Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The functional role of CXC chemokine ligand 10 in coxackievirus B3-induced myocarditis Yuan, Ji 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_fall_yuan_ji.pdf [ 5.42MB ]
Metadata
JSON: 24-1.0066642.json
JSON-LD: 24-1.0066642-ld.json
RDF/XML (Pretty): 24-1.0066642-rdf.xml
RDF/JSON: 24-1.0066642-rdf.json
Turtle: 24-1.0066642-turtle.txt
N-Triples: 24-1.0066642-rdf-ntriples.txt
Original Record: 24-1.0066642-source.json
Full Text
24-1.0066642-fulltext.txt
Citation
24-1.0066642.ris

Full Text

THE FUNCTIONAL ROLE OF CXC CHEMOKINE LIGAND 10 IN COXSACKIEVIRUS B3-INDUCED MYOCARDITIS by JI YUAN M.Sc., Shanghai Medical University, 1999 B.M., Shanghai Medical University, 1994 THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Pathology and Laboratory Medicine) UNIVERSITY OF BRITISH COLUMBIA Vancouver April, 2008 © Ji Yuan, 2008 ABSTRACT Coxsackievirus B3 (CVB3) is the primary cause of viral myocarditis. The role of cystein-x-cystein (CXC) chemokine ligand 10 (CXCL10, formerly interferon-y-inducible protein 10) in CVB3-induced myocarditis is unknown. To explore the contribution of CXCL10 to CVB3-induced myocarditis, we performed functional analyses using newly generated transgenic mice with cardiac-specific CXCL10 overexpression (Tg) and CXCL10 knock out (KO) mice. The mRNA levels of CXCL10 peaked in the myocardium at day 3 post-infection prior to immune infiltration, suggesting that mainly resident cells of the heart are the sources of CXCL10. Indeed, we showed that CXCL10 can be induced by IFN-y but not by CVB3 infection in cultured cardiomyocytes. Further, a transgenic mouse model with cardiac-specific overexpression of CXCL10 was generated. CXCL10 Tg mice had spontaneous infiltrations of mononuclear cells with limited mRNA upregulation of IFN-y and IL-10, which were not sufficient to cause the impairment of cardiomyocyte or cardiac function. Following CVB3 infection, the viral titre in the mouse hearts inversely correlated with the levels of CXCL10 at day 3 post-infection. Further, the decreased virus titers in the CXCL10 Tg mouse hearts led to reduced cardiac damage indicated by low serum cTnI levels and improved cardiac functional performance and vice versa in the KO mice. This antiviral ability of CXCL10 may be through increased recruitment of natural killer (NK) cells to the heart and increased IFN-y expression early post-infection. At days 7 and day 10 post- infection with massive influx of mononuclear cells, the expression of CXCL10 enhanced the infiltration of CXCR3 + cells, CD4+, and CD8+ T cells as well as their associated ii inflammatory cytokines. However, the augmented accumulation of these immune cells and associated cytokines did not alter the viral clearance and mouse survival. Our data demonstrate for the first time that CXCL1 0 confers the protection to the heart during the early course of CVB3 infection, which may be primarily attributed to NK cell recruitment to the site of infection. This data suggest that CXCL10 is an important player in the orchestrated action of a group of cytokines and chemokines in combating against the CVB3-induced myocarditis in the early phase of infection. iii TABLE OF CONTENTS Abstract  ^ii Table of Contents ^iv List of Tables ^viii List of Figures ^ix Abbreviations ^xi Acknowledgements^  xiv Dedication ^xvi CHAPTER I Introduction ^ 1 1.1 General characteristics of coxsackievirus B3  ^1 1.2 Coxsackievirus B3-induced myocarditis  ^5 1.3 Diagnosis  ^8 1.4 Therapy ^11 1.5 Mouse models of viral myocarditis  ^12 1.6 Pathogenesis of viral myocarditis  ^17 1.6.1 Direct virus injury ^ 17 1.6.2 Immune response ^19 1.6.3 Autoimmunity hypothesis  ^26 1.7. Chemokines  ^28 1.7.1 CXCR3 ^30 1.7.2 CXCR3 ligands  ^31 1.7.2.1 CXCL9 ^32 1.7.2.2 CXCL10 ^33 iv 1.7.2.3 CXCL11 ^34 1.7.3. CXCL10 in infection  ^34 1.7.4. Overexpression of CXCL10 in mice ^39 CHAPTER II Rationale, Hypothesis, Specific Aims and Experimental Design ^41 2.1 Rationale  ^41 2.2 Hypothesis  ^42 2.3 Specific aims ^42 2.4 Experimental design ^44 CHAPTER III Investigation of the Role of CXCL10 in CVB3-Induced Myocarditis ^ 46 3.1 Material and Methods ^46 3.1.1 Virus preparation ^ 46 3.1.2 Cell line  46 3.1.3 Primary murine cardiomyocyte isolation and culture ^46 3.1.4 Construction of the transgenes  ^47 3.1.5 Generation of transgenic mice ^49 3.1.6 Virus infection ^ 52 3.1.7 Viral plaque assay ^52 3.1.8 Preparation of genomic DNA from mouse tails for PCR ^53 3.1.9 cDNA synthesis and quantitative real time QPCR ^53 3.1.10 Enzyme-linked immunosorbent assay ^54 3.1.11 In situ hybridization ^ 54 3.1.12 Western blot  ^55 3.1.13 Histology analysis  ^55 3.1.14 Immnohistochemistry ^55 3.1.15 Immunohistochemistry quantification ^56 3.1.16 Flow cytometry ^ 56 3.1.17 Echocardiography ^ 56 3.1.18 Statistical analysis  ^ 57 3.2 Results  ^58 3.2.1 Expression profile of cytokines, CXCR3 ligands and receptor in CVB3- induced myocarditis ^  58 3.2.1.1 Virus detection and histopathology examination ^58 3.2.1.2 Upregulation of Thl cytokines after CVB3 infection ^60 3.2.1.3 Induction of CXCR3 ligands after CVB3 infection ^60 3.2.1.4 IFN-y but not CVB3 induces CXCL10 expression in mouse cardiomyocytes in vitro  ^62 3.2.2 Transgenic mice with cardiac-specific overexpression of CXCL10 ^64 3.2.2.1 Cardiac-specific overexpression of the CXCL10 gene in mice^ 64 3.2.2.2 CXCL10 overexpression causes spontaneous leukocyte infiltration and alteration of IFN-y and IL-10, but do not cause myocyte injury or heart dysfunction ^ 68 3.2.3 CVB3 infection in CXCL10-deficiency and CXCL10 overexpressing mice ^71 3.2.3.1 Variability in susceptibility to myocarditis between A/J and BALB/c mice ^71 vi 3.2.3.2 Constitutive cardiac CXCL10 expression or absence of CXCL10 does not affect the severity of myocarditis  ^73 3.2.3.3 CXCL10 overexpression inhibits CVB3 replication, protects myocytes from injury and attenuates heart function deterioration from CVB3 infection in the early phase ^76 3.2.3.4 CXCL10 overexpression recruits NK cell infiltration and increases IFN-y expression during the early phase of CVB3 infection ^80 3.2.3.5 CXCL10 overexpression enhances the immune response during the inflammatory stage of CVB3 infection ^82 CHAPTER IV Discussion, Conclusions and Future directions ^ 86 4.1 Discussion ^86 4.2 Conclusions  ^95 4.3 Future directions   ^97 ^ References    99 Appendix I Animal Care Certificate    137 Appendix II List of Publications, Abstracts and Presentations    138 vii LISTS OF TABLES Table 1. Infectious causes of myocarditis  ^6 Table 2. Histological criteria for the diagnosis of myocarditis according to the new WHF- classification ^9 Table 3. Summary of susceptibility to viral myocarditis in different strains of mice^ 15 Table 4. Immunomodulation strategies in mice of viral myocarditis ^ 20 Table 5. Chemokine families^  29 Table 6. CXCL10 and Infection  35 viii LISTS OF FIGURES Figure 1. Cleavage of viral polyprotein by 2Apro and 3CPr°  ^2 Figure 2. Overview of CVB3 replication cycle in the cell  ^ 4 Figure 3. Viral myocarditis: a triphasic disease  ^14 Figure 4. Structure of chemokine classes ^29 Figure 5. CXCL10 mRNA is upregulated in mouse hearts following CVB3 infection ^ 43 Figure 6. Experimental design^  45 Figure 7. Transgene preparation for microinjection^  48 Figure 8. Transgenic mouse production^  50 Figure 9. Backcrossing mice to C%&BL/6 and then outcrossing mice to A/J background ^ 51 Figure 10. Viral replication and histopathological findings in murine hearts following CVB3 infection^  59 Figure 11. Cytokines and CXCR3 ligand expression following CVB3 infection^ 61 ^ Figure 12. IFN-y induces CXCL10 expression in murine cardiomyocytes    63 Figure 13. Genotyping the offspring by PCR   65 Figure 14. Determination of CXCL10 mRNA expression in the heart by RT-PCR and in situ hybridization   66 Figure 15. Determination of CXCL10 protein Expression by Western blot, ELISA and immunohistochemical staining^  67 Figure 16. Mononuclear cell infiltration in the myocardium of CXCL10 Tg mice   69 Figure 17. Characteristics of CXCL10 Tg mice^  70 Figure 18. Variability in susceptibility to myocarditis between A/J and BALB/c mice ^ 72 ix Figure 19. The overexpression or deficiency of CXCL10 does not alter the severity of myocarditis ^  74 Figure 20. Survival rate in mice following CVB3 infection ^75 Figure 21. CXCL10 overexpression inhibits CVB3 replication in the myocardium early ^ during infection   77 Figure 22. CXCL10 overexpression protects myocardium from damage ^79 Figure 23. Transcription of CD4, CD8, NK, and proinflmmatory cytokines in hearts at day 3 pi ^  81 Figure 24. Immune cell infiltration in the heart of CXCL10 Tg or KO mice following CVB3 infection   83 Figure 25. Phenotypical analysis of immune cell infiltrates in the heart of CXCL10 Tg or KO mice following CVB3 infection^  84 Figure 26. Transcription of CD4, CD8, NK, and proinflmmatory cytokines in hearts at day 7 pi   85 Figure 27. Proposed model: the role of CXCL10 in response to CVB3 infection in the heart ^94 x LISTS OF ABBREVIATIONS Ab^antibody Ag antigen a-MHC^a —myosin heavy chain AODN antisense oligodeoxyribonucleotide APC^antigen presenting cell APC allophycocyanin CAR^coxsackievirus and adenovirus receptor CNS central nervous system CO^cardiac output CT threshold cycle cTnI^cardiac troponin T cTnT cardiac troponin I CVA^coxsackievirus group A CVB coxsackievirus group B CVB3^coxsackievirus B3 CXCL CXC chemokine ligand CXCR3^CXC chemokine receptor DAF decay accelerating factor DCM^dilated cardiomyopathy DMEM Dulbecco's modified Eagle's medium ECL^extracellular loop EF ejection fraction eIF4GI^eukaryotic translation initiation factor 4G1 ELISA enzyme-linked immunosorbent assay xi ELR^glutamate-leucine-arginine ERK extracellular signal-regulated kinase GM-CSF^granulocyte-macrophage colony-stimulating factor GPCR G-protein-coupled receptor H&E^hematoxylin and eosin HMVEC human microvascular endothelial cells HSV^herpes simplex virus IFNR interferon receptor IFNs^interferons IG immunoglobulin IL^interleukin iNOS inducible nitric oxide synthase IP 1 0/CXCL 1 0^interferon-inducible protein 10 IRF^interferon regulatory factor I-TAC/CXCL 1 1^interferon-inducialbe T-cell chemoattractant KO^knockout LCMV lymphocytic choriomeningitis virus MAP^mitogen-activated protein MCMV murine cytomegalovirus MCP^mononcyte chemoattractant protein MHC major histocompatibility complex MHV^murine hepatitis virus Mig/CXCL9^Monokine induced by gamma interferon MIP^macrophage inflammatory protein MV mitral valve xii NK^natural killer NO nitric oxide ORF^open reading frame PAGE polyacrylamide gel electrophoresis PCR^polymerase chain reaction PE phycoerythrin pfu^plaque-forming units pi post infection PI3K/Akt^phosphatidylinositol-3 kinase/Akt PSLA parasternal long axis PW^posterior wall qRT-PCR^quantitive reverse-transcriptase polymerase chain reaction RT-PCR reverse-transcriptase polymerase chain reaction siRNA^small interfering RNA Tg transgenic Th^T helper TLR toll-like receptors TMEV^Theiler's murine encephalomyelitis virus TNF tumor necrosis factor UTR^untranslated regions WHF World Heart Federation Wt^wild type ACKNOWLEDGEMENTS This thesis is the result of four and half years of work whereby I have been accompanied and supported by many people. This work would not have been possible without their help. First, I would like to express my deepest gratitude to my supervisor Dr. Decheng Yang for his mentorship, knowledge, dedication, and guidance. It was a great pleasure to me to conduct this work under his supervision. As well, I am sincerely indebted to my mentors Drs. Bruce McManus and Honglin Luo whose constant support, stimulating suggestions and encouragement helped me in all the time of research. I am also very grateful to my supervisory committee members, Drs. Cheryl Wellington, Bruce McManus, Mike Allard and Marc Horwitz for their valuable advice and guidance throughout the work. I greatly appreciate Dr. Andrew Luster (Massachusetts General Hospital and Harvard Medical School), who generously provide us CXCL10 knockout mice. Special thanks to my colleagues in the iCAPTURE Centre for their constant assistance in various aspect of my research, particularly, Dr. Yinjing Wang, Elizabeth Walker, Travis Lim, Lubos Bohunek, Beth Whalen, Anna Meridith, Dr. Jianqin He, Brain Wang, Huifang Zhang, Zongshu Luo, Luojia Yang, Dr. Jingchun Zhang, Dr. Caroline Cheung, Dr. John Boyd and Dr. Hon Leong. Furthermore, I thank the great support on mouse breeding by Sarah Hulme, Bill Masin from Wesbrook Animal Care at Univeristy of British Columbia, and Claire Smits, Tatjana Bozin, Lynne Carter from the GEM at iCAPTURE Centre. xiv I gratefully acknowledge the financial support by the Canadian Institutes of Health Research, the Heart and Stroke Foundation of Canada, the Michael Smith Foundation for Health Research, and Department of Pathology and Laboratory Medicine at University of British Columbia. Last but not least, I would like to thank my husband, my parents and my son whose love, understanding and support enabled me to complete my work. xv DEDICATION I would like dedicate this work to my mentors Drs. Decheng Yang, Bruce M. McManus, and Honglin Luo. xvi CHAPTER I INTRODUCTION 1.1 General characteristics of coxsackievirus B3 In 1948, coxsackievirus group A (CVA) was first isolated during a poliomyelitis epidemic from the feces of paralyzed children in Coxsackie, New York (1). In the following year, coxsackievirus group B (CVB) was isolated from cases of aseptic meningitis (2). CVA produced myositis with flaccid hind limb paralysis in newborn mice, whereas the CVB caused a generalized infection in mice, with involvement of the brain, heart, pancreas, brown fat and muscle. By the end of the 1950s, the CVB had been implicated as a significant etiological agent of myocarditis and since then, six CVB serotypes (CVB 1-6) have been identified (3). Coxsackievirus B3 (CVB3) is a member of genus Enterovirus within the family Picornaviridae. It is a small, non-enveloped, icosahedral RNA virus. The mature virions are approximately 300 A in diameter and interior of the capsid shell is packed with single- stranded plus-sense RNA. The genome of CVB3 contains a single open reading frame (ORF) flanked by 5' and 3' untranslated regions (UTRs). The ORF encodes four capsid proteins VP1, VP2, VP3, and VP4, and seven nonstructural proteins, including proteinase and RNA- dependent RNA polymerase, which play crucial roles in viral protein production and viral genome replication (Figure 1). Viruses enter the cytoplasm through the coxsackievirus and adenovirus receptor (CAR) (4) and the decay accelerating factor (DAF) co-receptor (5). Replication of virus takes place in the cytoplasm of infected cells. The genomic RNA can act directly as an mRNA template for translation of a single polyprotein that is post-translationally processed primarily by CVB3-endoded proteinases 2A and 3C to produce individual structural and non-structural 1 proteins (6). In addition, viral proteinases have been shown to directly cleave multiple host proteins early in infection, including regulatory proteins involved in host transcription and translation (7, 8). Viral RNA can also serve as a template for viral RNA transcription to synthesize more copies of parental RNA through a negative strand intermediate. The non- structural proteins, particularly the RNA-dependent RNA polymerase 3D, are responsible for viral RNA replication, which takes place with rapid kinetics in the small membranous vesicles of the cytoplasm (Figure 2). The entire replication cycle of CVB3 from entry of the host cell to the release of progeny virus takes approximately 6-8 hours. In the late stage of viral replication cycle, apoptotic cascades are triggered to facilitate viral release from the host cell (9). Different human isolates of CVB demonstrated a range of virulence phenotypes in mice, from avirulent through to the ability to induce severe myocarditis (10). The cardiovirulent phenotype of CVB3 was initially linked to U/C transition at nucleotide 234 (U in cardiovirulent and C in avirulent) in the 5'UTR of CVB3 (11). Later, sequencing studies of the CVB3 isolates from humans found that the 234 nucleotide was unlikely to be a major determinant, as many isolates contained a U at 234, despite marked differences in cardiovirulence (12). Other studies found VP2 position 165 or nucleotide 2916 were important for cardiovirulence (13-15). The 5'UTR was identified as a major determinant of the cardiovirulence phenotype from two clinical CVB3 isolates (16). More recently, the introduction of mutations at the nucleotides 473 and 475 within the CVB3 IRES resulted in reduced cardiovirulence (17, 18). Collectively, cardiovirulence may depend on multiple determinants throughout the virus genome. 3 CVB3 is a ubiquitous agent and can spread rapidly within the community causing small epidemics. Though a high proportion of infections are subclinical, presentation may range from mild, undifferentiated febrile illness or upper respiratory tract infection to a severe, systematic and sometimes fatal disease of neonates. Fecal-oral transmission of the CVB3 is the primary mode of transmission. The site of entry for CVB3 is believed to be the alimentary tract. Virus multiplication at the portal of entry may be followed by viremia and further proliferation of the virus in the reticuloendothelial system resulting in the dissemination of virus and involvement of target organs (2). 1.2. Coxsackievirus B3-induced myocarditis Myocarditis is an inflammation of the myocardium associated with damage that is unrelated to ischemic injury. Evidence of myocarditis has been found in approximately 1% of autopsies (19). A large number of infectious agents, such as viruses and bacteria, can cause myocarditis (Table 1). Of the numerous agents commonly infecting humans, CVB3 is the primary causative agent of viral myocarditis (20, 21). Epidemiological studies indicated that nearly 50% of North American clinical myocarditis cases are attributable to enterovirus infection, with the CVB3 serogroup making up the most significant portion of such infections (22, 23). The peak age group in which CVB-induced myocarditis occurs is young adults, primarily between 20 and 39 years of age (24). Myocardial damage is believed to be secondary to direct viral invasion of the myocytes, as well as to the host immune response to the infection. Initially, replication of the virus in the myocytes leads to cell damage and death. At this early phase, the virus is eliminated primarily by humoral- and cell-mediated immune processes, and in most cases, myocardial inflammation promptly resolved. If this initial immune response fails to clear the 5 Table 1. Infectious causes of myocarditis (25) Viral coxsackievirus, echovirus, cytomegalovirus, adenovirus, poliovirus, influenza, hepatitis B/C, encephalomyocarditis virus, Epstein-Barr virus, herpes zoster virus, dengue virus, influenza A virus, influenza B virus, lymphocytic choriomeningitis virus, rubella virus, retrovirus, human immunodeficiency virus, mumps virus, respiratory syncytial virus, rabies virus, vaccinia virus, varicella-zoster virus, yellow fever virus Bacterial actinomyces,^brucella,^Corynebacterium^diphtheriae,^gonococcus, Haemophilus^influenzae,^meningo co ccus ,^mycobacterium,^Mycoplasma pneumoniae,^nocardia,^pneumococcus,^salmonella,^Serratia^marcescens, staphylococcus,^Streptococcus^pneumoniae,^Streptococcus^pyogenes, Treponema pallidum, Tropheryma whippelii, Vibrio cholerae Rickettsial Coxiella burnetii, Rickettsia rickettsii, Rickettsia tsutsugamushi Fungal aspergillus, blastomyces, candida, coccidioides, cryptococcus, histoplasma, mucormycoses, sporothrix Protozoal Toxoplasma gondii, Trypanosoma cruzi, Pneumocystis carinii Spirochetal borrelia, leptospira Parasitic ascaris, schistosoma, Echinococcus granulosus, Trichinella spiralis, visceral larva migrans 6 viral agent, the persistence of a virus or ongoing immune processes directed against the myocardium may be responsible for the pathogenesis of dilated cardiomyopathy (DCM) and ultimately heart failure. Clinically, CVB3 infections are associated with different forms of subacute, acute, and chronic myocarditis (24, 26). The clinical presentation features of viral myocarditis are broad. Most patients are asymptomatic or present with non-specific complaints, such as fever, malaise, and myalgias. Such patients may recover completely without long-term sequelae. In some cases, the infections may cause cardiac arrhythmias and acute heart failure, occasionally with sudden death as a consequence. Years later, persistent myocardial inflammation may progress to DCM, to which the only current treatment is heart transplantation (27-30). Several studies suggest a link between persistent low grade viral infection and DCM using serological and molecular techniques (31, 32). The etiology of DCM may either be that infectious virus replication continues at low levels or that persistence of viral RNA in the absence of productive infection occurs. In a state of quiescence, viral antigens may still be presented on the cell surface, directing an immune response to these cells. Also, viral infection may trigger autoimmune-mediated myocardial damage. Morphologically, the heart may appear normal or dilated during the acute phase of myocarditis. These lesions may be diffuse or patchy. The ventricular myocardium is typically flabby and often mottled by either pale foci or minute hemorrhagic lesions. Mural thrombi may be present in any chamber. Under the microscope, interstitial inflammatory infiltrate and focal necrosis of myocytes adjacent to the inflammatory cells can be observed. The infiltrate is mononuclear and predominantly composed of lymphocytic cells. If the patient survives the 7 acute phase of myocarditis, the inflammatory lesions wither, resolve, or heal by progressive fibrosis. 1.3. Diagnosis Endomyocardial biopsy of the right ventricle remains the gold standard for diagnosing myocarditis. The diagnosis criteria, called the Dallas criteria, were produced by a panel of cardiac pathologists at the American College of Cardiology meeting in Dallas in March of 1984. Dallas criteria myocarditis is characterized by an inflammatory infiltrate and associated myocyte necrosis or damage in the absence of an ischemic event. Borderline myocarditis is characterized by a less intense inflammatory infiltrate and no light microscopic evidence of myocyte destruction (33). Definition of Acute and Chronic Myocarditis by the World Heart Federation (WHF) Task Force expanded the light microscopical Dallas criteria of myocarditis, as outlined in Table 2 (34). This includes more specific details of the amount of infiltrates: more than 14 leukocytes/mm 2 of cardiac tissue consisting predominately of activated T-cells, as assessed by immunohistochemistry, define active or chronic myocarditis. Based on these histopathological criteria, myocarditis accounts for approximately 10% of cases with new-onset cardiac dysfunction submitted for endomyocardial biopsy (35, 36). However, biopsies can result in false negatives because inflammatory involvement may be focal or patchy. Detection of CVB3 in the affected heart is important. In practice, isolation of virus from myocardium is rarely successful. One of the reasons is that virus may be eliminated from the tissue by the time the symptoms appear and a biopsy sample is taken for examination. 8 Table 2. Histological criteria for the diagnosis of myocarditis according to the new WHF-classification Diagnosis WHF Classification Acute (active) myocarditis An infiltrate (diffuse, focal or confluent) of> 14 leukocytes/mm2 ; necrosis or degeneration is compulsory; fibrosis may be absent or present. Chronic myocarditis An infiltrate of> 14 leukocytes/mm2 ; necrosis or degeneration are not evident; fibrosis may be absent or present. No myocarditis No infiltrating cells or < 14 leukocytes/mm 2 . Ongoing (persistent) myocarditis Criteria as in acute or chronic myocarditis. Resolving (healing) myocarditis Criteria as in acute or chronic myocarditis but the immunological process is sparser than in the first biopsy. Resolved (healed) myocarditis 2No infiltrating cells or < 14 leukocytes/mm , with or without fibrosis. 9 Traditionally serodiagnosis of a recent CVB3 infection is carried out by testing acute and convalescent sera in a virus neutralization assay. A four-fold rise in antibody titre is taken to be indicative of a recent infection. Recent infection can also be identified using a virus-specific IgM assay. The presence of IgM generally indicates infection with CVB3 in the past 1-3 months. Currently, there are several molecular methods available for detection of CVB3 RNA in myocardial tissue, including dot blot, Northern blot, in situ hybridization and RT-PCR (37). Early studies utilized the dot blot hybridization technique to investigate an association between enteroviruses and heart disease (38). Northern blot is more specific but also more time-consuming (39). In situ hybridization is another system frequently used. It is a technically demanding method which relies on an adequate number of RNA molecules being present inside each cell, to be detected by a labeled probe. A simple, yet specific and sensitive method is RT-PCR to detect viral genomic material. Hilton et al. used in situ hybridization and RT-PCR to investigate the presence of coxsackievirus RNA in childhood myocarditis using formalin fixed tissue (37). Two out ten cases studied were positive. Viral RNA was predominantly associated with areas containing inflammatory cell infiltrates and myofiber necrosis, suggesting lytic action of the virus. In addition to etiology identification, changes on the electrocardiogram are commonly ST segment and T wave abnormalities, especially if pericardial involvement is present. Elevated levels of myocardial creatine kinase and troponin I, which signify myocardial necrosis, may be detected in the blood during the acute phase of the illness. 