Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A role for epigenetic modifications in the maintenance of mouse Ly49 receptor expression Rouhi, Arefeh 2008

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
24-ubc_2008_spring_rouhi_arefeh.pdf [ 5.72MB ]
Metadata
JSON: 24-1.0066738.json
JSON-LD: 24-1.0066738-ld.json
RDF/XML (Pretty): 24-1.0066738-rdf.xml
RDF/JSON: 24-1.0066738-rdf.json
Turtle: 24-1.0066738-turtle.txt
N-Triples: 24-1.0066738-rdf-ntriples.txt
Original Record: 24-1.0066738-source.json
Full Text
24-1.0066738-fulltext.txt
Citation
24-1.0066738.ris

Full Text

A ROLE FOR EPIGENETIC MODIFICATIONS IN THE MAINTENANCE OF MOUSE LY49 RECEPTOR EXPRESSION  by  AREFEH ROUHI  B.Sc.(Hon.), The University of British Columbia, 2002  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2008 Arefeh Rouhi, 2008  Abstract  Although structurally unrelated, the human killer cell immunoglobulin-like (KIR) and the rodent lectin-like Ly49 receptors serve similar functional roles in natural killer (NK) cells. Moreover, both gene families display variegated and mostly mono-allelic expression patterns established at the transcriptional level. DNA methylation, but not histone modifications, has recently been shown to play an important role in maintenance of the expression patterns of KIR genes but the potential role of DNA methylation in the expression of Ly49 genes was unknown. My thesis focuses on the role of epigenetic modifications, especially DNA methylation, in the maintenance of mouse Ly49 gene expression. I show that hypomethylation of the region encompassing the main promoter of Ly49a and Ly49c in primary C57BL/6 (B6) mouse NK cells correlates with expression of these genes. Using B6 x BALB/c Fl hybrid mice, I demonstrate that the expressed allele of Ly49a is hypomethylated while the non-expressed allele is heavily methylated, indicating a role for epigenetics in maintaining mono-allelic Ly49 gene expression. Furthermore, the Ly49a promoter region is heavily methylated in fetal NK cells but variably methylated in nonlymphoid tissues. In apparent contrast to the KIR genes, I show that histone acetylation state of the promoter region strictly correlate with Ly49A and Ly49G expression status. Also, the instability of Ly49G expression on some lymphoid cell lines is at least in part due to changes in the level of histone acetylation of the promoter region. As for the activating Ly49 receptors, it seems that although DNA methylation levels of the promoter regions do correlate with the state of expression of these receptors, the pattern of DNA methylation is different from that of the inhibitory Ly49a and c genes. In conclusion, my results support a role for epigenetic mechanisms in the maintenance of Ly49 expression. Moreover, these  ii  epigenetic mechanisms appear to vary among the Ly49 genes and also differ from those governing KIR expression.  ill  Table of Contents Abstract ^  ii  Table of Contents ^  iv  List of Tables ^  viii  List of Figures ^  ix  List of Abbreviations ^  xi  Acknowledgments ^  xii  Co-Authorship Statement ^  xiii  Chapter 1 Introduction ^ 1.1 Epigenetic transcriptional regulation in the immune system ^ 1.1.1 An introduction to epigenetics ^  1 1 1  1.1.2 Role of epigenetics in the control of tissue-specific gene expression ^ 3 1.2 Natural Killer cell receptor control ^  4  1.2.1 NK cell function ^  4  1.2.2 Human and mouse NK receptors for MHC class-I ^  6  1.2.3 Evolution and diversity of MHC class-I receptors ^  8  1.2.4 Acquisition and Ontogeny of MHC class-I receptors ^ 1.3 NK cell education and self-tolerance ^  13 14  1.4 Initiation and maintenance of the stochastic expression of MHC class-I receptor families ^  15  1.5 Thesis objectives ^  20  1.6 Bibliography ^  22  Chapter 2 Evidence for epigenetic maintenance of Ly49a mono-allelic gene expression ^ 32  iv  2.1 Introduction ^  33  2.2 Materials and Methods ^  34  2.2.1 Mice ^  34  2.2.2 Antibodies, cell separation, and flow cytometry ^  34  2.2.3 Fetal liver NK cell retrieval and sort ^  34  2.2.4 Primary cell and tissue genomic DNA (gDNA) extraction ^ 35 2.2.5 Cell culture ^  35  2.2.6 Chromatin remodeling drug treatment and RT-PCR ^  36  2.2.7 Sodium bisulfite-conversion and PCR ^  36  2.2.8 Bisulfite sequencing and combined bisulfite and restriction enzyme analysis (COBRA) ^  37  2.2.9 Chromatin immunoprecipitation (ChIP) assays and Quantitative Real-time PCR ^ 39 2.3 Results ^ 2.3.1 CpG distribution of the Ly49 Pro-2 region ^  40 40  2.3.2 Differential DNA methylation of the Ly49a and Ly49c Pro-2 regions in primary NK cells ^  41  2.3.3 Ly49A mono-allelic gene expression is linked with DNA methylation profile ^ 46 2.3.4 Variable DNA methylation of Ly49a in non-lymphoid tissues ^ 47 2.3.5 Ly49a Pro2 is methylated in primary ex-vivo fetal NK1.1 + NK cells ^ 49 2.3.6 Linkage of DNA methylation status with histone acetylation of the Ly49a promoter region ^  50  2.3.7 Effect of chromatin remodeling drugs on Ly49 transcription ^ 52 2.4 Discussion ^  54  v  2.5 Bibliography ^  61  Chapter 3 Plasticity of Ly49g expression is due to epigenetics ^ 66 3.1 Introduction ^  67  3.2. Materials and Methods ^  68  3.2.1 Cell culture ^  68  3.2.2 Chromatin remodelling drug treatment and RT-PCR ^ 68 3.2.3 5' amplification of cDNA ends (5'-RACE) ^  68  3.2.4 Antibodies, cell separation and flow cytometry ^  69  3.2.5 Chromatin immunoprecipitation (ChIP) assays and Quantitative Real-time PCR ^ 69 3.3 Results ^ 3.3.1 CpG distribution of the Ly49g 5'-region ^  70 70  3.3.2. Chromatin remodeling drugs induce Ly49g transcription ^ 71 3.3.3. Determination of promoter of origin for Ly49g transcripts ^ 72 3.3.4. Histone acetylation is strongly linked to Ly49g transcription ^ 73 3.4. Discussion ^  76  3.5 Bibliography ^  79  Chapter 4 Role of DNA methylation in the maintenance of activating Ly49 receptor expression ^  82  4.1 Introduction ^  83  4.2 Materials and Methods ^  84  42.1 Mice ^  84  4.2.2 Antibodies, cell separation, and flow cytometry ^  84  42.3 Primary cell and tissue genomic DNA (gDNA) extraction ^ 85  vi  4.2.4 Sodium bisulfite-conversion and PCR ^  85  4.2.5 Combined Bisulfite and Restriction enzyme Analysis (COBRA) ^ 87 4.2.6 RNA extraction, RT-PCR and 5'amplification of cDNA ends (5'-RACE) ^ 87 4.2.7 Single cell RT-PCR ^ 4.3 Results ^  88 89  4.3.1 Transcription and expression of the activating Ly49 receptors: ^ 89 4.3.2 Ly49h 5' region DNA methylation correlates with state of expression ^ 90 4.3.3 DNA methylation of the 5' region of Ly49d correlates with expression state ^ 92 4.3.4 CpG distribution in the 5' region of activating Ly49 receptors ^ 93 4.35 DNA methylation of Ly49d and Ly49r 5' regions in 129S6/B6 Fl hybrid ^ 94 4.3.6 Detection of bi-allelic expression of Ly49d/r ^ 4.4 Discussion ^ 4.5 Bibliography ^ Chapter 5 General discussion and conclusion ^  96 98 103 108  5.1 Summary of thesis findings ^  108  5.2 Pitfalls and challenges ^  110  5.3 Model of epigenetic Ly49 regulation and comparison with the KIRs ^ 111 5.4 Potential future directions ^  113  5.4.1 Proximal regulatory elements ^  113  5.4.2 Distal regulatory elements ^  115  55 Concluding remarks ^  116  5.5 Bibliography ^  118  Appendix I: UBC Research Ethics Board Certificates of Approval ^ 121  vii  List of Tables Table 1.1 Comparison of KIR and Ly49 gene families ^  19  yiii  List of Figures Figure 1.1 MHC class-I recognizing receptors of human and mouse ^ 7 Figure 1.2 The MHC class-I clusters of human and mouse ^  8  Figure 1.3 Part of the C57BL/6 NK gene complex (NKC) ^  9  Figure 1.4 Phylogenetic tree of Ly49 genes in B6 mouse ^  10  Figure 1.5 Diversity of Ly49 cluster among three inbred mouse strains ^ 11 Figure 1.6 Phylogenetic comparison of 129/S6, B6 and BALB/c Ly49 cDNA sequences ^ 12 Figure 1.7 Variegated expression pattern of Ly49 genes. ^  13  Figure 2.1 Location of CpG dinucleotides in the Pro-2 regions of inhibitory Ly49 genes^ 41 Figure 2.2 Ly49a Pro-2 region. ^  42  Figure 2.3 Methylation status of Ly49a Pro-2 region in primary C57BL/6 Ly49A nonexpressing and expressing NK cells. ^  44  Figure 2.4 Methylation status of Ly49c Pro-2 region in primary ex-vivo C57BL/6 Ly49C expressing NK cells ^  45  Figure 2.5 Methylation status of Ly49a Pro-2 region in primary F1 hybrid Ly49A double negative and Ly49A B6+ NK cells. ^  47  Figure 2.6 Methylation status of Ly49a Pro-2 region in fresh B6 non-lymphoid tissue and fetal NK cells^  49  Figure 2.7 Histone acetylation and effect of chromatin remodeling drugs ^ 52 Figure 3.1 Ly49g upstream region in the C57BL/6 mouse strain ^  70  Figure 3.2 Induction of Ly49g transcription via chromatin remodelling drugs. ^ 71 Figure 3.3 Determination Ly49g promoter of origin in RMA-E3 and TSA treated EL4 cells. ^  72  ix  Figure 3.4 Chromatin immunoprecipitation (ChIP) assays and Quantitative Real-time PCR 74 Figure 4.1 Transcription of activating Ly49 genes ^  90  Figure 4.2 DNA methylation patterns of the 5'regions of Ly49h in the B6 strain. ^ 91 Figure 4.3 DNA methylation status of the 5'regions of Ly49d in the B6 strain. ^ 93 Figure 4.4 Comparison of CpG dinucleotide distribution in the 5' regions of activating Ly49 genes ^  94  Figure 4.5 DNA methylation of Ly49d and Ly49r 5'-region in the Fl hybrid of 129/S6 and B6. ^  96  Figure 4.6 Detection of Ly49d and r cDNA by single cell RT-PCR and Southern blotting ^ 97 Figure 5.1 Epigenetics of NK cell receptors during NK cell maturation ^ 113 Figure 5.2 Alignment of 5' regions of inhibitory and activating Ly49 genes ^ 114 Figure 5.3 CpG islands of the Ly49 cluster^  115  x  List of Abbreviations  5-aza-C^5-aza-cytidine by^base pair B6^C57BL/6 cDNA^complementary Deoxyribonucleic acid DAP12^DNAX activation protein 12 FACS^fluorescence activated cell sorting FITC^flurescin isothiocynate HLA^human leukocyte antigen IL-2^interleukin-2 ITAM^immunoreceptor tyrosine-based activation motif ITIM^immunoreceptor tyrosine-based inhibitory motif kb^kilobase KIR^killer immunoglobulin-like receptor LRC^leukocyte receptor complex Ly^lymphocyte antigen MCMV^mouse cytomegalovirus MHC^major histocompatibility complex ml^millilitre mRNA^messenger ribonucleic acid ng^nanogram NK cell^natural killer cell NKC^natural killer gene complex NKT^natural killer T-cell PCR^polymerase chain reaction RACE^rapid amplification of cDNA ends RNA^ribonucleic acid RT-PCR^reverse transcriptase-polymerase chain reaction TSA^trichostatin-A  xi  Acknowledgments  First and foremost I wish to thank my supervisor, Dixie Mager, for guiding me with her great wisdom and demanding the best of me at all times while remaining compassionate and human. I wish to express my most sincere gratitude to her for all that she has taught me in science and in life throughout these long years; I could not have asked for a better teacher. I wish to thank all my lab mates, past and present, especially my previous mentors  Brian Wilhelm, Josette Renee Landry and Karina McQueen. Great thanks to our superb technician, Liane Gagnier, our perfect secretary Christine Kelly and to Sally Rogers, my friend and colleague, for sharing the highs and lows of the NK side of the lab. Great thanks go to my committee member and unofficial co-supervisor, Fumio Takei, for all his guidance and support throughout my degree. I also wish to thank Mitsuko Takei for her support and kind words when I most needed them. Many thanks to all members of the Takei lab, past and present, especially Motoi Maeda, Nooshin Tabatabaei, Linnea Veinotte and Evette Haddad for helping me with FACS and antibodies. Big thanks to my fantastic committee members, Carolyn Brown and Louis Lefebvre, for their continuous interest in my project and their useful and realistic suggestions. I also wish to thank the TFL FACS facility staff, past and present for cell sorting and the BCCRC animal facility staff for taking care of my mice. My friends, Florian Kuchenbauer, Ghazaleh Tazmini, Nooshin Tabatabaei, Samuel Chang, Suzan Imren and Evette Haddad, they have each contributed positively to my life at the TFL and beyond. I owe them lots for getting me through the various difficulties of this journey. Last and but not least, I wish to thank my parents and brothers, Ali and Mamad for their never-ending love. I would like to express my deepest gratitude to my parents for all that they have endured emotionally and physically to bring me up through revolution, war and hardship and to get me where I am today. I dedicate this work to them and hope to make them proud.  xii  Co-Authorship Statement Chapter 2 A version of this chapter has been published. Rouhi, A., L. Gagnier, F. Takei, and D.L. Mager. 2006. Evidence for epigenetic maintenance of Ly49a mono-allelic gene expression. J Immunol 176: 2991-2999. Liane Gagnier assisted with the cloning of Ly49a and c bisulfate sequences. Fumio Takei provided antibodies and B6 mice in addition to comments on the manuscript. My supervisor, Dixie Mager, and I designed the experiments and I performed the experiments and analyzed the data. I wrote the manuscript with comments and corrections from my supervisor. Chapter 3 A version of this chapter has been published. Rouhi, A., C.G. Brooks, F. Takei, and D.L. Mager. 2007. Plasticity of Ly49g expression is due to epigenetics. Mol Immunol 44: 821826. Colin G. Brooks provided the RMA-E3 cell line and comments on the manuscript. Fumio Takei provided antibodies in addition to comments on the manuscript. My supervisor, Dixie Mager, and I designed the experiments and I performed the experiments and analyzed the data. I wrote the manuscript with comments and corrections from my supervisor. Chapter 4 A version of this chapter will be submitted for publication. Rouhi, A., F. Takei, and D.L. Mager. Fumio Takei provided antibodies and B6 mice in addition to comments on the draft manuscript. My supervisor, Dixie Mager, and I designed the experiments and I performed the experiments and analyzed the data. I wrote the manuscript with comments and corrections from my supervisor.  Chapter 1 Introduction  1.1 Epigenetic transcriptional regulation in the immune system  The immune system is, by necessity, very dynamic as it has to respond to threats throughout the life of an organism. In terms of gene regulation, this dynamism requires a plastic transcriptional state that rapidly changes to accommodate the various activation states of immune cells. To achieve a new expression state, the cell changes its transcriptional profile by either modifying its transcription factor repertoire, epigenetic state or both. An increasing body of data points to the use of epigenetic mechanisms in achieving transcriptional variation in immune system cells in response to various stimuli (Bruniquel and Schwartz, 2003; Smale and Fisher, 2002; Su et al., 2004).  1.1.1 An introduction to epigenetics  Epigenetic modifications play critical roles in the control of gene expression and subsequently affect states of differentiation, activation and function of all cell lineages. Epigenetics refers to differential usage of genetic material primarily through heritable but reversible modifications of chromatin (DNA and histone proteins) without changing the DNA sequence (Nakao, 2001). Chromatin remodelling through histone modifications and DNA methylation is involved in the transcriptional control of tissue-specific and allelespecific genes (Attwood et al., 2002; Gimelbrant et al., 2007; Murrell et al., 2004; Shen et al., 2007). DNA methylation in vertebrates predominantly occurs at the carbon-5 of a cytosine positioned within a 5'-CpG-3' dinucleotide resulting in methyl-CpG (Bernstein et al., 2007). 1  CpG methylation of regulatory sequences has been shown to cause transcriptional repression. CpG methylation can repress transcription directly by preventing methylation-sensitive transcription factors from binding to their recognition sites. Methylated CpGs also bind Methyl-CpG binding proteins that can block the binding sites of methylation-insensitive transcription factors and prevent transcription. The histone octamer undergoes many modifications such as acetylation, methylation, phosphorylation and ubiquitination at specific residues located predominantly in the Nterminal tails. However, the most studied modifications are histone acetylation and methylation (Kouzarides, 2007). Histone acetylation of lysine residues is associated with open chromatin and transcription whereas the effect of histone methylation on chromatin compaction and state of transcription depends on the residues modified and the number of methyl groups attached to a given residue. It is becoming clearer that histone modifications often exert their effect on chromatin as a collective. A given locus may contain both transcription promoting and repressive histone marks and that the changing balance of these marks determines the state of transcriptional activation (Bernstein et al., 2007). Methylated DNA and histone modifying enzymes interact. For example, methyl-CpG binding proteins recruit nuclear co-repressor complexes, such as the SIN3 complex that contains histone deacetylases, to CpG-methylated loci where acetyl groups from lysine residues present in the N-terminus of histones are removed (Goll and Bestor, 2005). This creates a more compact chromatin structure that is not accessible to the transcription machinery resulting in transcriptional repression. Hence, DNA methylation can directly and indirectly lead to the transcriptional repression of genes.  2  Methylated cytosines are susceptible to spontaneous deamination causing the mutation of CpG to TpG. This mutation is not recognised by the DNA mismatch repair machinery and the original CpG dinucleotide is only restored half of the time. This leads to a general under-representation of CpGs in genomes that are prone to high levels of DNA methylation. The majority of CpGs in the mammalian genome are methylated and it is thought that this methylation reduces transcriptional noise and silences CpG-rich transposable elements (Goll and Bestor, 2005). However, small regions of the genome with a high CpG density called CpG islands are mostly unmethylated and are mostly associated with the promoter regions of housekeeping genes. It is thought that CpG islands escape methylation due to binding of transcription factors and hence maintain their CpG density (Antequera, 2003).  1.1.2 Role of epigenetics in the control of tissue specific gene expression -  DNA methylation has been shown to allow for the transcriptional control of tissuespecific genes in differentiated cells (Bird, 2002; Shen et al., 2007). The olfactory genes, that number more than a thousand, have variegated mono-allelic transcription. It is believed that maintenance of the stable "one allele per one neuron" expression pattern of the olfactory receptors is via epigenetic mechanisms (Chess et al., 1994; Schwarzenbacher et al., 2004; Shykind, 2005). Imprinted genes, those that are expressed from either the maternal or paternal allele (Murrell et al., 2004), and some immune system genes with allelic expression are also transcriptionally controlled by DNA methylation (Chan et al., 2003; Rogers et al., 2006).  3  Chromatin modifications play a critical role in the development of immune system cell lineages and their states of activation (Krangel, 2007). For example, the expression of IL-2 was shown to correlate with the DNA methylation pattern of its promoter in naive and activated T cells. Active demethylation of a few CpG dinucleotides in the IL-2 promoter upon activation of T-cells leads to IL-2 transcription and expression (Bruniquel and Schwartz, 2003). Allelic exclusion of the immunoglobulin Kappa (Igic) region in developing B cells involves intricate and sequential epigenetic modifications including differential DNA methylation, histone modifications and subnuclear localization (Goldmit et al., 2005).  1.2 Natural Killer cell receptor control  Variation in local epigenetic modifications is one mechanism that could be responsible for establishing independent and variegated expression patterns among closely related genes. Families of natural killer (NK) cell receptor genes represent systems that display stochastic variegated expression.  1.2.1 NK cell function NK cells are a subset of lymphocytes that are part of the innate immune system as  their activation does not require prior exposure to antigen. As defined by surface markers, humans NK cells are a population of lymphocytes that express CD56 but not CD3 (T-cell receptor). In mouse, NK cells express NK1.1 (in C57BL/6 strain) and/or DX5 (CD49b also known as alpha-2 integrin) but not CD3 (Hayakawa et al., 2006). NK cells are capable of recognizing and destroying stressed, pathogen-infected and tumour cells and are therefore considered a first line of immune defence in the body (Biron et al., 1989; Eagle and  4  Trowsdale, 2007; Laskay et al., 1993; Mandelboim et al., 2001). NK cells exert their function through the secretion of cytokines, chemokines and via cytotoxicity through TNFa and TNF-related apoptosis inducing ligand (TRAIL) inducing apoptosis in the target cell. NK cells also induce antibody-dependent cell mediated cytotoxicity (ADCC) through the CD16 receptor on the surface of NK cells recognizing B-cell secreted immunoglobulin coated targets. Subsequently, the target is destroyed through the secretion of lytic compounds by the NK cells (Bryceson et al., 2006). Normal cells display a number of receptor molecules on their surface called MHC (Major histocompatibility complex) class I that are recognized by a number of inhibitory receptors on the surface of NK cells. The inhibitory receptors prevent activation of NK cells and the destruction of normal, MHC class I-possessing cells. Upon binding of the inhibitory receptor to its MHC-class-I ligand, the immunoreceptor tyrosine-based inhibitory motif (ITIM), located in the cytoplasmic domain of the inhibitory receptor, becomes phosphorylated and recruits SHP-2 phosphatases leading to an inhibitory signal and prevention of killing of the target cell (Lather, 2003). NK cells also possess stimulatory (activating) receptors that recognize other molecules on the surface of potential target cells which are mostly pathogen encoded such as the mouse cytomegalovirus (MCMV) MHC class-I-like m157 protein (Arase et al., 2002; Smith et al., 2002) or are self-coded proteins that are only expressed on stressed cells (Eagle and Trowsdale, 2007). However, some activating receptors are known to bind MHC class-I (Nakamura et al., 1999; Olcese et al., 1997; Silver et al., 2000). This means that both inhibitory and activating receptors can bind the same MHC class-I ligand but the binding affinity of activating receptors tends to be lower than the inhibitory ones (Nakamura et al., 2000). The activating receptors lack ITIMs and  5  rather they contain a charged amino acid in their transmembrane domain which allows association with an immunoreceptor tyrosine-based activation motif (ITAM)-containing adaptor protein such as DAP12. When an activating receptor is engaged by its ligand, the ITAM of the adaptor protein is phosphorylated and Syk and Zap-70 kinases are recruited to the cell membrane leading to the transmission of activating signals (Turnbull and Colonna, 2007). In the case of NK cells, it seems that the signal from an inhibitory receptor normally overrides the signal from an activating receptor (Ortaldo et al., 1999) unless the balance of activating and inhibitory ligands is tipped towards activation. Virus-infected cells and cancer cells often lose expression of MHC class I molecules and hence become sensitive to killing by NK cells. NK activation and the killing of target cells therefore depend on the balance between stimulatory and inhibitory signals received from the surface receptors.  