 in repair processes that are alternatives to homologous recombination repair. The reduced brood size and fitness ofjrh-1; eTlfunc-36J/dpy-18; eTl [unc-36]/unc-46 and jrh-1; nTl/+; nTl/dpy-11 resulted from the absence of JRH-1 in regions lacking a homologous pairing partner. This result suggests that chromosomes that cannot repair by recombining with their homologous partner encounter problems in the absence of JRH-1 . 4.3.9 Meiotic recombination is increased in jrh-1 mutants Based on the synthetic lethality of jrh-1 with dog-1, JRH-1 might be required for repair at stalled replication forks. Evidence for jrh-I function during replication is based on its genetic interaction with dog-1 as well as its role in reducing the number of RAD-51 foci in the mitotic germline. The affect of JRH-1 on translocation hétérozygotes also argues for a role during meiotic double strand break repair that does not involve the homologous chromosome. One possibility is that JRH-1 controls the balance between repair processes by channeling repair intermediates away from the homologous recombination repair pathway into other repair pathways. I f this is the case, a prediction is that recombination would be increased in the absence o f JRH-1 . To test this hypothesis, meiotic recombination was measured in jrh-1 mutants between three sets of visible markers: dpy-11 and unc-42, dpy-18 and unc-25, and dpy-17 and unc-36. For the markers dpy-11 and unc-42, in the control strain, 114 recombinants were observed in 3135 total progeny. Thus, in a wild type background, the map distance was 3.71cM with a 95% confidence interval ranging from 3.05 to 4.44. In the jrh-1; dpy-11 unc-42/++ strain, 66 recombinants were observed in 723 total progeny. In the absence of JRH-1 , the map distance between dpy-11 and unc-42 was 9.59 with a 95% confidence interval of 7.37 to 12.25 (Table 4.3). Between dpy-18 and unc-25 in a wild-type background, 238 recombinants were observed in 3483 total progeny, giving a map distance of 7.08cM with a 95% confidence interval of 6.16 to 8.02. In the jrh-1 background, 100 recombinants were observed in 776 total progeny for the dpy-18 unc-25 interval, giving a map distance of 13.83cM between these two markers, with a 95% confidence interval of 10.93 to 16.95 (Table 4.3). In a third interval, between dpy-17 unc-36, 32 recombinants were observed in 3299 total progeny, resulting in a map distance of 0.97cM in a wild-type background, with 95% confidence interval of 0.65 to 1.35. In the jrh-1 mutant, 18 recombinants were observed in 459 total progeny, resulting in a map distance of 4.00cM with 95% confidence interval of 2.47 to 6.24 (Table 4.3). These data represent a significant increase in meiotic recombination frequency in all intervals tested in the absence of JRH-1 , suggesting that JRH-1 suppresses recombination. Genotype Total Progeny Recombinants Map Distance in cM (95% CI) dpy-11 unc-42/++ (V) jrh-1; dpy-11 ut7c-42/++ (V) 3135 723 114 66 3.71 (3.05-4.44) 9.59 (7.37-12.25) dpy-18 unc-25/++(UY) jrh-1; dpy-18 unc-25/++ (HI) 3483 776 238 100 7.08 (6.16-8.02) 13.83 (10.93-16.95) dpy-J 7 unc-3 6/++{111) jrh-1; dpy-17 unc-36/++ (III) 3299 459 32 18 0.97 (0.65-1.35) 4.00 (2.47-6.24) Table 4.3: Meiotic recombination frequency in the absence of JRH-1 . The number of wi ld types and DpyUncs (non-recombinants), Dpys and Unes (recombinants) were scored for three intervals, which included both gene cluster {dpy-11 unc-42 and dpy-17 unc-36) and chromosome arm regions {dpy-18 unc-25). 4.3.10 him-6/BLM and mus-81 functionally interact with jrh-1 A function for JRH-1 in preventing excessive recombination repair and thereby promoting alternative means for repair is reminiscent of the function the Srs2 helicase in yeast. Srs2 removes Rad51 from D N A filaments, thereby acting as an anti-recombinase (Krejci et al., 2003; Veaute et al, 2003). This would be important in situations where inhiating homologous recombination repair would be detrimental. In S. cerevisiae, toxic recombination intermediates are thought to be prevented by separate pathways involving Srs2, the RecQ helicase Sgs l , and Mus81 (Fabre et al, 2002). If JRH-1 functions similar to Svs2, jrh-1 should show a genetic interaction with the C. elegans homologs of Sgsl and Mus81, analogous to the yeast data. In C. elegans, the sgsl homolog is him-6/BLM {Wicky et al, 2004). The double mutant jrh-1; him-6 was constructed. While 48.5% of him-6 progeny and 86%) of jrh-1 progeny survived to adulthood, only 7.1%o of jrh-1; him-6 progeny survived to adulthood in the first generation (Table 4.4). Thus, the viability of these mutants was strongly reduced in the double mutant. Genotype Total Brood Percent Percent Percent Viable Percent Males Size Embryonic Larval Progeny (of viable Lethality Lethality progeny) jrh-1 (n=20) J 68± 12 3.0 ±0.9 9.9 ±2.6 86.0 ±9.0 0.2 ± 0.2 him-6 (n=20) 214± 14 49.7 ± 1.4 1.8 ±0.4 48.5 ± 1.6 12.1 ± 1.0 jrh-1; him-6 (n=20) 54± 11 72.1 ±2.5 20.8 ±2.5 7.1 ± 1.6 14.5 ±3.8 Table 4.4: Phenotypes of jrh-1, him-6 and jrh-1; him-6 animals, n represents the number of parent worms whose progeny were scored. A l l values are ± standard error of the mean. In order to further examine the jrh-1; him-6 phenotype, multiple lines of jrh-1; him-6 were maintained at 20°C and examined over time to determine the fitness of the strain compared to jrh-1 and him-6 single mutants. For him-6 animals, 12 out of 20 lines survived beyond 10 generations, whereas 6 o f 20 lines of jrh-1 animals survived beyond 10 generations, jrh-1; him-6 animals displayed much reduced fitness compared to either single mutant, as none of the 20 lines of the double mutants survived beyond 6 generations, indicating that jrh-1; him-6 is synthetic lethal (Figure 4.14). in 0) (1) him-6 0 2 4 6 8 10 G e n e r a t i o n Figure 4.14: Fitness of 20 lines of N2 , him-6 and jrh-1 single mutants, and jrh-1; him-6 double mutants maintained at 20°C for 10 generations. I l l To test whether or not jrh-1 had a genetic interaction with mus-81, the double mutant was constructed. The jrh-1 mus-81 double mutant was synthetic lethal, as jrh-1 mus-81 adult animals laid a small number of eggs, but none hatched (Table 4.5). Genotype Total Brood Percent Percent Viable Size Embryonic Lethality Progeny jrh-I (n=20) 68± 12 3.0 ±0.9 86.0 ±9.0 mus-81 (n=20) 153± 13 15.2±6.0 84.8 ±6.0 jrh-1 mus-81 (n=30) 22 ±7 100 0 Table 4.5: Phenotypes ofjrh-1 and mus-81 single mutants and jrh-1 mus-81 double mutants, n represents the number of parent worms whose progeny were scored. A l l values are ± standard error of the mean. In C. elegans, him-6 and mus-81 have a synthetic lethal phenotype (N. O ' N e i l , p. communication). Thus, as in yeast, these genes interact in C. elegans, supporting the proposal that these genes represent separate pathways. These data are consistent with a role for JRH-1 in C. elegans that is similar to that of Srs2 in yeast. 