10 1.4. Therapy Current treatment strategies for patients with viral myocarditis are primarily supportive and include avoidance of exercise, electrocardiographic monitoring for arrhythmias, and treatment of heart failure. In recent years, some promising anti-viral therapeutic candidates have emerged, including molecules that specially target virus entry, nucleic acid-based anti-viral agents and immunomodulatory agents (40). Virus and host cell receptor interaction is the first event in the viral life cycle. Both the coxsackievirus and adenovirus receptor (CAR) and decay-accelerating factor (DAF; CD55) serve as receptors for virus attachment or internalization into host cells. Pleconaril acts by binding to the conserved hydrophobic pocket of the picornaviral capsid, thereby altering its conformation and subsequent receptor attachment. It is currently administered on compassionate basis for life-threatening meningitis, encephalitis and myocarditis. Data from compassionate use in neonates with life-threatening infectious hepatitis and pharmacokinetic evidence from adult infections suggest favorable responses (41, 42). Win54954 binds in the hydrophobic pocket of the CVB3 VP 1 protein and is a promising compound for the treatment of experimental viral myocarditis (43). As nucleic acid-based antiviral agents function through sequence-specific targeting of cellular mRNA, these molecules have become powerful tools in functional gene analysis and drug development. The applications of antisense oligodeoxyribonucleotide (AS-ODN) and small interfering RNA (siRNA) in the treatment of CVB3 infection have been reported during the past ten years (44-48). Although the development of AS-ODNs or siRNAs as anti- CVB3 drug candidates has made significant progress, many obstacles still need to be overcome before they can be clinically used. These include the issues on the selection of 1 1 easily accessible sites, delivery of the drug to the target organs or the specific compartment within the cells, and the potential side effects of the drug. Clinically, however, it is difficult to prove the etiology early enough to allow appropriate antiviral agents. At present, the role for immunosuppressive therapy in the treatment of viral myocarditis is limited. In the myocarditis treatment trial, 111 patients diagnosed with myocarditis based on the Dallas criteria were randomized to conventional therapy or an immunosuppressive regimen of corticosteroids combined with either azathioprine or cyclosporine. There was a similar degree of recovery of ventricular function and no difference in mortality at 4.3 years of follow-up (49). Targeted modulation has shown conflicting results. Immunoglobulin (IG) therapy has prevented myocardial injury in experimental models of myocarditis (50, 51). In a small patient study, high-dose IG improved recovery of left ventricular function and a trend of increased survival during the first year in pediatric patients with myocarditis (52). More recently, Kishimoto et al. also showed improved heart function in adults with myocarditis and DCM with IGs treatment (53). However, in the placebo-controlled prospective trial in patients with recent-onset DCM and myocarditis, McNamara et al. showed that IG administration did not improve in left ventricular heart function (54). 1.5. Mouse models of viral myocarditis Lerner et al. developed an animal model of myocarditis using mice inoculated with CVB (55). The mouse model of CVB3-induced myocarditis is composed of three distinct stages: including viremic injury, immune infiltration, and reclamation (56). The first 4 days post-infection (pi) are characterized by virus infection and direct damage of target cardiomyocytes prior to visible immune cell infiltration. The massive influx of mononuclear 12 cells occurs between 5-14 days pi, accompanied by destruction of infected myocytes and stromal collapse. By day 15 pi, healing advances with various degrees of fibrotic repair and cardiac dilation (Figure 3). Mice infected with CVB3 develop heart disease that closely mimics the human condition of myocarditis. Thus this model is a valuable tool in studying the pathogenesis of CVB-induced myocarditis. Variability in susceptibility to myocarditis of different mouse strains has been reported by several groups (Table 3). The underlying mechanisms are not well-understood, however it has been revealed that different immunopathogenesis of disease depends on the genetics of the host, including H-2 and non-H-2 genes (57, 58). The influence of the major histocompatibility complex (MHC, H-2 in mouse) on disease progression has been demonstrated by comparison of mice with the same or different H-2 congenics. In the acute phase of CVB3 infection, mice with H-2 b (C57BL/6, and A.By) generally demonstrate lower susceptibility to myocarditis than those with H-2 d (BALB/c, DBA/2, and BlOD.2N). A/J (H- 2') or C3H (H-2 k) mice are the most susceptible to CVB3-induced myocarditis (59, 60). However, the extent of virus replication and damage in the myocardium is considerably higher in SWR/J (H-2") mice than that observed in DBA/1J mice (H-2q), suggesting that non- H-2 factors may also contribute to the development of the disease. More recently, three loci in the host genome have been linked to myocardial infiltration or sarcolemmal disruption during CVB3 infection in mice of different genetic backgrounds but with a common H-2 haplotype (61). In addition, persistent CVB3 infection in association with inflammatory lesions was found to develop in the strains SWR/J (H-2") but not DBA/1J (H-2q) mice. The difference in pathogenesis in SWR/J and DBA/1J mice, which share the same H-2 haplotype, indicates that the resistance against the development of chronic myocarditis is not associated 13 Susceptibility to viral myocarditis References BALB/c, DBA/2, BlOD.2N (H-2 d) > C57BL/6, A.By (H-2 b) (60) A/J (H-2), C3H (H-2 k) > B 1 0.D2, BALB/c, DBA/2 (H-2 d) > C57BL/6 (H- 2b) (59) C3H (H-2k) > BALB/c, DBA/2 (H-2 d) (62) BALB/c (H-2d) = MRL±/± (H-2k) = DBA/2 (H-2 d) (63) Acute:^A.BY/SnJ^(H-2 1),^A.SW/SnJ^(H-2s)^>^A.CA/SnJ^(H-2)^> C3H.NB/SnJ (H-2'), B10.S/SgSf (H-2 s), B10.PL/SgSf (H-2u) Chronic: persistent viral infection in A.BY/SnJ (H-2 1), A.SW/SnJ (H-2 s), A.CA/SnJ (H-2), and C3H.NB/SnJ (H-2") but not B10.S/SgSf (H-2 s) and B10.PL/SgSf (H-2) (64) Acute: A.CA/Sn J (H-25, A. BY/SnJ (H-2 b), SWR/J (H-2 9) > DBA/1J mice (H-2q). Chronic: persistent viral infection in A.CAJSn J, A. BY/SnJ and SWRIJ but not DBA/1J mice. (65) Table 3. Summary of susceptibility to viral myocarditis in different strains of mice. Studies have shown that the cardiac damage and inflammation vary in different strains of mice. Variability in susceptibility to myocarditis of different mouse strains may depend on both H-2 and non-H-2 genes. Some studies showed mice with different H-2 congenics exerted variable susceptibility to myocarditis, suggesting that H-2 may contribute to the development of the disease. However, other studies showed that mice with same H-2 congenics exerted different degrees of myocarditis, indicating that non-H-2 factors may be also associated with the development of myocarditis. The genetic makeup of mice is crucial for development of myocarditis, but the major genetic determinants that contribute to the pathogenesis of the disease are still unknown. (`>' means the former has more severe myocarditis, and means they have smiliar degrees of viral myocarditis) 15 with the H-2 locus of the host (65). This is also supported by other study by Wolfgram et al., who observed the differences between A.SW/SnJ (H-2 s) and B10.S/SgSf (H-2 s) mice in the development of chronic myocarditis (64). In further analysis of host factors that might contribute to ongoing myocarditis in susceptible (A.BY/SnJ:H-2" & SWR/J:H-2 9) and resistant mouse (C57BL/6:H-2" & DBA/1J:H-2") strains, Szalay et al. determined that increased expression of immunoproteasomal subunits LMP2, LMP7, and MECL-1 resulted in enhanced proteolytic activities of cardiac proteasomes and concerted up-regulations of the antigen-presenting machinery in susceptible mouse strains (66). C57BL/6 and BALB/c mice have been known to react differently to identical pathogens such as Leishmania and encephalomyocarditis virus (67, 68). C57BL/6 mice developed a Th-1 response, while BALB/c produced a Th-2 response toward these infections. However, this can not be applied in the case of CVB3 infection. Leipner et al. found that C57BL/6 and BALB/c expressed similar levels of cytokine mRNA in the heart following CVB3 infection. Nevertheless, the virus in heart decreased more slowly in BALB/c than in C57BL/6 mice. The virus-specific antibody response was different in two mouse strains. C57BL/6 mice showed a moderate IgM response but a strong IgG response, whereas BALB/c mice showed a strong IgM response but weak IgG response. The protective role of virus-specific IgG may contribute to the efficient virus elimination from myocardium of C57BL/6 mice (69). Distinct immunopathogenic responses in different strains of mice lacking of T cell subtypes have also been demonstrated (57). For example, CD4 + KO mice in A/J background did not change the mortality or cardiac viral titres, but the severity of myocarditis was decreased in CD4+ KO mice, suggesting a pathogenic role of CD4+ lymphocytes (70). In 16 another study using C57BL/6 mice, Henke et al. showed that CVB3 infection of mice that lacked CD4+ lymphocytes had a marked increase in myocardial inflammation, a decrease in cardiac viral titre, and a decrease in mortality compared with control mice (71). The inconsistent results may be partially due to the different strains of mice used. As mentioned above, C57BL/6 mice (H-2 b) develop little myocarditis whereas A/J mice (H-2 k) develop a severe myocarditis after CVB3 infection. Gene-targeted KO of CD4+ T cells in H-2" mice with a low susceptibility to myocarditis results in a robust CD8-dependent inflammatory response after CVB3 infection, whereas in myocarditic H-2 k mice, KO of CD4+ or CD8 + T cells alone is not sufficient to markedly affect cellular infiltration and mortality. 1.6. Pathogenesis of viral myocarditis The pathogenesis of CVB3-induced myocarditis is complicated and controversial, with evidence that both direct virus-mediated injury and subsequent inflammatory response contribute to the injury of cardiomyocytes, and the extent of such injury determines the severity of end-stage organ dysfunction (20, 72, 73). There is ongoing debate regarding the significance of direct viral cytopathic effect, or deleterious facets of the evoking immune response, or both, in disease progression. The recent use of genetically manipulated mouse models of transgenic (Tg) overexpression or KO targets have provided opportunities to further explore the factors that determine the pathogenesis of myocarditis. 1.6.1. Direct virus injury CVB3 is able to produce a direct cytopathic effect in cardiomyocytes and is able to induce cell apoptosis (9). It has been demonstrated that the mitochondria-mediated apoptotic pathway that is involved in cell death and apoptosis during the late phase of virus infection facilitates viral progeny release (9). Overexpression of anti-apoptotic molecules Bcl-2 or Bc1- 17 xL, or the use of the pharmacologic general caspase inhibitor zVAD.fmk delayed the decrease in host cell viability and decreased viral progeny release following infection (9). The proteases of CVB3 are also actively involved in viral pathogenesis via cleavage of host proteins, such as translation and transcription initiation factors (74), signaling molecules, as well as structural proteins (8, 75). For example, during CVB3 infection, eukaryotic translation initiation factor 4G1 (eIF4GI) was found to be cleaved by 2AP r° (76, 77). Cleavage of this factor abruptly halts protein synthesis, and subsequently abolishes cap-dependent cellular mRNA translation while allowing cap-independent translation of viral RNA (78). Another functional role of 2AP ID in viral pathogenesis is the cleavage of dystrophin, a key protein component of heart muscle that is frequently mutated in congenital forms of DCM (8, 79). Proteolytical cleavage of dystrophin leads to functional and morphological disruption of cardiomyocytes and is believed to cause DCM (80). In experimental mouse models, the highest titres of virus are seen in the myocardium at day 3-5 pi. Cellular damage occurs concurrently with high titres of virus. Cardiac isoforms of troponin T or I (cTnT, cTnI) are only expressed in cardiac muscle and they are sensitive markers of myocardial injury. Lim et al. measured the serum cTnT levels, viral titres, and histological changes in mouse hearts at various time points during the course of CVB3 infection. They found serum cTnT levels were closely correlated with virus titres in the heart, but not with the degrees of inflammation, implying the major role of virus-mediated injury during the acute virus infection (81). In addition, the majority of extensive apoptotic phenotypic alterations in cardiomyocytes were co-localized with presence of viral RNA as demonstrated by in situ hybridization, reinforcing the importance of direct virus-mediated damage (82). Furthermore, experiments carried out on mice with severe combined 18 immunodeficiency showed that CVB3 is capable of lytic damage to cardiomyocytes (20). In the late phase of acute myocarditis, CVB3 may also evade immunological surveillance, thus inducing a latent infection of the heart. In animal studies, persistent infection of the heart has been found in several mouse strains and it is characterized by restricted viral replication and gene expression (64, 65). Notably, persistent infections were detectable in patients with end- stage DCM (83). Pathogenic consequences of persistent infection were further substantiated by expression of a mutated full-length non-infectious CVB3 cDNA in the heart as transgenes in mice that induced DCM (84). These evidences emphasize that the highly lytic viruses can injury host cells in the presence or absence of host immune defenses, favoring the hypothesis of virus-mediated damage. 1.6.2. Immune response Replication of CVB3 in the heart and the presentation of viral antigens on cardiomyocytes in the context of MHC can initiate an immune response directed towards the elimination of infectious agents. Insufficient immunity may delay viral clearance, but the intact immune response may indirectly cause cellular damage when it attempts to clear the infected cells. The well-established murine models of myocarditis permit this line of investigation (Table 4). The innate immune response of the host represents the first line of defense against the virus infection, and also serves to initiate and regulate subsequent adaptive immune responses. Early during infection, NK cell and macrophage migration, and interferon (IFN) production by infected cells are principal mechanisms of innate responses against viruses. Before specific T lymphocytes, the early infiltration of NK cells directly lyses 19 Table 4. Immunomodulation strategies in mice of viral myocarditis Treatment Background strain Viral titre in heart Severity of myocarditis References Natural killer (NK) cell depletion CD-1 I ± (73, 85) KO iNOS MF1/129SvJ T t (86, 87) KO MIP-la C57BL/6 ± 4, (88) anti-MIP-2 Ab treatment C3H/HeJ ± .i. (89) KO IFN-I3 129Sv/C57BL6 T T (90) KO IFN-y BALB/c T ± (91) KO Type I IFNR 129SvJ ± + (92) KO Type II IFNR 129SvJ ± ± (92-94) MyD88 C57BL/6 1 1 (95) KO TNF-a C57BL/6 ± i (96) KO MHC class II C57BL/6 ± 1 (97) KO CD4 A/J ± ,i (70) KO CD4+ C57BL/6 1 T (71) KO CD8 A/J ± ± (70) KO 132-microglobulin (lack CD8 cells) C57BL/6 i ± (71) KO I32-microglobulin (lack CD8 cells) C57BL/6 T T (98) KO perforin C57BL/6 ± ± (98) KO perforin C57BL/6 ± ,I (99) KO CD4+ and CD8 + A/J ± 1 (70) KO a/13-TCR A/J ± 1 (70) KO CD4' and depletion of CD8 + T cells C57BL/6 T 1 (71) athymic nude (lacks all T cells) BALB/c ± 1 (100) KO p56" A/J 1 i (101) KO CD45 A/J 1 i (102) SCID (lack T and B cells) C3H/HeJ T T (20) KO B cells C57BL/6 Delayed I (103) 20 infected cardiomyocytes to clear virus from the heart. In addition, NK cells induce MHC antigen expression on cardiomyocytes by releasing cytokines, which prepare the NK cells to interact with T lymphocytes. Murine NK cell activity increases early after CVB3 infection and follows similar kinetic patterns to viral titres in heart tissues, i.e., both peak at 3 to 4 days pi and then gradually decline (73). Animal models depleted of NK cells developed a more severe form of myocarditis as a result of increased viral replication and release (73, 85, 104). There was no significant difference in the number of inflammatory and scar lesions, however, these lesions exhibited increased dystrophic calcification and deterioration. These suggest an antiviral role of NK cells in the early stage of infection. Macrophages account for one of the major immune cell populations and appear early in infection. They may be primarily involved in eliminating virus and virus-damaged tissue. Nitric oxide (NO) produced by inducible nitric oxide synthase (iNOS) in macrophages is an early response to viral infection. CVB3 infection has been shown to induce iNOS, which has the effect of lowering viral titres early in infection (105). This anti-viral activity may be partially through the inactivation of CVB3 proteases 2A and 3C by NO (8, 106-108). Removal of the iNOS gene resulted in increased viral titres and severity of myocarditis in CVB3-infected mice (86, 87). On the other hand, macrophages may cause tissue injury through production of certain pro-inflammatory cytokines. CVB3 induced a potent release of tumor necrosis factor (TNF)-a, interleukin (IL)-1, and IL-6 from monocytes and supernatants of CVB3-infected monocytes displayed cytotoxic activity against cardiomyocytes, indicating that activation of monocytes by CVB3 may contribute to tissue damage in the myocardium (109, 110). This detrimental role of macrophages in viral myocarditis is further supported by studies using mice lacking chemokines that specifically attract macrophages. Mice unable to 21 produce macrophage inflammatory protein-1 alpha (MIP-la) were resistant to CVB3 infection (88). Plasma MIP-2 (murine counterpart of IL-8) levels were significantly elevated in mice on days 7, 10 and 14 pi. In mice with anti-MIP-2 antibody (Ab) treatment, survival rates were higher than in the control group. Histopathological examination revealed that cellular infiltration and myocardial necrosis with macrophage and T cell accumulation were less prominent in the anti-MIP-2 Ab-treated groups as compared to the controls (89). IFNs assist the immune response by inhibiting viral replication within host cells, activating NK cells, increasing antigen presentation to lymphocytes, and inducing the resistance of host cells to viral infection. Type I IFNs such as IFN-a, p, bind to type I IFN receptor (IFNR). Type II IFN, IFN-y binds to type II IFNR. In vitro studies provided evidence that both type I and II IFNs may attenuate CVB3 replication in cardiac-derived cell lines (111, 112). Treatment of type I IFNs can ameliorate viral myocarditis in mice (113, 114). Pancreatic overexpression of IFN-y protected mice from lethal myocarditis (115). IFN- y deficient BALB/c mice had increased levels of viral replication in the heart without altering myocardial inflammation (91-94). These findings illustrate the contribution of IFN-y in protecting the heart against CVB3 replication. Interestingly, Type I IFNR-deficient mice displayed greater susceptibility to CVB3 infection, higher mortality, higher virus titre in liver, but no increase of viral RNA in the heart (92, 116), suggesting that type I IFNR signaling is essential in the early virus life cycle and is required to control viral replication in the liver, but not in the heart. Similar results were shown in a recent study of mice lacking the IFN-I3 gene at the early stages of acute infection (day 4 and 7 pi). At day 10 pi, IFN-I3 KO mice exhibited higher viral titres in the liver, also in the heart (90). 22 Toll-like receptors (TLR) play important roles in innate immunity against viral infection. TLR7 and TLR8 were shown to be involved in the inflammatory response against CVB3 (117). Viral peptide motifs interact with TLRs, which subsequently activates intracellular signaling pathways to produce cytokines (118, 119). As the sole adapter for TLR7, TLR8, and TLR9, the intracellular adaptor MyD88 plays an important role in TLR/IL- 1R signaling and appears to be a key contributor to cardiac inflammation after CVB3 infection (95). MyD88 KO mice showed a dramatically higher survival rate than controls after CVB3 infection. Viral titre, cardiac inflammation and associated cytokine production were significantly decreased in the MyD88 KO mice. In contrast, levels of the activated interferon regulatory factor (IRF)-3 and IFN-I3 were significantly increased in the heart of MyD88 KO mice, which may confer host protection from infection (95). Further, the downstream cytokine cascades are activated and play an important role in innate immunity. Upon CVB3 infection, the expression of a number of cytokines is induced (120). IL-1 a, IL-113, IL-6, TNF-a, and TNF-I3 are expressed throughout the early phase. IL-2, IL-3, IL-4, IL-10 IFN-y, granulocyte-macrophage colony-stimulating factor (GM-CSF), and IL-2R are mainly expressed by the infiltrating cells. TNF-a, TNF-13, and IL-113 are also expressed in part by the infiltrating inflammatory cells. Thl -related cytokines (IL-2, IFN-y and TNF-a) are more strongly expressed than Th2-related cytokines (IL-4 and IL-10), indicating that Thl -type immune cells are the predominant infiltrate in the heart following CVB3 infection. TNF-a is expressed in the heart during viral myocarditis and its expression aggravates the condition. TNF-a decreases myocardial contractile efficiency, reduces ejection fraction, and induces biventricular dilation (121). TNF-a KO mice have significantly less myocarditis 23 and fewer CD4+ IFNI+ cells than controls. p55 TNFR KO mice also develop significantly less myocarditis than wild-type C57BL/6 mice. There is no difference in myocarditis between C57BL/6 and p75 TNFR KO animals, indicating that this receptor does not participate in the disease process. (96). The adaptive/acquired immunity is composed of T cells and B cells. The presence of T cells in the infiltrates indicates that acquired immunity also contributes to the pathogenesis of myocarditis. Viral peptide fragments are processed and presented to the cell surface in an MHC-restricted manner, allowing cytotoxic T cell to seek out the infected cells and destroy them through cytokine-mediated signaling or perforM-mediated cell death (120, 122, 123). Thus, the activation of acquired immunity is initially protective. Removal of T cell subsets may reduce immune-mediated damage but results in disseminated infection. However, the continuous activation of these cells is ultimately detrimental for the host, because both cytokine-mediated and T cell-directed damage to cardiomyocytes reduces contractility. In 1974, Woodruff first demonstrated that depletion of T cells using anti-thymocyte sera or thymectomy and irradiation, led to a decrease in mortality and a decrease in the inflammatory infiltrate after CVB3 infection (124). Subsequently, considerable research has been performed to determine the role of T cell subtypes in the immunopathogenesis of viral myocarditis. When CD4 KO or CD8 KO mice were exposed to CVB3, loss of CD8 + cells did not significantly affect survival, although it did attenuate the viral proliferation. Conversely, CD4 KO showed a trend toward an improvement in survival. Finally, it is the double KO of CD4±/CD8+ immune cells that demonstrated the best outcome in terms of viral attenuation and decreased mortality in the host (70, 71). This confirms the concept that the T cell 24 responses in this myocarditic phenotype are overly exuberant, which is detrimental for host survival with increased inflammation, cardiomyocyte destruction, and heart failure. The p56" is the primary Src kinase in T cells and is implicated in the maturation of thymocytes into CD4 + T cells. T cell receptor-associated tyrosine kinase p56" is critical for both virus proliferation in the heart and activation of the T cells homing to the heart (101). Indeed, p56" homozygous KO animals did not develop any myocarditis, despite exposure to large doses of the CVB3. CD45 is a unique cell membrane protein that is anchored to tyrosine phosphatase and modulates p56 /ck function and can be externally modulated. In CD45 KO mice, the infected hosts are resistant to viral infection, and exhibit decreased inflammation and increased interferon levels (102). Direct activation of co-receptor signaling pathways involving p56 1  may lead to activation of signal pathways and downstream cytokine modulation. This has been recently shown to be a function of the MAPKs (mitogen activated protein kinases) extracellular regulated kinase (ERK) 1/2, which have a dual function of modulating viral proliferation as well as myocardial phenotype (125). This connection begins to unravel the link between virus receptor signaling pathways of CAR, its co-receptor DAF, the T cell signaling regulators of p56 ick and CD45, to intracellular targets such as ERK1/2. A minor subtype of T lymphocytes called y8+ T cells are also involved in adaptive immunity. Huber et al. showed that myocarditis susceptibility depends upon activation of 76 + T cells, which favors Thl cell differentiation (126-128). Depletion of y6 + T cells abrogated myocarditis in susceptible animals and resulted in a Thl—Jh2 phenotype shift (128). Further, y8+ T cells are capable of directly inducing Fas-dependent apoptosis in cultured myocytes, 25 suggesting that they may be involved in myocardial injury during CVB3-induced myocarditis (129-131). B cells are the primary lymphocytes involved in the creation of antibodies that circulate in blood, plasma and lymph, known as humoral immunity. Though B cells are minimally detected, the importance of B cells in CVB3-induced myocarditis is apparent, as evidenced in the experiment by Mena et al (103). They demonstrated that in B cell KO mice following CVB3 infection, virus load was slightly delayed but histological outcome, inflammation, and mortality were more severe than that in controls during the acute phase. During the chronic phase, persistently higher viral titres, more severe myocardial fibrosis and ventricular dilation were observed in the B cell KO mice compared to control mice, highlighting the importance of humoral immunity in the surveillance and clearance of this virus. A beneficial role for antibodies has also been suggestion in another study. CVB3- infected newborn mice were found to be protected from death if CVB3-neutralizing antibodies were given before or after infection (51). Whether viral infection or immunological damage to cardiomyocytes contributes more to the pathogenesis of viral myocarditis is still debatable. A better molecular understanding of both the direct effect of viral infection on cardiac myocytes and the balance of beneficial and detrimental effects of the immune response will ultimately provide insight into the mechanisms by which viral infections cause cardiomyopathy in humans. 