1.2.2 Human and mouse NK receptors for MHC class I -  NK cells detect subtle changes in expression of MHC class I molecules on target cells via families of receptors on NK cells. In primates and some other mammals, the killer cell Iglike (KIR) family of genes provide this function (McQueen and Parham, 2002; McQueen et al., 2002). However, in rodents the Ly49 family is the main receptor gene family for the recognition of classical MHC class I. A third and smaller receptor family common to possibly all mammals is the CD94/NKG2 family (Takei et al., 2001; Yokoyama and Plougastel, 2003). CD94 is a single C-type lectin-like gene whose product forms heterodimers with the inhibitory receptor NKG2A and the activatory receptors NKG2C and E (Takei et al., 2001). Heterodimers of  6  CD94 and one of NKG2A, C and E bind to the non-classical MHC class-I HLA-E in humans and to Qa-1 in rodents. The non-classical MHC class-I molecules present the leader peptides of classical MHC class-I (Raulet et al., 2001). Therefore the NKG2/CD94 heterodimers indirectly sense the levels of the classical MHC class-I (Figure 1.1).  indirect recognition  direct recognition  CD94/^CD94/ NKG2A^NKG2A HLA-E}  Qa-1  Classical MHC Class I  Leader peptide of classical MHC class I ♦ Diverse peptides  Figure 1.1 MHC class-I recognizing receptors of human and mouse  Figure adapted from Raulet et al. 2001. MHC class-I genes are located on human chromosome 6 and mouse chromosome 17 and their main function is to present cellular antigens to immune cells. The human MHC cluster is referred to as HLA (Human leukocyte antigen) and the mouse counterpart is referred to as the 1-1-2 (Figure 1.2). The MHC is highly variable among different species and is fastest evolving gene cluster known to date. NK receptors likely co-evolve to match the rapid evolution of MHC class-I and pathogens (Kelley et al., 2005a).  7  Human Chromosome 6  MICB^HLA-B HLA-C^HLA-A A-G^HLA-F HFE  I  I  Classical and and MHC Class I  Mouse Chromosome 17 K  ^  D^L^Q (multiple genes)^T (r^genes)^M (multiple genes)  ^  Classical^ MHC Class I^  I  'if  /A-4  Classical and Nor-^cal MHC Class I  classical MHC class I molecules non-classical MHC class I molecules  Figure 1.2 The MHC class-I clusters of human and mouse Adapted from the book: "Immunity: The immune response in infectious and inflammatory disease" New Science Press Ltd. By: DeFranco, Locksley and Robertson (figure 4-6) http://www.new-science-press.com/info/illustration files/nsp-immunity-4-3-4 6.jpg  1.2.3 Evolution and diversity of MHC class-I receptors The KIR gene cluster of human is —150 kb containing approximately 14 genes and pseudogenes with very high coding and regulatory sequence similarity and is located in the leukocyte receptor complex (LRC) on chromosome 19 (Kelley et al., 2005b). The intergenic region of adjacent KIRs is around 2 Kb in length and contains the same Alu and LI repetitive elements for all the genes (Stulberg et al., 2007) indicating that they arose through recent gene duplication events. There is great diversity in both gene number and sequence polymorphisms for the KIRs among different people (Parham, 2005). The Ly49 gene cluster has also arisen from recent duplications and gene conversions of ancestral genes (Anderson et al., 2005; Makrigiannis et al., 2005; Wilhelm et al., 2002). Hence, there is high sequence similarity both in the coding and non-coding regions among the majority of the genes. The Ly49 cluster includes 16 genes and pseudogenes spanning over 600 kb in the C57BL/6 (B6) mouse strain and is located in the natural killer gene complex 8  (NKC) region (Figure 1.3) of chromosome 6 (Kelley et al., 2005b). Ly49a -j and q code for functional receptors and Ly49k- n and x are pseudogenes. Ly49d and h code for activating receptors and the rest of the functional Ly49 genes are inhibitory. Centromere  ^  NKG2  e  Telomere x^f^d^k^h^n^i  9^I j irl  c  a  b  DECA  Ly49 cluster Inhibitory receptor  I Activating receptor Pseudogenes  Figure 1.3 Part of the C57BL/6 NK gene complex (NKC)  The Ly49 and CD94/NKG2 genes are shown. There are two functional activating Ly49 genes (Ly49d and h). Ly49B and Q are not expressed on NK cells but rather they are expressed on myeloid cells. CD94 forms heterodimers with NKG2A, C and E. NKG2D is an activating receptor expressed on nearly all NK cells and some T-cells. It forms a homodimer that recognizes stress-induced molecules on the surface of cells and associates with ITAMcontaining signalling molecules to conduct activating signals (Eagle and Trowsdale, 2007). Figure 1.4 shows the phylogenetic tree representing 14 Ly49 genes from the B6 strain (does not include the diverged Ly49b and the short pseudogene Ly491) generated by multiple alignment of the genomic sequence spanning exons 1 to 7 (Wilhelm et al., 2002). With the exception of Ly49q which is located at the most centromeric end of the cluster, the rest of the genes form two main groups (containing functional receptor genes) and more related subgroups. Ly49c,j and i form a close group indicating recent duplication. Ly49a and g are also relatively closely related to each other.  9  ^ Ly49i ^ Ly49j ^ Ly49c ^ Ly49f ^ Ly49e ^ Ly49h ^Ly49k ^ Ly49n Ly49g ^ Ly49n ^ Ly49x ^ Ly49m ^ Ly4.9d  Ly49q  Figure 1.4 Phylogenetic tree of Ly49 genes in B6 mouse.  This tree was generated by the alignment of the genomic sequence spanning exons 1 to 7 (and exons 1 to 6 of Ly49q) of Ly49 genes (Figure adapted from Wilhelm et al. 2002). The number and sequence of the Ly49 genes (renamed killer cell lectin-like receptor subfamily A or Klra) varies between mouse and rat (Wilhelm and Mager, 2004) and among different mouse strains (Figure 15). This is due to strain-specific divergence of these genes because of their fast rate of evolution (Anderson et al., 2005; Makrigiarmis et al., 2005; Wilhelm et al., 2002).  10  BALBic  ^  C57BL/6^12986  TEL  0  100  If  a (Klra1) ^  a (Klral)  G(Klra3)  c (Klra3)  (Klra12)FE1  0  (Klra10)  m (KIra 13 ) I  (Klra10)  300  (KIra12) I^g (Klra7)  (KIra9) y (Klra24)  (Klra9)  Lim e(Klra5) 1111  P (Klra16)  pi(Klra12)  y (KIra7) ^ 200  g (KIra7)  r---  /7  h (Klra8)  I. (KIra9) ui (1(Klra21)  k (Klra11)  (Klra18)  d (KIra4)  Oc  (Kira6)  400  (Klra15)  q  x (Klra24)  (Klra19)  500^  F1 -  600  If  (KIra5) ^(Klral7)  1^  ec, tr i  (Klra22)  (KIra5)  700 4,(Klra17)  CFN  Figure 1.5 Diversity of Ly49 cluster among three inbred mouse strains The Ly49 gene cluster of C57BL/6, 129/SvEvTac (129S6) and BALB/c has been sequenced. I have added the new nomenclature (Kira) for the Ly49 genes. There is great diversity in gene content and sequence among mouse strains similar to variability of the KIR cluster of humans. Figure is adapted from Anderson et al. 2005 Genes and Immunity. However, based on sequence identity and chromosomal location some Ly49 genes could be considered alleles of each other in various mouse strains (Anderson et al., 2005;  I1  Makrigiannis et al., 2002). Figure 1.6 shows the phylogenetic tree generated from the alignment of the cDNA sequences of Ly49 genes from three mouse strains (Anderson et al., 2005). Ly49d-like Ly49c-like  csb ir‘2q  Ly491-like  —  1(0  99 73  00 100 62 97  Ly49h-like  86  Ly49a-like 9  Ly49g-like^4^Ly49e-like  Ly49q-like  Ly49b-like Figure 1.6 Phylogenetic comparison of 129/S6, B6 and BALB/c Ly49 cDNA sequences. These genes can be divided into groups with the most sequence homology and of these genes some can be considered alleles within different strains based on genomic location and sequence homology. Figure adapted from Anderson et al. 2005.  It is believed that the KIR, Ly49 and CD94/NKG2 are, for the most part, differentially and independently expressed on individual NK cells (Held and Kunz, 1998;  12  Kubota et al., 1999; Valiante et al., 1997). This leads to a variable combination of receptors on different NK cell-lineages giving rise to NK cell diversity (Figure 1.7). Ly49a  5^10^15^20^25^30^5^40^45^50  ^ ^ 5 60  1111 I 11 III 111111 I II II 11111 1 II NI III I 111111  b 111111111111111111111111111111111111111■111111111111111111111111 C1  III I 1111 I I 1111 1111 I II II III I II NI III 1111 III 1111^I II II III I 1111^1111 I II e 11111111111111111111111111111111111111111111111111111111111111 f 11111111111111111111111111111111111111111111111111111111111111 I 1111111 MI1111111111111111111 III h 1111111111111111111■ OM 111111111 II I ■11111 I I 11111111 1 I I 1 NI 111111 11 IN I NI I I 1111 II 1 1111 I 1111111 ■11111011111 111111111111111 111111101111111111111111111111111■  d  Figure 1.7 Variegated expression pattern of Ly49 genes. Ly49 expression pattern on 62 individual NK cells was assessed by single cell RT PCR with gene-specific primers. Each column represents a single NK cell and each row represents a given Ly49. Black boxes represent expression of Ly49 and white boxes represent the absence of Ly49. NK cells express a diverse array of receptors (Figure adapted from Kubota et al. 1999). -  1.2.4 Acquisition and Ontogeny of MHC class I receptors -  Most Fetal and neonatal mouse NK cells express the NKG2A/CD94 heterodimer. However, as the percentage of NK cells expressing Ly49 receptors rises after birth, the percentage of NKG2A/CD94 expressing NK cells declines to around 50% in adult mice (Dorfman and Raulet, 1998; Kubota et al., 1999). In addition to NK cells, some subsets of T-cells also express the Ly49 and KIR receptors (Raulet et al., 2001). Low expression of KIRs on fetal cord blood lymphocytes has been shown (Warren et al., 2006) but it is generally thought that the KIRs are expressed after birth on mature NK cells. Ly49E is the only Ly49 expressed on the surface of mouse fetal NK cells. After birth, the expression of other Ly49 genes is gradually turned on and reaches a plateau within 6-8 weeks whereas the number of NK cells expressing Ly49E decreases dramatically to 1-3% in  13  the adult mouse (Van Beneden et al., 2001). Ly49 acquisition seems to be sequential but stochastic based on in vivo and in vitro experiments, but the precise order of acquisition of the Ly49 receptors by maturing NK cells is still under debate (Dorfman and Raulet, 1998; Williams et al., 2000). The order of acquisition of the Ly49 genes seems to follow a "windows of opportunity" model where every NK cell has the "choice" to express a given Ly49 within a certain timeframe (Veinotte et al., 2003). This "choice" is stochastic and hence not every NK cell will express every Ly49 receptor. Each NK cell can co-express multiple Ly49 receptors where this expression may be mono-allelic or bi-allelic (Held and Kunz, 1998; Kubota et al., 1999). This scheme could, in theory, provide further diversity to the NK receptor repertoire.  1.3 NK cell education and self tolerance -  Traditionally, NK cell self-tolerance was thought to be mediated by the expression of at least one self-MHC class-I binding inhibitory receptor by NK cells (Parham, 2006). However, this view has recently been challenged by the discovery and characterization of a small subset of NK cells that do not express any known self-MHC class-I recognizing receptors (Fernandez et al., 2005). This subset of NK cells is MHC class-I background dependent and is hypo-responsive to the lack of MHC class-I, does not take part in allograft rejection and shows low IFN-y production in response to activating receptor stimulation (Fernandez et al., 2005). It is thought that developing NK cells that do not express self-MHC class-I inhibitory receptors either remain hyporesponsive ("unlicensed") or are actively made so and hence maintain self-tolerance (Fernandez et al., 2005; Kim et al., 2005). Engagement of the self-MHC class-I and signalling through the ITIM domain of inhibitory Ly49 receptors  14  of the developing NK cell determines the responsiveness of NK cells (Kim et al., 2005). Indeed, the MHC class-I background of various mouse strains has an "educating" effect on the NK population. Experiments in single and double MHC class-I allele mice has shown that different MHC class-I alleles have various degrees of effectiveness on Ly49 receptor acquisition and NK cell recognition of the "missing-self' (Johansson et al., 2005).  1.4 Initiation and maintenance of the stochastic expression of MHC class-I receptor families  The Ly49 genes have complex transcriptional regulation. With the exception of Ly49b and q, which have only one reported promoter, and Ly49g, which appears to have three promoters, other studied Ly49 genes have two putative promoters (Saleh et al., 2002; Wilhelm et al., 2001). The most upstream promoter referred to as Pro-1 has been shown to be active in adult and neonatal bone-marrow and liver for a number of inhibitory Ly49 genes and Pro-1 transcripts of only Ly49e were detected in fetal liver and thymus (Saleh et al., 2002). Pro-1 transcripts for the activating receptors were not detected even though a region with some homology to the inhibitory Pro-1 sequence was found for the activating receptors as well (Saleh et al., 2002). This region shows promoter activity in transient transfection assays for most inhibitory Ly49 genes but no promoter activity was detected for the putative Pro-1 region of the activating genes (Saleh et al., 2004; Saleh et al., 2002). Transcripts from Pro-1 seem to exist only transiently and possibly only in immature NK cells (Saleh et al., 2002). Pro-2, which is the main promoter used by NK cells, is located downstream of Pro-1. The coding region of all Ly49 genes starts in exon 2 and so the variability of exon 1 does not  15  affect the protein sequence. The presence of the Ly49a Pro-1 region was necessary for the maintenance of the stochastic expression of Ly49A in a transgenic mouse model and its deletion abolished Ly49A expression (Tanamachi et al., 2004). Subsequently, it was demonstrated that Pro-1 likely acts as a bi-directional stochastic promoter in immature NK cells and the relative strength of the forward promoter to the reverse promoter correlates with the percentage of NK cells expressing a given Ly49 receptor (Saleh et al., 2004). It is thought that the direction of transcription from Pro-1 in immature NK cells determines if the mature NK cell will express that Ly49 receptor (Pascal et al., 2006; Saleh et al., 2004). Based on transient transfection assays, a region upstream of the Pro-2 region appears to act as a suppressor element for a number of Ly49 genes (Gosselin et al., 2000; McQueen et al., 2001). A model has been proposed which suggests that the forward transcript from Pro-1 opens up the Pro-2 region by removing the silencing complex bound by the Pro-2 upstream suppressor element and facilitates transcription from this promoter (Pascal et al., 2006; Saleh et al., 2004). Hence, the Pro-1 may be responsible for the stochastic expression of the Ly49 receptors and Pro-2 maintains this pattern of expression in the mature NK cells. Variable transcriptional start sites for Ly49a, c, d and g have been reported (Wilhelm et al., 2001) via 5' rapid amplification of cDNA ends (5'RACE). For Ly49g, the majority of transcripts present in adult primary NK cells initiated within exon 2 in a region approximately 10-15 by upstream of the coding region. This suggests that the first intron acts as the promoter (Pro-3) for these transcripts (Wilhelm et al., 2001). It is interesting that Ly49a and g,  which are highly similar in 5' sequence, are transcribed from different promoter  regions.  16  Ly49b is located nearly 800kb telomeric to the main Ly49 cluster. Ly49e and q are  located nearly 55kb centromeric from Ly49x and the main cluster (Wilhelm et al., 2002). Interestingly, the expression pattern of these receptors is different from the rest. Ly49b (Gays et al., 2006) and q are not expressed on NK cells (Kubota et al., 1999; Toyama-Sorimachi et al., 2004) but they are the most conserved among all sequenced mouse strains and have strong potential orthologues in rat (Anderson et al., 2005; Wilhelm and Mager, 2004). Ly49e, which has predominant fetal NK expression (Van Beneden et al., 2001), is also well conserved among mouse strains examined (Anderson et al., 2005). A possible reason for the difference in the expression pattern of these three genes from the rest may be the existence of a locus control region (LCR) for the main cluster genes. However, such an element has not been found to date. The KIR genes have also been shown to have at least two promoters, proximal and distal, even though their intergenic regions are small and around 2 Kb in length. The distal promoter maps to adjacent Alu and Ll repetitive elements and is not NK cell specific (Stulberg et al., 2007). The proximal promoter is the main promoter and appears to act as a bidirectional switch and can transcribe in both directions just like the Pro-1 element of the Ly49 genes (Davies et al., 2007). Reverse transcripts from the proximal promoter were found  only in immature NK cells and are associated with lack of expression of a given KIR (Davies et al., 2007). Hence, direction of transcription from the proximal promoter in combination with distal promoter transcription might be the cause of stochastic expression of the KIR receptors (Davies et al., 2007). Similar to the Ly49 genes, the KIR transcripts from the proximal promoter have multiple start sites (Radeloff et al., 2005). The maintenance of the proximal KIR promoter  17  transcription is primarily controlled by DNA methylation (Santourlidis et al., 2002) but histone acetylation and methylation do not seem to play a big role (Chan et al., 2005). DNA methylation also correlates with mono-allelic expression of KIR receptors and seems to maintain the allele-specific transcription of both inhibitory and activating KIRs (Chan et al., 2003). The expression of NKG2A has been shown to be stochastic and mono-allelic (Vance et al., 2002). Subsequent to my work on the epigenetics of the Ly49 genes (discussed in Chapters 2 and 3), our laboratory showed that histone acetylation and DNA hypomethylation correlate with the expression of NKG2A in mice and furthermore, that DNA methylation of the 5'-region correlates with the mono-allelic expression of this receptor (Rogers et al., 2006). Although the KIR and Ly49 genes are not orthologs, they share many commonalties (Table 1.1). Both gene families are composed of closely related genes with unidirectional transcription and mono-allelic yet independent and stochastic expression (Held and Kunz, 1998; Kubota et al., 1999; Takei et al., 2001). This unique pattern of gene expression is established at the transcriptional level (Kubota et al., 1999; Valiante et al., 1997). The receptor repertoire of both KIR and Ly49 can be predicted by the product rule. That is, the probability of co-expression of two receptors by a given NK cell is roughly the product of the individual expression probabilities of each receptor (Reviewed in Raulet et al. 2001).  18  MR  Ly49  Functional in Primates  Functional in Rodents  90% similar in coding sequence  70-90% similar in coding sequence  -150Kb tight cluster  -650Kb cluster in B6 strain  Immunoglobulin-like  C-type lectin-like  Stochastic, variegated, mostly mono-allelic expression  Stochastic, variegated, mostly mono-allelic expression  High diversity in human population in number and type of KIRs and sequence polymorphisms  Gene number and sequence different among mouse strains.  Receptor repertoire is clonally stable  Receptor repertoire is clonally stable  CpG-rich promoters  CpG-poor promoter  Table 1.1 Comparison of KIR and Ly49 gene families  Much is yet unknown about the transcriptional control and expression of both the KIR  and Ly49 receptors. The KIR and Ly49 repertoires of a given NK clone have been shown to be stable (Held and Raulet, 1997; Valiante et al., 1997) and that allelic switching does not occur upon cell division. No mechanism for the selection of a parent-specific allele exists and allele expression is stochastic. This implies that a maintenance mechanism uncoupled from the stochastic switch exists to preserve the expression of a given KIR or Ly49 allele in an expanded NK clone. In the case of the KIRs, this mechanism is DNA methylation of the proximal promoter elements. However, the existence and quality of a potential maintenance mechanism for Ly49 genes was unknown at the start of my thesis work. 19  1.5 Thesis objectives The goal of my thesis was to elucidate the effect of epigenetic modifications on the transcriptional regulation of the Ly49 genes in mouse. My main objective was to determine the role of DNA methylation in the maintenance of Ly49 receptor expression in mature mouse NK cells. During the course of my project a number of publications by two other groups shed light on the epigenetic regulation of the KIR genes in human (Chan et al., 2003; Chan et al., 2005; Santourlidis et al., 2002). The data on the KIRs and my own subsequent findings on the Ly49 epigenetic regulation has allowed for a more comprehensive comparison of KIR and Ly49 gene regulation. In Chapter 2, I will discuss the role of epigenetic mechanisms in the regulation of the most well characterized inhibitory Ly49 receptor, Ly49a. The availability of allele-specific antibodies and an Ly49A-expressing cell line facilitated our analysis. A version of this chapter has been published: Rouhi, A., L. Gagnier, F. Takei, and D.L. Mager. (2006) Evidence for epigenetic maintenance of Ly49a mono-allelic gene expression. J Immunol 176: 2991-2999. In Chapter 3, I will discuss the role of epigenetic modifications in the control of the expression of another inhibitory receptor, Ly49g, in the context of the unstable and plastic expression of this receptor on cell lines. A version of this chapter has been published: Rouhi, A., C.G. Brooks, F. Takei, and D.L. Mager. (2007) Plasticity of Ly49g expression is due to epigenetics. Mol Immunol 44: 821-826. Chapter 4 is a work in progress and is presented as a manuscript in preparation. Here, I discuss the role of DNA methylation in the maintenance of the activating Ly49 receptor expression. The differences in the expression patterns of these receptors compared to their inhibitory counterparts points to a potentially different mode of gene regulation.  20  In Chapter 5, I will summarise and discuss my work in the context of the field of NK cell receptor transcriptional regulation. I will also mention some of the questions that remain unanswered and possible strategies for elucidating them.  21  1.6 Bibliography  Anderson, S.K., K. Dewar, M.L. Goulet, G. Leveque, and A.P. Makrigiannis. 2005. Complete elucidation of a minimal class I MHC natural killer cell receptor haplotype. Genes Immun 6: 481 92. -  Antequera, F. 2003. Structure, function and evolution of CpG island promoters. Cell Mol Life Sci 60: 1647-1658.  Arase, H., E.S. Mocarski, A.E. Campbell, A.B. Hill, and L.L. Lanier. 2002. Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science 296: 1323-1326.  Attwood, J.T., R.L. Yung, and B.C. Richardson. 2002. DNA methylation and the regulation of gene transcription. Cell Mol Life Sci 59: 241-257. Bernstein, B.E., A. Meissner, and E.S. Lander. 2007. The mammalian epigenome. Cell 128: 669-681. Bird, A. 2002. DNA methylation patterns and epigenetic memory. Genes Dev 16: 6-21. Biron, C.A., K.S. Byron, and J.L. Sullivan. 1989. Severe herpesvirus infections in an adolescent without natural killer cells. N Engl J Med 320: 1731-1735. Bruniquel, D. and R.H. Schwartz. 2003. Selective, stable demethylation of the interleukin-2 gene enhances transcription by an active process. Nat Immunol 4: 235-240. Bryceson, Y.T., M.E. March, H.G. Ljunggren, and E.O. Long. 2006. Activation, coactivation, and costimulation of resting human natural killer cells. Immunol Rev 214: 73-91.  22  Chan, H.W., Z.B. Kurago, C.A. Stewart, M.J. Wilson, M.P. Martin, B.E. Mace, M. Carrington, J. Trowsdale, and C.T. Lutz. 2003. DNA methylation maintains allelespecific KIR gene expression in human natural killer cells. JExp Med 197: 245-255. Chan, H.W., J.S. Miller, M.B. Moore, and C.T. Lutz. 2005. Epigenetic control of highly homologous killer Ig-like receptor gene alleles. J Immunol 175: 5966-5974. Chess, A., I. Simon, H. Cedar, and R. Axel. 1994. Allelic inactivation regulates olfactory receptor gene expression. Cell 78: 823-834. Davies, G.E., S.M. Locke, P.W. Wright, H. Li, R.J. Hanson, J.S. Miller, and S.K. Anderson. 