4.4 Discussion 4.4.1 Phenotypes oîjrh-1 mutant animais support a role in replication or repair The jrh-1 (tml866) strain observed under normal growth conditions has several phenotypes that are suggestive of defects in repair, jrh-1 mutants display a slow growth phenotype. However, unlike clk-2 mutants, which have slow development and elongated lifespan (Lakowski & Hekimi , 1996), they do not live longer than N 2 animals. The slow growth of jrh-1 mutants could be related to repair defects requiring additional developmental time. A protruding vulva phenotype, like that present in approximately 20% of jrh-1 mutants, has been attributed to vulval cell death in N 2 animals following D N A damage (Weidhaas et al., 2006). Elevated apoptosis in the jrh-1 germline, similar to dog-1 mutants, is consistent with defects in repair that activate the cep-l/p53 D N A damage checkpoint, triggering apoptosis. The dependence of the elevated apoptosis on the cep-l/p53 pathway was not tested due to the tight genetic linkage of jrh-1 and cep-1 on chromosome I; therefore, it is also possible that the elevated apoptosis is not D N A damage-induced, but might be physiological apoptosis. Further evidence for a role in repair comes from the results of the D N A damage sensitivity assays on jrh-1 mutants, jrh-1 mutants are not significantly sensitive to damage induced by X-rays, indicating that JRH-1 does not function in the homologous recombination repair or non-homologous end joining pathways, which are the major pathways for double strand break repair (reviewed in Wyman & Kanaar, 2006). S imi la r ly , j r^ - / mutants do not display significant hypersensitivity to the bulky adducts induced by UVC-irradiat ion (reviewed in Dip et al, 2004), indicating that jrh-1 does not play a role in nucleotide excision repair. However, yr/z-7 animals were moderately sensitive to cross-linking treatment by T M P + U V A , suggesting a possible role for JRH-1 in the cross-link repair pathway. Compared to dog-I mutants,yr/2-i animals were less sensitive to T M P + U V A . dog-I mutants were highly sensitive to cross-linking treatment at all o f the powers tested, whereas jrh-I mutants only showed significant sensitivity at higher doses, when the animals were treated with higher power U V A (i.e., more photons per second). These differences in sensitivity might reflect the different effects of low and high power U V A on the rate o f monoadduct (TMP-bound D N A ) versus cross-link ( D N A - D N A ) formation, and the activity of JRH-1 and DOG-1 on these repair substrates. During cross-linking treatment, T M P intercalates with the D N A . Upon U V A exposure, DNA-bound T M P monoadducts are formed when a photon is absorbed, whereas cross- links between two nearby monoadducts are formed when a second photon is absorbed (Johnston et al, 1981). Damage from T M P + U V A exposure is in the form of both T M P - D N A monoadducts and intra- and interstrand cross-links. The proportion o f cross-links to monoadducts should increase with higher U V A power, dog-1 mutant animals are extremely sensitive at all doses, possibly because DOG-1 is involved in the repair of both types of lesions. This would be consistent with the role of DOG-1 in the maintenance o f G/C-tracts. JRH-1 , on the other hand, appears to be involved preferentially in repair of cross-links because it shows moderate sensitivity only at higher power of cross-linking. A n alternative explanation for the different sensitivities of dog-1 and Jrh-1 is that the two gene products function in different parts of the cross-link repair pathway. DOG-1 might function early in cross-link repair, where it could be required at all cross-linked substrates. Conversely, JRH-1 might act late in the pathway, for example, in the restart the replication fork after the cross-link has been removed. There are several different ways that a replication fork can be restarted (reviewed in Branzei & Foiani, 2005); therefore, the pathway might branch at this point, causing the absence of JRH-1 to have only a minor effect on viability following cross-linking treatment. 4.4.2 JRH-1 is required for repair in the absence of DOG-1 The synthetic lethaUty between jrh-1 and dog-1 also supports a role for JRH-1 in repair. jrh-1 dog-1 double mutants are completely sterile and have enlarged mitotic nuclei and an overall reduction in the number of nuclei in the mitotic zone. This germline mitotic catastrophe is evidence of the activated S-phase replication checkpoint, similar to what is observed in hydroxyurea treated N 2 animals (Ahmed et al, 2001). In the absence of both helicase-like proteins, the progression of the germline nuclei is arrested. Therefore, JRH-1 is clearly required in the absence of D O G - 1 . DOG-1 maintains G/C-tracts, which delete in its absence (Cheung et al, 2002). Examination of the vab-1 G/C-tract in jrh-1 animals revealed no deletions. In addition, the frequency of jrh-1 dog-1 mutants with deletions was not significantly different from the dog-1 frequency, indicating that jrh-1 does not have a redundant role with dog-1 at G / C - tracts. The finding that JRH-1 is required in the absence of D O G - 1 , but that the two proteins do not have redundant functions suggests that JRH-1 functions in repair at stalled replication forks. When jrh-1 dog-1 animals were examined for signs of D N A damage, excessive RAD-51 foci were observed. One possibility is that the RAD-51 foci are the result of inefficient completion of homologous recombination repair in the absence of JRH-1 . However, the data do not support a role for JRH-1 in homologous recombination repair because in jrh-1 dog-1 double mutants there is no change in the frequency of animals with G/C-tract deletions compared to dog-I single mutants. This result differs from the increase in deletions observed when components of homologous recombination repair are absent in the dog-1 background (Youds et al, 2006; Chapter 2 of this thesis). In addition,yr/z-7 mutants are not sensitive to D N A double strand breaks from X-ray treatment, indicating that the homologous recombination repair and non-homologous end-joining pathways are functional in jrh-1 mutants. Nevertheless, that the RAD-51 foci appear on arrested mitotic nuclei in jrh-1 dog-1 animals would be consistent with a role for JRH-1 in resolving or removing RAD-51 from repair intermediates. The unresolved foci lead to activation of the replication checkpoint; this is an indication that severe D N A damage must be present in jrh-1 dog-1 animals. 