UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The genetics of sports behaviour : the role of the DRD4 gene in sensation seeking in skiers Thomson, Cynthia J 2008

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
ubc_2008_fall_thomson_cynthia.pdf [ 817.87kB ]
Metadata
JSON: 1.0066565.json
JSON-LD: 1.0066565+ld.json
RDF/XML (Pretty): 1.0066565.xml
RDF/JSON: 1.0066565+rdf.json
Turtle: 1.0066565+rdf-turtle.txt
N-Triples: 1.0066565+rdf-ntriples.txt
Original Record: 1.0066565 +original-record.json
Full Text
1.0066565.txt
Citation
1.0066565.ris

Full Text

    THE GENETICS OF SPORTS BEHAVIOUR: THE ROLE OF THE DRD4 GENE IN SENSATION SEEKING IN SKIERS   by  CYNTHIA J. THOMSON  B.Sc. & B.P.H.E., Queen?s University, 2003     A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES  (Human Kinetics)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  August 2008   ? Cynthia J. Thomson, 2008ii ABSTRACT  Previous  research  has  shown  a  large  genetic  influence  over  personality  traits, especially sensation seeking.  One gene thought to influence this behavioural trait is the dopamine-4-receptor gene (DRD4), in which variants have been associated with sensation seeking and novelty seeking in some, but not all studies.  The inconsistencies between studies  may  be  due  to  heterogeneity  in  both  the  behaviours  and  the  populations  being assessed.    Some  studies  included  only  males  and  few  studies  have  a  priori  analyzed males and females separately.  SS has been associated with high-risk sports, including skiing; however, this is the first study to address the possibility that genetics may play a role  in  individuals?  inclination  towards  SS  in  sport.    Using  the  Contextual  Sensation Seeking Questionnaire for Skiing (CSSQ-S), developed and validated for this study, and the Zuckerman-Kuhlman Personality Questionnaire (ZKPQ), levels of SS in males and females were analyzed in association with the alleles of a polymorphism in the dopamine-4-receptor, -521 C/T (a C or a T at position -521).  Behavioural analysis of skiers (N = 200)  revealed  a  significant  correlation  (r2=  .506,  p  <  .001)  between  skier  behaviour (CSSQ-S) and skier personality score (ZKPQ) for sensation seeking.  Genotype analysis (N = 74) revealed allele frequencies of .58 C and .42 T and an over-representation of the C  allele  was  found  in  the  population  of  skiers  compared  with  a  general  Caucasian population  (p  <  .01).    In  females,  a  significant  association  was  found  between  the homozygous C/C genotype and high levels of contextual skiing SS behaviour (N = 36, p = .006, eta2 = .2), along with a non-significant trend between ZKPQ impulsive SS scores and the alleles of -521  C/T (p = .086).  No  association, however, was  found in males (N=38, p ZKPQ = .473, p CSSQ-S = .345).  This study supports the hypothesis that alleles of the DRD4  -521  C/T  polymorphism  are  associated  with  context-specific  SS  behaviours, however only in females.  Social pressures may differentially influence male and female sensation-seeking behaviour which may explain the lack of association in males, though this hypothesis requires further investigation. iii TABLE OF CONTENTS  ABSTRACT ........................................................................................................................ ii TABLE OF CONTENTS ................................................................................................... iii LIST OF TABLES ............................................................................................................ vii LIST OF FIGURES ......................................................................................................... viii GLOSSARY ...................................................................................................................... ix ACKNOWLEDGEMENTS ............................................................................................... xi INTRODUCTION .............................................................................................................. 1 Overview ......................................................................................................................... 1 Risk-taking and evolution ............................................................................................... 1 Sensation seeking ............................................................................................................ 2 Sensation seeking and related traits ................................................................................ 2 Sensation seeking and sports .......................................................................................... 4 Dopamine and a physiological basis for novelty and sensation seeking ........................ 5 Inheritance and genetics of sensation seeking ................................................................ 8 The molecular biology of novelty and sensation-seeking behaviour .............................. 9 Justification for research ............................................................................................... 15 PURPOSE ..................................................................................................................... 16 RESEARCH QUESTIONS .......................................................................................... 16 HYPOTHESES ............................................................................................................. 16 METHODOLOGY ........................................................................................................... 17 Overview ....................................................................................................................... 17 Questionnaire development .......................................................................................... 17 Subjects ......................................................................................................................... 18 Data collection .............................................................................................................. 18 Questionnaire component ............................................................................................. 19 Consensual validity check ............................................................................................. 19 Genetics ......................................................................................................................... 20 DNA sampling .............................................................................................................. 20 DNA isolation ............................................................................................................... 20 iv DNA quantification ....................................................................................................... 21 Genotyping by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) .................................................................................................. 21 Gel electrophoresis ........................................................................................................ 23 Genotyping by pyrosequencing .................................................................................... 23 Sequencing for pyrosequencing .................................................................................... 23 PCR for pyrosequencing ............................................................................................... 24 Pyrosequencing reactions .............................................................................................. 24 STATISTICAL ANALYSIS ........................................................................................ 25 Phase I: Exploratory factor analysis and validation of CSSQ-S ................................... 25 Behaviour and personality ............................................................................................ 25 Phase II: Personality and -521 C/T polymorphism ....................................................... 25 RESULTS ......................................................................................................................... 27 Subjects ......................................................................................................................... 27 Phase I: Factor analysis and validation of CSSQ-S ...................................................... 27 Exploratory factor analysis (FA) of CSSQ-S ................................................................ 28 Internal consistency ...................................................................................................... 29 Consensual validity check ............................................................................................. 30 Correlation of CSSQ-S and ZKPQ ............................................................................... 30 Phase II: Personality and the -521 C/T polymorphism ................................................. 30 Personality questionnaire: ZKPQ data .......................................................................... 30 Genetic data .................................................................................................................. 32 Polymerase chain reaction (PCR) ................................................................................. 32 DRD4 sequencing ......................................................................................................... 32 Pyrosequencing DRD4 -521 C/T .................................................................................. 32 Hardy-Weinberg equilibrium ........................................................................................ 32 One-way blocked ANOVA: ZKPQ and genetics ......................................................... 33 DISCUSSION ................................................................................................................... 35 Phenotype identification ............................................................................................... 35 Sensation-seeking personality and behaviours ............................................................. 36 DRD4 gene association ................................................................................................. 38 v Sex differences .............................................................................................................. 38 LIMITATIONS ............................................................................................................. 40 Power ............................................................................................................................ 40 Generalizability ............................................................................................................. 41 Potential confounding variables .................................................................................... 41 FUTURE DIRECTIONS .............................................................................................. 42 CONCLUSIONS ........................................................................................................... 43 REFERENCES ................................................................................................................. 44 APPENDICES .................................................................................................................. 51 APPENDIX A:  Contextual Sensation Seeking Questionnaire for Skiing (CSSQ-S) ...... 53 APPENDIX B:  Zuckerman Kuhlman Personality Questionnaire (ZKPQ) ..................... 56 APPENDIX C:  Clinical Research Ethics Board Certificate ............................................ 60 APPENDIX D:  Subject consent ....................................................................................... 61 APPENDIX E:  Peer consent ............................................................................................ 66 APPENDIX F:  Peer CSSQ-S review form ...................................................................... 68 APPENDIX G:  Recipes ................................................................................................... 70 APPENDIX H:  Optimal PCR conditions for F4/R4 primer pair ..................................... 72 APPENDIX I:  A scatter-plot of the total CSSQ scores against the ZKPQ ImpSS scores73 APPENDIX J:  Normality and descriptive statistics for 13-item CSSQ. ......................... 74 APPENDIX K:  Scree plot test representing the percent of variance accounted for by each factor in the FA of the CSSQ ............................................................................................ 75 APPENDIX L:  Factor analysis of 13-item CSSQ: factor loadings, variances and communalities after ML extraction and varimax rotation. ............................................... 76 APPENDIX M:  Scree plot test representing the percent of variance accounted for the contextual sensation seeking factor in the 10-item CSSQ. ............................................... 77 APPENDIX N:  ANOVA Peer CSSQ and 10-item CSSQ (between groups, df = 1)....... 78 APPENDIX O:  Pearson?s correlation of CSSQ-S and ZKPQ ImpSS ............................. 79 APPENDIX P:  Cronbach alphas and tests for normality of ZKPQ subscales using total scores from all subjects (N = 201). ................................................................................... 80 APPENDIX P:  Cronbach alphas and tests for normality of ZKPQ subscales using total scores from all subjects (N = 201). ................................................................................... 80 vi APPENDIX Q:  Graphed distribution of ImpSS scores for males and females (N = 201). ........................................................................................................................................... 81 APPENDIX R:  A representative picture depicting digested PCR products and assigned genotypes (16/4/08) .......................................................................................................... 82 APPENDIX S:  Raw data including genotype, ZKPQ ImpSS score, CSSQ score, peer CSSQ (if available). .......................................................................................................... 83 APPENDIX T:  Sequencing data for ?C22? (CMMT/BCRI DNA Sequencing Core Facility, UBC, Vancouver). .............................................................................................. 85 APPENDIX U:  Pyrosequencing result.  Position 2 shows a C/C genotype, exhibited by the higher peak upon dispensation of the C nucleotide. ................................................... 86 APPENDIX V:  Expected allele frequencies .................................................................... 87 APPENDIX W:  Example of block design for two-way ANOVA using ImpSS scores .. 88 APPENDIX X:  One-way ANOVA blocked by sex. ........................................................ 89 vii LIST OF TABLES    Table 1:  A summary of research relating sensation seeking to high- and low-risk sports. 4 Table 2:  -521 C/T allele frequencies across populations. ................................................ 10 Table 3:  Genetic association studies on -521 C/T and novelty seeking and extraversion. ........................................................................................................................................... 12 Table 4:  A summary of participant statistics. .................................................................. 27 Table 5:  Factor analysis of 10-item CSSQ-S: factor loadings, alpha, variances. ............ 29 Table 6:  Means and standard deviations for males and females scores on the Zuckerman Kuhlman Personality Questionnaire (ZKPQ). .................................................................. 31 Table 7:  A summary of sensation-seeking scores by genotype for males and females. .. 34   viii LIST OF FIGURES  Figure 1:  Neurotransmission: dopamine and its receptor in the synaptic cleft. ................. 6 Figure 2:  Lock and key model.  Dopamine is shaped to fit into its designated receptor. .. 6 Figure 3:   A schematic diagram of the dopamine DRD4-gene (chromosome 11p15.5, NCBI dbSNP number is RS 1800955).............................................................................. 10 Figure 4:  The -521 C/T genotypes shown in a UV-light photograph. ............................. 22  ix GLOSSARY  Allele: one version of a genetic variant at a particular polymorphic locus (e.g. ?C? or ?T? at a ?C/T? polymorphism).  Bases:  the individual nucleotides that comprise DNA (A, C, T and G).  Chromosomes: long segments of DNA on which genes are encoded.  Humans have 23 distinct chromosomes and every cell (except sex cells) has two complete sets (one from mother, one from father).  Dopamine:    a  neurotransmitter  in  the  brain  that  has  both  excitatory  and  inhibitory functions related to motor control, motivation and reward pathways.  DRD4: the dopamine-4-receptor gene, one of five receptor subtypes for dopamine.  Eigenvalue:  algebraic transformation variables that represent the variance accounted for by each factor in a factor analysis.  EPI: Eyesenck Personality Inventory measures extraversion/introversion and neurotism.  Factor:  items  that  describe  different  components  of  the  same  larger  dimension  (e.g.  a personality trait) comprise a factor.  A factor is a single dimension that is independent, but is composed of highly related items.  Factor  Analysis:    a  statistical  method  used  to  group  items  (e.g.  in  a  questionnaire) according to their relatedness.    Gene:  A protein-encoding segment of DNA.  Genes are located on chromosomes.   Genotype:  The combination of alleles at a particular locus (e.g. C/C, C/T or T/T at a ?C/T? polymorphism).  HPLC:  high performance liquid chromatography, a purification method.  Maximum  likelihood  rotation:  a  rotation  of  eigenvalues  by  90  degrees,  used  in  factor analysis.  NEO-FFI: NEO Five-Factor model measures five basic dimensions of personality traits including  neurotism,  extraversion,  openness  to  experience,  agreeableness,  and conscientiousness.  Neurotransmitter: a brain chemical that transmits signals between neurons.  PCR: polymerase chain reaction, in the context of this study PCR is a method that allows amplification of a specific DNA segment via varied cycled temperatures. x Personality:  the  consistent  pattern  of  behaviours  that  is  characteristic  of  an  individual.  Personality is often organized in conceptual taxonomic structures.  Phenotype: an observable characteristic of an individual that is influenced by genetic and environmental factors.  Polymorphism:  a  common  variation  in  DNA  in  which  alternate  sequences  occur  in populations.  Polymorphic locus: the location in the DNA of a polymorphism.  RFLP:  restriction  fragment  length  polymorphism,  a  method  used  to  identify polymorphisms using an enzyme that either recognizes a specific allele and cuts at the specific site in the sequence, or does not recognize the allele resulting in an un-cut strand.  SSS-IV,  V:  Sensation  Seeking  Scales  forms  IV  and  V  measures  four  subscales  of sensation  seeking:  thrill  and  adventure  seeking,  experience  seeking,  boredom susceptibility and disinhibition.  SNP: single nucleotide polymorphism, a variation in the gene sequence that occurs at a single locus (one nucleotide base).  TCI:    Temperament  and  Character  Inventory  which  was  developed  by  Cloninger  to measure four temperaments traits: novelty seeking, harm avoidance, reward dependence and persistence.  Trait: a behavioural characteristic of a person that is stable over time.  Varimax rotation: a type of rotation in space that maximizes the variance captured by the items in a factor, used in factor analysis.  VNTR: variable number of tandem repeats occurs when a segment of the gene sequence is repeated a variable number of times.  ZKPQ:  Zuckerman-Kuhlman  Personality  Questionnaire  measures  five  traits:  impulsive sensation seeking, aggression-hostility, neurotism-anxiety, sociability and activity.  xi ACKNOWLEDGEMENTS    First and foremost I would like to thank Jim Rupert for his support and guidance throughout my master?s experience.  Early in my studies, Jim noticed a trend in my extra-curricular activities and wondered if there might be genetic influences guiding my urges for thrilling activities.  Intrigued, I launched into the field of behavioural genetics and I am thrilled that this became the topic of my thesis.   I would also like to thank my committee members, Dr. Mark Beauchamp and Dr. Wendy Robinson for their expertise and support.  Mark introduced me to the field of psychology, and was patient and available for extra guidance as psychology was outside my area of study.  Similarly, Wendy and members of her lab, especially Courtney Hanna, helped me troubleshoot the genetic analysis, also an area in which I lacked experience.  Their patience and generosity of lab materials helped me greatly.   The GRIP lab members at UBC were my support network, giving me advice on genetics and helping me with edits.  I would like to thank Pei, Matt, Maria and Mona for their support.   Finally, I would like to thank my friends and family for supporting me through stressful times.  My number one supporter, my best-friend and partner, Chris, for joining me on weekend trips to the lab, helping me recruit subjects in Whistler and for being my rock!    1 INTRODUCTION Overview   Personality is defined as the consistent pattern of behaviours, often organized in conceptual  taxonomic  structures,  that  are  characteristic  of  an  individual  (Gana  and Trouillet,  2003).    The  factors  underlying  personality  traits  are  not  fully  understood.  Environmental influences are no doubt of great importance, but the influences of genetics on  character  are  not  completely  understood  and  have  proven  challenging  to  study.  