Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Comparison of pregnancy rates, progesterone concentrations, and expression of genes associated with progesterone… Balendran, Anusha 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_fall_balendran_anusha.pdf [ 716.29kB ]
Metadata
JSON: 24-1.0066553.json
JSON-LD: 24-1.0066553-ld.json
RDF/XML (Pretty): 24-1.0066553-rdf.xml
RDF/JSON: 24-1.0066553-rdf.json
Turtle: 24-1.0066553-turtle.txt
N-Triples: 24-1.0066553-rdf-ntriples.txt
Original Record: 24-1.0066553-source.json
Full Text
24-1.0066553-fulltext.txt
Citation
24-1.0066553.ris

Full Text

COMPARISON OF PREGNANCY RATES, PROGESTERONE CONCENTRATIONS, AND EXPRESSION OF GENES ASSOCIATED WITH PROGESTERONE SYNTHESIS IN HEIFERS AND MATURE COWS by  ANUSHA BALENDRAN B.V.Sc University of Peradeniya, Sri Lanka, 2001  A THESIS SUMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE  In  THE FACULTY OF GRADUATE STUDIES (Animal Science)  THE UNIVERSITY OF BRITISH COLUMBIA (VANCOUVER)  August 2008  © Anusha Balendran, 2008  ABSTRACT It has been reported world wide that over the past fifty years production has dramatically increased in dairy cattle but at the same time fertility rates have steadily declined, particularly in mature cows. Fertility of heifers that were bred for the first time has not been affected. One of the major reasons for such fertility decline in mature cows could be impaired progesterone production. Therefore relationships of parity with reproductive performance, its effect on progesterone concentrations and genes associated with progesterone synthesis were examined in this thesis. In the first experiment, breeding records of 163 Holstein heifers and cows in 1st, 2nd, and 3rd/4th parities were used to compare pregnancy rates among heifers and parity cows and between parity cows. Progesterone levels of heifers, 1st, 2nd, and 3rd/4th parity (10 animals each group) were measured from milk and blood samples. First and second inseminations pregnancy rates were higher in heifers compared to other parity cows. Furthermore 1st parity cows showed higher pregnancy rates than 2nd and 3rd/4th parity cows. However, P4 levels were not significantly different among animals of different parity. In the second experiment, expression levels of steroidogenic genes – StAR, P450scc, 3-β HSD; apoptotic genes Bax and Bcl-2; and HSP70 in corpus luteum obtained from six heifers and three 2nd/3rd parity lactating cows were compared using RT-PCR. Relative optical density with house keeping gene was obtained for each gene. Analysis of variance revealed that expression levels of steroidogenic and Bax genes are higher (p<0.05) in cows than heifers. HSP70 gene and Bcl-2 gene expressions were not different (P>0.05) between the two groups.  ii  This study confirmed a clear relationship between parity and reproductive performance. There was no significance relationship between parity and circulating progesterone levels. Steroidogenic genes expression was higher in lactating cows than heifers and no differences were seen in mRNA levels of Bcl2, and HSP70 genes between heifers and mature cows. Bax mRNA expression was higher in mature cows suggesting that the lifespan of corpus luteum may be compromised in 2nd and 3rd parity cows, resulting in early embryonic mortality and reduced pregnancy rates.  iii  TABLE OF CONTENTS  ABSTRACT ………………………………………………………………….……….....ii TABLE OF CONTENTS ……………………………………………………………....iv LIST OF TABLES ………………………………………………………………….....viii LIST OF FIGURES ……………………….……………..………………….………….ix ABBREVIATIONS …………….………………………………………………………..x ACKNOWLEDGEMENTS ...................................................................................…....xv DEDICATION ………….……………………………………………………….….…xvi CO-AUTHORSHIP STATEMENT …………………………………...…………….xvii CHAPTER 1 ……….…………………………………………………………….………1 GENERAL INTRODUCTION AND LITERATURE REVIEW 1.1. GENERAL INTRODUCTION ………………………………….………..1 1.2. LITERATURE REVIEW ……………………………………….…….......4  I. Dairy fertility and production ……………………………………….......4  1.2.2. Current status of dairy fertility and production ……….……………4  II. Estrous cycle in the bovine ................................................................…...7  1.2.2. Bovine estrous cycle …..……………………………………….......7 1.2.3. Folliculogenesis, recruitment, and selection ………………………8  iv  1.2.4. Hormonal control of estrous cycle ………………………………....9 III. The corpus luteum ..........................................................................…...17 1.2.5. History ….…….………………………………………….………..17 1.2.6. Formation, structure, and function ...........................................…...17 1.2.7. Angiogenesis …….….….………………………….…………...…20 1.2.8. Luteal steroidogenesis ………………………………………...….21 1.2.9. Regulation ……………………………………………………..….23 1.2.9.1. Hormonal regulation ………..……….………………..……24 1.2.9.1.1. Luteinizing Hormone ………………………………24 1.2.9.1.2. Growth Hormone ………………………………..…26 1.2.9.2. Local regulation ……………………….…………………...27 1.2.10. Regression of the corpus luteum …….…………………………..28 1.2.10.1. Functional luteolysis ….........................................................29 1.2.10.2. Structural luteolysis …………………..……………………32 1.2.11. Maternal recognition of pregnancy ………………………….…..34 1.3. RATIONALE AND HYPOTHESIS ………………………………..…….37 1.4. SPECIFIC OBJECTIVES ……………………………….……………….37 1.5. REFERENCES …………………………………………………………….38 CHAPTER 2 ....................................................................................................................48 COMPARISON OF PREGNANCY RATES AND PERIPHERAL PROGESTERONE LEVELS BETWEEN DAIRY HEIFERS AND MATURE COWS 2.1. INTRODUCTION ……………………………………………….…..…48 2.2. MATERIALS AND METHODS ……………………………………....51  v  2.2.1. Animals and management ……..……………………….……..51 2.2.2. Breeding …………………………………………….….……..51 2.2.3. Blood and milk sample collection for progesterone measurement …………………………………………….......…52 2.2.4. Radioimmunoassay for progesterone measurement …………..52 2.2.5. Reproductive status of the animals based on progesterone concentrations ……………….…………………..53 2.2.6. Statistical analysis ………………………………..…….……..53 2.3. RESULTS ………………………………………………………...……..54 2.4. DISCUSSION …………………………………………………………...55 2.5. CONCLUSION …………………………………………………….…...59 2.6. REFERENCES ….……………………………………………………….64 CHAPTER 3 ……….………………………………………………………………….70 COMPARISON OF EXPRESSION LEVELS OF GENES ASSOCIATED WITH PROGESTERONE SYNTHESIS IN DAIRY HEIFERS AND MATURE COWS 3.1. INTRODUCTION ………………………………………….…………..69 3.2. MATERIALS AND METHODS ………………..……………………..73 3.2.1. Animals and treatment …………………………………….......73 3.2.2. Corpus luteum enucleation ………………………………..…..73 3.2.3. Processing of corpus luteal tissues …………..………………..74 3.2.4. RNA isolation ……………………………………………..…..74 3.2.5. Semi-quantitative Reverse Transcription-Polymerase Chain Reaction ………………………………………………...75 3.2.5.1. Reverse transcription …………………………….…...75 3.2.5.2. Gene specific PCR amplification ……...……………..76  vi  3.2.6 Statistical analysis ……………………………………………….78 3.3. RESULTS …………………………………………………………….....78 3.3.1  RNA quality …………………………………………....78  3.3.2  Expression levels of luteal steroidogenic genes in heifers and lactating cows ……...………………….…..78  3.3.3  Expression levels of luteal apoptotic genes in heifers and lactating cows ……………………………..79  3.3.4  HSP70 mRNA expression in heifers and lactating Cows ……………………………….…………..………79  3.4. DISCUSSION...……….…………………………..……………………...80 3.5. CONCLUSION …..….……..……………………………………………86 3.7. REFERENCES ....……………………………………………………......92 CHAPTER 4 …….……………………………………………………….….……..….97 GENERAL DISCUSSION AND CONCLUSIONS 4.1. GENERAL DISCUSSION …….……………………………….……..…97 4.2. GENERAL CONCLUSIONS ………………………………………..….99 4.3. REFERENCES.………………………………………………………....101  vii  LIST OF TABLES Table 2.1.  Comparison on progesterone levels among cows of different parity …...60  Table 3.1.  Spectrophotometry results for RNA samples ……………..…………….87  Table 3.2.  Primers used in the RT-PCR amplification of specific mRNA transcripts of luteal tissue in heifers and cows ………………………………….…..88  viii  LIST OF FIGURES Figure 1.1. Figure 1.2.  Endocrine events of bovine estrous cycle ………………………….……13 Schematic diagram of bovine ovarian follicular wave dynamics ……….14  Figure 1.3.  Follicular waves and gonadotropin (LH & FSH) changes in bovine estrous cycle ……………………………………………………..………………15  Figure 1.4.  Hypothalamus, anterior ovary and uterus interrelationships …………....16  Figure 1.5.  Biosynthesis of progetserone in a generic luteal cell …..………………..35  Figure 1.6.  Possible endocrine interactions that contribute to luteolysis in cattle …..36  Figure 2.1  First insemination pregnancy rates ……………………………….……..61  Figure 2.2.  First and second insemination pregnancy rates …………...…………….61  Figure 2.3.  Comparison of progesterone levels among cows of different parity….....62  Figure 2.4.  Pregnant Vs Non pregnant P4 levels ………………………………….....63  Figure 3.1.  Gel images showing expression levels of target genes in lactating cows and heifers …………………………………………………………….....89  Figure 3.2.  Relative abundance of steroidogenic genes in lactating cows and heifers………………………………………………………………….....90  Figure 3.3.  Relative abundance of apoptotic and HSP70 genes in lactating cows and heifers ………………………………………………………………..…..91  ix  ABBREVIATIONS µg  microgram  µl  microlitre  µM  micrometer  µM  micromolar  0  degrees centigrade  C  3-β HSD  3-β-hydroxysteroid dehydrogenase  AA  arachidonic acid  AA-CoA  arachidonyl-C  AC  adenyl cyclase  AI  artificial insemination  AKR1B5  Bovine Prostaglandin F synthase  Ang II  angiotensin II  ANPT-1  angiopoietin-1  ANPT-2  angiopoietin-2  APOA1  Apolipoprotein A-1  ARTISt  acyl CoA thioesterase  ATP  adenosine triphosphate  BP  binding protein  Ca2+  calcium ions  cAMP  cyclic adenosine monophosphate  cDNA  complementary or copy DNA  Cl-  Chloride ions  x  CL  corpus Luteum  COLIA2  Alpha2 collagen  COX  cyclooxygenase  CTP  cytidine triphosphate  DEPC  diethylpyrocarbonate  DF  dominant follicle  DNA  deoxyribonucleic acid  dNTP  deoxynucleoside triphosphate  E2  estradiol  EC  endothelial cells  ECM  extra cellular matrix  EEF1A  Elongation factor  EGF  epidermal growth factor  EPOX  epoxygenase  ER  estradiol receptors  ET-1  endothelin-1  FGF-1  fibroblast growth factor-1  FGF-2  fibroblast growth factor-2  FSH  follicular stimulating hormone  g  gravity  GH  growth hormone  GHR  growth hormone receptor  GnRH  gonadotropin-releasing-hormone  xi  GTP  guanosine triphosphate  HCl  hydrochloric acid  HDL  high density lipoproteins  HSD3B  3-beta-hydroxy-5 steroid dehydrogenase  HSP70  Heat shock Protein-70  I  iodine  IFN-τ  Interferon-τ  IGF-1  insulin-like growth factor- 1  IGF-2  insulin like growth factor- 2  IGFBP  insulin-like growth factor binding protein  IM  intra muscular  IU  international unit  KCl  potassium chloride  kDa  kilodalton  L  liter  LDL  low density lipoproteins  LH  luteinizing hormone  LLC  large luteal cells  LPOX  lipoxygenase  LTC4  Leukotriene C 4  MDFs  EGF/IGF-1/macrophage derived factors  mg  milligram  MgCl2  magnesium chloride  xii  MHz  megahertz  min  minute  ml  milliliter  Mm  millimeter  M-MLV  moloney murine leukemia virus  mRNA  messenger ribonucleic acid  n  number  ng  nanogram  NO  nitric oxide  OD  optical density  OT  oxytocin  OTR  oxytocin receptor  OvF  ovulatory follicle  P4  progesterone  P450  cytochrome P-450scc  PGE2  prostaglandin E2  PGF2α  prostaglandin F 2α  PKA  Protein Kinase A  PKA  protein kinase A  PKA  protein kinase A  PKC  protein kinase C  PLC  inositol- phospholipid- specific- phospholipase- C  PR  pregnancy rates  xiii  RIA  radio immuno assay  RPL10  Ribosomal protein  RT-PCR  Reverse Transcription-Polymerase Chain Reaction  SLC  small luteal cells  SPARC  Osteonectinn  StAR  steroidogenic acute regulatory protein  TGF  transforming growth factors  TIMP2  metalloproteinase inhibitor mRNA  TNF  tumor necrosis factor  TTP  thymidine triphosphate  VEGF A  vascular endothelial growth factor A  VIM  Vimentin  VLDL  very low density lipoproteins  xiv  ACKNOWLEDGEMENTS I am ever grateful to God, thank you making everything that is wonderful. It is with great delight that I acknowledge my debts to those who have contributed immensely to the success of this thesis. First and foremost I would like to express my deep and sincere gratitude to my supervisor, Dr. R. Rajamahendran. His wide knowledge and his logical way of thinking have been of great value for me. His understanding, encouraging and personal guidance have provided a good basis for the present thesis. I would like to register my sincere thanks to my supervisory committee members, Dr. K. M. Cheng, Faculty of Land and Food Systems and Dr. S. Graham, Faculty of Land and Food Systems for their tremendous guide through out my research period. My deepest appreciation should go to Dr. G. Giritharan who has been a colleague, well wisher and helped me in everything from the beginning till end of my study period. I am also grateful to my colleagues Ravinder Singh, Miriam Gordon, Pretheeban Thavaneetharajah, and Ruwanie Perera for their collaboration and especially my thanks go to Ravinder Singh, for being a good friend and editing my thesis. I deeply appreciate the unlimited and endless support and assistance offered by Sylvia Leung. Also appreciation goes to Dorathy Cheung. Many thanks to the rest of the faculty and university staff for their cooperation and assistance during my stay in this faculty. This research would have never been realized without my husband Jayakanthan’s continuous support, warm encouragement, understanding and love. Also I thank my little son Abhinavan for his cooperation. I wish to extend my warmest thanks to all family members and friends those who have helped me with my research in order to complete this successfully.  