4.4.3 Absence of JRH-1 specifically affects eTl and nil translocation hétérozygotes The translocations eTl and nTl were used to block homologous recombination repair o f meiotic double strand breaks in the translocated regions in a jrh-1 mutant background. During meiosis C. elegans, chromosomes pair and synapse with their homologs, and double strand breaks are created along the chromosomes by the SPO-11 protein in late zygotene to early pachytene (Dernburg et al, 1998). One of these double strand breaks becomes a substrate for meiotic crossover (exchange of flanking markers between homologs) during pachytene. Other breaks are repaired through gene conversion (no exchange o f flanking markers). In the case of the heterozygous reciprocal translocation eTl, the translocated portions of chromosomes III and V are not paired with their homologs. In C. elegans, homolog recognition regions determine the chromosome pairing partners ( M c K i m et al, 1988). Therefore, in eTl translocation hétérozygotes, chromosome V with the translocated right arm of chromosome III is paired with chromosome V , while chromosome III with the translocated left arm o f chromosome V is paired with chromosome III (Rosenbluth & Bail l ie , 1981). In the translocated regions of chromosomes III and V , meiotic recombination does not occur because of the lack of a homolog. A recent report by Smolikov et al. (2007) indicates that when homologous recombination (inter- homolog) repair is impaired, sister chromatid-directed repair contributes to the repair of meiotic double strand breaks. Normally, the synaptonemal complex between sister chromatids acts as a barrier to prevent meiotic double strand break repair between sister chromatids, promoting repair between homologs (Schwacha & Kleckner, 1997; Wan et al, 2004; Webber et al, 2004; N i u et al, 2005). However, sister chromatid-directed repair can occur once the synaptonemal complex breaks down between sister chromatids in late pachytene. A l p i et al (2003) have shown that in animals heterozygous for the eTl translocation, RAD-51 foci persist into late pachytene in the non-homologously paired regions chromosomes III and V . Thus, repair of meiotic double strand breaks on the translocated chromosomes in eTl hétérozygotes likely occurs by sister chromatid- directed repair after the dissolution of the synaptonemal complex between sister chromatids. Translocation hétérozygote animals lacking JRH-1 had reduced broods and fitness compared to translocation homozygotes in the jrh-1 background. The phenotype of jrh-1; eTl/dpy-18; eTl/unc-46 animals could be explained by defects in sister chromatid-directed repair in the absence of J R H - 1 . Under this hypothesis, in jrh-1; eTl/dpy-18; eTl/unc-46 animals, any meiotic double strand breaks in the translocated region would not be able to complete sister chromatid-directed repair because JRH-1 is absent. The lack of repair would result in meiotic double strand breaks that persist and lead to fragmented chromosomes later in diakinesis, and ultimately lethality. Ant i -RAD-51 staining done on jrh-1; eTl/dpy-18; eTl/unc- 46 animals by collaborators in the Boulton lab showed that R A D - 5 1 staining persists beyond late pachytene, even longer than the RAD-51 foci observed in eTl hétérozygotes. Fragmented chromosomes are also present at diakinesis in the translocation hétérozygotes in the absence of JRH-1 (J. Ward & S. Boulton, p. communication). These observations suggest that sister chromatid-directed repair is compromised in the absence of JRH-1 . Figure 4.15 summarizes a model for how the absence of JRH-1 affects viability oïeTl translocation hétérozygotes. A Wild type C. elegans germline Mitosis Leptotene Zygotene Pachytene Dip lotene Diakinesis Oogenesis - O O O O O O O O Q Q Q O O O O U 0 0 O o o o o o ° o / o > ^ © © ® o n o ^ o o o/p meiolic nSR meiotic crossing formation or repair by gene wild type eT1/+ jrh-1 jrh-1: eT1/+ Zygotene Pachytene (early) Pachytene " ~ y " (late) —r\- Diplotene Diakinesis D C Legend homologous — — chromosomes MM Sister chromatids synaptonemal complex ^ meiotic double strand break -^m^ eT1 translocated chromosome X meiotic crossover event ^ sister chromatid exchange gene conversion event Figure 4.15: Model for the affect of JRH-I absence on eTl hétérozygotes. A) Schematic of the wild type C. elegans germline. Nuclei in the mitotic zone undergo mitosis, serving as the stem cell compartment for the germline. Nuclei progress through the transition zone, where the characteristic crescent shaped D N A is visible within nuclei, and begin the early stages of meiosis. SPO-11-induced double strand breaks occur in late zygotene/early pachytene (indicated by red dots) and are resolved by meiotic crossing-over or through gene conversion. In diakinesis, six bivalents can be observed in each nucleus. B) Schematic of activity during meiosis. In wild type animals, homologous chromosomes pair and synapse. SPO-11-induced double strand breaks are formed along the chromosomes. One break per chromosome is resolved by crossing-over between homologs. Other breaks are repaired by gene conversion between homologs. In the case of a heterozygous eTl translocated chromosome, breaks that occur within the translocated region cannot be repaired through gene conversion or homologous crossover due to lack of homology. Instead, these breaks must be repaired through a repair mechanism using the sister chromatid. This must occur after dissolution of the synaptonemal complex (SC), as the SC prevents sister chromatid exchange. In jrh-l mutants with the heterozygous eTl translocation, homologous recombination repair is not possible in the translocated region, and the sister chromatid must be used as a template for repair. Defects in sister chromatid repair due to the absence of JRH-1 lead to fragmented chromosomes after the breakdown of the SC in jrh-1; eTl/+ animals. If JRH-1 functions in sister chromatid-directed repair, it could do so by two possible roles. JRH-1 could act directly in the repair process, or it could function to promote sister chromatid-directed repair. Repair from the sister chromatid occurs frequently during replication, thus it is unlikely that any mutant lacking the ability to repair damage using the sister chromatid would be viable. A more plausible flinction for JRH-1 is that it regulates the balance between different types of repair. JRH-1 might channel repair intermediates away from homologous recombination repair, thereby promoting sister chromatid-directed repair. If this were the case, in the absence of J R H - 1 , homologous recombination repair might occur inappropriately and/or excessively. Indeed, meiotic recombination was significantly increased in all three visible marker intervals tested in jrh-1 mutants compared to wild-type controls, supporting the idea that JRH-1 functions in the prevention of excessive recombination repair. Importantly, increases in meiotic recombination were observed for both gene cluster and chromosome arm regions, suggesting a global increase in recombination in the absence of JRH-1 rather than an alteration in the distribution of meiotic crossovers. Inappropriate homologous recombination can cause chromosomal aberrations (Chaganti et al, 1974; Whoriskey et al, 1991; Wu & Hickson, 2001; W u , 2007), and is thus problematic. In dog-1 mutants, for example, unresolved secondary structures caused by G/C-tracts could put a heavy demand on repair mechanisms. In the presence o f JRH-1 , many repair intermediates could be directed away from homologous recombination repair into other repair pathways. In the absence of JRH-1 , a greater number of recombination repair events may be initiated, resulting in excessive RAD-51 foci and ultimately, mitotic catastrophe in jrh-1 dog-1 mutants. The channeling of repair intermediates into certain pathways would be important to ensure efficient replication, and loss o f this function may explain the slow growth and protruding vulvae defects observed in jrh-1 mutants. 