Association studies are a common method for studying the relationship between genetics and personality traits.  Personality traits related to the seeking of novel experiences have been extensively studied in association with the genetics of a chemical in the brain called dopamine.  The sensation of pleasure (i.e. the ?high? that a sky-diver might feel during and  after  a  jump)  has  been  hypothesized  to  be  related  to  the  density  of  dopamine receptors  (Franken,  Zijlstra,  &  Muris,  2006).    Dopamine  levels  have  been  related  to motivation and reward mechanisms, which is why dopamine pathways in the brain are thought  to  be  involved  in  the  sensation-seeking  trait.    Sensation  seeking  has  been associated  with  behaviours  that  are  deemed  high-risk  in  Western  society,  including participation in certain types of sports.  Traditionally, the study of sensation seeking and sport has been limited to the field of psychology, and this study is the first to investigate the  genetics  of  sensation  seeking  in  a  sport  cohort.    Questionnaires  exist  to  measure global sensation seeking, namely the overall personality trait across all situations, but we developed a sport-specific questionnaire that measures contextual behaviours related to sensation  seeking  in  skiers  and  snowboarders.    This  study  focuses  on  the  sensation-seeking personality trait, sport-specific behaviours in skiing and snowboarding associated with  the  trait,  and  whether  an  association  exists  between  sensation-seeking  levels  and variations in the gene encoding one of the dopamine receptors.   Risk-taking and evolution What  propels  certain  individuals  to  fearlessly  jump  out  of  airplanes  and  speed down  ski  runs?    Downhill-mountain  bikers,  skiers,  mountaineers  and  other  ?extreme? athletes alike, risk all and show no restraint in order to rise to the top of their sport.  A 2 common thread among many high-risk sport athletes is a craving for thrill and adventure (Anonymous, Elevation), but to what degree is it genetically ?hard-wired? or influenced by  environmental  experience?    Day  to  day  challenges  of  many  early  settlers  such  as hunting, finding shelter and fighting for ones territory were risky activities (Zuckerman, 2000).  In the Western world strict safe-work policies and the amenities of urban life have removed natural outlets for thrill and adventure.  Perhaps to fill this void, a new class of recreation  involving  higher  physical  risks  has  emerged,  gaining  popularity  since  the 1970s (Creyer, Ross, & Evers, 2003).   Sensation seeking High-risk  sports  include  ?any  sport,  where  one  has  to  accept  a  possibility  of severe injury or death as an inherent part of the activity? (Kajtna, Scaronak, Bari, Cacute, &  Burnik, 2004).     Ice-hockey for example, is  not a high-risk sport, because  although bodily harm is common, the potential for death is low.  Sky-diving, on the other hand, is an example of a high-risk sport, since the stakes for possible death are greatly increased.  Downhill-skiing and snowboarding, the sports highlighted as the focus of this study, are also considered risky activities and their popularity has been increasing over the last few decades (Bouter, Knipschild, Feif & Volovics, 1988).   Certain personalities may be more attracted to risky sports, while others may shy away  from  these  potentially  dangerous  activities.    The  personality  trait,  ?sensation seeking?, coined by Zuckerman, emerged from observed behavioural differences between individuals  coming  out  of  sensory  deprivation  experiments  (Zuckerman,  1979,  p.  10).  Sensation seeking (SS), involves a desire to seek out new and thrilling experiences, and involves  taking  risks  for  the  sake  of  such  experiences  (Zuckerman,  1979).    Risk  is  a relative  term  however,  and  it  is  important  to  note  that  sensation-seeking  behaviours involve the risk perceived by the participant, not by the observer.  Sensation seeking and related traits Sensation  seeking  is  empirically  measured  using  standardized  personality questionnaires  that  have  evolved  over  the  years.    The  Sensation  Seeking  Scale  (SSS) Forms IV and V are questionnaires that have been used in psychology research since the 1970s to measure four subscales of sensation seeking: experience seeking (ES), thrill and 3 adventure  seeking  (TAS),  boredom  susceptibility  (BS),  and  disinhibition  (DIS) (Zuckerman, 2006).  In 1993, the questionnaire was modernized and expanded to a five-trait  measure,  becoming  the  Zuckerman-Kuhlman  Personality  Questionnaire  (ZKPQ).  This questionnaire measures impulsive sensation seeking (a combination of impulsivity and  sensation  seeking,  ImpSS),  along  with  four  other  personality  traits:  aggression-hostility  (Agg-Host),  sociability  (Soc),  neurotism-anxiety  (Neur-Anx),  and  activity (Zuckerman, Joireman, Teta, & Kraft, 1993).  Three of the traits, ImpSS, Agg-Hos and Soc  were  associated  with  risk-taking  behaviours  (including  smoking,  drug-use,  and reckless driving) in a study on college students (Zuckerman & Kuhlman, 2000).  Both the ZKPQ  and  the  SSS  questionnaires  have  been  used  to  study  sensation  seeking  in association with certain sports (Table 1) and other high-risk activities. Sensation seeking has often been associated with two other related traits: novelty seeking and extraversion.  Novelty seeking has also been studied in association with risky behaviours,  however  novelty  seeking  differs  in  both  the  instrument  of  measurement (McCourt, Guerrera & Cutter, 1993; Schweizer, 2004), and its scope.  Novelty seeking has a slightly narrower scope than sensation seeking and lacks the facet of risk taking (Zuckerman, 2005).  The trait ?extraversion? has been included in literature reviews of novelty and sensation seeking (Munafo, Yalcin, Willis-Owen, & Flint, 2008); however, extraversion  is  a  broader  personality  dimension  that  includes  novelty  seeking  as  one component  of  a  much  broader  trait  characterized  by  activity,  gregariousness,  and positivity (Bookman, Taylor, Adams-Campbell, & Kittles, 2002; Ebstein, 2006). Studies have shown that the three traits: novelty seeking, sensation seeking and extraversion,  are  related  (McCourt  et  al.,  1993;  Zuckerman  and  Cloninger,  1996; Bookman et al., 2002) and each has its own instrument of measure.  The SSS and the ZKPQ measure sensation seeking, while Cloninger?s Tri-Personality Inventory (TCI) and NEO-five  factor  inventory  are  used  to  measure  novelty  seeking  and  extraversion respectively  (Cloninger,  1987;  Reuter  and  Hennig,  2005).    The  ZKPQ  was  chosen  to measure the sensation-seeking trait in this study of skiers (rationale is explained in the discussion).  All of the above-mentioned questionnaires measure global personality traits and  are  not  situation  specific;  therefore,  for  the  purpose  of  this  study  a  sport-specific 4 questionnaire was created in order to assess contextual sensation seeking behaviours (See Methodology and Appendix A).  Sensation seeking and sports The  sensation-seeking  trait  has  been  associated  with  high-risk  sports  and  other high-risk social activities including promiscuous sex, illicit drugs, and crime (Gelernter, Kranzler, Coccaro, Siever, New, & Mulgrew, 1997; Zuckerman, 2000; Zuckerman and Kuhlman, 2000; Franques, Auriacombe, Piquernal, Verger, Brisseau-Gimenez, Grabot, & Tignol, 2003; Kelly, Robbins, Martin, Fillmore, Lane, Harrington, & Rush, 2006).  Some people may satisfy a need for adventure-seeking through risky sports, while others may be driven to the less socially accepted forms of thrill-seeking.  Logically, high-sensation seekers  tend  to  be  involved  in  high-risk  sports,  and  low-sensation  seekers  in  low-risk sport  (Table  1).    The  studies  listed  below  compared  sensation-seeking  scores  between high- and low-risk groups, but did not inquire about specific behaviours associated with the  high-risk  activity.    Few  studies  to  date  have  measured  context-specific  high-risk behaviours  since  most  studies  have  measured  sensation-seeking  using  standardized personality questionnaires that measure traits across all situations.  Table 1:  A summary of research relating sensation seeking to high- and low-risk sports. High-risk (N)  Controls and low-risk  (N)  Measure  Findings  Ref. Hand-gliding, mountaineering, skydiving, auto racing (93) Swimming, marathon running, aerobics, golf (73) SSS V  SS higher in high risk group 1          Surfing (41)  Golfing (44)  SSS V  Surfers scored higher on TAS and ES 2          Downhill skiing (219)  Matched reference (299)  SSS  Skiers scored higher on TAS 3          Paragliding (opioid dependent, OD) (34) College staff (OD) (34)  SSS IV  Para gliders scored higher on TAS and DIS 4 1) (Jack and Ronan, 1998); 2) (Diehm and Armatas, 2004); 3) (Bouter et al., 1988); 4) (Franques et al., 2003) 5 Sensation seeking is also associated with physical risk-taking behaviours in children.  Children who were willing to walk on a balance beam set at greater heights scored higher on sensation-seeking scales, the children included in the study were as young as 6 years of age. (Morrongiello and Lasenby, 2006).  Perhaps sensation seeking is an inherent trait, independent of experience.  Some children may be born with higher levels of sensation seeking than others, suggesting a greater influence from genetics than the environment (e.g. a younger child has a shorter exposure to environmental influences) although additional support is required.   Dopamine and a physiological basis for novelty and sensation seeking  Previous research demonstrated that dopamine, a neurotransmitter that acts as a messenger  in  the  brain,  is  a  key  molecule  in  reward  and  pleasure  pathways,  therefore becoming an important focus of sensation-seeking studies (Okuyama, Ishiguro, Nankai, Shibuya, Wantanabe,  &  Arinami, 1999).  Neurotransmitters are molecules in the brain that  are  released  by  one  neuron  and  taken  up  by  the  next  neuron  in  series  to  transmit signals  (Figure  1).    The  action  of  a  neurotransmitter  in  the  synaptic  cleft  can  either increase or decrease the action of a messenger inside the next neuron, thereby triggering (or inhibiting) a cascade of intracellular effects.   Cloninger (1987) theorized that each neurotransmitter may be associated with a broad personality trait, and suggested that dopamine is involved in the novelty-seeking trait.    Dopaminergic  neurons  are  activated  when  an  unexpected  reward  is  presented, which is why they are thought to be involved in the learning process (Pecina, Cagniard, Berridge, Aldridge, & Zhuang, 2003).  Further, animal models have shown that exposure to  a  novel  environment  elicits  an  increase  in  dopamine  release  (Rebec,  Christensen, Guerra, & Bardo, 1997). 6  Figure 1:  Neurotransmission: dopamine and its receptor in the synaptic cleft.  An excess of dopamine lingering in the synaptic cleft may be responsible for a ?high? sensation, similar to the mechanism of action for cocaine, while an exaggerated uptake of dopamine may result in a lack of the ability to feel pleasure, or ?anhedonia? (Franken  et  al.,  2006).    Variations  in  the  receptors  that  take  up  dopamine  may  affect sensations  of  reward.    Individuals  who  experience  anhedonia  in  the  face  of  normal stimulation might constantly seek increased levels of stimuli (e.g. speed, height, fearful situations) in order to experience some feeling  of reward.  On a physiological level, a person with a modified receptor might exhibit an altered (blunted or increased) uptake of dopamine,  thus  modifying  his/her  sensation  of  reward  and  affecting  the  motivation  to repeat an action (Pain, 2005).  A simplified conceptualization used in biochemistry is the ?lock and key? model: some individuals have a configuration where the lock matches the key, while others have a lock that does not quite match the key, making the union less successful (Figure 2).    Figure 2:  Lock and key model.  Dopamine is shaped to fit into its designated receptor. 7 There  are  five  dopamine  receptor  subtypes  (D1  to  D5)  in  the  human  brain  to which dopamine may bind.  The D4 is the receptor of interest for this study due to its primary  association  with  novelty  seeking  in  humans  (Benjamin,  Patterson,  Greenberg, Murphy,  &  Hamer,  1996;  Ebstein,  Novick,  Umanky,  Priel,  Osher,  Blaine,  Bennett, Nernanov,  Katz,  &  Belmaker,  1996;  Okuyama  et  al.,  2000;  Ronai,  Szekely,  Nermoda, Lakatos, Gervai, Staub, & Sasvari-Szekely, 2001; reviewed by Munafo et al., 2008 and Schinka, Letsch, & Crawford, 2002).  The D4 receptor belongs to the ?D2-like class? of receptors  (named  after  the  D2  receptor  sub-type),  which  are  inhibitory,  causing  a decrease  in adenylyl cyclase, a molecule involved in neuron-to-neuron communication (Strange, 2000).  The D4 is found mainly in the prefrontal cortex, hippocampus, thalamus and hypothalamus; regions of the brain that are part of the limbic system.  The limbic system is primarily involved in emotion and memory and because the D4 receptors are so densely distributed in these regions, a role for D4 in attention, motivation and memory has been hypothesized (Kreek, Nielson, Butelman, & LaForge, 2005; Mitsuyasu, Hirato, Sakai, Shibata, Takeda, Ninomiya, Kawasaki, Tashiro, & Fukymaki, 2001).  Pecina  and  colleagues  (2003)  measured  the  behaviour  of  hyper-dopaminergic mice in response to a reward (a sweet treat) and observed that the mutant mice showed higher wanting, or motivation, towards the reward.  This may be related to drug-addict behaviour, in that certain individuals may be predisposed to addiction because they have a continuous wanting of the drug due to sensitization of limbic pathways (Pecina, 2003).  Similarly,  in  the  sport  setting,  certain  individuals  may  have  an  insatiable  urge  for increasingly thrilling activities. Further  support  for  the  role  of  dopamine  in  the  sensation-seeking  trait  may  be inferred  from  the  relationship  between  dopamine  and  monoamine-oxidase  type-B (MAOB).  MAOB is an enzyme that breaks down dopamine in the synaptic cleft.  MAOB is higher in females and increases with age; the trends are inversely related to sensation seeking, which is lower in females and decreases with age (Zuckerman, 2000; Zuckerman and Kuhlman, 2000). 8 Inheritance and genetics of sensation seeking Identical twins are useful candidates for studying the inheritance of physical and psychological traits because monozygotic twins are genetically identical.  Variations in individual characteristics, or phenotypes, are due to a combination of environmental and genetic influences: Variability in phenotype (VP) = variability due to environment (VE) + variability due to genetics (VG),  in identical twins VG  = 0.  The heredity of a trait may therefore be determined by analyzing trait scores in monozygotic twins, and any variation that  exists  is  assumed  to  be  due  to  the  environment  (since  VG  =  0).    The  greater  the environmental influence, the lower the inheritance of the trait.    Twin  studies  have  shown  that  personality  traits  have  a  genetic  basis  for inheritance,  and  sensation  seeking  has  been  reported  to  be  one  of  the  mostly  highly inherited traits (Koopmans, Boomsma, Heath, & van Doornen, 1995; Stoel, De Geus, & Van Tol, 2006).  Complex personality traits follow a pattern of quantitative inheritance (Golimbet, Gritsenko, Alfimova, & Ebstein, 2005), meaning that the sensation-seeking trait likely involves the interaction of numerous genes.  A Finnish study analyzed both childhood  rearing  and  genetic  make-up  and  found  that  the  genetic  influence  plays  a dominant role in the novelty-seeking trait (Keltikangas-Jarvinen, Raikkonen, Ekelund, & Peltonen,  2004).    Large-scale  twin  studies  have  used  Zuckerman?s  questionnaires  to compare  levels  of  sensation  seeking  between  twin-pairs  reared  separately  (thereby differing in their environmental influences) and also between twin-pairs and their non-twin siblings sharing the same environment.  While some variation is due to environment, as high as 60% of the variation in sensation-seeking traits may be explained by genetics (Hur and Bouchard, 1997; Stoel et al., 2006).   There  exist  sex  differences  in  the  source  of  variation.    Sensation  seeking  in females may be more influenced by their genes, with zero variation being due to a shared environment, where as sensation seeking in males may be influenced by a combination of genes  and  environment  (Stoel  et  al.,  2006).    Bookman  and  colleagues  (2002)  found  a stronger association with extraversion and the -521 T variant of the D4 receptor gene in females, and other studies that included females showed similar trends (Lee, Kim, Kim, Kim,  Lee,  Joe,  Jung,  Suh,  &  Kim,  2003;  Ono,  Manki,  Yoshimura,  Muramatsu, Mizushima, Higuchi, Yagi, Kanba, & Asai, 1997). 9 The molecular biology of novelty and sensation-seeking behaviour  Humans  have  two  sets  of  23  chromosomes  that  carry  genetic  information  for proteins contributing to the anatomy and function of the body.  One set of chromosomes is  passed  to  the  offspring  from  each  its  mother  and  father.    The  chromosomes  carry approximately  twenty-five  thousand  protein-encoding  entities  called  ?genes? (Consortium,  2004).    At  the  DNA  level,  humans  are  99.9  %  the  same  (Collins  and Mansoura,  2001),  and  variations  that  exist  between  individuals  are  in  part  due  to  the relatively small, .1%, differences in our genome.  Variations within the genome that are common in a population are called ?polymorphisms?, whereas new variations are referred to as ?mutations?.  Specific polymorphisms are often chosen as candidates for association studies because the variant may have a causal role in the expression of the phenotype or is  associated  with  a  nearby  causal  variant    (Cordell  and  Clayton,  2005).    The polymorphism that is the focus of this study is called a single-nucleotide polymorphism or SNP, in which there are two possible variants (nucleotide base pairs) called ?alleles?.  SNPs are often named for their position in the gene, followed by the first letter of each allele.   Intra-individual differences in the dopamine receptor may be due to variations in the gene responsible for its encoding, the DRD4 gene, located on chromosome 11.  The DRD4 gene is highly polymorphic (Oak, Oldenhof, & Van Tol, 2000; Okuyama et al., 2000) which means that at multiple sites in the gene there are variations in the nucleotide sequence that are common in most populations.  Two particular genetic variations have been the focus of novelty-seeking association studies: -521C/T and the exon III VNTR.  A SNP in the promoter region of the DRD4 gene, -521 C/T (a cytosine to thymine transition 521 bases upstream from the protein-coding start-site, see Figure 4), is common in  a  variety  of  populations  (Table  2).    Because  each  individual  has  two  sets  of chromosomes, three combinations of nucleotide pairs (?genotypes?) at location ?521 are possible: C/C, C/T or T/T.  The ancestral genotype (based chimpanzees) contained a T allele at position -521 (UCSC Genome Bioinformatics, 2008).   10       Figure 3:   A schematic diagram of the dopamine DRD4-gene (chromosome 11p15.5, NCBI dbSNP number is RS 1800955). Note: two polymorphisms, 1) -521 C/T and 2) VNTR have been studied in association with novelty, sensation seeking and extraversion.    Table 2:  -521 C/T allele frequencies across populations. Origin of population  2Nuni01C2  Allele frequency   C  TSwedish (Jonsson et al., 2002)  776  .42  .58 Japanese (Okuyuma et al., 2000)  172  .53  .47 African American (Bookman et al., 2002)  142  .55  .45 Russian (Golimbet et al., 2005)   440  .43  .57 uni01C22N ? ?N? represents the total number of subjects, and two alleles per subject are included in the analysis (2N). exon II  exon III  exon IV Start site of DRD4  gene  -521C/T  VNTR     3? 11 Individuals  with  the  C/C  genotype  at  position  ?521  have  been  associated  with high novelty-seeking scores (Okuyama et al., 2000; Ronai et al., 2001).  Bookman and colleagues  (2002)  found  an  association  between  the  T  allele  and  low  levels  of extraversion,  a  trait  that  is  related  to  novelty  and  sensation  seeking  (Bookman  et  al., 2002; Daitzman and Zuckerman, 1980), in females, but not in males.  It is important to note that although novelty seeking and sensation seeking are not identical traits, they are thought  to  share  common  biochemical  pathways  (Zuckerman  &  Kuhlman,  2000).    To date, no studies have examined the -521 C/T polymorphism in association with sensation seeking, but based on previous associations between novelty seeking and -521 C/T and the similarities between the two traits, a similar association may be found between the DRD4  gene  and  the  sensation-seeking  trait.    Overall,  seven  studies  to  date  have investigated the association between novelty seeking and the -521 C/T SNP (Table 3).  Only  two  studies  report  a  significant  association,  however,  the  studies  that  had  non-significant results (p > .05) showed a consistent trend of higher novelty-seeking scores  in C/C homozygotes compared to the C/T heterozygotes and the T/T homozygotes (Jonsson et al., 2002; Mitsuyasu et al., 2001). 12  Table 3:  Genetic association studies on -521 C/T and novelty seeking and extraversion.  