xv  DEDICATION I dedicate this thesis in honor of my late grand parents, Mr. & Mrs. Visakasuntharam, especially grand father, who taught me the value of education, and my mother, Suthanthira devi who made sacrifices for her children so that we could have the opportunity what she did not have. I wish to place a special dedication to my family, dear husband Jayakanthan, who has been a great source of motivation and inspiration and shinning little son Abhinavan, who keeps me constantly cheerful with his charming jovial state. I also dedicate this thesis to my only sister Vani. Finally, I also would like to dedicate this thesis to my uncle late Dr. V. Kunanandam, who supported me all the way since from the beginning of my studies.  xvi  CO-AUTHORSHIP STATEMENT A version of Chapter two of this thesis has been submitted for publication. Balendran, A., Gordon, M., Pretheeban, T., Singh, R., Perera, R., and Rajamahedran, R. 2008. Decreased fertility with increasing parity in lactating dairy cows. Canadian Journal of Animal Science. This project was initiated by Dr.R.Rajamahendran (supervisor). A.Balendran began literature review and designed the project. Then it was revised by Dr.R.Rajamahendran. M.Gordon helped in animal handling and treatments. Radio Immuno Assay was performed by A.Balendran. Statistical analysis was performed by A.Balendran. Manuscript was edited by T.Pretheeban, R.Singh and R.Perera. Through all stages of the project, Dr. R.Rajamahendran provided helpful discussions and clarified many of the biological details. A version of Chapter three of this thesis will be submitted for publication. Balendran, A., Singh, R., Giritharan, G., Pretheeban, T., and Rajamahendran, R. Comparison of expression levels of genes associated with progesterone synthesis in dairy heifers and mature cows. This study was initiated by Dr.R.Rajamahendran. A.Balendran performed literature review and designed the study. Dr.R.Rajamahendran helped in animal treatments and performed surgery. Tissue processing and all the laboratory procedures were performed by A.Balendran. Primers were designed by A.Balendran. Results were interpreted by A.Balendran under G.Giritharan’s guidance. Manuscript was edited by R.Singh and T.Pretheeban.  xvii  CHAPTER 1 GENERAL INTRODUCTION AND LITERATURE REVIEW 1.1. GENERAL INTRODUCTION Reproductive losses have a larger impact on the economy of the dairy industry (Darwash et al., 1997). Studies suggest that to maximize profit in a typical dairy cattle operation, reproduction should receive the greatest emphasis. Thus, fertility is a major determinant of cattle industry. In dairy cows, fertility is defined as the ability of the animal to conceive and maintain pregnancy when served at the appropriate time in relation to ovulation (Pryce et al., 2004). Failure to establish a successful pregnancy could arise from failure to show or detect estrus, failure to ovulate, inappropriate patterns of ovarian cyclicity, and embryo or fetal loss (Bilodeau-Goeseels and Kastelic, 2003). Several reports indicate worldwide decline in milk cow numbers whereas increase in milk production (Jorritsma et al., 2003; Pryce et al., 2004; Moore and Thatcher, 2006). Reproductive decline in dairy cows began in the mid-1980 and may be continuing on modern dairy farms (Lucy, 2001). An immense increase in milk yield experienced by dairy cows in last 25 years has been happening simultaneously with this reduction in fertility. For example, in last hundred years United States dairy industry shows sharp reduction cow numbers with six fold increase in production (Coppock, 2000) There is evidence from field data to suggest that selection for milk yield has led to deterioration in the fertility and consequently to shorter life span in lactating dairy  1  cows (Berry et al., 2003; Veerkampa et al., 2003 & 2007). The causes for this decline in reproductive efficiency are not known, but physiological, genetic and management factors are all contributing considerations (Stevenson, 2001; Lo´pez-Gatius et al., 2006). Female fertility refers to the ability to conceive, carry to the term and able to have viable offspring. Therefore, among the physiological and genetic factors, ovarian functions with respect to both follicular and corpus luteum (CL) development have been identified as key factors in improving reproductive performances. Uterine environment also plays a major role in female fertility. Uterus which is appropriately conditioned by ovarian hormone predominantly determines the successful of pregnancy (Rogers, 1992). Predicting the fertility of bulls is an area of research that has been active for sometime and which is on going. For the most part, prediction of female fertility has been not developed very well even though it plays a vital role in the economics of any dairy cattle operation. Artificial insemination studies revealed that fertility of heifers has remained relatively constant at approximately 65% (first service conception), whereas the first service conception rate for lactating cows has decreased dramatically 33% from 60-40% (Nebel, 2002). Therefore fertility studies in heifers and mature cows may reveal useful information to the dairy industry. In cattle, field fertility assessment, can be performed by number of ways such as recording interval to first service, days open, calving interval, conception rate to first service, and number of services per conception. These are traditional fertility parameters, can be biased by management decisions (Royal et al., 2000). Alternatively, physiological fertility parameters can be provided by measurement of  2  milk progesterone levels (Royal et al., 2000). These indicate when an animal ovulates, reflects the formation and lifespan of CL, whether estrous cyclicity is typical, and a pregnancy is maintained. One of the advantages in using physiological measures is that they are more indicative of the cow’s inherent ability to be fertile. The CL plays a pivotal role in mammalian reproduction. CL is a source of progesterone (P4) which is necessary to maintain pregnancy. In almost all, eutherian mammals CL provides P4 support at least for the first trimester of pregnancy. In large domestic ungulates, like in cattle, sheep, goats, pigs, and horses, the CL is needed for at least the first 60 days of the gestation (Silvia, 1999). CL is a transient endocrine gland. It grows, develops and reaches structural and functional maturity by mid-luteal phase and then begins to regress and completely absorbed into ovarian stroma in a non-fertile cycle. Both its structure and function are important for the successful pregnancy (Niswender et al., 2000). In cattle, P4 a steroid hormone, which is a primary secretary product of CL, is essential for the regulation of estrous cycle, establishment and maintenance of pregnancy (Schams and Berisha, 2004; Casey et al., 2005). During pregnancy for at least 200 days embryo and fetus are dependent on luteal P4 (Lo´pezGatiusa at al., 2004). A significant proportion of pregnancy failure (30-40%) and infertility problems in cattle have been attributed to sub-optimal functioning of the CL following ovulation (Hommieda et al., 2004; our lab). Sub- optimal function refers either inadequate P4 synthesis or premature luteal regression. It has been reported that several P4 synthesis associated genes expressed in CL. Although there are few field studies to address this problem of reduced pregnancy rate in cows, but not very many studies have been done at the molecular  3  level. Therefore, fertility assessment and the study of differential expression levels of genes associated with P4 synthesis in heifers and mature cows may bring answer for the pregnancy difference among these two groups.  1.2. LITERATURE REVIEW This chapter provides background information pertaining to this thesis, and is presented in three parts. Part I covers on current status of dairy fertility and production and part II gives an overview of bovine estrous cycle. Part III covers corpus luteum (CL) development, function, and its demise in cattle. The rationale for the present study, general hypothesis tested, and the objectives of the study are presented at the end of this section.  I. Dairy fertility and production 1.2.1. Current status of dairy fertility and production The world dairy sector is important to millions of farmers and workers as well as thousands of companies all over the world. Millions of tones of milk are processed every day into dairy products and food ingredients. In 2004, world wide cow’s milk represents 84% (514 million tones) of total milk production while the remaining supply comes from goats, sheep and buffalo. Since 1999, world milk production has grown by 7.6% or 43 million tones. The European Union (EU 15) leads the world in cow milk production, with 23% of the total, followed by North America with 19%, Asia with 14% and the Commonwealth of Independent States (CIS) with 10% (Canadian Dairy Industry Profile, 2005).  