4.4.4 JRH-1 might have a function similar to the yeast helicase Srs2 Fabre et al. (2002) have shown that in S. cerevisiae, toxic homologous recombination repair intermediates are prevented by separate pathways involving Srs2, Mus81 and the RecQ helicase Sgs l . Srs2 is thought to do this by removing R A D 5 1 from recombination repair intermediates, thereby dissociating the D-loop, and promoting non-recombinogenic types of repair, such as synthesis-dependent strand annealing ( S D S A ; Robert et al, 2006; reviewed in Macris & Sung, 2005). M u s B l has multiple possible functions; M u s S l might be able to cleave double Holliday junctions, resulting in a non-recombinational outcome of repair following replication (Osman & Whitby, 2007). In addition, M u s S l might be involved in synthesis- dependent strand annealing (SDSA) , where it could prevent the D N A end from reinvading the donor duplex thereby avoiding the formation of a recombination repair intermediate (Robert et al, 2006). S g s l / B L M processes recombination repair intermediates through double Holliday junction dissolution, which leads to non-crossover outcomes, and is also able to dissociate D - loop recombination repair intermediates, thereby providing additional means for non- recombinational outcome o f repair of a stalled fork (Bennett et al, 1999; Karow et al, 2000; W u & Hickson, 2003; Liberi et al, 2005; Bartos et al, 2006). Thus, it appears that all three of these genes have a role in preventing recombinational outcomes of repair, each by a different mechanism (Refer to Figure 1.2). Analysis o f double mutants in S. cerevisiae has been used to separate the functions of Srs2, M u s S l and S g s l . Knock-out of sgsl and srs2 causes a slow growth phenotype that is suppressed by disrupting homologous recombination through mutation of rad51 (Fabre et al, 2002; Schmidt & Kolodner, 2006). Similarily, mutation of mus81 and sgsl causes a synthetic lethal phenotype, while mus81 srs2 double mutants display mild growth defects (Mullen et al, 2001; Fabre et al, 2002). Based on this data, sgsl and srs2 represent separate pathways, as do mus81 and sgsl. The relationship between srs2 and musSl is less clear, as these genes might be part of the same pathway but also might function independently in S. cerevisiae (Fabre et al, 2002). In C. elegans, the genetic interactions shown here between mus81, him-6 and jrh-1 support the idea of an srs2-like role for jrh-1. Similar to sgsl and mus81 in yeast, him-6 and mus-81 have a synthetic lethal phenotype in C. elegans (N. O ' N e i l , p. communication), indicating that him-6 and mus-81 function in parallel pathways. Mutation of jrh-I causes a synthetic lethal phenotype with him-6, reminiscent of yeast srs2 sgsl double mutants. In addition, jr/z-7 was synthetic lethal with mus-81. The interaction between srs2 and mus81 in S. cerevisiae is lesser than that observed between jrh-1 and mus-81 in C. elegans, but this may be due to the differences between single-celled and multicellular organisms. Based on the genetic data alone, it is not clear whether JRH-1 functions to prevent homologous recombination repair by the same means as Srs2. However, the genetic interactions of jrh-1 in C. elegans are similar to those of srs2 in yeast. In future, molecular experiments should be carried out to confirm the genetic findings for jrh-1 reported here. Biochemical studies should test whether or not JRH-1 is able to dissociate RAD-51 protein from D N A filaments, as Srs2 does (Krejci et al, 2003; Veaute et al, 2003). Helicase assays that test the activity of JRH-1 on different substrates, such as recombination intermediates, forked duplexes and D N A secondary structures would be informative. In addition, interspecies rescue experiments would provide definitive evidence that JRH-1 functions in tlie same manner as Srs2. In tliese experiments,7>/z-i could be introduced into yeast srs2 mutants to try to rescue the sickness of the strain, as well as the synthetic lethality of srs2 sgsl double mutants. Similar experiments could be done with human NHL cells or with mouse RTEL, in which srs2 replaces these genes in order to test whether the human and mouse jrh-1 homologs have functional similarity to srs2. 4.4.5 A role for JRH-1 at telomeres? Findings from the mouse suggest that R T E L functions at telomeres, where it is proposed to unwind G-rich telomere repeat structures, thereby helping to maintain telomere length (Ding et al, 2004). R T E L is thought to function in a similar manner in maintaining genome stability at G-rich D N A sites throughout the genome (Ding et al, 2004). The telomeres of jrh-1 animals were not specifically examined as part of this study. C. elegans telomere maintenance mutants such as mrt-2 have a mortal germline (Mrt) phenotype that is characterized by the inability to maintain the strain beyond several generations, presumably due to progressive telomere shortening (Ahmed & Hodgkin, 2000). jrh-1 mutants do show a Mrt phenotype when individual lines are propagated by transferring single individuals (Figure 4.12), though the strain can be maintained indefinitely by transferring multiple animals. The chromosome fusion events that occur in mrt-2 mutant animals (Ahmed & Hodgkin, 2000) were not observed in jrh-1 mutants. However, it is easy to see how regulating or preventing homologous recombination between telomeres could be an important function for JRH-1 . If too much homologous recombination occurred between telomeres, this would lead to gains at some telomeres, and losses at others, which could be problemafic. Thus, the role for JRH-1 in genome stability could be relevant to telomeres, as well as replication forks and other repair intermediates. The role for JRH-1 at other sites throughout the genome, such as stalled replication forks, might overshadow a more minor role at telomeres in C. elegans. Future experiments could examine jrh-1 for telomere defects, and any aberrations might be more obviously detectable in a cep-l/p53 background because the absence of the D N A damage checkpoint would exaggerate any telomere maintenance defects. The experiments described in this chapter characterize the function of the dog-l/FANCJ- related gene jrh-1. The excessive RAD-51 foci in jrh-1 dog-1 animals along with the affect of the jrh-1 mutation on translocation hétérozygotes, increased meiotic recombination, and the genetic interactions between jrh-1 and dog-1, him-6 and mus-81 support a possible role for J R H - 1 in channeling repair intermediates away from homologous recombinational repair. This activity would be particularly important following replication fork stalling, such as that at G / C - tract secondary structures in the dog-1 mutant, or following removal o f a lesion that has stalled a replication fork, such as an interstrand cross-link. Chapter 4 References Ahmed S, A l p i A , Hengartner M O , & Gartner A (2001) C. elegans R A D - 5 / C L K - 2 defines a new D N A damage checkpoint protein. Curr Biol 11: 1934-1944 A l p i A , Pasierbek P, Gartner A , & Loid l J (2003) Genetic and cytological characterization of the recombination protein R A D - 5 1 in Caenorhabditis elegans. Chromosoma 112: 6-16 Bartos JD, Wang W, Pike JE , & Bambara R A (2006) Mechanisms by which Bloom protein can disrupt recombination intermediates of Okazaki fragment maturation. J Biol Chem 281: 32227- 