Cohort  N  Measure   Findings  Reference Young Male  86  TCI   C/C highest NS scores, T/T lowest (p < 0.001)* Okuyama, et al. 2000 Extremes (high and low NS scores) 200  TCI  No significant association  Ekelund, et al. 2001 Schizophrenics and controls 173  TCI  No significant association*  Mitsuyasu, et al. 2001 Students  99  TCI  C/C higher NS than C/T and T/T especially in women (p = 0.008)* Ronai, et al. 2001 Normals  381  TCI  No significant association*  Jonsson, et al. 2002 Normals  276  TCI  No significant association  Strobel, et al. 2002 Adolescent females  101  TCI  No association for -521, but a significant interaction between -521, VNTR and NS Lee et al. 2003 Normals  104  NEO-FFI  No significant association  Eichhammer, et al. 2005 Normals  220  EPItriagup  A joint contribution of ?521 C/T and ?809 A/G to levels of extraversion  Golimbet, et al. 2005  (*) studies included in meta-analysis by Schinka et al., 2002.  (triagup) EPI is a measure of extraversion, see glossary (p. ix) for details on the measures.  In  simple  Mendelian  inheritance,  an  allele  may  be  dominant,  recessive,  or  co-dominant.  A dominant allele paired with a recessive allele overshadows the effect of the latter.  The inheritance of eye colour in humans is a classic (albeit simplified) example of the Mendelian model: the allele for brown eyes (B) is dominant and the allele for blue eyes  (b)  is  recessive.    In  order  for  an  individual to  have  blue  eyes,  both  parents  must contribute a ?b? allele to the offspring in order to produce the ?blue? phenotype from the ?bb?  genotype.    The  other  combinations  of  genotypes  (BB  and  Bb)  will  both  result  in brown eyes.  A pattern of inheritance for the -521C/T SNP has not yet been determined, and dominance of one allele over the other has been inconsistently reported (Mitsuyasu et al., 2001; Ronai et al., 2001).  Three studies follow the trend of -521 T as dominant, set by Bookman and colleagues (2002) (Eichhammer, Sand, Stoertebecker, Langguth, Zowe, & Hajak, 2005; Munafo et al., 2008), while others have treated -521 C as the dominant allele (Okuyama et al., 2000; Mitsuyasu et al., 2001; Jonsson et al., 2002).   13 Only two studies to date have investigated the functional differences between the alleles of the -521 C/T  polymorphism (the second was an attempted replication of the first).    Constructs  containing  -521C  and  ?521T  alleles  were  introduced  in  vitro  into human cell lines.  In the first study, those cells containing the ?C? version of the allele were  40%  more  transcriptionally  active1  than  those  with  a  ?T?  allele  (Okuyama  et  al., 2000).  The second study however found no significant difference between the two cell-lines  (Kereszturi,  Kiraly,  Barta,  Molnar,  Sasvari-Szekely,  &  Caspo,  2006).    An  up-  or down-regulation  of  receptors  may  affect  personality  more  than  a  change  in  protein structure  (Seamen,  Fisher,  Chang,  &  Kidd,  1999),  this  theory  is  based  on  the  higher density (six-fold) of D4 receptors in the brains of schizophrenics post-mortem (Seeman, Guan,  &  Van  Tol,  1993).    The  density  of  receptors  is  a  function  of  regulation,  for example an up-regulation of a gene that translates receptor proteins may result in more receptors.  The ?521 polymorphism occurs in the 5?(upstream) promoter region of the gene,  and  while  upstream  SNPs  do  not  alter  the  protein  itself,  they  may  change expression  levels  (or  regulation)  of  receptors,  which  can  have  major  consequences  in neuromodulation (Cordell and Clayton, 2005).   A meta-analysis of studies that have investigated the ?521 C/T polymorphism in association with novelty-seeking found a small to medium effect size of .32 for the SNP (See (*) in Table 3) (Schinka et al., 2002).  A more recent meta-analysis that included studies  on  extraversion  and  novelty  seeking  combined  (totalling  11  studies),  found  a statistically significant effect size of 0.25 and suggested the -521 C/T SNP accounts for up to 3% of phenotypic variance in these related personality traits (Munafo et al., 2008).  The  proportion  of  phenotypic  variance  accounted  for  by  the  ?521  C/T  appears  small, however  this  is  consistent  with  other  studies  that  have  reported  significant  effects (Cloninger,  1987;  Reuter  and  Hennig,  2005).    It  is  important  to  note  that sensation/novelty  seeking  are  complex  traits  that  are  influenced  by  a  combination  of numerous genes (and within these genes possibly numerous polymorphisms); in addition, environmental influences account for at least 40 % of the phenotypic variance.                                                        1 This refers to the rate at which the RNA molecules are derived from DNA. 14 The first polymorphism that was studied in association with novelty seeking is a repeated section of the third coding region of the gene, in which a variable number (2-11) of tandem repeats (VNTR) exist in humans (Van Tol, Wu, Guan, Ohara, Bunzow, Civelli, Kennedy,  Seeman,  Niznik,  &  Jovanovic,  1992).    Associations  were  found  between subjects carrying seven repeats and high novelty-seeking scores (Benjamin et al., 1996; Ebstein  et  al.,  1996),  although  replications  of  these  findings  have  been  inconsistent (reviewed  by  Kluger,  Siegfried,  &  Ebstein,  2002  and  Munafo  et  al.,  2008).    One hypothesis  suggested  that  variations  in  the  length  of  the  DRD4  gene  may  cause differences  in  G-protein  coupling  and  receptor  affinity  based  on  the  observation  that shorter  VNTR  forms  (<=<5  repeats)  showed  different  binding  patterns  with  dopamine antagonists  compared  to  the  longer  (>5  repeats)  VNTR  forms  (Van  Tol  et  al.,  1992).  Further attempts to characterize the functional differences between VNTR forms found only  small  differences  in  binding  profiles  between  antagonists  and  variants,  and  the influence  of  the  VNTR  may  only  be  minor  (Asghari,  Schoots,  van  Kaats,  Ohara, Jovanovic, Guan, Bunzow, Petronis, & Van Tol, 1994).   Weak  associations  with  novelty  seeking  between  both  the  VNTR  and  the polymorphism  at  ?521  have  been  found,  but  the  strength  of  the  associations  is  not sufficient  to  explain  the  total  variance  due  to  genetics  based  on  twin  studies  (Noble, Ozkaragoz, Ritchie, Zhang, Belin, & Sparkes, 1998).  Likely, multiple genetic variations (and a combination thereof) are responsible for contributing to the novelty-seeking trait (Golimbet et al., 2005),  and the same may be true of the sensation-seeking trait.  The alleles  of  the  two  aforementioned  polymorphisms  have  been  found  to  exist  in  linkage disequilibrium in some (Ekelund et al., 1999; Strobel et al., 2002) but not all (Jonsson et al.,  2002)  studies.    Linkage  disequilibrium  (LD)  occurs  because  proximally  located variations  have  a  low  probability  of  being  separated  during  DNA  recombination  and therefore  a  high  probability  of  being  inherited  together  (Bouchard,  Blair,  &  Haskell, 2007).    Inconsistent  replications  of  dopamine-receptor  associations  may  have  occurred because  the  VNTR  polymorphism  may  not  directly  influence  novelty  and  sensation seeking,  but  may  be  in  linkage  disequilibrium  with  another  polymorphism  (e.g.  ?521 C/T) in the gene that may contribute to the sensation-seeking trait.    15 This study will be the first to correlate sensation-seeking behaviours to genetics in a  specific  athletic  population.      Although  candidate-gene  association  studies  do  not provide causal evidence, they provide a foundation (e.g. physiological pathways) for an experimental design that may lead to evidence for a cause-effect relationship.  Genetic associations  studies  are  important  for  demonstrating  how  specific  genetic  variations contribute to human characteristics (Cordell and Clayton, 2005).  Previous research has identified polymorphisms (VNTR and ?521 C/T) that may predispose  an individual to novelty-seeking  behaviours;  however  research  has  focused  on  drug  addicts, schizophrenics or general (predominantly male) populations.     Justification for research The discovery of a  genetic predisposition to the seeking of novel, thrilling  and adventurous behaviour is important, because these individuals are often associated with other  deviant  behaviours  including  drug  abuse,  gambling,  risky  sexual  practices  and reckless driving (Zuckerman, 2000).  With an understanding of the genetic influence on behaviours educators may target such individuals early, encouraging them to participate in thrilling sports as a diversion from other risky behaviour.   Previous  studies  have  measured  personality  traits  using  questionnaires  that measure  personality  traits  across  all  situations.    A  context-specific  sensation-seeking questionnaire was created because it may be interesting to test whether global sensation-seeking  measures  relate  to  specific  behaviours  in  a  high-risk  sport  and  this  new questionnaire  may  provide  an  additional  means  of  phenotype  identification.  Neurotransmitters  such  as  dopamine  are  hypothesized  to  govern  particular  reactive behaviours (Zuckerman, 2000) and specific behaviours, as opposed to global traits, may be more directly linked to physiological variations.     Further research into the genetic determinants of sensation-seeking behaviour is needed based on both the highly polymorphic nature of the DRD4 gene and twin studies that  have  suggested  large  genetic  influences  over  the  sensation-seeking  construct.  Numerous  polymorphisms  within  the  DRD4  gene  have  been  identified;  however, previous  studies  have  focused  on  related  traits  including  novelty  seeking  and extraversion, and have not explored the genetics of the sensation-seeking trait.   16 PURPOSE The purpose of this study was to determine whether an association exists between the  upstream  polymorphism  at  position  ?521  C/T  in  the  DRD4  gene  and  sensation seeking in skiers and snowboarders.   RESEARCH QUESTIONS  1)  Are ski-specific sensation-seeking behaviours associated with ZKPQ global sensation-seeking scores? 2)  Is there an association between genetics and sensation-seeking levels among high-risk sport participants? HYPOTHESES Main effects hypotheses for the study include: 1.  High  scores  on  the  ZKPQ  sensation  seeking  subscale will  correlate  moderately with high scores on the ski-specific behaviour questionnaire (CSSQ-S). 2.  Having a C/C genotype at position -521 will be associated with higher scores for sensation seeking. a.  Overall,  there  will  be  a  higher  proportion  of  skiers/snowboarders  who report  high  sensation  seeking  qualities  compared  with  a  general population. b.  The frequency of the ?C? allele will be higher in the population of skiers and  snowboarders  when  compared  to  the  background  frequency  of  the general population.  Interaction hypothesis: Previous studies have shown a greater variance explained by genetics (as opposed to environment) in females (Bookman et al., 2002; Stoel et al., 2006).  The presence of a C/C genotype may have a stronger influence on the sensation-seeking levels of females, resulting in a stronger association in females. 17 METHODOLOGY Overview This was a candidate-gene association study between the alleles of the ?521 C/T single  nucleotide  polymorphism  and  the  sensation-seeking  personality  trait.    Global sensation seeking was measured using the ZKPQ, and context-specific sensation-seeking for  skiing  was  measured  using  the  CSSQ-S.    Factor  analysis  of  the  CSSQ-S  was employed and the degree of association between the two sensation-seeking questionnaires was measured before the genetic association analysis was carried out.   Questionnaire development A ski/snowboard-specific sensation-seeking questionnaire was developed for the purpose of this study. A focus group (N = 4) of male and female, advanced and expert skiers  and  snowboarders,  ages  25-29  were  interviewed  to  create  a  list  of  ?risky?  and sensation-seeking behaviours specific to skiing and snowboarding.  The definition for the sensation-seeking trait according to Zuckerman (1979) was read to the group members and  they  were  asked  to  discuss  what  behaviours  in  skiing  or  snowboarding  might  be carried  out  by  high-sensation  seekers.    The  list  initially  contained  approximately  16 items.    Dr.  Mark  Beauchamp  (School  of  Human  Kinetics)  and  I  reviewed  the  list  and items  diverging  from  the  definition  for  sensation  seeking  along  with  redundant  items were removed, leaving 13 items in the first version of the ski-specific sensation-seeking questionnaire.  For the purpose of this thesis, the ski-specific questionnaire is referred to as the Contextual Sensation Seeking Questionnaire for Skiing (CSSQ-S).  Examples of the items in the CSSQ-S included, ?I like to ski fast? or ?I like to go down runs that I have never been down before?, scored using a Likert Scale as follows: strongly disagree (=1), disagree (=2), neutral (=3), agree (=4), and strongly agree (=5), indicating the extent to which the subject agreed or disagreed with each statement.  The full questionnaire is attached (Appendix A). The  validated  Zuckerman-Kuhlman  Personality  Questionnaire  was  chosen  for measuring  levels  of  global  sensation  seeking.    Permission  was  obtained  from  Dr. 18 Kuhlman, and he included the raw data and full questionnaire from a 1993 publication (Zuckerman et al., 1993) (Appendix B).     Ethical approval was obtained from the University of British Columbia Clinical Research  Ethics  Board  (CREB)  in  April  2007  and  data  collection  commenced immediately following (Appendix C). Subjects Intermediate  (and  more  experienced)  level  skiers  and  snowboarders  (N  =  201, average age = 27.1 years, SD = 4.8)2, 50 % of whom were women, were recruited from Whistler,  British  Columbia  and  Lake  Louise,  Alberta  ski  villages.    Posters  were  also displayed  around  UBC  campus,  at  Mountain  Equipment  Co-op  (a  large  Outdoor Recreation  Co-Operative  Franchise),  and  at  fitness  centres  around  Vancouver,  British Columbia.    Intermediate  ability  was  defined  as  being  able  to  ski  a  ?blue  square?  run comfortably.    For  the  ease  of  discussion  I  will  refer  to  the  sport  of  ?skiing?  as encompassing both skiing and snowboarding. Data collection Study packages were created to accommodate interested subjects who preferred to complete  the  process  on  their  own  time.    A  consistent  ordering  of  the  packages  was maintained as follows: consent form, the CSSQ-S (with participant demographics at the beginning),  ZKPQ,  a  consent  that  explained  the  peer  review  process,  a  peer  review questionnaire,  and  finally  an  envelope  that  contained  a  swab  for  DNA  sampling (Appendices D, E, F).  Each portion of the study package is described in detail below.  In cases  where  the  subject  was  able  to  complete  the  questionnaire  at  recruitment  time,  I administered the package in the same order, and offered only an explanation about how to effectively  swab  the  cheek  to  obtain  cells  for  DNA.    Numerous  study  packages  were handed out with self-addressed stamps, however approximately 30% were not returned.                                                   2 The ages were based on age groups (e.g. 19-24 yrs), non-continuous variables.  19 Questionnaire component The subjects filled out two questionnaires, and a peer of the subject (if available) was invited to fill out a third party questionnaire (a consensual validity check).  The first, the Contextual Sensation Seeking Questionnaire for Skiing, CSSQ-S, was a measure of ?context-specific?  sensation  seeking  in  skiing  or  snowboarding  that  included  the dimension  of  risk-taking  (Appendix  A).    This  questionnaire  also  included  a  brief demographic  section  about  the  subject,  including  age,  sex,  race,  level  of  ability  and frequency  of  sporting  activity.    Race  categories  were  included  because  frequencies  of genetic  variants  differ  between  populations  (based  on  HapMap3).    There  were  13 questions  to  gauge  sensation-seeking  behaviour  in  skiing  and  snowboarding,  answered using a Likert scale from 1 to 5.  Questionnaire development is described above.   The  second  questionnaire  is  a  standardized  personality  questionnaire,  the Zuckerman-Kuhlman  Personality  Questionnaire  that  assesses  five  subscales  of personality  (Zuckerman,  1993)  (Appendix  B).    These  include  impulsive-sensation-seeking, aggression/hostility, sociability, neurotism/anxiety, and activity.  The impulsive-sensation-seeking (ImpSS) subscale was our ?global? measure for sensation-seeking (as opposed to the ?contextual? measure from the CSSQ-S).  The ZKPQ inventory includes 99  true  or  false  statements,  and  there  are  19  items  in  the  ImpSS  subscale.    A  sixth subscale, the infrequency scale, includes items that are socially desirable, but are unlikely to be true for anyone (e.g. a high infrequency score would be suspect).   Consensual validity check   In an attempt to maintain high consensual validity (which would contribute to the internal  validity  of  the  design  (Goma-i-Freixanet,  Wismeijer,  &  Valero,  2005),  the subject was given the option to have a peer fill out the ski-specific questionnaire about his/her behaviour on the slopes.  The measurement of personality traits via questionnaires such as the ZKPQ and CSSQ-S are based on self-report, and the inclusion of a third party allows for the accuracy of the subjects? responses to be verified (Goma-i-Freixanet et al., 2005).  It was not, however, an essential component and when it was not possible to find                                                  3 HapMap is an online database of SNPs in linkage disequilibrium. 20 a  peer  who  had  frequently  skied  with  the  individual,  this  was  not  included  in  the evaluation.  Discrepancies between the CSSQ-S and the peer review were evaluated using a one-way ANOVA between subject-item scores and peer-item scores. Genetics DNA sampling After  completing  the  questionnaires,  the  subjects  provided  buccal  (cheek  cell) samples by brushing the inside of their mouths with a ?cytobrush? (Medscand Medical AB,  Sweden).    The  samples  were  stored  in  paper  envelopes  at  room  temperature, allowing them to air dry, and were then frozen at -20?C for longer-term storage.   DNA isolation DNA  from  cheek  cells  was  isolated  from  the  cytobrushes  using  techniques described  by  Saftlas,  Waldschmidt,  Logsden-Sackett,  Triche,  &  Field,  (2004).    The brushes were incubated at 55?C overnight (at least 8 hrs) in a 700 ?L mixture of lysis buffer  (Recipes,  Appendix  G)  and  proteinease  K  (.11  mg/mL)  to  breakdown  cellular proteins  and  remove  the  cells  from  the  bristles.    After  incubation,  the  tubes  were centrifuged for 2 minutes at 15 900 g at 4 ?C.  The brushes were discarded, and RNAse (.03 mg/mL) was added to the supernatant which was then incubated for 60 minutes at 55?C to denature RNA.  320 ?L of 5M potassium acetate precipitation buffer (KOAc) was added and the tubes were stored on ice for 10 minutes and then centrifuged (15 900 g) for 5 minutes.  The supernatants were transferred to new tubes and the pellets that had precipitated  out  of  solution  were  discarded.    Glycogen  (.025  mg/mL)  and  510  ?L  of isopropanol were added to the solution and the tubes were stored on ice for 20 minutes, glycogen  acts  as  a  DNA  carrier  to  pull  the  DNA  out  of  solution  (as  described  in  the Invitrogen Catalogue, 2008).  The tubes were centrifuged (15 900 g) for 10 minutes and the supernatants were discarded leaving DNA pellets.  The DNA pellets were rinsed with a 70% ethanol (200 ?L) followed by a 1 minute centrifuge to remove remaining salts.  The ethanol was carefully discarded from each tube and the DNA pellets were air dried and re-suspended in 90 ?L TE buffer (10 mM Tris/Cl, 1 mM EDTA pH 8.0) for future use.   21 DNA quantification The concentration of buccal DNA was analyzed using a spectrophotometer.  The machine  was  calibrated  to  zero  absorbance  using  samples  of  distilled  water  and  TE buffer.    The  absorbance  of  a  1  ?L  aliquot  of  each  sample  was  analyzed  at  two wavelengths (260 nm and 280 nm) and the concentration of DNA was calculated based on the constant: 1 OD (optic distance) = 50 ug/mL of DNA.    Genotyping by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) DNA  was  amplified  using  primers  specific  to  the  DRD4  gene  based  on procedures  used  by  Okuyama  et  al.,  (2000)  with  modifications  described  below, including  the  use  of  Taq  DNA  polymerase  (Invitrogen,  California)    instead  of  Pfu polymerase.  Primers were chosen to match the genetic sequence surrounding the ?521 C/T polymorphism.  Forward and reverse primers were chosen based on the literature and the DNA sequence data in HapMap.  Once the optimal PCR conditions were established and the primer pair successfully amplified the correct region of the gene the following primer pair was used for the majority of the analyses: the forward primer, F3, 5? - CGG GGG CTG AGG GCC AGA GGC T ?3? (Tm = 70.5?C), and the reverse primer, R3, 5? - GCA TCG ACG CCA GCG CCA TCC TAC C ? 3? (Tm = 67.5?C) (NAPS IDT, UBC, Vancouver).    These  two  primers  matched  primers  used  by  Okuyuma  and  colleagues (2000),  with  the  exception  of  three  base  pairs  within  the  forward  primer  (highlighted above), modified to match the  genomic sequence (according to Hap Map, rs1800955).  Polymorphisms  exist  at  these  three  loci  (Ronai,  Szantai,  Nemoda,  Lakatos,  Gervai, Guttman, & Sasvari-Szekely, 2004), which may explain the discrepancies between primer pairs used in various studies.  Two other primers, F4/R4 were used to amplify a portion of the samples prior to the optimizing of the F3/R3 pair.  F4 (5? ? AGG ATC AAC TGT GCA ACG GGT ? 3?, Tm = 59.2 ?C) and R4 (5? ? AGA CGC AGA AAG ACC TGA GC ?  3?,  Tm  =  57.2  ?C)  were  created  based  on  the  genetic  sequence  (NAPS  IDT,  UBC, Vancouver).  Since the F3 pair was used for the majority of the analysis, the optimizing conditions for F3 are included in this section, please refer to Appendix H for details on F4/R4.   