4  The agriculture and agri-food sector plays an important role in the Canadian economy, providing one in eight jobs in Canada and accounting for 8% of the total Gross Domestic Product in 2006 (A overview of the Canadian Agriculture and Agri-Food system 2007). Dairy farming is one of Canada’s most important agricultural activities, which ranks fourth in the Canadian agricultural sector (Canada’s dairy industry at a glance 2005). Canadian milk and dairy products are world-renowned for their excellence quality. In 2005, dairy production generated total net farm receipts of $4.8 billion (Canada’s dairy industry at a glance 2005). The decline in reproductive performances in high producing dairy cows has been widely reported with various studies around the world (Mackey et al., 2007). For example about fifty years before conception rates for lactating dairy cows were >50%. In 1970s rates were about 50% and in 1940s they were 40% or less (Sartori et al., 2002). The average Canadian dairy herd culling rate is increasing every year, from 20% in 2003 to 28% in 2006. The culling rate in western Canada is approximately 33%. For the dairy cows the largest single reason (approximately 30%) for culling is reproductive failure (Agricultural and Agri-Food Canada). The average first service conception rate in dairy cows is only 30%. In Canada, the numbers of dairy farms have fallen significantly over the past 25 years from 31, 200 in 1991/92 to 14, 660 in 2006/07 (Agricultural and Agri-Food Canada). During the same period, the national dairy herd has declined 40%, while total milk production increased slightly due to the benefits of research including improvements in genetics, animal feed and disease control and farm technologies. In 1980, total Canadian milk production was 71.9 million hectoliters while it was 75.9 million  5  hectoliters (at 3.6 kilograms of butterfat per hectoliter) in 2004. Despite of the increase in milk production total number of milk cows were declined from 1,773,000 in 1980 to 1,057,000 in 2004 (Canadian Dairy Industry Profile, 2005). There has been dramatic increase in productivity of cows over the past decades at the expense of fertility. It has now been recognized that long term selection for high milk production in dairy cattle is generally accompanied by reduced fertility and reduced health (Berry et al., 2003). Several studies from all over the world show increased production has a negative genetic correlation with reproductive performance. Continued genetic gain in production traits, declined the fertility. It's suggested that for every 1,000 kilogram increase in milk production, average days open go up by eight days (Murray, 2003). Canada’s rate of genetic gain for production, including milk volume and components, is among the highest in the world. Genetic correlations between calving interval and milk, fat and protein yields were moderately high: between 0.56 and 0.61. This means higher production has a strong positive genetic relationship to increased calving interval (Murray, 2007). The economic loss is valued at $4.70 per cow for each day that calving is delayed beyond 12.5 months and this amounts to a projected loss of $25 million in Alberta and British Columbia alone (Rajamahendran, 2007). Selection for milk yield has changed the endocrine profiles of the cow which favors the blood concentration of hormones for lactation (Nebel and McGilliard, 1993). It has been suggested that approximately 50% of the progress in milk yield can be attributed to genetics and the remaining 50% can be attributed to improved environmental factors such as better nutrition, housing, health and management (Lo´pez-Gatius et al., 2006).  6  II. Estrous cycle in the bovine 1.2.2. Bovine estrous cycle. The cow is a non-seasonal poly-estrus species. The bovine estrous cycle is a dynamic process (Figure 1.1). The growth and development of follicles and corpus luteum are highly regulated by secretion and pattern of different hormones. Estrus is defined as the time the cows show sexual desire and acceptance of male by standing to be mounted (Bearden and Fuquay, 1992). Estrous cycle is defined as the interval between the two estrus periods (Dhali et al., 2005). The average length of estrous cycle in mature cows is 21 days with the range of 18-23 days. (Rioux and Rajotte, 2004; Scho et al., 2007). Cows have continuous estrous cycles throughout the year unless interrupted by pregnancy or pathological conditions. The estrous cycle is continuous but for better understanding it can be broken into four stages- proestrus, estrus, metestrus and diestrusFigure 1.1 (Kappel et al., 2007; Shearer, 2003). Proestrus occurs 2-3 days before estrus, on the day 19-21 of the cycle lasts for 3 days. It starts with luteal regression and reduction in P4 levels. This period is characterized by follicular growth and estradiol-17β (E2) production (Shearer, 2003). Estrus is the period of sexual desire; the average duration is 18 hours and may vary from 18-24 hours is considered normal. Ovulation take places 12 hours after the end of estrus (Shearer, 2003). Animals in estrus show distinctly different behavioral characteristics from rest of the animals. The primary sign of estrus is standing to be mounted. The secondary sings of estrus are discharge clear mucus originates from cervix and uterus, mounting other cows, restlessness, swelling and reddening of vulva, hair loss and dirt marks on the tail head, blood stain on tail head or vulval area, decreased feed intake and milk yield (Diskin and Sreenan, 2000). Metestrus lasts for 5 or 7 days  7  occurs in the day 1-3 of the cycle. This is the period where ovulation occurs (Shearer, 2003). Diestrus is the lengthiest period occurs on the day 5-18 of the cycle lasts for 10-15 days with functional CL with increasing P4 production. If pregnancy occurs, the CL will be maintained throughout the pregnancy period, if not CL will be maintained for 17 or 18 days, there after animal will enter into next estrous cycle (Shearer, 2003).  1.2.3. Folliculogenesis, recruitment, and selection. In mammalian female ovaries the final number of oocytes available for the reproduction of next generation is defined at birth (Pepling, 2006). Follicles are a structural and functional unit of the ovary which gives suitable microenvironment for the growth and development of oocyte (Itoh et al., 2002). Primordial follicles are follicles containing single oocyte surrounded by squamous follicular epithelial cells established during embryonic development (Hansel and Convey, 1983). Among follicles only a limited number of them (less than 1%) will ever reach ovulation; others will undergo atresia (Senbon et al., 2003). Folliculogenesis is defined as formation of graffian follicle (mature or preovulatory follicle) from pools of primordial follicles (Spicer and Echternkamp, 1986). In cattle, primordial follicle number is stable about 133,000 in the first 4 years of life then it declines to 3000 in 15-20 years of life. Bovine estrous cycle normally shows two waves follicular cycle mostly in cows or three waves follicular cycle mostly in heifers (Rajamahendran et al., 1994). Each wave contains recruitment of follicle cohort and selection of few 2-5 follicles from cohort which will grow continuously to medium size which is beyond 4mm in diameter. Among selected follicles finally dominant follicle (DF) will further grow up to 10-20mm in  8  diameter in size while other subordinate follicles will become atretic and degenerated (Crowe, 1999; Evans, 2003). DF can suppress the growth of other follicles and ovulate with the appropriate hormone treatment at the appropriate stage of the cycle (Ireland et al., 2000). In two follicular waves cycle the first wave starts around days 3 and 4 of the estrous cycle and results non-ovulating follicle; and the second wave starts between days 12 and 14 of the cycle resulting in ovulatory follicle (Ireland et al., 2000). In three follicular waves, cycle begins around days 2, 9, and 16 (Evans, 2003). DF of the last wave undergoes ovulation in both follicular waves’ cycles which means, if the DF formed during follicular phase will under go ovulation, if it is formed in luteal phase will undergo atresia (Crowe, 1999). Therefore each wave ends with ovulation or atresis of DF. Follicular events are shown in Figure 1.2.  1.2.4. Hormonal control of estrous cycle Estrous cycle generally can be divided into two phases, follicular phase lasting for 3-4 days and luteal phase approximately 17 days in length. During estrous cycle, the growth and development of follicles and CL are regulated by changes in the secretion and patterns of different hormones (Perry, 2000). Hypothalamo-pituitary-ovarian axis and the hormones produced at each level of the axis are responsible for the morphological changes as well as behavioral changes during estrous cycle Figure 1.2. and Figure 1.3. Gonadotropin-releasing-hormone (GnRH) the main neuroendocrine reproductive hormone secreted by hypothalamus initiates synthesis and releases of gonadotropins-  9  Luteinizing hormone (LH) and Follicular stimulating hormone (FSH) from gonadotrophs of the anterior pituitary (Ramakrishnappa, et al., 2005). Gonadotropins are responsible for gametogeneis, folliculogenesis, ovulation, CL function and steroidogenesis in the ovary. GnRH secretion is controlled through three feedback long, short, and ultra short loop mechanisms Figure 1.4. Long loop feedback involves interaction among the ovary (E2 and P4), pituitary (LH and FSH) and hypothalamus (GnRH). In the short loop feedback system, the levels of pituitary gonadotropins (LH and FSH) can influence the secretory activity of the releasing hormones without mediation of the ovary. In the ultra short loop GnRH by it’s receptors by a way of auto-regulation regulate its own secretion. A feedback loop maintains equilibrium between the rates of secretion of pituitary and ovarian hormones. Pulsatile GnRH secretion stimulates pulsatile secretion of LH. The follicular phase (or proliferative phase) is the phase of the estrous cycle during which follicles in the ovary mature. It ends with ovulation. The main hormone controlling this stage is E2. Initial stage of follicular growth occurs independent of gonadotropin hormones (Crowe, 1999). Later stage follicular growth beyond 4mm depends on gonadotropins LH and FSH (Austin et al., 2001). Emergence of follicular wave occurs after transient increase in FSH. FSH concentrations control follicular growth (Hunter et al., 2004). During selection the follicle which acquires LH receptors first becomes DF. The LH dependent DF can suppress growth of other follicles by selective FSH inhibition on them through the secretion of inhibin (Lucy, 2007). Increase LH secretion stimulates DF maturation (Kulick et al., 2001). IGF-1 synergistic with FSH causes increased E2 secretion by DF (Lucy, 2007). Increased amount of E2 simultaneously with decreased amount of P4 cause preovulatory LH surge (Chenault et  10  al., 1974). LH surge occurs at or near the onset of estrus with high concentrations of E2 and FSH. Ovulation occurs 25-35 hours after the onset of LH surge. Preovulatory surge of gonadotropins are responsible for final follicular maturation and subsequent ovulation. E2 peaks during estrus then after LH surge starts to decline. The luteal phase begins with the formation of the CL and ends in either pregnancy or luteolysis. The main hormone controlling this stage is P4, which is significantly higher during the luteal phase than other phases of the cycle. During luteal phase, P4 concentrations are on basal level in early luteal phase, rapidly increases by day 4 and reaches maximum by day 12 of the estrous cycle, maintained constantly on high level until days 16-18 and rapidly decreases before day 2-4 of estrus (Rioux and Rajotte,. 2004). High concentrations of P4 secreted by CL blocks E2 induced gonadotropin surge. Therefore both ovarian steroids P4 and E2 regulate LH secretion. P4 acts at the sites of the hypothalamus and pituitary and negatively affects LH frequency and concentration. It also inhibits GnRH surge. Therefore LH secretion is lower in mid and late luteal phases than early luteal phase and basal levels are observed during mid luteal phase of the estrous cycle. Decrease LH during luteal phase prevents follicular maturation.  E2  secretion from ovary goes down from early to mid-late luteal phase; although mostly in whole cycle E2 follows LH pattern some fluctuations observed during luteal phase could be due to the follicular wave development. In the infertile cycle the luteolytic hormone PGF2α secreted cyclically from the uterus between 16 and 19 day of the cycle causes CL regression (McCracken, 1999). Luteolysis coupled with cessation of P4 synthesis and animal enters into new cycle.  