2007. Identification of bidirectional promoters in the human KIR genes. Genes Immun 8: 245 253. -  Dorfman, J.R. and D.H. Raulet. 1998. Acquisition of Ly49 receptor expression by developing natural killer cells. JExp Med 187: 609-618. Eagle, R.A. and J. Trowsdale. 2007. Promiscuity and the single receptor: NKG2D. Nat Rev Immunol 7: 737 744. -  Fernandez, N.C., E. Treiner, R.E. Vance, A.M. Jamieson, S. Lemieux, and D.H. Raulet. 2005. A subset of natural killer cells achieves self-tolerance without expressing inhibitory receptors specific for self-MHC molecules. Blood 105: 4416-4423. Gays, F., J.G. Aust, D.M. Reid, J. Falconer, N. Toyama-Sorimachi, P.R. Taylor, and C.G. Brooks. 2006. Ly49B is expressed on multiple subpopulations of myeloid cells. J Immunol 177: 5840 5851. -  Gimelbrant, A., J.N. Hutchinson, B.R. Thompson, and A. Chess. 2007. Widespread monoallelic expression on human autosomes. Science 318: 1136-1140.  23  Goldmit, M., Y. Ji, J. Skok, E. Roldan, S. Jung, H. Cedar, and Y. Bergman. 2005. Epigenetic ontogeny of the Igk locus during B cell development. Nat Immunol 6: 198-203. Go11, M.G. and T.H. Bestor. 2005. Eukaryotic cytosine methyltransferases. Annu Rev Biochem 74: 481 514. -  Gosselin, P., A.P. Makrigiannis, R. Nalewaik, and S.K. Anderson. 2000. Characterization of the Ly49I promoter. Immunogenetics 51: 326-331. Hayakawa, Y., N.D. Huntington, S.L. Nutt, and M.J. Smyth. 2006. Functional subsets of mouse natural killer cells. Immunol Rev 214: 47-55. Held, W. and B. Kunz. 1998. An allele-specific, stochastic gene expression process controls the expression of multiple Ly49 family genes and generates a diverse, MHC-specific NK cell receptor repertoire. Eur J Immunol 28: 2407-2416. Held, W. and D.H. Raulet. 1997. Expression of the Ly49A gene in murine natural killer cell clones is predominantly but not exclusively mono-allelic. Eur J Immunol 27: 28762884. Johansson, S., M. Johansson, E. Rosmaraki, G. Vahlne, R. Mehr, M. Salmon-Divon, F. Lemonnier, K. Kane, and P. Hoglund. 2005. Natural killer cell education in mice with single or multiple major histocompatibility complex class I molecules. J Exp Med 201: 1145-1155.  Kelley, J., L. Walter, and J. Trowsdale. 2005a. Comparative genomics of major histocompatibility complexes. Immunogenetics 56: 683-695. Kelley, J., L. Walter, and J. Trowsdale. 2005b. Comparative genomics of natural killer cell receptor gene clusters. PLoS Genet 1: e27.  24  Kim, S., J. Poursine-Laurent, S.M. Truscott, L. Lybarger, Y.J. Song, L. Yang, A.R. French, J.B. Sunwoo, S. Lemieux, T.H. Hansen, and W.M. Yokoyama. 2005. Licensing of natural killer cells by host major histocompatibility complex class I molecules. Nature 436: 709 713. -  Kouzarides, T. 2007. Chromatin modifications and their function. Cell 128: 693-705. Krangel, M.S. 2007. T cell development: better living through chromatin. Nat Immunol 8: 687-694. Kubota, A., S. Kubota, S. Lohwasser, D.L. Mager, and F. Takei. 1999. Diversity of NK cell receptor repertoire in adult and neonatal mice. Jlmmunol 163: 212-216. Lanier, L.L. 2003. Natural killer cell receptor signaling. Curr Opin Immunol 15: 308-314. Laskay, T., M. Rollinghoff, and W. Solbach. 1993. Natural killer cells participate in the early defense against Leishmania major infection in mice. Eur Jlmmunol 23: 2237-2241. Makrigiannis, A.P., D. Patel, M.L. Goulet, K. Dewar, and S.K. Anderson. 2005. Direct sequence comparison of two divergent class I MHC natural killer cell receptor haplotypes. Genes Immun 6: 71-83. Makrigiannis, A.P., A.T. Pau, P.L. Schwartzberg, D.W. McVicar, T.W. Beck, and S.K. Anderson. 2002. A BAC contig map of the Ly49 gene cluster in 129 mice reveals extensive differences in gene content relative to C57BL/6 mice. Genomics 79: 437444. Mandelboim, 0., N. Lieberman, M. Lev, L. Paul, T.I. Amon, Y. Bushkin, D.M. Davis, J.L. Strominger, J.W. Yewdell, and A. Porgador. 2001. Recognition of haemagglutinins on virus-infected cells by NKp46 activates lysis by human NK cells. Nature 409: 1055-1060.  25  McQueen, K.L. and P. Parham. 2002. Variable receptors controlling activation and inhibition of NK cells. Curr Opin Immunol 14: 615-621. McQueen, K.L., B.T. Wilhelm, K.D. Harden, and D.L. Mager. 2002. Evolution of NK receptors: a single Ly49 and multiple KIR genes in the cow. Eur Jlmmunol 32: 810817. McQueen, K.L., B.T. Wilhelm, F. Takei, and D.L. Mager. 2001. Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes. Immunogenetics 52: 212-223. Murrell, A., S. Heeson, and W. Reik. 2004. Interaction between differentially methylated regions partitions the imprinted genes Igf2 and H19 into parent-specific chromatin loops. Nat Genet 36: 889-893. Nakamura, M.C., S. Hayashi, E.C. Niemi, J.C. Ryan, and W.E. Seaman. 2000. Activating Ly-49D and inhibitory Ly-49A natural killer cell receptors demonstrate distinct requirements for interaction with H2-D(d). JExp Med 192: 447-454. Nakamura, M.C., P.A. Linnemeyer, E.C. Niemi, L.H. Mason, J.R. Ortaldo, J.C. Ryan, and W.E. Seaman. 1999. Mouse Ly-49D recognizes H-2Dd and activates natural killer cell cytotoxicity. JExp Med 189: 493-500. Nakao, M. 2001. Epigenetics: interaction of DNA methylation and chromatin. Gene 278: 2531. Olcese, L., A. Cambiaggi, G. Semenzato, C. Bottino, A. Moretta, and E. Vivier. 1997. Human killer cell activatory receptors for MHC class I molecules are included in a multimeric complex expressed by natural killer cells. Jlmmunol 158: 5083-5086.  26  Ortaldo, J.R., R. Winkler-Pickett, J. Willette-Brown, R.L. Wange, S.K. Anderson, G.J. Palumbo, L.H. Mason, and D.W. McVicar. 1999. Structure/function relationship of activating Ly-49D and inhibitory Ly-49G2 NK receptors. J Immunol 163: 5269-5277. Parham, P. 2005. MHC class I molecules and KIRs in human history, health and survival. Nat Rev Immunol 5: 201 214. -  Parham, P. 2006. Taking license with natural killer cell maturation and repertoire development. Immunol Rev 214: 155-160. Pascal, V., M.J. Stulberg, and S.K. Anderson. 2006. Regulation of class I major histocompatibility complex receptor expression in natural killer cells: one promoter is not enough! Immunol Rev 214: 9-21. Radeloff, B., L. Nagler, M. Zirra, A. Ziegler, and A. Volz. 2005. Specific amplification of cDNA ends (SPACE): a new tool for the analysis of rare transcripts and its application for the promoter analysis of killer cell receptor genes. DNA Seq 16: 4452. Raulet, D.H., R.E. Vance, and C.W. McMahon. 2001. Regulation of the natural killer cell receptor repertoire. Annu Rev Immunol 19: 291-330. Rogers, S .L., A. Rouhi, F. Takei, and D.L. Mager. 2006. A role for DNA hypomethylation and histone acetylation in maintaining allele-specific expression of mouse NKG2A in developing and mature NK cells. J Immunol 177: 414-421. Saleh, A., G.E. Davies, V. Pascal, P.W. Wright, D.L. Hodge, E.H. Cho, S.J. Lockett, M. Abshari, and S.K. Anderson. 2004. Identification of probabilistic transcriptional switches in the Ly49 gene cluster: a eukaryotic mechanism for selective gene activation. Immunity 21: 55-66.  27  Saleh, A., A.P. Makrigiannis, D.L. Hodge, and S.K. Anderson. 2002. Identification of a novel Ly49 promoter that is active in bone marrow and fetal thymus. J Immuno1168: 5163-5169. Santourlidis, S., H.I. Trompeter, S. Weinhold, B. Eisermann, K.L. Meyer, P. Wernet, and M. Uhrberg. 2002. Crucial role of DNA methylation in determination of clonally distributed killer cell Ig-like receptor expression patterns in NK cells. Jlmmunol 169: 4253-4261. Schwarzenbacher, K., J. Fleischer, H. Breer, and S. Conzelmann. 2004. Expression of olfactory receptors in the cribriform mesenchyme during prenatal development. Gene Expr Patterns 4: 543 552. -  Shen, L., Y. Kondo, Y. Guo, J. Zhang, L. Zhang, S. Ahmed, J. Shu, X. Chen, R.A. Waterland, and J.P. Issa. 2007. Genome-wide profiling of DNA methylation reveals a class of normally methylated CpG island promoters. PLoS Genet 3: 2023-2036. Shykind, B.M. 2005. Regulation of odorant receptors: one allele at a time. Hum Mol Genet 14 Spec No 1: R33 39. -  Silver, E.T., D.E. Gong, C.S. Chang, A. Amrani, P. Santamaria, and K.P. Kane. 2000. Ly49P activates NK-mediated lysis by recognizing H-2Dd. Jlmmunol 165: 1771-1781. Smale, S.T. and A.G. Fisher. 2002. Chromatin structure and gene regulation in the immune system. Annu Rev Immunol 20: 427 462. -  Smith, H.R., J.W. Heusel, I.K. Mehta, S. Kim, B.G. Dorner, O.V. Naidenko, K. Iizuka, H. Furukawa, D.L. Beckman, J.T. Pingel, A.A. Scalzo, D.H. Fremont, and W.M. Yokoyama. 2002. Recognition of a virus-encoded ligand by a natural killer cell activation receptor. Proc Natl Acad Sci U S A 99: 8826-8831.  28  Stulberg,^P.W. Wright, H. Dang, R.J. Hanson, J.S. Miller, and S.K. Anderson. 2007. "Identification of distal KIR promoters and transcripts. Genes Immun 8: 124-130. Su, R.C., K.E. Brown, S. Saaber, A.G. Fisher, M. Merkenschlager, and S.T. Smale. 2004. Dynamic assembly of silent chromatin during thymocyte maturation. Nat Genet 36: 502-506. Takei, F., K.L. McQueen, M. Maeda, B.T. Wilhelm, S. Lohwasser, R.H. Lian, and D.L. Mager. 2001. Ly49 and CD94/NKG2: developmentally regulated expression and evolution. Immunol Rev 181: 90-103. Tanamachi, D.M., D.C. Moniot, D. Cado, S.D. Liu, J.K. Hsia, and D.H. Raulet. 2004. Genomic Ly49A transgenes: basis of variegated Ly49A gene expression and identification of a critical regulatory element. J Immunol 172: 1074-1082. Toyama-Sorimachi, N., Y. Tsujimura, M. Maruya, A. Onoda, T. Kubota, S. Koyasu, K. Inaba, and H. Karasuyama. 2004. Ly49Q, a member of the Ly49 family that is selectively expressed on myeloid lineage cells and involved in regulation of cytoskeletal architecture. Proc Natl Acad Sci USA 101: 1016-1021. Turnbull, I.R. and M. Colonna. 2007. Activating and inhibitory functions of DAP12. Nat Rev Immunol 7: 155-161.  Valiante, N.M., M. Uhrberg, H.G. Shilling, K. Lienert-Weidenbach, K.L. Arnett, A. D'Andrea, J.H. Phillips, L.L. Lanier, and P. Parham. 1997. Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity 7: 739-751.  29  Van Beneden, K., F. Stevenaert, A. De Creus, V. Debacker, J. De Boever, J. Plum, and G. Leclercq. 2001. Expression of Ly49E and CD94/NKG2 on fetal and adult NK cells. J Immunol 166: 4302-4311.  Vance, R.E., A.M. Jamieson, D. Cado, and D.H. Raulet. 2002. Implications of CD94 deficiency and mono-allelic NKG2A expression for natural killer cell development and repertoire formation. Proc Natl Acad Sci U S A 99: 868-873. Veinotte, L.L., B.T. Wilhelm, D.L. Mager, and F. Takei. 2003. Acquisition of MHC-specific receptors on murine natural killer cells. Crit Rev Immunol 23: 251-266. Warren, H.S., P.M. Rana, D.T. Rieger, K.A. Hewitt, J.E. Dahlstrom, and A.L. Kent. 2006. CD8 T cells expressing killer Ig-like receptors and NKG2A are present in cord blood and express a more naive phenotype than their counterparts in adult blood. J Leukoc Biol 79: 1252-1259.  Wilhelm, B.T., L. Gagnier, and D.L. Mager. 2002. Sequence analysis of the Ly49 cluster in C57BL/6 mice: a rapidly evolving multigene family in the immune system. Genomics 80: 646-661.  Wilhelm, B.T. and D.L. Mager. 2004. Rapid expansion of the Ly49 gene cluster in rat. Genomics 84: 218-221.  Wilhelm, B.T., K.L. McQueen, J.D. Freeman, F. Takei, and D.L. Mager. 2001. Comparative analysis of the promoter regions and transcriptional start sites of mouse Ly49 genes. Immunogenetics 53: 215-224.  Williams, N.S., A. Kubota, M. Bennett, V. Kumar, and F. Takei. 2000. Clonal analysis of NK cell development from bone marrow progenitors in vitro: orderly acquisition of receptor gene expression. Eur J Immunol 30: 2074-2082.  30  Yokoyama, W.M. and B.F. Plougastel. 2003 Immune functions encoded by the natural killer gene complex. Nat Rev Immunol 3: 304-316.  http://www.new-science-press.com/info/illustration_files/nsp-immunity-4-3-4_6jpg  31  Chapter 2 Evidence for epigenetic maintenance of Ly49a mono-allelic gene expression'  1 A version of this chapter has been published. Rouhi, A., L. Gagnier, F. Takei, and D.L. Mager. 2006. Evidence for epigenetic maintenance of Ly49a mono-allelic gene expression. J Immunol 176: 2991-2999. L. Gagnier assisted with the bisulfate cloning.  32  2.1 Introduction The Ly49 and KIR NK receptor genes share the same variegated pattern of expression. A recent study presented evidence that an upstream, bidirectional Ly49 promoter, Pro-1, acts as a probabilistic switch that establishes activity of the downstream major promoter, Pro-2 (Saleh et al., 2004; Saleh et al., 2002). However, the molecular mechanisms that maintain stable Pro-2 activity in mature NK cells are unknown. It has been established that KIR transcription is in part regulated by epigenetic mechanisms primarily through differential DNA methylation of their CpG island promoters (Chan et al., 2003; Santourlidis et al., 2002). Held et al. (Held et al., 1999a) suggested that the maintenance of mono-allelic Ly49 expression may be achieved via DNA methylation. This suggestion was proposed on the basis of the relative stability of mono-allelic expression of Ly49 receptors on cultured NK cells (Held and Raulet, 1997), but no studies to examine the methylation state of Ly49 genes or alleles have been published. In this study, we have investigated the epigenetic state of the Ly49a Pro-2 region in primary NK cells and cell lines and show a strong link between DNA hypomethylation, histone acetylation, and transcriptional activity of the gene. These findings support the view that DNA methylation plays a role in maintaining Ly49 expression patterns.  33  2.2 Materials and Methods  2.2.1 Mice All mice were bred and maintained in the animal facility of the British Columbia Cancer Research Centre (Vancouver, British Columbia, Canada). Fl hybrids were generated by crossing female BALB/c with C57BL/6 (B6) males. All mice used in this study were 6-10 weeks old unless specified otherwise. All experiments were according to a protocol approved by the Committee on Animal Care of the University of British Columbia (Appendix I).  2.2.2 Antibodies, cell separation, and flow cytometry The monoclonal antibodies (mAbs) anti-FcRy (2.4G2), biotin-conjugated YE1/48 (anti-Ly49A BALB/c and B6), biotin-conjugated 4L03311 (anti-Ly49C BALB/c and B6) have been described (Brennan et al., 1996; Takei et al., 1997). Biotin-conjugated Al (antiLy49A B6-specific), anti- CD3c-PerCP-Cy5.5 (145-2C11), anti- NK1.1-PE, anti-NK1.1APC, anti-Ter-119-PE and fluorochrome-conjugated streptavidin were purchased from BD Biosciences (Mississauga, Ontario, Canada). FITC-conjugated anti-Ly49E/C (4D12) antibody was kindly provided by Dr. G. Leclercq (University of Ghent, Ghent, Belgium). Flow cytometry for cell sorting was performed on BD FACSAriaTM Cell Sorting System (Mississauga, Ontario, Canada). All sorted samples were 95 % pure.  2.2.3 Fetal liver NK cell retrieval and sort Embryonic day 175 B6 embryos were dissected for extraction of whole liver in icecold lx PBS. Single cell suspension of liver cells was stained with anti-Ter-119-PE and  34  immunomagnetically depleted of embryonic erythrocytes via the Easysep kit (StemCell Technologies Inc. Vancouver BC) according to manufacture's protocol. The remaining cells were stained with anti- CD3c-PerCP-Cy5.5 (145-2C11), anti-NK1.1-APC and FITCconjugated anti-Ly49E/C (4D12) and sorted for NK1.1 + CD3s - and Ly49E positive and negative populations on BD FACSAriaTM Cell Sorting System. The sorted populations were resorted for^% purity.  2.2.4 Primary cell and tissue genomic DNA (gDNA) extraction  Genomic DNA was obtained by pelleting FACS sorted cells via centrifugation and lysis by addition of 50p,1 of water. The lysate was incubated 10min at 98°C after which proteinase K was added to a final concentration of lmg/ml. The lysate was further incubated for 130min at 55°C and 10min at 98°C. gDNA was extracted from fresh B6 mouse kidney and pancreas using DNAzol reagent (Invitrogen Life Technologies) per manufacturer's instructions. Further proteinase K digestion and phenol-chloroform extraction was performed.  2.2.5 Cell culture The B6 NKT cell line, EIA, the IL-2 independent T-cell line, CTLL2 (obtained from  T. Gonda, Hanson Center for Cancer Research, Adelaide, Australia) (Wilhelm et al., 2003), and the pancreatic endothelium cell line, MS1 (ATCC CRL-2279; American Type Culture Collection), were cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin, and 100U/m1 streptomycin.  35  2.2.6 Chromatin remodeling drug treatment and RT-PCR  EL4 cells were cultured at an initial concentration 10 4 cells/ml for 24h and treated with varying amounts and combinations of 5-aza-cytidine (5-aza-C) and trichostatin-A (TSA) for 96h before RNA extraction. Total RNA was extracted from EM cells with Trizol Reagent (Invitrogen Life Technologies) per manufacturer's instruction. RT-PCR was performed as described before (McQueen et al., 2001) with the gene-specific primers for Ly49a, Forward primer: 5'- GGT CAC TTA TTC AAT GGT G -3', Reverse primer: 5'-  AGA TAA CAA CAT ACA TCC C -3'; Ly49d, Forward primer: 5'-CGG AAG CCT GAA AAA GCT CG -3', Reverse primer: 5'- TCA CAC AGT ATG TTT TGA TCC C -3'; Ly49g, Forward primer: 5'- TTG CCA CGA TAA CTG CAG CC -3', Reverse primer: 5'- ATG TCT GAA GGA GCC AGG TTC -3'; fl-actin, Forward primer: 5'- GAG GGC TAT GCT CTC CCT CA -3', Reverse primer: 5'- GCG CAA GTT AGG TTT TGT CAA -3' and a general primer pair for Ly49c-like (Ly49c/e/f/i/j) transcripts, Forward primer: 5'- TCA TAA GTC TTC AGG GTT G -3', Reverse primer: 5'- ATC ATA AGA CAA TCC AAT CC -3'.  2.2.7 Sodium bisulfate-conversion and PCR  Bisulfite conversion of DNA leads to conversion of all unmethylated cytosines into uracils, while methylated cytosines remain unchanged. Bisulfite conversion was performed using the CpGenome DNA Modification Kit (CHEMICON International, Inc. CA, formerly, Intergen, NY) according to the manufacturer's protocol with the following exceptions: gDNA was re-suspended in 0.304 NaOH and heated at 50°C for 10min The gDNA was incubated with the kit's reagent-I at 50°C for a total of nearly 4h with 30s pulses to 95°C every 15min The conversion rate was >98%. First-round PCR amplification of Ly49a 5' 36  region was performed using forward flanking Ly49a-specific primer: 5'-GTG TTT TTG TTT TTT TTG TAG GAG TT-3' and reverse flanking Ly49a-specific primer: 5'-AAA AAA TCA CAA TTA TCA CAT ACT C-3'. Converted DNA was used as template in a 45kd reaction volume, containing 30pmol of each primer, 1mM dNTPs, 3mM MgC12, and 0.5U Taq Platinum DNA polymerase (Qiagen). After initial denaturation for 7min at 95°C, 30-40 cycles were performed, each consisting of 90s at 95°C, 55s at 53°C, and 30s at 72°C followed by a final extension of 7min at 72°C . Two microliters of the first PCR was used for semi-nested amplification using forward nested primer: 5'- TGT TTT GAG GGT TAG GTT TTA TTA A-3' and the same reverse primer used in the first round. The same amplification conditions were chosen as for first-round PCR with the exception that the annealing temperature was raised to 54°C and the extension time was reduced to 20s. For the Ly49c 5'region the following primers were used: forward flanking Ly49c-specific primer: 5'-TTA AAG ATA ATG TTT TTT TTT TTT TGT AGT-3'; reverse flanking Ly49c-specific primer: 5'- CAA TTA TCA CAT ACT ACC AAA ATT-3'; forward nested Ly49c-specific primer: 5'- AAT AAG TAA TTT TTT TTT TTT GTT TTG G-3'; reverse nested Ly49c-specific primer: 5'- TTC AAT ATA TTT AAT CAT TTA ATA AAA AC-3'.  2.2.8 Bisulfite sequencing and combined bisulfate and restriction enzyme analysis (COBRA)  The PCR products were electrophoresed on 1% agarose gel and correct size bands were extracted using the MinElute gel extraction kit (Qiagen). To exclude any Ly49g  37  fragments that might have amplified along with the Ly49a fragments, the purified bands were subjected to Earl (NEB) restriction enzyme digest, per manufacturer's instructions, which selectively cuts Ly49g in the amplified region. The digested products were gel extracted using the MinElute gel extraction kit (Qiagen). The purified products were cloned into the Tvector using the pGEMT-vector kit (Promega). Sequencing was performed using the SP6 primer by McGill University and Genome Quebec Innovation Centre sequencing facility. All clones included in the figures are unique. Each clone was considered unique if it satisfied at least one of the following criteria: 1) if it contained a unique CpG pattern. 2) If the clone contained any unique unconverted (ie. from C to T) non-CpG cytosines assuming that the clone's total C to T conversion was within the random 95% cut-off limit. 3) If the clone contained any unique substitution of non-cytosine (non-CpG) base due to Taq-polymerase errors assuming that there were two or less of such events within a clone. 4) If there were identical clones in sequence that were derived from independent original gDNA samples. In cases where variation among various COBRA batches was observed (in particular Ly49A +, Ly49C + samples) the bisulfite sequencing data was derived from 10 to 16 independent PCRs (two to three independent cell sorting events) for a more accurate estimation of the DNA methylation state. For COBRA, the Earl-digested gel purified fragments were digested with Tael and/or Acll restriction enzymes (NEB) to distinguish between methylated (CpG) and unmethylated (TpG). Tael and Acll recognize and cut 5 '-TCGA-3'and 5 '-AACGTT-3' respectively and therefore will only cut fragments that were originally methylated in the gDNA and hence have not been converted by sodium bisulfite treatment.  38  2.2.9 Chromatin immunoprecipitation (ChIP) assays and Quantitative Real-time PCR ChIP assays were performed using a Chromatin Immunoprecipitation Assay kit (Upstate  Biotechnology) according to the manufacturer's instructions. Briefly, cells were cross-linked with 1% formaldehyde at 37 °C for 10min Cells were washed twice with ice-cold phosphatebuffered saline (PBS). Cell pellets were lysed in the SDS lysis buffer provided in the kit. Lysates were sonicated at 30% power, 6 x 5s using a Sonic Dismembrator model 300 (Fisher Scientific, Pittsburgh, PA) on ice to shear gDNA. The following Abs were used to perform immunoprecipitations, polyclonal anti-acetyl-histone 113 (Lysine-9) (Upstate Biotechnology) and polyclonal Anti-acetyl-histone H4 (multiple residues) (Upstate Biotechnology). Subsequent washes, elution and de-cross-linking were done according to manufacturer's protocol. The DNA was purified via QIAquick PCR purification (Qiagen) and resuspended in 40;11 of deionised water. Quantitative PCR amplification of the promoter-2 (Pro2) region of Ly49a was performed using Ly49a-specific forward primer 5'- CAA CTT TTT CCT CCA CCA GAA C-3' and Ly49a-specific reverse primer 5% CGA GCG CTC AGA TAA CAC TAC-3'. The housekeeping gene p-glucuronidase (gus-b) was used as a positive control and for normalization of the data (primers kindly provided by Dr. Lars Palmqvist, Sahlgren's University Hospital, Gotenberg, Sweden). Forty-eight rounds of amplification with SYBR® Green PCR Master Mix (Applied Biosystems) were performed. The default 7500 System SDS software version 1.2.10 (7500 RealTime PCR System, Applied Biosystems) cycle was used with the exception that amplification was performed at 62°C in a total volume of 204 Dissociation curve analysis was performed after the end of the PCR to confirm the presence of a single and specific product.  