1.6.3. Autoimmunity hypothesis Autoimmune-mediated myocardial injury has been implicated in the mechanism of post-myocarditis DCM. The post-viral autoimmunity and antigenic mimicry hypotheses have 26 been proposed for cardiomyocyte damage and resultant ventricular dilation following CVB3 infection. According to the post-viral autoimmunity hypothesis, CVB3 infection initially causes limited myocardial lesions but resultant myosin or other structural protein leakage into the circulation triggers an adverse antibody response that is primarily responsible for myocyte injury. This is supported by the presence of autoantibodies against myosin, actin and other heart-specific antigens in patients with myocarditis (132, 133). The other proposed mechanism is antigenic mimicry between CVB3 and host proteins. Molecular mimicry of myocardiogenic epitopes causes the breakdown of antigen- specific self-tolerance. It has been shown that mimicry exists between cardiac myosin and the M5 protein of group A streptococcus that causes rheumatic fever. Monoclonal antibodies to streptococcal M protein and human cardiac myosin also neutralize CVB3, indicating that these pathogens that induce autoimmune heart disease share a common cross-reactive epitope with cardiac myosin (133). It has been reported that CVB3 has sequence homology to streptococcal M protein and cardiac myosin (134, 135), which can lead to antibodies or cytotoxic T lymphocytes originally directed against the virus to cross-react with host antigens. These harmful immune properties were demonstrated by transfer of mononuclear cells from mice infected with CVB3 into genetically identical or immunodeficient mice (136). However, the viral antigens that initiate autoimmune myocarditis have not yet been fully determined in experimental models or in clinical cases. Thus far, despite the demonstration of autoimmune phenomena in patients with myocarditis and DCM, there is no definitive validation of the autoimmune pathogenesis in viral myocarditis and more extensive studies are needed to support a plausible link. 27 1.7. Chemokines Leukocyte migration during physiologic and pathologic conditions is regulated by a number of protein families including adhesion molecules, cytokines, chemokines, and proteases. Chemokines are small heparin-binding proteins that specifically direct the movement of circulating leukocytes to sites of inflammation or injury. They bind to proteoglycans on the surface of endothelial cells. Leukocytes interact with these chemokines through specific receptors, which activate integrins and trigger intravascular adhesion (137). In addition, leukocyte migration through tissues to the target microenvironment is driven by chemokines (138, 139). To date, approximately 50 human chemokines and 19 receptors are divided into four families on the basis of relative position of conserved cysteine residues (140-142). The groupings are termed the CC, CXC, CX 3C, and XC chemokines (Table 5, Figure 4). Functionally, chemokines are also classified as inflammatory or immune/constitutive chemokines. Inflammatory chemokines are induced in peripheral tissues by inflammation, while immune/constitutive chemokines fulfil housekeeping functions and may be involved in constitutive leukocyte trafficking (143). The pattern of chemokine receptor localization and distribution of chemokines in tissues critically influences immune responses, as each individual chemokine may direct different types of cells to distinct microenvironments. For example, Thl cells have been demonstrated to express CXCR3 and CCR5, whereas Th2 cells express CCR3, CCR4, and CCR8 (143). CXC chemokines are further subclassified into glutamate-leucine-arginine (ELR) and non-ELR CXC chemokines on the presence or absence of a characteristic ELR motif near the N terminal of the molecule that dictates their functional activity (142). The CXC chemokines 28 —CXC CC chemokines^CXC chemokines CX3C chemokines^C chemokines Table 5. Chemokine families Family Structure Receptor Chemokine ligands CC First 2 of the 4 cysteine residues adjacent to each other CCR CCL CXC single amino acid residue positioned between the first two cysteines CXCR CXCL CX3C 3 amino acids positioned between first 2 cysteine residues CX3CR CX3CL XC Single cysteine residue XCR XCL Figure 4. Structure of chemokine classes. Chemokine families are structurally related peptides possessing a pattern of conserved cysteine residues near the amino-terminal domain. The position of the cysteine residues is the basis for the classification into four families. The -CC- has two adjacent cysteine residues. The -CXC- has one amino acid (X) separating two of four conserved cysteine residues. The -CX3C-chemokine has three amino acids separating two of four cysteines. The -C-chemokine has only one conserved cysteine residue. C represents cysteine, X represents an amino acid. — Peptide chain, — disulphide bridge. 29 with this ELR motif (ELR±) promote angiogenesis. In contrast, CXC chemokines that lack the ELR motif (ELR -), inhibit angiogenesis (144, 145). Modulation of the angiogenic action of ELR or ELR- CXC chemokines holds promise for cancer treatment (145). Three CXCR3 ligands: monokine induced by gamma interferon (Mig/CXCL9), interferon-inducible protein 10 (IP10/CXCL10), and interferon-inducible T-cell chemoattractant (I-TAC/CXCL11), are classified as ELR - CXC chemokines which function through specific binding of their seven transmembrane domain G protein-coupled receptor (GPCR) CXCR3. 1.7.1 CXCR3 Human, mouse and rat CXCR3 were cloned in late 1990's (146-149). Recently, a splice variant of human CXCR3, termed CXCR3-B was found by Lasagni (150). Compared to classic CXCR3 (renamed CXCR3-A), CXCR3-B contains an extended NH2-terminal. CXCR3-B mediates the inhibitory activity of CXCL9, CXCL10, CXCL11 and CXCL4 on the growth of human microvascular endothelial cells (HMVEC). By contrast, the CXCR3-A mediates the proliferation of human mesangial cells in response to CXCL9, CXCL10 and CXCL11 and is responsible for both increased survival and angiogenic properties of transfected HMVEC cell. CXCR3-A is the major chemokine receptor found on Thl effector T cells, cytotoxic CD8+ T cells, activated B cells, NK cells, monocytes, dentritic cells, endothelial cells, astrocytes, and neurons (151). Both CXCR3-A and —B mRNAs are expressed in the heart, kidney, liver, and skeletal muscle, but only CXCR3-A mRNAs are observed in the placenta (150). These studies were limited to human tissue and whether CXCR3-B exists in mouse tissue still needs further investigation. CXCR3 is a GPCR. Its extracellular domain consists of an N-terminus and three extracellular loops (ECL1-3) that act to bind the chemokine ligands. CXCR3 ligands interact 30 with their receptor differently in extracellular regions (146, 152, 153). For example, the N- terminus and ECL1 is essential for CXCL10- and CXCL11-mediated receptor activation, but not for CXCL9 signaling. ECL3 is important for CXCL9 and CXCL10-mediated activation. The difference on interaction sites among CXCR3 ligands may imply their distinct biological function roles. The intracellular domain has three loops and the C-terminus, which functions to transduce signal on ligand engagement. The C-terminal domain and 13-arrestin-1 were predominantly required by CXCL9 and CXCL10, and the third intracellular loop was predominantly required by CXCL11, suggesting the three ligands transducer different signals through CXCR3 (152). Interaction of CXCR3 ligands with their specific receptors results in chemotaxis of lymphocytes. Multiple cellular pathways including mobilization of intracellular calcium and several survival pathways such as the MAPK pathway, phosphatidylinositol-3 kinase/protein kinase B (PI3K/PKB) pathways, src-kinase-linked small GTPase pathway, have been involved in this activation process. 1.7.2. CXCR3 ligands Three major CXCR3 ligands: CXCL9, CXCL10, and CXCL11, share about 40% sequence homology and all can be induced by IFNs (154, 155). They direct and stimulate the adhesion of activated T cells and NK cells by binding to and activating CXCR3. However, these three chemokines exhibit differences in their potencies and efficacies toward CXCR3. Recent studies using neutralizing antibodies and KO mice have shown they exhibit unique temporal and spatial expression patterns, suggesting that they have non-redundant functions in vivo. CXCL10 expression is seen earlier than CXCL9 and CXCL11 following infection with a number of pathogens and in response to LPS injection (156-158). In addition, 31 differential expression of CXCL9, CXCL10, and CXCL11 has been demonstrated in human atherosclerotic lesions in situ (159) and in psoriasis (160). In cardiac transplantation, vascular cells express CXCL11 and CXCL10, whereas CXCL9 is localized in infiltrating macrophages (161, 162). Antibody neutralization demonstrated that CXCL10 is required for survival of mice following infection with Toxoplasma gondii and could not be substituted by other CXCR3 chemokine ligands (157). In a recent study of herpes simplex virus type 1 (HSV-1), CXCL10 but not CXCL9 KO mice showed an elevation in virus titre that was associated with an increase in the expression of CCL2 but no significant change in the infiltration of CD4+ T cells or NK cells into the corneal stroma. In contrast, a significant reduction in CD4+ T cell infiltration into the cornea was found in CXCL9 deficient mice following HSV-1 infection consistent with the absence of CXCL9 expression and reduction in expression of other chemokines including CCL3, CCL5, CXCL1, and CXCL10. Collectively, the results suggest a non-redundant role for CXCL9 and CXCL10 in response to ocular HSV-1 infection in terms of controlling virus replication and recruitment of CD4 + T cells into the cornea (163). 1.7.2.1. CXCL9 CXCL9 was identified by differential screening of a cDNA library from lymphokine- activated macrophages (154). Mouse and human CXCL9 were induced specifically by IFN-y (154, 155). The human CXCL9 protein was found to be a chemoattractant for activated, tumor-infiltrating lymphocytes (164) and for CD4 + and CD8+ peripheral blood T cells (165). CXCL9 has also been associated with T cell infiltration in malignancy (166) inflammatory diseases of the skin (167, 168), joints (169), and central nervous system (CNS) (170, 171). In mouse models, CXCL9 is highly induced in an IFN-y-dependent fashion during cell- 32 mediated responses to pathogens (158) and has been shown to be active in anti-viral defense (172, 173) and in mediating the rejection of tumors (174, 175) and allografts (176, 177). Moreover, CXCL9 induced both calcium signals and chemotaxis in activated B cells. CXCL9 KO mice showed reductions of 50-75% in Abs produced against the intracellular bacterium Francisella tularensis live vaccine strain (178). In addition, the CXCL9 gene can be produced by all classes of antigen presenting cells (APCs). These results suggest that CXCL9 may be important not only to recruit T cells to peripheral inflammatory sites, but also in some cases to maximize interactions among activated T cells, B cells, and dendritic cells within lymphoid organs to provide optimal humoral responses to pathogens (178). 1.7.2.2. CXCL10 Compared with CXCL9 and CXCL11, CXCL10 has been studied in greater depth. CXCL10 was first cloned from a monocyte-like cell line by Luster (179). It is constitutively expressed at low levels in thymic, splenic, and lymph node stroma (180). A variety of cells, including endothelial cells, fibroblasts, keratinocytes, astrocytes, and neutrophils can express CXCL10 by stimulation of IFN-a, -13, -7, or LPS. In addition, T cells produce CXCL10 in response to antigen activation (181-183). CXCL10 is expressed in many Thl-type inflammatory diseases, psoriasis (160, 184), multiple sclerosis (170, 185), atherosclerosis (159), rheumatoid arthritis (186), transplant rejection (187, 188), and inflammatory bowel disease (189). The levels of CXCL10 correlate with T cell infiltration, indicating its role in the chemoattraction of T cells to disease sites. Elevated levels of CXCL10 also have been found in numerous infectious diseases including bacterial, fungus, parasite, and virus infection. The role of CXCL10 in infectious diseases will be reviewed later. 33 1.7.2.3. CXCL11 CXCL11 was cloned by several different groups and has been assigned various names, including 0-R1, H174, and SCYB11 (190-194). Like CXCL9 and CXCL10, CXCL11 is induced by IFN-y and attracts CXCR3-bearing cells such as T cells, B cells, NK cells, and Thl cells (180, 195, 196). Of the three CXCR3 agonists, CXCL11 is the most potent and efficacious, featuring the highest affinity for CXCR3 (195). CXCL11 mRNA has been reported to be upregulated in IFN-y-treated monocytes (195), bronchial epithelial cells (197), neutrophils (198), keratinocytes (190), and endothelial cells, hence implying a role in T cell recruitment to sites of inflammation (199). The involvement of CXCL11 has been indicated in multiple sclerosis (200), transplant coronary artery disease (162), bleomycin-induced pulmonary fibrosis (201), and tumor angiogenesis (202, 203). 1.7. 3. CXCL10 in infection Diverse phenotypes of CXCL10 have been described after infectious, inflammatory, autoimmune, transplant, and other challenges. Antibody neutralization, genetic deficiency or overexpression of CXCL10 in mice has been applied to explore the roles of CXCL10 in the pathogenesis of these diseases (Table 6). A number of studies using different experimental systems have characterized that CXCL10 can play multiple roles in infection: 1) direct antimicrobial activity; 2) protective role by enhancement of NK cell activity; and 3) immunopathological role by contributing to inflammatory responses. Direct antimicrobial activity against Escherichia coli and Listeria monocytogenes has been demonstrated by the three CXCR3 ligands in vitro (204). In a recent study of Dengue virus, peak virus RNA levels were associated with peak CXCL10 levels. Further, it has been found that CXCL10 competes with virus for binding to heparan sulfate on the cell surface, 34 Table 6. CXCL10 and Infection Virus Treatment Infiltrates Pathogen burden Mortality References MHV Abs neutralization ICD4+, CD8 + delayed viral clearance T (205) MHV CXCL10 KO mice ICD4+, CD8 + , macrophage T ND (206) HSV Abs neutralization J,mononuclear cell T ND (207) TMEV Abs neutralization NE NE NE (208) MCMV Abs neutralization of CXCL10 and ICD8+ Transient T NE (209) West Nile virus Abs neutralization of CXCL10 and I CXCR3 + CD8 T T (210) Dengue virus CXCL10 and CXCR3 KO mice ICD4+ CD8 + T T (211) LCMV CXCL10 KO mice I CD3 +, CD8 + NE 1 (212) Toxoplasma gondii Abs neutralization ICD4+ CD8 + T T (157) Klebsiella pneumoniae Abs neutralization INK, NK-T, CD4+, ya T cells T I (213) Pneumocystis CXCR3 KO mice ICD4+ CD8 + Transient I NE (214) MCMV CXCR3 KO mice I CD8+ Transient I NE (209) Influenza A virus CXCR3 KO mice NE NE NE (215) Borna disease virus CXCR3 KO mice NE NE NE (216) LCMV CXCR3 KO mice . CD8+ T cell NE I (217) MHV: mouse hepatitis virus; HSV: herpes simplex virus; TMEV: Theiler's murine encephalomyelitis virus; MCMV: murine cytomegalovirus; LCMV: lymphocytic choriomeningitis virus; W: worse than controls; NE: no effect; ND: not done. 35 thereby blocking its entry and replication (218). In this way, CXCL10 may limit the spread of infection and contribute to early host defense during virus infection. Following virus infection, CXCL10 expression precedes immune cell infiltration. This suggests that CXCL10 expression could be driven by innate immune responses to infection, independent of the adaptive immune responses. For example, CNS infection with three distinct Theiler's murine encephalomyelitis virus (TMEV) infections: DA virus, GCVII virus, and H101 virus led to different degrees of the number and distribution of mononuclear cell infiltrates. However, Theil et al. (206) detected the same pattern of CXCL10 mRNA in the CNS during all three infections, suggesting resident cells rather than infiltrating cells produce CXCL10. An important role for CXCL10 in the innate immune response is the inhibition of viral replication at early stages following infection, through the modulation of NK cell trafficking and the delivery of NK cell-derived IFN-y (219, 220). NK cells participate in innate immune responses that can inhibit intracellular pathogens. Recent findings have also illustrated an important role for CXCL10 in innate defense following infection with various pathogens. It has been shown that CXCL10 induction following Toxoplasma gondii or vaccinia virus can be independent on IFN-y (158). NK cells can express CXCR3 and have been found to migrate in response to CXCR3 ligands by in vitro chemotaxis assay (221). Moreover, CXCL10 have been shown to promote cytotoxic granule release by resting human NK cells to enhance NK cell cytolytic activity (222). In animal models, CXCL10 has been shown to induce NK cell migration following viral infection (220, 223, 224). Local production of CXCL10 can enhance the cytolytic activity of NK cells, contributing recombinant vaccinia viruses clearance in vivo (172). Consistently, presence of CXCL10 36 with intracerebral mouse hepatitis virus (MHV) infection induced the recruitment and activation of NK cells that result in reduced viral replication and enhanced survival in mice absence of mature T and B cells (219). In addition, defective production CXCL10 in regional lymph nodes, with subsequent, inadequate stimulation of NK cell cytotoxicity and cytokine production, may contribute to the susceptibility of mice to Leishmania infection. During the early phase of Leishmania infection, CXCL10 is expressed in the draining lymph nodes from resistant mice but not susceptible mice. Local administration of CXCL10 augmented NK cell cytotoxicity in the draining lymph nodes of susceptible mice infected with Leishmania (225). However, in the mouse model of Trypanosoma cruzi-induced myocarditis, CXCL10 alone is not sufficient to control parasitemia because simultaneous antibody depletion of CXCL10 and CXCL9, but not CXCL10 alone, resulted in an increased parasite burden without alteration of the inflammation responses within the heart (226). In a number of viral disease models, CXCL10 and its receptor CXCR3 have been shown to function in host resistance to virus infection by regulating the trafficking of activated inflammatory T cells as well as optimizing IFN production at site of virus replication (206, 211). Such immunopathological role has been demonstrated in MHV infection. Anti-CXCL10 Ab treatment during the acute phase compromised viral clearance and mortality due to reduced CD4 + and CD8+ T cell infiltrates in the CNS (227). These results were further supported by a recent study using CXCL10 deficient mice infected with MHV (206), suggesting early expression of CXCL10 may play a beneficial role in host defense by attracting Thl lymphocytes into the CNS that contribute to viral clearance. On the contrary, other studies have stated that CXCL10 has no effect on T cell migration and viral clearance (208, 215, 216, 228). In the study of TMEV infection, no significant differences in 37 clinical signs, pathology, and virus clearance were seen between control mice and mice treated with anti-CXCL10 antibody (208). Beyond a role of CXCL10 in leukocyte trafficking, accumulating evidence also implicates CXCL10 may participate in the generation of effector cells. Presence of CXCL10 expression in secondary lymphoid tissue suggests a role in generating effector T cells during Ag-specific activation (229-231). Indeed, blockage of CXCL10 or CXCR3 resulted in impaired T cell effector responses, such as proliferation and secretion of IFN-y by Ag- specific T cells, indicating that CXCL10 is capable of directing effector T cell generation (157, 206, 232). The effects of CXCR3 are inconsistent in the different virus infection models. Infection of Boma disease virus or influenza A virus in CXCR3 KO mice, showed that CXCR3 had no effect on these diseases and CD8+ cell migration (215, 216). Unlike Boma disease virus or influenza A virus, lymphocytic choriomeningitis virus (LCMV) is non- cytolytic and a fatal outcome of intracerebral infection is directly related to efficient delivery of cytolytic CD8+ T cell to the areas of virus infection within the CNS. Thus, LCMV infection in CXCR3 KO mice survived intracerebral LCMV infection, whereas wild-type mice invariably died from CD8+ T cell-mediated immunopathology (217). Interestingly, CXCR3 KO mice were still able to generate activated CD8 + T cells and recruit leukocyte to the CNS, but the migration of CD8 + effector T cells from meninges into the outer layers of the brain parenchyma was impaired (217). The conflicting results among varied models of infection suggest complex and multiple roles of CXCR3 and CXCL10 in the pathogenesis of infectious diseases. Thus, 38 further study is required to determine how antangonizing CXCR3 receptor or blockage of CXCL10 be applied to treat human diseases. 1.7.4. Overexpression of CXCL10 in mice Three CXCL10 Tg mouse models have been established, including overexpression of CXCL10 in keratinocytes, in astrocytes, and in 13 cells (228, 233, 234). These mice developed normally but spontaneously recruited leukocytes into the organs that expressed the transgene except the expression of CXCL10 by keratinocytes in the skin. It is well known that CXCL10 induces chemotaxis of activated CD4 + Thl and CD8+ T cells, NK cells, and monocyte/macrophages, but not neutrophils. Consistent with this, recent studies using pancreatic cell-specific expression of CXCL10 or using adenovirus-mediated expression of CXCL10 in the CNS resulted in spontaneous mononuclear cell infiltration of CD4 + and CD8+ T cells (228). CXCL10 expression in astrocytes contained the infiltrates in the CNS that were predominantly neutrophils, with much smaller numbers of CD4+ and CD8+ T cells present. Additional tissue-specific factors may be involved in determining the composition of infiltrates to the specific organ. Interestingly, the expression of CXCL10 by keratinocytes in the skin did not promote spontaneous recruitment of leukocytes (234). Differences between the skin and other organs for the recruitment of leukocytes have been reported for the Tg production of CCL21 or monocytes chemoattractant protein-1 (MCP-1). Studies of CXCL10 Tg mouse models reported the leukocyte infiltration did not cause upregulation of pro-inflammatory cytokine mRNA (228, 233). Despite the presence of leukocyte infiltration, it was not sufficient to trigger pathology by CXCL10 expression alone, indicating additional signals other than CXCL10 are required for induction of an immune- mediated disease. In contrast, target expression of chemokine MCP-1 in heart muscle 39 resulted in mainly macrophage infiltration without pro-inflammatory cytokine production, but prolonged MCP-1 expression led to cardiomyopathy and cardiac failure (235). Compared to chemokines, cardiac production of TNF-a resulted in leukocyte infiltration and an active inflammatory process leading to heart tissue destruction and congestive heart failure (236). CXCL10-mediated chemotaxis is enhanced in the Tg mice with pathological challenges. When pancreatic r3 cell-specific CXCL10 Tg mice were crossed with the mice expressing the nucleoprotein of LCMV in p cell and infected with LCMV, type 1 diabetes was greatly accelerated by enhancing the migration of Ag-specific CD8 + T cells to the target sites (228). Besides leukocyte chemotaxis, CXCL10 also displays other actions, such as antiangiogenic activity. No developmental defects in skin vasculature were found in Tg mice with keratinocyte-targeted expression of CXCL10. However, upon exogenous injuries, CXCL10 expression in keratinocytes resulted in delayed wound healing, characterized by a more intense inflammatory phase and a prolonged and disorganized granulation phase with impaired blood vessel formation (234). Therefore, normal chemokine expression is necessary for host defense, and inappropriate or exaggerated activation of these genes may pose a threat to health and response to pathogens. 