11  FSH shows a different pattern from LH during follicular phase and early luteal phase. After luteolysis LH frequency goes up but not FSH. FSH peaks during preovulatory LH surge and second FSH surge occurs after first surge which is not seen with LH. It has been demonstrated that FSH surge preceded the beginning of a new follicular wave. The second peak during follicular phase initiates the first follicular wave. Another transient peak is observed in the mid luteal phase when first wave DF goes atresia and this leads to the beginning of the second follicular wave cycle. In the three waves cycle cows additional FSH peak is observed during second wave DF atresia and that leads to the emergence of third wave (Lucy, 2007). Although E2 controls FSH and LH secretions this different FSH pattern suggests that several other factors actin, inhibin and follistatins secreted by gonads and pituitary may regulate FSH secretion.  12  Hormone levels  Luteal phase  F ph  Progesterone FSH  LH PGF2α ovulation  E D0 D1  Estradiol  Metestrus  Diestrus D5  Days Proestrus D17  D21  Figure 1.1. Endocrine events of bovine estrous cycle E-Estrus D-Day F ph- Follicular phase  13  Progesterone  Estradiol  ovulation  DF  DF  DF  R 9  12 S  15  18  0  3  D  S  D  S  6  9 D  12  Days of estrous cycle  S  Figure 1.2. Schematic diagram of bovine ovarian follicular wave dynamics. Emergence of a cohort of similar sized growing follicles is called recruitment. Under selection process 2-5 follicles are selected and further grow. Finally dominant follicle ovulates and others subordinate follicles become atretic. S-Selection phase; D-Dominance phase; DFDominant follicle; R-Recruitment  14  CL Ovulation  FSH  LH 0 2 Estrus  21  Estrous cycle  Estrus  Figure 1.3. Follicular waves and gonadotropin (LH & FSH) changes in bovine estrous cycle. CL-Corpus Luteum  15  Higher nervous control  Hypothalamus tonic release centre  Hypothalamus cyclic release centre GnRH  (-) f.back  (+) f.back  Anterior pituitary  (+) or (-) f.back  FSH  LH (-) f.back  Inhibin Follicle growth  Ovaries  Ovulation  Corpus luteum  Progesterone  estradiol PGF2ά  Uterus  Figure 1.4. Hypothalamus, anterior ovary and uterus interrelationships. F.back-Feedback  16  III. The corpus luteum 1.2.5. History The CL is a transient endocrine reproductive gland and secretes P4 which is necessary for the establishment and maintenance of pregnancy (Schams and Berisha, 2004). Although Coiter defined the gland as cavities filled with yellow solid the gland was first definitively described by Regnier de Graaf (1641-1673) as ‘globular bodies’, and named as corpora (yellow) lutea (bodies) by Marcello Malpighi (1628–1694) (McCracken et al., 1999; Niswender et al., 2000). Then Prenant in 1898 suggested it may produce substance which regulates pregnancy (Niswender et al., 2000). CL’s biological significance was first published in 1903 by Frankel (Niswender et al. 1994). Later in 1932 by four independent groups a luteal factor was crystallized and characterized, and it was concluded to be important for the establishment and maintenance of pregnancy (Niswender et al., 1994 and 2000). Then it was named as P4 and was first synthesized by Butenandt and Westphal in 1934 (Slotta et al., 1934; McCracken et al., 1999).  1.2.6. Formation, structure, and function CL plays a central role in the estrous cycle and pregnancy maintenance. It is the one of few adult tissues which shows regular growth, function and regression. CL a continuation of a follicular maturation formed after ovulation from the rest of the graffian follicular cells. Pre ovulatory LH surge causes structural and biochemical changes which lead to ovulation- expulsion of the ovum from ruptured graffian follicle and subsequent development of CL (Acosta and Miyamoto, 2004). The follicle contains an inner avascular layer of granulosa cells surrounded by a basement membrane, a layer of theca  17  interna and an outer layer of theca externa. After ovulation basement membrane breaks down; granulosa and theca interna cells invade the follicle; blood flow increases; both the grnulosa and theca cells undergo hypertrophy and hyperplasia (Milvae et al., 1996). This re organization of follicular cells which is called luteinization leads to the formation of CL and alters the steroidogenic pathway. Before the CL formation the primary steroid secreted by the ovary is estrogen. P4 is the primary steroid produced by CL. (Niswender et al., 2000; McCracken et al., 1999). CL grows rapidly. The first half of the estrous cycle weight increases six folds (Milvae et al., 1996). Maintenance of CL weight is important for the healthy cycle. CL is a complex tissue consists of numerous types of cells. It’s a heterogeneous tissue made up of steroidogenic large and small luteal cells, endothelial cells, immune cells, fibroblasts, and smooth muscle cells (Schams and Berisha, 2004). Majority of the cells are steroidogenic cells referred as luteal cells which account for 70% of the volume of CL. This makes sense that primary function of CL to secrete steroid hormone P4 during pregnant and non pregnant cycles (Fields and Fields 1996). Both luteal cells differ in morphology and physiology. Large luteal cells (LLC) formed from granulosa cells are 20µM or more in diameter; small luteal cells (SLC) formed from theca interna are 1020µM in diameter (Smith et al., 1994; Milvae et al., 1996). SLC and LLC comprise 26% and 3% of the luteal cells and makes up 28% and 90% of the volume of CL respectively (Fields and Fields, 1996). LLC have centrally positioned round nucleus, well developed smooth endoplasmic reticulum, more mitochondria, convoluted cell surface with membrane bound dense granules. SLC have eccentric cup shaped nucleus, smooth and rough endoplasmic reticulum, mitochondria with tubular cristae, and smooth surface  18  membrane with microvilli. For their steroidogenesis capacity both have a well developed smooth endoplasmic reticulum, golgi complex and lipid droplets (Milvae et al., 1996). CL is called yellow body, because of its high content of antioxidant β carotene. This protects cholesterol side-chain cleavage P450 against damage from its own oxygen free radicals formed during steroidogenesis (Rapoport et al., 1998). Therefore the antioxidant deficiency may affect steroidogenesis and fertility (Milvae et al., 1996). CL function depends on production of adequate amount of P4. It may determine the length of estrous cycle, ovulation and fate of embryo (Smith et al., 1994). In pregnant cattle P4 stimulates endometrial function, embryo development and secretion of interferon- τ which prevents luteolysis (Chagas e Silva et al., 2002). For last thirty years LH is considered as the major luteotropic hormone which promotes CL formation and P4 secretion. LH pulses stimulate P4 synthesis in mid luteal phase of the cycle. But in early luteal phase LH is not responsible for the large amount of P4 synthesis in early CL (Quintal-Franco et al., 1999). Growth hormone (GH) is also considered as luteotropic with LH (Chase et al., 1999; Schams and Berisha 2004; Berisha and Schams 2005). It has been stated that LH is important for the CL development but not for its function. In bovine, pulsatile secretion of LH mainly stimulates P4 production from SLC whereas GH stimulates 80% of the total P4 production from LLC during mid luteal phase (Schams and Berisha, 2004; Kobayashia et al., 2001). Although LLC produce more P4 per cell SLC respond maximally to LH and produce high concentrations about forty folds of P4 (Niswender et al., 1994). In the late stage of CL development eventually SLC develop into LLC (Quintal-Franco et al., 1999; Milvae et al., 1996). During early pregnancy  19  granulosa derived LLC disappear and theca originated LLC persist through out the pregnancy (Schams et al., 1987).  1.2.7. Angiogenesis CL formation is involved with dramatic increase of blood supply because of its rapid growth. Angiogenesis is defined as the generation of new blood vessels through sprouting from already existing blood vessels in a process involving the migration and proliferation of EC from pre-existing vessels (Schams and Berisha, 2004). Endothelial cells (EC) comprised approximately half of the CL cell population and 85% of the cells which proliferate during CL growth are EC (Webb et al., 2002). In mature CL every parenchyma is contacted with one or more capillaries (Schams and Berisha, 2002). Precise control of ovary is important for the normal luteal development. Several promoters have been identified in angiogenesis. The vascular endothelial growth factor A (VEGF A), acidic and basic fibroblast growth factor (FGF-1 and FGF-2), insulin-like growth factors (IGF-1 and IGF-2) and angiopoietins (ANPT-1 and ANPT-2) are considered most important among them. Other possible inducers of angiogenesis are members of transforming growth factors are (TGF) family, tumor necrosis factor (TNF), vasoactive peptides-like angiotensin II (Ang II) and endothelin-1 (ET-1) and proteins of the extra cellular matrix (ECM) (Schams and Berisha, 2004). VEGF regulate most steps of the angiogenic process like EC degradation of extra cellular matrix, migration, proliferation and tubular formation. FGF also involve in several steps in CL development including cell development and migration (Schams and Berisha, 2002). IGF systems play important roles in bovine CL. They stimulate  20  luteinization in granulose and thecal cells; stimulate oxytocin (OT) and P4 production (Davis et al., 1996; Schams and Berisha, 2002). Also in early CL indirectly involve in angiogenesis by VEGF stimulation (Schams and Berisha, 2002).  1.2.8. Luteal steroidogenesis Steroidogenesis is defined as the process in which specialized cells in specific tissues synthesize steroid hormones (Stocco, 2001). It’s a very complex process (Stocco, 2005). The main function of CL is to synthesize and secrete steroid hormone P4. Cholesterol is the main precursor for the luteal P4 production, which can be derived from the diet or under deprived conditions it can be synthesized denovo from Acetyl CoA in the luteal cells (Rekawiecki and Kotwica, 2007). Lipoproteins  are  macromolecular  complexes  of  protein,  phospholipid,  cholesterol, cholesterol ester and triglyceride and function to transport lipid through blood (Grummer and Carroll, 1988). Based on hydrated densities they can be separated into chylomicrons, very low density lipoproteins (VLDL), low density lipoproteins (LDL) and high density lipoproteins (HDL). Under normal condition the majority of the cholesterol is synthesized in liver. LDL and HDL are most common sources of cholesterol for the steroid production in the bovine CL (Milvae et al., 1991; Niswender et al., 2000). LDL uptake mediated via receptor mediated endocytosis, and then lysosome bound membrane dissociation which will release free cholesterol. HDL binds to HDL plasma membrane binding protein and the mechanism for the cell intake is not defined yet. Free cholesterol can be used for steroidogenesis, formation of membrane or it can esterified with fatty acids and form cholesterol esters for storage (Niswender et al., 2000).  