39  2.3 Results  2.3.1 CpG distribution of the Ly49 Pro-2 region  The human KIR genes have classical CpG island promoters, where the CpG density is much higher than the rest of the human genome (Gardiner-Garden and Frommer, 1987), and CpG sites are generally well conserved among the promoters (Santourlidis et al., 2002). In contrast, both promoter-1 (Pro-1) and promoter-2 (Pro-2) of the mouse Ly49 genes are CpGpoor. That is, the CpG density of these regions is on par with the average CpG distribution of the mouse genome. The distribution and conservation of CpG dinucleotides in the Pro-2 region of several Ly49 genes is shown in Figure 2.1. Pro-2 is the major promoter in mature NK cells and gives rise to multiple transcriptional start sites in the genes that have been analysed (Wilhelm et al., 2001). In general Ly49 genes that are closely related, namely Ly49c, i, e and f, show a more conserved CpG distribution among the genes as would be  expected. However, compared to the highly related KIR genes, there is much less CpG conservation among the Ly49 genes in this region. Nevertheless, since DNA methylation of even a single CpG residue has been shown to be functionally important (Santoro and Grummt, 2001), the low density of CpGs does not preclude a role for DNA methylation in this gene cluster.  40  Ly49a  Ly49g  1  Ly49c  Ly49i  Ly49e  Ly49i  Figure 2.1 Location of CpG dinucleotides in the Pro-2 regions of inhibitory Ly49 genes.  A 340 by region surrounding Pro-2 regions of Ly49a, c, e, f, g and i was aligned. CpG dinucleotides are represented by vertical lines. The approximate locations of transcription start sites mapped by 5'RACE are indicated by brackets for Ly49a and c. The bent arrows indicate the 5' ends of the following mRNA sequences Ly49i mRNA (U4986); Ly49e mRNA (U10091); Ly49fmRNA (U10092). For Ly49g, transcription was shown to be initiated mostly from promoter-3 (Pro-3) located near exon2 (in primary NK cells) which is not shown in this figure (26). A CpG dinucleotide conserved between Ly49a and c is indicated with a crescent symbol. Two CpG dinucleotides conserved among Ly49c, i, e orf are shown with star symbols. A single CpG site conserved among Ly49c, e, f and i is shown with a sun symbol. 2.3.2 Differential DNA methylation of the Ly49a and Ly49c Pro-2 regions in primary NK cells  To investigate the role of DNA methylation in Ly49 gene expression, we examined the methylation state of the Ly49a regulatory region in Ly49A-positive and negative primary NK cells from C57BL/6 (B6) mice. As mentioned above, both Pro-1 and Pro-2 of Ly49a are CpG-poor (Figure 2.2A). The Pro-1 region of Ly49a contains only two CpG dinucleotides but the Pro-2 region, where transcription in mature NK cells originates (Saleh et al., 2002; 41  Wilhelm et al., 2001), contains six CpG dinucleotides within an approximately 340 by range. This region, which we collectively call the Ly49a Pro-2 region, covers Pro-2, exon 1 and part of intron 1 (Figure 2.2B).  A.  Pro-1  Pro-2  Scale: 500bp -  ■ Exon 1  ■ Exon 2  B. •■ cictttgttletgagggtcaggtttcattaatgagggtcaggtttcattaagcagtttcctctttttgictttgati G  sac aggaggagcataaaatcatgaggttgagtatctctcagtggaaatttagttctact ttattttggag  acacttaggggatatcaaccagaaaaagccaactttttcctccaccagaaccacttcttgCtagcga.caca g A  taacaataactgtttttatttgttttctactaaactatcaaatatattttcaggtagtgttatCtgagtg--1  -  G  at tgat ggggaaggcctgttagt tgt tttagat cagttaaat ccgggagcatgtgacaactgtgatt ct t cat c •^  Figure 2.2 Ly49a Pro-2 region.  A. Locations of all CpG dinucleotides relative to the Pro-1 and the Pro-2 regions of  Ly49a. CpGs are represented by vertical lines, black boxes represent exons and the bent arrows indicate promoter regions and the direction of transcription. Ly49 genes typically  have two promoters. The putative Promoter-1 (Pro-1) is located upstream of exon la and is active in immature NK cells. Promoter-2 (Pro-2) is located upstream of exon 1 and is the main promoter in mature NK cells. Exon 2 includes the ATG start codon. The CpGs within the boxed region of Pro-2 were assayed for methylation in this study. B. Nucleotide sequence of the boxed area in part A. The CpG dinucleotides are shaded. The CpG dinucleotide assayed in COBRA by Tael is shown by a star symbol; the two TCF-1 sites (Held et al., 1995) are indicated with boxes; the ATF-2 biniding site (Kubo et al., 1999) is shown with a dashed line above the sequence; the underlined region indicates 42  the interval in which transcriptional start sites for Ly49a have been mapped (Wilhelm et al., 2001). The horizontal arrows represent the nested bisulfite primers and the dashed horizontal arrows the location of the ChIP primers. The exonl/intronl boundary is indicated with a horizontal line. This sequence is from the B6 Ly49a and the nucleotides shown below each line are the polymorphisms from the BALB/c sequence (Anderson et al., 2005). There are two polymorphisms within the region amplified by the nested bisulfite primers and a third polymorphism within the 5' primer that can not be detected using this primer pair. To determine the DNA methylation status of this region, we collected primary exvivo 136 adult splenic NK cells (CDR - NK1.1) by sorting, according to Ly49A surface expression, into expressing and non-expressing fractions. DNA was isolated from each fraction and sodium bisulfite sequencing and combined bisulfite restriction analysis (COBRA) was performed. As shown in Figure 2.3A, the CpG dinucleotides located in the Pro-2 region of Ly49a are heavily methylated in Ly49A NK cells. In contrast, in DNA from Ly49A + cells, half of the clones sequenced were completely unmethylated and the other half were heavily methylated as in the Ly49A fraction (Figure 2.3B). COBRA of Ly49A + NK cells, which assays one CpG in the region (Figure 2.2B), also showed the nearly equal presence of methylated and unmethylated sites in DNA from Ly49A + cells (Figure 2.3C). Hence, this methylation pattern is likely not due to patchy methylation or partial hypomethylation of this region but rather may reflect the mono-allelic expression of Ly49a, a possibility tested directly below.  43  ••• 000 • 0 •• ••  ••• ••• •  o o  0 0  •  •••••• •••• GO  IS  •• ••• ••  B. -  0  ••• •  0  0  -  0 0 0  0 0 0 0 0 0  -  00 0 CO 0 0 00^ 0 0^00 0 -  • • IN 00 • • 0^•• • • IS • • •• • ••  ••  •  C.  1 2 3 4 Unmethylated—• Methylated ► —  Figure 2.3 Methylation status of Ly49a Pro-2 region in primary C57BL/6 Ly49A nonexpressing and expressing NK cells.  Each line represents the sequence of an independent clone. The white and black circles represent unmethylated and methylated CpGs respectively. A. Bisulfite sequencing of Ly49A non-expressing NK cells (YE1/48 negative). B. Bisulfite sequencing of Ly49A expressing NK cells (YE1/48 positive) assayed from ten independent gDNA samples. C. COBRA of Ly49A + NK cells in four independent samples. The location of the CpG dinucleotide assayed by COBRA is indicated by a star symbol in Figure 2.2B. Fragments that retain a CpG dinucleotide at this location are digested by Tael restriction endonuclease indicating methylation in the original genomic DNA. Fragments that remain uncut contain a TpG instead of a CpG which indicates that in the original genomic DNA template this CpG was unmethylated. The over representation of the unmethylated signal in the COBRA samples might be due to some heteroduplex formation during PCR and hence inhibition of the restriction enzyme digestion (Warnecke et al., 2002).  44  Ly49c is also shown to be mono-allelically expressed (Held and Kunz, 1998), so we  investigated the methylation pattern of Ly49c Pro-2 region in Ly49C + cells. As with Ly49a, the Ly49c Pro-1 and Pro-2 regions are CpG poor (Figure 2.4A). We observed the same pattern of DNA methylation for the Ly49C + NK cells, where the presence of unmethylated and methylated clones was detected via bisulfite sequencing and COBRA (Figure 2.4B and C respectively). In Ly49C adult NK cells this region is highly methylated as indicated by bisulfite sequencing (Figure 2.4D).  A. Pro-1  I I ^I  Pro-2  ■  Exon 1 a  B.  Tacrl  Scale: 500bp  0  0-  0  0  0-  0 0  •  •  • •  0 0- • •  •• ••  ••  •0•  •• •• •0 •• 0-  •  0  •• •• • •  00  ■ Exon2  D.  C.  Ac1-1  11  ■ Exonl  Taq'l 1 2 3 4  0-  00 0 • •  Acl-I 12  •  •••  •  •• • ••  •  0  • •  •• • ••^ •0^•• •• •  U M  Figure 2.4 Methylation status of Ly49c Pro-2 region in primary ex-vivo C57BL/6 Ly49C expressing NK cells.  A. Vertical lines depict CpG sites relative to Pro-1 and Pro-2 (arrows) of Ly49c. The positions of exons la, 1 and 2 (small boxes) are also shown. The Pro-2 region of Ly49c analysed is indicated with the open box. Methylation state of the seven CpG residues located within the open box in part A from Ly49C positive (4L03311) NK cells assayed by bisulfite sequencing from twelve independent PCRs (B) and COBRA on four independent samples with TaeI and another two independent samples with AclI (C). The locations of the CpG dinucleotides assayed with COBRA by TaeI and Acll restriction endonucleases are shown 45  by arrows in part B. Digestion by the AclI enzyme at either of its two recognition sites would generate a band labeled "methylated". The slight over-representation of the methylated clones might be due to a small amount of PCR bias for the methylated allele (Warnecke et al., 1997). D. Methylation of Ly49c Pro-2 in Ly49C negative NK cells. Each line represents the sequence of an independent clone. The white and black circles represent unmethylated and methylated CpGs respectively. 2.3.3 Ly49A mono allelic gene expression is linked with DNA methylation profile -  To investigate the link between DNA methylation pattern of the Ly49a Pro-2 region and mono-allelic expression of Ly49A, we generated C57BL/6 x BALB/c Fl hybrid mice. For the Ly49A - population, Fl NK cells were sorted using the YE1/48 antibody, which recognizes both B6 and BALB/c Ly49A, and DNA was subjected to bisulfite analysis. In this Ly49A - population, the region was heavily methylated as evident from bisulfite sequencing and COBRA (Figure 25A and B). For the Ly49A B6+ fraction, we sorted Fl NK cells that stained positive with the Al antibody, which detects only the B6 allele of Ly49A (Held et al., 1995). As expected, COBRA of DNA from Ly49A B6+ cells showed the presence of both methylated and unmethylated CpG residues (data not shown). Two polymoiphisms between B6 and BALB/c Ly49a in the region of interest (shown in Figure 22B) were used to distinguish the allelic origin of templates analyzed by bisulfite sequencing. In DNA from Ly49AB6+ F1 NK cells, all BALB/c alleles sequenced were heavily methylated and all B6 alleles were largely unmethylated (Figure 2.5C). This result demonstrates that transcriptional activity of Ly49a alleles is associated with lack of DNA methylation in the Pro-2 region. Although a small percentage of Ly49A + cells ( -%5) should express Ly49A from both alleles (Held and Kunz, 1998; Held and Raulet, 1997) we did not detect any unmethylated BALB alleles in the Ly49A B6+ (stained only with the Al antibody) fraction. The failure to detect such clones may be due to the low percentage of double positive cells.  46  A.^  •••  0  •  •  o  0 0 0  • a  0 ••  C. BAL13/C allele  la  IF 0-  0^111 0 0^S  00  6 4 0^• o•0 ^• •  46 44 OD * * • II  • 0  •  O  00 a 00 0 4111 • as 0  =8=t=it=lt  •  0 0 6  B.  •  0 • 0^I 0^• 0^a  0 SD •  * 0 6 0  •4  C56BL/6 allele  1^2^3 4  O  U M —4  0^0  O 0^• 0- 0--  CO  00 0 CO 0  0  0 o 0 G^  OD GO CO 00 OD OD 03  0 0 0 0 0 0 0  O o^•• ^0 0 0^0 O -o^0  O0  Figure 2.5 Methylation status of Ly49a Pro-2 region in primary Fl hybrid Ly49A double negative and Ly49A B6+ NK cells.  A. Bisulfite sequencing and B. COBRA (four independent samples) of Ly49A nonexpressing (YE1/48 negative) NK cells. The location of the site assayed by COBRA is shown with a star in Figure 2.2B. C. Bisulfite sequencing of Ly49A B6 expressing NK cells (Al positive) derived from sixteen independent gDNA samples. The methylation profiles of B6 and BALB/C alleles are shown individually. 23.4 Variable DNA methylation of Ly49a in non lymphoid tissues -  Ly49A expression is limited to lymphocytes probably because non-lymphoid cells do not possess the transcription factor repertoire needed to express this gene (Held et al., 1999b). We therefore hypothesized that there would be less need for maintenance of a hypermethylated state at the Ly49a locus in non-lymphoid cells. To test this hypothesis, we analyzed the methylation status of the Ly49a Pro-2 region in DNA from freshly isolated B6 kidney and pancreas (pooled from three mice) via COBRA. We found a mix of methylated and unmethylated CpGs in both the pancreas and kidney (Figure 2.6A). There is a significant  47  level of hypomethylation in the pancreas and to a lesser level in the kidney at least for one CpG site. This hypomethylation is not due to the incomplete digestion of the fragments by the enzyme (data not shown). To further investigate the DNA methylation state of the Ly49a Pro-2 region in non-lymphoid tissues, we performed bisulfite sequencing on pancreatic gDNA (Figure 2.6B). The DNA methylation of this region in pancreatic cells is generally lower than that observed in Ly49A NK cells.  48  Pancreas^Kidney 1 M—#  B.  2^3^1^2  isk 111.  • o o • •o  • 0^et^o ---o^•^is^• o^o^is^o • •^ell^o •^•^so oo o^I^IS • ♦^••^0 0^•^••^0 • ♦^OD^• 0^•^OD^• • •^••^0 0^•^••^0 • • •^•0^0 0^•^•0^0 0^•^•o^0 0^•^H 0 o^•^0•^0  •  0 o •  0 0  0  •  • • o C.  1^2^3^4 U  —.  M^40*  D.  0 • • •  •  ••  •  0 • 0 •  • • •  oI •  ••  ••  •••• -••• •• 5• 55 so • IS o  Figure 2.6 Methylation status of Ly49a Pro-2 region in fresh B6 non-lymphoid tissue and fetal NK cells. A. COBRA of Ly49a Pro-2 region of fresh pancreas and kidney (three and two  independent samples respectively) from B6 mouse. B. Methylation of Ly49a Pro-2 region in pancreas assayed by bisulfite sequencing. C. COBRA (four independent samples) and D. bisulfite sequencing of the same region in primary ex-vivo fetal (day17.5) liver NK cells. The location of the site assayed by COBRA is shown with a star in Figure 22B.  2.3.5 Ly49a Pro2 is methylated in primary ex vivo fetal NK1.1 + NK cells -  To gain insight into DNA methylation of the Ly49a Pro-2 region and Ly49 ontogeny, we examined the methylation state of Ly49a in fetal NK cells. Primary fetal NK cells from  49  B6 mice do not express any Ly49 genes except Ly49e (Toomey et al., 1998; Van Beneden et al., 1999). IL-2 dependent expansion of fetal day 17 (FD17) splenic and thymic NK cells also does not lead to expression of Ly49A (Van Beneden et al., 1999). As well, we did not detect Ly49A on the surface of IL-2 expanded B6 FD17.5 liver NK cells via flow cytometry (data not shown). We sorted fresh liver NK cells from FD17.5 embryos, isolated DNA, and performed bisulfite sequencing and COBRA at the Ly49a Pro-2 region. As evident from the COBRA analysis, there is heavy methylation of the assayable CpG site in FD17.5 NK cells (Figure 2.6C). Bisulfite sequencing revealed nearly complete methylation of all CpG dinucleotides (Figure 2.6D). To address the possibility that the heavy DNA methylation of the Ly49a Pro-2 region is a characteristic of fetal NK cells rather than a phenomenon based on transcription, we analysed the methylation status of Ly49e in Ly49E expressing FD17.5 NK cells. As expected, the Ly49e Pro-2 region contains both methylated and unmethylated CpGs as assayed with COBRA (unpublished data).  2.3.6 Linkage of DNA methylation status with histone acetylation of the Ly49a promoter region  DNA hypo-methylation and histone acetylation usually correlate with transcriptional activity but this is not always the case (Fu et al., 2005; Walsh and Bestor, 1999). To determine if these two epigenetic marks are correlated with Ly49 expression, we used cell lines positive and negative for Ly49A expression. As judged by bisulfite sequencing and/or COBRA analysis, the methylation profile of Ly49a in B6 lymphoid and non-lymphoid cell lines mimics that seen in primary cells. The Pro-2 region of Ly49a is mostly unmethylated in the NKT cell line EL4, which expresses Ly49A ( ›)7% by FACS), but is heavily methylated  50  in the Ly49A T-cell line CTLL2 (negative by FACS and RT-PCR) and partially methylated -  in the pancreatic endothelium cell line MS1 (data not shown). We examined the histone acetylation status of the Ly49a Pro-2 region in these cell lines using chromatin immunoprecipitation (ChIP). Primers for the specific region analyzed are shown by dashed arrows in figure 22B. We observed a significant enrichment of Ly49a in acetyl-lysine-9413 and acetyl-114 (multiple residues) fractions for EL4 compared to the Ly49A cell lines CTLL2 and MS1 (Figure 2.7a). The Ly49a region in EL4 cells is more than one hundred fold enriched in H3-acetyl-lysine-9 fraction compared to CTLL2 and to slightly lesser extent compared to MS 1. The same differential levels of Ly49a enrichment were detected in the acetyl-H4 fractions. Interestingly, there is a slight enrichment (less than 3 fold) of this region in the H3-acetyl-lysine-9 fraction of MS 1 compared to CTLL2 which correlates with the less dense DNA methylation in MS1 compared to CTLL2.  51  ^  •  B.  A. V)  co  /.co'r  4 (7  0.5  0 0  0^k  ^9 0 • 0  0.4  47. 4,^43 43 4?^CP 4 4 4 4b ,moo^  0 0 C) 0  Ly49a  c 0.3  0  Ly49c-like co  Ly49d  0.2  Ly49g  E •  actin 0.1  0)  <  0.0 2  ^ ^ 3  2  ^  3  Acetyl-H3 Lysine-9^Acetyl-H4  Figure 2.7 Histone acetylation and effect of chromatin remodeling drugs.  A. Chromatin immunoprecipitations (ChIP) of the Ly49a Pro-2 region in Lymphoid and non-lymphoid cell lines. ChIP analysis with anti-acetyl-Lysine-9 H3 and anti-acetyl-H4 (multiple residues) antibodies on 1. EL4, 2. CTLL2 and 3. MS1. The fold enrichments relative to the endogenous control are presented as 1/2 °ct ; where ACt is the difference between the threshold cycles (Ct) of Ly49a and the endogenous control (gus-b) of the same immunoprecipitation (IP). Enrichment is calculated as 2 °Ct where approximately every 3.3 cycle difference is equivalent to 10 fold enrichment. The data is the average of three independent ChIP experiments (E1/2 Act) plus standard deviation (SD) performed in duplicates. The enrichment of the control gene was equal among the three cell lines in all fractions and the non-specific enrichment (no-antibody control) of both the control gene and Ly49a was very low in all three cell lines (data not shown). B. Induction of Ly49 transcription in EL4 by 5-aza-cytidine and/or Trichostatin-A treatment. Cells were cultured in various drug conditions for 96hr. Total RNA was isolated and RT-PCR was performed using gene-specific primers for /3-actin and Ly49a (35 cycles), Ly49d and g (37 cycles) and a general primer pair for Ly49c-like transcripts, Ly49c, e, f i and j (40cycles). 2.3.7 Effect of chromatin remodeling drugs on Ly49 transcription  Although the Ly49 genes are similar in sequence and may share the same transcription factor repertoire, it is unknown if they share a similar link between epigenetic 52  modifications and transcription. As a preliminary step to answering this question, we treated ELA cells with the DNA methyltransferase inhibitor 5-aza-cytidine (5-aza-C) and the histone ,  deacetylase inhibitor trichostatin-A (TSA). Because the Ly49a locus in EL4 is already in a state of open chromatin, no changes in Ly49a transcription were expected and none were detected. However, these treatments induced the detectable transcription of a number of other Ly49 genes. Most transcripts were detected with the combination of the two drugs. Ly49d, g  and at least one of Ly49c, e, f i and j were detected in EL4 (Figure 2.7B).  53  2.4 Discussion Here we have extensively analysed the DNA methylation state of the Pro-2 region of Ly49a in B6 and Fl hybrid NK cells. Ly49A expression and DNA hypo-methylation  correlate where, only the transcribed Ly49a allele is unmethylated. In NK cells that do not express Ly49A, both alleles are hyper-methylated. Apart from the general hypo or hyper methylation, it seems that the four most 3' CpG dinucleotides, which are located in exon-1 and intron-1 (Figure 2.2B), are most indicative of the expression state of the allele. In the Ly49A NK cells of adult B6, fetal B6 and the BALB/c allele of Ly49A B6+ F1 hybrid NK cells, these CpGs are nearly completely methylated. This pattern of DNA methylation may indicate an intronic control element or a general mechanism for the prevention of transcription from Pro-2 via the creation of transcriptionally restrictive chromatin. Previous work by our group showed that a region including the end of exon-1, all of intron-1 and the beginning of exon-2, has insignificant promoter activity in transient transfection assays in lymphoid cell lines (McQueen et al., 2001). Even though possible enhancer activity by this region can not be ruled out, it is likely that when this region is methylated, the formation of closed chromatin is induced which spreads into the promoter region and inhibits transcription from Pro-2. Indeed we have shown a significant difference in histone acetylation levels of the Ly49a Pro-2 region between Ly49A positive and negative cell lines. Since the DNA  methylation profile of the cell lines reflects that of the primary cells, it is quite probable that the primary cell histone acetylation profile also reflects that of the cell lines. A closed chromatin structure of downstream regions has also been shown to inhibit transcriptional elongation by RNA polymerase II (Lorincz et al., 2004).  54  Ly49a expression was shown to be dependent on the transcription factor, T-cell factor-1  (TCF-1) (Held et al., 1999b). However, the TCF-1 protein is present in equal amount in both Ly49A expressing and non-expressing primary NK cells. Therefore, the decision to express Ly49A or which allele to express it from, is not dependent on the presence of TCF-1. Rather, we propose that epigenetic mechanisms are responsible for the maintenance of the stable clonal mono-allelic gene expression of Ly49a and possibly other Ly49 genes. We observed the same correlation between Ly49c expression and DNA methylation of the Pro-2 region of this gene in B6 NK cells as we have seen with Ly49a. Interestingly, the Ly49a Pro-2 region is significantly less methylated (P <0.001 as calculated by Chi square) in primary non-lymphoid pancreatic cells compared with the region in all Ly49A-non-expressing NK cells (B6 fetal, B6 adult, Fl double-negative and Fl BALB alleles). In fresh pancreatic cells, the Ly49a Pro-2 region is patch methylated and this pattern is quite different from that of Ly49A NK cells. Additionally, we observed a slight increase -  in the enrichment of the acetylated histones for this region from MS 1 cells. This apparent DNA hypomethylation and possibly a less restrictive chromatin structure in non-lymphoid tissue at the Ly49a Pro-2 region may indicate a lack of need for the maintenance of a closed chromatin structure due to the absence of lymphoid specific transcription factors. We speculate that the maintenance of heavy methylation of Ly49a Pro-2 region is only necessary in Ly49A non-expressing lymphoid cells because they contain the transactivating factors to express this gene (Held et al., 1999b; Kubo et al., 1999). In accord with this idea is the finding that the IL-4 gene region in fibroblast cells, which lack the ability to express this gene, was shown to be hypo-methylated compared to the IL-4 non-expressing T-cells (Santangelo et al., 2002).  