22 The  optimal  PCR  condition  started  with  a  high  heat  treatment  for  a  longer duration to denature the GC-rich DNA strand.  The final PCR cycled as follows: 98?C for 2 minutes, followed by 39 cycles of 96?C for 45s, 62?C for 45s and 72?C for 2 minutes, finally a chase for 10 minutes at 72?C.  The 25 ?L reactions contained 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.8 mM MgCl2, 0.2 ?M dNTP, 0.6 ?M of each primer, 1 U Taq, and 1.0 ?L DNA template (approximately 20 ng/?L). Identification of ?521 C/T genotypes was based on the restriction fragment length polymorphism (RFLP) technique.  PCR products were digested using FspI (recognition sequence: 5? TGCtriagupGCA 3?) restriction endonuclease (New England Biolabs, Beverly, MA,  USA)  in  order  to  identify  the  alleles  at  -521.    The  restriction  enzyme  acts  as  a diagnostic tool, FspI cuts if a ?T? allele is present, and does not cut the site if ?C? allele is present.  The result is two products that differ in length (176 base pairs (bp) for T, 285 base pairs for C), see Figure 5.  FspI (50 U/mL) was mixed with 8 ?L of PCR products, 2 ?L NE Buffer 4 (see recipe in Appendix G) and water to a total volume of 20 ?L which was incubated at 37?C for at least 5 hours and as long as 16 hours.     Figure 4:  The -521 C/T genotypes shown in a UV-light photograph. A single band just below the 300 bp marker represents an un-cut C/C genotype; a single band below the 200 bp marker represents two cleaved strands of DNA, or a T/T homozygote; and finally two lines denote a heterozygote genotype, C/T, with one strand that has been cleaved. C/C  T/T  C/T 100 bp marker 285 bp 176 bp 300  200  23 Gel electrophoresis PCR  products  were  separated  by  polyacrylamide  gel  electrophoresis  (PAGE).   PAGE gels that were 8% Acrylamide/Bis (see Appendix G for recipe) were inserted in a BioRad vertical gel electrophoresis chamber and the chamber was filled with tris-borate EDTA buffer (1 x TBE, see Appendix G).  The standard running time for the gels was 45 minutes  at  120  volts.    PCR  (8  ?L)  or  digestion  products  (20  ?L)  were  loaded  into individual  wells  using  approximately  1  ?L  Bromphenol  Blue  loading  buffer  (30% glycerol, 10% TE).  After electrophoresis, the gels were soaked in a dilute solution of ethidium  bromide  (~0.5  ?g/mL)  to  stain  the  PCR  products.    The  DNA  bands  were visualized using ultra-violet light and the gels were digitally photographed with a Cannon Power Shot A620 with Canon LA-DC58F Lens adapter. The size of the DNA bands were determined based on their location in the gel compared to a standard 100 bp reference ladder (Invitrogen, California).  The size of the uncut band amplified using F3/R3 primers was 285 bp (see Figure 5).   Genotyping by pyrosequencing In  a  final  attempt  to  optimize  the  amplification  of  the  GC-rich  region  that surrounds -521 C/T, the pyrosequencing technique was employed.  Primers were chosen using  the  Biotage  AB  PSQ  Assay  Design  Software  (Version  1.0.6,  USA):  forward primer, F1 pyro, 5? TAG GCG TCG GCG GTT GAG 3?; reverse primer, R1 pyro, 5? GAC TCG CCT CGA CCT CGT G 3?; and sequencing primer, S1 pyro 5? TCG GGG GCA GGG GGA 3?.  The amplified region of the DRD4 gene (amplicon) was 82 base pairs in length.  Primers were HPLC purified and the reverse primer was biotinylated at the 5? end (NAPS IDT, UBC, Vancouver).   Sequencing for pyrosequencing   Preliminary pyrosequencing data reported sequences that did not match sequence data (i.e. reporting numerous SNPs in the region) reported in the University of California Santa Cruz (UCSC) Genome Bioinformatics database for the upstream DRD4 region.  In order to minimize pyrosequencing errors, PCR products were sent away for sequencing.  Three DNA templates that had been identified by RFLP as C/C, C/T and TT respectively 24 were amplified  with the pyro-primers.   The PCR products were purified using Qiagen QIAquik  PCR  Purification  Kit  (Qiagen  Sciences,  Maryland)  and  analyzed  in  the CMMT/BCRI DNA Sequencing Core Facility (UBC, Vancouver).   PCR for pyrosequencing DNA  was  amplified  using  the  following  PCR  conditions:  95?C  for  5  minutes, followed by 49 cycles of 95?C for 20s, 60?C for 20s and 72?C for 20s, followed by a chase of 5 minutes at 72?C.  The 15 ?L reactions contained 20 mM Tris-HCl pH 8.4, 50 mM  KCl,  1.5  mM  MgCl2,  0.2  ?M  dNTP,  0.4  ?M  of  each  primer,  1  U  native  Taq polymerase (Invitrogen, California), and 1.0 ?L DNA (approximately 20 ng/?L). Pyrosequencing reactions   Single-stranded  biotinylated  PCR  products  were  prepared  for  sequencing  using the  Pyrosequencing  Vacuum  Prep  Tool  (Biotage  AB,  Uppsala,  Sweden)  (Zhou  et  al., 2006).  Two microlitres of streptavidin-coated sepharose beads (Biotage AB) was added to 38 ?L of binding buffer (Biotage AB) and 25 ?L of distilled water and was then mixed with  15  ?L  of  PCR  product  for  approximately  20  minutes  using  a  Labnet  Orbit  P2 Shaker.  The beads bound to the PCR products which then adhered to the vacuum filter probes.  The vacuum was washed for 5 s each in 70% ethanol, followed by a denaturation solution (0.2 M NaOH), and finally a washing buffer (10 mM Tris-acetate).  The vacuum was then disabled, and the beads were released from the individual probes into a PSQ HS 96 Plate (Biotage AB) containing a solution of 0.4 ?M sequencing primer (S1 pyro) and 19.2 ?L annealing buffer (Biotage AB) per 20 ?L reaction. The PSQ 96 SNP Reagent Kit (Biotage AB) containing 182 ?L enzyme, 182 ?L substrate and a solution of each nucleotide (volumes based on the software instructions once the amplicon sequence data was entered into the PyroQ SNP computer program) were  dispensed  into  the  PSQ  96  plate.    The  following  sequence  was  inputted  into  the PyroQ  SNP  software:  5?  GCGGGCGNGGAGGGYG  3?.    Previous  data  suggested  the presence of a SNP six nucleotides up-stream from the ?521 C/T SNP, therefore when the sequence primer reached ?N?, the machine dispensed one of each A, C, T, G.  At the SNP site of interest (-521) ?Y?, a C and a T was dispensed.  The PyroMark MD dispensed the nucleotides  in  the  following  order,  beginning  the  sequence  with  a  random  base  (T), 25 TGCGCGACTGAGATC.    Sample  genotypes  were  determined  using  SNP  Software (Biotage AB).   STATISTICAL ANALYSIS Phase I: Exploratory factor analysis and validation of CSSQ-S An  exploratory  factor  analysis  of  the  CSSQ-S  was  performed  using  SPSS Graduate  Student  Version  16.0  to  determine  whether  all  of  the  items  (1  through  13) measured the same facet of personality (contextual sensation-seeking for skiing), and to determine the amount of variance accounted for by the factor(s).  I chose an exploratory factor  analysis  (instead  of  a  confirmatory  FA)  because  it  is  a  tool  for  generating hypotheses  about  relationships  in  the  data  set,  and  is  often  used  in  the early  stages  of research  (Tabachnick  and  Fidell,  1983).    The  sample  size  for  the  proposed  study  was smaller than ideal for factor analysis, but over 200 samples is considered a ?fair? sample size (Tabachnick and Fidell, 1996).  Questions showing up as outliers after factor analysis were discarded from further analyses.  Internal consistency measures, Cronbach alphas, were calculated to provide one measure of reliability.   Behaviour and personality  The second portion of Phase I involved comparing the CSSQ-S results against the ZKPQ ImpSS scores.  Pearson?s Correlation (r) was calculated to measure the association (if  one  exists)  between  global  sensation  seeking  and  contextual  sensation-seeking behaviours.  Phase II: Personality and -521 C/T polymorphism The  personality  variables  (CSSQ-S  and  ZKPQ  ImpSS)  have  continuous outcomes, therefore the data was analyzed using a blocked one-way analysis of variance (ANOVA) (based on recommendations by Balding, 2006).  Sex was a blocking variable since  studies  have  suggested  that  the  genetic  influence  on  traits  related  to  sensation seeking, such as novelty seeking and extraversion, is stronger in females (Bookman et al., 2002; Ronai et al., 2002; Ono et al., 1997).  Using the ANOVA method decreased the 26 number  of  tests  of  significance,  measuring  subscales  and  genotype  frequencies simultaneously, thereby eliminating the need for multiple testing corrections.   27 RESULTS   Subjects   A total of 201 subjects were included in the study.  Table 4 lists the descriptive statistics for the variables of interest.  Table 4:  A summary of participant statistics.     NTot  Genotype  Ngene  Total ImpSS  NSS  CSSQ  NCSSQ Males  101  CC CT TT 14 14 10 12.84 ? 3.30  98  3.83 ? .56  100 Females  100  CC CT TT 15 14 7 10.80 ? 4.66  97  3.05 ? .70  100 Note: CSSQ scores are post-factor analysis (10-item score).  The number of participants (N) is included for each stage of the analysis.   Phase I: Factor analysis and validation of CSSQ-S The  CSSQ-S4  was  examined  for  accuracy  of  data  entry,  missing  values  and outliers  before  employing  the  factor  analysis.    One  case  (033)  was  excluded  from  the factor analysis (FA) because 10 out of 13 scores were missing.  Two other cases (236 and 193) had two and three missing data points respectively, which appeared to be random.  The missing data points were replaced with the average value based on the other 10 or 11 responses on the questionnaire.  This method is considered a conservative approach to dealing  with  missing  data  since  the  mean  for  the  distribution  remains  the  same (Tabachnick and Fidell, 1983).     Based  on  Mahalanobis  distance  (p  <  .001),  no  cases  were  identified  as multivariate  outliers  for  the  CSSQ-S  in  combination  with  the  ImpSS  ZKPQ  subscale (Tabachnick and Fidell, 1983).  Linearity was confirmed by examining a simple bivariate scatterplot  between  the  total  CSSQ-S  score  and  the  ImpSS  subscale  from  the  ZKPQ (Appendix I).    Finally,  the  CSSQ-S  continuous  variables  were  screened  for  normality.    Both skewness  and  kurtosis  of  each  variable  was  examined  (zcritical  =  ?2.58,  p  <  .01)  to                                                  4 Recall: CSSQ-S is the contextual sensation-seeking questionnaire developed for a ski population. 28 determine the normality of the data set.  This procedure indicated that the CSSQ-S scores were normally distributed (See Appendix J).   Exploratory factor analysis (FA) of CSSQ-S Maximum  likelihood  (ML)  extraction  and  varimax  rotation  were  performed  on the 13-item CSSQ-S using SPSS 16.0 statistical software.  The items had been previously screened for missing data, outliers, linearity and normality.   Factor analysis is a statistical method often used to determine the number of factors assessed by a questionnaire, in this case the newly developed CSSQ-S.  A varimax rotation was chosen because it maximizes the variance of the items within each factor (Tabachnick and Fidell, 1983).   The minimum criterion for a factor to be meaningful was set at an eigenvalue5 greater than 1, which is convention (Tabachnick and Fidell, 1983).  Each factor loading represents  the  amount  of  variance  shared  with  the  overall  factor,  a  criteria  of  .30 represents  a  9%  overlap  of  variance  and  is  often  used  as  the  inclusion  minimum (Tabachnick and Fidell, 1983), however since the study sample was smaller than ideal, a more conservative cut-off value of .40 (representing a 15% overlap) was used for factor loadings.   Two factors with eigenvalues greater than 1 were extracted from the exploratory FA, lambda1 = 4.38 and lambda2 = 1.78, accounting for 33.67% and 13.67% respectively of the total explained  variance.    The  scree  test  was  also  used  to  provide  a  visual  estimate  of  the number  of  factors  (Appendix  K).    Loadings  of  variables  on  factors  1  and  2, communalities and percents of variance are shown in Appendix L.    Two items loaded strongly with Factor 2, which will be named ?etiquette? (.666 and .984), while the other 10 items loaded onto Factor 1 ?contextual sensation seeking? (factor loading range from .530  to  .731)  (Appendix  L).    Factor  1  accounted  for  a  greater  proportion  of  the  total variance compared to Factor 2. One item (Q13, ?If I see a ?danger of avalanche? sign I will  usually  try  to  find  another  safer  route?)  was  omitted  from  analysis  because  its loading after rotation was less than .40.  The two items that were selected for deletion due to high loadings on the factor 2 (etiquette) were Q11 and Q12 on the questionnaire (?I                                                  5 Eigenvalues are algebraic transformation variables that represent the variance accounted for by each factor (for more information, see Tabachnik and Fidell, 1983).   29 slow down on busy  runs?, and ?I don?t slow down on busy  runs, instead  I just dodge people?).  The final questionnaire consisted of 10 items measuring a single factor, namely ?contextual  sensation  seeking?.    Factor  analysis  of  the  10-item  questionnaire  was employed to confirm that the questionnaire measured a single factor (contextual sensation seeking) and to determine the amount of variance accounted for by the factor.  The factor matrix for the 10-item questionnaire is shown below in Table 5.  Variables are ordered by the size of loading to facilitate interpretation and loadings under .4 were omitted.  One eigenvalue, 5.010 accounted for 50.096% of the variance (Scree plot shown in Appendix M).  The factor loadings for the 10 items in the questionnaire ranged from .539 to .786.  Table 5:  Factor analysis of 10-item CSSQ-S: factor loadings, alpha, variances. CSSQ-S Item  Factor 1*  Communalities Q6 Push limits  .786  .618 Q4 Out of bounds  .750  .562 Q9 Novelty  .745  .555 Q1 Speed  .707  .499 Q10 Cliff jump  .689  .475 Q8 Straight line  .651  .424 Q2 Explore  .630  .397 Q7 Lose control  .577  .333 Q3 Unknown  .562  .316 Q5 Quality of jump  .539  .290      Eigenvalue  5.010   % variance  50.096   *Factor 1 represents contextual sensation seeking.  Factor loadings are shown after three items (Q11, 12, 13) were removed from the questionnaire. Internal consistency The  Cronbach  alpha  was  used  to  measure  the  internal  consistency  of  the questionnaires.  The 10-item CSSQ-S had an alpha of .882.  This reflects a very high internal  consistency  (Clark  and  Watson,  1995)  indicating  that  each  item  in  the  scale measured  the  same  facet  of  personality  (contextual  sensation-seeking  in  skiing  and snowboarding).  The mean inter-item correlation was .442 (range .279 to .641) and the mean inter-item covariance was .491 (.218 to 1.02).  Overall item mean was 3.44 out of a maximum score of 5 (individual item means listed in Appendix J). 30 Consensual validity check   Out of the 201 samples collected, a peer review supplemented 62 samples.  The responses  to  all  of  the  items  on  the  CSSQ-S  peer  version  were  compared  against  the participant  CSSQ-S  using  a  one-way  ANOVA.    There  was  no  significant  difference between the peer versions and the participant CSSQ (p>.05) (Appendix N).   Correlation of CSSQ-S and ZKPQ The two measures of sensation seeking were screened for outliers, normality and linearity (See Appendix I, J, and P).  Both the CSSQ and the ZKPQ satisfied all of the assumptions required for a correlation analysis.  Pearson?s correlation coefficient between the two sensation seeking scales was calculated using SPSS and revealed a significant association between the measures of global (ZKPQ ImpSS) and context-specific (CSSQ-S) sensation seeking (r2 = .506, p < .001) (Appendix O).   Phase II: Personality and the -521 C/T polymorphism Personality questionnaire: ZKPQ data The ZKPQ was examined for accuracy of data entry, missing values and outliers using SPSS before the  genetic  association analysis was carried out.   The missing data from  the  ImpSS  subscale  was  substituted  with  mean  values,  however  a  modified approach was required since the responses were dichotomous and the total score was a tally of points rather than an average.  Specifically, the total ImpSS score was divided by the maximum score for the individual and this value was inserted in place of the missing value.    The  data  were  also  screened  for  outliers  using  Mahalanobis  distance  detailed above (prior to FA of CSSQ-S).  The assumptions of linearity and normality were met (Appendix P).   The  infrequency  scale  is  the  sixth  subscale  of  the  ZKPQ.    It,  in  itself  is  not  a separate factor, but a way of eliminating subjects.  The items comprising the infrequency scale  are  exaggerated  or  socially  desirable,  but  unlikely  to  be  true  for  anyone.    In Zuckerman?s questionnaire validation, only 4% of subjects scored higher than 3 on the scale (three true responses), and therefore this was set as the cut-off in a previous study (Zuckerman et al., 1993).  In the current sample, 26% of subjects scored 3 or higher and 31 13% scored 4 or higher.  This high number of infrequency scores prompted a closer look into  the  items.    One  item  ?No  matter  how  hot  or  cold  it  gets,  I  am  always  quite comfortable? may be biased in this group of skiers who may have a tolerance to extreme temperatures due their choice of sport.  Upon eliminating this item from the infrequency scale, the high scorers (greater than 3) dropped to 6% (or 12 subjects).  Further, another question on the scale ?I never get lost, even in unfamiliar places? had a high response rate, 41 individuals (20%) answered true (scoring a point on the infrequency scale).  With such a high response rate, this item does not fit the criteria for an infrequency item in this particular population, thus the item was removed.  After modifying the infrequency items, 3% (N = 6)6 of the ski population scored higher than 3 and therefore were removed from the analysis.  In  accordance  with  the  hypothesis  that  skiers  and  snowboarders  would  exhibit higher levels of sensation seeking than the general population, the population of skiers and snowboarders displayed significantly higher impulsive sensation-seeking scores.  The mean ImpSS score for skiers was 11.82 (SD = 4.15) out of a maximum of 19, which was significantly different than ?norms? described elsewhere (mean = 10.18, SD = 4.10, N = 2969) (Zuckerman et al., 1993), t = 5.47, p < .01 (df = 3167).  Consistent with previous studies, males score significantly (tobs = 3.51, p<.01) higher than females (Table 6).  The distribution of scores in the ImpSS for males and females is shown in Appendix Q.    Table 6:  Means and standard deviations for males and females scores on the Zuckerman Kuhlman Personality Questionnaire (ZKPQ).   Males (N=98)  Females (N=97) ZKPQ  Mean  SD  Mean  SD ImpSS  12.84  3.30  10.80  4.66 Agg-Hos  7.08  3.17  6.46  3.20 Neu-Anx  4.40  3.42  7.63  4.14 Soc  8.42  3.39  9.78  3.58 Activity  9.79  3.56  10.16  3.57     Note: The cases with high infrequency scores have been removed at this stage of the analysis.                                                  6  The cases that were removed from further analyses using ZKPQ were 024, 044, 106, 208, 287, and 332. 32 Genetic data   The  concentrations  of  175  DNA  templates  were  measured  using spectrophotometry  because  there  was  large  variability  between  samples.    The  average concentration was 21.3 ng/?L (? 22.4 ng/?L).   Polymerase chain reaction (PCR) Using  the  PCR  and  RFLP  methods,  the  ?521  C/T  SNP  genotypes  of  as  many individuals as possible were confirmed.  The DNA of all 201 subjects was isolated and PCR was attempted, however a total of only 59 subjects? genotypes were confirmed via the PCR RFLP method (a representative photograph depicting digested PCR products is shown in Appendix R).  A summary table in Appendix S includes genotypes, CSSQ-S scores and ZKPQ ImpSS scores of the individuals whose DNA successfully amplified by either the pyrosequencing and/or RFLP methods (total N = 74). DRD4 sequencing Sequence data for the 82 bp amplicon using the pyrosequencing primers is shown in  Appendix  T.    The  sequence  was  consistent  with  some  of  the  literature,  although additional SNPs reported by the UCSC genome informatics centre did not appear in any of the samples.  The ancestral alleles were therefore used for pyrosequencing (with the exception of the -521 C/T SNP and a SNP at -515).   Pyrosequencing DRD4 -521 C/T    A total of 25 genotypes were confirmed using pyrosequencing methods.  Ten of the  genotypes  had  already  been  identified  by  RFLP,  and  genotypes  identified  by  both methods were consistent.  A sample pyrosequencing result is attached in Appendix U.   Hardy-Weinberg equilibrium A Chi square test was used to compare observed allele frequencies with expected frequencies  to  verify  that  the  population  is  in  Hardy-Weinberg  equilibrium  (HWE), indicating the presence of random mating.  A HWE test may provide additional evidence for an association if our test population is not in equilibrium.  The allele frequencies for the sample of skiers and snowboarders were .58 C and .42 T.  The genotype frequencies 33 were  .39  C/C,  .38  C/T  and  .23  T/T.    The  observed  frequencies  were  compared  to  the expected frequencies resulting in a Chi square value of 3.67, this is slightly less than the critical value (chi2 = 3.84, df = 1, p = .05), therefore the population did not deviate from Hardy Weinberg Equilibrium. The allele frequencies for the ski population were not consistent with Caucasian population  data  (recall  Swedish  0.42  C:0.58  T  and  Russian  0.43  C:0.57  T,  Table  2).  