21  The first step in the steroidogenesis is release of free cholesterol from cholesterol esters. This is acutely controlled by second messenger pathways (Niswender et al., 2000). Protein Kinase A (PKA) activates cholesterol ester by phosphorylation. The generic P4 synthesis is illustrated in Figure 1.5. The rate of conversion of cholesterol to P4 is regulated by three main enzymes (Rekawiecki et al., 2005). Those steroidogenic enzymes are Steroidogenic Acute Regulatory protein (StAR), Cytochrome P-450scc (P450), 3-beta-hydroxysteroid dehydrogenase (3beta HSD). For the steroid production cholesterol has to be transported to the mitochondria and from outer mitochondrial membrane to inner mitochondrial membrane. Tropic hormones stimulation enhances this transportation. Cholesterol transportation from outer mitochondrial membrane to inner mitochondrial membrane is the rate limiting step of steroidogenesis as well as the primary site for second messenger acute positive and negative regulation (Niswender et al., 2000). Cholesterol is a hydrophobic molecule; that makes its diffusion through hydrophilic cytoplasm difficult. Further the presence of hydroxyl group at third position produces a discrete hydrophilic region making it difficult for ‘flip_/flop’ of cholesterol between membrane surfaces within the lipid bilayer of cellular membranes. Therefore cholesterol movement requires special transport proteins. StAR under the influence of gonadotropins and other factors which stimulate steroidogenesis transfers cholesterol from outer mitochondrial membrane to inner membrane (Mamluk et al., 1999; Pescador et al., 1996). During luteal development StAR mRNA presents in low level then reach maximum concentration during mid luteal phase and disappear in regressed CL (Pescador et al., 1996). It is formed as 37-kDa cytosolic precursor protein and once imported into mitochondria gives rise to four 30-kDa isoforms. The insertion and  22  maturation of StAR may involve in cholesterol transportation (Pescador et al., 1996). Although its precise mechanism is not defined it has been clearly shown that StAR plays critical role in steroidogenesis (Niswender et al., 2000). Following transportation P4 synthesis requires only two enzymatic reactions (Christenson and Devoto, 2003). In the mitochondrial matrix P450 catalyzes the first step of steroidogeneis. It cleaves the cholesterol side chain and converts it to pregnenolone. Three oxidation steps are involved in this process with hydroxylations’ at the 20 and 22 positions and then cleavage between these two carbons (Diaz et al., 2002). The mRNA and protein for P450 dramatically increase in CL after the LH surge and luteinization reaches a plateau at mid luteal phase (Diaz a et al., 2002; Mamluk et al., 1999). Pregnenolone is having two hydrophilic residues that make it readily mobile through cell membrane. Pregnenolone exits mitochondria, enters smooth endoplasmic reticulum, converted to P4 by 3beta HSD. The levels of 3beta HSD mRNA and protein increase dramatically following the LH surge and ovulation to a maximum at days 8-/11 after estrus in cattle (Couet et al., 1990). P4 then diffuses from the cell enters blood stream and distributes to the target tissues. (Stocco, 2001; Niswender et al., 2000). Although P4 is the primary steroid bovine CL also secretes 20b-hydroxy, preg 4-ene, and 3-one.  1.2.9. Regulation In ruminants the CL function is primarily regulated by gonadotropins and GH. Now it has been found that several intra ovarian or extra ovarian factors can modulate local action of these hormones or specific direct actions (Schams and Berisha, 2004). CL  23  function depends on balance of tropic and lytic actions induced by the above mentioned hormones and factors.  1.2.9.1. Hormonal regulation 1.2.9.1.1. Lutienizing Hormone Simmons and Hansel, 1964 first introduced LH as the major luteotropic agent in bovine. Luteotropic means support the growth and/or function of CL. LH plays a principal role in the regulation of CL function (Okuda et al., 1999). It’s characteristically released in a pulsatile fashion from anterior pituitary during estrous cycle. The preovulatory LH surge causes luteinization of granulosa and thecal cells of the graffian follicle, forms CL and alters the steroidogenic pathway to produce P4. Pulsatile release of LH is important for normal CL development but may be not for its function (Niswender et al., 2000). It has been shown anti bovine LH causes luteolysis; whereas LH administration prolongs luteal life span (Garverick et al., 1985). Cows treated with GnRH antagonist after CL development hasn’t affected P4 secretion and GnRH antagonist treatment during CL development had very little effect on P4 secretion (Peters et al., 1994). Although in ruminants LH has been identified as major luteotropic hormone for last three decades still its precise physiological role in CL regulation has not been well established (Diaz et al., 2002). LH secretion is regulated by positive feedback by E2 and negative feedback by P4 (Kazama and Hansel, 1970; Hobson and Hansel, 1972). LH has its specific membrane receptors in both LLC and SLC (Yuan and Lucy, 1996). During P4 production in SLC, LH binds to its specific membrane receptor; the LH-receptor complex activates adenylate  24  cyclase resulting cAMP formation from ATP which leads to protein kinase A (PKA) activation which is the final step in the pathway resulting in the phosphorylation of proteins involved in the steroidogenesis (Nishimura et al., 2004; Schams and Berisha, 2004). cAMP is an important second messenger for tropic hormone stimulated steroidogenesis. In addition to adynylate cyclase – cAMP pathway in bovine LH stimulates P4 production via the inositol- phospholipid- specific- phospholipase- C (PLC) – inositol phosphate pathway. The phospholipase C pathway functions independent of adynylate cyclase – cAMP pathway and both intracellular pathways directly stimulate P4 production (Nishimura et al., 2004). It is also known that tropic hormone induces arachidonic acid (AA) in steroidogenic cells that’s important for steroidogeneis (Wang et al., 2000). All these mechanisms make steroidogenesis more complicated (Stocco, 2005). Large amount of P4 is produced by LLC, but the mechanism for P4 synthesis in these cells are so far undefined (Diaz et al., 2002). It has been shown that aspirating LLC reduces the size of CL (Milvae et al., 1991). Major steroidogenic enzymes -P450, 3beta HSD and StAR are more expressed in LLC than SLC. Still this doesn’t give the proper explanation for the P4 synthesis in the absence hormonal control. PKA pathway may underlie the elevated constitutive P4 synthesis. This has been not confirmed yet (Diaz et al., 2002). Although LH is a potent stimulator of P4 secretion in bovine an inverse relationship between circulating plasma P4 and LH pulse frequency is observed (Fike et al., 2004). Bergfeld, E.G.M., et al. (1996) reported there is an acute increase in LH pulse with sudden decrease of plasma P4 concentrations and vice versa. During early luteal phase when circulating P4 concentration is low LH pulses are high frequent with low  25  amplitude. During mid to late luteal phase when P4 production is high LH pulses are low frequent with high amplitude. Further LH pulse frequency is lower in luteal phase (1 pulse/ 6 hours) than follicular phase (1 pulse/ 1 hour). Both in pregnant and cycling cows show same LH pulse frequency and LH concentrations (Peters et al., 1994; Okuda et al., 1999). Although LH pulse frequency and concentration are not correlated with P4 secretion LH receptor concentration increases with P4 secretion from early to mid luteal phase (Okuda et al., 1999). LH receptors have not been seen in regressed CL. In pregnant cows throughout the gestation period the receptor concentration is similar to those in mid cycle CL (Okuda et al., 1999). High concentrations of LH receptors in the luteal phase leads to assume, that LH may acts as direct luteotropic factor during early pregnancy and indirect luteotropic in the late stage of pregnancy (Okuda et al., 1999).  1.2.9.1.2. Growth Hormone This is one of the primary luteotropic hormones in bovine. In hypophysectomized ewes during luteal development replacement with LH had normal CL development, steroidogenic enzyme expression and P4 secretion. But the CL weight was below the normal. When they had GH replacement still had circulating P4 levels with weight increase. But one of the steroidogenic enzyme 3beta HSD was not expressed. This study clearly shows that both LH and GH are important for the normal development and function of the CL (Niswender et al., 2000). In vitro studies showed GH induced P4 production in CL (Chase et al., 1999). In vivo study showed acute, direct local stimulation of GH in ovine luteal cells caused P4 secretion (Miyamoto et al., 1998).  26  GH receptors (GHR) are found in LLC. GHR are more stable than LHR, unlike LHR they persist in regressed CL as well. In vitro studies showed in early bovine CL, PGF2α, P4, and oxytocin (OT) production are mostly stimulated by GH not by LH. In bovine although PGF2α considered as luteolytic factor, in early CL it stimulates P4 production from large luteal cells in response to GH (Kobayashia et al., 2001).  1.2.9.2. Local regulation Growth factors regulate bovine CL in an auto/paracrine manner. As already been mentioned IGF stimulate P4 and OT production in bovine CL. IGF1 has been identified in cytoplasm of LLC and SLC. IGF1 is the important promoter of steroidogenesis and acts in multiple steps (Webb et al., 2002). A peptide hormone OT is highly expressed on bovine LLC and SLC (Schams and Berisha, 2004). Preovulatory LH surge causes OT secretion concomitantly with P4 secretion (Miyamoto and Schams, 1991). Although OT is mainly involved in luteolysis it’s considered as a potent luteotropic factor in bovine CL by participating in steroidogenesis during early and mid luteal phases (Skarzynski et al., 2001). Noradrenaline (NA) directly involves in P4 production and also it stimulates PGF2α and PGE2 synthesis and release from bovine luteal cells (Schams and Berisha, 2004). PGE2 is a known luteotropic factor by participating in steroidogenesis through the cAMP and PKA pathway in bovine CL (Rekawiecki et al., 2005). P4 itself has auto/paracrine effect on bovine CL. It regulates the CL secretion in the stage dependent fashion. In the early CL, P4 stimulates P4, OT, and PGs synthesis, but in the mid luteal phase it inhibits PGF2α secretion but not in the late CL (Skarzynski et al.  27  2001). P4 also stimulates LH receptors in bovine CL and prevents apoptosis (Schams and Berisha, 2004). PGF2α acts as a luteotropic agent in the early to mid luteal phases but not in the late luteal phase. Bovine CL secretes high concentrations of PGF2α during early luteal phase than mid and late luteal phases. Ovarian E2, P4, OT with some other factors regulate this PGF2α secretion. Through PKC activation PGF2α directly and through OT indirectly stimulates P4 secretion in bovine CL (Skarzynski et al., 2001). All these intra ovarian factors may have auto/paracrine positive feedback which decreases CL sensitivity to exogenous PGF2α that prevents premature luteolysis (Skarzynski et al., 2001).  1.2.10. Regression of the corpus luteum The life span of bovine CL is approximately 17-18 days (Shirasuna et al., 2007). Luteal regression is a dynamic process. At the end of the estrous cycle if pregnancy does not occur, CL is regressed and animal enters to the next estrous cycle. Therefore the process gives females more frequent opportunities to conceive in the event that they fail to conceive at a particular mating (Silvia, 1999). CL regression is defined as; CL loses its capacity to produce P4 and undergoes structural involution (Bowen-Shauver and Telleria, 2003). CL regression has two phases. The initial decline of P4 secretion is called functional luteolysis followed by the degradation of cells and tissues mainly through the apoptotic process are called structural luteolysis (Korzekwa et al., 2007). Decrease of P4 production is associated with decreased blood flow to the CL (Niswender et al., 2000). The endocrine interactions among the uterus, ovary and posterior pituitary gland that  28  control luteolysis in bovine are complex. Although CL regression is studied for many years the exact mechanisms that regulate this process are not well understood (Liszewska et al., 2005). Luteal regression is initiated by a series of morphological and biochemical changes in a variety of cell types including large and small luteal cells, fibroblasts, endothelial and immune cells. During luteal regression lipid droplets accumulates in the luteal cytoplasm; capillaries get degenerated; number of primary lysosomes increases. Ultimately these lead to cessation of steroidogenic capacity, cell death and extensive tissue involution with the formation of scar called corpus albicans (Niswender et al., 1994; Casey et al., 2005; McCracken et al., 1999).  