55  There are differing views on the acquisition order of Ly49A receptor by NK cells. Depending on the developmental stage of the NK progenitor or the culture system used, Ly49A was measured to be the first (Dorfman and Raulet, 1998) or one of the last (Williams et al., 2000) Ly49 receptors to be expressed. However, there are no reports of Ly49A expression on fetal NK cells and our own analysis has also confirmed this. It seems that regardless of its acquisition order, Ly49A expression is restricted to post-natal and adult NK and NKT cells. Indeed, we have found that Ly49a Pro-2 region of FD 17.5 liver NK cells is highly methylated which not only correlates with the expression pattern of this receptor but also may indicate that at this stage in mouse development Ly49a transcription has not been initiated yet. An upstream promoter, Pro-1, that seems to be active only in immature NK cells was identified for the inhibitory Ly49 genes (Saleh et al., 2002). Pro-1 is essential for the expression of Ly49a as its deletion in an Ly49a transgene model abolished Ly49 expression in NK, T and B cells (Tanamachi et al., 2004). This transgenic Ly49a construct was expressed with the same ontogeny as the native wildtype gene in NK cells regardless of gene copy number and genomic position suggesting that the initiation of Ly49a expression is primarily dependent on the developmental stage of the NK cell and not on genomic location (Tanamachi et al., 2004). However, the deregulated expression of Ly49a in B-cells, which normally do not express it, may suggest aberrant epigenetic regulation due to multiple gene copies and change in the genomic location of the gene. Pro-1 has been shown to act as a binary switch with the ability to transcribe in two directions and the strength of forward and reverse transcription from Pro-1 correlated well  56  with the percentage of NK cells expressing a given Ly49 (Saleh et al., 2004). It is possible that the variegated expression of Ly49a is due to the variegated expression from Pro-1 but the mechanism that ultimately stabilises and maintains the fmal expression pattern is likely epigenetic. Pro-1 is hypersensitive to DNaseI in Ly49A expressing and non-expressing cells but not in non-lymphoid tissue (Tanamachi et al., 2004), suggesting that the lymphoidspecific control is applied at another location, possibly Pro-2. We believe that the presence of the Pro-1 region is not sufficient for maintenance of tissue specific and mono-allelic Ly49a expression. In the V(D)J regions of the immunoglobulin heavy chain locus, non-coding genic and intergenic transcripts appear before the rearrangement of each region and act to open up the chromatin to allow accessibility of the recombination machinery (Bolland et al., 2004). In the immature NK cells, forward transcripts originating from Pro-1 might lead to the opening of the closed chromatin of Pro-2 and subsequent transcription from Pro-2 (Saleh et al., 2004). In every individual NK cell the combination of Ly49 alleles expressed may be further reinforced and maintained by the chromatin structure of the Pro-2 region. In the KIR system of human NK cells, there is a generally high acetylation level for H3 and H4 of all the genes in the cluster regardless of expression state (Uhrberg, 2005). A recent study has shown that the histone acetylation level of KIR3DL1 is similar in KIR3DL1expressing and non-expressing NK cell lines and IL-2 expanded primary NK cells (Chan et al., 2005). This is contrary to what we have found in mouse cell lines for Ly49a where we observe a significant difference between acetylation levels of the Ly49a Pro-2 region among expressing and non-expressing cell lines. We observed very low levels of histone acetylation for the Ly49e Pro-2 region which is not expressed by any of the cell lines tested (unpublished data). This difference in types of epigenetic control between KIR and Ly49 genes may be due  57  to distance between the genes in the cluster. The KIR genes are located very close together in a small 150kb cluster whereas the Ly49 genes (excluding Ly49b) are spread out over a 650kb region (Santourlidis et al., 2002; Takei et al., 2001). It is possible that the Ly49 genes have insulators between adjacent genes that would prevent spreading of open or closed chromatin from one gene to the other whereas such insulators may not exist in the KIR cluster. Indeed, differential DNA methylation may be sufficient for maintenance of KIR gene expression (Chan et al., 2003; Chan et al., 2005; Santourlidis et al., 2002). This proposed mechanism is supported by the fact that transcription of KIR genes can be readily induced in NK cells by DNA methyltranferase inhibitors but not by the histone deacetylase inhibitor trichostatin-A (TSA) (Santourlidis et al., 2002). We have detected transcripts from the majority of Ly49 genes after treatment of EL4 cells with chromatin remodelling drugs, but the response of the genes to these drugs seems to be variable. Ly49g seems to be the most responsive to these drugs and we are currently investigating the link between Ly49g transcription and epigenetic mechanisms (Rouhi et al., 2007). It is tempting to speculate that the different Ly49 genes are controlled by somewhat different epigenetic mechanisms and that the density of CpG dinucleotides in the promoter regions affects their maintenance capacity. In light of new evidence on the plasticity of the Ly49 repertoire of lymphoid cells in response to various cytokines (Gays et al., 2005), the involvement of epigenetic mechanisms seems plausible. The EL4 cell line is the most permissive lymphoid cell line to Ly49 transcription. Promoter constructs of Ly49c, f g, i and j have activity in EL4 even though these genes are not usually expressed by this cell line (Kunz and Held, 2001; McQueen et al., 2001). In accordance with the hypothesis of epigenetic control of Ly49 transcription, our chromatinremodelling drug treatment of EL4 led to the detection of transcripts from these genes.  58  However, we also detected Ly49d transcripts in ETA after drug-treatment. This is contrary to the promoter construct experiment performed by Kunz and Held (2001) where their Ly49d Pro-2 construct had no activity in the RA cell line (Kunz and Held, 2001). Experiments with chromatin remodelling drugs are known to produce false positive and false negative results, as these drugs affect the whole genome. However, it is also possible that the Ly49d transcripts detected were transcribed from a promoter other than Pro-2. Further work is needed to determine the role of epigenetic mechanisms in the transcriptional control of various Ly49 genes. In general, we expected the Ly49 genes to be less responsive to DNA methyltransferase inhibitors compared to the KIR genes because the promoter structure and CpG content of the two gene families are quite different. CpG island promoters, such as those of the KIR genes, tend to respond much more readily to such agents (Brueckner et al., 2005; Lodygin et al., 2005). The Ly49 genes responded best to combinations of DNA methyltransferase and histone deacetylase inhibitors. Although it is not possible to make any firm conclusions about the variable effect of epigenetic mechanisms on the regulation of all Ly49 genes from our chromatin remodelling drug experiments, we can deduce a general trend  underlining the effect of histone acetylation levels on transcriptional control of these genes. In the present study, we have shown a strong association between lack of DNA methylation and expression of the Ly49a gene in primary NK cells. We have also determined a positive link between mono-allelic expression and mono-allelic DNA methylation pattern. We propose that differential epigenetic modifications are likely major factors in maintenance of the stable clonal and mono-allelic Ly49 repertoire of NK cells. It would be interesting to determine if the transcribed and the non-transcribed Ly49 alleles have different replication  59  timings and nuclear organization as these seem to be additional epigenetic features related to random mono-allelic gene expression (Singh et al., 2003).  60  2.5 Bibliography  Anderson, S.K., K. Dewar, M.L. Goulet, G. Leveque, and A.P. Makrigiannis. 2005. Complete elucidation of a minimal class I MHC natural killer cell receptor haplotype. Genes Immun 6: 481  -  92.  Bolland, DJ., A .L. Wood, C.M. Johnston, S.F. Bunting, G. Morgan, L. Chakalova, PJ. Fraser, and A.E. Corcoran. 2004. Antisense intergenic transcription in V(D)J recombination. Nat Immunol 5: 630-637. Brennan, J., S. Lemieux, J.D. Freeman, D.L. Mager, and F. Takei. 1996. Heterogeneity among Ly-49C natural killer (NK) cells: characterization of highly related receptors with differing functions and expression patterns. JExp Med 184: 2085-2090. Brueckner, B., R.G. Boy, P. Siedlecki, T. Musch, H.C. Kliem, P. Zielenkiewicz, S. Suhai, M. Wiessler, and F. Lyko. 2005. Epigenetic reactivation of tumor suppressor genes by a novel small-molecule inhibitor of human DNA methyltransferases. Cancer Res 65: 6305-6311. Chan, H.W., Z.B. Kurago, C.A. Stewart, M.J. Wilson, M.P. Martin, B.E. Mace, M. Carrington, J. Trowsdale, and C.T. Lutz. 2003. DNA methylation maintains allelespecific KIR gene expression in human natural killer cells. JExp Med 197: 245-255. Chan, H.W., J.S. Miller, M.B. Moore, and C.T. Lutz. 2005. Epigenetic control of highly homologous killer Ig-like receptor gene alleles. J Immunol 175: 5966-5974. Dorfman, J.R. and D.H. Raulet. 1998. Acquisition of Ly49 receptor expression by developing natural killer cells. JExp Med 187: 609-618.  61  Fu, X.H., D.P. Liu, X.B. Tang, G. Liu, X. Lv, Y.J. Li, and C.C. Liang. 2005. A conserved, extended chromatin opening within alpha-globin locus during development. Exp Cell Res 309: 174 184. -  Gardiner-Garden, M. and M. Frommer 1987. CpG islands in vertebrate genomes. J Mol Biol 196: 261-282.  Gays, F., K. Martin, R. Kenefeck, J.G. Aust, and C.G. Brooks. 2005. Multiple cytokines regulate the NK gene complex-encoded receptor repertoire of mature NK cells and T cells. Jlmmunol 175: 2938-2947. Held, W. and B. Kunz. 1998. An allele-specific, stochastic gene expression process controls the expression of multiple Ly49 family genes and generates a diverse, MHC-specific NK cell receptor repertoire. Eur Jlmmunol 28: 2407-2416. Held, W., B. Kunz, V. Ioannidis, and B. Lowin-Kropf. 1999a. Mono-allelic Ly49 NK cell receptor expression. Semin Immunol 11: 349-355. Held, W., B. Kunz, B. Lowin-Kropf, M. van de Wetering, and H. Clevers. 1999b. Clonal acquisition of the Ly49A NK cell receptor is dependent on the trans-acting factor TCF-1. Immunity 11: 433-442. Held, W. and D.H. Raulet. 1997. Expression of the Ly49A gene in murine natural killer cell clones is predominantly but not exclusively mono-allelic. Eur Jlmmunol 27: 28762884. Held, W., J. Roland, and D.H. Raulet. 1995. Allelic exclusion of Ly49-family genes encoding class I MHC-specific receptors on NK cells. Nature 376: 355-358.  62  Kubo, S., R. Nagasawa, H. Nishimura, K. Shigemoto, and N. Maruyama. 1999. ATF-2binding regulatory element is responsible for the Ly49A expression in murine T lymphoid line, EL-4. Biochim Biophys Acta 1444: 191-200. Kunz, B. and W. Held. 2001. Positive and negative roles of the trans-acting T cell factor-1 for the acquisition of distinct Ly-49 MHC class I receptors by NK cells. J Immunol 166: 6181-6187.  Lodygin, D., A. Epanchintsev, A. Menssen, J. Diebold, and H. Hermeking. 2005. Functional epigenomics identifies genes frequently silenced in prostate cancer. Cancer Res 65: 4218-4227. Lorincz, M.C., D.R. Dickerson, M. Schmitt, and M. Groudine. 2004. Intragenic DNA methylation alters chromatin structure and elongation efficiency in mammalian cells. Nat Struct Mol Biol 11: 1068 1075. -  McQueen, K.L., B.T. Wilhelm, F. Takei, and D.L. Mager. 2001. Functional analysis of 5' and 3' regions of the closely related Ly49c and j genes. Immunogenetics 52: 212-223. Rouhi, A., C.G. Brooks, F. Takei, and D.L. Mager. 2007. Plasticity of Ly49g expression is due to epigenetics. Mol Immunol 44: 821-826. Saleh, A., G.E. Davies, V. Pascal, P.W. Wright, D.L. Hodge, E.H. Cho, Si. Lockett, M. Abshari, and S.K. Anderson. 2004. Identification of probabilistic transcriptional switches in the Ly49 gene cluster: a eukaryotic mechanism for selective gene activation. Immunity 21: 55-66. Saleh, A., A.P. Makrigiannis, D.L. Hodge, and S.K. Anderson. 2002. Identification of a novel Ly49 promoter that is active in bone marrow and fetal thymus. J Immuno1168: 5163-5169.  63  Santangelo, S., D.J. Cousins, N.E. Winkelmann, and D.Z. Staynov. 2002. DNA methylation changes at human Th2 cytokine genes coincide with DNase I hypersensitive site formation during CD4( 4) T cell differentiation. Jlmmunol 169: 1893-1903. Santoro, R. and I. Grummt. 2001. Molecular mechanisms mediating methylation-dependent silencing of ribosomal gene transcription. Mol Cell 8: 719-725. Santourlidis, S., H.I. Trompeter, S. Weinhold, B. Eisermann, K.L. Meyer, P. Wernet, and M. Uhrberg. 2002. Crucial role of DNA methylation in determination of clonally distributed killer cell Ig-like receptor expression patterns in NK cells. Jlmmunol 169: 4253-4261. Singh, N., F.A. Ebrahimi, A.A. Gimelbrant, A.W. Ensminger, M.R. Tackett, P. Qi, J. Gribnau, and A. Chess. 2003. Coordination of the random asynchronous replication of autosomal loci. Nat Genet 33: 339-341. Takei, F., J. Brennan, and D.L. Mager. 1997. The Ly-49 family: genes, proteins and recognition of class I MHC. Immunol Rev 155: 67-77. Takei, F., K.L. McQueen, M. Maeda, B.T. Wilhelm, S. Lohwasser, R.H. Lian, and D.L. Mager. 2001. Ly49 and CD94/NKG2: developmentally regulated expression and evolution. Immunol Rev 181: 90-103. Tanamachi, D.M., D.C. Moniot, D. Cado, S.D. Liu, J.K. Hsia, and D.H. Raulet. 2004. Genomic Ly49A transgenes: basis of variegated Ly49A gene expression and identification of a critical regulatory element. Jlmmunol 172: 1074-1082. Toomey, JA., S. Shrestha, S.A. de la Rue, F. Gays, J.H. Robinson, Z.M. ChrzanowskaLightowlers, and C.G. Brooks. 1998. MHC class I expression protects target cells from lysis by Ly49-deficient fetal NK cells. Eur Jlmmunol 28: 47-56.  64  Uhrberg, M. 2005. Shaping the human NK cell repertoire: an epigenetic glance at KIR gene regulation. Mo/ Immunol 42: 471-475. Van Beneden, K., A. De Creus, V. Debacker, J. De Boever, J. Plum, and G. Leclercq. 1999. Murine fetal natural killer cells are functionally and structurally distinct from adult natural killer cells. J Leukoc Biol 66: 625-633. Walsh, C.P. and T.H. Bestor. 1999. Cytosine methylation and mammalian development. Genes Dev 13: 26 34. -  Warnecke, P.M., C. Stirzaker, J.R. Melki, D.S. Millar, C.L. Paul, and S.J. Clark. 1997. Detection and measurement of PCR bias in quantitative methylation analysis of bisulphite-treated DNA. Nucleic Acids Res 25: 4422-4426. Warnecke, P.M., C. Stirzaker, J. Song, C. Grunau, J.R. Melki, and S.J. Clark. 2002. Identification and resolution of artifacts in bisulfate sequencing. Methods 27: 101107. Wilhelm, B.T., J.R. Landry, F. Takei, and D.L. Mager. 2003. Transcriptional control of murine CD94 gene: differential usage of dual promoters by lymphoid cell types. J Immunol 171: 4219 4226. -  Wilhelm, B.T., K.L. McQueen, J.D. Freeman, F. Takei, and D.L. Mager. 2001. Comparative analysis of the promoter regions and transcriptional start sites of mouse Ly49 genes. Immunogenetics 53: 215 224. -  Williams, N.S., A. Kubota, M. Bennett, V. Kumar, and F. Takei. 2000. Clonal analysis of NK cell development from bone marrow progenitors in vitro: orderly acquisition of receptor gene expression. Eur J Immunol 30: 2074-2082.  65  Chapter 3 Plasticity of Ly49g expression is due to epigenetics 2  A version of this chapter has been published. Rouhi, A., C.G. Brooks, F. Takei, and D.L. Mager. 2007. Plasticity of Ly49g expression is due to epigenetics. Mol Immunol 44: 821826. C.G. Brooks provided the RMA-E3 cell line and comments on the manuscript. 2  66  3.1 Introduction  Although the Ly49 receptor repertoire of NK and NKT cells was thought to be quite stable (Dorfman and Raulet, 1998; Veinotte et al., 2003), there is evidence for change in receptor and allele repertoire in IL-2 cultured primary NK cells (Gays et al., 2005; Makrigiannis et al., 2004). In addition, Ly49A and, in particular, Ly49G expression is highly unstable in the NKT cell line EL4 and its derivative sublines (Gays et al., 2000). Some EM sublines such as RMA-D3 and RMA-E3 heterogeneously express Ly49G and this expression correlates with variable mRNA levels (Gays et al., 2000). In this study, we have investigated the connection between the epigenetic state of the Ly49g 5'-region and plastic expression of Ly49G on EL4 sublines and show a strong link between histone acetylation levels and expression of the gene. Our findings support the view that epigenetic mechanisms are involved in the maintenance of Ly49 expression patterns. Moreover, it appears that the quality and magnitude of this effect may vary among different Ly49 genes.  67  3.2. Materials and Methods  3.2.1 Cell culture  The B6 lymphoid cell lines CTLL-2 (obtained from T. Gonda, Hanson Center for Cancer Research, Adelaide, Australia), EL4, RMA-E3 and the pancreatic endothelium cell line, MS1 (ATCC CRL-2279), were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 U/ml streptomycin.  3.2.2 Chromatin remodelling drug treatment and RT PCR -  EM cells were cultured at an initial concentration of 10 4 cells/ml for 24 h and treated with varying amounts and combinations of 5-aza-cytidine (5-aza-C) and trichostatin-A (TSA) for 96 h before RNA extraction. Total RNA was extracted from EL4 cells with Trizol Reagent (Invitrogen) per manufacturer's instruction. RT-PCR was performed as described before with the gene-specific primers for Ly49g and f3-actin (Rouhi et al., 2006).  3.2.3 5' amplification of cDNA ends (5' RACE) -  5'-Rapid Amplification of cDNA Ends (5'-RACE) was performed on RNA extracted from EM and RMA-E3 cells using the FirstChoice RML-RACE kit (Ambion) per manufacturer's protocol with Ly49g-specific primers (sequences available upon request). The products were cloned into the T-vector using the pGEMT-vector kit (Promega). Sequencing was performed using the T7 primer by McGill University and Genome Quebec Innovation Centre sequencing facility.  68  3.2.4 Antibodies, cell separation and flow cytometry  FITC-conjugated 4D11 (anti-Ly49G) was purchased from BD Biosciences (Mississauga, Ont., Canada). Flow cytometry for cell sorting was performed on BD FACSAriaTM Cell Sorting System (Mississauga, Ont., Canada).  3.2.5 Chromatin immunoprecipitation (ChIP) assays and Quantitative Real time PCR -  Chromatin immunoprecipitation (ChIP) assays were performed using a chromatin immunoprecipitation assay kit (Upstate Biotechnology) according to the manufacturer's instructions and as described before (Rouhi et al., 2006). Quantitative PCR amplification of the Pro-2 regions of Ly49e and g was performed using Ly49e-specific forward primer 5'GCA ATT TCC TCC TTT TGC TTA GAT A-3'; Ly49e-specific reverse primer 5'-TGG AGG GAA AAG TTG GGT GAA A-3; Ly49g-specific forward primer 5'-CAC AGG AAT CAC TTC TCA GTA GA-3' and Ly49g-specific reverse primer 5'-ATC GAG CGC TCA CAT AAC ACT AT-3'. The Pro-2 region of Ly49a was also amplified with gene-specific primers as described before (Rouhi et al., 2006). The housekeeping gene /3-glucuronidase (gus b) was used as a positive control (primers kindly provided by Dr. Lars Palmqvist, -  Sahlgren's University Hospital, Gotenburg, Sweden). Forty-eight rounds of amplification with SYBR® Green PCR Master Mix (Applied Biosystems) were performed. The default 7500 System SDS software version 1.2.10 (7500 RealTime PCR System, Applied Biosystems) cycle was used with the exception that amplification was performed at 62°C in a total volume of 20 pl. Dissociation curve analysis was performed after the end of the PCR to confirm the presence of a single and specific product.  69  3.3 Results 3.3.1 CpG distribution of the Ly49g 5'-region  The C57BL/6 Ly49g gene is located in the middle of the Ly49 cluster, just telomeric to Ly49i. (Takei et al., 2001; Wilhelm et al., 2002) Three promoters have been identified for Ly49g (Figure 3.1). Pro-1 is active in immature NK cells and appears to act as a bidirectional  switch to establish transcription from downstream promoters (Saleh et al., 2004; Saleh et al., 2002). Pro-2 and Pro-3 are the promoters used in mature lymphoid cells (Smith et al., 1994; Wilhelm et al., 2001). Pro-3  Pro-1  Pro-2^  III^11 11  f^ ■  ^  Exon is  ^  ■ Exon lb  1. 1 1 11 Hill ^  Exon 1^  Exon 2  Scale: 500bp  Figure 3.1 Ly49g upstream region in the C57BL/6 mouse strain. Three promoters have been reported for Ly49g. The putative Promoter-1 (Pro-1) is located upstream of exon la; Promoter-2 (Pro-2) is located upstream of exon 1 and Promoter-3 (Pro3) is located in intronl near exon 2. Exon 2 includes the ATG start codon. CpGs are represented by vertical lines, black boxes represent exons and the bent arrows indicate promoter regions and the direction of transcription. The approximate location of Pro-3 transcription start sites, as mapped by 5'RACE (Wilhelm et al. 2001) is shown with bracket.  All three Ly49g promoters are CpG-poor. Moreover, regarding DNA methylation potential, it is noteworthy that Ly49g has only two CpG sites in the 1 kb vicinity of the major promoter, Pro-2, (Figure 3.1), which is lower than the CpG content of other inhibitory Ly49 genes (Rouhi et al., 2006).  70  3.3.2. Chromatin remodeling drugs induce Ly49g transcription  An Ly49g Pro-2 construct showed high promoter activity by transient transfection assays in EL4 cells, indicating that the lack of transcription of Ly49g in this cell line is not due to absence of the required transcription factor repertoire (Kunz and Held, 2001). To test whether a restrictive chromatin state is responsible for lack of expression of Ly49G in an Ly49G-non-expressing EL4 subline, we treated these cells with the DNA methyltransferase inhibitor 5-aza-cytidine (5-aza-C) and the histone deacetylase inhibitor trichostatin-A (TSA) to attempt to induce transcription via chromatin opening (Figure 3.2). We detect none to very low levels of Ly49g transcripts in two independent untreated cultures of our EL4 line. When EL4 was treated with increasing concentrations of the chromatin remodeling drugs, Ly49g transcript was detected in increasingly higher amounts. Treatment with 5-aza-C had some effect on the induction of Ly49g but TSA had a larger overall effect as evident from Figure 3.2. Ar  (P  co  c)  §  A4?^  4 4 4 4 4-  a;^,z1t^cO4 5 Ly49g^Ow  ao  Actin^it  5  e  ham, Milla  id  00  Figure 3.2 Induction of Ly49g transcription via chromatin remodelling drugs. The B6 NKT cell-line, EL4, was treated with varying amounts and combinations of 5-azacytidine (5-aza-C) and trichostatin-A (TSA) for 96hr before RNA extraction. RT-PCR was performed with the gene-specific primers for Ly49g and /3 actin. -  71  3.3.3. Determination of promoter of origin for Ly49g transcripts To determine which of the three Ly49g promoters is inducible by chromatin remodelling drugs, we performed 5'-RACE on multiple batches of EL4 cells treated with these drugs. The results indicate Pro-2 as the main promoter activated by the chromatin remodelling drugs in EL4 (Figure 3.3). We also detected a small number of Pro-3 transcripts (data not shown) which initiated from a site previously shown to be frequently used in primary NK cells (Wilhelm et al., 2001). As observed previously for primary NK cells (Wilhelm et al., 2001), we found that the locations of transcriptional start sites were heterogeneous, reflecting the fact that most Ly49 genes lack a strong TATA box. These results suggest that transcription from both Pro-2 and Pro-3 may be controlled epigenetically. In addition, we performed 5'RACE for Ly49g on the Ly49G-expressing RMA-E3 cell line and also identified Pro-2 as the primary promoter used (Figure 3.3). 3  1  2  2  4 4, 4 4 AGGAGCMTCATGAGG1TGAGTATCACTCAGTGGAAATTTAGTTCTACTG'FITTIT GGAGACACTTA ,  33^  3 1  GGGGATATCAACCAGAAAAAGCCAAC tilliCTCCACAGGAATCACTICICAGTAGAGACACA TAACAAT AACTGC 1 1 1 sATTGG illiCTACTAAATGATCAAATATAATITCAGATAGTGTTATOTGAGCGCMGATTGATG  Figure 3.3 Determination Ly49g promoter of origin in RMA-E3 and TSA treated EL4 cells.  