Comparing the ski population in a 2x2 contingency table with the data from Jonsson and colleagues? (2002) Swedish population data (N = 368), a significant difference in allele frequencies between the two populations was found (p < .001) (Appendix V). One-way blocked ANOVA: ZKPQ and genetics    Using the statistical software Gpower7, the sample size N=201 for the group was large enough to detect an effect size of .30 (based on Schinka et al., 2002) at a power of .95 with alpha set at .05 using a one-way ANOVA with two levels.  Unfortunately, due to difficulties amplifying the DRD4 -521 C/T SNP, the sample size for the genetic analysis was reduced to N = 74.  This sample size had insufficient power (<.8) to detect a small effect  size,  nonetheless  genetic  data  was  analyzed  in  association  with  personality parameters. The sample (N = 74) was analyzed by one-way ANOVA with sex as the blocking variable and genotype as the independent fixed factor (2 levels), against the CSSQ and ImpSS scores (dependent).  The ANOVA assumptions were upheld and the personality scores  were  normally  distributed  (based  on  Q-Q  plots)  and  the  variances  were  not significantly  different  (Levene?s  test  for  homogeneity  of  variance,  p  >  .05  for  each dependent variable) (Balding, 2006).  A sample of the blocks of the ANOVA is shown in Appendix W.  The number of cases per block are not equal, however, because the ratio between blocks (i.e. female C/C genotype block N = 15, female C/T or T/T  genotype block N = 21) is close to 1.5, the type of sums of squares does not need to be modified (Stevens, 1999).  The default Type III sums of squares was therefore employed in the analysis.  Males and females were analyzed separately because it was hypothesized that                                                  7 An online statistical software that calculates power (http://www.psycho.uni-duesseldorf.de/abteilungen/aap/gpower3/) 34 the  relationship  between  genotype  and  sensation-seeking  scores  would  differ  between males and females.    The grouping of genotypes for the analysis was based both on the literature and an independent t-test between genotype scores in females.  A significant difference between the  CSSQ-S  means  for  the  C/C  genotype  compared  to  the  C/T  group  was  found  (t  = 3.418, df = 27, p = .002), whereas no significant difference was found between the mean scores of the C/T and T/T genotypes (t = 1.79, df = 19, p = .09).  The T allele was thus assigned dominance, and C/T and T/T genotypes were grouped together.   The sensation-seeking scores for males and females by genotype are summarized in Table 7.   Table 7:  A summary of sensation-seeking scores by genotype for males and females. Sex  Genotype  CSSQ-S score  ZKPQ ImpSS Males  C/C (n = 14)  3.89 (.63)  14.21(3.23)    C/T & T/T (n = 24)  3.75 (.48)  13.17 (3.27) Females  C/C (n = 15)  3.43 (.61)  12.73 (4.25)    C/T & T/T (n = 21)  2.83 (.60)  10.10(4.52)                                        ZKPQ and CSSQ-S results are given as mean raw scores (SD).  There were no significant differences in mean sensation-seeking scores  (ImpSS and  CSSQ-S)  between  genotype  groups  for  males  (pImpSS  =  .345,  pCSSQ-S  =  .473) (Appendix Y).  There was, however, a significant difference in sensation-seeking scores between genotypes for the females.  Females with C/C genotypes had significantly higher CSSQ-S  scores  than  females  with  C/T  or  T/T  genotypes  (p  =  .006)  (Table  7  and Appendix X).  The effect size of the relationship between genotype and CSSQ-S score in females was low to moderate (eta2 = .2).  A trend between genotype and ImpSS score was also observed in females, and although it was not significant (p = .086), the C/C group had higher scores than the C/T, T/T group (Table 7 and Appendix X).  Genotype had a small effect on ImpSS scale in females (eta2 = .08).  35 DISCUSSION   The primary purpose of this investigation was to determine whether an association exists between the alleles of the -521 C/T polymorphism of the dopamine-4 receptor and levels  of  sensation  seeking  in  skiers  and  snowboarders.    In  order  to  measure  the association  between  genetics  and  sensation  seeking,  the  CSSQ-S  was  developed  and validated to serve as a precise means of phenotype identification in addition to the global ZKPQ  ImpSS  scale.    Overall,  an  association  between  the  alleles  of  the  -521  C/T polymorphism and sensation-seeking was found in females, however no association was found in males.  Precise phenotype identification coupled with separate analyses by sex may have contributed to strength of the study design. Phenotype identification Following  Eisenberg  and  colleagues  (2007),  this  investigation  is  the  second  to analyze the sensation-seeking trait in association with a DRD4 polymorphism.  Previous studies  have  investigated  novelty  seeking  and  extraversion  in  relation  to  DRD4 polymorphisms and have resulted in inconsistent findings (reviewed by  Schinka et al., 2002 and Munafo et al., 2008).  Sensation seeking is highly related to novelty seeking (Zuckerman  and  Cloninger,  1996;  Zuckerman  and  Kuhlman,  2000),  however  novelty-seeking  does  not  describe  the  quality  of  sensations  that  are  sought  (e.g.  intense  and complex  sensations)  (Zuckerman,  2005).    Perhaps  certain  types  of  sensations  have  a greater effect on dopamine-mediated approach behaviours. Unsuccessful replications of genetic association studies may be attributable to the failure to identify the corresponding phenotype.  One great challenge of psycho-genetic studies  is  the  identification  of  precise  phenotypes,  since  inaccurate  phenotype classification  leads  to  incorrect  results  (Kreek  et  al.,  2005).    The  questionnaire  that measures novelty seeking, the TCI, has been criticized for having psychometric weakness including  low  internal  consistencies  and  heterogeneous  subscales  (Cloninger,  1987; Reuter and Hennig, 2005; Gana and Trouillet, 2003).  The psychometric weakness of the TCI  may  be  a  possible  explanation  for  inconsistent  replications  of  the  -521  C/T associations.   36 In order to measure the sensation-seeking trait, I employed the ZKPQ rather than the older SSS forms because the former contained more relevant (and current8) questions for  my  study  population.    ZKPQ  has  shown  high  content  and  construct  validity  in previous studies, meaning that the sensation-seeking subscale measures all facets of the trait  and  inferences  about  the  personality  trait  may  be  based  on  the  scores  obtained (Zuckerman et al., 1993).  Furthermore, the ZKPQ is a scale that has shown high retest reliability  (.82  to  .87,  retest  interval  =  2  months)  (Zuckerman  and  Kuhlman,  2000).  Retest  reliability  is  important  because  failures  to  find  associations  between  the  DRD4 gene and personality traits may have been due to the lack of uniformity employed when measuring the personality trait (Lusher, Chandler, & Ball, 2001).   In  summary,  sensation-seeking  was  measured  as  opposed  to  novelty  seeking, because the latter only describes a portion of the sensation-seeking concept (Zuckerman, 2005).    In  addition  to  the  ZKPQ,  a  new  questionnaire  (the  CSSQ-S)  that  measures specific  behaviours  associated  with  sensation  seeking  was  developed  to  provide  an additional means of phenotype identification.   Sensation-seeking personality and behaviours   A  main  objective  of  the  study  was  to  create  a  sport-specific  questionnaire  (the CSSQ-S)  that  measures  sensation-seeking  behaviours  in  skiers,  and  to  evaluate  how closely  it  relates  to  Zuckerman?s  impulsive  sensation-seeking  scale.    An  exploratory factor analysis of the CSSQ-S for the entire sample (N = 200) was employed and revealed a two-factor solution.   A total of three items were removed from the questionnaire based on the results of the  exploratory  factor  analysis.  One  of  the  items  was  deleted  because  of  inadequate loading (< .4), and the two other items loaded separately onto a second factor that was named ?etiquette?.  The two items from factor 2 selected for deletion were highly related (inter-item correlation = .71) and stated ?I slow down on busy runs? and ?I don?t slow down  on  busy  runs,  instead  I  just  dodge  people?.    Conceptually,  the  items  do  not represent the sensation-seeking definition, and appear to be a measure of ?etiquette? or                                                  8 An example of an out-dated item, ?I would like to meet some persons who are homosexuals? and an irrelevant item, ?I like some of the earthy body smells?. 37 ?courtesy?  instead.    The  item  that  failed  to  load  onto  either  factors  stated,  ?If  I  see  a ?danger of avalanche? sign  I will usually try to find another safer route?, which is not applicable to subjects who have never been in avalanche terrain, and therefore was not an appropriate question for this sample population.   A second factor analysis was employed to confirm the factor structure.  The factor analysis of the 10-item CSSQ-S revealed that all items loaded onto a single factor, that of ?contextual  sensation  seeking  in  skiing?.    Each  item  appeared  to  represent  a  different facet of the factor since the factor loadings were neither too high nor too low (.539 to .786).    In  scale  development  it  is  recommended  that  developers  strive  for  internal consistencies (measured by Cronbach alpha) of at least .80 (Clark and Watson, 1995).  The internal consistency of the CSSQ-S surpassed this criterion (alpha = .88).  A high internal consistency reveals that the questionnaire is measuring what it is supposed to measure, responders were consistent between items. High  scorers  on  the  ZKPQ  ImpSS  scale  in  general  exhibit  greater  sensation-seeking behaviours in the context of skiing (based on the CSSQ-S).  Global sensation seeking  and  contextual  sensation  seeking  are  related  (r2  =  .506),  which  confirms  the hypothesis of a moderate correlation between the two measures.  Conceptually, it makes sense that one would behave on the slopes similarly to how they would behave in life.  There  are  some  exceptions,  however,  that  may  influence  behaviour,  one  such  being ability.  For example, an intermediate skier may sky-dive and act without inhibitions in day-to-day  life,  but  lacks  the  ability  to  display  the  risk-taking,  sensation-seeking behaviours in the context of skiing.  For this reason, the current study excluded beginner skiers  which  may  have  contributed  to  the  strong  relationship  observed  between  ski behaviours and personality. Many studies have compared global sensation-seeking scores between high- and low-risk activities; however few studies have investigated the relationship between the sensation-seeking  personality  trait  and  context-specific  high-risk  behaviours.    More importantly,  the  creation  of  a  situation-specific  questionnaire  (CSSQ-S)  that  measures behaviours  associated  with  sensation  seeking  provides  more  precise  phenotype identification for this candidate gene association study.  38 DRD4 gene association The  higher  sensation-seeking  scores  in  skiers  compared  with  other  populations supports  previous  associations  that  high-sensation  seekers  often  involve  themselves  in high-risk activities (Bouter et al., 1988; Diehm and Armatas, 2004; Franken et al., 2006; Zuckerman, 2000).  The hypothesis that an over-representation of the C allele would be present in this study population, given that skiing is often considered a high-risk sport, was confirmed.  Compared with a Caucasian (Swedish) college population, the sample of skiers had a significantly higher frequency of -521 C alleles (chi2  = 11.8, p < .01).  The skiers  were  a  self-selected  (non-random)  population,  and  therefore  a  deviation  from Hardy Weinberg Equilibrium was expected, however possibly due to the small sample size (N = 74) the deviation was not significant (chi2observed = 3.67, chi2critical  = 3.84). Previously, the grouping of genotypes (i.e. assigning a dominant allele) has varied between studies.  In the current study, the T allele was assigned dominance based on the observation of a smaller difference in scores between the C/T and T/T genotypes.  The C/T and T/T genotypes were therefore combined into a single group.  In support of the interaction hypothesis, a stronger association between the  alleles of the -521 C/T SNP and  sensation-seeking  behaviours  (CCSQ-S  score)  in  skiing  (p  =  .006),  along  with  a similar trend in sensation-seeking personality scores (p = .086), was found in females.  Females having the C/C genotype displayed the highest sensation-seeking ski-behaviours compared to the C/T and T/T genotypes.  The presence of the C allele (in a homozygote) may have a stronger influence on the sensation-seeking levels of females over males.  It was  unanticipated  that  no  association  (nor  trend)  was  observed  in  the  male  study population (pCSSQ = .345, pImpSS  = .473).  These results prompt an interesting question: what are possible causes of these sex differences? Sex differences   Inconsistent  and  non-significant  findings  in  previous  DRD4  association  studies may be due to the fact that a small number of studies included only males (Ebstein et al., 1996; Okuyama et al., 2000; Benjamin et al., 1996).  Previous studies that have combined the  sexes  for  analysis  may  have  missed  the  relationship  between  genetics  and  the novelty/sensation-seeking trait in females, which may have a stronger genetic basis than 39 in  males  (Stoel  et  al.,  2006).    Furthermore,  previous  studies  that  have  included  only females, or carried out separate analyses, found associations between novelty seeking and extraversion and the alleles of the -521 C/T polymorphism (Bookman et al., 2002; Lee et al., 2003; Ronai et al., 2001).  Sex may therefore be an important independent factor to consider  when  designing  the  statistical  analysis  of  behavioural-genetic  association studies.   In  the  current  study  females  scored  significantly  lower  (Mfemales=  10.80,  tobs  = 3.51, p < .01) than males (Mmales= 12.84) on the ImpSS scale and on the CSSQ-S scale (Mfemale  = 3.05(.7), Mmales= 3.83(.6), tobs = 8.7), and this is consistent with results from other  studies  (Zuckerman  and  Kuhlman,  2000;  Zuckerman  et  al.,  1993).    From  an evolutionary perspective, lower levels of risky behaviours exhibited by females may be in part due to the distinct biological roles males and females play (Zuckerman, 2000).  A lower score for females is not surprising given that behaviours associated with sensation seeking may threaten the survival of progeny.  Inherently, females are required to invest in  the  long-term  care  of  their  children  and  therefore  need  to  stay  alive  by  using  risk-avoidance  strategies.    Males,  on  the  other  hand,  are  only  needed  for  conception  and therefore benefit from carrying out risky behaviours that lead to increased propagation and genetic diversity through exploration (Zuckerman, 2000; Zuckerman and Kuhlman, 2000).      Although evolution and genetics play an important role in the sensation-seeking trait, the other factors that influence personality must not be overlooked and may provide insight as to why an association was found in women and not in men.  Humans are social beings,  and  therefore  the  environment  plays  a  substantial  role  in  personality  traits, possibly more so for males according to a twin study by Stoel and colleagues (2006).  All of the variation in the sensation-seeking trait between female monozygotic twin-pairs and their  non-twin  siblings  was  attributable  to  genetics;  where  as  a  large  portion  of  the variability  in  the  male  twin/sibling  comparisons  was  environmental.    It  was  suggested that varied levels of sensation seeking in males is more a product of their environment than their genetic make-up (Stoel et al., 2006).  A conceivable explanation is that certain personality traits, such as impulsive sensation seeking, may be considered more socially desirable for one gender than the other.  Sensation seeking has been linked to more ?so-40 called?9 masculine interests and characteristics, and has been negatively associated with ?so-called? feminine interests (Kish, 1971; Daitzman and Zuckerman, 1980).  High levels of  sensation  seeking  in  males  may  be  considered  socially  desirable  because  it  further contributes to a stereotypical gender identity of masculinity.   Today,  activities  that  showcase  individuals  with  the  high  thrill-seeking  persona (e.g.  extreme  sports)  receive  positive  coverage  in  the  media.    Extreme  sports  are  no longer activities for members on the fringe of society; in fact, these sports have become somewhat  main-stream  (Creyer  et  al.,  2003).    High-risk  sports  have  gained  a  certain prestige due to increased media exposure; which may lead to increased social pressures, particularly  for  males,  to  exhibit  higher  levels  of  the  sensation-seeking  trait.    For example,  a  low  sensation-seeking,  young  man  might  try  to  flaunt  sensation-seeking characteristics in order to identify with a peer group.  The same pressure does not exist for  women  since  sensation  seeking  is  not  iconic  of  femininity  (Saxvik  and  Joiremen, 2005).  The non-significant association between the DRD4-gene and sensation seeking levels  in  males  may  be  in  part  due  to  differential  social  pressures  faced  by  men  and women.   LIMITATIONS Power   Genetic association studies are often plagued by low statistical power because the effect  sizes  of  the  SNPs  are  often  very  small  (Ebstein,  2006;  Munafo  et  al.,  2008).  Numerous  studies  suggest  that  replications  of  the  DRD4-gene  and  novelty-seeking associations have been problematic due to inadequate sample size leading to Type II error (Golimbet  et  al.,  2005;  Lee  et  al.,  2003).    On  the other  hand,  some  studies  that  claim adequate power failed to find associations (Jonsson et al., 2002), suggesting that previous associations may have been found by chance (Type I error).     The  current  study  was  under-powered  due  to  difficulties  encountered  in genotyping the -521 C/T SNP.  Power analysis suggests a minimum sample size of 138                                                  9 Note: I have used the term ?so-called? because today the lines between gender categories are not clear-cut. 41 and  we  were  only  able  to  include  a  random  sample  of  74  individuals.    Attempts  to analyze the entire sample (N = 201) are ongoing. Generalizability   This was the first study to address the genetics of sensation seeking in the field of sports.    It  was  therefore  important  to  maintain  a  homogenous  sample  by  comparing individuals  within  one  sport  group  rather  than  across  different  sports  (e.g.  mountain bikers versus golfers) at the cost of lower generalizability.  Skiing and snowboarding are classified as high-risk sports, but it was hypothesized that these particular sports would include  a  number  of  high-sensation  seekers,  while  still  including  a  number  of  lower sensation seekers.  Because the sample criteria included skiers of at least an intermediate level  the  distribution  of  ImpSS  scores  was  expected  to  be  higher  than  the  general population.  This sample of skiers and snowboarders scored on average 1.5 points higher on  the  ImpSS  scale  when  compared  with  sample  means  from  a  general  population  of college students (Zuckerman et al., 1993).  The advancements in ski ability required to reach an intermediate level involve a shift towards more challenging terrain (along with the  speed  and  exposure  that  accompanies).    This  may  explain  the  presence  of  higher ImpSS scores in the present study, as the low-sensation seekers may be weeded out of the sport at the novice level.   Potential confounding variables Participants?  familial  situations  may  be  a  potential  confounding  factor.    The participant demographic section should have included a question regarding dependents.  It was observed that one subject had outlying scores (both ImpSS and CSSQ-S) for her genotype group (2 SD below the mean) and under occupation, she had listed that she was a mother.  Although genetic composition remains constant throughout one?s life, having children may influence personality traits (i.e. levels of sensation seeking may decrease).  A shift to lower sensation-seeking behaviours may occur in an effort to avoid risk and protect one?s child. Another confounding variable that we attempted to control was age.  Exclusions for  age  (between  19  and  40  years)  were  imposed  because  levels  of  sensation  seeking decrease after the age of 40 years (Zuckerman, 1979, p. 125).  It has been hypothesized 42 that this decrease may be due to an increase in levels of an enzyme that breaks down dopamine, MAOB (Zuckerman, 1979, p. 376).  Although the genetic composition of a person  does  not  change  with  age,  lower  levels  of  dopamine  may  have  an  effect  on sensation-seeking  behaviours,  thus  confounding  the  study.    A  younger  population  (i.e. elementary school-aged children) would be an ideal population to study in order to avoid biological and social confounding variables. FUTURE DIRECTIONS A  weakness  of  association  studies  is  that  they  do  not  provide  causal  evidence; therefore studies must be replicated in different populations to ensure the findings are not due to chance alone.  Further studies are needed to evaluate the contribution of the DRD4 gene to the sensation-seeking trait.  A possible design may involve comparing high-risk and low-risk sport groups.  For example a sample of high-risk BASE (Building, Antenna, Span (a bridge or arch) Earth (usually a cliff)) jumpers may be compared with a low-risk group  (golfers)  to  see  whether  an  over-expression  (measured  using  a  two-by-two contingency table) of the ?C? allele exists in the BASE-jumping group compared to the golfers.  