1.2.10.1. Functional luteolysis The decline in P4 production is called functional luteolysis that is a hallmark of luteolysis (Davis and Rueda, 2002). Functional luteolysis is initiated by surge release of PGF2α from the uterus which causes cascade of events within the CL that ultimately leads to the demise of tissue. Lifespan of the bovine CL is primarily determined by pulsatile release of uterine origin luteolytic agent PGF2α (Casey et al., 2005). In bovine PGF2α secretion starts to increase in late luteal phase, reaches maximum level in the follicular phase with the highest point at estrus (Okuda and Sakumoto, 2006; Murakami et al., 2001). Then gradually secretion declines during early to mid luteal phases. It has been postulated that PGF2α enters the ovarian artery from the utero-ovarian vein, via a countercurrent exchange mechanism (Niswender et al., 2000). PGF2α is secreted from bovine endometrium in several series of pulses of short duration for 2-3 days during and after luteolysis. This fashion suggests that pulsatile release of PGF2α is important for the  29  luteal regression. Continuous exposure of PGF2α may desensitize the luteal PGF2α receptor cells whereas pulsatile secretion prevents desensitization and maintain or enhance cellular response (Okuda et al., 2002). Studies have shown that luteolysis is delayed or prevented during inhibition of PGs synthesis by administering non steroid anti inflammatory drugs or by immunization against PG2α (Silvia, 1999). Surgical removal of uterus expanded bovine CL life span (Wiltbank and Casida 1956). In ruminants, oxytocin (OT), P4 and E2 regulate uterine secretion of PGF2α (Silvia et al., 1991). OT is a product of magnocellular neurons in the paraventricular and supraoptic nuclei of the hypothalamus and secreted from axonal terminals in the neurohypophysis. Recently it has been found that ruminant CL synthesizes and secretes OT (Silvia, 1999). Recent studies suggest that OT may support the pulsatile secretion of PGF2α but it’s not essential for the initial PGF2α secretion (Okuda et al., 2002; Goff, 2004). OT stimulated PGF2α secretion is associated with activation of protein kinase C (PKC) and expression of several PGF2α synthesis associated genes. Bovine endometrium highly responds to OT during luteal regression till early luteal phase of the next cycle. Steroids regulate endometrial response to OT and other factors (Okuda et al., 2002). The length of endometrium exposure to P4 determines the length of the luteal phase. During early to mid luteal phases P4 inhibits OTR gene expression through this suppresses PGF2α secretion. But prolong P4 exposure promotes Arachidonic acid accumulation and cyclooxygenase (COX) which are important for PGF2α synthesis and stimulates PGF2α secretion by endometrium (Goff, 2004). The effect of E2 is depending on P4. E2 receptors (ER) increase at the end of the luteal phase. Up regulation of ER induces OTR and that causes PGF2α secretion (Goff, A.K. 2004). Although both P4 and E2 together stimulate  30  OTR and uterine PGF2α secretion recently in vitro study has shown uterine PGF2α production in the absence of OT. Therefore it is anticipated that some other factors may exist and participate in the bovine luteolysis (Miguez et al., 2005). Although PGF2α is the primary luteolytic factor in cows its direct function in CL is still controversial (Korzekwa et al., 2007). It is now believed that PGF2α mediated luteolysis can be mediated by several intraluteal factors produced by endothelial cells and immune cells (Korzekwa et al., 2007). Recent studies have proposed that endometrial/extra luteal PGF2α initiates functional luteolysis; whereas luteal PGF2α may involve in structural luteolysis (Shirasuna et al., 2007). The primary precursor for PG synthesis is Arachidonic Acid (AA) an essential fatty acid stored in membrane phospholipids. Bovine endometrium and CL has a rich source of AA (Arosh et al., 2004a; Okuda et al., 2002). For last thirty years it has been proposed that first impact of PGF2α is causing rapid decrease in blood flow induced by vasoactive substances like Endothelin I, angiotensin II (Shirasuna et al., 2007). Now it has been shown that initially PGF2α induces an acute increase in blood flow for short time (2-4 hrs) due to some vasodilators like Nitric Oxide followed by decrease in blood flow. This may be the starting signal for luteolysis (Shirasuna et al., 2007; Berisha and Schams, 2005). Theses changes of blood flow were not seen in the early CL. It has been shown that Endothelin I via binding its specific receptors in LLC and SLC inhibits luteal P4 production and enhance luteal PGF2α synthesis (Milvae, 2000). Outline of bovine luteolysis is shown in Figure 1.6. Towards the end of luteal phase P4 down regulates its own receptors in CL and pituitary which brings the action of  31  E2. E2 stimulates hypothalamic OT pulse generator to secrete high frequency bursts of low levels of OT. OT synthesized and secreted from posterior pituitary stimulates uterine PGF2α production that induces luteolysis. In order to get high concentration of OTR in uterus it has to be preconditioned by long exposure of P4 followed by E2. PGF2α by positive feed back loop stimulates OT secretion from CL and it‘s own synthesis from CL. P4 in addition to its effect on OTR also stimulates accumulation of lipid droplets and prostaglandin H synthase -2 enzyme which initiates the conversion of AA to PGF2α. Since bovine CL expresses E2 receptors E2 may have direct action on bovine CL. The mechanisms by which PGF2α decrease P4 production could be 1) down regulation of receptors for luteotropic hormones, 2) decreased cellular uptake of cholesterol, 3) decreased transport of cholesterol through the cell and/or across the mitochondrial membranes and 4) decreased activity of the steroidogenic enzymes required for biosynthesis of P4.  1.2.10.2. Structural luteolysis Although PGF2α plays a central role in spontaneous and induced luteolysis the actual mechanism is poorly understood. It is now well established that apoptosis is a significant component of luteal regression (Yadav et al., 2002). Bovine CL undergoes apoptosis or programmed cell death during structural luteolysis. This is a morphological highly regulated cell death process that eliminates distinct populations of cells by activating endonucleases within the cells (Juengel et al., 1993). It is expressed by internucleosomal fragmentations of luteal DNA (Okuda et al., 2004). In bovine luteal cells apoptosis can be mediated by several mechanisms.  32  Immune and cytokines play role in luteal function. Number of leukocytes such as T lymphocytes, macrophages increase during luteal regression; they secrete cytokines like tumor necrosis factor (TNF) and interferon τ (Taniguchi et al., 2002). It has been shown that death receptor-activating cytokines, such as tumor necrosis factor α (TNFα) and Fas ligand (FasL), as being important mediators of PGF2α -initiated luteolysis (Carambula et al., 2003). Activated macrophages can secrete TNFα in response to various stimuli including PGF2α. TNFα acting through its specific type- I can inhibit P4 production and enhance PGF2α production mostly in luteal endothelial cells. It has been shown that luteal cells are protected from TNFα by P4. Therefore decline in P4 production preceding TNFα mediated structural luteolysis in bovine CL (Friedman et al., 2000). Fas antigen (Fas) a member of tumor necrosis factor family of cell surface receptor that triggers apoptosis in sensitive cells when bound to Fas L or agonistic anti-Fas antibody in bovine CL (Okuda et al., 2004; Taniguchi et al., 2002). Decline in P4 production is sufficient to initiate Fas mediated apoptosis. The other mechanisms which control apoptosis are via expression of number of apoptotic regulatory genes such as Bcl-2, Bax and caspases (Okuda et al., 2004). Caspases, a family of aspartic acid-specific cysteine proteases, are pivotal mediators of apoptosis during regression of the CL; among 14 identified family members caspase-3 is the best characterized enzyme (Okuda et al., 2004). It has been shown cessation of P4 production is the important stimulation for increasing caspase-3 expression (Okuda et al., 2004). Therefore P4 can protect luteal cells from caspase induced apoptosis as well (Liszewska et al., 2005). Bcl-2 family genes Bax which increases cell death whereas Bcl-2 protects cell from apoptotic death. The out come of  33  cell is determined by the Bcl-2: Bax ratio. Although there is evidence that intra luteal P4 can affect expressions of Bcl-2 ad Bax genes (Liszewska et al., 2005), Okuda, K., et al. (2004) proposed that expression of these genes occurs independently intra luteal P4. PGF2α or cytokines are not toxic to the steroidogenic luteal cells. Therefore it has been proposed that Nitric oxide (NO) can mediate apoptotic signal. A recent study from Korzekwa et al. (2007) showed that NO can participate both in functional and structural luteolysis in stage dependent manner. It is produced in all three main bovine luteal cells- steroidogenic, endothelial and immune cells and seems to be a universal mediator of luteolysis. During functional luteolysis NO stimulates PGF2α secretion and inhibits P4 production. It directly involves in structural luteolysis by breaking DNA and inhibiting it’s repairing. Further it has been stimulating expressions of Bax, Fas and caspase proteins (Korzekwa et al., 2007).  1.2.11. Maternal recognition of pregnancy During bovine estrous day 15-17 are considered the critical period. During this period luteolysis occurs or pregnancy is established in the presence of viable embryo (Arosh et al., 2004b). Early embryonic development, implantation and maintenance of a pregnancy are critically dependent on an intact embryo-maternal communication (Wolf et al., 2003). Interferon-τ (IFN τ) secreted by embryonic trophoblast cells is recognized as the pregnancy recognition signal (Arosh et al., 2004b). Secretion of IFN-τ by bovine blastocyst is highest between day 15 and 17, but is observed up to day 28 of pregnancy (Arosh et al. 2004b). IFN- τ reduces the expression of uterine E2 and OT via paracrine manner thus prevents pulsatile PGF2α secretion and luteolysis (Wolf et al., 2003).  34  Free cholesterol Cyto skeletal movement Outer mitochondrial membrane  StAR  Inner mitochondrial membrane  P450 scc Mitochondria  Pregnenolone 3β HSD Smooth endoplasmic reticulum  Progesterone Figure 1.5. Biosynthesis of progesterone in a generic luteal cell. The key steps involved in luteal steroidogenic pathway and respective enzymes are illustrated  35  Follicle  Posterior pituitary  estradiol  estradiol  oxytocin  progesterone  estradiol  Uterus progesterone oxytocin  PGF2α PGF2α  Corpus luteum  luteolysis  Figure 1.6. Possible endocrine interactions that contribute to luteolysis in cattle  36  1.3. RATIONALE AND HYPOTHESIS Milk yields among dairy cows have dramatically increased over the past fifty years, yet as production has risen, fertility rates have steadily declined. The fertility of heifers, however, has not shown the dramatic decline compared to lactating cows. But the effect of parities in cows pregnancy rates and on circulating P4 level is yet not clear. Fertility statistics for dairy cows and heifers are not available in the province of British Columbia in Canada. Reduced fertility has been shown to be associated with lower abnormal P4 levels after breeding. The effect of parity on cows pregnancy rates and on P4 production is as yet unclear. Although studies conducted on expression level of apoptotic genes (Bax and Bcl-2), steroidogenic genes (StAR, 3beta HSD, P450) and Heat shock Protein-70 (HSP70) in bovine CL, none of the studies were conducted to see the differential level of these P4 synthesis associated genes in heifers and lactating cows. In this study, we hypothesize that pregnancy rates, circulating P4 levels, and expression level of genes associated with P4 synthesis will be higher in dairy heifers compared to lactating dairy cows.  1.4. SPECIFIC OBJECTIVES 1. Compare the pregnancy rates between heifers and lactating cows. 2. Compare peripheral P4 levels between heifers and lactating cows. 3. Compare the expression levels of genes associated with P4 synthesis in CL obtained from heifers and cows.  37  1.5. REFERENCES. Acosta1, T.J., and Miyamoto, A. 2004. Vascular control of ovarian function: ovulation, corpus luteum formation and regression. Animal Reproduction Science 82–83: 127–140 Arosh, J.A., Banu, S.K., Chapdelaine, P., Madore, E., Sirois, J., and Fortier, M.A. 2004a. Prostaglandin biosynthesis, transport, and signaling in corpus luteum: A basis for autoregulation of luteal function. Endocrinology 145: 2551–2560 Arosh, J.A., Banu, S.K., Kimmins, S., Chapdelaine, P., Maclaren, L.A., and Fortier, M.A.. 2004b. Effect of Interferon-τ on prostaglandin biosynthesis, transport, and signaling at the time of maternal recognition of pregnancy in cattle: Evidence of polycrine actions of prostaglandin E2. Endocrinology 145: 5280–5293 Austin E.J., Mihm, M., Evans, A.C.O., Knight, P.G., Ireland, J.L.H., Ireland, J.J., and Roche. J.F4. 