40 CHAPTER II RATIONALE, HYPOTHESIS, SPECIFIC AIMS AND EXPERIMENTAL DESIGN 2.1 Rationale CVB3-induced myocarditis is characterized by cardiomyocyte damage and massive immune cell infiltration to the myocardium. The essential role of the immune response in combating viral myocarditis has been demonstrated by recent studies using a series of KO mice (63, 70). The protective function of the host immune response, in particular NK cells and T cells, in response to CVB3 infection has been well documented (72, 73, 85, 86). Conversely, others have argued that robust protective responses can also be deleterious to host tissue to some extent. However, general immunosuppressive therapy did not benefit patients with myocarditis (49), raising the need for a better understanding of the components of host defense mediated by leukocyte subsets and for more specific inhibition of defined disease-causing subsets. During the process of leukocyte trafficking, it is well known that chemokines are the principal chemotactic factors mediating leukocyte migration to the site of infection (237). CXCL10 has been widely studied and is known to be involved in the regulation of lymphocyte recruitment observed in autoimmune inflammatory lesions (238), delayed-type hypersensitivity (206), some viral infections (209, 218, 219) and certain tumors. In a number of viral disease models, CXCL10 and its receptor CXCR3 have been shown to function in host resistance to virus infection by regulating the trafficking of activated inflammatory T cells (206, 211), whereas other studies have reported that CXCL10 has no effect on T cell migration and viral clearance (208, 215, 216, 228). The important role of CXCL10 in the innate immune response has also been found to inhibit viral replication at early stages of 41 infection, through modulating NK cell trafficking and the delivery of NK cell-derived IFN-y (219, 220). In addition, expression of CXCL10 has been found contribute to the direct anti- microbial effect (172, 204). These diverse reports on the role of CXCL10 may be due to the differences in the virus-host systems employed. Whether CXCL10 plays a beneficial or detrimental role to the host in CVB3-induced myocarditis has not been studied. We previously found that CXCL10 was significantly upregulated in CVB3-infected mouse heart by differential mRNA display and cDNA microarray (56, 239, 240) (Figure 5). In this dissertation, I investigate the expression profile of Thl /Th2 cytokines and CXCR3 ligands and their receptor in mouse hearts following CVB3 infection. Further, I employed both myocardium-specific CXCL10 Tg and CXCL10 KO mouse models to address whether CXCL10 is required for host immune defense during CVB3 infection. 2.2 Hypothesis CXCL10 is required for the host immune response against CVB3 infection, and alteration of CXCL10 expression during CVB3 infection affects the host's ability to control CVB3 replication and clearance through the modulation of immune cell migration to the site of infection. 2.3 Specific aims 1. To characterize the expression of Thl /Th2 cytokines, CXCR3 ligands and their receptors in mouse hearts following CVB3 infection 2. To generate a cardiac-specific CXCL10 overexpressing Tg mouse model and breed CXCL10 KO mice 3. To determine the effects of CXCL10 on the pathogenesis of CVB3-induced myocarditis using CXCL10 Tg and KO mice 42 2.4 Experimental Design I used qRT-PCR and enzyme-linked immunosorbent assay (ELISA) to determine the expression levels of cytokines and chemokines in CVB3-infected myocardium or serum. To examine if cardiomyocytes are able to produce CXCL10, adult murine cardiomyocytes were isolated and treated with IFN-y or infected with CVB3, and then CXCL10 RNA was measured using RT-PCR. To establish the CXCL10 Tg mouse, transgenes containing mouse CXCL10 were constructed and microinjected into the pronuclei of mouse embryos. The integration and expression of CXCL10 gene were confirmed by PCR, RT-PCR, in situ hybridization, Western blot and immunohistochemical staining. To determine the effects of the CXCL10 in CVB3-induced myocarditis, I infected CXCL10 Tg, CXCL10 KO and control wild-type mice with viruses and then performed histopathological analysis, immunohistochemistry, qRT-PCR, flowcytometry, plaque assay, ELISA and echocardiography to assess the degree and composition of immune infiltration, expression levels of pro-inflammatory cytokines, virus titres in the myocardium, the severity of the cardiomyocyte injury and associated cardiac function. The experimental design is summarized in Figure 6. 44 CHAPTER III INVESTIGATION OF THE ROLE OF CXCL10 IN CVB3-INDUCED MYOCARDITIS 3.1 Material and Methods 3.1.1 Virus preparation The virus (Gauntt strain) was propagated in HeLa cells (American Type Culture Collection), and titres were routinely determined by plaque assay at the beginning of the experiments (46). CVB3 stock was stored at -80°C until use. 3.1.2. Cell line HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 1.1g/m1 penicillin/streptomycin (Invitrogen). The HL-1 cell line, an atrial cardiomyocyte cell line established from an AT-1 mouse, was a kind gift from Dr. William C. Claycomb (Louisiana State University Health Science Center) (241). The cells were maintained in Claycomb medium (JRH Biosciences) supplemented with 10% fetal bovine serum (JRH Bioscience), 100 µg/ml penicillin/streptomycin (Life Technologies), 0.1 mM norepinephrine (Sigma) and 2 mM L- glutamine (Life Technologies). 3.1.3 Primary murine cardiomyocyte isolation and culture Murine ventricular myocytes were isolated from 5 to 6 week old male Ad mice (242). Animals were injected with heparin (1000 U/kg i.p.) 20 mM prior to the experimental protocol and anesthetized using ketamine/xylazine (0.1 mL/100 g, intraperitoneally). Hearts were immediately placed in ice cold buffer solution (120 mM NaC1, 5.4 mM KC1, 1.2 mM NaH2PO4, 5.6 mM glucose, 20 mM NaHCO3, 1.6 mM MgC12 pH 7.4), then hung on a Langendorf perfusion apparatus with the same buffer (37 °C) running at 2 mL/min. Hearts 46 were then perfused with buffer containing 0.125 mg/mL type B collagenase (Worthington) and 2.5 gg/mL type XIV protease (Sigma) for 2 min. At this stage CaC1 2 was added to a concentration of 50 gM and the enzyme digestion continued for 14 min. The heart was then removed from the perfusion rig and the atria removed. The digested heart was aspirated through a plastic transfer pipet until all tissue was disrupted, and the cells were then pelleted through centrifugation for 1 min at 500 rpm. Subsequently cells were re-suspended in buffer containing 125 gM CaC12 and allowed to settle for 10 min at room temperature. This process was repeated for calcium concentrations of 250 µM and 500 p,M. Cells were then re- suspended in AS media (Cellutron) at a density of 20,000 cells/mL and placed in a 37 °C incubator on matrigel (BD Biosciences)-coated coverslips. Over 99% of living cells were rod-shaped cardiomyocytes (242). 3.1.4 Construction of the transgenes The mouse CXCL10 gene was excised from pcDNA3-CXCL10 with EcoRI and cloned into plasmid pBSII-SK at the same site. The 5.5 kb fragment in the plasmid containing the murine a-myosin heavy chain (a-MHC) promoter, the coding sequence of murine CXCL10 and human growth hormone poly(A) tail was excised with NotI before microinjection (Figure 7). This a-MHC promoter located upstream of CXCL10 enables the heart-specific targeting of the transgene. The sequence was confirmed by DNA sequencing at the Nucleic Acid Protein Service Unit, University of British Columbia. 47 3.1.5 Generation of transgenic mice C57BL/6 and CBA F1 hybrid mice were used for generation of Tg mice. The transgene construct was microinjected into the pronuclei of one-cell mouse embryos, which were reimplanted into pseudopregnant mice (Figure 8). After offspring were born, the tails were biopsied and serum was collected at 3 weeks and 6 weeks of age, respectively. The founders were identified by PCR with a 5' primer (5'AAGTGGTGGTGTAGGAAAG3') specific to the a-MHC promoter and 3' primer (5'AAGCTTCTAGTTAGTCAGTC3') specific to CXCL10 after isolating genomic DNA from tail snips. Furthermore, sandwich ELISA was employed for determining CXCL10 expression levels in PCR-positive mice. The Tg founders with highest CXCL10 expression levels were mated back to C57BL/6 mice for > six generations to introduce nearly pure genetic C57BL/6, and then were outcrossed with A/J mice for > six generations to A/J background (Figure 9). To confirm the CXCL10 upregulation in mouse heart, RT-PCR, ELISA and Western blot analyses were performed. For CXCL10 KO mice (BALB/C), further breeding was performed using breeder pairs kindly provided by Dr. Andrew Luster (Massachusetts General Hospital, Harvard Medical School) (206). Wild type (Wt) BALB/c mice were purchased from Jackson Laboratories. Mice overexpression or deficiency of CXCL10 are transgenic modified mice, here I refer mice overexpression CXCL10 as CXCL10 Tg mice and mice deficiency of CXCL10 as CXCL10 KO mice. This study was conducted using age- and sex-matched groups of Wt, CXCL10 Tg mice, and CXCL10 KO mice. Experimental groups consisted of a minimum of five mice. Mice which died prematurely during the experiments were excluded from all analyses. 49 3.1.6 Virus infection Four to five week old male mice (CXCL 10 Tg and Wt littermates, CXCL 10 KO and Wt) were injected intraperitoneally with 200 pi, of CVB3 (Gauntt strain, 10 5 plaque-forming units), and mice were sacrificed at days 3, 7, and 10 pi (59). The ventricular portions of the hearts were collected and transversely sectioned into the apex, mid and basal portions for analysis. Apex portions were weighed, homogenized in DMEM, and diluted to a final concentration of 1 mg of tissue per ml. Mid-portions were fixed in 10% formalin and used for histopathological examination. Basal portions were stored at -80° C for RNA extraction. All animal procedures were in accordance with the protocols approved by the Animal Care Committee, University of British Columbia. 3.1.7 Viral plaque assay For evaluation using mouse model, apex portions of the ventricules were weighed and then homogenized in DMEM (Invitrogen); after three cycles of freeze-thawing to release intracellular viruses, the supernatant was collected by centrifugation at 4,000xg for 5 min and used for plaque-forming assay. HeLa cells were seeded onto 6-well plates and incubated at 37 °C for 20 h. When cell confluence reached approximately 90%, cells were washed with PBS to remove FBS and then overlaid with 1 ml of 1:10 diluted supernatant. The cells were incubated at 37 °C for 60 min and the supernatants were removed and followed by a PBS wash. Finally, cells were overlaid with 2 ml of sterilized soft Bacto-agar/MEM (2 x DMEM: 1.5% Bacto-agar = 1:1). The cells were incubated at 37 °C for 72 h, fixed with Carnoy's fixative for 30 min and then stained with 1% crystal violet. The plaques were counted and the viral plaque forming unit (pfu)/mg was calculated (239). 52 3.1.8 Preparation of genomic DNA from mouse tails for PCR After offspring were born, 0.5 cm of mouse tails were removed and were digested by DNA digestion buffer (50 mM Tris-HC1 pH 8.0, 100 mM EDTA pH 8.0, 100 mM NaC1, 1% SDS, 0.5 mg/ml proteinase K) at 55°C overnight. Then 6M NaC1 was added with vigorous shaking and subsequent microfugation (14,000xg) for 5 min. The resulting supernatants were removed and ethanol was added to precipitate genomic DNA (243). DNA was quantified and 0.1 pg of DNA was used for PCR. PCR reactions were run using two 5' primers (5'AAGTGGTGGTGTAGGAAAG3', and 5'TCAGGATCTCTAGATTGGT3') specific to the a-MHC promoter and one 3' primer (5' AAGCTTCTAGTTAGTCAGTC3') specific to the CXCL10. 3.1.9 cDNA synthesis and quantitative real time QPCR Total mouse RNA was isolated from the basal portion of the heart using RNeasy kit (Qiagen), and 0.5 fig of RNA was converted to cDNA using Superscript reverse transcriptase (Invitrogen) according to manufacturer's protocol. Real time QPCR was performed in 384 well plates on an ABI Prism 7900HT Sequence Detection System (Applied Biosystems) using the pre-made primers and probes (Applied Biosystems). The reactions were performed according to the manufacturer's instructions with minor modifications. Each sample was assayed in triplicate wells, whereby three no-template controls were included. Standard curves were generated from cDNAs made from decreasing amounts of total RNA (containing 15, 5, 1.67, 0.56, 0.19, 0.06 ng). The threshold cycle (CT) was determined with the use of SDS 2.1 software (Applied Biosystems). The CT values were subsequently used to calculate and plot a linear regression line by plotting the logarithm of template amount against the corresponding threshold cycle. 53 3.1.10 Enzyme-linked immunosorbent assay (ELISA) Mouse blood samples were collected and left in room temperature for 1 hour to clot. Samples were centrifuged at 2000 rpm for 10 minutes and then the sera were removed. Serum samples were frozen at -80°C and thawed prior to use. Quantitative sandwich enzyme immunoassay was used for determination of mouse CXCL10 levels. A polyclonal anti-mouse CXCL10 antibody (ID Lab) was coated onto a microplate. Standards, controls, and samples were pipetted into the wells. After washing, a biotinylated polyclonal anti-mouse CXCL10 antibody (ID Lab) was added to the wells. Serial dilutions of mouse CXCL10 were employed as a standard. An avidin-horse radish peroxidase (AV-HRP) and a peroxidase substrate were added to the wells and the intensity of the color was measured at 405nm. Mouse serum samples were also collected for determination of mouse cardiac troponin-I (cTnI) using a High Sensitivity Mouse Cardiac Troponin-I ELISA kit (Life Diagnostics) (244). The assay was conducted according to the manufacturer's instructions. The absorbance was read at 450 nm with a plate reader. 3.1.11 In situ hybridization Paraffin-embedded tissue sections were permeabilized with proteinase K, dehydrated, and hybridized with a digoxigenin-labeled CVB3 probe prepared by in vitro transcription as previously described (245). Hybridization occurred at 42 °C overnight followed by stringent washings in 50% formamide and 2x SSC. After an anti-digoxigenin antibody was applied to tissue sections, probe was detected using the ABComplex kit with an alkaline phosphatase- conjugated antidigoxigenin antibody (Roche Diagnostics) and Vector Red colour substrate (Vector Laboratories). The stained sections were counterstained with hematoxylin and 54 images were captured using a Nikon inverted microscope and Spot digital camera. Previously validated CVB3-infected mouse heart sections were used as positive controls (44). 3.1.12 Western blot Western blots were performed by standard protocols. Briefly, equal amounts of protein were loaded per lane for 12% SDS-polyacrylamide gel electrophoresis (PAGE), and then transferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk containing 0.1% Tween-20 and probed with either a monoclonal mouse Ab against CXCL10 (BD Transduction Laboratories), or a (3-actin monoclonal Ab (Sigma), followed by incubation with HRP-conjugated secondary antibody. Signal was detected with ECL system reagents (Amersham). 3.1.13 Histological analysis Formalin fixed mid-ventricular portions of heart, spleen, liver, and pancreas were sectioned into 4-1.1m sections, stained with hematoxylin and eosin (H&E) and coded. H&E sections were graded by a cardiovascular pathologist on the following scale: 0 meaning no or questionable presence of foci of cardiomyocyte injury and immune infiltration; 1 for limited focal distribution; 2-3 for intermediate severity; and 4-5 for coalescent and extensive foci over the entirety of the transversely sectioned ventricular tissue. Images were all captured using a Nikon inverted microscope and Spot digital camera. 3.1.14 Immunohistochemistry Paraffin-embedded heart sections were probed for the presence and localization of CD3 and CD45. Briefly, slides were heated in 0.01M citrate buffer (pH 6.0) using a steamer for 30 min and then incubated overnight at room temperature using CD3 antibody (DAKO) and CD45 antibody (BD Bioscience). Finally, the signals were detected using the substrates 55 diaminobenzidine (for CD45 detection) (Sigma) and Vector Red (for CD3 detection) (Vector Labs). Images were all captured using a Nikon inverted microscope and Spot digital camera. 3.1.15 Immunohistochemistry quantification ImagePro Plus ® program was used to quantify the extent of immune-infiltration as identified by immunohistochemistry. Ten images from each mouse were taken using a 20x objective. The amount of immune cells as indicated by the areas of staining was measured using a color segmentation technique. 3.1.16 Flow cytometry Hearts were aseptically removed, minced and subjected to enzymatic digestion with collagenase type II and trypsin (Sigma) (246). Single cell suspensions were sequentially filtered through a 70 inn nylon cell strainer (Becton Dickinson Falcon). Mononuclear cells were removed by centrifugation through Ficoll-Histopaque (Sigma). Individual cell suspensions from 10 mice were pooled by group. Cells were incubated with 1 pg of antibodies or corresponding IgG isotype for 30 min at 4°C in the dark. Antibodies used for flow cytometry were PE-CXCR3 from R & D, and allophycocyanin (APC)-CD45, APC- CD49b (NK cell), phycoerythrin (PE)-CD3, PE-CD4, and PE-CD8 from eBioscience. Cells were run on flowcytometer (Epics XL; Beckman Coulter, Inc.) and data were analyzed using Summit software (version 3.1; DakoCytomation). 3.1.17 Echocardiography Mice were anesthetized with 2% isoflurane and echocardiograms were recorded using a Vevo 770® (VisualSonics) system. Echocardiographic measurements were taken from 2D M-mode left ventricular (LV) short axis view at the papillary muscle level. Mice were laid prone on a temperature-controlled stage and temperature monitored throughout the procedure. 56 Views were standardized serially and between mice by strict adherence to the anatomical guidelines and conventions established by the American Society of Echocardiography. Measurements were taken at both diastole and systole and included: LV internal diameter in systole and diastole. Cardiac output (CO) and LV ejection fraction (EF) were calculated by the Vevo 770® internal software. 3.1.18 Statistical analysis The results are expressed as means ± SE. The comparisons of two groups of subjects were performed by a nonparametric test (Wilcoxon test). All calculations were carried out with the JMP® 5.1 (SAS Institute Inc.) software package. A value of p < 0.05 was considered statistically significant. 57 3.2. Results 3.2.1 EXPRESSION PROFILE OF CYTOKINES, CXCR3 LIGANDS AND RECEPTOR IN CVB3-INDUCED MYOCARDITIS During the course of CVB3 infection, various cytokines are produced by resident cells in the heart or infiltrating immune cells to regulate the immunological responses or to induce apoptosis in the myocardium. Early studies showed Thl cytokines were more strongly expressed than Th2 cytokines in myocarditis-susceptible mice (247, 248). CXCL10 is expressed in many Thl -type inflammatory diseases and the levels of CXCL10 correlate with the tissue infiltration of immune cells (142). To understand the contribution of CXCL10 in the pathogenic mechanisms of myocarditis, I first examined the expressional patterns of cytokines, CXCR3 ligands and receptor CXCR3 in a murine model of viral myocarditis. 3.2.1.1 Virus detection and histopathology examination Wt A/J mice were infected with CVB3. To confirm the CVB3 infection in the mouse hearts, viral plaque assay and histological examination were performed. The virus titres in the hearts peaked at day 3 pi and remained high at day 7 pi, but decreased significantly at day 10 pi (Figure 10a). As early as day 3 pi, small foci of infected myocytes and cytopathic effects were observed without obvious inflammatory cell infiltration. The decline of virus titre was accompanied by increasing densities of inflammatory cells in the heart. Around day 7 to 10 pi, multifocal lesions consisting of mononuclear cell infiltrates and necrotic myocytes were distributed in the right and left ventricles, indicating the host immune response was triggered and activated immune cells were recruited to clear the viruses and infected cells (Figure 10b). 58 3.2.1.2 Upregulation of Thl cytokines after CVB3 infection CXCL10 is upregulated in many Thl -type inflammatory diseases and the levels of CXCL10 correlate with the tissue infiltration of immune cells. Thl and Th2 cytokines often show varied expression in response to infection by different viruses. To investigate the local cytokine expression in the hearts after CVB3 infection, real time qRT-PCR was performed to measure expression of Thl cytokines (IFN-y and IL-12) and Th2 cytokines (IL-4, IL-5 and IL-10). Consistent with previous studies (247, 248), we observed the upregulation of predominantly Thl cytokines, especially IFN-y (Figure 11a). IFN-y was induced at day 3 pi and significantly elevated at day 7 pi. 3.2.1.3 Induction of CXCR3 ligands after CVB3 infection CXCR3 ligands are closely linked with Thl type inflammatory responses in vivo and they all can be induced by IFN-y. To determine the effect of CVB3 infection on the expression of CXCR3 ligands CXCL10, CXCL9 and CXCL11, mouse heart RNAs were extracted during the acute inflammatory phase of myocarditis (day 3 and 7 pi) and chemokines mRNA levels were measured by real time qRT-PCR. As shown in Figure 11b, all three chemokines were dramatically increased at day 3 and declined at day 7 pi, with CXCL10 showing the highest level among all three CXCR3 ligands. The peak expression of their receptor CXCR3 was delayed to day 7 pi. Next, we assessed the production of CXCL10 mRNA and protein in the serum over the time course of myocarditis. CVB3 infection resulted in a peak level of CXCL10 protein at day 3 pi, and continued the production up to day 14 pi (Figure 11 c, d). Given the severe inflammation of myocarditis and peak expression of CXCR3 at day 7 pi, the early increase of CXCL10 prior to the inflammatory cell infiltration suggests for the first time that resident cells in the heart are the main sources of 60 CXCL10 production at the early phase of infection, which serves to amplify inflammation by attracting immune cells expressing CXCR3. 3.2.1.4 IFN-y but not CVB3 induces CXCL10 expression from cultured mouse cardiomyocytes It is well known that multiple cell types, such as T cells, endothelial cells, and fibroblasts, can secrete CXCL10 upon certain stimuli. However, it is unknown whether cardiomyocytes can produce CXCL10. To clarify this issue, mouse atrial cardiomyocytes HL-1 cells were stimulated by IFN-y. At 6 h post-induction, CXCL10 mRNA was dramatically increased as compared with mock-treated cells (Figure 12a). Upregulation of CXCL10 protein was also detected in the supernatants by Western blot at 24 h post-induction (Figure 12b). Interestingly, CXCL10 expression was not able to be induced by direct CVB3 infection, suggesting cardiomyocytes produce CXCL10 upon IFN-y stimulation to attract more immune cells to the site of infection. To confirm this result, primary mouse ventricular cardiomyocytes (Fig 12c) were isolated from adult Ad mice and were stimulated by IFN-y or CVB3 infection. As early as 4h post-induction, CXCL10 mRNA was dramatically increased by IFN-y but not by CVB3 infection (Fig 12d). 