Inclusion of a heterozygous population would increase the generalizability of the results.   This study included only the ?521 C/T SNP because a majority of studies reported significant  linkage  disequilibrium  between  ?521  C/T  and  the  VNTR  (Ekelund  et  al., 1999; Strobel et al., 2002).  Numerous studies have failed to find an association between novelty seeking and the DRD4 VNTR, and many concluded that the initial associations might  have  occurred  because  the  repeated  variant  exists  in  linkage  with  another functional variant (Noble et al., 1998).  In future studies, however, other polymorphisms in the DRD4-gene and in other neurotransmitter genes (there are many (Benjamin, Osher, Kotler, Gritsenko, Nemanoc, Belmaker, & Ebstein, 2000; Oak et al., 2000; Okuyama et al., 2000))  should be considered for investigation. Other genes may also be investigated, including variations in the stathmin gene and the gene encoding MAOB.  Stathmin, a gene found in high density in the amygdala (part  of  the  limbic  system),  has  been  linked  to  fearlessness  in  mice  (Shumyatsky, Malleret,  Shin,  Takizawa,  Tully,  Tsvetkov,  Zakharenko,  Joseph,  Vronskaya,  &  Yin, 43 2005) and might be another possible candidate for sensation-seeking studies.  Based on HapMap, there are few variations within and around both the stathmin gene and MAOB in  the  population.    Many  of  the  variations  are  dependent,  meaning  that  only  a  few variations  would  need  to  be  analyzed  to  see  if  associations  with  the  sensation-seeking trait exist.   CONCLUSIONS Sensation  seeking  is  a  complex  personality  trait  that  is  likely  influenced  by  a combination  of  genetics  and  environment.    Variations  in  numerous  genes,  each contributing  a  small  effect,  combined  with  phenotypes  measured  by  self-report  are common obstacles faced by behavioural geneticists.  Precise phenotype identification is essential, and at the cost of losing validity from the use of smaller sample sizes, there is a gain of  generating less false positives or negatives (Kreek et al., 2005).   The CSSQ-S may have provided a more precise tool for phenotype identification in females.  The a priori decision to analyze females separately from males distinguished this study from previous ones and added to its strength.  Males and females experience different social and  environmental  influences  and  should  therefore  be  studied  separately  regarding genetic contributions to personality.   44 REFERENCES  Asghari, V., Schoots, O., van Kats, S., Ohara, K., Jovanovic, V., Guan, H.C., Bunzow, J.R., Petronis, A., &  Van Tol, H.H. (1994). Dopamine D4 receptor repeat: analysis of different native and mutant forms of the human and rat genes. Molecular pharmacology 46, 364-373.  Balding, D.J. (2006). A tutorial on statistical methods for population association studies. Nature reviews 7, 781-791.  Benjamin,  J.,  Li,  L.,  Patterson,  C.,  Greenberg,  B.D.,  Murphy,  D.L.,  &  Hamer,  D.H. (1996). Population and familial association between the D4 dopamine receptor gene and measures of Novelty Seeking. Nature genetics 12, 81-84.  Benjamin,  J.,  Osher,  Y.,  Kotler,  M.,  Gritsenko,  I.,  Nemanov,  L.,  Belmaker,  R.H.,  & Ebstein, R.P.  Association between tridimensional personality questionnaire (TPQ) traits and  three  functional  polymorphisms;  dopamine  receptor  D4  (DRD4),  serotonin transporter  promoter  region  (5-HTTLPR)  and  catechol  O-methyltransferase  (COMT).  Molecular psychiatry 5(1), 96-100.  Bookman,  E.B.,  Taylor,  R.E.,  Adams-Campbell,  L.,  &  Kittles,  R.A.  (2002).  DRD4 promoter  SNPs  and  gender  effects  on  Extraversion  in  African  Americans.  Molecular psychiatry 7, 786-789.  Bouchard,  C.,  Blair,  S.N.,  &  Haskell,  W.L.  (2007).  Genetic  Differences  and  P.A.  and Health. In Physical Activity and Health (Windsor, Human Kinetics).  Bouter, L.M., Knipschild, P.G., Feij, J.A., & Volovics, A. (1988). Sensation Seeking and Injury Risk in Downhill Skiing. Personality & Individual Differences 9, 667-673.  Clark, L.A., & Watson, D. (1995). Constructing Validity: Basic Issues in Objective Scale Development. Psychological Assessment 7, 309-319.  Cloninger, C.R. (1987). A systematic method for clinical description and classification of personality variants. A proposal. Archives of general psychiatry 44, 573-588.  Collins,  F.S.,  &  Mansoura,  M.K.  (2001).  The  Human  Genome  Project.  Revealing  the shared inheritance of all humankind. Cancer 91, 221-225.  Consortium (2004). Finishing the euchromatic sequence of the human genome. Nature 431, 931-945.  Cordell,  H.J.,  &  Clayton,  D.G.  (2005).  Genetic  association  studies.  Lancet  366,  1121-1131.  45 Creyer,  E.H.,  Ross  Jr,  W.T.,  &  Evers,  D.  (2003).  Risky  recreation:  an  exploration  of factors influencing the likelihood of participation and the effects of experience. Leisure Studies, 239.  Daitzman, R., & Zuckerman, M. (1980). Disinhibitory sensation seeking, personality and gonadal hormones. Personality & Individual Differences 1, 103-110.  Diehm, R., & Armatas, C. (2004). Surfing: an avenue for socially acceptable risk-taking, satisfying needs for sensation seeking and experience seeking. Personality and  Individual Differences 36, 663-677.  Ebstein, R.P. (2006). The molecular genetic architecture of human personality: beyond  self-report questionnaires. Molecular psychiatry 11, 427-445.  Ebstein,  R.P.  (2000).  Association  between  tridimensional  personality  questionnaire (TPQ)  traits  and  three  functional  polymorphisms:  dopamine  receptor  D4  (DRD4), serotonin  transporter  promoter  region  (5-HTTLPR)  and  catechol  O-methyltransferase (COMT). Molecular psychiatry 5, 96-100.  Ebstein, R.P., Novick, O., Umansky, R., Priel, B., Osher, Y., Blaine, D., Bennett, E.R., Nemanov, L., Katz, M., & Belmaker, R.H. (1996). Dopamine D4 receptor (D4DR)  exon III polymorphism associated with the human personality trait of Novelty Seeking. Nature genetics 12, 78-80.  Eichhammer,  P.,  Sand,  P.G.,  Stoertebecker,  P.,  Langguth,  B.,  Zowe,  M.,  &  Hajak,  G. (2005).  Variation  at  the  DRD4  promoter  modulates  extraversion  in  Caucasians. Molecular psychiatry 10, 520-522.  Eisenberg, D.T., Mackillop, J., Modi, M., Beauchemin, J., Dang, D., Lisman, S.A., Lum, J.K.,  &  Wilson,  D.S.  (2007).  Examining  impulsivity  as  an  endophenotype  using  a behavioral  approach:  a  DRD2  TaqI  A  and  DRD4  48-bp  VNTR  association  study. Behavioral Brain Function 3, 2.  Ekelund, J., Lichtermann, D., Jarvelin, M.R., & Peltonen, L. (1999). Association between novelty seeking and the type 4 dopamine receptor gene in a large Finnish cohort sample. The American journal of psychiatry 156, 1453-1455.  Estabrooks,  P.A.,  &  Carron,  A.V.  (2000).  The  physical  activity  environment questionnaire: An instrument for the assessment of cohesion in exercise classes for older adults.  Group Dynamics 4, 230-243.  Franken, I.H., Zijlstra, C., & Muris, P. (2006). Are nonpharmacological induced  rewards  related  to  anhedonia?  A  study  among  skydivers.  Progress  in  neuro-psychopharmacology & biological psychiatry 30, 297-300.  46 Franques, P., Auriacombe, M., Piquemal, E., Verger, M., Brisseau-Gimenez, S., Grabot, D.,  &  Tignol,  J.  (2003).  Sensation  seeking  as  a  common  factor  in  opioid  dependent subjects and high risk sport practicing subjects. A cross sectional study. Drug and alcohol dependence 69, 121-126.  Gana, K., & Trouillet, R. (2003). Structure invariance of the Temperament and Character Inventory (TCI). Personality and individual differences 35.  Gelernter, J., Kranzler, H., Coccaro, E., Siever, L., New, A., & Mulgrew, C.L. (1997). D4 dopamine-receptor  (DRD4)  alleles  and  novelty  seeking  in  substance-dependent, personality-disorder, and control subjects. American journal of human genetics 61, 1144-1152.  Golimbet, V.E., Gritsenko, I.K., Alfimova, M.V., & Ebstein, R.P. (2005). Polymorphic markers  of  the  dopamine  D4  receptor  gene  promoter  region  and  personality  traits  in mentally healthy individuals from the Russian population. Human genetics 41, 789-793.  Goma-i-Freixanet,  M.,  Wismeijer,  A.A.,  &  Valero,  S.  (2005).  Consensual  validity parameters  of  the  Zuckerman-Kuhlman  personality  questionnaire:  evidence  from  self-reports and spouse reports. Journal of personality assessment 84, 279-286.  Hur, Y.M., & Bouchard, T.J., Jr. (1997). The genetic correlation between impulsivity and sensation seeking traits. Behavioral genetics 27, 455-463.  Jack,  S.J.,  &  Ronan,  K.R.  (1998).  Sensation  seeking  among  high-  and  low-risk  sports participants. Personality & individual differences, 1063.  Jonsson, E.G., Ivo, R., Gustavsson, J.P., Geijer, T., Forslund, K., Mattila-Evenden, M., Rylander,  G.,  Cichon,  S.,  Propping,  P.,  Bergman,  H.,  et  al.  (2002).  No  association between dopamine D4 receptor gene variants and novelty seeking. Molecular psychiatry 7, 18-20.  Kajtna, T., Tu, Scaronak, M., Bari, Cacute, R., & Burnik, S. (2004). Personality in High-Risk Sports Athletes. Kinesiology 36(1), 24-34.  Kelly, T.H., Robbins, G., Martin, C.A., Fillmore, M.T., Lane, S.D., Harrington, N.G., & Rush,  C.R.  (2006).  Individual  differences  in  drug  abuse  vulnerability:  d-amphetamine and sensation-seeking status. Psychopharmacology 189, 17-25.  Keltikangas-Jarvinen, L., Raikkonen, K., Ekelund, J., & Peltonen, L. (2004). Nature and nurture in novelty seeking. Molecular psychiatry 9, 308-311.  Kereszturi,  E.,  Kiraly,  O.,  Barta,  C.,  Molnar,  N.,  Sasvari-Szekely,  M.,  &  Csapo,  Z. (2006).  No  direct  effect  of  the  -521  C/T  polymorphism  in  the  human  dopamine  D4 receptor gene promoter on transcriptional activity. BMC molecular biology 7.  47 Kish,  G.B.  (1971).  CPI  correlates  of  stimulus-seeking  in  male  alcoholics.  Journal  of clinical psychology 27, 251-253.  Kluger, A.N., Siegfried, Z., & Ebstein, R.P. (2002). A meta-analysis of the association between DRD4 polymorphism and novelty seeking. Molecular psychiatry 7, 712-717.  Koopmans,  J.R.,  Boomsma,  D.I.,  Heath,  A.C.,  &  van  Doornen,  L.J.  (1995).  A multivariate genetic analysis of sensation seeking. Behavioral genetics 25, 349-356.  Kreek, M.J., Nielsen, D.A., Butelman, E.R., & LaForge, K.S. (2005). Genetic influences on  impulsivity,  risk  taking,  stress  responsivity  and  vulnerability  to  drug  abuse  and addiction. Nature neuroscience 8, 1450-1457.  Lee, H.J., Lee, H.S., Kim, Y.K., Kim, S.H., Kim, L., Lee, M.S., Joe, S.H., Jung, I.K., Suh,  K.Y.,  &  Kim,  S.  (2003).  Allelic  variants  interaction  of  dopamine  receptor  D4 polymorphism  correlate  with  personality  traits  in  young  Korean  female  population. American journal of medical genetics part B neuropsychiatric genetics 118, 76-80.  Lusher, J.M., Chandler, C., & Ball, D. (2001). Dopamine D4 receptor gene (DRD4) is associated  with  Novelty  Seeking  (NS)  and  substance  abuse:  the  saga  continues. Molecular psychiatry 6, 497-499.  McCourt,  W.F.,  Gurrera,  R.J.,  &  Cutter,  H.S.  (1993).  Sensation  seeking  and  novelty seeking. Are they the same? The Journal of nervous and mental disease 181, 309-312.  Mitsuyasu, H., Hirata, N., Sakai, Y., Shibata, H., Takeda, Y., Ninomiya, H., Kawasaki, H., Tashiro, N., & Fukumaki, Y. (2001). Association analysis of polymorphisms in the upstream region of the human dopamine D4 receptor gene (DRD4) with schizophrenia and personality traits. Journal of human genetics 46, 26-31.  Morrongiello,  B.A.,  &  Lasenby,  J.  (2006).  Finding  the  daredevils:  development  of  a Sensation Seeking Scale for children that is relevant to physical  risk taking. Accident; analysis and prevention 38, 1101-1106.  Munafo,  M.R.,  Yalcin,  B.,  Willis-Owen,  S.A.,  &  Flint,  J.  (2008).  Association  of  the Dopamine D4 Receptor (DRD4) GEne and Approach-Related Personality Traits: Meta-Analysis and New Data. Biological Psychiatry 63, 197-206.  Noble,  E.P.,  Ozkaragoz,  T.Z.,  Ritchie,  T.L.,  Zhang,  X.,  Belin,  T.R.,  &  Sparkes,  R.S. (1998). D2 and D4 dopamine receptor polymorphisms and personality. American journal of medical genetics 81, 257-267.  Oak,  J.N.,  Oldenhof,  J.,  &  Van  Tol,  H.H.  (2000).  The  dopamine  D(4)  receptor:  one decade of research. European journal of pharmacology 405, 303-327.  48 Okuyama,  Y.,  Ishiguro,  H.,  Nankai,  M.,  Shibuya,  H.,  Watanabe,  A.,  &  Arinami,  T. (2000). Identification of a polymorphism in the promoter region of DRD4 associated with the human novelty seeking personality trait. Molecular psychiatry 5, 64-69.  Okuyama, Y., Ishiguro, H., Toru, M., & Arinami, T. (1999). A genetic polymorphism in the promoter region of DRD4 associated with expression and schizophrenia. Biochemical and biophysical research communications 258, 292-295.  Ono, Y., Manki, H., Yoshimura, K., Muramatsu, T., Mizushima, H., Higuchi, S., Yagi, G., Kanba, S., & Asai, M. (1997). Association between dopamine D4 receptor (D4DR) exon  III  polymorphism  and  novelty  seeking  in  Japanese  subjects.  American  journal  of medical genetics 74, 501-503.  Pain, M.T. (2005). Essay Risk taking in sport. In medicine and sport, pp. S33-S35.  Pecina,  S.,  Cagniard,  B.,  Berridge,  K.C.,  Aldridge,  J.W.,  &  Zhuang,  X.  (2003). Hyperdopaminergic  mutant  mice  have  higher  "wanting"  but  not  "liking"  for  sweet rewards. Journal of neuroscience 23, 9395-9402.  Rebec, G.V., Christensen, J.R., Guerra, C., & Bardo, M.T. (1997). Regional and temporal differences  in  real-time  dopamine  efflux  in  the  nucleus  accumbens  during  free-choice novelty. Brain research 776, 61-67.  Reuter,  M.,  &  Hennig,  J.  (2005).  Association  of  the  functional  catechol-O-methyltransferase VAL158MET polymorphism with the personality trait of extraversion. Neuroreport 16, 1135-1138.  Ronai, Z., Szantai, E., Szmola, R., Nemoda, Z., Szekely, A., Gervai, J., Guttman, A., & Sasvari-Szekely, M. (2004). A novel A/G SNP in the -615th position of the dopamine D4 receptor promoter region as a source of misgenotyping of the -616 C/G SNP. American journal of medical genetics part B neuropsychiatric genetics 126, 74-78.  Ronai,  Z.,  Szekely,  A.,  Nemoda,  Z.,  Lakatos,  K.,  Gervai,  J.,  Staub,  M.,  &  Sasvari-Szekely,  M.  (2001).  Association  between  Novelty  Seeking  and  the  -521  C/T polymorphism in the promoter region of the DRD4 gene. Molecular psychiatry 6, 35-38.  Saftlas,  A.F.,  Waldschmidt,  M.,  Logsden-Sackett,  N.,  Triche,  E.,  &  Field,  E.  (2004). Optimizing buccal cell DNA yields in mothers and infants for human leukocyte antigen genotyping. American journal of epidemiology 160, 77-84.  Saxvik,  S.,  &  Joiremen,  J.  (2005).  Sensation  seeking,  felt  gender  compatibility  and psychosocial adjustment in women. Personality & individual differences 38, 1505-1515.  Schinka, J.A., Letsch, E.A., & Crawford, F.C. (2002). DRD4 and novelty seeking: results of meta-analyses. American journal of medical genetics 114, 643-648.  49 Schweizer,  T.S.  (2004).  An  Individual  Psychology  of  Novelty  Seeking,  Creativity  and Innovation. In Psychology (Erasmus University Rotterdam), pp. 288.  Seaman,  M.I.,  Fisher,  J.B.,  Chang,  F.,  &  Kidd,  K.K.  (1999).  Tandem  duplication polymorphism upstream of the dopamine D4 receptor gene (DRD4). American journal of medical genetics 88, 705-709.  Seeman, P., Guan, H.C., & Van Tol, H.H. (1993). Dopamine D4 receptors elevated in schizophrenia. Nature 365, 441-445.  Shumyatsky,  G.P.,  Malleret,  G.,  Shin,  R.M.,  Takizawa,  S.,  Tully,  K.,  Tsvetkov,  E., Zakharenko,  S.S.,  Joseph,  J.,  Vronskaya,  S.,  Yin,  D.,  et  al.  (2005).  Stathmin,  a  gene enriched in the amygdala, controls both learned and innate fear. Cell 123, 697-709.  Stevens,  J.  (1999).  Intermediate  statistics:  a  modern  approach.  (Lawrence  Erlbaum Associates).  Stoel,  R.D.,  De  Geus,  E.J.,  &  Boomsma,  D.I.  (2006).  Genetic  analysis  of  sensation seeking with an extended twin design. Behavioral genetics 36, 229-237.  Strange, P.G. (2000). Dopamine Receptors. Tocris reviews 15.  Strobel,  A.,  Lesch,  K.P.,  Hohenberger,  K.,  Jatzke,  S.,  Gutzeit,  H.O.,  Anacker,  K.,  & Brocke, B. (2002). No association between dopamine D4 receptor  gene  exon III and -521C/T polymorphism and novelty seeking. Molecular psychiatry 7, 537-538.  Tabachnick, B.G., & Fidell, L.S. (1983). Using Multivariate Stastitics (New York).  Tabachnick, B.G., & Fidell, L.S. (1996). Fundamental equations for factor analysis. In Using Multivariate Statistics, C. Woods, ed. (New York, Harper Collins College).  Unknown. The mental makeup of those who go big. In Elevation, pp. 31-32.  Van Tol, H.H., Wu, C.M., Guan, H.C., Ohara, K., Bunzow, J.R., Civelli, O., Kennedy, J.L., Seeman, P., Niznik, H.B., & Jovanovic, V. (1992). Multiple dopamine D4 receptor variants in the human population. Nature 358, 149-152.  Zhou, Z., Poe, A.C., Limor, J., Grady, K.K., Goldman, I., McCollum, A.M., Escalante, A.A., Bramwell, J.W. & Udhayakumar, V.  (2006).  Pyrosequencing, a High-Throughput Method for Detecting Single Nucleotide Polymorphisms in the Dihydrofolate Reductase and  Dihydropteroate  Synthetase  Genes  of Plasmodium  falciparum.    Journal  of  clinical microbiology, 44(11).  Zuckerman, M. (1979). Sensation Seeking: Beyond the Optimal Level of Arousal.  New Jersey: Lawrence Erlbaum Associates.  50 Zuckerman, M. (2000). Are you a Risk-Taker? Psychology Today.  Zuckerman, M. (2005). Neurobiology of Exceptionality.  The Neurobiology of Impulsive Sensation Seeking. US: Springer.  Zuckerman, M. (2006). Sensation seeking and risky behavior, Prevention and treatment of unhealthy risk-taking behavior. American Psychological Association.  Zuckerman, M., & Cloninger, C.R. (1996). Relationships between Cloninger's,  Zuckerman's,  and  Eysenck's  dimensions  of  personality.  Personality  &  individual differences 21.  Zuckerman,  M.,  &  Kuhlman,  D.M.  (2000).  Personality  and  risk-taking:  common biosocial factors. Journal of personality 68, 999-1029.  Zuckerman,  M.K.,  Kuhlman,  D.M.,  Joireman,  J.  Teta,  P.,  &  Kraft,  M.  (1993).  A comparison of three structural models for personality: the big three, the big five, and the alternative five. Journal of personality and social psychiatry 65, 757-768. 51 APPENDICES Appendix A  Contextual Sensation Seeking Questionnaire (CSSQ) Appendix B  Zuckerman Kuhlman Personality Questionnaire (ZKPQ) Appendix C  Clinical Research Ethics Board Certificate Appendix D  Subject consent Appendix E  Peer consent Appendix F  Peer CSSQ-S review form Appendix G  Recipes Appendix H  Optimal PCR conditions for F4/R4 primer pair Appendix I  A scatter-plot of the total CSSQ scores against the ZKPQ ImpSS scores   Appendix J  Tests of normality and descriptive statistics for 13-item CSSQ Appendix K  Scree plot test for factor analysis of 13-item CSSQ   Appendix L  Factor analysis of 13-item CSSQ: factor loadings, communalities, eigenvalues Appendix M  Scree plot test for 10-item CSSQ Appendix N  One-way ANOVA table peer review vs. CSSQ  Appendix O  Pearson?s Correlation between CSSQ-S and ZKPQ ImpSS Appendix P  Cronbach alphas and tests for normality of ZKPQ subscales using total scores from all subjects (N = 201) Appendix Q  Graphed Distribution of ImpSS scores for males and females (N = 201) Appendix R  A representative picture depicting digested PCR products and assigned genotypes Appendix S  Raw data including genotype, ZKPQ ImpSS score, CSSQ score, peer CSSQ (if available) Appendix T  Sequencing Data 52 Appendix U  Pyrosequencing results: C/C genotype Appendix V   Expected allele frequencies   Appendix W   Block design for One-way ANOVA  Appendix X  One-way ANOVA blocked by sex  53 APPENDIX A:  Contextual Sensation Seeking Questionnaire for Skiing (CSSQ-S)    Genetics of sport-behaviours  Age:      19-24      25-30             31-40  Gender:   Male      Female   Occupation:           Full Time   Part Time  City of residence: _________________________  Highest level of education:      High School    Undergraduate degree    Graduate degree                                                     (i.e. MBA/PHD/MD) Race:    White (European descent) First Nations descent Black (Carribean) Black (African) Black (other)  Asian (Indian) Asian (Pakistani) Asian (Japanese) Asian (Chinese) Other, please specify: _____________  Sport of choice:   Skiing       Snowboarding  Level of ability:      Beginner            Novice            Intermediate          Advanced           Expert*                    (*any terrain, *any condition) Average number of runs skied in a day per difficulty grade: uni25CF____  filledbox____  diamond____  diamonddiamond_____ (estimate out of 10)  Number of days at the hill per season:    < 10    10-25    25-40    >40  Do you wear a helmet?    YES    NO  Number of ski-related injuries this season:      0  1  2  > 3  Number of ski-related injuries over the last three seasons (not including this season) _________ ID CODE:     UBC Human Kinetics T H E   U N I V E R S I T Y   O F   B R I T I S H   C O L U M B I A  54 Please complete the following questionnaire.  It is a sport-specific questionnaire containing 13 specific questions about skiing/snowboarding behaviours.  Please take your time to read the questions and answer truthfully.  There are no right or wrong answers to any of these questions, so please just give your immediate response to the questions.  You may feel that in some cases questions are repetitive but please answer every question (unless you feel uncomfortable doing so). Remember that your responses will remain confidential and no one other than the researchers involved in this study will have access to your data.   SECTION I:   Please rate the extent to which you agree or disagree with the following statements. Circle the appropriate answer.       1    2    3    4    5 Strongly Disagree     Disagree            Neutral            Agree     Strongly Agree    1.  I like to ski/ride fast.         1    2    3    4    5  2.  I like to ski/ride down runs that I have never been down before. 1    2    3    4    5  3.  