2001. Alterations in intra follicular regulatory factors and apoptosis during selection of follicles in the first follicular wave of the bovine estrous cycle. Biology of Reproduction 64: 839–848 Bearden, H.J. and Fuquay, J.W. 1992. The estrous cycle. Pages 53-66 in Applied Anima1 Reproduction (3rd Edition). Prentice Hall, New Jersey. Bergfeld, E.G.M., Kojima, F.N., Cupp, A.S., Wehrman, M.E., Peters, K.E., Mariscal, V., Sanchez, T., and Kinder, J.E. 1996. Changing dose of progesterone results in sudden changes in frequency of luteinizing hormone pulses and secretion of 17P-estradiol in bovine females. Biology of Reproduction 54: 546-553 Berisha, B., and Schams, D. 2005. Ovarian function in ruminants. Domestic Animal Endocrinology 29: 305–317 Berry, D. P., Buckley, F., Dillon, P., Evans, R.D., Rath, M., and Veerkamp, R.F. 2003. Genetic relationships among body condition score, body weight, milk yield, and fertility in dairy cows. Journal of Dairy Science 86: 2193–2204. Bilodeau-Goeseels, S and Kastelic, J.P. 2003. Factors affecting embryo survival and strategies to reduce embryonic mortality in cattle. Canadian Journal of Animal Science 83: 659-671 Bowen-Shauver, J.M., and Telleria, C.M. 2003. Luteal regression: a redefinition of the terms. Reproductive Biology and Endocrinology 1: 28 Carambula, S.F., Pru, J.K., Lynch, M.P., Matikainen, T., Gonçalves, P.B.D., Flavell, R.A., Tilly, J.L., and Rueda, B.R. 2003. Prostaglandin F2alpha- and FAS-activating antibodyinduced regression of the corpus luteum involves caspase-8 and is defective in caspase-3 deficient mice. Reproductive Biology and Endocrinology 1: 15  38  Casey, O., Morris, D., Powell, R., Sreenan, J., and Fitzpatrick, R. 2005. Analysis of gene expression in non-regressed and regressed bovine corpus luteum tissue using a customized ovarian cDNA array. Theriogenology 64: 1963–1976 Chagas e Silva, J., Lopes da Costa, L., and Robalo Silva, J. 2002. Plasma progesterone profiles and factors affecting embryo-fetal mortality following embryo transfer in dairy cattle. Theriogenology 58: 51-59 Chase, C.C., Kirby, C.J., Hammond, A.C., Olson, T.A., and Lucy, M.C. 1999. Patterns of ovarian growth and development in cattle with a growth hormone receptor deficiency. Journal of Animal Science 76: 212–219 Chenault, J.R., Thatcher, W.W., Kalra, P.S., Abrams, R.M., and Wilcox, C.J. 1974. Transitory changes in plasma progestins, estradiol, and luteinizing hormone approaching ovulation in the bovine. Journal of Dairy Science 58: 709-717 Christenson, L.K., and Devoto, L. 2003. Cholesterol transport and steroidogenesis by the corpus luteum. Reproductive Biology and Endocrinology 1: 90 Coppock, C.E. 2000. Selected features of the U.S. dairy industry from 1900 to 2000. http://www.coppock.com/carl/writings/History_of_Dairy_Production_From_1900_to_20 00.htm Couet, J., Martel, C., Dupont, E., Luu-The, V., Sirard, M.A., Zhao, H.F., Pelletier, G., and Labrie, F. 1990. Changes in 3b-hydroxysteroid dehydrogenase/D5_/D4 isomerase messenger ribonucleic acid, activity and protein levels during the estrous cycle in the bovine ovary. Endocrinology 127: 2141-2148. Crowe, M.A. 1999. Gonadotrophic control of terminal follicular growth in cattle. Reproduction in Domestic Animals 34: 157-166 Darwash, A.O., Lamming, G.E., and Woolliams, J.A. 1997. Estimation of genetic variation in the interval from calving to postpartum ovulation of dairy cows. Journal of Dairy Science 80: 1227-1234 Davis, J.S., and Rueda, B.R. 2002. The corpus luteum: an ovarian structure with maternal instincts and suicidal tendencies. Frontiers in Bioscience 7: d1949-1978 Davis, J.S., May, J.V., and Keel, B.A. 1996. Mechanisms of hormone and growth factor action in the bovine corpus luteum. Theriogenology 45: 1351-1380 Dhali, A., Mishra, D.P., Mech, A., Karunakaran, M., and Rajkhowa, C. 2005. Endocrine control of estrous cycle in mithun (Bos frontalis). Theriogenology 64: 2010–2021  39  Diaz, F.J., Anderson, L.E., Wua, Y.L., Rabot, A., Tsai, S.J., and Wiltbank, M.C. 2002. Regulation of progesterone and prostaglandin F2a production in the corpus luteum. Molecular and Cellular Endocrinology 191: 65-/80 Diskin, M.G., and Sreenan, J.M. 2000. Expression and detection of oestrus in cattle. Reproduction Nutrition Development 40: 481–491 Evans, A.C.O. 2003. Characteristics of ovarian follicle development in domestic animals. Reproduction in Domestic Animals 38: 240–246 Fields, M.J., and Fields, P.A. 1996. Morphological characteristics of the bovine corpus luteum during the estrous cycle and pregnancy. Theriogenology 45: 1295-1325 Fike, K.E., Kojima, F.N., Lindsey, B.R., Bergfeld, E.G.M., Quintal-Franco, J.A., Melvin, E.J., Zanella, E.L., Wehrman, M.E., and Kinder, J.E. 2004. Regulation of frequency of luteinizing hormone pulses by magnitude of acute change in circulating concentration of progesterone of female cattle. Animal Reproduction Science 84: 279– 291 Friedman, A., Weiss, S., Levy, N., and Meidan, R. 2000. Role of tumor necrosis Factor α and I its Type I receptor in luteal regression: Induction of programmed cell death in bovine corpus luteum -derived endothelial cells. Biology of Reproduction 63: 1905–1912 Garverick. H.A., Smith, M.F., Elmore, R.G., Morehouse, G.L., Sp. Agudo, L., and Zahler, W.L. 1985. Changes and interrelationships among luteal lh receptors, adenylate cyclase activity and phosphodiesterase activity during the bovine estrous cycle. Journal of Animal Science 61: 216-223 Goff, A.K. 2004. Steroid hormone modulation of prostaglandin secretion in the ruminant endometrium during the estrous cycle. Biology of Reproduction 71: 11–16 Grummer, R.R., and Carroll, D.J. 1988. A review of lipoprotein cholesterol metabolism: importance to ovarian function. Journal of Animal Science 66: 3160-3173 Hansel, W., and Convey, M.E.1983. Physiology of the estrous cycle. Journal of Animal Science 57: 404- 424 Hobson, W.C., and Hansel, W. 1972. Plasma LH levels after ovariectomy, corpus luteum removal and estradiol administration in cattle. Endocrinology 91: 185-190 Hunter, M.G., Robinson, R.S., Mann, G.E., and Webb, R. 2004. Endocrine and paracrine control of follicular development and ovulation rate in farm species. Animal Reproduction Science 82–83: 461–477  40  Ireland, J.J., Mihm, M., Austin, E., Diskin, M.G., and Roche, J.F. 2000. Historical perspective of turnover of dominant follicles during the bovine estrous cycle: Key concepts, studies, advancements, and terms. Journal of Dairy Science 3: 1648–1658 Itoh, T., Kacchi, M., Abe, H., Sendai, Y., and Hoshi, H. 2002. Growth, antrum formation, and estradiol production of bovine preantral follicles cultured in a serum-free medium. Biology of Reproduction 67: 1099–1105 Jorritsma, R., Wensing, T., Kruip, T., Vos, P., and Noordhuizen, J. 2003. Metabolic changes in early lactation and impaired reproductive performance in dairy cows. Veterinary Research 34: 11–26. Juengel, J.L., Garverick, H.A., Johnson, A.L., Youngquist, R.S., and Smith, M.F. 1993. Apoptosis during luteal regression in cattle. Endocrinology 132: 259-254 Kappel, N.D., Proll, F., Gauglitz, G. 2007. Development of a TIRF-based biosensor for sensitive detection of progesterone in bovine milk. Biosensors and Bioelectronics 22: 2295–2300 Kazama, n., and Hansel, W. 1970. Preovulatory changes in the progesterone level of bovine peripheral blood plasma. Endocrinology 108: 386-1391 Kobayashia, S., Miyamotoa, A., Berishab, B., and Schams, D. 2001. Growth hormone, but not luteinizing hormone, acts with luteal peptides on prostaglandin F2a and P4 secretion by bovine corpora lutea in vitro. Prostaglandins and Other Lipid Mediators 63: 79–92 Korzekwa, A., Woclawek-Potocka, I., Okuda, K., AcostA, T.J., and Skarzynski, D.J. 2007. Nitric oxide in bovine corpus luteum: Possible mechanisms of action in luteolysis. Animal Science Journal 78: 233–242 Kulick, L.J., Bergfelt, D.R., Kot, K., and Ginther, O.J. 2001. Follicle selection in cattle: Follicle deviation and codominance within sequential waves. Biology of Reproduction 65: 839–846 Liszewska, E., Rekawiecki, R., and Kotwica, J. 2005. Effect of progesterone on the expression of bax and bcl-2 and on caspase activity in bovine luteal cells. Prostaglandins and other Lipid Mediators 78: 67–81 Lo´pez-Gatius, F., Garcı´a-Ispierto, I., Santolaria, P., Ya´niz, J., Nogareda, C., and Lo´pez-Be´jar, M. 2006. Screening for high fertility in high- roducing dairy cows. Theriogenology 65: 678–1689 Lo´pez-Gatiusa, F., Santolariab, P., Ya´nizb, J.L., and Hunter, R.H.F. 2004. progesterone supplementation during the early fetal period reduces pregnancy loss in high-yielding dairy cattle. Theriogenology 62: 1529–1535  41  Lucy, M.C. 2001. Reproductive loss in high-producing dairy cattle: Where will it end? Journal of Dairy Science 84: 1277-1293 Lucy, M.C. 2007. The bovine dominant ovarian follicle. Journal of Animal Science 85: E89–E99 Mackey, D.R., Gordon, A.W., McCoy, M.A., Verner, M., and Mayne, C.S. 2007. Associations between genetic merit for milk production and animal parameters and the fertility performance of dairy cows. Animal 1: 29–43 Mamluk, R., Greber, Y., and Meidan, R. 1999. Hormonal regulation of messenger ribonucleic acid expression for Steroidogenic Factor-1, Steroidogenic Acute Regulatory Protein, and Cytochrome P450 Side-Chain Cleavage in bovine luteal Cells. Biology of Reproduction 60: 628–634 McCracken, J., Custer, E., and Lamsa, J. 1999. Luteolysis: A neuroendocrine-mediated event. Physiological Reviews 79: 263-323 Miguez, P.H.P., Cunha, P.M., Marques, V.B., Bertan, C.M., Binelli, M. 2005. Combination of estradiol-17β and progesterone is required for synthesis of PGF2α in bovine endometrial explants. Animal Reproduction 2: 172-177 Milvae, R.A. 2000. Inter-relationships between endothelin and prostaglandin F2α in corpus luteum function. Reviews of Reproduction 5: 1–5 Milvae, R.A., Alila, H.W., Bushmich, S.L., and Hansel, W. 1991. Bovine corpus luteum function after removal of granulosa cells from the preovulatory follicle. Domestic Animal Endocrinology 8: 439-/443. Milvae, R.A., Hinckley, S.T., and Carlson, J.C. 1996. Luteotropic and luteolytic mechanisms in the bovine corpus luteum. Theriogenology 45: 1327 1349 Miyamoto, A., and Schams, D. 1991. Oxytocin Stimulates progesterone release from microdialyzed bovine corpus luteum in vitro. Biology of Reproduction 44: 1163-1170 Miyamoto, A., Takemoto, K., AcostA, T.J., Ohtani, M., YamadA, J., and Fukui, Y. 1998. Comparative activities of growth hormone and luteinizing hormone in the direct stimulation of local release of progesterone from microdialyzed ovine corpora lutea in vivo. Journal of Reproduction and Development 44: 273-280 Moore, K., and Thatcher, W.W. 2006. Major advances associated with reproduction in dairy cattle. Journal of Dairy Science 89: 1254–1266  42  Murakami, S., Miyamoto, Y., Skarzynskia, D.J., and Okuda, K. 2001. Effects of tumor necrosis factor-a on secretion of prostaglandins E2 and F2α in bovine endometrium throughout the estrous cycle. Theriogenology 