5'-Rapid Amplification of cDNA Ends (5'-RACE) was performed on RNA extracted from three independent batches of EL4 cells treated with chromatin remodelling drugs (100nM TSA, 4,uM 5-aza-C +50nM TSA and 4M 5-aza-C + 100nM TSA) with Ly49g-specific primers. The same procedure was performed for bulk RMA-E3 cells. The RMA-E3 Ly49g transcription start sites are indicated with arrows above the sequence and those of drugtreated EL4 are shown with arrows below. The numbers adjacent to the arrows show the number of clones originating from that specific nucleotide. The star shows the start of the cDNA sequences deposited in Genbank (U10093 and U10095). The bracket indicates the boundary of exon 1 and intron 1. The Ly49g-specific ChIP primers are shown with underlined bold text. Primers were chosen in this location to prevent cross amplification of 72  Ly49a and at the same time amplify the region containing the two CpG dinucleotides in the Ly49g Pro-2 region (both located within the 3' primer).  3.3.4. Histone acetylation is strongly linked to Ly49g transcription  Although the chromatin remodelling drugs induced Ly49g expression, it is not certain if this induction is due to the opening of the Ly49g promoter region or whether it is an indirect effect. We performed chromatin immunoprecipitation (ChIP) on the Ly49g Pro-2 region in the Ly49G'" g'' RMA-E3 (Figure 3.4a) and Ly49G-non-expressing EL4, CTLL-2 (Tcell) and MS 1 (pancreatic endothelium) cell lines to determine if Ly49G expression and histone acetylation levels are linked. Acetylation status of histone H3-lysine-9 and multiple residues of histone H4 was assayed (Figure 3.4b) and we observed a significantly higher amount of histone acetylation at the Ly49g Pro-2 region in RMA-E3 compared to EM and the other Ly49G cell lines.  73  a.  b.  C. SX104 7)00'  Acetyl H3-K9 Acetyl H4^•  SX104 5X104 4X104 3X104 2X10*  0  Ly49e  14499  Ly49a  Figure 3.4 Chromatin immunoprecipitation (ChIP) assays and Quantitative Real-time PCR a. FACS plot of the expression of Ly49G by RMA-E3 cells as indicated by 4D11 antibody staining. The Ly49G hig n RMA-E3 cells (gated area) were sorted for use in ChIP assays. b. ChIP analysis with anti-acetyl-Lysine-9 H3 and anti-acetyl-H4 (multiple residues) antibodies on RMA-E3 (NKT cell line), EL4 (NKT cell line), CTLL2 (T-cell line) and MS1  74  (pancreatic endothelium) numbered 1 to 4 respectively. The fold enrichments relative to the endogenous control are presented as 1/2 °a ; where ACt is the difference between the threshold cycles (Ct) of Ly49g and the endogenous control (gus b) of the same immunoprecipitation (IP). The data is the average of three independent ChIP experiments (E /2 Act/.3) plus standard deviation. c. The fold enrichments of Ly49a, e and g relative to their respective no-antibody controls in anti-acetyl-Lysine-9 H3 and anti-acetyl-I-14 (multiple residues) fractions was calculated for the RMA-E3 cell line. The data is presented as 2 °Q ; where ACt is the difference between the Ct of the no-antibody control of each gene-specific primer pair and the Ct of the same primer pair in the anti-acetyl-Lysine-9 H3 and anti-acetyl-H4 (multiple residues) fractions. The data is the average of three independent ChIP experiments (E2Act/3) plus standard deviation. -  We also compared the histone acetylation levels of Ly49a and e with Ly49g in the RMA-E3 cell line in the Ly49G high population to exclude the possibility that the high acetylation level of Ly49g in this cell line is due to a generally high level of histone acetylation (Figure 3.4c). As expected, the Pro-2 regions of the expressed Ly49a and g genes contain hyperacetylated histones but the histones of the non-expressed Ly49e Pro-2 region are comparatively hypoacetylated.  75  3.4. Discussion Here we have investigated the role of epigenetic mechanisms in the transcriptional control of Ly49g and the role of these mechanisms in creating the variable expression of this receptor. Transcription from the Pro-2 promoter is activated by the histone deacetylase inhibitor TSA in Ly49G non-expressing EM cells. In the Ly49G + RMA-E3, the Pro-2 region contains hyperacetylated histones compared to the Ly49G -cell lines. Yet, we also observe a significant amount of histone acetylation in EL4 compared to CTLL-2 and MS 1 for this region. This intermediate amount of histone acetylation is probably associated with the low Ly49g transcription by some EL4 cells (Figure 3.2 untreated samples) or perhaps because the  Pro-2 region in EM is more accessible than that of CTLL-2 and MS 1. Given these results, we believe that a closed chromatin configuration at and around Ly49g Pro-2 is responsible for repression of Ly49g  transcription. It is quite possible that the  instability of Ly49G expression in the RMA cell lines is also due to a highly variable epigenetic state of this gene. The variable expression of other NK-related genes as shown by Gays et al. (2000) may also be due to the same mechanism. It is possible that a defect in one or more of the components of the chromatin modification pathway has led to a defective maintenance of the epigenetic state of multiple genes in these cell lines. However, since the majority of the variability was seen for Ly49A, G and NKRP1-A or B, it is also possible that this phenomenon is a property of the NK complex (NKC) (Gays et al., 2000). In primary NK cells, Pro-3 appears to be the main promoter used (Wilhelm et al., 2001) and, although our data is mostly concerning Pro-2, Ly49G surface expression was induced in IL-2 expanded primary B6 Ly49G - NK cells in response to low concentrations of TSA (data not shown) indicating a possible common transcriptional control mechanism 76  emulated by the EL4 cell line. Also, we observed some Ly49g transcripts originating from Pro-3 in the drug-treated WI samples suggesting that Pro-3 is also epigenetically controlled. Some evidence suggests that transitory transcription from Pro-1 in immature NK cells acts as a bidirectional switch controlling activity of the downstream Ly49 promoters (Saleh et al., 2004). It would therefore be interesting to determine the relationship between Pro-1 activity and the epigenetic state of Pro-2 and Pro-3. In Fl hybrid crosses of C57BL/6 (B6) with 129 and BALB/c strains, NK cells respond surprisingly to IL-2 culturing where a significant proportion of the mono-allelic Ly49G B6+ population of NK cells gradually acquire the other strain's Ly49G allele and become double positive for Ly49G (Makrigiannis et al., 2004). Such a phenomenon might be due to a plastic epigenetic state, at the transcriptional level, malleable to cytokine concentrations. It has been shown that IL-2 and other cytokines indirectly lead to chromatin remodeling of multiple loci (Barlic et al., 2004; Bream et al., 2004; O'Sullivan et al., 2004). It is unknown if this apparent allelic plasticity is a specific attribute of Ly49g or whether other Ly49 genes that have mono-allelic expression such as Ly49a and c would present a similar  phenotype in response to IL-2. A recent report has indicated a significant Ly49 repertoire shuffle in NK and T cells in response to high levels of various cytokines in the B6 strain (Gays et al., 2005). This phenomenon may indicate that the allelic plasticity of Ly49G in primary NK cells (Makrigiannis et al., 2004) and its variable expression on some EL4 sublines (Gays et al., 2000) are not an exception to the norm but a more general property of most Ly49 genes. The effect of cytokines such as IL-2 on chromatin structure of Ly49 genes is unknown.  77  In conclusion, we have presented evidence of epigenetic control of Ly49g primarily through differential histone acetylation, showing a direct link between histone acetylation levels of promoter regions and Ly49G expression. Our results suggest that the unstable and mosaic Ly49 expression phenotypes of the EL4 and RMA cell lines are due to a heterogeneous and plastic epigenetic state that likely mimics the transcriptional control mechanism of primary NK cells. Finally, since only relatively small differences in histone acetylation status distinguish expressed from non-expressed KIR genes in human NK cells (Chan et al., 2005), these findings serve to illustrate significant differences between epigenetic mechanisms governing KIR and Ly49 gene expression.  78  3.5 Bibliography Barlic, J., D.H. McDermott, M.N. Merrell, J. Gonzales, L.E. Via, and P.M. Murphy. 2004. Interleukin (IL)-15 and IL-2 reciprocally regulate expression of the chemokine receptor CX3CR1 through selective NFAT1- and NFAT2-dependent mechanisms. J Biol Chem 279: 48520 48534. -  Bream, J.H., D.L. Hodge, R. Gonsky, R. Spolski, W.J. Leonard, S. Krebs, S. Targan, A. Morinobu, J.J. O'Shea, and H.A. Young. 2004. A distal region in the interferongamma gene is a site of epigenetic remodeling and transcriptional regulation by interleukin-2. J Biol Chem 279: 41249-41257. Chan, H.W., J.S. Miller, M.B. Moore, and C.T. Lutz. 2005. Epigenetic control of highly homologous killer Ig-like receptor gene alleles. Jlmmunol 175: 5966-5974. Dorfman, J.R. and D.H. Raulet. 1998. Acquisition of Ly49 receptor expression by developing natural killer cells. J Exp Med 187: 609-618. Gays, F., K. Martin, R. Kenefeck, J.G. Aust, and C.G. Brooks. 2005. Multiple cytokines regulate the NK gene complex-encoded receptor repertoire of mature NK cells and T cells. Jlmmunol 175: 2938-2947. Gays, F., M. Unnikrishnan, S. Shrestha, K.P. Fraser, A.R. Brown, C.M. Tristram, Z.M. Chrzanowska-Lightowlers, and C.G. Brooks. 2000. The mouse tumor cell lines EL4 and RMA display mosaic expression of NK-related and certain other surface molecules and appear to have a common origin. Jlmmunol 164: 5094-5102. Kunz, B. and W. Held. 2001. Positive and negative roles of the trans-acting T cell factor-1 for the acquisition of distinct Ly-49 MHC class I receptors by NK cells. Jlmmunol 166: 6181-6187.  79  Makrigiannis, A.P., E. Rousselle, and S.K. Anderson. 2004. Independent control of Ly49g alleles: implications for NK cell repertoire selection and tumor cell killing Jlmmunol 172: 1414-1425. O'Sullivan, A., H.C. Chang, Q. Yu, and M.H. Kaplan. 2004. STAT4 is required for interleukin-12-induced chromatin remodeling of the CD25 locus. J Biol Chem 279: 7339-7345. Rouhi, A., L. Gagnier, F. Takei, and D.L. Mager. 2006. Evidence for epigenetic maintenance of Ly49a mono-allelic gene expression. Jlmmunol 176: 2991-2999. Saleh, A., G.E. Davies, V. Pascal, P.W. Wright, D.L. Hodge, E.H. Cho, S J. Lockett, M. Abshari, and S.K. Anderson. 2004. Identification of probabilistic transcriptional switches in the Ly49 gene cluster: a eukaryotic mechanism for selective gene activation. Immunity 21: 55-66. Saleh, A., A.P. Makrigiannis, D.L. Hodge, and S.K. Anderson. 2002. Identification of a novel Ly49 promoter that is active in bone marrow and fetal thymus. Jlmmunol 168: 5163-5169. Smith, H.R., F.M. Karlhofer, and W.M. Yokoyama. 1994. Ly-49 multigene family expressed by IL-2-activated NK cells. Jlmmunol 153: 1068-1079. Takei, F., K.L. McQueen, M. Maeda, B.T. Wilhelm, S. Lohwasser, R.H. Lian, and D.L. Mager. 2001. Ly49 and CD94/NKG2: developmentally regulated expression and evolution. Immunol Rev 181: 90-103. Veinotte, L.L., B.T. Wilhelm, D.L. Mager, and F. Takei. 2003. Acquisition of MHC-specific receptors on murine natural killer cells. Crit Rev Immunol 23: 251-266.  80  Wilhelm, B.T., L. Gagnier, and D.L. Mager. 2002. Sequence analysis of the ly49 cluster in C57BL/6 mice: a rapidly evolving multigene family in the immune system. Genomics 80: 646-661. Wilhelm, B.T., K.L. McQueen, J.D. Freeman, F. Takei, and D.L. Mager. 2001. Comparative analysis of the promoter regions and transcriptional start sites of mouse Ly49 genes. Immunogenetics 53: 215 224. -  81  Chapter 4 Role of DNA methylation in the maintenance of activating Ly49 receptor expression 3  3  A version of this chapter will be submitted for publication. Rouhi, A., F. Takei, and D.L. Mager. 82  4.1 Introduction  The C57B1/6 (B6) mouse genome has two functional activating receptors, Ly49D and H. Ly49D binds to the MHC-class-I allele H2-D d (George et al., 1999; Mason et al., 1996) and Ly49H binds to the m157 protein of mouse cytomegalovirus (MCMV) conferring resistance towards virus infection in the strains of mice that express Ly49H (Arase et al., 2002; Daniels et al., 2001; Lee et al., 2001; Smith et al., 2002). Unlike the inhibitory Ly49 receptors that are expressed on T and NKT cells as well as NK cells, the stimulatory Ly49 receptors are only expressed on NK cells (Takei et al., 2001). Lack of a well-defined promoter-1 (Pro-1) region, which likely acts as a stochastic switch for inhibitory receptor genes in immature NK cells (Saleh et al., 2004; Saleh et al., 2002) and reports of the higher co-expression of Ly49D and H and deviation from the product rule (Smith et al., 2000), suggest that the activating Ly49 genes, despite being surrounded by inhibitory genes in the Ly49 gene cluster, are subject to distinct regulatory mechanisms  DNA methylation of the 5'-region of the inhibitory Ly49 receptors correlates with their expression. In the case of Ly49a and Ly49c, where stochastic mono-allelic expression has been demonstrated, I have previously shown that DNA methylation and mono-allelic receptor expression correlate (Rouhi et al., 2006). The existence of stochastic mono-allelic expression and/or correlation with DNA methylation is unknown for the activating receptors. In this chapter I have investigated the link between DNA methylation of the 5'-region of activating receptors and the maintenance of their expression.  83  4.2 Materials and Methods  4.2.1 Mice All C57BL/6 mice were bred and maintained in the animal facility of the British Columbia Cancer Research Centre (Vancouver, British Columbia, Canada). 129SvEvTac and 129SvEvTac/C57BL6 Fl hybrids were ordered from Taconic farms. All mice used in this study were more than 6 weeks old. All experiments were according to a protocol approved by the Committee on Animal Care of the University of British Columbia (Appendix I).  4.2.2 Antibodies, cell separation, and flow cytometry The monoclonal antibody (mAb) anti-FcRy (2.4G2) has been described (Brennan et al., 1996; Takei et al., 1997). Anti- CD3E-PerCP-Cy5.5, anti- NK1.1-PE, anti-NK1.1-APC, anti-DX5-PE (alpha-2 integrin, CD49b), 1F8-FITC (anti-Ly49C/I/H), 5E6-biotin (antiLy49C/I), 4E5-FITC (anti-Ly49D) Al-biotin (anti-Ly49A B6) and fluorochrome-conjugated streptavidin were purchased from BD Biosciences (Mississauga, Ontario, Canada). The 12A8 purified antibody was generously provided by Dr. Stephen Anderson (NCI, Frederick, Maryland, USA) and was conjugated to FITC via Thermo Scientific Pierce EZ-label fluorescein isothiocyanate protein labelling kit (Rockford, IL, USA) per manufacturer's protocol. Flow cytometry for cell sorting was performed on Becton Dickinson FACSVantage and FACSAria Cell Sorting System (Mississauga, Ontario, Canada). All sorted samples were >95% pure or resorted for high purity.  84  4.2.3 Primary cell and tissue genomic DNA (gDNA) extraction  Genomic DNA (gDNA) was obtained from FACS sorted cells as described before (Rouhi et al., 2006). gDNA was extracted from fresh B6 mouse liver using DNAzoI reagent (Invitrogen) per manufacturer's instructions. Further proteinase K digestion and phenolchloroform extraction was performed.  4.2.4 Sodium bisulfite conversion and PCR -  Bisulfite conversion was performed as described previously (Rouhi et al., 2006). The conversion rate was >98%. First-round PCR amplification of Ly49h 5' region was performed using forward flanking primer: 5'- ATA GGG GAA TGT TAG GGT TAA AAA G -3' and reverse flanking primer: 5'- ATT TAA CCT AAT ATA ACA CAA CCA A -3'. Converted DNA was used as template in a 45µ1 reaction volume, containing 30 pmol of each primer, 1 mM dNTPs,3 mM MgC12, and 0.5U Taq Platinum DNA polymerase (Qiagen). After initial denaturation for 7 min at 95°C, 30-40 cycles were performed, each consisting of 90 s at 95°C, 55 s at 50°C, and 40 s at 72°C with a fmal extension of 7 min at 72°C. 20 of the first PCR was used for nested amplification using forward nested primer: 5'- GGA TAT ATG TTT TGT TTT TTT TGG T-3' and the reverse nested primer 5'- TAA CAC AAC CAA AAA AAC TCT CAA C -3'. The same amplification conditions were chosen as for first-round PCR with the exception that the annealing temperature was raised to 48 + 0.1°C/cycle. For the Ly49d 5'region in the B6 strain the following primers were used to amplify two regions for COBRA analysis of two CpG dinucleotides:  1st  round (flanking) PCR was  85  performed with forward flanking Ly49d-specific primer: 5'- TAT TAA GAT GTA ATT AGT ATG ATT TAA T -3'; reverse flanking Ly49d-specific primer: 5'- ACA ATA CAT TTA TAC ACT TCA CCT AA -3'. After initial denaturation for 7 min at 95°C, 35 cycles were performed, each consisting of 90 s at 95°C, 55 s at 51°C, and 50 s at 72°C with a final extension of 7 min at 72°C. Two separate nested PCRs were performed on 30 of the product of the flanking PCR to amplify two regions containing an upstream and a downstream (in relation to transcription start site) CpG dinucleotide. Upstream CpG-containing fragment: Forward flanking Ly49d-specific primer: 5'- TAT TAA GAT GTA ATT AGT ATG ATT TAA T -3' and reverse nested Ly49d-specific primer: 5'- CCA AAT ACT ACA AAA AAA ATA ACT ATA T -3'. After initial denaturation for 7 min at 95°C, 35 cycles were performed, each consisting of 90 s at 95°C, 55 s at 51°C, and 17 s at 72°C with a final extension of 7 min at 72°C. Downstream CpG-containing fragment: Forward nested Ly49dspecific primer: 5'- AGG TAG AGT TAT AGG TAA TAA TAG T -3' and reverse flanking Ly49d-specific primer: 5'- ACA ATA CAT TTA TAC ACT TCA CCT AA -3'. Afterinitial denaturation for 7 min at 95°C, 35 cycles were performed, each consisting of 90 s at 95°C, 55 s at 53 °C, and 40 s at 72°C with a final extension of 7 min at 72°C. The resulting products were subjected to COBRA. For Ly49d and Ly49r 5' region amplification from the 129SvEvTac/C57BL6 Fl hybrid cells, 1 st round PCR was performed with the same flanking primers as Ly49d as their sequence is identical to Ly49r with the same PCR conditions as that used for Ly49d of B6. Nested PCR was performed on 3/21 of the flanking PCR product with the forward nested Ly49d primer (which is identical to Ly49r sequence) and reverse nested Ly49d/r primer: 5'-  TTC CTC TAC CTT AAT TTC TTA AC -3'. After initial denaturation for 7 min at 95°C, 35  86  cycles were performed, each consisting of 90 s at 95°C, 55 s at 50 +0.1 °C/cycle, and 45 s at 72°C with a final extension of 7 min at 72°C. The PCR products were electrophoresed on 1% agarose gels and correct size bands were extracted using the MinElute gel extraction kit (Qiagen). The purified products were cloned into the T-vector using the pGEMT-vector kit (Promega). Sequencing was performed using the SP6 primer by McGill University and Genome Quebec Innovation Centre sequencing facility. All clones included in the figures are unique as per criteria stated in Chapter 2 and Rouhi et al. 2006.  4.2.5 Combined Bisulfite and Restriction enzyme Analysis (COBRA)  For COBRA, gel purified fragments of Ly49d upstream and downstream regions were digested with TaeI and BmgBI restriction enzyme (NEB) respectively to distinguish between methylated (CpG) and unmethylated (TpG). Taq °7 recognizes and cuts 5'-TCGA-3'. BmgBI recognizes and cuts 5'-GACGTG-3'. Hence, only fragments that were originally  methylated in the gDNA and therefore not converted by sodium bisulfate treatment are cut.  4.2.6 RNA extraction, RT PCR and 5'amplification of cDNA ends (5' RACE) -  -  cDNA was generated from total B6 spleen and FACS sorted T-cell RNA per SuperScript III protocol PCR was performed on the generated cDNA using Ly49d and Ly49h specific primers: Ly49d Exon 2 forward primer: 5'-CGG AAG CCT GAA AAA GCT CG3'; Ly49d Exon 4 reverse primer: 5'-TCA CAC AGT ATG TTT TGA TCC C-3'; Ly49h Exon 2 forward primer: 5'-GAA CAG CCA GGT GAG ACT T-3'; Ly49h Exon 3-4 reverse primer: 5'-TGT TTG TGA CAA AGT TTT TTC AGT-3'.  87  5'-RACE was performed on B6 spleen RNA using the FirstChoice RML-RACE kit (Ambion) per manufacturer's protocol with Ly49h-specific primers. For the outer PCR, the Ly49h Exon 3-4 reverse primer used for RT PCR was used as the outer 5'RACE primer in  combination with the kit's outer forward primer. For the inner PCR, inner Ly49h Exon 2 reverse primer: 5'-AAA GTG ACC TCC TGC TCA CT-3' in combination with the kit's inner forward primer. The products were cloned into the T-vector using the pGEMT-vector kit (Promega). Sequencing was performed using the T7 primer by McGill University and Genome Quebec Innovation Centre sequencing facility.  4.2.7 Single cell RT PCR -  We performed single cell RT-PCR and Southern blotting as described in Kubota et al. 1999 with minor modifications. We used primers to amplify cDNA of both Ly49d and r with the following sequences: Ly49d/r forward Exon 2 primer: 5'-GCT GTG AGA TTC CAT AAG TCT TC-3'; Ly49d/r reverse exon 4 primer: 5'-GAT GCT GCA GTT ATT GTG GTG3'. We used Ly49d-specific oligo probe: 5'-CGG AAG CCT GAA AAA GCT CG-3' and Ly49r-specific oligo probe: 5'-AGC CTC GAA AAG CTG GCC TCA-3' to specifically detect cDNA from Ly49d or r in Southern blot analysis.  88  4.3 Results  4.3.1 Transcription and expression of the activating Ly49 receptors:  The activating Ly49 receptors of the B6 strain (Ly49D and H) are not expressed on the surface of T and NKT cells. This might be due to the lack of DAP12 expression in these cells (Voyle et al., 2003) since DAP12 seems to be required for the cell surface expression of the B6 activating Ly49 receptors (Bakker et al., 2000). However, there is a report of the association of Ly49D with the activating adaptor protein CDg (Ortaldo et al., 1999). We also did not detect Ly49R or Ly49D and R expression on 129SvEvTac or 129SvS6/B6 Fl hybrid fresh ex-vivo splenic T-cells (DX5 , CDR) (data not shown). To determine the -  existence of their transcripts in T-cells, fresh ex-vivo splenic lymphocytes were sorted with high purity for T-cells and RT-PCR with Ly49d and Ly49h-specific primers was performed on the isolated RNA (Figure 4.1A). Transcripts from both Ly49d and Ly49h were detected in whole spleen RNA but very little to none in splenic T-cell RNA, which correlates with the lack of surface expression of these receptors on T-cells.  89  0 0 0 0  A  49  8 0 co coib 4.17  -  Ly49d  B  e  Ly49h  Actin  1,1011i.  0010  55 TTCTTCTTG GAG CCTCTTAG G GGATACAGACCAG TAAAGGCCCA CATTACCCCAATTQAGGCATCCATTCMCTACCGGCATCACTTCAG G GTG GAGACACAgGACATATTITTTAAAAGAACATACTCTACGTATT CCCAAGATGA 1 Exon1/i ntron 1 boundary Figure 4.1 Transcription of activating Ly49 genes A. RT-PCR on whole spleen and sorted splenic T-cells with actin (25 cycles), Ly49d (35 cycles) and Ly49h (35 cycles) primers. B. 5'RACE of Ly49h on cDNA from whole spleen. Vertical arrow pointing down show the transcription start sites assayed by 5'RACE. The numbers on top of the arrows show the number of sequenced clones beginning at a given nucleotide position. The exon 1/intron 1 boundary is also indicated. Ly49 genes have multiple promoters but most utilize the region called Pro-2 which is  thought to be the main promoter in mature NK cells. To determine the promoter of origin for Ly49h, 5'RACE was performed on whole spleen RNA with gene-specific primers. The Ly49h transcripts detected originated from Pro-2. However, unlike other Ly49 genes  (Wilhelm et al., 2001) we did not detect transcriptional start site variability (Figure 4.1B).  