I like to start a run even if I cannot see what lies ahead (i.e. big cornice). 1    2    3    4    5  4.  I like to ski/ride out of bounds. 1    2    3    4    5  5.  I like to attempt jumps even if I?m not sure of the quality of the landing area. 1    2    3    4    5  6.  I like to push my boundaries when I ski/ride. 1    2    3    4    5  7.  If I lose control, I don?t try to immediately slow down, I just go with it. 1    2    3    4    5  8.  If the only way down is a straight line through a narrow pass, I go for it without hesitation even if I know I will have to go fast. 1    2    3    4    5  9.  I am always trying to find new and exciting ways down a run. 1    2    3    4    5  10.  A 15-foot high drop off a cliff isn?t too high a jump for me. 1    2    3    4    5      T H E   U N I V E R S I T Y   O F   B R I T I S H   C O L U M B I A  55     1    2    3    4    5       Strongly Disagree     Disagree            Neutral            Agree     Strongly Agree    11.  I slow down on busy runs. 1    2    3    4    5  12.  I don?t slow down on busy runs, instead I just dodge people. 1    2    3    4    5  13.  If I see a ?danger of avalanche? sign, I will usually try to find another safer route. 1    2    3    4    5        THANK YOU.    WE WILL NOW PROCEED WITH THE ZKPQ STANDARDIZED PERSONALITY QUESTIONNAIRE.  56  APPENDIX B:  Zuckerman Kuhlman Personality Questionnaire (ZKPQ)  DIRECTIONS:  On the following pages you will find a series of statements that persons might use to describe themselves.  Read each statement and decide whether or not it describes you.  Then indicate your answer on the separate answer sheet (provided). If you agree with the statement or decide that it describes you, answer TRUE by blacking in A on the answer sheet.  If you disagree with the statement or feel that it is not descriptive of you, answer FALSE in B on the answer sheet. A = T R U E  B= F A L S E In marking your answers on the answer sheet, be sure that the number of the statement you have just read is the same as the number on your answer sheet.  Answer every statement either True (A) or False (B) even if you are not entirely sure of your answer.               1.  I tend to begin a new job without much planning on how I will do it.     2.  I do not worry about unimportant things.         3.  I enjoy seeing someone I don't care for humiliated before other people. 4.  I never met a person that I didn't like. 5.  I do not like to waste time just sitting around and relaxing. 6.  I usually think about what I am going to do before doing it. 7.  I am not very confident about myself or my abilities. 8.  When I get mad, I say ugly things. 9.  I tend to start conversations at parties. 10.  I have always told the truth. 11.  It's natural for me to curse when I am mad. 12.  I do not mind going out alone and usually prefer it to being out in a large group. 13.  I lead a busier life than most people. 14.  I often do things on impulse. 15.  I often feel restless for no apparent reason. 16.  I almost never litter the streets. 17.  I would not mind being alone in a place for some days without any human contacts. 18.  I like complicated jobs that require a lot of effort and concentration. 19.  I very seldom spend much time on the details of planning ahead. ZUCKERMAN-KUHLMAN PERSONALITY QUESTIONNAIRE  M. Zuckerman & D.M. Kuhlman, 1993 57 20.  I sometimes feel edgy and tense. 21.  I almost never feel like I would like to hit someone. 22.  I spend as much time with my friends as I can. 23.  I do not have a great deal of energy for life's more demanding tasks. 24.  I like to have new and exciting experiences and sensations even if they are a little frightening. 25.  My body often feels all tightened up for no apparent reason. 26.  I always win at games. 27.  I often find myself being ?the life of the party?. 28.  I like a challenging task much more than a routine one. 29.  Before I begin a complicated job, I make careful plans. 30.  I frequently get emotionally upset. 31.  If someone offends me, I just try not to think about it. 32.  I have never been bored. 33.  I like to be doing things all of the time. 34.  I would like to take off on a trip with no preplanned or definite routes or timetables. 35.  I tend to be oversensitive and easily hurt by thoughtless remarks and actions of others. 36.  In many stores you just cannot get served unless you push yourself in front of other people. 37.  I do not need a large number of casual friends. 38.  I can enjoy myself just lying around and not doing anything active. 39.  I enjoy getting into new situations where you can't predict how things will turn out. 40.  I never get lost, even in unfamiliar places. 41.  I am easily frightened. 42.  If people annoy me I do not hesitate to tell them so. 43.  I tend to be uncomfortable at big parties. 44.  I do not feel the need to be doing things all of the time. 45.  I like doing things just for the thrill of it. 46.  I sometimes feel panicky. 47.  When I am angry with people I do not try to hide it from them. ZUCKERMAN-KUHLMAN PERSONALITY QUESTIONNAIRE  M. Zuckerman & D.M. Kuhlman, 1993 58 48.  At parties, I enjoy mingling with many people whether I already know them or not. 49.  I would like a job that provided a maximum of leisure time. 50.  I tend to change interests frequently. 51.  I often think people I meet are better than I am. 52.  I never get annoyed when people cut ahead of me in line. 53.  I tend to start my social weekends on Thursdays. 54.  I usually seem to be in a hurry. 55.  I sometimes like to do things that are a little frightening. 56.  Sometimes when emotionally upset, I suddenly feel as if my legs are unsteady. 57.  I generally do not use strong curse words even when I am angry. 58.  I would rather ?hang out? with friends rather than work on something by myself. 59.  When on vacation I like to engage in active sports rather than just lie around. 60.  I'll try anything once. 61.  I often feel unsure of myself. 62.  I can easily forgive people who have insulted me or hurt my feelings. 63.  I would not mind being socially isolated in some place for some period of time. 64.  I like to wear myself out with hard work or exercise. 65.  I would like the kind of life where one is on the move and traveling a lot, with lots of change and excitement. 66.  I often worry about things that other people think are unimportant. 67.  When people disagree with me I cannot help getting into an argument with them. 68.  Generally, I like to be alone so I can do things I want to do without social distractions. 69.  I never have any trouble understanding anything I read the first time I read it. 70.  I sometimes do ?crazy? things just for fun. 71.  I often have trouble trying to make choices. 72.  I have a very strong temper. 73.  I have never lost anything. 74.  I like to be active as soon as I wake up in the morning. 75.  I like to explore a strange city or section of town by myself, even if it means getting lost. 76.  My muscles are so tense that I feel tired much of the time. 77.  I can't help being a little rude to people I do not like. ZUCKERMAN-KUHLMAN PERSONALITY QUESTIONNAIRE  M. Zuckerman & D.M. Kuhlman, 1993 59 78.  I am a very sociable person. 79.  I prefer friends who are excitingly unpredictable. 80.  I often feel like crying sometimes without a reason. 81.  No matter how hot or cold it gets, I am always quite comfortable. 82.  I need to feel that I am a vital part of a group. 83.  I like to keep busy all the time. 84.  I often get so carried away by new and exciting things and ideas that I never think of possible complications. 85.  I don't let a lot of trivial things irritate me. 86.  I am always patient with others even when they are irritating. 87.  I usually prefer to do things alone. 88.  I can enjoy routine activities that do not require much concentration or effort. 89.  I am an impulsive person. 90.  I often feel uncomfortable and ill at ease for no real reason. 91.  I often quarrel with others. 92.  I probably spend more time than I should socializing with friends. 93.  It doesn?t bother me if someone takes advantage of me. 94.  When I do things, I do them with lots of energy. 95.  I like ?wild? uninhibited parties. 96.  After buying something I often worry about having made the wrong choice. 97.  When people shout at me, I shout back. 98.  I have more friends than most people do. 99.  Other people often urge me to ?take it easy?.   60 APPENDIX C:  Clinical Research Ethics Board Certificate     The University of British Columbia Office of Research Services Clinical Research Ethics Board ? Room 210, 828 West 10th Avenue, Vancouver, BC V5Z 1L8   PRINCIPAL INVESTIGATOR:  DEPARTMENT:  UBC CREB NUMBER: James L. Rupert   UBC/Education/Human Kinetics   H07-00207 INSTITUTION(S) WHERE RESEARCH WILL BE CARRIED OUT:  Institution  Site UBC  Vancouver (excludes UBC Hospital) Other locations where the research will be conducted: Whistler/Blackcomb Ski Resort Lake Louise Ski Resort Backcountry ski areas coastal and interior British Columbia Mountain Equipment Co-op   CO-INVESTIGATOR(S): Mark R. Beauchamp Cynthia Thomson   SPONSORING AGENCIES: N/A  PROJECT TITLE: The relationship between genetics and skiing/snowboarding behaviours: variants in the Dopamine receptor gene. The current UBC CREB approval for this study expires:  April 22, 2009 AMENDMENT(S):   AMENDMENT APPROVAL DATE:  Change in number of Subjects  April 22, 2008 CERTIFICATION:  In respect of clinical trials:  1. The membership of this Research Ethics Board complies with the membership requirements for Research Ethics Boards defined in Division 5 of the Food and Drug Regulations.  2. The Research Ethics Board carries out its functions in a manner consistent with Good Clinical Practices.  3. This Research Ethics Board has reviewed and approved the clinical trial protocol and informed consent form for the trial which is to be conducted by the qualified investigator named above at the specified clinical trial site. This approval and the views of this Research Ethics Board have been documented in writing.    The Chair of the UBC Clinical Research Ethics Board has reviewed the documentation for the above named project.  The research study, as presented in the documentation, was found to be acceptable on ethical grounds for research involving human subjects and was approved for renewal by the UBC Clinical Research Ethics Board.    Approval of the Clinical Research Ethics Board by:                             AssociateChair                  61 APPENDIX D:  Subject consent   SUBJECT INFORMATION AND CONSENT FORM  Project: The relationship between genetics and skiing/snowboarding behaviours: variants in the Dopamine receptor gene.  Principal investigator:   Jim Rupert, PH.D.        School of Human Kinetics       Room 346 Wesbrook Building, UBC       Vancouver, B.C., CANADA V6T 1Z2       Phone (604) 822-8462   Fax (604) 822-9451                    E-mail: rupertj@interchange.ubc.ca    Other investigators:    Mark Beauchamp, PH.D.; UBC School of Human Kinetics, Annex         Cynthia Thomson, M.Sc.; UBC School of Human Kinetics    Sponsor:     UBC Faculty of Education/School of Human Kinetics  Emergency Telephone Number: Dr Jim Rupert (as above) or cell (778) 386-0908    Introduction: The goals of this project are to analyze sport behaviours  (sensation seeking) using a ski-specific questionnaire, and a standardized personality questionnaire (ZKPQ); and to analyze whether an association exists between common variants in the dopamine receptor gene (DRD4) and sport-specific behaviours and personality types such as sensation seeking/risk taking. The dopamine receptor gene makes the molecule that the neurotransmitter ?dopamine? binds to.  Neurotransmitters are the chemical signals that the brain uses to connect nerves to cells in the body.        Your participation is voluntary: Your participation is entirely voluntary, so it is up to you to decide whether or not to take part in this study.  Before you decide, it is important for you to understand what the research involves.  This consent form will tell you about the study, why the research is being done, what will happen to you during the study and the possible benefits, risks and discomforts.   If you wish to participate, you will be asked to sign this form.  If you do decide to take part in this study, you are still free to withdraw at any time and without giving any reasons for your decision.   Please take time to read the following information carefully.  You may wish to discuss it with your family and friends before you decide.  Feel free to take this form with you to read and contact the researchers at a later date if you wish to participate.    Who is conducting the study: This project is being conducted by researchers in the School of Human Kinetics at UBC.  The investigators are not receiving any compensation for doing this research from any commercial organization.  You are welcome to request any details concerning the funding arrangements from the Principal Investigator.  Background:  A number of studies have implicated the dopamine receptor in personality and/or behavioural patterns such as sensation seeking or risk taking.  Based on twin and family studies, such personality traits may be highly hereditary. Common variations in the dopamine receptor gene have been reported as over-represented in individuals displaying certain behavioural traits in a number of studies, although the evidence for a functional role for the gene is inconclusive.  The genetic contribution to personality has not been studied in a sports context.   What is the purpose of the study? School of Human Kinetics 210, War Memorial Gym 6081 University Boulevard Vancouver, B.C., Canada V6T 1Z1 Tel: (604) 822-3838  Fax: (604) 822-6842  62 Objectives:  To determine whether there is a genetic association between sensation seeking/risk taking behaviours (in skiing and snowboarding), and genetic variants (alleles) in the gene encoding one of the dopamine receptors (DRD4).   The goals of the project that you are consenting to take part in are:  1) to determine the sport context behavioural patterns for each individual as measured by a ski/snowboarding behaviour questionnaire and to assess personality traits using an established personality questionnaire (ZKPQ); 2) to determine if there is an under/over representation of variants in the DRD4 among certain groups of skiers/snowboarders.  Who can participate in the study? Men and women between 19 and 40 years of age who are at least intermediate skiers or snowboarders.  The questionnaires are available in English.   Who should not participate in the study? Given the genetic component of the study, we wish to have only one member of a family (i.e. only one of mother, brother, sister).  Note: significant others are eligible.  What does the study involve?  The questionnaire component (stage 1) involves filling out a brief questionnaire on skiing/snowboarding behaviours and a standardized personality questionnaire (Zuckerman-Kuhlman Personality Questionnaire), this should take no longer than 25 minutes.  You will also be given the option to have one or two friends fill out an accompanying ?peer-review? questionnaire (brief, 5 minutes), which may be mailed at their convenience, postage provided.  If you feel uncomfortable answering any of the questions in the questionnaires, feel free to skip to the next one.   Buccal DNA sample (stage 2):  A sample of cells from the inner cheek will be collected using a cytobrush (Med).  This will feel similar to rubbing a firm toothbrush against your inner cheek.    Please Note:  This study does not involve an actual practical ski/snowboard component.  DNA banking (optional):   As gene variants are routinely being discovered that may influence personality constructs, the investigators would like to keep the DNA samples obtained as part of this study for future genetic analysis.  Declining to allow the investigators to ?bank? your DNA for future, sport-behavioural studies, IN NO WAY affects your participation in ?the relationship between genetics and skiing/snowboarding behaviours: variants in the Dopamine receptor gene? part of the project. If you agree to allow DNA banking, the researchers will not contact you for further consent. All guarantees of confidentially described in this consent form will apply to any future use of the DNA and you may ask to have your DNA sample destroyed at any time.    What are the possible side effects for participating in this study? There may be a very slight tingling or irritation in the inner cheek after the buccal swabbing.   What are the benefits of participating in this study?  There are no benefits for participating in this study; however, the final results for the study will be available to you if you indicate on the consent form that you would like follow-up information.  What happens if I decide to withdraw my consent to participate?  Your participation in this research is entirely voluntary.  You may withdraw from this study at any time without explanation. If you choose to enter the study and then decide to withdraw at a later time, all data collected about you during your enrolment in the study will be retained for analysis.    If you chose the option of allowing the researchers to bank your DNA samples for future, unspecified studies into the role of genetic variants in determining personality traits and sport-specific behaviours, you may withdraw from the study anytime and request that your DNA sample be destroyed.    Compensation for Injury Signing this consent form in no way limits your legal rights against the sponsor, investigators, or anyone else.    Will my taking part in this study be kept confidential?   63 Your confidentiality will be respected.  No information that discloses your identity will be released or published without your specific consent to the disclosure.  However, research records identifying you may be inspected in the presence of the Investigator or his or her designate by representatives of the UBC Research Ethics Board for the purpose of monitoring the research.  However, no records which identify you by name or initials will be allowed to leave the Investigators' offices. Everything (questionnaires, DNA samples, results) are coded and the key stored separately, so even in the event of a security failure in the lab or the office, it is highly unlikely that anyone could link you to the data.           Who do I contact if I want to know more about the study, or to discuss my results?  You are more than welcome to ask questions about the study at any time. Any of the investigators will be glad to discuss the results of the study with you.  We welcome your comments about any aspect of the study.  Please note that complex traits such as ?sensation seeking? behavior are likely influenced by many genetic and environmental factors, and, while we hope the data from our study will tell us about trends in populations, the data will not be very informative at the individual level (i.e. we will have to look at a lot of people to see a ?trend? for sensation seekers to have a specific genetic variant). The data that we will obtain from your DNA has no clinical utility or medical relevance.      Who do I contact if I have any questions or concerns about my rights as a subject during the study? If you have any concerns about your rights as a research subject and/or your experiences while participating in this study, contact the Research Subject Information Line in the University of British Columbia Office of Research Services  at 604-822-8598.  64 SUBJECT CONSENT TO PARTICIPATE  Project: The relationship between genetics and skiing/snowboarding behaviours: variants in the Dopamine receptor gene.  Principal investigator: Dr. Jim Rupert, School of Human Kinetics, UBC  Please initial the component(s) of the project in which you wish to participate.  I am consenting to participate in the questionnaire component of this project  _______________   I would like a copy of the results (provide an E-mail to which the results can be sent)__________  To participate in the  DNA banking component of the study, please read the box on the next page  ?  I understand that by signing this form, I am consenting to participate in the study. ?  I have had sufficient time to consider the information provided and to ask for advice if necessary.  ?  I have had the opportunity to ask questions and have had satisfactory responses to my questions.  ?  I understand that all of the information collected will be kept confidential and that the result will only be used for scientific objectives.  ?  I understand that my participation in this study is voluntary and that I am completely free to refuse to participate, or to withdraw from this study at any time. ?  I understand that I am not waiving any of my legal rights as a result of signing this consent form. ?  I have read this form and I freely consent to participate in this study.   ?  I have been told that I will receive a dated and signed copy of this form.   ?    Printed name of subject:__________________ Signature:__________________Date___________   Printed name of witness:__________________ Signature:_________________ Date___________  Printed name of principal  investigator/representative:_________________ Signature:_________________Date___________       65  Optional Voluntary Donation of Tissue for Unspecified Uses: Banking DNA samples  There are millions of common genetic variations in humans.  The researchers would like to keep the DNA samples that was made from the cheek sample that you gave us for use in other experiments similar to the DRD4 experiments described in this consent form.  This procedure is often called DNA banking and requires a separate consent.  Please read the following, and if you are willing to allow the researchers to bank your DNA, sign below.    Storage and future use of your DNA:  Your DNA will be stored in a secure lab at UBC and will not carry any personal identifiers (i.e. it will be coded by a number). Any future use of the DNA will be overseen by the Principal Investigator (Jim Rupert) listed in the consent form (i.e. the DNA will not be provided to other researchers - if Dr. Rupert is working with other investigators, the DNA samples will remain in his lab and under his control).  