62 3.2.2 TRANSGENIC MICE WITH CARDIAC-SPECIFIC OVEREXPRESSION OF CXCL 10 3.2.2.1 Cardiac-specific overexpression of the CXCL10 gene in mice To investigate the effect of CXCL10 on the development of CVB3-induced myocarditis, a Tg mouse model specifically overexpressing CXCL10 in the heart was generated by microinjection of a transgene containing an a-MHC promoter, which directs expression of the transgene specifically in the heart (Figure 7). The transgene was microinjected into the pronuclei of mouse embryos, which were re-implanted into pseudopregnant mice (Figure 8). The offspring were genotyped by PCR using genomic DNA isolated from tail clips. The Tg allele generated both 438 by and 776 by fragments, while the wild-type allele could not (Figure 13a, b). To confirm the CXCL10 upregulation was specific to the heart, RT-PCR, in situ hybridization, Western blot and ELISA analyses were performed using the mouse heart tissue and sera. As shown in Figures 14a and 14b, CXCL10 mRNA was predominantly expressed in the heart of CXCL10 Tg mice, as demonstrated by RT-PCR and in situ hybridization, but not in wild type (Wt) littermates. The low level of CXCL10 mRNA expression in the lungs may be due to the presence of endogenous MHC gene in the wall of pulmonary veins. Further, CXCL10 protein was upregulated in mouse heart and secreted into the serum, as detected by Western blot, ELISA, and immunohistochemical staining, respectively (Figure 15a, b, c). The Tg mice bred normally and did not display obvious physical or behavioral abnormalities. 64 3.2.2.2 CXCL10 overexpression causes spontaneous leukocyte infiltration and alteration of the transcription of IFN-y and IL-10, but can not induce myocyte injury or heart dysfunction Histological sections were stained to look for pathological alterations in the hearts of Tg mice. Cardiac-specific expression of CXCL10 resulted in spontaneous minor mononuclear cell infiltrates in perivascular and interstitial regions of the myocardium as compared to control littermates (Figure 16). The number of infiltrations was age-dependent, with the greatest number in older Tg mice, but barely any in 4 week-old mice. We used real time qRT-PCR to determine the levels of CD45, CD3, CD4, CD8, and natural cytotoxicity receptor (NCR), which served as an index of CD45 + , CD3 +, CD4+, CD8+ , and NK cell infiltrations. As shown in Figure 17a, the levels of CD4, CD8 and NCR were substantially higher in Tg mice. The increase in CD8 was more pronounced than that of CD4 and NCR. Morphological observations revealed that peripheral organs including liver, pancreas, spleen, and kidney appeared normal in Tg mice. Despite the presence of mononuclear cell infiltrations, there were no discernible pathological alterations in the hearts of Tg mice without viral infection. We also determined whether the presence of CXCL10 altered the expression of cytokines and CXCR3 ligands. Compared with wild-type littermates, the expression levels of the other CXCR3 ligands (CXCL9, CXCL11) and their receptor CXCR3, IFN-y, and counterinflammatory IL-10 cytokine in Tg hearts were significantly higher than that in Wt mouse hearts but the expression levels of the pro-inflammatory cytokines (TNF-a, IL-4, IL-5, IL-6, IL-12) were unchanged (Figure 17b). However, the increased mRNA levels of IFN-y in Tg mouse hearts were much lower than that in CVB3-infected hearts during the acute phase of infection. The 68 serum levels of IFN-y could not be detected by ELISA (data not shown). Further, the presence of mononuclear cells and upregulation of IFN-y and IL-10 in the myocardium did not result in myocyte injury or heart function impairment, as revealed by (i) cTnI levels, a serum marker of myocyte injury (data not shown); (ii) echocardiography, a measure of heart ejection fraction (EF) (Figure 17c); and (iii) heart mass/body weight (Figure 17d). These findings indicate that CXCL10 primarily directs T cells and NK cells to the myocardium, and is associated with minor defense immunity but is insufficient to cause cardiomyocyte dysfunction. 3.2.3. CVB3 INFECTION IN CXCL10—DEFICIENT AND CXCL10 OVER- EXPRESSING MICE 3.2.3.1 Variability in susceptibility to myocarditis between A/J and BALB/c mice The CXCL10 Tg mice and KO mice used in this study are in A/J and BALB/c background respectively. Both Wt A/J and Wt BALB/c mouse strain are susceptible to CVB3-induced myocarditis, but Wt A/J mice demonstrate higher susceptibility to CVB3- induced myocarditis than Wt BALB/c mice (59). The viral load, myocardium injury, and pathological score of the Wt A/J and Wt BALB/c mice following infection were analyzed by plaque assay, ELISA for serum cTnI levels, and pathological evaluations, respectively. As shown in Figure 18a and b, the viral titres and the serum levels of cTn I in the Wt A/J mice were higher than that in the Wt BALB/c mice. However, there were no significant differences in the severity of myocarditis (Figure 18c, d). 71 3.2.3.2 Constitutive cardiac CXCL10 expression or absence of CXCL10 does not affect the severity of myocarditis It is known that both direct virus injury and subsequent inflammatory responses contribute to the injury of cardiac myocytes and the extent of such injury determines the severity of late stage organ dysfunction. To determine whether overexpression or ablation of CXCL10 affects the severity of myocarditis, pathological scoring of H&E-stained heart tissues of Wt, Tg and KO mice was conducted by an experienced cardiovascular pathologist. Taking both myocyte damage and immune cell infiltration into consideration, there was a similar pathological score of myocarditis for all four groups at day 7 pi (Figure 19a, b). Further, CXCL10 Tg, KO, and Wt mice did not show the differences in survival rate (Figure 20a, b). 73 3.2.3.3 CXCL10 overexpression inhibits CVB3 replication, protects myocytes from injury and attenuates heart function deterioration from CVB3 infection in the early phase To further understand the role of CXCL10 in viral replication, immune infiltration, and viral clearance, we next analyzed the cell injury and immune cell influx separately. To assess the contribution of CXCL10 to anti-viral defense, viral titres in the hearts were examined. At day 3 pi, viral titre in mouse hearts inversely correlates with the levels of CXCL10 (Fig 21a, b): viral titre was higher in CXCL10 KO and lower in CXCL10 Tg mice as compared with the Wt control. However, at day 7 and 10 pi, viral clearance was not significantly different in infected CXCL10 Tg or KO mice compared to controls (Fig 21a, b). The plaque assay results were further confirmed by real time qRT-PCR (Fig 21c, d). We next checked if virus load correlates with cardiomyocyte damage. cTnI is only expressed in cardiac muscle and its serum level is a sensitive indicator of myocardial injury (249). We used cTnI as a marker to detect myocyte damage during the active proliferative phase of CVB3 infection and found that the serum cTnI levels increased in a time-dependent manner in the CVB3-induced murine myocarditis. The cTnI levels were elevated at day 3 pi, peaked at day 7 pi and normalized at day 10 pi in all groups (Figure 22a, b). The elevated serum cTnI levels from day 3 to 7 pi correlated with the massive myocardial damage caused by virus infection and the immune response. At day 3 and 7 pi, the levels of cTnI observed in CXCL10 KO mice were significantly higher than those in Wt mice, whereas the levels in CXCL10 Tg mice were lower than those in Wt mice, indicating that CXCL10 expression attenuates cell damage from virus infection. Since cTnls start to rise 3-4 hours after onset of myocardial necrosis and remains for 4-10 days because of a gradual degeneration of 76 myofibrils with release of the troponin complex (250, 251), it is expected that the accumulated cTnI levels at day 7 pi reflect the myocardial damage at early time points. To examine whether the alterations of myocyte injury and inflammation caused by CXCL10 overexpression subsequently affect cardiac function following CVB3 infection, we conducted echocardiography during the acute phase of infection. At day 5 pi, the infected CXCL10 Tg mice exhibited a significant increase in EF and CO whereas the infected CXCL10 KO mice exhibited a significant decrease in EF and CO, as compared to Wt mice (Figure 22c, d). 78 3.2.3.4 CXCL10 overexpression recruits NK cell infiltration and increases IFN-7 expression during the early phase of CVB3 infection At day 3 pi, the host innate immune response is triggered. NK cells and IFN production are the principal mechanisms of innate immunity against viruses. Murine NK cell activity increases early after CVB3 infection (73). To determine the effects of CXCL10 on the profiles of immune cell infiltration, the mRNA levels of CD4, CD8, NCR, and cytokines were measured by qRT-PCR. As shown in Figure 23, the levels of NK cells, CXCR3, and IFN-y in CXCL10 Tg and KO mice were proportional to CXCL10 levels. Although the levels of CD4 and CD8 in Tg mice also rose, this increase was largely due to the constitutive CXCL10 overexpression as these elevations of CD4 and CD8 were present before viral infection (Figure 17a). Both NK cells and IFN-y have been shown to limit replication of CVB3 in the mouse heart. In addition, one of the mechanisms by which NK cells control viral infection is the secretion of anti-viral cytokines such as IFN-y. Therefore, these results indicate that the early inhibition of viral replication by CXCL10 may be through increased NK infiltration and concerted IFN-y expression. 80 3.2.3.5 CXCL10 overexpression enhances the immune responses during the inflammatory stage of CVB3 infection As the infiltration of immune cells into the site of infection is one of the most important pathological characteristics of viral myocarditis, we examined whether overexpression or deficiency of CXCL10 could alter the migration of immune cells and associated immune response in the acute inflammatory phase of CVB3 infection. As shown in Figure 24, at day 7 pi, CXCL10 Tg mice accumulated more CD45 + and CD3 + cells in the myocardium and CXCL10 KO mice accumulated fewer than Wt control mice. Additional phenotypic analysis of the infiltrating leukocytes in the heart of CXCL10 Tg or KO mice revealed that these cells are predominantly CD4 + and CD8+ T cells, and the number of these cells correlated with the levels of CXCL10 in the hearts (Figure 25a, b). These results were further solidified by real time qRT-PCR (Figure 26a, c). We next examined by qRT-PCR whether the altered leukocyte recruitment was associated with altered expression of a number of cytokines or chemokines. As shown in Figure 26b, the marked increase in leukocyte infiltration was accompanied by upregulation of gene expression of IFN-y, IL-10, and IL-12a. In contrast to Wt mice, lower expression levels of these cytokines and additional lower CXCL11, TNF-a, and IL-6 were seen in the CXCL10 KO mice (Figure 26d). Despite altered influx of leukocytes into the heart at day 7 pi, the clearance of viruses did not significantly change in CXCL10 Tg or KO mice. These data indicate that CXCL10 expression is correlated with the recruitment of leukocytes into the myocardium of mice with viral myocarditis, but CXCL10-induced chemotaxis of leukocytes is not sufficient for host immune responses to clear the viruses. 82 CHAPTER IV DISCUSSION, CONCLUSIONS AND FUTURE DIRECTIONS 4.1 Discussion CXCL10/IP10, a potent chemoattractant for activated T cells and NK cells, has been implicated in the pathogenesis of various viral infections. In the present study, we investigated the function of this chemokine in CVB3-induced myocarditis using newly generated Tg mice with cardiac-specific CXCL10 overexpression and CXCL10 KO mice. We found the induction of CXCL10 occurred early after CVB3 infection in vivo: levels peaked at day 3 pi, and returned to basal levels by days 10-14 pi. In vitro investigation also demonstrated that IFN-y but not CVB3 can induce cardiomyocyte expression of CXCL10. Cardiomyocyte-specific expression of CXCL10 triggers infiltration of mononuclear cells to the myocardium. However, the presence of mononuclear cell aggregates and transcriptional upregulation of certain cytokines were not sufficient to cause myocyte injury, as present in an active inflammatory process. During the early phase of viral infection prior to the massive immune cell infiltration, CXCL10 overexpression led to a decrease in viral titre with reduced myocyte damage and improved cardiac function, whereas CXCL10 deficiency resulted in an increase in viral titre, accompanied by enhanced myocyte injury and reduced cardiac function. The anti-viral activity of CXCL10 may be as a result of the increased NK infiltration and concerted IFNI expression during the early phase of CVB3 infection. In the acute inflammatory phase, the levels of CXCL10 also correlate with the CD4 + and CD8+ T cell infiltrations in the myocardium, which participate in but are not sufficient for the host immune response toward virus infection as ultimately viral clearance and survival were not improved. 86 Variations in the susceptibility to CVB3-induced myocarditis among different strains of mice have been reported previously (59, 60, 63, 65). The A/J and BALB/c mouse strains we used in this study are both susceptible to CVB3-induced myocarditis and they are used to study pathogenic mechanisms of this disease (70, 91, 101). The extent of virus replication and damage in the myocardium was higher in A/J mice than that observed in BALB/c mice. However, A/J and BALB/c mice showed similar levels of inflammation and necrosis in the myocardium (day 7 pi), as well as comparable survival at day 10 pi. These results suggest that virus titre in the heart may not account for disease severity among mouse strains as reported previously (20). Although both A/J and BALB/c mice have similar levels of myocarditis at day 7 pi, the difference in severity of myocarditis has been demonstrated at late timepoints pi (57). ALT mice reach peak levels of inflammation at day 14 pi, while BALB/c mice develop acute myocarditis with maximal inflammatory lesions between day 7 and 10 pi and inflammation gradually decreases after day 7 pi. In addition, BALB/c mice showed more severe hepatitis following infection than A/J mice (data not shown). The varied pathological features between A/J and BALB/c mice following CVB3 infection reflect the importance of host genetics in the immunopathogenesis of myocarditis. Indeed, studies have shown that the immunopathogenic mechanisms are different between A/J and BALB/c mice in response to CVB3 infection. In A/J mice, both CD4 + and CD8+ cells are pathogenic with both humoral and cellular immunopathogenic mechanisms involved (57). Infection of BALB/c mice results in induction of CD8 + effects without humoral pathogenicity (134, 252). Thus, we used Wt mice with same genetic background of Tg or KO mice as controls. The murine model of CVB3-induced myocarditis has been shown to closely mimic the pathology of human myocarditis (24). Myocardial lesions are focal, consisting of necrotic 87 myocytes with infiltrating mononuclear cells (71, 72). Local secretion of cytokines and chemokines by myocardial cells and inflammatory cells over the course of CVB3 infection is important in determining the histopathological and immunological responses in animal models of CVB3-induced myocarditis. Consistent with previous studies, we showed that primary Thl cytokine IFN-y was upregulated in the myocardium at day 3 pi and reached the maximal levels at day 7 pi, accompanied by abundant immune infiltration. Here we did not examine cytokine levels at day 1 pi, when Seko et al. showed the upregulation of IFN-y in the heart (247). IFN-y has been shown to be a potent agonist in stimulating a variety of cells to express CXCL10 (181-183, 253). Intravenous injection of mice with IFN-y results in tissue-specifc expression of CXCL10 (158, 254). These results suggest the IFN-y may be an agonist for CXCL10 at early phase of viral myocarditis. However, in the CVB3-infected mouse hearts, we showed that CXCL10 peaked at day 3 pi and decreased at day 7 pi, while IFNI rose at day 3 pi and peaked at day 7 pi, suggesting that CXCL10 is not completely dependent on IFN-y. This is consistent with a previous study of mouse hepatitis virus, which demonstrated the early induction of CXCL10 following infection preceded IFN-y expression (255). A study by Amichary et al. also showed that CXCL10 induction following vaccinia virus was not completely dependent on IFN-y expression (158). In addition, Asensio et al. demonstrated CXCL10 was expressed in the brains of IFN-y KO mice during lymphocytic choriomeningitis (256). These results suggest CXCL10 can be induced by other cytokines or directly by the virus. For example, IFN-a and IFN-I3, which are commonly upregulated following virus infection, have been shown to induce expression of CXCL10 (257, 258). By day 7 pi, increased levels of IFN-y may potentiate expression of other chemokines (259, 260). 88 The early peak of CXCL10 at day 3 pi implies the resident cells in the myocardium are the primary sources of CXCL10. CVB3 infection induces host cells to express certain chemokines and cytokines. For example, cardiomyocytes infected with CVB3 in vivo produce TNF-a and IL-1 a before the occurrence of inflammatory cell infiltration (247, 261). Shen et al. showed that MCP-1 was induced in cardiomyocytes after CVB3 infection in a time- and dose-dependent manner (262). Here we show for the first time that CXCL10 can be induced by IFN-y but not by CVB3 infection in both the mouse cardiomyocyte HL-1 cell line and primary adult mouse cardiomyocytes. These results suggest early expression of IFN-y induces cardiomyocytes and/or other resident cells in the myocardium, such as resident immune cells, endothelial cells and fibroblasts, to produce CXCL10 to modulate immune cell infiltration. The infiltrated immune cells generate IFN-y and the other cytokines to inhibit virus replication in the myocardium. As known, CXCL10 induces chemotaxis of activated CD4 + Thl and CD8 + T cells, NK cells and monocyte/macrophages, but not neutrophils. Consistent with this, our data and others from recent studies using pancreatic p cell-specific expression of CXCL10 or using adenovirus-mediated expression of CXCL10 in the CNS demonstrated spontaneous infiltration of NK cells, CD4+ and CD8 + T cells (228, 233). This is further supported by the fact that T cell infiltration in CVB3-infected CXCL10 KO mice was decreased. However, with overexpression of CXCL10 in astrocytes, the immune infiltrates in the CNS were dominated by neutrophils but not by CD4 + and CD8+ T cells. This discrepancy between studies implies that additional tissue-specific factors may affect the composition of infiltrates to a specific tissue. Interestingly, there is one exception that the expression of CXCL10 by keratinocytes in the skin did not promote spontaneous recruitment of leukocytes (234). The 89 differences between the skin and other organs for the recruitment of leukocytes has also been reported for the Tg production of CCL21 or MCP-1 (263, 264). Previous studies of CXCL10 Tg mouse models reported that leukocyte infiltration does not cause pro-inflammatory cytokine mRNA upregulation (228, 233). In our Tg mice, CXCL10 expression in cardiomyocytes induced the upregulation of a number of cytokines (IFN-y, IL-10) and chemokines (CXCL9, CXCL11) along with T cell and NK cell infiltrations. However, their protein levels in the serum were not detectable by ELISA, suggesting upregulation is limited compared with the active immune process which occurs in response to viral infection. Cytokines, such as TNF-a, are known to decrease myocardial contractile efficiency, reduce ejection fraction, and induced biventricular dilation (121, 265- 267). It is unclear whether CXCL10 has negative inotropic actions on cardiomyocyte contractility, but no cardiac damage, functional changes or cardiomyopathy was observed in our CXCL10 Tg mice. Despite the presence of mononuclear cell infiltrations and increased IFN-y and IL-10 mRNA expression, the CXCL10 cardiac-specific transgene was not sufficient to cause myocarditis, indicating additional mediators are required for induction of an immune-mediated disease. In contrast, another report indicates that expression of the chemokine MCP-1 in the heart results primarily in macrophage infiltration without pro- inflammatory cytokine production, but prolonged MCP-1 expression leads to cardiomyopathy and cardiac failure (235). Further experiments to compare the effects of MCP-1 and CXCL10 in cardiomyocyte contractility will help understand their roles in cardiac function during virus infection. It is interesting that CVB3 infection directly induces MCP-1 expression in cardiomyocytes (262). It seems that CXCL10 and MCP-1 have different roles in viral-induced myocarditis and subsequent cardiomyopathy. Unlike 90 chemokines, cardiac-specific overexpression of TNF-a results in leukocyte infiltration and an active inflammatory process leading to heart tissue destruction and congestive heart failure (236). CXCL10 participates in both innate and adaptive host defense mechanisms by contributing to cell migration and activation. The important role of CXCL10 in the innate immune response has also been shown in studies of vaccinia virus and MHV. It controls viral replication by recruiting and activating NK cells (172, 219). In this study, the early peak of CXCL10 expression prior to inflammatory cell infiltration implies its important role in innate immunity during CVB3-induced myocarditis. The results here showed at day 3 pi, CXCL10 overexpression prevented viral replication, while CXCL10 KO impaired the ability to efficiently control virus replication. In addition, CXCL10 levels were associated with NK cell infiltration and IFN-y expression in the myocardium. Following CVB3 infection, NK cells infiltrate the heart first and are the major early-stage sources of IFN-y. One mechanism by which NK cells defend against viral infection is through the secretion of anti-viral cytokines such as IFN-y (268). Indeed, NK cells and IFN-y have previously been shown to play important roles in limiting CVB3 replication in the heart (73, 85, 91). Mice depleted of NK cells resulted in increased viral replication in the heart (85). Pancreatic overexpression of IFN-y protected mice from lethal myocarditis (115). IFN-y-deficient mice had higher virus titres in the heart (91). Therefore, the early CXCL10 expression following CVB3 infection may inhibit viral replication in the heart through recruitment of NK cells and associated cytokines such as IFN-y. Further modulation of NK cells in CXCL10 Tg or KO mice will clarify the link. It is known that other innate lymphocyte effectors, such as NK T cells and ye T cells, are also involved in the innate immue response at early course of CVB3 infection 91 (269-271). Comparison of their expression levels in CXCL10 Tg or KO mice and employment of individual KO mice will identify the innate immune effectors that attracted by CXCL10 following CVB3 infection. In addition to the effect on NK cell trafficking, CXCL10 may exert a direct anti-viral effect. As recently reported, CXCL10 efficiently prevented Dengue virus from binding to the cell surface, thereby blocking its entry and replication (218). In this way, CXCL10 may limit the spread of infection and contribute to host defense early during virus infection. However, whether CXCL10 has a direct anti-viral role in CVB3 infection needs further investigation. Recent reports have demonstrated a critical role in adaptive immunity for CXCL10 in directing effector T cell migration towards the site of infection, which then facilitates viral clearance (206, 210, 211). During the inflammatory stage of CVB3 infection (day 7 pi), it was expected that overexpression or deficiency of CXCL10 should augment or impair the ability of target cells to attract T cells expressing CXCR3 to the heart and in turn affect the clearance of virus. However, neither overexpression nor deficiency of CXCL10 altered the viral clearance or mouse survival rate despite altered T cell recruitment and expression levels of associated cytokines. Further, no difference in the severity of myocarditis was observed between CXCL10 Tg or KO mice compared to controls by the histological evaluation. These results imply that CXCL10 may not be a crucial inflammatory-stage mediator compared to other chemokines, such as MIP-1 a. For example, MIP-la KO mice are resistant to CVB3- induced myocarditis (88). Anti-MIP-2 antibody treatment decreased cellular infiltration and myocardial necrosis, and increased survival rate compared to the control group (89). Notably, both MIP-la and MIP-2 peaked around day 7-10 pi when the maximal inflammatory changes occurred, unlike CXCL10 which peaked at day 3 pi. The distinctive expression patterns of 92 these chemokines imply their different roles in the course of CVB3 infection. Despite the unique kinetic pattern of each chemokine, they work in concert to regulate the innate or adaptive immune response to protect host from virus invasion. Based on our findings in this study, a proposed model is summarized in Figure 27. Following CVB3 infection, early rise of IFNs from infected cells and immune cells stimulates CXCL10 expression in cardiomyocytes and/or other resident myocardial cells. At day 3 pi, CXCL10 expression inhibits CVB3 replication and in turn protects cardiomyocytes from damage and improves heart function at early stage of infection. This protective effect of CXCL10 is a result of enhanced NK cell infiltration and associated IFN-y expression, suggesting a critical role for CXCL10 during the early course of CVB3 infection. At day 7 pi, CXCL10 expression attracts the migration of T cells to the site of infection. However, the enhancement of T cell infiltration by CXCL10 is not sufficient for viral clearance or to rescue the mice from death during acute inflammation stages. The other chemokines, such as MIP-1 a, are likely required for host clearance of viruses (88). In addition, the early protective thymus-independent antibody response to CVB3 is responsible for virus clearance (124). In other words, host immune responses against external invasion need the orchestrated action of multiple anti-viral mediators to effectively protect host itself. Thus, early intervention of CVB3 by CXCL10 combined with the other chemokines and/or cytokines during inflammation may provide a new therapeutic strategy towards viral-induced myocarditis. 