4.3.2 Ly49h 5' region DNA methylation correlates with state of expression 5'RACE indicated the main promoter region, which is the equivalent to the Pro-2 region of the inhibitory Ly49 genes, as the main area of transcriptional start for Ly49h. We  90  examined the DNA methylation status of the CpG dinucleotides of this region that we shall refer to as the 5' region of Ly49h from here onwards. There is a cluster of six CpGs within the proximal 5' region of Ly49h with three CpGs located upstream and three located downstream of the transcription start site (Figure 4.2A). A  111 1111111^1^1^1^11  ■ Exon 1  Ly49H  Negative NK  Tacrl  0  •  •- • • 0 •- 0 0 •  0^4 • 4 • 0 0 00 0-0-0—•—•-•--• 0 • • 4• 0  •  •  •• •• • 0 ••  00 • 0-0—•----•—••-  CpG:  Exon 2  Ly49H Positive NK  BsaAI  •  1 ^1 •  0-0-0-0-1-0-0^00^0-^0 00  Ly49H in T-cells Tacrl  BsaAI  •  0-0-0-0-0-0-0^0^0^0^00 —0--0-0---0-0-•-0^•^•^ 0 0 00 —0-0-0-0-0-0• 0^•^0^00 -0^0^0^0^00  0-  •  00 0 0 0  0  • • 0 0 0 0  • •  o  •  0 0  ••  • •  rhn  • • • •  • •0  ••  ••  • 0  •• •• •• ••  •  BsaAI  C  Exon: • Methylated CpG: • UnMethylated CpG: 0  Unmethylated Methylated  Zi.4  Unmethylated Methylated  Figure 4.2 DNA methylation patterns of the 5'regions of Ly49h in the B6 strain. A. Locations of all CpG dinucleotides in the 5' region of Ly49h is shown. CpGs are represented by vertical lines, black boxes represent exons and the bent arrow indicates the promoter region and the direction of transcription. The CpGs within the boxed region were assayed for methylation in primary C57BL/6 splenic NK cells via sodium bisulfite sequencing (B) and COBRA (C). For bisulfite sequencing, each line represents the sequence of an independent clone. The location of the CpG dinucleotides assayed by COBRA are indicated by arrows. Fragments that contain a CpG dinucleotide at these locations are digested by restriction endonuclease indicating methylation in the original genomic DNA. Fragments that remain uncut contain a TpG instead of a CpG which indicates that in the original genomic DNA template this CpG was unmethylated.  91  Sodium bisulfite sequencing revealed hyper-methylation of this region in FACSsorted Ly49H-negative (1F8) splenic NK and T-cells but not in Ly49H-positive (1F8 +, 5E6) NK cells (Figure 4.2B). As with the inhibitory Ly49a gene (Rouhi et al., 2006), the CpG sites downstream of the transcriptional start site are most heavily methylated in Ly49H-negative cells. Interestingly, in the Ly49H-positive population, the tested region was hypo-methylated in all clones sequenced. The bisulfite sequencing results were also confirmed by COBRA (Figure 4.2C).  4.3.3 DNA methylation of the 5' region of Ly49d correlates with expression state  There are very few CpG dinucleotides in the 5'-region of Ly49d. Hence, we only used COBRA to analyse two CpG dinucletides, one upstream and the other downstream of the transcription start site (Figure 4.3A). TaeI and BmgBI restriction endonucleases were used to assay the upstream and downstream CpGs respectively. T-cells and Ly49D expressing and non-expressing NK cells of fresh ex-vivo spleen were FACS sorted and analysed for DNA methylation at these two CpGs. The results are the combination of four individual PCRs per each sorted population. T-cells and Ly49D negative NK cells show moderate amounts of DNA methylation at both assayed CpGs where as the Ly49D positive NK cells show almost no DNA methylation at either site (Figure 4.3B).  92  i  Tacrl BrngB1  A  ^III^I  II^1H^  ■  I^ I  Exon 1  CpG: I Exon: •^  Tacial .*•  BmgBI e^e  13 ^ 4.1'  ^0.  Unmethylated — 0 Methylated  ■ Exon 2  A4.b Unmethylated Methylated  Figure 4.3 DNA methylation status of the 5'regions of Ly49d in the B6 strain. A. CpG dinucleotide distribution in the 5' region of Ly49d is shown. CpGs are represented by vertical lines, black boxes represent exons and the bent arrow indicates the promoter region and the direction of transcription. B. Two CpGs indicated with vertical arrows were assayed for methylation in primary B6 T cells and splenic NK cells by COBRA. 4.3.4 CpG distribution in the 5' region of activating Ly49 receptors  We aligned a 0.5 kb stretch of the 5' region of all activating receptors whose sequence is available from B6, BALB/c and 129/S6 strains, to compare CpG dinucleotide distribution and conservation (Figure 4.4). Similar to the inhibitory Ly49 genes (see Figure 2.1 in Chapter 2), the activating ones are also CpG-poor in their 5' region surrounding exon 1 with little conservation among the genes.  93  Ly49dB 6 Ly49r 129 Ly49p 129 L y491BALB Ly49hB 6  I CpG Txn Start mRNA Start  Figure 4.4 Comparison of CpG dinucleotide distribution in the 5' regions of activating Ly49 genes.  A -550 by region surrounding exon 1 regions of Ly49d, r, p , 1 and h was aligned. CpG dinucleotides are represented by vertical lines. The approximate locations of transcription start sites mapped by 5'RACE are indicated by brackets for Ly49d and h. The bent arrows indicate the 5' ends of the following mRNA sequences Ly49p mRNA (AF146570.4); Ly49r mRNA (AF288377.1). Two CpG dinucleotides one conserved between Ly49d and r and another between Ly49d and Ly491 are indicated with crescent symbols. Another CpG dinucleotide conserved among Ly49d, 1, p and r is shown with a star symbol. No CpG dinucleotides are shared between Ly49h and the other activating receptors analysed here. One CpG, which is located in intron 1, is conserved among Ly49d, 1, p and r (indicated with star symbol in Figure 4.4). These genes are more related to eachother rather than to Ly49h which is more related to Ly49u 129 and the B6 pseudogenes  Ly49k and n  (Anderson et al., 2005). The Ly49u 129 sequence of this region is not available in the database and hence could not be included in the alignment.  4.3.5 DNA methylation of Ly49d and Ly49r 5' regions in 129S6/B6 Fl hybrid  Mono-allelic gene expression has not been shown for the activating Ly49 genes and we did not observe the half-and half DNA methylation pattern of the mono-allelically  94  expressed inhibitory Ly49a and c (Rouhi et al., 2006) for Ly49d and h in receptor-expressing NK cells. In order to verify the DNA methylation status of both alleles of an activating receptor in receptor-expressing NK cells, we investigated the DNA methylation status of the Fl hybrid of 129S6 and B6 strains. Ly49dB6 and Ly49r 129 are considered alleles based on the criteria presented by Makrigiannis et al. (2002) such as coding region homology, intron homology and gene order (Makrigiannis et al., 2001; Makrigiannis et al., 2002). We therefore chose to assay DNA methylation of the 5'-regions of Ly49d and r in the Fl hybrid. There are no Ly49D or Ly49R-specific antibodies making receptor-specific sorting impossible. 4E5 and 12A8 (Mason et al., 1996) antibodies detect both receptors. The antibody 4E5 also detects Ly490 129 and Ly49V 129 where as 12A8 detects Ly49A B6 (Makrigiannis et al., 2001). The percentage of NK cells expressing Ly49D (stained with 4E5) and R (stained with 12A8 antibody) in B6 and 129S6 strains respectively is 50-60% (data not shown). In order to distinguish Ly49D and R expressing cells from Ly49A expressing cells in 129S6/B6 Fl hybrid, we co-stained splenic lymphocytes with 12A8 and Al antibodies. The Al antibody also detects Ly49P 129 and V 129 with low binding affmity (Makrigiannis et al., 2001). We hypothesized that assuming Ly49d and r are allelic, based on the lack of the halfand half DNA methylation pattern observed for Ly49D and H expressing NK cells in B6, then both Ly49d and r 5'-regions should be hypo-methylated. We FACS sorted 12A8positive/A1-negative NK cells. This population should include Ly49D-single positive, Ly49R single-positive and Ly49D and R double positive cells. A few polymorphisms in the 5'-region assayed by sodium bisulfite sequencing exist between Ly49d and r that allow for  95  their distinction (Figure 4.5). We also sorted 12A8 negative (Ly49D/R non-expressing) NK cells and analysed the 5'-region of Ly49d and r for this population as well. Ly49D/R Negative NK^  Ly49D/R Positive NK  Ly49r  ^  Ly49d  ^•  0 0  Figure 4.5 DNA methylation of Ly49d and Ly49r 5'-region in the Fl hybrid of 129/S6 and B6. Sodium bisulfite sequencing of 12A8-positive/A1-negative NK cells (Ly49D/R positive) and 12A8-negative NK cells (Ly49D/R negative). Ly49d and r differ in the position of one CpG dinucleotide but also have other polymorphisms in this region ( —700bp). All clones presented here are unique. As expected, the 5'-region of Ly49d and r in the Ly49D/R-negative NK cells was hyper-methylated for all the sequenced clones. With the exception of one clone for Ly49d, all other clones are hypo-methylated in Ly49D/R-positive NK cells. More clones are needed to make a conclusion about these results.  4.3.6 Detection of bi allelic expression of Ly49d/r -  In order to directly test biallelic expression of these receptors, we single cell FACS sorted 12A8-positive/A1-negative NK cells (Ly49D/R positive) from Fl hybrid spleen and performed single cell RT-PCR (Kubota et al., 1999) followed by Southern blot and hybridization with allele-specific probes (Figure 4.6).  96  Ly49dB 6 Ly49r' 29 Figure 4.6 Detection of Ly49d and r cDNA by single cell RT-PCR and Southern blotting  Ly49d-specific and Ly49r-specific probes were hybridized to identical blots of amplified cDNA generated from single cell RT-PCR on FACS sorted Fl hybrid splenic NK cells. This figure shows a representative experiment where eight individual cells show one or more products. One cell contains Ly49d only, four cells contain Ly49r only and three cells contain both products. We have assayed 60 single cells of which in 23 cells we detected cDNA for Ly49d and /or Ly49r. We detected cDNA from both Ly49d and r in 9 of the 23 cells. These preliminary results show -40% biallelic expression for Ly49d and r. We never detected any products from wells that only contained carrier cells. The single cell RT-PCR technique tends to underestimate biallelic expression due to the possible loss of one allele through inefficient cDNA generation during the RT reaction, multiple sample purification steps and random sampling error (Kubota et al., 1999; Rhoades et al., 2000). The transcription factor, Pax-5, was statistically deemed to be biallelically expressed by this method even though only half of the cells analysed showed biallelic expression (Rhoades et al., 2000). We are currently analysing more single cells and endeavouring to improve the efficiency of this technique. As well, we are considering using a control gene that is expressed by all NK cells, prefebly at the level of Ly49 genes, to test the efficiency of cell sorting and cDNA generation and detection.  97  4.4 Discussion Here, we have analysed the DNA methylation of the 5' region of B6 activating NK receptor genes, Ly49d and h. We have shown that the DNA methylation of this region correlates with expression patterns of these receptors as with the inhibitory Ly49A and C (Rouhi et al., 2006) and NKG2A (Rogers et al., 2006). Also, as in the case of Ly49a, the CpG dinucleotides downstream of the transcriptional start site of Ly49h seem to have higher levels of methylation compared to those located upstream. This again raises the possibility of the existence of a proximal downstream regulatory element for the Ly49 genes whose function might be affected by DNA methylation. In contrast to the inhibitory receptors, the DNA methylation pattern of the 5'region in the Ly49D and H expressing NK populations does not follow the half-and-half methylation pattern. The half-and-half pattern of DNA methylation correlates with the mono-allelic expression of Ly49A, C and NKG2A as was subsequently shown using Fl hybrids for Ly49a (Rouhi et al., 2006) and NKG2A (Rogers et al., 2006; Rouhi et al., 2006). If DNA methylation does not correlate with stochastic mono-allelic expression; either stochastic gene expression is maintained at the level of histone modifications only or this pattern is possibly an indication of bi-allelic expression or even the lack of stochastic expression of the activating receptors. We have previously shown that the transcription of some Ly49 genes and NKG2A correlates with histone acetylation levels (Rogers et al., 2006; Rouhi et al., 2007; Rouhi et al., 2006). Ly49g transcription in the EM cell line is activated mostly in response to histone deacetylase inhibitors but is mostly unaffected by DNA methyltransferase inhibitors. Histone acetylation levels of the Pro-2 region as assayed via chromatin immunoprecipitation (ChIP)  98  also correlate with state of expression in EL4-derived subclones (Rouhi et al., 2007). However, in splenic NK cells, Pro-3 is the main promoter for Ly49g (Wilhelm et al., 2001). We sorted Ly49G expressing and non-expressing B6 splenic NK cells and analysed the Pro-3 region for DNA methylation. Preliminary results show that although this region is more methylated in FACS-sorted Ly49G-negative splenic NK cells compared to Ly49Gpositive NK cells, the difference in the level of methylation is quite small between the two populations. In other words, these preliminary results indicate that the Pro-3 region has patchy methylation in both Ly49G-negative and Ly49G-positive cells but somewhat lower levels of methylation in the positive population. Strikingly, unlike Ly49a and c, where expressing cells show half-and-half DNA methylation at the Pro-2 region, in Ly49Gexpressing NK cells no such pattern was observed (Refer to Chapter 2). This is in accord with the effect of the chromatin-remodelling drugs on the transcription of Ly49g and might also indicate that the stochastic mono-alleleic expression of Ly49G (Held and Kunz, 1998) is controlled at the level of histones only. Based on these results, it is possible that the maintenance of the activating receptor expression patterns is through differential histone modifications. The alternative hypothesis to explain the lack of a half-and-half DNA methylation pattern could be that the expression of the activating receptors is biallelic. Based on this hypothesis, in the Ly49D/R expressing NK cells of the Fl hybrid of 129/S6 and B6, assuming that Ly49d and r are truly allelic, the 5' regions of both Ly49d and r should always be hypomethylated to reflect biallelic expression. If however, the expression of Ly49D and R is stochastic mono-allelic, as in the case of Ly49A, C and G, the percentage of biallelic NK cells in the D/R-expressing population would be approximately 17%. This is based on the  99  formula presented in Held and Kunz 1998, assuming that Ly49D and R are each expressed by nearly 50% of NK cells. It is not inconceivable to think that the activating receptors are expressed differently from the inhibitory receptors. The lack of a well defined Pro-1 element and its transcripts (Saleh et al., 2004; Saleh et al., 2002) in addition to deviation of co-expression percentages from the product rule (Smith et al., 2000) points to the possibility of a different mode of transcriptional regulation than that of the inhibitory genes. Also, in the Ly49h genomic transgenic mouse, Ly49H expression was restricted to NK cells as is the case with the endogenous receptor (Lee et al., 2003). However in contrast to the endogenous receptor, in the Ly49a genomic transgenic mouse, expression of Ly49A was seen on the majority of splenic B-cells for all transgenic lines regardless of copy number of the transgene (Tanamachi et al., 2004). The 30Kb Ly49a genomic transgene contained the Pro-1 region and it was subsequently shown that the deletion of this region in the same transgene abrogated the expression of Ly49A in NK, T and B cells (Tanamachi et al., 2004). Both the 212Kb and the 79Kb Ly49h genomic transgenes contained the putative activating Ly49h Pro-1 element, which is described based only on some homology to the inhibitory Ly49 Pro-1 element (Makrigiannis et al., 2005; Saleh et al., 2002), but a deletion of this region and its possible effect on Ly49H expression was not tested (Lee et al., 2003). Human activating KIRs are expressed on some subsets of T-cells but the downstream effect of their stimulatory signal depends on the adaptor protein they pair with (Snyder et al., 2003; Snyder et al., 2004). However, the activating Ly49 receptors are not expressed on Tcells and we did not detect their transcript in FACS sorted splenic T-cells (Figure 4.1). The activating Ly49 receptors that recognize self-MHC class-I bind their ligands with low affinity  100  and their activating signal can be over-ridden by signals from the inhibitory Ly49 receptors (Nakamura et al., 2000; Ortaldo et al., 1999). So, why should mouse T-cells not express the activating Ly49 receptors? If this is a matter of negative selection, co-expression of the inhibitory receptors should abrogate this need. It has been reported that in DAP12 deficient mice, surface expression of Ly49D and H is severely reduced as pairing with this adaptor protein is thought to be necessary for the surface expression of these receptors (Bakker et al., 2000). Since the expression of DAP12 is very low in most T-cell subsets, this is thought to be the reason for the lack of expression of the activating Ly49 receptors on T and NKT cells (Voyle et al., 2003). However, there is evidence for the association of Ly49D with the ITAM-containing adapter protein, CD3C (Ortaldo et al., 1999). It is also possible that the regulatory sequences of the activating receptors evolved differently from that of the inhibitory receptors in order to allow a tighter control in NK cells and as a side effect of this evolution, T-cells lost the ability to express these receptors. Lack of stochastic expression might also allow more control on the number of activating receptors on the surface of NK cells because mono-allelic expression leads to a lower number of receptors on the cell surface compared to bi-alleleic expression. Hence, in a non-stochastic system, the expression level of these receptors is homogeneous among different NK cells. In this study, we show that the DNA methylation patterns of activating Ly49 genes, Ly49d and h, are significantly different from that of the inhibitory genes. While the inhibitory Ly49a and Ly49c genes display a "half-and-half DNA methylation pattern in Ly49 ± cells,  indicative of mono-allelic expression, the activating receptor genes do not. However, hypermethylation of their promoter regions and lack of Ly49D and H surface expression  101  correlate. Based on these DNA methylation patterns and the single cell RT-PCR results, we hypothesize that the activating receptors are expressed bi-allelically and that their mechanism of transcriptional control differs from that of the inhibitory receptors.  102  4.5 Bibliography  Anderson, S.K., K. Dewar, M.L. Goulet, G. Leveque, and A.P. Makrigiannis. 2005. Complete elucidation of a minimal class I MHC natural killer cell receptor haplotype. Genes Immun 6: 481  -  92.  Arase, H., E.S. Mocarski, A .E. Campbell, A.B. Hill, and L.L. Lanier. 2002. Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science 296: 1323  -  1326.  Bakker, A.B., R.M. Hoek, A. Cerwenka, B. Blom, L. Lucian, T. McNeil, R. Murray, L.H. Phillips, J.D. Sedgwick, and L.L. Lanier. 2000. DAP12-deficient mice fail to develop autoimmunity due to impaired antigen priming. Immunity 13: 345-353. Brennan, J., S. Lemieux, J.D. Freeman, D.L. Mager, and F. Takei. 1996. Heterogeneity among Ly-49C natural killer (NK) cells: characterization of highly related receptors with differing functions and expression patterns. JExp Med 184: 2085-2090. Daniels, K.A., G. Devora, W.C. Lai, C.L. ODonnell, M. Bennett, and R.M. Welsh. 2001. Murine cytomegalovirus is regulated by a discrete subset of natural killer cells reactive with monoclonal antibody to Ly49H. JExp Med 194: 29-44. George, T.C., L.H. Mason, J.R. Ortaldo, V. Kumar, and M. Bennett. 1999. Positive recognition of MHC class I molecules by the Ly49D receptor of murine NK cells. J Immunol 162: 2035  -  2043.  Held, W. and B. Kunz. 1998. An allele-specific, stochastic gene expression process controls the expression of multiple Ly49 family genes and generates a diverse, MHC-specific NK cell receptor repertoire. Eur J Immunol 28: 2407-2416.  103  Kubota, A., S. Kubota, S. Lohwasser, D.L. Mager, and F. Takei. 1999. Diversity of NK cell receptor repertoire in adult and neonatal mice. Jlmmunol 163: 212-216. Lee, S.H., S. Girard, D. Macina, M. Busa, A. Zafer, A. Belouchi, P. Gros, and S.M. Vidal. 2001. Susceptibility to mouse cytomegalovirus is associated with deletion of an activating natural killer cell receptor of the C-type lectin superfamily. Nat Genet 28: 42-45. Lee, S.H., A. Zafer, Y. de Repentigny, R. Kothary, M.L. Tremblay, P. Gros, P. Duplay, J.R. Webb, and S.M. Vidal. 2003. Transgenic expression of the activating natural killer receptor Ly49H confers resistance to cytomegalovirus in genetically susceptible mice. J Exp Med 197: 515-526.  Makrigiannis, A.P., D. Patel, M.L. Goulet, K. Dewar, and S.K. Anderson. 2005. Direct sequence comparison of two divergent class I MHC natural killer cell receptor haplotypes. Genes Immun 6: 71-83. Makrigiannis, A.P., A.T. Pau, A. Saleh, R. Winkler-Pickett, J.R. Ortaldo, and S.K. Anderson. 2001. Class I MHC-binding characteristics of the 129/J Ly49 repertoire. Jlmmunol 166: 5034-5043. Makrigiannis, A.P., A.T. Pau, P.L. Schwartzberg, D.W. McVicar, T.W. Beck, and S.K. Anderson. 2002. A BAC contig map of the Ly49 gene cluster in 129 mice reveals extensive differences in gene content relative to C57BL/6 mice. Genomics 79: 437444. Mason, L.H., S.K. Anderson, W.M. Yokoyama, H.R. Smith, R. Winkler-Pickett, and J.R. Ortaldo. 1996. The Ly-49D receptor activates murine natural killer cells. JExp Med 184: 2119-2128.  104  Nakamura, M.C., S. Hayashi, E.C. Niemi, J.C. Ryan, and W.E. Seaman. 2000. Activating Ly-49D and inhibitory Ly-49A natural killer cell receptors demonstrate distinct requirements for interaction with H2-D(d). J Exp Med 192: 447-454. Ortaldo, J.R., R. Winkler-Pickett, J. Willette-Brown, R.L. Wange, S.K. Anderson, G.J. Palumbo, L.H. Mason, and D.W. McVicar. 1999. Structure/function relationship of activating Ly-49D and inhibitory Ly-49G2 NK receptors. Jlmmunol 163: 5269-5277. Rhoades, K.L., N. Singh, I. Simon, B. Glidden, H. Cedar, and A. Chess. 2000. Allele-specific expression patterns of interleukin-2 and Pax-5 revealed by a sensitive single-cell RTPCR analysis. Curr Biol 10: 789-792. Rogers, S.L., A. Rouhi, F. Takei, and D.L. Mager. 2006. A role for DNA hypomethylation and histone acetylation in maintaining allele-specific expression of mouse NKG2A in developing and mature NK cells. Jlmmunol 177: 414-421. Rouhi, A., C.G. Brooks, F. Takei, and D.L. Mager. 2007. Plasticity of Ly49g expression is due to epigenetics. Mol Immunol 44: 821-826. Rouhi, A., L. Gagnier, F. Takei, and D.L. Mager. 2006. Evidence for epigenetic maintenance of Ly49A mono-allelic gene expression. Jlmmunol 176: 2991-2999. Saleh, A., G.E. Davies, V. Pascal, P.W. Wright, D.L. Hodge, E.H. Cho, S.J. Lockett, M. Abshari, and S.K. Anderson. 2004. Identification of probabilistic transcriptional switches in the Ly49 gene cluster: a eukaryotic mechanism for selective gene activation. Immunity 21: 55-66. Saleh, A., A.P. Makrigiannis, D.L. Hodge, and S.K. Anderson. 2002. Identification of a novel Ly49 promoter that is active in bone marrow and fetal thymus. Jlmmunol 168: 5163-5169.  105  Smith, H.R., H.H. Chuang, L.L. Wang, M. Salcedo, J.W. Heusel, and W.M. Yokoyama. 2000. Nonstochastic coexpression of activation receptors on murine natural killer cells. JExp Med 191: 1341-1354. Smith, H.R., J.W. Heusel, I.K. Mehta, S. Kim, B.G. Domer, O.V. Naidenko, K. Iizuka, H. Furukawa, D.L. Beckman, J.T. Pingel, A.A. Scalzo, D.H. Fremont, and W.M. Yokoyama. 2002. Recognition of a virus-encoded ligand by a natural killer cell activation receptor. Proc Natl Acad Sci USA 99: 8826-8831. Snyder, M.R., M. Lucas, E. Vivier, C.M. Weyand, and J.J. Goronzy. 2003. Selective activation of the c-Jun NH2-terminal protein kinase signaling pathway by stimulatory KIR in the absence of KARAP/DAP12 in CD4+T cells. JExp Med 197: 437-449. Snyder, M.R., T. Nakajima, P.J. Leibson, C.M. Weyand, and J.J. Goronzy. 2004. Stimulatory killer Ig-like receptors modulate T cell activation through DAP12-dependent and DAP12-independent mechanisms Jlmmunol 173: 3725-3731. Takei, F., J. Brennan, and D.L. Mager. 1997. The Ly-49 family: genes, proteins and recognition of class I MHC. Immunol Rev 155: 67-77. Takei, F., K.L. McQueen, M. Maeda, B.T. Wilhelm, S. Lohwasser, R.H. Lian, and D.L. Mager. 