Before the DNA can be used for any future studies by Dr. Rupert, the proposed research will be evaluated and approved by the Clinical Research Ethics Board at UBC to confirm that the DNA is not being used for studies that differ from those to which you have consented.  No attempt will be made to link your DNA to that of any member of your family. The researchers are interested only in general population categories, not in individuals, families or pedigrees.   Consent for DNA banking  I agree that the researchers may use the  DNA sample obtained from me as part of this project in future similar studies of the role of genetics in behavioral traits (sensation/novelty seeking or risk taking) in sport.  I understand that the investigators will not contact me to request further consent for these studies and that the DNA may be kept indefinitely (unless I request that it be destroyed).  I understand that allowing my DNA sample to be banked for future studies is completely optional, and that declining to do so does not effect my participation in the other components of this study.        Printed name of subject:_____________________ Signature:_________________ Date_______________  Printed name of witness:_____________________Signature:_________________Date_______________  Printed name of principal  Investigator/representative:___________________Signature:_________________Date_______________   You are free to withdraw, without explanation, from the DNA banking component of the project anytime you wish.  To do so, simply contact Dr. Rupert (604) 822-8462 or rupertj@interchange.ubc.ca and request that your DNA sample be removed from the bank and destroyed.  66 APPENDIX E:  Peer consent         PEER REVIEW INFORMATION AND CONSENT FORM  Project: The relationship between genetics and skiing/snowboarding behaviours: variants in the Dopamine receptor gene.  Principal investigator:  Jim Rupert, PH.D.        School of Human Kinetics       Room 346 Wesbrook Building, UBC       Vancouver, B.C., CANADA V6T 1Z2       Phone (604) 822-8462   Fax (604) 822-9451                                        E-mail: rupertj@interchange.ubc.ca    Other investigators:   Mark Beauchamp, PH.D.; UBC School of Human Kinetics, Annex        Cynthia Thomson, M.Sc.; UBC School of Human Kinetics    Sponsor:         UBC Faculty of Education/School of Human Kinetics  Emergency Telephone Number: Dr Jim Rupert (as above) or cell (778) 386-0908    Introduction: Your friend, from whom you have received this package, has consented to participating in this research project regarding ski/snowboarding behaviours.  The goals of the project are to analyze sport behaviours using a ski-specific questionnaire, and a standardized personality questionnaire (ZKPQ); and to analyze whether an association exists between common variants in the dopamine receptor gene (DRD4) and sport-specific behaviours and personality types such as sensation seeking/risk taking. The dopamine receptor gene makes the molecule that the neurotransmitter ?dopamine? binds to.  Neurotransmitters are the chemical signals that the brain uses to connect nerves to cells in the body.      Your participation is voluntary: Your participation is entirely voluntary, so it is up to you to decide whether or not to take part in this portion of the study.  Before you decide, it is important for you to understand what the research involves.  This information form will tell you about the study, why the research is being done, about your role in the study if you choose to participate.    If you wish to participate, proceed with this information form and follow the instruction for filling out the attached questionnaire regarding your peer from whom you received this package (this should take no longer than 5 minutes).  If you do decide to take part in this study it will not affect the status of your friend?s participation in the study.  Please take time to read the following information carefully.  Feel free to take this form with you to read and contact the researchers at a later date if you wish to participate.   Who is conducting the study: This project is being conducted by researchers in the School of Human Kinetics at UBC.  The investigators are not receiving any compensation for doing this research from any commercial organization.  You are welcome to request any details concerning the funding arrangements from the Principal Investigator.  Background:  A number of studies have implicated the dopamine receptor in the personality/behavioural patterns.  Based on twin and family studies, the personality traits are highly hereditary. Common variations in the dopamine receptor gene have been reported over-represented in individuals displaying certain behavoural traits in a number of studies; although the evidence for a functional role for the gene is inconclusive.  The genetic contribution to personality has not been studied in a sports context.   What is the purpose of the study? Objectives:  To determine whether there is a genetic association between sport behaviours (in skiing and snowboarding), and genetic variants (alleles) in the gene encoding one of the dopamine receptors (DRD4). School of Human Kinetics 210, War Memorial Gym 6081 University Boulevard Vancouver, B.C., Canada V6T 1Z1 Tel: (604) 822-3838  Fax: (604) 822-6842   67  The goals of the project in which you are playing a role (and for which your friends has consented):  1) to determine the sport context behavioural patterns for each individual as measured by a ski/snowboarding behaviour questionnaire and to assess personality traits using an established personality questionnaire (ZKPQ); 2) to determine if there is an under/over representation of variants in the DRD4 among certain groups of skiers/snowboarders.  What does this portion of the study involve? The questionnaire component involves filling out a brief questionnaire on skiing/snowboarding behaviours of the friend by whom you were recruited.  Please Note:  This study will not involve an actual practical ski/snowboard component.   What are the benefits of participating in this study?  There are no benefits for participating as a peer-reviewer in this study.  Will my taking part in this study be kept confidential?  Your confidentiality will be respected.  No information that discloses your identity will be released or published without your specific consent to the disclosure.  Your answers will be kept confidential from the friend whom you are reviewing.  We will not tell the friend who recruited you whether you elected to participate in the study or what your answers to the questions were.   No information that discloses your identity will be released or published. Your name will not be kept on the actual questionnaire, so even if there is a security failure, your responses will remain confidential.      If you wish to participate please fill out the following questionnaire, detach it from this consent form (which is for your records) and mail the completed questionnaire to the researchers in the enclosed envelope.    Who do I contact if I want to know more about the study?  You are more than welcome to ask questions about the study at any time.  We welcome your comments and suggestions.   Please consider the following points before submitting the completed questionnaire.  I have had sufficient time to consider the information provided and to ask for advice if necessary.  I have had the opportunity to ask questions and have had satisfactory responses to my questions.  I understand that all of the information collected will be kept confidential and that the result will            only be used for scientific objectives.  I understand that my participation in this study is voluntary and that I am completely free to refuse to participate, or to withdraw from this study at any time. I understand that I am not waiving any of my legal rights as a result of signing this consent form. I have read this form and I freely consent to participate in this study.   I have been given a copy of this for my records.     BY RETURNING A COMPLETED QUESTIONNAIRE, YOU ARE CONSENTING TO BEING A PART OF THE STUDY.       THE QUESTIONNAIRE FOLLOWS ON THE NEXT PAGE.     68 APPENDIX F:  Peer CSSQ-S review form  Genetics of sport-behaviours:  Peer Review Form  Name:  will peel off this portion    Name of Friend/Participant:  will peel off this portion  (We are only asking you to provide your name to match this questionnaire with an identification code. Once the match has been made, your responses will be made anonymous (coded by ID number) your answers will not be shared with the subject whom you are reviewing.)  PLEASE ANSWER THE FOLLOWING QUESTIONS ABOUT YOUR FRIEND (NOT ABOUT YOURSELF).    Peer?s sport of choice:    Skiing       Snowboarding  Peer?s level of ability:       Beginner    Novice    Intermediate    Advanced            Expert *                         (*any terrain, *any condition)  Average number of runs skied by your friend in a day per difficulty grade: uni25CF____  filledbox____  diamond____  diamonddiamond_____  How many times have you skied/snowboarded with the subject?  <5    5-10    >10    Not sure.   Please complete the following questionnaire.  It is a sport-specific questionnaire containing 13 specific questions about the skiing/snowboarding behaviours of your friend.  Please take your time to read the questions and answer truthfully.  There are no right or wrong answers to any of these questions, so please just give your immediate response to the questions.  You may feel that in some cases questions are repetitive but please answer every question (unless you feel uncomfortable doing so). Remember that your responses will remain confidential and no one other than the researchers involved in this study will have access to your data.  SECTION I:  Please rate the extent to which you agree or disagree with the following statements. Circle the appropriate answer.             1    2    3    4    5 Strongly Disagree     Disagree    Neutral   Agree       Strongly Agree   1.  He/she likes to ski/ride fast.         1    2    3    4    5  2.  He/she likes to ski/ride down runs that he/she has never been down before. 1    2    3    4    5  3.  He/she likes to start a run even if he/she cannot see what lies ahead (e.g. big cornice). 1    2    3    4    5     69  4.  He/she likes to ski/ride out of bounds. 1    2    3    4    5  5.  He/she likes to attempt jumps even if he/she is not sure of the quality of the landing area. 1    2    3    4    5   6.  He/she likes to push his/her boundaries when skiing/riding. 1    2    3    4    5  7.  If he/she loses control, he/she doesn?t seem to immediately slow down, he/she just appears go with it. 1    2    3    4    5  8.  If the only way down is a straight line through a narrow pass, he/she would go for it without hesitation even if it means going fast. 1    2    3    4    5  9.  He/she is always trying to find new and exciting ways down a run. 1    2    3    4    5  10.  A 15-foot high drop off a cliff isn?t too high a jump for my friend. 1    2    3    4    5  11.  He/she slows down on busy runs. 1    2    3    4    5  12.  He/she doesn?t slow down on busy runs, instead he/she just appears to dodge people. 1    2    3    4    5 13.  If there is a ?danger of avalanche? sign, he/she will usually try to find another safer route. 1    2    3    4    5    THANK YOU FOR YOUR TIME.  PLEASE PLACE COMPLETED QUESTIONNAIRE (2 pages) IN PRE-STAMPED ENVELOPE.    70 APPENDIX G:  Recipes Lysis Buffer (DNA Isolation) 100 mM   NaCl 10 mM   TrisCl 25 mM   EDTA 0.5%     SDS   TBE Buffer (5x) 27 g    Tris base (s) 13.75 g  Boric Acid (s) 10 mL   EDTA (0.5 M) 490 mL  Water  TAE buffer (40x), Recipe for 4.0 liters, add to 3 litres of water:   1.6 M Tris     775.2 grams 0.52 M acetate   283.2 gram 80 mm EDTA   119.2 grams    pH to ~8.0 with acetic acid (about 200 mL will be required) and top up with H2O to a final volume of 4.0 litres  8% PAGE Gel 6.3 mL   Water 2.4 mL   5 x TBE  3.2 mL   Acrylamid/Bis (30%) 80 ?L    APS (10%, ammonium persulfate) 12 ?L    TEMED  2% Agarose Gel (Volume = 120mL) 120mL 1x TAE Buffer ~2.4 g of Agarose (s)  Microwave approximately 2 minutes until a light boil and solution has turned clear.  FspI, New England Biolabs, Beverly, MA, USA 8 ?l     PCR product 9.8 ?l     Water 2.0 ?L    NE Buffer 4 50mM potassium acetate 20 mM Tris-acetate 10 mM magnesium acetate 1 mM dithiothreitol 0.2 ?L    FspI  71 Incubate at 37 ?C for at least 3 hours.  Standard Polymersase Chain Reaction (1 reaction) 17.2 ?L   Water 2.5 ?L    10x PCR Buffer 0.9 ?L    MgCl2 0.2 ?L    dNTP 1.5 ?L    F3 Primer (10 pmol/?L) 1.5 ?L    R3 Primer (10 pmol/?L) 0.2 U    Taq DNA polymerase 1 ?L     DNA template  BIORAD (California) or G-Storm (Gene Technologies, Essex, UK ) Thermocycler Program STEP 1:  98 ?C    2 minutes STEP 2:  98 ?C (or 96?C)  45 s STEP 3:  62 ?C    45 s STEP 4:  72 ?C    2 minutes STEP 5:  Repeat Steps 2 -4, 39 times STEP 6:  72 ?C    10 minutes STEP 7:  4 ?C     Infinite   72 APPENDIX H:  Optimal PCR conditions for F4/R4 primer pair  The optimal PCR conditions cycled as follows: 95?C for 5 minutes, followed by 39 cycles of 94?C for 45s, 58?C for 45s and 72?C for 2 minutes, finally a chase for 10 minutes at 72?C.  The 25 ?L reactions contained 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.8 mM MgCl2, 0.2 ?M dNTP, 0.6 ?M of each primer, 1 U Taq, and 2.0 ?L DNA template (approximately 90 ng/?L).      73 APPENDIX I:  A scatter-plot of the total CSSQ scores against the ZKPQ ImpSS scores.     Impulsive Sensation Seeking Score20CSSQtotal5.004.003.002.001.00  74 APPENDIX J:  Normality and descriptive statistics for 13-item CSSQ.  CSSQ Item  Normality  Descriptive Statistics    Skewness  Kurtosis  Mean  SD  N Q1 Speed  -1.26  1.09  4.30  .89  200 Q2 Explore  -1.06  1.69  4.36  .72  200 Q3 Unknown  -.109  -.825  3.18  1.11  200 Q4 Out of Bounds  -.703  -.579  3.65  1.28  200 Q5 Quality of Jump  .484  -.444  2.28  1.03  200 Q6 Push Limits  -.747  .323  3.92  .90  200 Q7 Lost Control  .041  -.843  2.92  1.09  200 Q8 Straight Line  -.172  -.798  3.23  1.15  200 Q9 Novelty  -.734  -.099  3.96  1.00  200 Q10 Cliff Jump  .319  -1.247  2.60  1.38  200 Q11 (Slow Down)  .246  -.799  2.91  1.04  200 Q12 Dodge People  -.054  -.865  3.11  1.12  200 Q13 (Danger Avi)  .412  -.728  2.51  1.16  200  75 APPENDIX K:  Scree  plot test representing the percent of variance accounted for by each factor in the FA of the CSSQ.   Factor Number13Eigenvalue6543210Scree Plot     76 APPENDIX L:  Factor analysis of 13-item CSSQ: factor loadings, variances and communalities after ML extraction and varimax rotation.      CSSQ Item  Factor Loadings    Factor 1  Factor 2  Communalities Q1 Speed  .659     .503 Q2 Explore  .646    .419 Q3 Unknown  .560    .323 Q4 Out of Bounds  .730    .569 Q5 Quality of Jump  .530    .292 Q6 Push Limits  .731    .619 Q7 Lost Control  .540    .33 Q8 Straight Line  .640    .428 Q9 Novelty  .725    .555 Q10 Cliff Jump  .670    .475 Q11 (Slow Down)     .666  .507 Q12 Dodge People     .984  .999 Q13 (Danger Avi)  * < .4    .167        Eigenvalues  4.38  1.78   % explained variance  33.68  13.67             77 APPENDIX M:  Scree plot test representing the percent of variance accounted for the contextual sensation seeking factor in the 10-item CSSQ.   78 APPENDIX N:  ANOVA Peer CSSQ and 10-item CSSQ (between groups, df = 1).   CSSQ Item Sum of Squares Mean Square  F  p value Q1 speed  .65  .653  .792  .375 Q2 explore  .40  .395  .806  .371 Q3 unknown  2.06  2.065  1.562  .214 Q4 out of bounds  .40  .395  .217  .642 Q5 quality of jump  3.23  3.226  2.993  .086 Q6 push limits  .20  .202  .267  .606 Q7 lose control  4.27  4.266  3.317  .071 Q8 straight line  .07  .073  .056  .814 Q9 novelty  1.58  1.581  1.565  .213 Q10 cliff jump  .40  .395  .185  .668   79 APPENDIX O:  Pearson?s correlation of CSSQ-S and ZKPQ ImpSS        Total CSSQ-S  Total ImpSS Total CSSQ-S Pearson Correlation  1 .506**  Sig. (2-tailed)    .00  N  194 194Total ImpSS  Pearson Correlation  .506** 1  Sig. (2-tailed)  .00    N  194 195** Correlation is significant at the .01 level (2-tailed).   80 APPENDIX P:  Cronbach alphas and tests for normality of ZKPQ subscales using total scores from all subjects (N = 201).    Scale  ImpSS  Agg-Host  Neur-Anx  Soc  Activity Cronbach Alpha  .834  .708  .828  .757  .994 Mean Inter-item covariance  .040  .025  .039  .033  .024 Mean Inter-item correlation  .207  .120  .203  .157  .924 Skewness  -.270  .089  .813  -.048  -.130 Kurtosis  -.601  -.597  .001  -.578  -.819    81 APPENDIX Q:  Graphed distribution of ImpSS scores for males and females (N = 201).        82 APPENDIX R:  A representative picture depicting digested PCR products and assigned genotypes (16/4/08) A            B  Genotypes from left to right:  A 1-10: C/Ctriagup; T/T; C/T; C/T; C/T; T/T; C/Ctriagup; C/C; C/T; uncut control     B 11-20: n/a; T/T; T/T; C/C; C/C*; C/C; T/T; T/T; T/T; uncut control   Note:  (triagup)   Lanes 1 and 7 (Photograph A) were unclear and were re-cut and re-photographed to confirm genotypes.    (*)   Gel imperfections make lane 15 (Photograph B) difficult to call a C/C or C/T, however re-take photographs do not show evidence of the T allele.   83 APPENDIX S:  Raw data including genotype, ZKPQ ImpSS score, CSSQ score, peer CSSQ (if available).   Subject  Sex  Genotype ZkPQ  CSSQ  CSSQ ImpSS   Total  Peer 4  F  C/C  15  4.1   5  F  T/T  10  3.3   17  F  C/T  2  1.9   21  M  C/C  15  4   27  F  C/T  16  2.5  2.7 28  M  C/T  8  2.9   31  F  C/C  19  3   35  M  C/T  18  4   40  F  C/C  15  3.5   45  F  C/C  14  3.9   46  M  C/T  17  3.6   57  F  C/C  11  3.6   58  F  C/C  8  3.7  3.6 59  M  C/C  12  3.9  3.7 61  F  C/T  15  3.9  4.2 62  F  C/C  17  3.3  4 63  M  T/T  10  3  3.1 64  F  T/T  11  2.7  2.9 65  F  C/C  9  3.9  4.5 74  M  C/C  15  3.9   75  F  C/C  17  3   76  F  T/T  4  3   81  M  C/C  19  3.7  3.4 88  M  C/T  10  3.9   89  M  C/C  8  2.1  1.9 101  F  C/T  12  2.9   109  F  C/T  7  3   110  M  T/T  12  4   115  M  C/C  18  4.2   116  M  C/C  17  4.4   117  F  C/C  9  4   120  M  C/T  16  2.6   122  F  C/T  6  2.1  1.9 123  M  C/C  13  3.8  3.9 126  F  C/T  3  2.4  2.2 128  F  T/T  14  3.9      84 Subject  Sex  Genotype  ZkPQ  CSSQ  CSSQ       ImpSS   Total  Peer 129  M  C/T  14  3.8   132  M  C/T  14  4.3   133  F  T/T  10  2.5   138  M  T/T  18  3.1   143  M  C/C  13  4.4   146  M  T/T  16  4   149  M  C/C  15  4.5  4.1 155  F  C/T  13  2.6   156  M  T/T  12  3.8   162  M  C/C  16  3.8   165  M  T/T  12  3.8   169  M  C/T  4  3.5   191  M  C/C  17  3.9   216  M  C/C  12  4.6   220  M  C/T  12  3.9   230  M  C/T  13  3.6   233  F  C/T  5  1.9  2.1 235  M  T/T  13  3.6   242  F  C/C  10  2.7   249  M  C/T  12  4.2  4.6 251  F  T/T  12  2.8   254  F  T/T  11  3.8  5 258  F  C/C  18  3.9   259  M  T/T  17  3.4  3.7 261  F  C/T  6  2.7   263  M  C/C  9  3.2   264  M  T/T  11  4.3   270  F  C/T  11  2.6   274  F  C/C  13  3.5   276  M  C/T  14  4.1   279  M  C/T  13  4.1  3.4 281  F  C/C  12  3.5  3.3 287  M  C/T  14  4.1   297  F  C/T  14  3.4  3.4 305  F  C/C  4  1.8   316  M  T/T  16  4.5  4.5 331  F  C/T  11  3.3  2.2 340  F  C/T  19  2.3        85 APPENDIX T:  Sequencing data for ?C22? (CMMT/BCRI DNA Sequencing Core Facility, UBC, Vancouver).                                                        TGGAGGGTGCGCACGAGGCGAGTCA                                 -521 C/T             Legend: Black   G Red   T Green  A Blue   C    86 APPENDIX U:  Pyrosequencing result.  Position 2 shows a C/C genotype, exhibited by the higher peak upon dispensation of the C nucleotide.          87 APPENDIX V:  Expected allele frequencies    Pop 1 = Swedish population (Jonsson et al., 2002): allele C = .42, allele T = .58. Pop 2 = Caucasian Canadian population (current study): allele C = .58, allele T = .42.  2x2 Contingency Table   Observed Allele Count   C  T Pop 1  314  422 Pop 2  86  62   Expected Allele Count   C  T Pop 1  333  403 Pop 2  67  81  (Vassar Stats online, http://faculty.vassar.edu/lowry/VassarStats.html)    88 APPENDIX W:  Example of block design for two-way ANOVA using ImpSS scores     Genotype Sex  C/C  C/T or T/T Male  15     8  10    12     18  12    15     17  18    19     10  16    8     16  12    18     14  12    17     14  13    13     4  17    13     12  11    15     13  16    16     12       17     14       12     13       9     14      Genotype Female  C/C  C/T or T/T    15     2  11    19     16  4    15     15  14    14     12  10    11     7  12    8     6  11    17     3       9     13       17     5       9     6       10     11       18     14       13     11       12     19       4     10       89 APPENDIX X:  One-way ANOVA blocked by sex.   Sex  Source Dependent Variable Type III Sum of Squares  df Mean Square  F  Sig. Partial Eta Squared Observed Power(a) Male  Genotype  ImpSS  9.70  1  9.70  .92  .345  .02  .15     CSSQ Total  .15  1  .15  .52  .473  .01  .11    Error  ImpSS  381.69  36  10.60                 CSSQ Total  10.50  36  .29            Total  ImpSS  7371.00  38                    CSSQ Total  560.13  38           Female  Genotype  ImpSS  60.90  1  60.90  3.12  .086  .08  .40     CSSQ Total  3.08  1  3.08  8.53  .006  .20  .81    Error  ImpSS  662.74  34  19.49                 CSSQ Total  12.28  34  .36            Total  ImpSS  5235.00  36                    CSSQ Total  356.99  36           *significant at alpha = .05, **significant at alpha = .001, (a) computed using alpha = .05 SS ? Sum of Squares, eta2 = eta squared measures effect size    

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
Turkey 21 0
United States 16 0
China 16 0
France 10 0
Canada 9 4
Netherlands 7 0
Australia 6 0
Hungary 4 0
Russia 3 0
Poland 3 0
United Kingdom 2 3
Egypt 1 1
Israel 1 0
City Views Downloads
Unknown 37 3
Beijing 9 0
Istanbul 8 0
Guangzhou 7 0
Budapest 4 0
Vancouver 4 4
Amsterdam 4 0
Plano 3 0
Québec 3 0
Leiden 3 0
Ashburn 3 0
Moscow 2 0
Washington 2 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066565/manifest

Comment

Related Items