93 4.2 Conclusions In CVB3-induced myocarditis, several chemokines, including MIP-1 a, MIP-2 and MCP-1, have been studied using Ab neutralization or Tg murine models (88, 89, 262). The upregulation of CXCL10 was detected following CVB3 infection by our group as well as others, yet the exact functional role of CXCL10 was not investigated (240, 272). By using newly generated Tg mice with cardiac-specific CXCL10 expression and CXCL10 KO mice, I made the first attempt to explore the contribution of CXCL10 in the innate and adaptive responses during the acute phase of CVB3 infection in mice. A summary of the highlights from this study are listed below: 1. In CVB3-infected murine hearts, Thl cytokines, especially IFN-y, were induced at day 3 pi, suggesting that IFN-y may serve as an agonist for CXCL10 during the early phase of CVB3-induced myocarditis. 2. In CVB3-infected murine hearts, the expression levels of CXCR3 ligands (CXCL9, CXCL10, and CXCL11) peaked at day 3 and declined at day 7 pi with CXCL10 showing the highest level among all three CXCR3 ligands. Their receptor CXCR3 reached the maximal level at day 7 pi when significant mononuclear cell infiltration was present. The kinetic patterns of CXCL10 and CXCR3 suggest that resident cells of the heart are the primary source of CXCL10, which serves to amplify inflammation and protection by attracting immune cells expressing CXCR3. 3. CXCL10 expression was induced by IFN-y but not by CVB3 in cultured mouse cardiomyocytes. 95 4. A Tg mouse model with cardiac-specific overexpression of CXCL10 was generated and expression of CXCL10 in the heart was confirmed. The Tg mice bred normally and did not show obvious physical or behavioral abnormalities. 5. CXCL10 Tg mice had spontaneous NK cell, CD4 4 , and CD8 + T cell infiltration and increased transcription expression levels of IFN-y and IL-10. However, the mild elevation of those cytokines did not cause cardiomyocyte destruction nor deterioration of cardiac function. 6. During the early phase of acute infection, levels of CXCL10 inversely correlated with the viral titre in the mouse hearts, and were associated with the NK cell infiltration and IFN-y expression. These data indicate CXCL10 is required to control of CVB3 replication early in infection, which may be through the regulation of NK cell infiltration and associated IFN-y expression. 7. During the inflammatory phase of acute infection, levels of CXCL10 were associated with CD4+ and CD84- T cell infiltrations to the myocardium with upregulation of cytokines, but CXCL1 0-induced chemotaxis of T cells failed to facilitate the host's ability to clear the virus, and to improve the pathology and ultimate survival. Collectively, CXCL10 expression inhibits CVB3 replication during the early course of CVB3 infection, which may be attributed to the recruitment of NK cells and associated INF-y expression. However, CXCL10-directed chemo attractant effect during the inflammatory stage is not sufficient for host to clear the virus in the heart. 96 4.3 Future directions To gain a better understanding of how the chemokines modulate the immune response after CVB3 infection, I propose these additional experiments in the following directions: 1. During the early course of CVB3 infection, CXCL10 expression inhibits CVB3 replication through the recruitment of NK cells. Further depletion of NK cells in CXCL10 Tg mice or exogenous administration of CXCL10 in CXCL10 KO mice during CVB3 infection will clarify the link between CXCL10 and downstream target NK cells. 2. In this work, I focused on the acute phase of CVB3 infection. Examination of the immune infiltration, fibrosis, viral persistence, and cardiac function in late time-points after CVB3 infection using both CXCL10 Tg and KO mice will facilitate a better understanding of the role of CXCL10 in the chronic phase of the disease. 3. Different strains of mice exhibit a wide range of susceptibility to CVB3. Characterization of the lymphocyte subsets in the heart in different strains of mice and the relation with local chemokine expression pattern will uncover the chemokine candidates that contribute to the pathogenesis of this disease. 4. CVB3 not only causes myocarditis, but also infection and inflammation of the pancreas, liver, and spleen. Analysis of the effect CXCL10 in other organs following infection will help us to gain insight into the role of CXCL10 in CVB3 infection. 5. Studies of other CXCR3 ligands and receptor CXCR3 in myocarditis by using genetically-modified mice will add to our understanding of their roles in leukocyte accumulation and activation during inflammatory processes which occur during CVB3 infection. 97 6. The newly generated cardiac specific CXCL10 Tg mice can be used to investigate other cardiovascular diseases, such as myocardial ischemia and reperfusion injury. It has been identified that several chemokines are pivotal elements in directing leukocyte subsets to the heart during CVB3 infection. Further challenges for investigators will lie in identifying the particular roles of each ligand/receptor pair by relating temporal and spatial expression to the multistep process of CVB3-induced cardiac pathology. Ultimately, this effort is directed toward identifying viable targets for therapeutic interventions. 98 REFERENCES 1. Dalldorf, G., and G. M. Sickles. 1948. An unidentified, filtrable agent isolated from the feces of children with paralysis. Science 108:61. 2. Melnick, J. 1996. Enteroviruses: Polioviruses, coxsackieviruses, echoviruses and newer enteroviruses. In Virology. B. Fields, ed. Raven Press, New York, p. 655. 3. Melinick, J. L., E. W. Shaw, and E. C. Curnen. 1949. A virus isolated from patients. diagnosed as non-paralytic poliomyelitis or aseptic meningitis. Proc Soc Exp Biol Med 71:344. 4. Bergelson, J. M., J. A. Cunningham, G. Droguett, E. A. Kurt-Jones, A. Krithivas, J. S. Hong, M. S. Horwitz, R. L. Crowell, and R. W. Finberg. 1997. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275:1320. 5. Shafren, D. R., R. C. Bates, M. V. Agrez, R. L. Herd, G. F. Burns, and R. D. Barry. 1995. Coxsackieviruses Bl, B3, and B5 use decay accelerating factor as a receptor for cell attachment. J Virol 69:3873. 6. Klump, W. M., I. Bergmann, B. C. Muller, D. Ameis, and R. Kandolf. 1990. Complete nucleotide sequence of infectious Coxsackievirus B3 cDNA: two initial 5' uridine residues are regained during plus-strand RNA synthesis. J Virol 64:1573. 7. Goldstaub, D., A. Gradi, Z. Bercovitch, Z. Grosmann, Y. Nophar, S. Luria, N. Sonenberg, and C. Kahana. 2000. Poliovirus 2A protease induces apoptotic cell death. Mol Cell Biol 20:1271. 8. Badorff, C., G. H. Lee, B. J. Lamphear, M. E. Martone, K. P. Campbell, R. E. Rhoads, and K. U. Knowlton. 1999. Enteroviral protease 2A cleaves dystrophin: evidence of cytoskeletal disruption in an acquired cardiomyopathy. Nat Med 5:320. 99 9. Carthy, C. M., B. Yanagawa, H. Luo, D. J. Granville, D. Yang, P. Cheung, C. Cheung, M. Esfandiarei, C. M. Rudin, C. B. Thompson, D. W. Hunt, and B. M. McManus. 2003. Bcl-2 and Bcl-xL overexpression inhibits cytochrome c release, activation of multiple caspases, and virus release following coxsackievirus B3 infection. Virology 313:147. 10. Tracy, S., K. Hofling, S. Pirruccello, P. H. Lane, S. M. Reyna, and C. J. Gauntt. 2000. Group B coxsackievirus myocarditis and pancreatitis: connection between viral virulence phenotypes in mice. J Med Virol 62:70. 11. Tu, Z., N. M. Chapman, G. Hufnagel, S. Tracy, J. R. Romero, W. H. Barry, L. Zhao, K. Currey, and B. Shapiro. 1995. The cardiovirulent phenotype of coxsackievirus B3 is determined at a single site in the genomic 5' nontranslated region. J Virol 69:4607. 12. Gauntt, C. J., and M. A. Pallansch. 1996. Coxsackievirus B3 clinical isolates and murine myocarditis. Virus Res 41:89. 13. Knowlton, K. U., E. S. Jeon, N. Berkley, R. Wessely, and S. Huber. 1996. A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3. J Virol 70: 7811. 14. Cameron-Wilson, C. L., Y. A. Pandolfino, H. Y. Zhang, B. Pozzeto, and L. C. Archard. 1998. Nucleotide sequence of an attenuated mutant of coxsackievirus B3 compared with the cardiovirulent wildtype: assessment of candidate mutations by analysis of a revertant to cardiovirulence. Clin Diagn Virol 9•99. 15.^Stadnick, E., M. Dan, A. Sadeghi, and J. K. Chantler. 2004. Attenuating mutations in coxsackievirus B3 map to a conformational epitope that comprises the puff region of VP2 and the knob of VP3. J Virol 78:13987. 100 16. Dunn, J. J., N. M. Chapman, S. Tracy, and J. R. Romero. 2000. Genomic determinants of cardiovirulence in coxsackievirus B3 clinical isolates: localization to the 5' nontranslated region. J Virol 74:4787. 17. M'Hadheb-Gharbi, M. B., S. Paulous, M. Aouni, K. M. Kean, and J. Gharbi. 2007. The substitution U475 --> C with Sabin3-like mutation within the IRES attenuate Coxsackievirus B3 cardiovirulence. Mol Biotechnol 36:52. 18. Ben M'hadheb-Gharbi, M., J. Gharbi, S. Paulous, M. Brocard, A. Komaromva, M. Aouni, and K. M. Kean. 2006. Effects of the Sabin-like mutations in domain V of the internal ribosome entry segment on translational efficiency of the Coxsackievirus B3. Mol Genet Genomics 276:402. 19. Gravanis, M. B., and N. H. Sternby. 1991. Incidence of myocarditis. A 10-year autopsy study from Malmo, Sweden. Arch Pathol Lab Med 115:390. 20. Chow, L. H., K. W. Beisel, and B. M. McManus. 1992. Enteroviral infection of mice with severe combined immunodeficiency. Evidence for direct viral pathogenesis of myocardial injury. Lab Invest 66:24. 21. McManus, B. M., L. H. Chow, S. J. Radio, S. M. Tracy, M. A. Beck, N. M. Chapman, K. Klingel, and R. Kandolf. 1991. Progress and challenges in the pathological diagnosis of myocarditis. Eur Heart J 12 Suppl D:18. 22. Huber, S. A., C. J. Gauntt, and P. Sakkinen. 1998. Enteroviruses and myocarditis: viral pathogenesis through replication, cytokine induction, and immunopathogenicity. Adv Virus Res 51:35. 23. Maze, S. S., and R. J. Adolph. 1990. Myocarditis: unresolved issues in diagnosis and treatment. Clin Cardiol 13:69. 101 24. Woodruff, J. F. 1980. Viral myocarditis. A review. Am J Pathol 101:425. 25. Feldman, A. M., and D. McNamara. 2000. Myocarditis. N Engl J Med 343:1388. 26. Reyes, M. P., and A. M. Lerner. 1985. Coxsackievirus myocarditis--with special reference to acute and chronic effects. Prog Cardiovasc Dis 27:373. 27. Martino, T. A., P. Liu, and M. J. Sole. 1994. Viral infection and the pathogenesis of dilated cardiomyopathy. Circ Res 74:182. 28. Cetta, F., and V. V. Michels. 1995. The autoimmune basis of dilated cardiomyopathy. Ann Med 27:169. 29. Kandolf, R. 1993. Molecular biology of viral heart disease. Herz 18:238. 30. Rose, N. R., A. Herskowitz, and D. A. Neumann. 1993. Autoimmunity in myocarditis: models and mechanisms. Clin Immunol Immunopathol 68:95. 31. Schwaiger, A., F. Umlaut K. Weyrer, C. Larcher, J. Lyons, V. Muhlberger, 0. Dietze, and K. Grunewald. 1993. Detection of enteroviral ribonucleic acid in myocardial biopsies from patients with idiopathic dilated cardiomyopathy by polymerase chain reaction. Am Heart J 126:406. 32. Cambridge, G., C. G. MacArthur, A. P. Waterson, J. F. Goodwin, and C. M. Oakley. 1979. Antibodies to Coxsackie B viruses in congestive cardiomyopathy. Br Heart J 41:692. 33. Aretz, H. T. 1987. Myocarditis: the Dallas criteria. Hum Pathol 18:619. 34.^Maisch, B., I. Portig, A. Ristic, G. Hufnagel, and S. Pankuweit. 2000. Definition of inflammatory cardiomyopathy (myocarditis): on the way to consensus. A status report. Herz 25:200. 102 35. Felker, G. M., R. E. Thompson, J. M. Hare, R. H. Hruban, D. E. Clemetson, D. L. Howard, K. L. Baughman, and E. K. Kasper. 2000. Underlying causes and long-term survival in patients with initially unexplained cardiomyopathy. N Engl J Med 342:1077. 36. Dec, G. W., Jr., I. F. Palacios, J. T. Fallon, H. T. Aretz, J. Mills, D. C. Lee, and R. A. Johnson. 1985. Active myocarditis in the spectrum of acute dilated cardiomyopathies. Clinical features, histologic correlates, and clinical outcome. N Engl J Med 312:885. 37. Hilton, D. A., S. Variend, and J. H. Pringle. 1993. Demonstration of Coxsackie virus RNA in formalin-fixed tissue sections from childhood myocarditis cases by in situ hybridization and the polymerase chain reaction. J Pathol 170:45. 38. Bowles, N. E., P. J. Richardson, E. G. Olsen, and L. C. Archard. 1986. Detection of Coxsackie-B-virus-specific RNA sequences in myocardial biopsy samples from patients with myocarditis and dilated cardiomyopathy. Lancet 1:1120. 39. Okada, I., A. Matsumori, C. Kawai, J. Yodoi, and S. Tracy. 1990. The viral genome in experimental murine Coxsackievirus B3 myocarditis: a Northern blotting analysis. J Mol Cell Cardiol 22:999. 40. Liu, Z., J. Yuan, B. Yanagawa, D. Qiu, B. M. McManus, and D. Yang. 2005. Coxsackievirus-induced myocarditis: new trends in treatment. Expert Rev Anti Infect Ther 3:641. 41. Aradottir, E., E. M. Alonso, and S. T. Shulman. 2001. Severe neonatal enteroviral hepatitis treated with pleconaril. Pediatr Infect Dis J 20:457. 42. Rotbart, H. A., and A. D. Webster. 2001. Treatment of potentially life-threatening enterovirus infections with pleconaril. Clin Infect Dis 32:228. 103 43. Pauksen, K., N. G. Ilback, G. Friman, and J. Fohlman. 1993. Therapy of coxsackie virus B3-induced myocarditis with WIN 54954 in different formulations. Scand J Infect Dis Suppl 88:125. 44. Yuan, J., D. A. Stein, T. Lim, D. Qiu, S. Coughlin, Z. Liu, Y. Wang, R. Blouch, H. M. Moulton, P. L. Iversen, and D. Yang. 2006. Inhibition of coxsackievirus B3 in cell cultures and in mice by peptide-conjugated morpholino oligomers targeting the internal ribosome entry site. J Virol 80:11510. 45. Yuan, J., P. K. Cheung, H. M. Zhang, D. Chau, and D. Yang. 2005. Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand. J Virol 79:2151. 46. Yuan, J., P. K. Cheung, H. Zhang, D. Chau, B. Yanagawa, C. Cheung, H. Luo, Y. Wang, A. Suarez, B. M. McManus, and D. Yang. 2004. A phosphorothioate antisense oligodeoxynucleotide specifically inhibits coxsackievirus B3 replication in cardiomyocytes and mouse hearts. Lab Invest 84:703. 47. Kim, J. Y., S. K. Chung, H. Y. Hwang, H. Kim, J. H. Kim, J. H. Nam, and S. I. Park. 2007. Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice. Virus Res 125:9. 48. Merl, S., C. Michaelis, B. Jaschke, M. Vorpahl, S. Seidl, and R. Wessely. 2005. Targeting 2A protease by RNA interference attenuates coxsackieviral cytopathogenicity and promotes survival in highly susceptible mice. Circulation 111:1583. 104 49. Mason, J. W., J. B. O'Connell, A. Herskowitz, N. R. Rose, B. M. McManus, M. E. Billingham, and T. E. Moon. 1995. A clinical trial of immunosuppressive therapy for myocarditis. The Myocarditis Treatment Trial Investigators. N Engl J Med 333:269. 50. Weller, A. H., M. Hall, and S. A. Huber. 1992. Polyclonal immunoglobulin therapy protects against cardiac damage in experimental coxsackievirus-induced myocarditis. Eur Heart J 13:115. 51. Takada, H., C. Kishimoto, and Y. Hiraoka. 1995. Therapy with immunoglobulin suppresses myocarditis in a murine coxsackievirus B3 model. Antiviral and anti- inflammatory effects. Circulation 92:1604. 52. Drucker, N. A., S. D. Colan, A. B. Lewis, A. S. Beiser, D. L. Wessel, M. Takahashi, A. L. Baker, A. R. Perez-Atayde, and J. W. Newburger. 1994. Gamma-globulin treatment of acute myocarditis in the pediatric population. Circulation 89:252. 53. Kishimoto, C., K. Shioji, M. Kinoshita, T. Iwase, S. Tamaki, M. Fujii, A. Murashige, H. Maruhashi, S. Takeda, H. Nonogi, and T. Hashimoto. 2003. Treatment of acute inflammatory cardiomyopathy with intravenous immunoglobulin ameliorates left ventricular function associated with suppression of inflammatory cytokines and decreased oxidative stress. Int J Cardiol 91:173. 54. McNamara, D. M., R. Holubkov, R. C. Starling, G. W. Dec, E. Loh, G. Torre- Amione, A. Gass, K. Janosko, T. Tokarczyk, P. Kessler, D. L. Mann, and A. M. Feldman. 2001. Controlled trial of intravenous immune globulin in recent-onset dilated cardiomyopathy. Circulation 103:2254. 55.^Lerner, A. M. 1965. An experimental approach to virus myocarditis. Prog Med Virol 7..97. 105 56. McManus, B. M., B. Yanagawa, N. Rezai, H. Luo, L. Taylor, M. Zhang, J. Yuan, J. Buckley, T. Triche, G. Schreiner, and D. Yang. 2002. Genetic determinants of coxsackievirus B3 pathogenesis. Ann N Y Acad Sci 975:169. 57. Lodge, P. A., M. Herzum, J. Olszewski, and S. A. Huber. 1987. Coxsackievirus B-3 myocarditis. Acute and chronic forms of the disease caused by different immunopathogenic mechanisms. Am J Pathol 128:455. 58. Roy, S., M. T. Scherer, T. J. Briner, J. A. Smith, and M. L. Gefter. 1989. Murine MHC polymorphism and T cell specificities. Science 244:572. 59. Chow, L. H., C. J. Gauntt, and B. M. McManus. 1991. Differential effects of myocarditic variants of Coxsackievirus B3 in inbred mice. A pathologic characterization of heart tissue damage. Lab Invest 64:55. 60. Buie, C., P. Lodge, M. Herzum, and S. Huber. 1987. Genetics of coxsackievirus B3 and encephalomyocarditis virus-induced. myocarditis in mice. Eur Heart J 8:399. 61. Aly, M., S. Wiltshire, G. Chahrour, J. C. Osti, and S. M. Vidal. 2007. Complex genetic control of host susceptibility to coxsackievirus B3-induced myocarditis. Genes Immun 8:193. 62. kishimoto, C., C. Kawai, and W. Abelmann. 1987. Immuno-genetic aspects of the pathogenesis of experimental viral myocarditis. In Pathogenesis of myocarditis and cardiomyopathy: recent experimental and clinical studies. C. Kawai, and W. Abelmann, eds. University of Tokyo Press, Tokyo, p. 3. 63. Huber, S. A. 1997. Coxsackievirus-induced myocarditis is dependent on distinct immunopathogenic responses in different strains of mice. Lab Invest 76:691. 106 64. Wolfgram, L. J., K. W. Beisel, A. Herskowitz, and N. R. Rose. 1986. Variations in the susceptibility to Coxsackievirus B3-induced myocarditis among different strains of mice. J Immunol 136:1846. 65. Klingel, K., and R. Kandolf. 1993. The role of enterovirus replication in the development of acute and chronic heart muscle disease in different immunocompetent mouse strains. Scand J Infect Dis Suppl 88•79. 66. Szalay, G., S. Meiners, A. Voigt, J. Lauber, C. Spieth, N. Speer, M. Sauter, U. Kuckelkorn, A. Zell, K. Klingel, K. Stangl, and R. Kandolf. 2006. Ongoing coxsackievirus myocarditis is associated with increased formation and activity of myocardial immunoproteasomes. Am J Pathol 168:1542. 67. Sacks, D., and N. Noben-Trauth. 2002. The immunology of susceptibility and resistance to Leishmania major in mice. Nat Rev Immunol 2:845. 68. Shioi, T., A. Matsumori, and S. Sasayama. 1996. Persistent expression of cytokine in the chronic stage of viral myocarditis in mice. Circulation 94:2930. 69. Leipner, C., K. Grun, I. Schneider, B. Gluck, H. H. Sigusch, and A. Stelzner. 2004. Coxsackievirus B3-induced myocarditis: differences in the immune response of C57BL/6 and Balb/c mice. Med Microbiol Immunol 193:141. 70. Opaysky, M. A., J. Penninger, K. Aitken, W. H. Wen, F. Dawood, T. Mak, and P. Liu. 1999. Susceptibility to myocarditis is dependent on the response of alphabeta T lymphocytes to coxsackieviral infection. Circ Res 85:551. 71. Henke, A., S. Huber, A. Stelzner, and J. L. Whitton. 1995. The role of CD8+ T lymphocytes in coxsackievirus B3-induced myocarditis. J Virol 69:6720. 107 72. McManus, B. M., L. H. Chow, J. E. Wilson, D. R. Anderson, J. M. Gulizia, C. J. Gauntt, K. E. Klingel, K. W. Beisel, and R. Kandolf. 1993. Direct myocardial injury by enterovirus: a central role in the evolution of murine myocarditis. Clin Immunol Immunopathol 68:159. 73. Godeny, E. K., and C. J. Gauntt. 1986. Involvement of natural killer cells in coxsackievirus B3-induced murine myocarditis. J Immunol 137:1695. 74. Sommergruber, W., H. Ahorn, H. Klump, J. Seipelt, A. Zoephel, F. Fessl, E. Krystek, D. Blaas, E. Kuechler, H. D. Liebig, and et al. 1994. 2A proteinases of coxsackie- and rhinovirus cleave peptides derived from eIF-4 gamma via a common recognition motif. Virology 198:741. 75. Baxter, N. J., A. Roetzer, H. D. Liebig, S. E. Sedelnikova, A. M. Hounslow, T. Skern, and J. P. Waltho. 2006. Structure and dynamics of coxsackievirus B4 2A proteinase, an enyzme involved in the etiology of heart disease. J Virol 80:1451. 76. Novoa, I., and L. Carrasco. 1999. Cleavage of eukaryotic translation initiation factor 4G by exogenously added hybrid proteins containing poliovirus 2Apro in HeLa cells: effects on gene expression. Mol Cell Biol 19:2445. 77. Chau, D. H., J. Yuan, H. Zhang, P. Cheung, T. Lim, Z. Liu, A. Sall, and D. Yang. 2007. Coxsackievirus B3 proteases 2A and 3C induce apoptotic cell death through mitochondrial injury and cleavage of eIF4GI but not DAP5/p97/NAT1. Apoptosis 12:513. 78.^Gradi, A., H. Imataka, Y. V. Svitkin, E. Rom, B. Raught, S. Morino, and N. Sonenberg. 1998. A novel functional human eukaryotic translation initiation factor 4G. Mol Cell Biol 18:334. 108 79. Xiong, D., T. Yajima, B. K. Lim, A. Stenbit, A. Dublin, N. D. Dalton, D. Summers- Torres, J. D. Molkentin, H. Duplain, R. Wessely, J. Chen, and K. U. Knowlton. 2007. Inducible cardiac-restricted expression of enteroviral protease 2A is sufficient to induce dilated cardiomyopathy. Circulation 115:94. 80. Badorff, C., G. H. Lee, and K. U. Knowlton. 2000. Enteroviral cardiomyopathy: bad news for the dystrophin-glycoprotein complex. Herz 25:227. 81. Lim, B. K., J. 0. Shin, S. C. Choe, S. W. Choi, J. 0. Jeong, I. W. Seong, D. K. Kim, and E. S. Jeon. 2005. Myocardial injury occurs earlier than myocardial inflammation in acute experimental viral myocarditis. Exp Mol Med 37:51. 82. Saraste, A., A. Arola, T. Vuorinen, V. Kyto, M. Kallajoki, K. Pulkki, L. M. Voipio- Pulkki, and T. Hyypia. 2003. Cardiomyocyte apoptosis in experimental coxsackievirus B3 myocarditis. Cardiovasc Pathol 12:255. 83. Kandolf, R., M. Sauter, C. Aepinus, J. J. Schnorr, H. C. Selinka, and K. Klingel. 1999. Mechanisms and consequences of enterovirus persistence in cardiac myocytes and cells of the immune system. Virus Res 62:149. 84. Wessely, R., K. Klingel, L. F. Santana, N. Dalton, M. Hongo, W. Jonathan Lederer, R. Kandolf, and K. U. Knowlton. 1998. Transgenic expression of replication-restricted enteroviral genomes in heart muscle induces defective excitation-contraction coupling and dilated cardiomyopathy. J Clin Invest 102:1444. 85.^Godeny, E. K., and C. J. Gauntt. 1987. Murine natural killer cells limit coxsackievirus B3 replication. J Immunol 139:913. 109 86. Zaragoza, C., C. Ocampo, M. Saura, M. Leppo, X. Q. Wei, R. Quick, S. Moncada, F. Y. Liew, and C. J. Lowenstein. 1998. The role of inducible nitric oxide synthase in the host response to Coxsackievirus myocarditis. Proc Natl Acad Sci USA  95:2469. 87. Zaragoza, C., C. J. Ocampo, M. Saura, C. Bao, M. Leppo, A. Lafond-Walker, D. R. Thiemann, R. Hruban, and C. J. Lowenstein. 1999. Inducible nitric oxide synthase protection against coxsackievirus pancreatitis. Jlmmunol 163:5497. 88. Cook, D. N., M. A. Beck, T. M. Coffman, S. L. Kirby, J. F. Sheridan, I. B. Pragnell, and 0. Smithies. 1995. Requirement of MIP-1 alpha for an inflammatory response to viral infection. Science 269:1583. 89. Kishimoto, C., H. Kawamata, S. Sakai, H. Shinohara, and H. Ochiai. 2000. Role of MIP-2 in coxsackievirus B3 myocarditis. J Mol Cell Cardiol 32:631. 90. Deonarain, R., D. Cerullo, K. Fuse, P. P. Liu, and E. N. Fish. 2004. Protective role for interferon-beta in coxsackievirus B3 infection. Circulation 110:3540. 91. Fairweather, D., S. Yusung, S. Frisancho, M. Barrett, S. Gatewood, R. Steele, and N. R. Rose. 2003. IL-12 receptor beta 1 and Toll-like receptor 4 increase IL-1 beta- and IL-18-associated myocarditis and coxsackievirus replication. Jlmmunol 170:4731. 92. Wessely, R., K. Klingel, K. U. Knowlton, and R. Kandolf 2001. Cardioselective infection with coxsackievirus B3 requires intact type I interferon signaling: implications for mortality and early viral replication. Circulation 103:756. 93. Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, J. Vilcek, R. M. Zinkernagel, and M. Aguet. 1993. Immune response in mice that lack the interferon-gamma receptor. Science 259 : 1742 . 110 94. Muller, U., U. Steinhoff, L. F. Reis, S. Hemmi, J. Pavlovic, R. M. Zinkernagel, and M. Aguet. 1994. Functional role of type I and type II interferons in antiviral defense. Science 264:1918. 