2001. Ly49 and CD94/NKG2: developmentally regulated expression and evolution. Immunol Rev 181: 90-103. Tanamachi, D.M., D.C. Moniot, D. Cado, S.D. Liu, J.K. Hsia, and D.H. Raulet. 2004. Genomic Ly49A transgenes: basis of variegated Ly49A gene expression and identification of a critical regulatory element. Jlmmunol 172: 1074-1082. Voyle, R.B., F. Beermann, R.K. Lees, J. Schumann, J. Zimmer, W. Held, and H.R. MacDonald. 2003. Ligand-dependent inhibition of CD1d-restricted NKT cell  106  development in mice transgenic for the activating receptor Ly49D. J Exp Med 197: 919-925. Wilhelm, B.T., K.L. McQueen, J.D. Freeman, F. Takei, and D.L. Mager. 2001. Comparative analysis of the promoter regions and transcriptional start sites of mouse Ly49 genes. Immunogenetics 53: 215 224. -  107  Chapter 5 General discussion and conclusion  5.1 Summary of thesis findings  In this thesis I have, for the first time, shown a role for epigenetics as a factor in the maintenance of the state of expression of some of the Ly49 receptors in mouse NK cells. In Chapter 2, I investigated in great detail the epigenetic state of the promoter region of Ly49a predominantly in adult primary cells. I showed that the inhibitory Ly49a and Ly49c genes display a "half-and-half' DNA methylation pattern in Ly49 ÷ cells, indicative of mono-allelic expression and clearly demonstrated a link between DNA hyper-methylation of the 5'-region of the unexpressed allele in C57BL/6 x BALB/c Fl hybrid mice. These findings define a mechanism for the maintenance of the stable mono-allelic expression of Ly49A in expanded NK clones. In addition, I showed a lack of a stringent DNA methylation pattern in nonlymphoid tissue, supporting the role of DNA methylation in the maintenance of the state of Ly49A expression in lymphoid cells where the transcription factor repertoire necessary for Ly49 expression is available. In an attempt to investigate the state of DNA methylation in ontogeny, I assayed fetal liver NK cells, that do not express any Ly49 receptors with the exception of Ly49E, and found that DNA methylation and lack of expression correlate. We also went on to show that differential histone acetylation at the 5' region of Ly49a correlates with its state of expression in cell lines. I then went on to analyse the role of epigenetics in the regulation of Ly49g (Chapter 3), another inhibitory gene that is most closely related to Ly49a, but which has previously been shown to have unstable expression in the clonally expanded sublines of the EL4 cell line (Gays et al., 2000). I demostrated that transcription from the Pro-2 promoter of Ly49g is  108  activated in an Ly49G-non-expressing EL4 subline after treatment with the histone deacetylase inhibitor, trichostatin-A. Ly49G-expressing cells have significant hyperacetylation of the Pro-2 region compared to Ly49G-non-expressing lymphoid and nonlymphoid cell lines as assayed with ChIP. These results strongly suggest that variable histone acetylation state at the Pro-2 region of Ly49g is responsible for the unstable and variable expression of Ly49G in the EM and its sublines. Histone acetylation may be the main epigenetic mechanism of transcriptional regulation for Ly49g in lymphoid cell lines and primary NK cells. These results also touch on the controversial topic of receptor repertoire stability and the possibility of a plastic mode of expression initiation of new alleles (Makrigiannis et al., 2004) and new receptors (Gays et al., 2005) in a modified epigenetic environment due to varied cytokine levels and activation states. Probably the most enigmatic Ly49 receptors are the activating ones. Very little is known about their transcriptional regulation and much is debated about their expression patterns. The functional B6 activating genes, Ly49d and h, are located in the middle of the Ly49 cluster with a number of activating Ly49 psuedogenes (Refer to Chapter 1, Figure 1.3).  In Chapter 4 I tested the possible link between DNA methylation and the state of expression of the activating receptors. These results showed that, although hypermethylation of the 5' regions and lack of Ly49D and H surface expression correlate, the "half-and-half' DNA methylation pattern observed for the inhibitory Ly49a and c in Ly49 + cells does not exist for the activating receptors. Since the half-and —half DNA methylation pattern is indicative of mono-allelic expression, the activating receptor genes might not be mono-allelically expressed. By performing single cell RT-PCR on the Fl hybrid of 129/S6 and B6, for the likely allelic Ly49d and r (Makrigiannis et al., 2002), we attempted to clearly show biallelic  109  expression. Our preliminary results, given the inefficiency of the single cell RT-PCR technique, indicate a high probability of biallelic expression for Ly49d and r.  5.2 Pitfalls and challenges  This field suffers from the shortage of receptor-specific antibodies. Due to the high similarity of different receptors, it is difficult to produce allele-specific or receptor-specific antibodies. Due to strain-specific variation in gene number and sequence, caution must be taken in the use of antibodies in various strains. Most antibodies that recognize one receptor or one allele of a given receptor in one mouse strain cross-react to varying degrees with other receptors in other strains. This creates the necessity of knowing the full receptor complex and their antibody binding patterns (Makrigiannis et al., 2001) for any strain under study. This is why we chose Ly49d and r for the study of allele-specific expression and DNA methylation (Chapter 4). Ideally, we would have chosen Ly49h as it has more CpG dinucletides in its 5'region and is functionally more interesting than Ly49D as Ly49H is shown to be important in MCMV infection control (Lee et al., 2003). The genomic sequence of the Ly49 cluster of 129/S6 and BALB/c is mostly complete but some gaps remain in various parts of the two clusters. For example, we could not use the Ly49u 5' region in the alignment for the activating receptors due to a gap in this region. This  also creates problems with locus-specific PCR primer design as primers may also amplify a region within a gap. Shortage of Ly49-expressing cell lines limits investigations in this area. There are no mouse NK cell lines that express the Ly49 receptors. The only cell line that expresses an  110  Ly49 is EL4 (a B6 NKT cell line) and its sub-lines that also sporadically express Ly49G (refer to Chapter 3).  5.3 Model of epigenetic Ly49 regulation and comparison with the KIRs  As alluded to in Table 1.1, the structurally and evolutionary unrelated gene families of KIR and Ly49 have many commonalities in their expression patterns. However, the mechanisms governing the initiation and maintenance of their expression are likely different (Pascal et al. 2006). Multiple groups have shown that RNA and protein levels correlate with each other and hence gene expression is quite possibly controlled mainly at the level of transcription for KIR and Ly49 receptors (Held and Raulet, 1997; Kubota et al., 1999; Lee et al., 2003; Valiante et al., 1997). Limitation of transcription factors such as TCF-1, that has been shown to be necessary for Ly49A expression (Held et al., 1999b), can not be exclusively responsible for the establishment and maintenance of the stochastic expression pattern of Ly49 receptors (also refer to Chapter 2). However, differential epigenetic modifications could explain the lack of allele switching and the relatively stable receptor repertoire of NK cells. Two other groups have shown a role for epigenetics in the regulation of the maintenance of human KIR expression. Both groups have shown that DNA methylation is an important factor in the maintenance of the expression state of the KIRs but that histone acetylation is not a major factor (Chan et al., 2003; Chan et al., 2005; Santourlidis et al., 2008; Santourlidis et al., 2002). Chan et al. (2005) showed that the promoter regions of both expressed and non-expressed KIRs contain hyperacetylated histones albeit, the level of histone acetylation is somewhat reduced at the non-expressed KIR promoter. A very recent  111  report showed that the whole KIR cluster contains hyperacetylated histones and that DNA methylation is the main factor restricting accessibility at the promoter regions of the KIRs (Santourlidis et al., 2008). This study went on to show that, at the level of hematopoietic progenitor cells, the KIR cluster is hypo-acetylated, hyper-methylated and its chromatin is inaccessible (Santourlidis et al., 2008). In contrast to the KIRs, my work has shown that not only DNA methylation but also histone acetylation levels correlate with expression patterns of the Ly49 genes. I have also shown that the epigenetic modifications governing the maintenance of the Ly49 receptor expression are not uniform for all the Ly49 genes. For the activating Ly49 receptors, the DNA methylation pattern of the receptor-expressing cells does not correlate with monoallelic expression. However, the KIR activating receptors have the half-and-half DNA methylation pattern indicative of mono-allelic expression (Chan et al., 2003). Given our results for Ly49a fetal primary NK cells (Chapter 2) and for NKG2A in hematopoietic progenitor cells, where the NKG2A 5' region was hypermethylated in undifferentiated cells (Rogers et al., 2006), it seems that the default state for these genes might be hypermethylation. A comparison model of epigenetic modifications of human KIR and mouse Ly49 receptors during the maturation of NK cells is shown in Figure 5.1.  112  ^  I  Human KIR  Mouse Ly49 I  Low Histone Acetylation High DNA methylation Low chromatin accessibility  Hematopoietic Progenitor Cell I  Low Histone Acetylation? High DNA methylation? Low chromatin accessibility?  Mature NK  ^ KIR-positive High Histone Acetylation Low DNA methylation High chromatin accessibility  KIR-negative I  I  Ly49-positive  High Histone Acetylation ^High Histone Acetylation High DNA methylation^Low DNA methylation Low chromatin accessibility^High chromatin accessibility?  Ly49-negative Low Histone Acetylation High DNA methylation Low chromatin accessibility?  Figure 5.1 Epigenetics of NK cell receptors during NK cell maturation This figure is the accumulation of the finding of Santourlidis et al. 2002, Chan et al. 2003, Chan et al. 2005, Santourlidis et al. 2008 and research performed in our laboratory presented in Rogers et al 2006 and Chapters 2-4 of this thesis. Comments with question marks denote untested hypotheses.  The timing, kinetics and triggers of epigenetic modification during NK cell development are unexplored topics. 5.4 Potential future directions  5.4.1 Proximal regulatory elements  Promoter elements of the activating Ly49 genes have not been analysed to date. It is unknown if inhibitory and activating genes share common transcription factors. Multiple alignment of inhibitory and activating Ly49 genes shows a region of high homology, located  113  in exon 1, that is present for the activating Ly49 genes but is either absent or different for the inhibitory ones (Figure 5.2). Ly49f Ly49e Ly49c Ly49r Ly491 Ly49d Ly49p Ly49h Ly49g Ly49a  ATTTCCTCTTTTTGCTTTGATGAAGAGGAGGGGCAGAAAATCATGAGGTTGAGTATCACT ATTTCCTCCTTTTGCTTAGATAAAGAGGAGGGGCAGAAAATCATGAGGTTGAGTATCACT ATTTCCTCTTTTTGCTTTGGTGACGAGGAGGGGCAGAAAATCATGAGGTTGAGTATCACC ATTTCCTCTTTTTGATTTGGTCAAGAGGAGGGGCAGAAAACCATGAGATTGAGTGTTGCT ATTTCCTCTTTTTGATTTGGTCAAGAGGAGGGGCAGAAAACCATGAGATTGAGTGTTGCT ATTTCCTCTTTTTGATTTGGTCAAGAGGAGGGGCAGAAAACCATGAGATTGAGTGTTGCT ATTTCCTCTTTTTGATTTGGTCAAGAGGAGGGGCAGAAAACCATGAGATTGAGTGTTACT ATTTCCTCTTTTCGATTTGGTCAAGAGGAGGGGCAGAAAAACATGAGGTTGAGTATCACT GTTTCCTCTTTTTGCTTTGATGAAGAGGAGGAGCATAAAATCATGAGGTTGAGTATCACT GTTTCCTCTTTTTGCTTTGATGACGAGGAGGAGCATAAAATCATGAGGTTGAGTATCTCT ******* **• * ** * * * ******• ■** **** ****** ****** * *  182 153 182 173 219 230 237 222 153 240  Ly49f Ly49e Ly49c Ly49r Ly491 Ly49d Ly49p Ly49h Ly49g Ly49a  CGGTGGAAATTTAGTTCTGTCTTTCATTTTTGAAACTTGTAGGGGATATAGACTAGAAAA AGGTGGAAATTTAGTTCCGTCTTTCATTTTTGAAACTCGTAGGGGATATAGACCAGAAAA CGGTGGAAATTTAGTTCCGACTTTCAATTTTGAAACTCGTAGGAGATCTAAACCAGAAAA CAGAGGAAATTTAGTTCTGCCTTTCTTCTTGGAGCCTCTAAGGGGATACAGACCAGGAAA CAGAGGAAATTTAGTTCTGCCTTTCTTCTTGGAGCCTCTAAGGGGATACAGACCAGGAAA CAGAGGAAATTTAGTTCTGCCTTTCTTCTTGGAGCCTCTAAGGGGATACACACCAGAAAA CAGAGGAAATTTAGTTCTGC- TTTCTTCTTGGAGTCTCTAAGGGGATACAGACCAGGAAA CGGAGGAAATTTAGTTCTGCCTTTCTTCTTGGAGCCTCTTAGGGGATACAGACCAGTAAA CAGTGGAAATTTAGTTCTACTGTTTATTTTGGAGACACTTAGGGGATATCAACCAGAAAA CAGTGGAAATTTAGTTCTACCGTTTATTTTGGAGACACTTAGGGGATATCAACCAGAAAA * ******•******^•*^** ** *^*** ***^** ** ***  242 213 242 233 279 290 296 282 213 300  Ly49f Ly49e Ly49c Ly49r Ly491 Ly49d Ly49p Ly49h Ly49g Ly49a  CACCAACTCTAC ^AGACAAATTTTCCCTC-ACCAGAATCACTCCGG--TAGAG CGCCAACTTTTC ^ ACCCAACTTTTCCCTCCACCAGAATCACTCCGG--TAGAG CGCCAACGTTTC ^ AGACAAATTTTCCCTCCACCAGCATCACTCCGG--TAGAG GGCCCACATTACGCCAACAGGGACATCCATTCCTTCTACCCACCTCACTTCAGG-TAGAG GACCCACATTACCCCAACAGGGACATCCATTCCTTCTACCCACCTCACTTCAGG-TAGAG GGCCCACATTACCCCAACAGGGACATCCATTCCTTCTACCCACCTCACTTCAGG-TAGAG GGCCCAAATTACCCCAACTGGGGAATCCATTCCTTCTACCCACATCACTTCAGG-TAGAG GGCCCACATTACCCCAATTGAGGCATCCATTCTTTCTACCGGCATCACTTCAGGGTGGAG AGCCAACTTT ^ TTC TCCACAGGAATCACTTCTCAGTAGAG AGCCAACTTT ^ TTCCTCCACCAGAACCACTTCTTGCTAGCG ** *^*^ *^** **^**** *^* *  291 263 292 292 338 349 355 342 252 340  Ly49f Ly49e Ly49c Ly49r Ly491 Ly49d Ly49p Ly49h Ly49g Ly49a  ACACAGGTAAAAAAAGTAACTGCCTTTTTTTTTTTTCTACCAAACGATCAAATATACTCA ACACAGGTAAAAA---TAACTGC ^ TTTTTTCTACTAAATGATCAAATATAATCA ACACAGGTAAAAG---TATCTCCCTTT TTGTTCCTACCAAATGATCAAATATACTGA TCACAGGTAACAA---TAGCTGCTTTTATTGTTTTTCTATCAAATGTTCAAATAAACTCT TCACAGGTAACAA---TAGCTGCTTTTATTGTTTTTCTATCAAATGTTCAAATAAACTCT TCACAGGTAACAA---TAGTTGCTTTTATTGTTTTTCTATCAAATGTTCAAATAAACTCT ACACAGGTAACAA---TAGCTGCTTTTATTGTTTTTCTATCAAATGTTCAAATAAACTCT ACACAGGTAAAAA---TAGCTGCTTTTTTTGTTTTTCTAAGAAATGATAAAATATACTCT ACACAGGTAACAA---TAACTGCTTTTATTGGTTTTCTACTAAATGATCAAATATA---ACACAGGTAACAA---TAACTGTTTTTATTTGTTTTCTACTAAACTATCAAATATA ********* * ** * ** *** *** * ***** *  351 313 346 349 395 406 412 399 305 393  Figure 5.2 Alignment of 5' regions of inhibitory and activating Ly49 genes A region that has high homology among activating receptors only is boxed. The region of transcriptional start site is indicated by the solid black line above the alignment. The Ly491 sequence if from BALB/C, Ly49p and r sequences are from 129/S6 and the rest of the Ly49 sequences are from the B6 strain. Ly49d, h, 1, p and r are activating genes.  Further investigation of the possible differential regulatory role of this region might explain some of the differences between inhibitory and activating receptor expression. We have generated promoter constructs including or excluding this region for Ly49d and h. We  114  will be testing the effect of this region on promoter activity in transient transfection assays in lymphoid cell lines. A further line of investigation would be to look for possible activating gene specific transcription factors.  5.4.2 Distal regulatory elements  No attempt has been made to look for distal regulatory elements in the Ly49 cluster. A possible candidate region could be the sequence between Ly49e and x in the B6 cluster. Ly49E and Q are expressed differently from the majority of Ly49 receptors (Kubota et al., 1999; Toyama-Sorimachi et al., 2004; Van Beneden et al., 2001). The region separating Ly49e and q from the main cluster contains a number of repetitive elements belonging to the  long terminal repeat (LTR) retroelement class (Wilhelm et al., 2002). I have identified multiple classical CpG islands (Gardiner-Garden and Frommer, 1987) within these elements (Figure 5.3). ^ 1 q  z  e^xif^d^k^h^n^i  ^  g^I j m  ^  a  i *-- . —  -5Kb  t-4-i^  i  -31Kb Ly49Q  I^el■IN101■1.4...■■■■•Th  -6.5Kb -2Kb Ly49E^  11  Ly49X  "1,—/ LTJ -9Kb -6.5Kb -20Kb -55Kb  Figure 5.3 CpG islands of the Ly49 cluster The downward arrows represent CpG islands, the boxes represent genes and the bent arrows show the location of promoters and the transcriptional direction. The six CpG islands are located at the centromeric side of the cluster with four situated upstream of Ly49e and two 115  downstream of Ly49q. The closest CpG island near an Ly49 gene is -6 kb upstream of the putative Pro-1 region of Ly49e. The distance created by the insertion of these retroelements might have disrupted the interaction of a regulatory element within the main Ly49 cluster with Ly49e and q. It is also possible that these elements form some sort of a boundary element isolating and protecting Ly49e and q from regulatory elements of the main Ly49 cluster. Scanning the sequence of  this region for the binding sequences of boundary element factors, such as CTCF, may reveal a possible function for this region in the expression pattern of Ly49E and Q. A further two CpG islands were also identified centromeric to Ly49q (Figure 5.3). Differential DNA methylation of these putative CpG islands might have an effect on the expression of the Ly49 receptors.  5.5 Concluding remarks  Natural killer (NK) cells constitute an important part of the body's defence both as centurions of innate immunity and as communicators and collaborators of the adaptive immune system. They exert their function via the interpretation of signals received from their surface receptors. Elucidating the regulatory mechanisms governing the expression of these receptors is of utmost importance in understanding the biology of NK cells. In this thesis I have endeavoured to shed light on the expression control of the multi-gene family of mouse Ly49 receptors. I have shown a strong link between differential epigenetic modifications at proximal regulatory regions and expression state of a number of these receptors. However, the quality and quantity of these epigenetic controls seem to differ from gene to gene. My  116  work also shows that, in contrast to the human KIRs, differential histone modifications correlate with the state of expression for the tested Ly49 genes.  117  5.5 Bibliography  Chan, H.W., Z.B. Kurago, C.A. Stewart, M.J. Wilson, M.P. Martin, B.E. Mace, M. Carrington, J. Trowsdale, and C.T. Lutz. 2003. DNA methylation maintains allelespecific KIR gene expression in human natural killer cells. J Exp Med 197: 245-255. Chan, H.W., J.S. Miller, M.B. Moore, and C.T. Lutz. 2005. Epigenetic control of highly homologous killer Ig-like receptor gene alleles. Jlmmunol 175: 5966-5974. Gardiner-Garden, M. and M. Frommer. 1987. CpG islands in vertebrate genomes. J Mol Biol 196: 261-282.  Gays, F., K. Martin, R. Kenefeck, J.G. Aust, and C.G. Brooks. 2005. Multiple cytokines regulate the NK gene complex-encoded receptor repertoire of mature NK cells and T cells. Jlmmunol 175: 2938-2947. Gays, F., M. Unnikrishnan, S. Shrestha, K.P. Fraser, A.R. Brown, C.M. Tristram, Z.M. Chrzanowska-Lightowlers, and C.G. Brooks. 2000. The mouse tumor cell lines EL4 and RMA display mosaic expression of NK-related and certain other surface molecules and appear to have a common origin. Jlmmunol 164: 5094-5102. Held, W., B. Kunz, B. Lowin-Kropf, M. van de Wetering, and H. Clevers. 1999. Clonal acquisition of the Ly49A NK cell receptor is dependent on the trans-acting factor TCF-1. Immunity 11: 433-442. Held, W. and D.H. Raulet. 1997. Expression of the Ly49A gene in murine natural killer cell clones is predominantly but not exclusively mono-allelic. Eur Jlmmunol 27: 28762884. Kubota, A., S. Kubota, S. Lohwasser, D.L. Mager, and F. Takei. 1999. Diversity of NK cell receptor repertoire in adult and neonatal mice. Jlmmunol 163: 212-216.  118  Lee, S.H., A. Zafer, Y. de Repentigny, R. Kothary, M.L. Tremblay, P. Gros, P. Duplay, J.R. Webb, and S.M. Vidal. 2003. Transgenic expression of the activating natural killer receptor Ly49H confers resistance to cytomegalovirus in genetically susceptible mice. J Exp Med 197: 515 526. -  Makrigiannis, A.P., A.T. Pau, A. Saleh, R. Winkler-Pickett, J.R. Ortaldo, and S.K. Anderson. 2001. Class I MHC-binding characteristics of the 129/J Ly49 repertoire. Jlmmunol 166: 5034-5043.  Makrigiannis, A.P., A.T. Pau, P.L. Schwartzberg, D.W. McVicar, T.W. Beck, and S.K. Anderson. 2002. A BAC contig map of the Ly49 gene cluster in 129 mice reveals extensive differences in gene content relative to C57BL/6 mice. Genomics 79: 437444. Makrigiannis, A.P., E. Rousselle, and S.K. Anderson. 2004. Independent control of Ly49g alleles: implications for NK cell repertoire selection and tumor cell killing. Jlmmunol 172: 1414-1425.  Pascal, V., M.J. Stulberg, and S.K. Anderson. 2006. Regulation of class I major histocompatibility complex receptor expression in natural killer cells: one promoter is not enough! Immunol Rev 214: 9-21. Rogers, S.L., A. Rouhi, F. Takei, and D.L. Mager. 2006. A role for DNA hypomethylation and histone acetylation in maintaining allele-specific expression of mouse NKG2A in developing and mature NK cells. Jlmmunol 177: 414-421. Santourlidis, S., N. Graffmann, J. Christ, and M. Uhrberg. 2008. Lineage-specific transition of histone signatures in the killer cell Ig-like receptor locus from hematopoietic progenitor to NK cells. Jlmmunol 180: 418-425.  119  Santourlidis, S., H.I. Trompeter, S. Weinhold, B. Eisermann, K.L. Meyer, P. Wernet, and M. Uhrberg. 2002. Crucial role of DNA methylation in determination of clonally distributed killer cell Ig-like receptor expression patterns in NK cells. J Immunol 169: 4253-4261. Toyama-Sorimachi, N., Y. Tsujimura, M. Maruya, A. Onoda, T. Kubota, S. Koyasu, K. Inaba, and H. Karasuyama. 2004. Ly49Q, a member of the Ly49 family that is selectively expressed on myeloid lineage cells and involved in regulation of cytoskeletal architecture. Proc Natl Acad Sci U S A101: 1016-1021. Valiante, N.M., M. Uhrberg, H.G. Shilling, K. Lienert-Weidenbach, K.L. Arnett, A. D'Andrea, J.H. Phillips, L.L. Lanier, and P. Parham. 1997. Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity 7: 739-751. Van Beneden, K., F. Stevenaert, A. De Creus, V. Debacker, J. De Boever, J. Plum, and G. Leclercq. 2001. Expression of Ly49E and CD94/NKG2 on fetal and adult NK cells. J Immunol 166: 4302 4311. -  Wilhelm, B.T., L. Gagnier, and D.L. Mager. 2002. Sequence analysis of the 1y49 cluster in C57BL/6 mice: a rapidly evolving multigene family in the immune system. Genomics 80: 646-661.  120  Appendix I: UBC Research Ethics Board Certificates of Approval  Certificate: University of British Columbia, Department of Health, Safety and Environment, Laboratory Biological Saftey Course. Completed May 1 st , 2001  Certificate: University of British Columbia, Department of Health, Safety and Environment, Radionuclide Saftey and Methodology Course. Completed May 23,2001  Certificate: University of British Columbia, online training requirement of the Candaian Council on Animal Care (CCAC)/ National Institutional Animal User Training (NIAUT) Program. Issued January 13,2005.  121  THE UNIVERSITY OF BRITISH COLUMBIA  Department of Health, Safety and Environment  9Se g4a k has successfully completed a course in  75Egrri,  Laboratory Biological Safety  Chair, Biosafet ommittee  gTuesday, May 01, 2001  Director, Health, Safety and Environment  THE UNIVERSITY OF BRITISH COLUMBIA  Department of Health, Safety and Environment  Arefeh Rouhi has successfully completed the Canadian Nuclear Safety Commission requirement in  Radionuclide Safety and Methodology Including receiving Class 7 Dangerous Goods  Chair, Committee on Radioisotopes and Radiation Hazards  Radiation S  Course Date: Wednesday, May 23, 2001 DiZor, Health, Safety and Environment  UBC  THE UNIVERSITY OF BRITISH COLUMBIA  Arefeh Rouhi has successfully completed the online training requirements of the Canadian Council on Animal Care (CCAC) / National Institutional Animal User Training (NIAUT) Program  Chair, Animal Care Committee  Certificate #: 0184  ^  ^  Veterinarian  Date Issued: January 13, 2005  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066738/manifest

Comment

Related Items