32239 Bennett RJ , Keck J L , & Wang JC (1999) Binding specificity determines polarity of D N A unwinding by the Sgsl protein of S. cerevisiae. J Mol Biol 289: 235-248 Branzei D & Foiani M (2005) The D N A damage response during D N A replication. Curr Opin Cell Biol 17: 568-575 Chaganti R S , Schonberg S, & German J (1974) A manyfold increase in sister chromatid exchanges in Bloom's syndrome lymphocytes. Proc Natl Acad Sci US All: 4508-4512 Cheung I, Schertzer M , Rose A , & Lansdorp P M (2002) Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich D N A . Nat Genet 31: 405-409 Crow & Gardner (1959) Confidence intervals for the expectation of a Poisson variable. Biometrika 46: 441-7. Dernburg A , McDonald K , Moulder G , Barstead R, Dresser M , Villeneuve A (1998) Meiotic recombination in C. elegans initiates by a conserved mechanism and is dispensible for homologous chromosome synapsis. Cell 94(3): 387-398. Ding H , Schertzer M , W u X , Gertsenstein M , Selig S, Kammori M , Pourvali R, Poon S, Vulto I, Chavez E , Tam PP, Nagy A , & Lansdorp P M (2004) Regulation of murine telomere length by Rtel: an essential gene encoding a helicase-like protein. Cell 117: 873-886 Dip R, Camenisch U , & Naegeli H (2004) Mechanisms of D N A damage recognition and strand discrimination in human nucleotide excision repair. DNA Repair (Amst) 3: 1409-1423 Doe C L , A h n JS, Dixon J, & Whitby M C (2002) M u s S l - E m e l and R q h l involvement in processing stalled and collapsed replication forks. J Biol Chem 211: 32753-32759 Edgley M L , Bai l l ie D L , Riddle D L & Rose A M (1995) Genetic balancers. Caenorhabditis elegans, modern biological analysis of an organism. Academic press, San Diego, 147-184. Fabre F, Chan A , Heyer W D , & Gangloff S (2002) Ahemate pathways involving Sgsl/Top3, M u s S l / Mms4, and Srs2 prevent formation of toxic recombination intermediates from single- stranded gaps created by D N A replication. Proc Natl Acad Sci U S A 99: 16887-16892 Gerring S L , Spencer F, & Hieter P (1990) The C H L 1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G 2 / M . EMBO J 9: 4347-4358 Gilchrist EJ , O'Nei l N J , Rose A M , Zetka M C , & Haughn G W (2006) T I L L I N G is an effective reverse genetics technique for Caenorhabditis elegans. BMC Genomics 7: 262 Johnston B H , Kung A H , Moore C B , & Hearst JE (1981) Kinetics of formation of deoxyribonucleic acid cross-links by 4'-(aminomethyl)-4,5',8-trimethylpsoralen. Biochemistry 20:735-738 Karow J K , Constantinou A , L i JL , West SC, & Hickson ID (2000) The Bloom's syndrome gene product promotes branch migration of Holliday junctions. Proc Nad Acad Sci USA 91: 6504- 6508 Krejci L , Van Komen S, L i Y , Vi l lemain J, Reddy M S , K le in H , Ellenberger T, & Sung P (2003) D N A helicase Srs2 disrupts the Rad51 presynaptic filament. Nature 423: 305-309 Laha S, Das SP, Hajra S, Sau S, Sinha P (2006) The budding yeast protein C h l l p is required to preserve genome integrity upon D N A damage in S-phase. Nucleic Acids Res 34(20): 5880-5891 Lakowski B & Hekimi S (1996) Determination of life-span in Caenorhabditis elegans by four clock genes. Science 272: 1010-1013 Liberi G , Maffioletti G , Lucca C , Chiolo I, Baryshnikova A , Cotta-Ramusino C, Lopes M , Pellicioli A , Haber JE, & Foiani M (2005) Rad51-dependent D N A structures accumulate at damaged replication forks in sgsl mutants defective in the yeast ortholog of B L M RecQ helicase. Genes Dev 19: 339-350 Macris M A & Sung P (2005) Multifaceted role of the Saccharomyces cerevisiae Srs2 helicase in homologous recombination regulation. Biochem Soc Trans 33: 1447-1450 M c K i m K S , Howel l A M , Rose A M (1988) The effects of translocations on recombination frequency in Caenorhabditis elegans. Genetics 120(4): 987-1001. Mullen JR, Kaliraman V , Ibrahim SS, & B r i l l SJ (2001) Requirement for three novel protein complexes in the absence o f the Sgsl D N A helicase in Ssccharomyces cerevisiae. Genetics 157: 103-118 N i u H , Wan L , Baumgartner B , Schaefer D , Lo id l J, HoUingsworth N M (2005) Partner choice during meiosis is regulated by Hopl-promoted dimerization of M e k l . Mol Biol Cell 16(12): 5804-18. Osman F & Whitby M C (2007) Exploring the roles of Mus81-Emel /Mms4 at perturbed replication forks. DNA Repair (Amst) Rinaldo C, Bazzicalupo P, Ederle S, Hill iard M , & L a Volpe A (2002) Roles for Caenorhabditis elegans rad-51 in meiosis and in resistance to ionizing radiation during development. Genetics 160:471-479 Rinaldo C, Ederle S, Rocco V , & L a Volpe A (1998) The Caenorhabditis elegans RAD51 homolog is transcribed into two alternative m R N A s potentially encoding proteins of different sizes. Mol Gen Genet 260: 289-294 Robert T, Dervins D , Fabre F, & Gangloff S (2006) M r c l and Srs2 are major actors in the regulation of spontaneous crossover. EMBO J 25: 2837-2846 Rosenbluth R E & Bail l ie D L (1981) The genetic analysis of a reciprocal translocation, eTlÇlll; V ) , in Caenorhabditis elegans. Genetics 99: 415-428 Schmidt K H & Kolodner R D (2006) Suppression of spontaneous genome rearrangements in yeast D N A helicase mutants. Proc Nad Acad Sci iyS'y^ 103: 18196-18201 Schwacha A & Kleckner N (1997) Interhomolog bias during meiotic recombination: meiotic function promote a highly differentiated interhomolog-only pathway. Cell 90: 1123-1135. Skibbens R V (2004) C h l l p , a D N A helicase-like protein in budding yeast, functions in sister- chromatid cohesion. Genetics 166: 33-42 Smolikov S, Eizinger A , Hurlburt A , Rogers E , Villeneuve A M , & Colaiacovo M P (2007) Synapsis-defective mutants reveal a correlation between chromosome conformation and the mode of double-strand break repair during C. elegans meiosis. Genetics Spencer F, Gerring S L , Connelly C, & Hieter P (1990) Mitotic chromosome transmission fidelity mutants in Saccharomyces cerevisiae. Genetics 124: 237-249 Veaute X , Jeusset J, Soustelle C , Kowalczykowski SC, Le Cam E , & Fabre F (2003) The Srs2 helicase prevents recombination by disrupting Rad51 nucleoprotein filaments. Nature 423: 309- 312 Wan L , de los Santos T, Zhang C, Shokat K , HoUingsworth N M (2004) M e k l kinase activity functions downstream of R E D 1 in the regulation of meiotic double strand break repair in budding yeast. Mol Biol Cell 15: 11-23 Webber H A , Howard L , Bicke l SE (2004) The cohesion protein O R D is required for homolog bias during meiotic recombination. JCell Biol 164: 819-829 Weidhaas JB, Eisenmann D M , Holub J M , & Nallur S V (2006) A Caenorhabditis elegans tissue model of radiation-induced reproductive cell death. Proc Nad Acad Sci USA 103: 9946-9951 Whoriskey S K , Schofield M A , & Mi l le r J H (1991) Isolation and characterization of Escherichia coli mutants with altered rates of deletion formation. Genetics 127: 21-30 Wormbase website: www.wormbase.org. Release WS178, August 2007 W u L (2007) Role of the B L M helicase in replication fork management. DNA Repair (Amst) W u L & Hickson ID (2003) The Bloom's syndrome helicase suppresses crossing over during homologous recombination. Nature 426: 870-874 W u L & Hickson ID (2001) RecQ helicases and topoisomerases: components of a conserved complex for the regulation of genetic