95. Fuse, K., G. Chan, Y. Liu, P. Gudgeon, M. Husain, M. Chen, W. C. Yeh, S. Akira, and P. P. Liu. 2005. Myeloid differentiation factor-88 plays a crucial role in the pathogenesis of Coxsackievirus B3-induced myocarditis and influences type I interferon production. Circulation 112:2276. 96. Huber, S. A., and D. Sartini. 2005. Roles of tumor necrosis factor alpha (TNF-alpha) and the p55 TNF receptor in CD1d induction and coxsackievirus B3-induced myocarditis. J Virol 79:2659. 97. Leipner, C., M. Borchers, I. Merkle, and A. Stelzner. 1999. Coxsackievirus B3- induced myocarditis in MHC class II-deficient mice. J Hum Virol 2:102. 98. Klingel, K., J. J. Schnorr, M. Sauter, G. Szalay, and R. Kandolf. 2003. beta2- microglobulin-associated regulation of interferon-gamma and virus-specific immunoglobulin G confer resistance against the development of chronic coxsackievirus myocarditis. Am J Pathol 162:1709. 99. Gebhard, J. R., C. M. Perry, S. Harkins, T. Lane, I. Mena, V. C. Asensio, I. L. Campbell, and J. L. Whitton. 1998. Coxsackievirus B3-induced myocarditis: perforin exacerbates disease, but plays no detectable role in virus clearance. Am J Pathol 153:417. 100. Kishimoto, C., and W. H. Abelmann. 1990. In vivo significance of T cells in the development of Coxsackievirus B3 myocarditis in mice. Immature but antigen- specific T cells aggravate cardiac injury. Circ Res 67:589. 111 101. Liu, P., K. Aitken, Y. Y. Kong, M. A. Opaysky, T. Martino, F. Dawood, W. H. Wen, I. Kozieradzki, K. Bachmaier, D. Straus, T. W. Mak, and J. M. Penninger. 2000. The tyrosine kinase p561ck is essential in coxsackievirus B3-mediated heart disease. Nat Med 6:429. 102. Irie-Sasaki, J., T. Sasaki, W. Matsumoto, A. Opaysky, M. Cheng, G. Welstead, E. Griffiths, C. Krawczyk, C. D. Richardson, K. Aitken, N. Iscove, G. Koretzky, P. Johnson, P. Liu, D. M. Rothstein, and J. M. Penninger. 2001. CD45 is a JAK phosphatase and negatively regulates cytokine receptor signalling. Nature 409:349. 103. Mena, I., C. M. Perry, S. Harkins, F. Rodriguez, J. Gebhard, and J. L. Whitton. 1999. The role of B lymphocytes in coxsackievirus B3 infection. Am J Pathol 155:1205. 104. Gauntt, C. J., E. K. Godeny, C. W. Lutton, and G. Fernandes. 1989. Role of natural killer cells in experimental murine myocarditis. Springer Semin Immunopathol 11:51. 105. Mikami, S., S. Kawashima, K. Kanazawa, K. Hirata, Y. Katayama, H. Hotta, Y. Hayashi, H. Ito, and M. Yokoyama. 1996. Expression of nitric oxide synthase in a murine model of viral myocarditis induced by coxsackievirus B3. Biochem Biophys Res Commun 220:983. 106. Saura, M., C. Zaragoza, A. McMillan, R. A. Quick, C. Hohenadl, J. M. Lowenstein, and C. J. Lowenstein. 1999. An antiviral mechanism of nitric oxide: inhibition of a viral protease. Immunity 10:21. 107. Zell, R., R. Markgraf, M. Schmidtke, M. Gorlach, A. Stelzner, A. Henke, H. H. Sigusch, and B. Gluck. 2004. Nitric oxide donors inhibit the coxsackievirus B3 proteinases 2A and 3C in vitro, virus production in cells, and signs of myocarditis in virus-infected mice. Med Microbiol Immunol 193:91. 112 108. Badorff, C., B. Fichtlscherer, A. Muelsch, A. M. Zeiher, and S. Dimmeler. 2002. Selective delivery of nitric oxide to a cellular target: a pseudosubstrate-coupled dinitrosyl-iron complex inhibits the enteroviral protease 2A. Nitric Oxide 6:305. 109. Henke, A., M. Nain, A. Stelzner, and D. Gemsa. 1991. Induction of cytokine release from human monocytes by coxsackievirus infection. Eur Heart J 12 Suppl D:134. 110. Henke, A., C. Mohr, H. Sprenger, C. Graebner, A. Stelzner, M. Nain, and D. Gemsa. 1992. Coxsackievirus B3-induced production of tumor necrosis factor-alpha, IL-1 beta, and IL-6 in human monocytes. J Immunol 148:2270. 111. Heim, A., A. Canu, P. Kirschner, T. Simon, G. Mall, P. H. Hofschneider, and R. Kandolf. 1992. Synergistic interaction of interferon-beta and interferon-gamma in coxsackievirus B3-infected carrier cultures of human myocardial fibroblasts. J Infect Dis 166:958. 112. Kandolf, R., A. Canu, and P. H. Hofschneider. 1985. Coxsackie B3 virus can replicate in cultured human foetal heart cells and is inhibited by interferon. J Mol Cell Cardiol 17:167. 113. Matsumori, A., N. Tomioka, and C. Kawai. 1988. Protective effect of recombinant alpha interferon on coxsackievirus B3 myocarditis in mice. Am Heart J 115:1229. 114. Lutton, C. W., and C. J. Gauntt. 1985. Ameliorating effect of IFN-beta and anti-IFN- beta on coxsackievirus B3-induced myocarditis in mice. J Interferon Res 5:137. 115. Horwitz, M. S., A. La Cava, C. Fine, E. Rodriguez, A. Ilic, and N. Sarvetnick. 2000. Pancreatic expression of interferon-gamma protects mice from lethal coxsackievirus B3 infection and subsequent myocarditis. Nat Med 6:693. 113 116. Diefenbach, A., H. Schindler, N. Donhauser, E. Lorenz, T. Laskay, J. MacMicking, M. Rollinghoff, I. Gresser, and C. Bogdan. 1998. Type 1 interferon (IFNalpha/beta) and type 2 nitric oxide synthase regulate the innate immune response to a protozoan parasite. Immunity 8:77. 117. Triantafilou, K., G. Orthopoulos, E. Vakakis, M. A. Ahmed, D. T. Golenbock, P. M. Lepper, and M. Triantafilou. 2005. Human cardiac inflammatory responses triggered by Coxsackie B viruses are mainly Toll-like receptor (TLR) 8-dependent. Cell Microbiol 7•1117. 118. Lord, K. A., B. Hoffman-Liebermann, and D. A. Liebermann. 1990. Nucleotide sequence and expression of a cDNA encoding MyD88, a novel myeloid differentiation primary response gene induced by IL6. Oncogene 5:1095. 119. Adachi, 0., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, and S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity 9:143. 120. Seko, Y., H. Matsuda, K. Kato, Y. Hashimoto, H. Yagita, K. Okumura, and Y. Yazaki. 1993. Expression of intercellular adhesion molecule-1 in murine hearts with acute myocarditis caused by coxsackievirus B3. J Clin Invest 91:1327. 121. Meldrum, D. R. 1998. Tumor necrosis factor in the heart. Am J Physiol 274:R577. 122. Zoller, J., T. Partridge, and I. Olsen. 1994. Interactions between cardiomyocytes and lymphocytes in tissue culture: an in vitro model of inflammatory heart disease. J Mol Cell Cardiol 26:627. 114 123. Seko, Y., Y. Shinkai, A. Kawasaki, H. Yagita, K. Okumura, F. Takaku, and Y. Yazaki. 1991. Expression of perforin in infiltrating cells in murine hearts with acute myocarditis caused by coxsackievirus B3. Circulation 84:788. 124. Woodruff, J. F., and J. J. Woodruff. 1974. Involvement of T lymphocytes in the pathogenesis of coxsackie virus B3 heart disease. J Immunol 113:1726. 125. Opaysky, M. A., T. Martino, M. Rabinovitch, J. Penninger, C. Richardson, M. Petric, C. Trinidad, L. Butcher, J. Chan, and P. P. Liu. 2002. Enhanced ERK-1/2 activation in mice susceptible to coxsackievirus-induced myocarditis. J Clin Invest 109:1561. 126. Huber, S. A., A. Mortensen, and G. Moulton. 1996. Modulation of cytokine expression by CD4+ T cells during coxsackievirus B3 infections of BALB/c mice initiated by cells expressing the gamma delta + T-cell receptor. J Virol 70:3039. 127. Huber, S. A., J. E. Stone, D. H. Wagner, Jr., J. Kupperman, L. Pfeiffer, C. David, R. L. O'Brien, G. S. Davis, and M. K. Newell. 1999. gamma delta+ T cells regulate major histocompatibility complex class II(IA and IE)-dependent susceptibility to coxsackievirus B3-induced autoimmune myocarditis. J Virol 73:5630. 128. Huber, S. A. 2000. T cells expressing the gamma delta T cell receptor induce apoptosis in cardiac myocytes. Cardiovasc Res 45:579. 129. Kawai, C. 1999. From myocarditis to cardiomyopathy: mechanisms of inflammation and cell death: learning from the past for the future. Circulation 99:1091. 130. Barry, W. H. 2001. Cellular and molecular basis of inflammatory myocardial disease. J Nud Cardiol 8:499. 131. Kishimoto, C., T. Misaki, C. S. Crumpacker, and W. H. Abelmann. 1988. Serial immunologic identification of lymphocyte subsets in murine coxsackievirus B3 115 myocarditis: different kinetics and significance of lymphocyte subsets in the heart and in peripheral blood. Circulation 77:645. 132. Huber, S. A., and M. W. Cunningham. 1996. Streptococcal M protein peptide with similarity to myosin induces CD4+ T cell-dependent myocarditis in MRL/++ mice and induces partial tolerance against coxsakieviral myocarditis. J Immunol 156:3528. 133. Cunningham, M. W., S. M. Antone, J. M. Gulizia, B. M. McManus, V. A. Fischetti, and C. J. Gauntt. 1992. Cytotoxic and viral neutralizing antibodies crossreact with streptococcal M protein, enteroviruses, and human cardiac myosin. Proc Natl Acad Sci USA  89:1320. 134. Huber, S. A., and P. A. Lodge. 1984. Coxsackievirus B-3 myocarditis in Balb/c mice. Evidence for autoimmunity to myocyte antigens. Am J Pathol 116:21. 135. Schwimmbeck, P. L., C. Badorff, H. P. Schultheiss, and B. E. Strauer. 1994. Transfer of human myocarditis into severe combined immunodeficiency mice. Circ Res 75:156. 136. Schwimmbeck, P. L., S. A. Huber, and H. P. Schultheiss. 1997. Roles of T cells in coxsackievirus B-induced disease. Curr Top Microbiol Immunol 223:283. 137. Campbell, J. J., J. Hedrick, A. Zlotnik, M. A. Siani, D. A. Thompson, and E. C. Butcher. 1998. Chemokines and the arrest of lymphocytes rolling under flow conditions. Science 279:381. 138. Kim, C. H., and H. E. Broxmeyer. 1999. Chemokines: signal lamps for trafficking of T and B cells for development and effector function. J Leukoc Biol 65:6. 139. Cyster, J. G. 1999. Chemokines and cell migration in secondary lymphoid organs. Science 286:2098. 116 140. Luster, A. D. 1998. Chemokines--chemotactic cytokines that mediate inflammation. N Engl J Med 338:436. 141. Gerard, C., and B. J. Rollins. 2001. Chemokines and disease. Nat Immunol 2:108. 142. Charo, I. F., and R. M. Ransohoff. 2006. The many roles of chemokines and chemokine receptors in inflammation. N Engl J Med 354:610. 143. Sallusto, F., A. Lanzavecchia, and C. R. Mackay. 1998. Chemokines and chemokine receptors in T-cell priming and Thl/Th2-mediated responses. Immunol Today 19:568. 144. Bikfalvi, A. 2004. Platelet factor 4: an inhibitor of angiogenesis. Semin Thromb Hemost 30:379. 145. Strieter, R. M., J. A. Belperio, R. J. Phillips, and M. P. Keane. 2004. CXC chemokines in angiogenesis of cancer. Semin Cancer Bio114:195. 146. Loetscher, M., B. Gerber, P. Loetscher, S. A. Jones, L. Piali, I. Clark-Lewis, M. Baggiolini, and B. Moser. 1996. Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes. J Exp Med 184:963. 147. Lu, B., A. Humbles, D. Bota, C. Gerard, B. Moser, D. Soler, A. D. Luster, and N. P. Gerard. 1999. Structure and function of the murine chemokine receptor CXCR3. Eur J Immunol 29:3804. 148. Soto, H., W. Wang, R. M. Strieter, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, J. Hedrick, and A. Zlotnik. 1998. The CC chemokine 6Ckine binds the CXC chemokine receptor CXCR3. Proc Natl Acad Sci USA  95:8205. 149. Wang, X., X. Li, D. B. Schmidt, J. J. Foley, F. C. Barone, R. S. Ames, and H. M. Sarau. 2000. Identification and molecular characterization of rat CXCR3: receptor 117 expression and interferon-inducible protein-10 binding are increased in focal stroke. Mol Pharmacol 57:1190. 150. Lasagni, L., M. Francalanci, F. Annunziato, E. Lazzeri, S. Giannini, L. Cosmi, C. Sagrinati, B. Mazzinghi, C. Orlando, E. Maggi, F. Marra, S. Romagnani, M. Serio, and P. Romagnani. 2003. An alternatively spliced variant of CXCR3 mediates the inhibition of endothelial cell growth induced by IP-10, Mig, and I-TAC, and acts as functional receptor for platelet factor 4. J Exp Med 197•1537. 151. Liu, L., M. K. Callahan, D. Huang, and R. M. Ransohoff. 2005. Chemokine receptor CXCR3: an unexpected enigma. Curr Top Dev Biol 68:149. 152. Colvin, R. A., G. S. Campanella, J. Sun, and A. D. Luster. 2004. Intracellular domains of CXCR3 that mediate CXCL9, CXCL10, and CXCL11 function. J Biol Chem 279:30219. 153. Dagan-Berger, M., R. Feniger-Barish, S. Avniel, H. Wald, E. Galun, V. Grabovsky, R. Alon, A. Nagler, A. Ben-Baruch, and A. Peled. 2006. Role of CXCR3 carboxyl terminus and third intracellular loop in receptor-mediated migration, adhesion and internalization in response to CXCL11. Blood 107:3821. 154. Farber, J. M. 1990. A macrophage mRNA selectively induced by gamma-interferon encodes a member of the platelet factor 4 family of cytokines. Proc Natl Acad Sci U S A 87:5238. 155. Farber, J. M. 1993. HuMig: a new human member of the chemokine family of cytokines. Biochem Biophys Res Commun 192:223. 156. Widney, D. P., Y. R. Xia, A. J. Lusis, and J. B. Smith. 2000. The murine chemokine CXCL11 (IFN-inducible T cell alpha chemoattractant) is an IFN-gamma- and 118 lipopolysaccharide-inducible glucocorticoid-attenuated response gene expressed in lung and other tissues during endotoxemia. J Immuno1164: 6322. 157. Khan, I. A., J. A. MacLean, F. S. Lee, L. Casciotti, E. DeHaan, J. D. Schwartzman, and A. D. Luster. 2000. IP-10 is critical for effector T cell trafficking and host survival in Toxoplasma gondii infection. Immunity 12:483. 158. Amichay, D., R. T. Gazzinelli, G. Karupiah, T. R. Moench, A. Sher, and J. M. Farber. 1996. Genes for chemokines MuMig and Crg-2 are induced in protozoan and viral infections in response to IFN-gamma with patterns of tissue expression that suggest nonredundant roles in vivo. Jlmmunol 157:4511. 159. Mach, F., A. Sauty, A. S. larossi, G. K. Sukhova, K. Neote, P. Libby, and A. D. Luster. 1999. Differential expression of three T lymphocyte-activating CXC chemokines by human atheroma-associated cells. J Clin Invest 104:1041. 160. Flier, J., D. M. Boorsma, P. J. van Beek, C. Nieboer, T. J. Stoof, R. Willemze, and C. P. Tensen. 2001. Differential expression of CXCR3 targeting chemokines CXCL10, CXCL9, and CXCL11 in different types of skin inflammation. J Pathol 194:398. 161. Zhao, D. X., Y. Hu, G. G. Miller, A. D. Luster, R. N. Mitchell, and P. Libby. 2002. Differential expression of the IFN-gamma-inducible CXCR3-binding chemokines, IFN-inducible protein 10, monokine induced by IFN, and IFN-inducible T cell alpha chemoattractant in human cardiac allografts: association with cardiac allogaft vasculopathy and acute rejection. Jlmmunol 169:1556. 162. Kao, J., J. Kobashigawa, M. C. Fishbein, W. R. MacLellan, M. D. Burdick, J. A. Belperio, and R. M. Strieter. 2003. Elevated serum levels of the CXCR3 chemokine 119 ITAC are associated with the development of transplant coronary artery disease. Circulation 107:1958. 163. Wuest, T., J. Farber, A. Luster, and D. J. Carr. 2006. CD4+ T cell migration into the cornea is reduced in CXCL9 deficient but not CXCL10 deficient mice following herpes simplex virus type 1 infection. Cell Immunol 243:83. 164. Liao, F., R. L. Rabin, J. R. Yannelli, L. G. Koniaris, P. Vanguri, and J. M. Farber. 1995. Human Mig chemokine: biochemical and functional characterization. J Exp Med 182:1301. 165. Rabin, R. L., M. K. Park, F. Liao, R. Swofford, D. Stephany, and J. M. Farber. 1999. Chemokine receptor responses on T cells are achieved through regulation of both receptor expression and signaling. J Immunol 162:3840. 166. Yoong, K. F., S. C. Afford, R. Jones, P. Aujla, S. Qin, K. Price, S. G. Hubscher, and D. H. Adams. 1999. Expression and function of CXC and CC chemokines in human malignant liver tumors: a role for human monokine induced by gamma-interferon in lymphocyte recruitment to hepatocellular carcinoma. Hepatology 30:100. 167. Goebeler, M., A. Toksoy, U. Spandau, E. Engelhardt, E. B. Brocker, and R. Gillitzer. 1998. The C-X-C chemokine Mig is highly expressed in the papillae of psoriatic lesions. J Pathol 184:89. 168. Flier, J., D. M. Boorsma, D. P. Bruynzeel, P. J. Van Beek, T. J. Stoof, R. J. Scheper, R. Willemze, and C. P. Tensen. 1999. The CXCR3 activating chemokines IP-10, Mig, and IP-9 are expressed in allergic but not in irritant patch test reactions. J Invest Dermatol 113:574. 120 169. Konig, A., V. Krenn, A. Toksoy, N. Gerhard, and R. Gillitzer. 2000. Mig, GRO alpha and RANTES messenger RNA expression in lining layer, infiltrates and different leucocyte populations of synovial tissue from patients with rheumatoid arthritis, psoriatic arthritis and osteoarthritis. Virchows Arch 436:449. 170. Sorensen, T. L., M. Tani, J. Jensen, V. Pierce, C. Lucchinetti, V. A. Folcik, S. Qin, J. Rottman, F. Sellebjerg, R. M. Strider, J. L. Frederiksen, and R. M. Ransohoff. 1999. Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients. J Clin Invest 103:807. 171. Simpson, J. E., J. Newcombe, M. L. Cuzner, and M. N. Woodroofe. 2000. Expression of the interferon-gamma-inducible chemokines IP-10 and Mig and their receptor, CXCR3, in multiple sclerosis lesions. Neuropathol Appl Neurobiol 26:133. 172. Mahalingam, S., J. M. Farber, and G. Karupiah. 1999. The interferon-inducible chemokines MuMig and Crg-2 exhibit antiviral activity In vivo. J Virol 73:1479. 173. Salazar-Mather, T. P., T. A. Hamilton, and C. A. Biron. 2000. A chemokine-to- cytokine-to-chemokine cascade critical in antiviral defense. J Clin Invest 105:985. 174. Sgadari, C., J. M. Farber, A. L. Angiolillo, F. Liao, J. Teruya-Feldstein, P. R. Burd, L. Yao, G. Gupta, C. Kanegane, and G. Tosato. 1997. Mig, the monokine induced by interferon-gamma, promotes tumor necrosis in vivo. Blood 89:2635. 175. Tannenbaum, C. S., R. Tubbs, D. Armstrong, J. H. Finke, R. M. Bukowski, and T. A. Hamilton. 1998. The CXC chemokines IP-10 and Mig are necessary for IL-12- mediated regression of the mouse RENCA tumor. J Immunol 161:927. 176. Koga, S., M. B. Auerbach, T. M. Engeman, A. C. Novick, H. Toma, and R. L. Fairchild. 1999. T cell infiltration into class II MHC-disparate allografts and acute 121 rejection is dependent on the IFN-gamma-induced chemokine Mig. J Immunol 163:4878. 177. Miura, M., K. Morita, H. Kobayashi, T. A. Hamilton, M. D. Burdick, R. M. Strieter, and R. L. Fairchild. 2001. Monokine induced by IFN-gamma is a dominant factor directing T cells into murine cardiac allografts during acute rejection. J Immunol 167:3494. 178. Park, M. K., D. Amichay, P. Love, E. Wick, F. Liao, A. Grinberg, R. L. Rabin, H. H. Zhang, S. Gebeyehu, T. M. Wright, A. Iwasaki, Y. Weng, J. A. DeMartino, K. L. Elkins, and J. M. Farber. 2002. The CXC chemokine murine monokine induced by IFN-gamma (CXC chemokine ligand 9) is made by APCs, targets lymphocytes including activated B cells, and supports antibody responses to a bacterial pathogen in vivo. J Immuno1169:1433. 179. Luster, A. D., J. C. Unkeless, and J. V. Ravetch. 1985. Gamma-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature 315:672. 180. Gattass, C. R., L. B. King, A. D. Luster, and J. D. Ashwell. 1994. Constitutive expression of interferon gamma-inducible protein 10 in lymphoid organs and inducible expression in T cells and thymocytes. J Exp Med 179:1373. 181. Luster, A. D., and J. V. Ravetch. 1987. Biochemical characterization of a gamma interferon-inducible cytokine (IP-10). J Exp Med 166:1084. 182. Vanguri, P., and J. M. Farber. 1990. Identification of CRG-2. An interferon-inducible mRNA predicted to encode a murine monokine. J Biol Chem 265:15049. 122 183. Ohmori, Y., and T. A. Hamilton. 1990. A macrophage LPS-inducible early gene encodes the murine homologue of IP-10. Biochem Biophys Res Commun 168:1261. 184. Gottlieb, A. B., A. D. Luster, D. N. Posnett, and D. M. Carter. 1988. Detection of a gamma interferon-induced protein IP-10 in psoriatic plaques. J Exp Med 168:941. 185. Balashov, K. E., J. B. Rottman, H. L. Weiner, and W. W. Hancock. 1999. CCR5(+) and CXCR3(+) T cells are increased in multiple sclerosis and their ligands MIP- 1 alpha and IP-10 are expressed in demyelinating brain lesions. Proc Natl Acad Sci U S A 96:6873. 186. Patel, D. D., J. P. Zachariah, and L. P. Whichard. 2001. CXCR3 and CCR5 ligands in rheumatoid arthritis synovium. Clin Immunol 98:39. 187. Melter, M., A. Exeni, M. E. Reinders, J. C. Fang, G. McMahon, P. Ganz, W. W. Hancock, and D. M. Briscoe. 2001. Expression of the chemokine receptor CXCR3 and its ligand IP-10 during human cardiac allograft rejection. Circulation 104:2558. 188. Agostini, C., F. Calabrese, F. Rea, M. Facco, A. Tosoni, M. Loy, G. Binotto, M. Valente, L. Trentin, and G. Semenzato. 2001. Cxcr3 and its ligand CXCL10 are expressed by inflammatory cells infiltrating lung allografts and mediate chemotaxis of T cells at sites of rejection. Am J Pathol 158:1703. 189. Grimm, M. C., and W. F. Doe. 1996. Chemokines in inflammatory bowel disease mucosa: Expression of RANTES, macrophage inflammatory protein (MIP)-1, MIP-1, and -interferon-inducible protein-10 by macrophages, lymphocytes, endothelial cells, and granulomas. Inflamm. Bowel Dis. 2:88. 190. Tensen, C. P., J. Flier, E. M. Van Der Raaij-Helmer, S. Sampat-Sardjoepersad, R. C. Van Der Schors, R. Leurs, R. J. Scheper, D. M. Boorsma, and R. Willemze. 1999. 123 Human IP-9: A keratinocyte-derived high affinity CXC-chemokine ligand for the IP- 10/Mig receptor (CXCR3). J Invest Dermatol 112:716. 191. Rani, M. R., G. R. Foster, S. Leung, D. Leaman, G. R. Stark, and R. M. Ransohoff. 1996. Characterization of beta-R1, a gene that is selectively induced by interferon beta (IFN-beta) compared with IFN-alpha. J Biol Chem 271:22878. 192. Luo, Y., R. Kim, D. Gabuzda, S. Mi, L. A. Collins-Racie, Z. Lu, K. A. Jacobs, and M. E. Dorf. 1998. The CXC-chemokine, H174: expression in the central nervous system. J Neurovirol 4:575. 193. Laich, A., M. Meyer, E. R. Werner, and G. Werner-Felmayer. 1999. Structure and expression of the human small cytokine B subfamily member 11 (SCYB11/forrnerly SCYB9B, alias I-TAC) gene cloned from IFN-gamma-treated human monocytes (THP-1). J Interferon Cytokine Res 19:505. 194. Meyer, M., M. Erdel, H. C. Duba, E. R. Werner, and G. Werner-Felmayer. 2000. Cloning, genomic sequence, and chromosome mapping of Scybll, the murine homologue of SCYB11 (alias betaRl/H174/SCYB9B/I-TAC/IP-9/CXCL11). Cytogenet Cell Genet 88:278. 195. Cole, K. E., C. A. Strick, T. J. Paradis, K. T. Ogborne, M. Loetscher, R. P. Gladue, W. Lin, J. G. Boyd, B. Moser, D. E. Wood, B. G. Sahagan, and K. Neote. 1998. Interferon-inducible T cell alpha chemoattractant (I-TAC): a novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. J Exp Med 187:2009. 124 196. Sallusto, F., D. Lenig, C. R. Mackay, and A. Lanzavecchia. 1998. Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes. J Exp Med 187:875. 197. Sauty, A., M. Dziejman, R. A. Taha, A. S. Iarossi, K. Neote, E. A. Garcia-Zepeda, Q. Hamid, and A. D. Luster. 1999. The T cell-specific CXC chemokines IP-10, Mig, and I-TAC are expressed by activated human bronchial epithelial cells. J Immunol 162:3549. 198. Gasperini, S., M. Marchi, F. Calzetti, C. Laudanna, L. Vicentini, H. Olsen, M. Murphy, F. Liao, J. Farber, and M. A. Cassatella. 1999. Gene expression and production of the monokine induced by IFN-gamma (MIG), IFN-inducible T cell alpha chemoattractant (I-TAC), and IFN-gamma-inducible protein-10 (IP-10) chemokines by human neutrophils. Jlmmunol 162:4928. 199. Mazanet, M. M., K. Neote, and C. C. Hughes. 2000. Expression of IFN-inducible T cell alpha chemoattractant by human endothelial cells is cyclosporin A-resistant and promotes T cell adhesion: implications for cyclosporin A-resistant immune inflammation. Jlmmunol 164:5383. 200. Hamilton, N. H., J. L. Banyer, A. J. Hapel, S. Mahalingam, A. J. Ramsay, I. A. Ramshaw, and S. A. Thomson. 2002. IFN-gamma regulates murine interferon- inducible T cell alpha chemokine (I-TAC) expression in dendritic cell lines and during experimental autoimmune encephalomyelitis (EAE). Scand Jlmmunol 55:171. 201. Burdick, M. D., L. A. Murray, M. P. Keane, Y. Y. Xue, D. A. Zisman, J. A. Belperio, and R. M. Strieter. 2005. CXCL11 attenuates bleomycin-induced pulmonary fibrosis via inhibition of vascular remodeling. Am J Respir Crit Care Med 171:261. 125 202. Hanahan, D., and J. Folkman. 1996. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 86:353. 203. Distler, J. H., A. Hirth, M. Kurowska-Stolarska, R. E. Gay, S. Gay, and 0. Distler. 2003. Angiogenic and angiostatic factors in the molecular control of angiogenesis. Q J Nucl Med 47:149. 204. Cole, A. M., T. Ganz, A. M. Liese, M. D. Burdick, L. Liu, and R. M. Strieter. 2001. Cutting edge: IFN-inducible ELR- CXC chemokines display defensin-like antimicrobial activity. Jlmmunol 167:623. 205. Liu, M. T., B. P. Chen, P. Oertel, M. J. Buchmeier, D. Armstrong, T. A. Hamilton, and T. E. Lane. 2000. The T cell chemoattractant IFN-inducible protein 10 is essential in host defense against viral-induced neurologic disease. J Immunol 165:2327. 206. Dufour, J. H., M. Dziejman, M. T. Liu, J. H. Leung, T. E. Lane, and A. D. Luster. 2002. IFN-gamma-inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking. Jlmmunol 168:3195. 207. Carr, D. J., J. Chodosh, J. Ash, and T. E. Lane. 2003. Effect of anti-CXCL10 monoclonal antibody on herpes simplex virus type 1 keratitis and retinal infection. J Virol 77:10037. 208. Tsunoda, I., T. E. Lane, J. Blackett, and R. S. Fujinami. 2004. Distinct roles for IP- 10/CXCL10 in three animal models, Theiler's virus infection, EAE, and MHV infection, for multiple sclerosis: implication of differing roles for IP-10. Mult Scler 10:26. 126 209. Hokeness, K. L., E. S. Deweerd, M. W. Munks, C. A. Lewis, R. P. Gladue, and T. P. Salazar-Mather. 2007. CXCR3-dependent recruitment of antigen-specific T lymphocytes to the liver during murine cytomegalovirus infection. J Virol 81:1241. 210. Klein, R. S., E. Lin, B. Zhang, A. D. Luster, J. Tollett, M. A. Samuel, M. Engle, and M. S. Diamond. 2005. Neuronal CXCL10 directs CD8+ T-cell recruitment and control of West Nile virus encephalitis. J Virol 79:11457. 211. Hsieh, M. F., S. L. Lai, J. P. Chen, J. M. Sung, Y. L. Lin, B. A. Wu-Hsieh, C. Gerard, A. Luster, and F. Liao. 2006. Both CXCR3 and CXCL10/IFN-inducible protein 10 are required for resistance to primary infection by dengue virus. Jlmmunol 177:1855. 212. Christensen, J. E., C. de Lemos, T. Moos, J. P. Christensen, and A. R. Thomsen. 2006. CXCL10 is the key ligand for CXCR3 on CD8+ effector T cells involved in immune surveillance of the lymphocytic choriomeningitis virus-infected central nervous system. Jlmmunol 176:4235. 213. Zeng, X., T. A. Moore, M. W. Newstead, J. C. Deng, S. L. Kunkel, A. D. Luster, and T. J. Standiford. 2005. Interferon-inducible protein 10, but not monokine induced by gamma interferon, promotes protective type 1 immunity in murine Klebsiella pneumoniae pneumonia. Infect Immun 73: 8226. 214. McAllister, F., S. Ruan, C. Steele, M. Zheng, L. McKinley, L. Ulrich, L. Marrero, J. E. Shellito, and J. K. Kolls. 2006. CXCR3 and IFN protein-10 in Pneumocystis pneumonia. Jlmmunol 177:1846. 215. Wareing, M. D., A. B. Lyon, B. Lu, C. Gerard, and S. R. Sarawar. 2004. Chemokine expression during the development and resolution of a pulmonary leukocyte response to influenza A virus infection in mice. J Leukoc Biol 76:886. 127 216. Hausmann, J., C. Sauder, M. Wasmer, B. Lu, and P. Staeheli. 2004. Neurological disorder after Boma disease virus infection in the absence of either interferon-gamma, Fas, inducible NO synthase, or chemokine receptor CXCR3. Viral Immunol 17:79. 217. Christensen, J. E., A. Nansen, T. Moos, B. Lu, C. Gerard, J. P. Christensen, and A. R. Thomsen. 2004. Efficient T-cell surveillance of the CNS requires expression of the CXC chemokine receptor 3. J Neurosci 24:4849. 218. Chen, J. P., H. L. Lu, S. L. Lai, G. S. Campanella, J. M. Sung, M. Y. Lu, B. A. Wu- Hsieh, Y. L. Lin, T. E. Lane, A. D. Luster, and F. Liao. 2006. Dengue virus induces expression of CXC chemokine ligand 10/IFN-gamma-inducible protein 10, which competitively inhibits viral binding to cell surface heparan sulfate. J Immunol 177:3185. 219. Trifilo, M. J., C. Montalto-Morrison, L. N. Stiles, K. R. Hurst, J. L. Hardison, J. E. Manning, P. S. Masters, and T. E. Lane. 2004. CXC chemokine ligand 10 controls viral infection in the central nervous system: evidence for a role in innate immune response through recruitment and activation of natural killer cells. J Virol 78:585. 220. Arai, K., Z. X. Liu, T. Lane, and G. Dennert. 2002. IP-10 and Mig facilitate accumulation of T cells in the virus-infected liver. Cell Immunol 219:48. 221. Robertson, M. J. 2002. Role of chemokines in the biology of natural killer cells. J Leukoc Biol 71:173. 222. Taub, D. D., T. J. Sayers, C. R. Carter, and J. R. Ortaldo. 1995. Alpha and beta chemokines induce NK cell migration and enhance NK-mediated cytolysis. J Immunol 155:3877. 128 223. Maghazachi, A. A., B. S. Skalhegg, B. Rolstad, and A. Al-Aoukaty. 1997. Interferon- inducible protein-10 and lymphotactin induce the chemotaxis and mobilization of intracellular calcium in natural killer cells through pertussis toxin-sensitive and - insensitive heterotrimeric G-proteins. FASEB J 11: 765. 224. Kakimi, K., T. E. Lane, S. Wieland, V. C. Asensio, I. L. Campbell, F. V. Chisari, and L. G. Guidotti. 2001. Blocking chemokine responsive to gamma-2/interferon (IFN)- gamma inducible protein and monokine induced by IFN-gamma activity in vivo reduces the pathogenetic but not the antiviral potential of hepatitis B virus-specific cytotoxic T lymphocytes. J Exp Med 194:1755. 225. Vester, B., K. Muller, W. Solbach, and T. Laskay. 1999. Early gene expression of NK cell-activating chemokines in mice resistant to Leishmania major. Infect Immun 67:3155. 226. Hardison, J. L., R. A. Wrightsman, P. M. Carpenter, T. E. Lane, and J. E. Manning. 2006. The chemokines CXCL9 and CXCL10 promote a protective immune response but do not contribute to cardiac inflammation following infection with Trypanosoma cruzi. Infect Immun 74:125. 227. Liu, M. T., H. S. Keirstead, and T. E. Lane. 2001. Neutralization of the chemokine CXCL10 reduces inflammatory cell invasion and demyelination and improves neurological function in a viral model of multiple sclerosis. J Immunol 167:4091. 228. Rhode, A., M. E. Pauza, A. M. Barral, E. Rodrigo, M. B. Oldstone, M. G. von Herrath, and U. Christen. 2005. Islet-specific expression of CXCL10 causes spontaneous islet infiltration and accelerates diabetes development. J Immunol 175:3516. 129 229. Klein, R. S., L. Izikson, T. Means, H. D. Gibson, E. Lin, R. A. Sobel, H. L. Weiner, and A. D. Luster. 2004. IFN-inducible protein 10/CXC chemokine ligand 10- independent induction of experimental autoimmune encephalomyelitis. J Immunol 1 72:550. 230. Narumi, S., T. Kaburaki, H. Yoneyama, H. Iwamura, Y. Kobayashi, and K. Matsushima. 2002. Neutralization of IFN-inducible protein 10/CXCL10 exacerbates experimental autoimmune encephalomyelitis. Eur Jlmmunol 32:1784. 231. Yoneyama, H., S. Narumi, Y. Zhang, M. Murai, M. Baggiolini, A. Lanzavecchia, T. Ichida, H. Asakura, and K. Matsushima. 2002. Pivotal role of dendritic cell-derived CXCL10 in the retention of T helper cell 1 lymphocytes in secondary lymph nodes. J Exp Med 195:1257. 232. Liu, L., D. Huang, M. Matsui, T. T. He, T. Hu, J. Demartino, B. Lu, C. Gerard, and R. M. Ransohoff. 2006. Severe disease, unaltered leukocyte migration, and reduced IFN- gamma production in CXCR3-/- mice with experimental autoimmune encephalomyelitis. Jlmmunol 176::4399. 233. Bortug, K., M. J. Carson, N. Pham-Mitchell, V. C. Asensio, J. DeMartino, and I. L. Campbell. 2002. Leukocyte infiltration, but not neurodegeneration, in the CNS of transgenic mice with astrocyte production of the CXC chemokine ligand 10. J Immunol 169:1505. 234. Luster, A. D., R. D. Cardiff, J. A. MacLean, K. Crowe, and R. D. Granstein. 1998. Delayed wound healing and disorganized neovascularization in transgenic mice expressing the IP-10 chemokine. Proc Assoc Am Physicians 110: 183. 130 235. Kolattukudy, P. E., T. Quach, S. Bergese, S. Breckenridge, J. Hensley, R. Altschuld, G. Gordillo, S. Klenotic, C. Orosz, and J. Parker-Thornburg. 1998. Myocarditis induced by targeted expression of the MCP-1 gene in murine cardiac muscle. Am J Pathol 152:101. 236. Kubota, T., C. F. McTiernan, C. S. Frye, S. E. Slawson, B. H. Lemster, A. P. Koretsky, A. J. Demetris, and A. M. Feldman. 1997. Dilated cardiomyopathy in transgenic mice with cardiac-specific overexpression of tumor necrosis factor-alpha. Circ Res 81:627. 237. Sallusto, F., C. R. Mackay, and A. Lanzavecchia. 2000. The role of chemokine receptors in primary, effector, and memory immune responses. Annu Rev Immunol 18:593. 238. Fife, B. T., K. J. Kennedy, M. C. Paniagua, N. W. Lukacs, S. L. Kunkel, A. D. Luster, and W. J. Karpus. 2001. CXCL10 (IFN-gamma-inducible protein-10) control of encephalitogenic CD4+ T cell accumulation in the central nervous system during experimental autoimmune encephalomyelitis. J Immunol 166:7617. 239. Yang, D., J. Yu, Z. Luo, C. M. Carthy, J. E. Wilson, Z. Liu, and B. M. McManus. 1999. Viral myocarditis: identification of five differentially expressed genes in coxsackievirus B3-infected mouse heart. Circ Res 84:704. 240. Zhang, H. M., J. Yuan, P. Cheung, D. Chau, B. W. Wong, B. M. McManus, and D. Yang. 2005. Gamma interferon-inducible protein 10 induces HeLa cell apoptosis through a p53-dependent pathway initiated by suppression of human papillomavirus type 18 E6 and E7 expression. Mol Cell Biol 25:6247. 131 241. Claycomb, W. C., N. A. Lanson, Jr., B. S. Stallworth, D. B. Egeland, J. B. Delcarpio, A. Bahinski, and N. J. Izzo, Jr. 1998. HL-1 cells: a cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. Proc. Natl. Acad. Sci. USA 95:2979. 242. Boyd, J. H., S. Mathur, Y. Wang, R. M. Bateman, and K. R. Walley. 2006. Toll-like receptor stimulation in cardiomyoctes decreases contractility and initiates an NF- kappaB dependent inflammatory response. Cardiovasc Res 72:384. 243. Miller, S. A., D. D. Dykes, and H. F. Polesky. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215. 244. Mullick, A., Z. Leon, G. Min-Oo, J. Berghout, R. Lo, E. Daniels, and P. Gros. 2006. Cardiac failure in CS-deficient A/J mice after Candida albicans infection. Infect Immun 74:4439. 245. Hohenadl, C., K. Klingel, J. Mertsching, P. H. Hofschneider, and R. Kandolf. 1991. Strand-specific detection of enteroviral RNA in myocardial tissue by in situ hybridization. Mol Cell Probes 5:11. 246. Fairweather, D., S. Frisancho-Kiss, S. A. Yusung, M. A. Barrett, S. E. Davis, R. A. Steele, S. J. Gatewood, and N. R. Rose. 2005. IL-12 protects against coxsackievirus B3-induced myocarditis by increasing IFN-gamma and macrophage and neutrophil populations in the heart. J Immunol 174:261. 247. Seko, Y., N. Takahashi, H. Yagita, K. Okumura, and Y. Yazaki. 1997. Expression of cytokine mRNAs in murine hearts with acute myocarditis caused by coxsackievirus b3. J Pathol 183:105. 132 248. Leipner, C., K. Grun, M. Borchers, and A. Stelzner. 2000. The outcome of coxsackievirus B3-(CVB3-) induced myocarditis is influenced by the cellular immune status. Herz 25:245. 249. Smith, S. C., J. H. Ladenson, J. W. Mason, and A. S. Jaffe. 1997. Elevations of cardiac troponin I associated with myocarditis. Experimental and clinical correlates. Circulation 95:163. 250. Tucker, J. F., R. A. Collins, A. J. Anderson, J. Hauser, J. Kalas, and F. S. Apple. 1997. Early diagnostic efficiency of cardiac troponin I and Troponin T for acute myocardial infarction. Acad Emerg Med 4:13. 251. Bertinchant, J. P., C. Larue, I. Pernel, B. Ledermann, P. Fabbro-Peray, L. Beck, C. Calzolari, S. Trinquier, J. Nigond, and B. Pau. 1996. Release kinetics of serum cardiac troponin I in ischemic myocardial injury. Clin Biochem 29:587. 252. Huber, S. A., and P. A. Lodge. 1986. Coxsackievirus B-3 myocarditis. Identification of different pathogenic mechanisms in DBA/2 and Balb/c mice. Am J Pathol 122:284. 253. Wojcik, W. J., P. Swoveland, X. Zhang, and P. Vanguri. 1996. Chronic intrathecal infusion of phosphorothioate or phosphodiester antisense oligonucleotides against cytokine responsive gene-2/IP-10 in experimental allergic encephalomyelitis of lewis rat. J Pharmacol Exp Ther 278:404. 254. Narumi, S., L. M. Wyner, M. H. Stoler, C. S. Tannenbaum, and T. A. Hamilton. 1992. Tissue-specific expression of murine IP-10 mRNA following systemic treatment with interferon gamma. J Leukoc Biol 52:27. 255. Lane, T. E., V. C. Asensio, N. Yu, A. D. Paoletti, I. L. Campbell, and M. J. Buchmeier. 1998. Dynamic regulation of alpha- and beta-chemokine expression in 133 the central nervous system during mouse hepatitis virus-induced demyelinating disease. J Immunol 160:970. 256. Asensio, V. C., and I. L. Campbell. 1997. Chemokine gene expression in the brains of mice with lymphocytic choriomeningitis. J Virol 71: 7832. 257. Padovan, E., G. C. Spagnoli, M. Ferrantini, and M. Heberer. 2002. IFN-alpha2a induces IP-10/CXCL10 and MIG/CXCL9 production in monocyte-derived dendritic cells and enhances their capacity to attract and stimulate CD8+ effector T cells. J Leukoc Biol 71:669. 258. Buttmann, M., F. Berberich-Siebelt, E. Serfling, and P. Rieckmann. 2007. Interferon- beta is a potent inducer of interferon regulatory factor-1/2-dependent IP-10/CXCL10 expression in primary human endothelial cells. J Vasc Res 44:51. 259. Lane, T. E., A. D. Paoletti, and M. J. Buchmeier. 1997. Disassociation between the in vitro and in vivo effects of nitric oxide on a neurotropic murine coronavirus. J Virol 71:2202. 260. Pearce, B. D., M. V. Hobbs, T. S. McGraw, and M. J. Buchmeier. 1994. Cytokine induction during T-cell-mediated clearance of mouse hepatitis virus from neurons in vivo. J Virol 68:5483. 261. Okuno, M., M. Nakagawa, M. Shimada, M. Saito, S. Hishinuma, and K. Yamauchi- Takihara. 2000. Expressional patterns of cytokines in a murine model of acute myocarditis: early expression of cardiotrophin-1. Lab Invest 80:433. 262. Shen, Y., W. Xu, Y. W. Chu, Y. Wang, Q. S. Liu, and S. D. Xiong. 2004. Coxsackievirus group B type 3 infection upregulates expression of monocyte 134 chemoattractant protein 1 in cardiac myocytes, which leads to enhanced migration of mononuclear cells in viral myocarditis. J Virol 78:12548. 263. Nakamura, K., I. R. Williams, and T. S. Kupper. 1995. Keratinocyte-derived monocyte chemoattractant protein 1 (MCP-1): analysis in a transgenic model demonstrates MCP-1 can recruit dendritic and Langerhans cells to skin. J Invest Dermatol 105:635. 264. Chen, S. C., G. Vassileva, D. Kinsley, S. Holzmann, D. Manfra, M. T. Wiekowski, N. Romani, and S. A. Lira. 2002. Ectopic expression of the murine chemokines CCL21a and CCL2lb induces the formation of lymph node-like structures in pancreas, but not skin, of transgenic mice. J Immunol 168:1001. 265. Pagani, F. D., L. S. Baker, C. Hsi, M. Knox, M. P. Fink, and M. S. Visner. 1992. Left ventricular systolic and diastolic dysfunction after infusion of tumor necrosis factor- alpha in conscious dogs. J Clin Invest 90:389. 266. Murray, D. R., and G. L. Freeman. 1996. Tumor necrosis factor-alpha induces a biphasic effect on myocardial contractility in conscious dogs. Circ Res 78:154. 267. Finkel, M. S., C. V. Oddis, T. D. Jacob, S. C. Watkins, B. G. Hattler, and R. L. Simmons. 1992. Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science 257:387. 268. Huhn, M. H., M. Hultcrantz, K. Lind, H. G. Ljunggren, K. J. Malmberg, and M. Flodstrom-Tullberg. 2007. IFN-gamma production dominates the early human natural killer cell response to Coxsackievirus infection. Cell Microbiol. 269. Huber, S., D. Sartini, and M. Exley. 2003. Role of CD1d in coxsackievirus B3- induced myocarditis. J Immunol 170:3147. 135 270. Huber, S. A., D. Sartini, and M. Exley. 2002. Vgamma4(+) T cells promote autoimmune CD8(+) cytolytic T-lymphocyte activation in coxsackievirus B3-induced myocarditis in mice: role for CD4(+) Thl cells. J Virol 76:10785. 271. Huber, S. 2004. T cells in coxsackievirus-induced myocarditis. Viral Immunol 17:152. 272. Shen, Y., W. Xu, X. A. Shao, R. Z. Chen, Y. Z. Yang, and S. D. Xiong. 2003. [Infection of Coxsackievirus group B type 3 regulates the expression profile of chemokines in myocardial tissue/cells]. Zhonghua Yi Xue Za Zhi 83:981. 136 APPENDIX I ANIMAL CARE CERTIFICATE jLAIC THE UNIVERSITY OF BRITISH COLUMBIA ANIMAL CARE CERTIFICATE Application Number: A06-1524 Investigator or Course Director: Decheng Yang Department: Pathology & Laboratory Medicine Animals: Mice IP10 knockout mouse (BALB/C) 58 Mice BALB/C 58 Mice IP 10 Transgenic mouse & non-transgenic littermates (A/J) 116 Start Date: January 1, 2007 ApprovalDate: December 19, 2006 Funding Sources: Funding Agency: Funding Title: Canadian Institutes of Health Research Functional characterization of IP 10 in coxsachievirus-induced myocarditis using genetically modified mice Unfunded^Functional Characterization of IP10 in Coxsackievirus-Induced title:^Myocarditis using Genetically Modified Mice The Animal Care Committee has examined and approved the use of animals for the above experimental project. This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required by the CCAC and some granting agencies. A copy of this certificate must be displayed in your animal facility. Office of Research Services and Administration 102, 6190 Agronomy Road, Vancouver, BC V6T 1Z3 Phone: 604-827-5111 Fax: 604-822-5093 137 APPENDIX II LIST OF PUBLICATIONS, ABSTRACTS, AND PRESENTATIONS A. Articles submitted or published in refereed journals 1. Yuan, J., Lim, T., He, J., Walker, E., Shier, C., Wang, Y., Zhang, H., Sall, A., Liu, Z., McManus, B.M., and Yang, D. CXCL10 inhibits virus replication through recruitment of natural killer cells in coxsackievirus B3-induced myocarditis. In review. 2. Cheung, P., Lim, T., Yuan, J., Zhang, M., Chau, D., McManus, B.M., and Yang, D. Specific interaction of HeLa cell proteins with coxsackievirus B3 3'UTR: La autoantigen binds the 3' and 5'UTR independently of the poly(A) tail (2007). Cell Microbiol. 9:1705-15. 3. Chau, D.H., Yuan, J., Zhang, H., Cheung, P., Lim, T., Liu, Z., Sall, A., and Yang, D. Coxsackievirus B3 proteases 2A and 3C induce apoptotic cell death through mitochondrial injury and cleavage of eIF4GI but not DAP5/p97/NAT1 (2007). Apoptosis. 12:513-24. 4. Yuan, J., Stein, D., Lim, T., Qiu, D., Coughlin, S., Liu, Z., Wang, Y., Bouch, R., Moulton, H., Iversen, P., and Yang, D. Inhibition of Coxsackievirus B3 in Cell- cultures and in Mice by Peptide-Conjugated Morpholino Oligomers Targeting the IRES (2006). J Virol. 80:11510-9. 5. Yuan, J., Lim, T., Liu, Z., Qiu, D., Wong, B., Luo, H., Si, X., McManus, B.M., and Yang, D. Antisense DNA and RNA: Potential Therapeutics for Viral Infection (2006). Anti-Infective Agents Med Chem. 5: 367-377 6. Lim, T.W., Yuan, J., Liu, Z., Qiu, D., Sall, A., and Yang, D. Nucleic-acid-based antiviral agents against positive single-stranded RNA viruses (2006). Curr Opin Mol Ther. 8:104-7. 7. Yuan, J., Zhang, J., Wong, B., Si, X., Yang, D., McManus, B.M., and Luo, H. Inhibition of glycogen synthase kinase 30 suppresses coxsackievirus-induced cytopathic effect and apoptosis via stabilization of j3-catenin (2005). Cell Death Differ. 12:1097-106. 8. Yuan, J., Cheung, P., Zhang, H.M., Chau, D., and Yang, D. Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand (2005). J Virol. 79:2151-9. 9. Yuan, J., Chen Z., Cheung, P., Chau, D., and Yang, D. Nucleic Acid-Based Gene- Silencing Molecules as Potential Antiviral Therapeutics (2005). Drug Des Rev. - Online. 2, 323-33. 10. Zhang, H.M., Yuan, J., Cheung, P., Chau, D., Wong, B.W., McManus, B.M., and Yang, D. Gamma interferon-inducible protein 10 induces HeLa cell apoptosis through 138 a p53-dependent pathway initiated by suppression of human papillomavirus type 18 E6 and E7 expression (2005). Mol Cell Biol. 25:6247-58. 11. Cheung, P.K., Yuan, J., Zhang, H.M., Chau, D., Yanagawa, B., Suarez, A., McManus, B.M., and Yang, D. Specific interactions of mouse organ proteins with the 5'untranslated region of coxsackievirus B3: potential determinants of viral tissue tropism (2005). J Med Virol. 77:414-24. 12. Liu, Z., Yuan, J., Yanagawa, B., Qiu, D., McManus, B.M., and Yang, D. Coxsackievirus-induced myocarditis: new trends in treatment (2005). Expert Rev Anti Infect Ther. 3:641-50. 13. Yuan, J., Cheung, P., Zhang, H.M., Chau, D., Cheung, C., Yanagawa, B., Luo, H., Wang, J., Suarez, A., McManus, B.M., and Yang, D. A phosphorothioate antisense oligodeoxynucleotide specifically inhibits coxsackievirus B3 replication in cardiomyocytes and mouse hearts (2004). Lab Invest. 84: 703-14. 14. Zhang, H.M., Yuan, J., Cheung, P., Luo, H., Yanagawa, B., Chau, D., Stephan-Tozy, N., Wong, B.W., Zhang, J., Wilson, J.E., McManus, B.M., and Yang, D. (2003). Overexpression of interferon-gamma-inducible GTPase inhibits coxsackievirus B3- induced apoptosis through the activation of the phosphatidylinositol 3-kinase/Akt pathway and inhibition of viral replication. J Biol Chem. 278: 33011-9. 15. Si., X., Luo, H., Morgan, A., Zhang, J., Wong, J., Yuan, J., Sefandiarei, M., Gao, G., Cheung, C., and McManus, BM. Stress-activated protein kinases are involved in coxsackievirus B3 viral progeny release (2005). J Virol. 79: 13875-81. 16. Si, X., McManus, B.M., Zhang, J., Yuan, J., Cheung, C., Esfandiarei, M., Suarez, A., Morgan, A., and Luo, H. Pyrrolidine dithiocarbamate reduces coxsackievirus B3 replication through inhibition of the ubiquitin-proteasome pathway (2005). J Virol. 79:8014-23. 17. Yang, D., Cheung, P., Sun, Y., Yuan, J., Zhang, H., Carthy, C.M., Anderson, D.R., Bohunek, L., Wilson, J.E., and McManus, B.M. (2003). A shine-dalgarno-like sequence mediates in vitro ribosomal internal entry and subsequent scanning for translation initiation of coxsackievirus B3 RNA. Virology. 305: 31-43. 18. Cheung, P., Zhang, M., Yuan, J., Chau, D., Yanagawa, B., McManus, B.M., and Yang, D. (2002). Specific interactions of HeLa cell proteins with Coxsackievirus B3 RNA: La autoantigen binds differentially to multiple sites within the 5' untranslated region. Virus Res. 90: 23-36. 1. 19. Zhang, H.M., Yanagawa, B., Cheung, P., Luo, H., Yuan, J., Chau, D., Wang, A., Bohunek, L., Wilson J.E., McManus, B.M., and Yang, D. (2002) Nip21 gene expression reduces coxsackievirus B3 replication by promoting apoptotic cell death via a mitochondria-dependent pathway. Circ Res. 90: 1251-8. 139 20. McManus, B.M., Yanagawa, B., Rezai, N., Luo, H., Taylor, L., Zhang, M., Yuan, J., Buckley, J., Triche, T., Schreiner, G., and Yang, D. (2002). Genetic determinants of coxsackievirus B3 pathogenesis. Ann N Y Acad Sci. 975:169-79. B. Abstracts/Presentations 1. Yuan, J., Lim, T., He, J., Walker, E., Shier, C., Wang, Y., Sall, A., Zhang, H., Liu, Z., McManus, B., and Yang, D. CXCL10 inhibits virus replication but can not enhance virus clearance in coxsackievirus B3-induced myocarditis. Keystone Symposia: Chemokines and Chemokine Receptors, Keystone, 2008 2. Yuan, J., Lim, T., Coughlin, S., Qiu, D., Liu, Z., Stein, D.A., Iversen, P.L., and Yang, D.C. Inhibition of coxsackievirus B3 replication by peptide-conjugated morpholino oligomers. American Society for Virology 25 th annual meeting, Madison, 2006 3. Yuan, J., Lim, T., Coughlin, S., Qiu, D., Liu, Z., Stein, D.A., and Yang, D.C. Inhibition of Coxsackievirus B3 Replication in HeLa Cells and Cardiomyocytes by Peptide-Conjugated Phosphorodiamidate Morpholino Oligomers. 19 th International Conference on Antiviral Research, San Juan, Puerto Rico, 2006 4. Yuan, J., Cheung, P., Zhang, H., Chau, D., and Yang, D. Inhibition of Coxsackievirus B3 Replication by Small Interfering RNAs in vitro and in vivo. America Society for Microbiology-105 th General Meeting, Atlanta, 2005. 5. Yuan, J., Zhang, J., Wong, B., Si, X., Yang, D., McManus, BM., and Luo, H. Inhibition of glycogen synthase kinase 3I3 suppresses coxsackievirus-induced cytopathic effect and apoptosis via stabilization of 13-catenin. 1st Annual Symposium of the American Heart Association's Council on Basic Cardiovascular Sciences: Stress Signals, Molecular Targets, and the Genome, Stevenson, 2004. 6. Yuan, J., Cheung, P., Zhang, H.M., Chau, D., Cheung, C., Yanagawa, B., Luo, H., Wang, J., Suarez, A., McManus, B.M., and Yang, D Inhibition of coxsackievirus B3 replication in cardiomyocytes and mouse hearts by an antisense oligodeoxynucleotide. UBC Pathology Day, Vancouver, 2004. (Oral presentation) 7. Yuan, J., Cheung, P., Zhang, H.M., Chau, D., and Yang, D. Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match to the positive strand of virus. National Research Forum for Young Investigators in Circulatory and Respiratory Health, Winnipeg, 2004. 8. Yuan, J., Cheung, P., Zhang, H.M., Chau, D., Cheung, C., Yanagawa, B., Luo, H., Wang, J., Suarez, A., McManus, B.M., and Yang, D. A phosphorothioate antisense oligodeoxynucleotide specifically inhibits coxsackievirus B3 replication in cardiomyocytes and mouse hearts. United States and Canadian Academy of Pathology Annual Meeting, Vancouver, 2004. 9. Yuan, J., Zhang, H.M., Cheung, P., Luo, H., Yanagawa, B., Chau, D., Stephan-Tozy, N., Wong, B.W., Zhang, J., Wilson, J.E., McManus, B.M., and Yang, D. 140 Overexpression of interferon-gamma-inducible GTPase inhibits coxsackievirus B3- induced apoptosis through the activation of the phosphatidylinositol 3-kinase/Akt pathway and inhibition of viral replication. Frontiers in Cardiovascular Research, Vancouver, 2003. 10. Yanagawa, B., Luo, H., Schreiner, G., Yuan, J., Cheung, C., Zhang, H., Cheung, P., Yang, D., Bonigut, S., Deisher, T., and McManus, B.M. Gene profiling in CVB3- infected mouse hearts. Horizons in Heart Failure Conference in San Diego, 2002. 11. Zhang, H.M., Yanagawa, B., Cheung, P., Yuan, J., Esfandiarei, M., Chau, D., Luo, H., Zhang, J., Dabiri, D., Wilson, J.E., McManus, B.M., and Yang, D. Functional role of IP10 and IGTP expression in coxsackievirus B3 replication. FASEB, New Orlean, 2002. 12. Zhang, H.M., Cheung, P., Yuan, J., Chau, D., Luo, H., Wilson, J.E., McManus, B.M., and Yang, D. Functional characterization of IP 10 and IGTP in fetal gene re- expression and coxsackievirus B3 replication. Frontiers in Cardiovascular Research, Seattle, 2001. 13. Yang, D., Zhang, H.M., Cheung, P., Chau, D., Yuan, J., Luo, H., Toma, M., Yanagawa, B., Zhang, J., Wilson, J.E., and McManus, B.M. Coxsackievirus B3 proteases 2A and 3C induce cell death through apoptosis. Frontiers in Cardiovascular Research, Seattle, 2001. C. Book Chapter 1. Si, X., Rahmani, M., Yuan, J., and Luo, H. Detection of Cardiac Signaling in the Hypertrophied Heart (2005). Molecular Cardiology: Methods Mol Med. 112:291-303. D. Awards 1. Canada Graduate Scholarships Doctoral Award, Canadian Institutes of Health Research, 2005-2008. 2. Senior Graduate Studentship Award, Michael Smith Foundation for Health Research, 2005-2008. 3. Doctoral Research Award, Heart & Stroke Foundation of Canada, 2004-2007. 4. Travel Award, 19th International Conference on Antiviral Research, 2006. 5. Travel Award, American Society for Virology 25th annual meeting, 2006. 6. Albert B and Mary Steiner Summer Research Award, 2004. 7. Graduate Student Entrance Award, University of British Columbia, 2003. 141

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0066642/manifest

Comment

Related Items