recombination. Cell Mol Life Sci 58: 894-901 Wyman C & Kanaar R (2006) D N A double-strand break repair: all's well that ends wel l . Annu Rev Genet 40: 363-383 Youds JL , O'Neil N J , & Rose A M (2006) Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173: 697-708 CHAPTER 5: General Discussion 5.1 C. elegans as a model to study interstrand cross-link repair dog-1 has a conserved function with human BRIPl/FANCJ. In humans, the F A pathway includes at least 13 proteins: F A N C A , B , C, D 1 / B R C A 2 , D2 , E , F , G , I, J / B R I P l , L , M and N / P A L B 2 (Taniguchi & D'Andrea, 2006; Reid et al, 2007). Only 5 of these proteins, F A N C D 1 / B R C A 2 , F A N C D 2 , F A N C J / B R I P l , F A N C L and F A N C M , have known homologs in C. elegans (Dequen et al, 2005; Coll is et al, 2006; Patel & Joenje, 2007). The other F A proteins might exist in C. elegans, but might not have been identified due to lack of sequence conservation. Alternatively, the F A proteins currently identified in C. elegans might represent the minimum set of proteins that make up the F A pathway in lower organisms. Therefore, C. elegans might represent a simplified model for the F A interstrand cross-link repair pathway. In humans, F A N C M becomes hyperphosphorylated after D N A damage, and is involved in the early steps of F A core complex assembly, while components of the core complex including F A N C L function in the ubiquitylation of F A N C D 2 (Meetei et al, 2005; Levitus etal, 2006). In C. elegans, the F A N C M homolog might function in the initial response to the stalled replication fork, while the F A N C L homolog could be responsible for the monoubiquitylation of F C D - 2 / F A N C D 2 . Because the downstream components of the F A pathway are not well understood, study of DOG-1 and its function relative to the other C. elegans F A proteins could be an important means to dissect this pathway. In particular, identification of the substrates on which DOG-1 functions and examination of possible interactions between DOG-1 and B R C - 2 / B R C A 2 w i l l be informative in understanding the response to interstrand cross-links downstream of F C D - 2 / F A N C D 2 . Current knowledge o f DOG-1 in C. elegans might apply to human B R I P l / F A N C J , which has not yet been extensively studied. Data described in this thesis indicate that the homologous recombination repair and translesion synthesis proteins are crucial in preventing deletions at G/C-tracts in the absence of D O G - 1 . Though it is not clear whether G/C-tract secondary structures and interstrand cross-links represent a common substrate, it is possible that homologous recombination repair and translesion synthesis w i l l be important for maintaining genome stability in the absence of B R I P l / F A N C J . Furthermore, BRIPl/FANCJ might show conserved genetic interactions with BLM, MUS81 and NHL in humans, just as dog-1 has been shown to functionally interact with him-6/BLM, mus-81 and jrh-I/NHL in C elegans. 5.2 A potential role for human B R I P l / F A N C J at G-rich DNA There a multiple sites of G-rich D N A in the human genome, including at the telomeres, ribosomal D N A , certain microsatellites, and the immunoglobulin heavy chain switch regions (Maizels, 2006). Algorithms that search for G-rich sequences that could potentially form secondary structures, such as G-quadruplex, have identified more than 300,000 sites in the human genome (Huppert & Balasubramanian, 2005). These sites have the potential to form secondary structures whenever the D N A is single stranded, as it is during replication and transcription. Therefore, it seems reasonable that there might be a protein that unwinds these types of structures in humans, as DOG-1 has been proposed to do in C. elegans. Based on the sequence and other functional similarity between DOG-1 and B R I P l / F A N C J , it is possible that B R I P l / F A N C J might carry out this function in humans. If B R I P l / F A N C J acts both in cross-link repair and in maintaining G-rich D N A by unwinding secondary structures in these sequences, what are the implications for Fanconi anemia? A real possibility is that the formation of endogenous secondary structures is a source of genome instability in F A patients. Generally, exogenous agents are required for D N A cross-link formation, and although cross-links are a very toxic type of damage, D N A cross-linking is likely a rare event. However, endogenously forming D N A secondary structures could form very frequently, during any time when the D N A is single stranded. If the protein that normally manages these structures is absent, there would be great potential for genome instability at G-rich D N A sites throughout the genome. F A patients show evidence of genome instability including chromatid breaks, large deletions and chromosomal rearrangements (Hintz et al, 2006; Levitus et al, 2006). The genome instability in F A patients might be a result of problematic D N A secondary structures that lead to deletions, rearrangements and other chromosomal aberrations i f the lesions are repaired through erroneous means. This hypothesis is currently being tested by several groups in the D N A repair community who are sequencing G-rich D N A sites in F A group J patients. It wi l l be interesting to see whether or not the roles for DOG-1 in C. elegans can lead to greater understanding of F A in humans. 5.3 The DOG-l/FANCJ-related heUcase, JRH-1, functions in DNA repair Examination o f a helicase-like protein closely related to dog-1 showed that jrh-1 also has a function in D N A repair, but that it differs from the function oï dog-1. jrh-1 mutants and dog-1 mutants have different sensitivities to the interstrand cross-linking treatment trimethylpsoralen with U V A ; dog-1 animals are extremely hypersensitive, while jrh-1 animals are moderately sensitive. JRH-1 and DOG-1 do not have redundant roles at G/C-tracts. However, j r /z - i dog-1 double mutant animals displayed a synthetic lethal phenotype that appeared to be the result of excessive homologous recombination repair intermediates. Based on the affect of the jrh-1 mutation on translocation hétérozygote animals, along with other data, the favored hypothesis is that JRH-1 might be required to channel repair intermediates away from the homologous recombination repair pathway and into other repair pathways, such as sister chromatid-directed repair. Preventing excessive homologous recombination repair is a function analogous to the role of Srs2 in yeast. Similar to yeast srs2 mutants, jrh-1 was shown to have a synthetic lethal phenotype with him-6/BLM and mus-81, supporting the hypothesis that JRH-1 might have a function similar to Srs2. In vitro protein work wi l l be required to determine whether or not J R H - 1 has the same properties as Srs2 and is able to displace R A D - 5 1 from single stranded D N A . If JRH-1 were the functional homolog of Srs2, this would be exciting because no Srs2-like gene has been identified in higher organisms to date. Nonetheless, Srs2 plays such an important role in removing R A D 5 1 from invading D N A filaments that it could be expected that a protein or proteins with a similar function would exist in organisms other than yeast. In mice, the protein most similar to JRH-1 , Rtel, is proposed to function at telomeres (Ding et ai, 2004). Based on the data presented here for C. elegans, as well as the study of Rtel in mouse, it is likely that human homolog, N H L , could have a function in maintaining genome stability at sites such as stalled replication forks and telomeres, where it might function in preventing excessive or inappropriate homologous recombination repair thereby promoting other repair mechanisms. A s DOG-1 appears to be the C. elegans B R I P l / F A N C J homolog, the genetic interaction between dog-1 and jrh-1 in C. elegans might also be conserved in humans, between BRIPl/FANCJ and NHL. I f conserved, this interaction is potentially relevant to Fanconi anemia patients. N H L might perform a function that is essential in the absence of B R I P l / F A N C J . If this is the case, targeted knock-out of NHL function in cancer cells in Fanconi group J patients might prove to be a useful therapeutic means to destroy tumor cells. 5.4 An extended model for repair at G/C-tracts in the dog-J mutant In Youds et al. (2006) and in Chapter 2 of this thesis, a model was proposed in which replication forks stalled at G/C-tract secondary structures could be repaired through deletion-free mechanisms such as translesion synthesis, homologous recombination repair or through H I M - 6 functioning independently of R A D - 5 1 , or by an unknown deletion-prone mechanism. The new data described in the remainder of this thesis present an opportunity to add to this model, now including JRH-1 , MUS-81 and HIM-6 in a separate branch of the model. Mutations in genes involved in homologous recombination repair in the dog-1 background lead to an increase in the frequency of animals with deletions, but do not affect viability of the animals (Youds et al, 2006). On the other hand, mutations in any ofjrh-1, mus- 81 or him-6 in the dog-1 background lead to synthetic lethal (Jrh-l dog-1) or synthetic sick phenotypes {mus-81 dog-1 and dog-1; him-6 [mus-81 dog-1 shovm by N . O ' N e i l , p. communication; Youds et al, 2006]). dog-1; him-6 animals had increased G/C-tract deletions, while jrh-1 dog-1 and mus-81 dog-1 double mutants had a similar number of deletions to the 11% observed in dog-1 single mutant animals (for mus-81 dog-1 13.7% of animals had deletions, n=255). Thus, it appears that the frequency of small G/C-tract deletion formation does not correlate with viability of any of the double mutants tested in this thesis. Based on the decreased viability in the absence of jrh-1, mus-81 or him-6, it is possible that these genes represent the preferred means for stalled replication fork repair in dog-1 mutants. If JRH-1 functions similar to Srs2 in yeast, JRH-1 might be involved in regulating the balance between homologous recombination and other types of repair, jrh-1 dog-1 double mutants display mitotic catastrophe in the germline and this could be due to the inability to shunt some repair intermediates away from homologous recombination repair into other pathways in the absence o f JRH-1 . Both MUS-81 and H I M - 6 / B L M are implicated in resolving repair intermediates; therefore, the synthetic sick phenotypes of mus-81 dog-1 and dog-1; him-6 might be because repair of stalled forks can still occur but is less efficient in the absence of either MUS-81 or H I M - 6 / B L M . Both mus-81 and him-6 are proposed to have multiple roles; therefore, while MUS-81 and H I M - 6 might function in separate pathways for RAD-51 independent repair, these proteins likely also have additional functions in replication and repair. In accordance with this idea, dog-1; him-6 double mutants show increased numbers of animals with deletions as well as reduced viability possibly because him-6 can function both downstream of RAD-51 as well as independently. Additional biochemical and genetic experiments w i l l be required to dissect the complex interaction between these repair proteins. In the absence of other error-free repair mechanisms involving MUS-81 or HIM-6 , most G/C-tract stalled forks would be repaired through homologous recombination repair, which does not generate small deletions, but likely leads to reduced viability because of excessive crossing- over that could cause larger genomic aberrations. The deletion-prone pathway is always active at low levels in dog-1 mutants. The activity of the deletion-prone pathway increases when homologous recombination repair substrates are not formed, leading to an increased frequency of animals with deletions. A s none of the genes tested in combination with dog-1 led to a decrease in animals with deletions, it is possible that the deletions are generated when no repair is initiated, and a gap occurs in the lagging strand at the site corresponding to the G/C-tract secondary structure. Figure 5.1 describes this model, highlighting the multiple repair mechanisms that can fonction at a stalled replication fork to maintain genome stability. G-r ich D N A secondary structure forms during replication / \ no D O G - 1 p resen t : a l ternat ive repai r of s ta l led fork requ i red structure reso lved ^ by D O G - 1 deletion-prone repair t rans- les ion recombinational f sister chromatid-directed (mechanism unknown) synthes is repair (RAD-51) repair / \ J \ HIM-9 HIM-6 M U S - 8 1 HIM-6 recombinationai non-rocombinationai outcome outcome Figure 5.1 A n extended model for repair of replication forks stalled at G/C-tract secondary structures. Normally, D O G - 1 would be present to unwind the G/C-tract secondary structure, but in its absence, the secondary structure persists, causing replication fork stalling. The stalled fork can be repaired through various deletion-free means. Sister chromatid-directed repair would be the preferred mechanism, and JRH-1 might function to promote this pathway, while MUS-81 and H I M - 6 resolve the repair intermediates in this pathway. The stalled fork could also be repaired during replication through translesion synthesis by either po\r\ or polK, or through homologous recombination repair, involving B R D - 1 , R A D - 5 1 , H I M - 9 or HIM-6 . Altematively, the deletion-prone repair pathway might act through an unknovm mechanism that results in a deletion at the site of the secondary structure. 5.5 Future studies on DOG-1 and the DOG-1 heUcase-iike proteins There are several potential avenues for investigation that branch from the work completed in this thesis. A s dog-] can now be used as a model to study the interstrand cross-link repair pathway, one way to identify new players in the cross-link repair pathway might be to carry out a large scale yeast two-hybrid screen to look for proteins that interact with DOG-1 or other components of cross-link repair, such as F C D - 2 / F A N C D 2 . A s previously mentioned, study of the substrates that JRH-1 and DOG-1 can unwind would be informative in determining whether or not JRH-1 functions in a manner similar to Srs2, as well as in understanding the range o f substrates that these helicase-like proteins might unwind. Finally, there are two members o f the dog-] helicase-like family, M03C]].2 and Y50D7A.2, which have not been studied in C. elegans. M03C11.2 is similar to yeast helicase C h l l , which functions in sister chromatid cohesion (Gerring et al., 1990; Spencer et al., 1990; Skibbens, 2004), while Y50D7A.2 has similarity to the nucleotide excision repair helicase X P D (www.wormbase.org). When viable mutations or knock-outs of these genes are available, characterization of M03C11.2 and Y50D7A.2 is likely to reveal roles for these genes in replication and/or repair, similar to the roles of dog-1 and jrh-1 described here. Potential interactions between M03C11.2 and Y50D7A.2 and both genes with dog-1 and jrh-1 should also be tested. It w i l l be interesting to see how the genes in the dog-1 helicase-like family function together to maintain genome stability during replication and repair. Chapter 5 References Cheung I, Schertzer M , Rose A , & Lansdorp P M (2002) Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich D N A . Nat Genet 3\: 405-409 Collis SJ, Barber L J , Ward JD, Martin JS, & Boulton SJ (2006) C. elegans F A N C D 2 responds to replication stress and functions in interstrand cross-link repair. DNA Repair (Amst) 5: 1398-1406 Dequen F, St-Laurent JF, Gagnon S N , Carreau M , Desnoyers S (2005) The Caenorhabditis elegans FancD2 ortholog is required for survival following D N A damage. Comp Biochem Physiol B Biochem Mol Biol 141(4): 453-60 Ding H , Schertzer M , W u X , Gertsenstein M , Selig S, Kammori M , Pourvali R, Poon S, Vulto I, Chavez E , Tam PP, Nagy A , & Lansdorp P M (2004) Regulation of murine telomere length by Rtel: an essential gene encoding a helicase-like protein. Cell 117: 873-886 Gerring S L , Spencer F , & Hieter P (1990) The C H L 1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G 2 / M . EMBO J 9: 4347-4358 Hinz J M , Nham P B , Salazar E P , & Thompson L H (2006) The Fanconi anemia pathway limits the severity of mutagenesis. DNA Repair (Amst) 5: 875-884 Huppert J L & Balasubramanian S (2005) Prevalence of quadruplexes in the human genome. Nucleic Acids Res 33: 2908-2916 Joenje H & Patel K J (2001) The emerging genetic and molecular basis of Fanconi anaemia. Nat Rev Genet 2: 446-457 Levitus M , Joenje H , & de Winter JP (2006) The Fanconi anemia pathway of genomic maintenance. Cell Oncol 28: 3-29 Maizels N (2006) Dynamic roles for G4 D N A in the biology of eukaryotic cells. Nat Struct Mol Biol 13: 1055-1059 Meetei A R , Medhurst A L , L ing C, Xue Y , Singh TR, Bier P, Steltenpool J, Stone S, Dokal I, Mathew C G , Hoatlin M , Joenje H , de Winter JP, & Wang W (2005) A human ortholog of archaeal D N A repair protein H e f is defective in Fanconi anemia complementation group M . Nat Genet 37: 958-963 Patel K & Joenje H (2007) Fanconi anaemia and D N A replication repair. DNA Repair 6(7): 885- 90. Reid S, Schindler D , Hanenberg H , Barker K , Hanks S, Kalb R, Neveling K , Ke l ly P, Seal S, Freund M , Wurm M , Batish SD, Each FP, Yetgin S, Neitzel H , Arif f in H , Tischkowitz M , Mathew C G , Auerbach A D , Rahman N (2007) Biallelic mutations in P A L B 2 cause Fanconi anemia subtype F A - N and predispose to childhood cancer. Nat Genet 39(2): 162-4 Skibbens R V (2004) C h l l p , a D N A helicase-like protein in budding yeast, functions in sister- chromatid cohesion. Genetics 166: 33-42 Spencer F, Gerring S L , Connelly C, & Hieter P (1990) Mitotic chromosome transmission fidelity mutants in Saccharomyces cerevisiae. Genetics 124: 237-249 Taniguchi T & D'Andrea A D (2006) Molecular pathogenesis o f Fanconi anemia: recent progress. Blood 107: 4223-4233 Youds J L , O'Nei l N J , & Rose A M (2006) Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173: 697-708 Appendix 1; Primer sequences Primer sequences for detection of G/C-tracts and deletion alleles of genes Gene Amplified Name of Primer Sequence (5'-3') Anneal atrC) Products dog-l(gklO) dogL2 GGA GTA TAG AAC GTG TTT CG 55 wild type product 604 & 3003bp, deletion product 972bp dogM2 GCT CTT CTT TCA ATG TGA CGG dogR2 CGT CCA CAT CAA CAG AAC C him-6(ok412) him-6EL TTT TCG TGT TGC GGT TCG 57 wild type product 700 & 2398bp, deletion product 500bp him-6 ER ACG CCA GTC GTA GTG TTT CC him-6 IR2 GTGTTCTTGGATGGTGGC wm-l(gk99) WRN EL GCT GCA GAA TTG AAG AGA AAG 54 wild type products 455& 928bp, deletion product 732bp WRNIR CAT CAC TTA TCA TCT GTG CAT G WRNER CGA GTT CTC AGA GTG TAT CC brd-1 (gk297) brd-1 EL GCA AAG ACT TGT TAA GTA AGG 55 wild type products 743 & 1636 bp, deletion product 1254bp brd-lIR CCA GAA TTG GAT ATA TTC CAC brd-1 ER GCT ATC GAG TGT GTT AAA TG cep-1 (gkI38) cep-1 ER CGA CGG AGA TTG ACA GTT TTC G 55 wild type product 1532 & 2784bp, deletion product 1123bp cep-1 IR GGA ATT ATT TGC CGA TTT TCT C cep-1 IR2 GAA ATT ATG TCT GAA TTT ACC C him-9 (el487) NON50 GGACAGTACTCTCGGAGATT 56 NON50/53 ~lkb product only in wild type; NON50/87 ~800bp product only in him-9 NON53 CGAACTGTATCAAATTGGTCTG NON87 CACATTGTCCGCTTGTGTC rad-51 (lg8701) rad-51 EL CTC GAT CTA CCA TAC TAA AGC 58 wild type products 764 & 1995bp, deletion product 1055bp rad-51 IL GGT AAT AAT TAC AGC GAC ACC rad-51 ER GTC ATA ATT TGA TCT CCC GAC xpa-1 (ok698) xpa-1 EL CAA TGG CAA TTT GCT AGT ATT TC 58 wild type products 476 & 1494bp, deletion product 581 bp xpa-1 IR CTG GCA CTT CAG ATA CAA CTT C xpa-1 ER CAT GCG CGT AAT ATA TGT GTA G lig-4 (ok716) lig-4 EL CGT ATT TGT GGT ATT ACC CGG 58 wild type products 766 &2120bp, deletion product 578bp lig-4 IR CTG TTC TCT TCA CAA CGA TTC C lig-4 ER GAT CAT CTT TAT TGC AAC GTT CG cku-80 (ok861) cku-80 EL GCC GTT AGT GAA AGT AAT GCA G 58 wild type products 636 &2312bp, deletion product 744bp cku-80 IR CAC CGG GAG ATG GAT TCC AG cku-80 ER CCT CAT CTG GTT GTG TCA TAT TC fcd-2(tml298) tml298-EL CTA GCC AAT CAG ATG GAG TG 58 wild type product 502 & 982bp, deletion product 744bp tmI298-IR GGA GCC TCT GGA ATG ATG tml298-ER CAG AAG CGA GCA AGC GCG Gene Amplified Name of Primer Sequence (5'-3') Anneal at C O Products mus-81 (tml937) C43E11.2F AGG TAT TTG GCA GAC TTA CC 58 wild type product 406 & 2070bp, deletion product 879bp C43E11.2R GGC TGA ATG GAA CAC CCG AA C43E11.21 GAG CTT CCG ATC TTC TTG C Jrh-1 (tml866) tml866-EL CCT GTG TGG TGT GTG ATT AA 58 wild type product 784 & 2527bp, deletion product 1181bp tml866-IR CCT AGA ATT GTG GTT TTG ACC tml866-ER CAA TTC TGT AGA CGT ACA ATC vab-1 G/C-tract external vabNl CGATTCCAACAATTGGTAAATACC 58 wild type product 890bp vabN2 AATATTTGCTAAACCTATTGTTGCC vab-1 G/C-tract internal 152 CGA CGA AAA ATG CAG AAT TTG GC 62 wild type product 499bp 153 AGG TGT GTG TGC ATA CCT CCG R144 cosmid G/C-tract 398 CAT ATG GAT TGG CAT GTG AAG CA 62 wild type product 1028bp R144-IN2 CTG CCT ACA GTA GTC TTT GCG ZK377 cosmid A/T(27) tract ZK3-L CGT CTG GAG TTT TTT GTA TTC 56 wild type product 856bp ZK3-R GCA TCG TGA TGA GTG GAT AC Y77E11A cosmid A/T(22i tract Y77-L CGA ATT TTT CGC CAT TTT CAG 56 wild type product 918bp Y77-R GCT CCG TGT GCA TTG TAC C F12F6 cosmid (CAG)(8) tract F12-L CAC ATA CAA CCA TCG TCT CC 56 wild type product 860bp F12-R CTT GAA ACG AAT TAC ATA TTG AG F46H6 cosmid G/C- tract F46-EX1 CCT CGA CAG TGA AAA TAA TAA AC 62 wild type product 915bp F46-EX2 GTA GCT GAT TGG TTC AGG TTC

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0066819/manifest

Comment

Related Items