55: 1667-1678 Murray, B. 2003. Balancing act - Research shows we are sacrificing fertility for production. http://www.omafra.gov.on.ca/english/livestock/dairy/facts/info_balancing.htm Murray, B. 2007. Pregnancy puzzle. http://www.omafra.gov.on.ca/english/livestock/dairy/facts/pregnancy.htm Nebel, L.R. 2002. What should your AI conception rate be? Dairy pipeline May http://www.ext.vt.edu/news/periodicals/dairy/2002-05/aiconception.html Nebel, L.R., and McGilliard, M.L. 1993. Interactions of high milk yield and reproductive performance in dairy cows. Journal of Dairy Science 76: 3257-3268 Nishimura, R., Shibaya, M., Skarzynski, J., and Okuda, K. 2004. progesterone stimulation by LH involves the phospholipase C pathway in bovine luteal cells. Journal of Reproduction and Developmet 50: 257-268 Niswender, G.D., Juengel, J.L., Mcguire, W.J., BelfiorE, C.J., and Wiltbank, M.C. 1994. Luteal function: The estrous cycle and early pregnancy. Biology of Reproduction 50: 239-247 Niswender, G.D., Juengel, J.L., Silva, P.J., Rollyson, M.K., and Mcintush, E.W. 2000. Mechanisms controlling the function and life span of the corpus luteum. Physiological Reviews 80: 1-29 Okuda, K., Korzekwa, A., Shibaya, M., Murakami, S., Nishimura, R., Tsubouchi, M., Woclawek-Potocka, I., and Skarzynski, D.J. 2004. Progesterone is a suppressor of apoptosis in bovine luteal cells. Biology of Reproduction 71: 2065–2071 Okuda, K., Miyamoto, Y., and Skarzynski, D.J. 2002. Regulation of endometrial prostaglandin F2_ synthesis during luteolysis and early pregnancy in cattle. Domestic Animal Endocrinology 23: 255–264 Okuda, K., and Sakumoto, R. 2006. Regulation of uterine function by cytokines in cows: Possible actions of tumor necrosis factor-α, interleukin-1α and interferon-τ. Animal Science Journal 77: 266–274 Okuda, K., Uenoyama, Y., Naito, A.C., Sakabe, A.Y., and Kawate, N. 1999. Luteinizing hormone receptors in the bovine corpus luteum during the oestrous cycle and pregnancy. Reproduction, Fertility and Development 11: 147–151  43  Pepling, M.E. 2006. From primordial germ cell to primordial follicle:mammalian female germ cell development. Genesis 44: 622-632 Perry, G. 2000. The bovine estrous cycle. South Dakota State University—Cooperative Extension Service—USDA. Pescador, N., Soumano, K., Stocco, D.M., Price, C.A., and Murphy, B.D. 1996. Steroidogenic Acute Regulatory Protein in bovine corpora lutea. Biology of Reproduction 55: 485-491 Peters, K.E., Bergfeld, E.G., Cupp, A.S., Kojima, F.N., Mariscal, V., SancheZ, T., Wehrman, M.E., Grotjan, H.E., Hamernik, D.L., KittoK, R.J., and Kinder, J.E. 1994. Luteinizing hormone has a role in development of fully functional corpora lutea (CL) but is not required to maintain corpus luteum function in heifers'. Biology of Reproduction 51: 1248-1254 Pryce, J.E., Royal MD Garnsworthy, P.C., and Mao, I.L. 2004. Fertility in highproducing dairy cow. Livestock Production Science 86: 125-135 Quintal-Franco, J.A., Kojima, F.N., Melvin, E.J., Lindsey, B.R., Zanella, E., Fike, K.E., Wehrman, M.E., Clopton, D.T., and Kinder, J.E.1999. Corpus luteum development and function in cattle with episodic release of luteinizing hormone pulses inhibited in the follicular and early luteal phases of the estrous cycle. Biology of Reproduction 61: 921– 926 Rajamahendran, R. 2007. Alberta ACCAF Advance Vol.2 Spring Rajamahendran, R., Ambrose, J.D., Burton, B. 1994. Clinical and research application of real-time ultrasonography in bovine reproduction. The Canadian Veterinary Journal 35: 563-572 Ramakrishnappa, N., Rajamahendran, R., Yung-Ming Lin., and Leung, PC.K. 2005. GnRH in non-hypothalamic reproductive tissues. Animal Reproduction Science 88: 95– 113 Rapoport, R., Sklan, D., Wolfenson, D., Shaham-Albalancy, A., and Hanukoglu, I. 1998. Antioxidant capacity is correlated with steroidogenic status of the corpus luteum during the bovine estrous cycle. Biochimica et Biophysica Acta 1380: 133–140 Rekawiecki, R., and Kotwica, J. 2007. Molecular regulation of progesterone synthesis in the bovine corpus luteum. Veterinarni Medicina 52: 405–412 Rekawiecki, R., Nowik, M., and Kotwica, J. 2005. Stimulatory effect of LH, PGE2 and progesterone on StAR protein, cytochrome P450 cholesterol side chain cleavage and 3_ hydroxysteroid dehydrogenase gene expression in bovine luteal cells. Prostaglandins and other Lipid Mediators 78: 169–184  44  Rioux, P., and Rajotte, D. 2004. Progesterone in milk: a simple experiment illustrating the estrous cycle and enzyme immunoassay. Advances in Physiology Education 28: 64– 67 Royal, M., Mann, G.E., and Flint, A.P.F. 2000. Strategies for reversing the trend towards subfertility in dairy cattle. The Veterinary Journal 60: 53–60 Sartori, R., Sartor-Bergfelt, R., Mertens, S.A., Guenther, J.N., Parrish, J.J., and Wiltbank, M.C. 2002. Fertilization and early embryonic development in heifers and lactating cows in summer and lactating and dry cows in winter. Journal of Dairy Science 85: 2803–2812 Schams, D., and Berisha, B. 2004. Regulation of corpus luteum function in cattle – an overview. Reproduction in Domestic Animals 39: 241–251 Schams, D., and Berisha, B. 2002. Angiogenic factors (VEGF, FGF and IGF) in the bovine corpus luteum. Journal of Reproduction and Developmet 48: 233-242 Schams, D., Koll, R., Ivell, R., Th. Mitter meier, and Th. Kruip, A.M. 1987. The role of OT in follicular growth and luteal function. In Follicular growth and ovulation rate in farm animals by Roche, J.F and O’Callaghan.. Scho, P.C., Ha¨mel, K., Puppe, B.,Tuchscherer, A., Kanitz, W., and. Manteuffel, G. 2007. Altered vocalization rate during the estrous cycle in dairy cattle. Journal of Dairy Science 90: 202–206 Senbon, S., Atsushi Ota, A., Tachibana, M., and Miyano, T. 2003. Bovine oocytes in secondary follicles grow and acquire meiotic competence in severe combined immunodeficient mice. Zygote 11: 139–149. Shearer, J.K. 2003. Reproductive anatomy and physiology of dairy cattle. Animal Science Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. Shirasuna, K., Matsui, M., Shimizu, T., and Miyamoto, A. 2007. Local mechanisms for luteolysis in the cow: Novel roles of vasoactive substances in the luteolytic cascade within the corpus luteum. Animal Science Journal 78: 460–466 Silvia, W.J. 1999. The role of uterine and ovarian hormones in luteolysis: A comparison among species. Reproduction in Domestic Animals 34: 317-328 Silvia, W.J., Lewis, G.S., McCracken, J.A., Thatcher, W.W., and Wilson, L.Jr. 1991. Hormonal regulation of uterine secretion of prostaglandin F2α during luteolysis in ruminants. Biology of Reproduction 45: 655–663.  45  Simmons, K.R., and Hansel, W. 1964. Nature of the luteotropic hormone in the bovine. Journal of Animal Science 23: 136-141. Skarzynski, J., Jaroszewski, J.J., and Okuda, K. 2001. Luteotropic mechanisms in the bovine corpus luteum: Role of OT, Prostaglandin F2α, Progetserone and noradrenaline. Journal of Reproduction and Developmet 47: 125-137 Slotta, K. H., Ruschig, H., and Fels, H. 1934. Reindarstellung der hormone aus dem corpus luteum. Berich. Dtsch. Chem Geselischaft 67: 1270- 1273. Smith, M.F., McIntush, E.W and Smith, G.W. 1994. Mechanisms associated with corpus luteum development. Journal of Animal Science 72: 1857-1872 Spicer, L.J., and Echternkamp, S.E. 1986. Ovarian follicular growth, function and turnover in cattle: A review. Journal of Animal Science 62: 428—451 Stevenson, J.S. 2001. Reproductive management of dairy cows in high milk- producing herds. Journal of Dairy Science 84: E128-E143 Stocco, D.M. 2001. StAR protein and the regulation of steroid hormone biosynthesis. Annual Review of Physiology 63: 193–213 Stocco, D.M., Wang, X.J., Jo, Y., and Manna, P.R. 2005. Multiple signaling pathways regulating steroidogenesis and StAR expression: More complicated than we thought. Molecular Endocrinology 19: 2647–2659 Taniguchi, H., Yokomizo, Y., and Okuda, K. 2002. Fas-Fas ligand system mediates luteal cell death in bovine corpus luteum. Biology of Reproduction 66: 754–759 Veerkampa, R.F., and Beerdaa, B. 2007. Genetics and genomics to improve fertility in high producing dairy cows. Theriogenology 68S: S266–S273 Veerkampa, R.F., Beerdaa, B., and van der Lende, T. 2003. Effects of genetic selection for milk yield on energy balance, levels of hormones, and metabolites in lactating cattle, and q possible links to reduced fertility. Livestock Production Science 83: 257–275 Wang, X.J., Walsh, L.P., Reinhart, A.J., and Stocco, D.M. 2000. The role of arachidonic acid in steroidogenesis and Steroidogenic Acute Regulatory (StAR) gene and protein expression. The journal of Biological Chemistry 275: 20204–20209 Webb, R., Woad, K.J., Armstrong, D.G. 2002. Corpus luteum function: local control mechanisms. Domestic Animal Endocrinology 23: 277–285 Wiltbank, J.N., and Casida, L.E. 1956. Alteration of ovarian activity by hysterectomy. Journal of Animal Science 15: 134-140.  46  Wolf, E., Arnold, G.J., Bauersachs, S., Beier, H.M., Blum, H., Einspanier, R., Fro¨ hlich, T., Herrler, A., Hiendleder, S., Kolle, S., Prelle, K., Reichenbach, H-D., Stojkovic, M., Wenigerkind, H., and Sinowatz, F. 2003. Embryo-maternal communication in bovine – Strategies for deciphering a complex cross-talk. Reproduction in Domestic Animals 38: 276–289 Yadav, V.K., Sudhagar, R.R., and. Medhamurthy, R. 2002. Apoptosis during spontaneous and prostaglandin F2a-induced luteal regression in the buffalo cow (Bubalus bubalis): Involvement of mitogen-activated protein kinases. Biology of Reproduction 67: 752–759 Yuan, W., and M. C. Lucy. 1996. Messenger ribonucleic acid expression for growth hormone receptor, luteinizing hormone receptor and steroidogenic enzymes during the estrous cycle and pregnancy in porcine and bovine corpora lutea. Domestic Animal Endocrinology 13: 431-444.  47  CHAPTER 2 COMPARISON OF PREGNANCY RATES AND PERIPHERAL PROGESTERONE LEVELS BETWEEN DAIRY HEIFERS AND MATURE COWS.  2.1. INTRODUCTION Reduced fertility of cows is the most economical trait to a dairy producer and it has become a major problem for many dairy producers. Cows fertility is commonly measured by calculating the pregnancy rate per artificial insemination (PR/AI) (Quintela et al., 2004). The calving rate of the modern dairy cow is declining at approximately 1% per annum (Royal et al., 2000). A number of recent publications have documented the decline in reproductive efficiency in dairy cattle (Pryce et al., 2004; Royal et al., 2000; Lucy, 2001; Butler, 1998; Dillon and Veerkamp, 2001). A decline in first service conception rate from approximately 65% in 1951 to 40% in 1996 (Liu and Rosenwake, 2001) has been reported and this declines in reproductive efficiencies in dairy cattle is occurring world wide- the United States, Ireland, the United Kingdom, Australia etc (Lucy, 2001). The striking interesting feature is that over the past fifty years it has been found that with the decline of fertility efficiency, milk production has dramatically increased (Jeffrey, 2001). For example in the United States milk production has increased by ______________ * A version of this chapter has been accepted for publication- Balendran, A., Gordon, M., Pretheeban, T., Singh, R., Perera, R., and Rajamahedran, R. 2008. Decreased fertility with increasing parity in lactating dairy cows. Canadian Journal of Animal Science (September 2008).  48  approximately 20% in the last ten years. At the same time, indices of reproductive efficiency have worsened (Lucy, 2001). Data from national Milk Records in the United Kingdom show that average yields of dairy cows have risen by 200kg/year over the last 4 years (Pryce et al., 2004). With increasing milk yields fertility has declined and there is a long history of associating greater milk production with reduced reproductive performance in dairy cattle. Based on large data sets, there is clearly an antagonistic relationship between milk production and reproductive efficiency in fertility (Kuhn et al., 2006; Lo´pez-Gatius et al., 2006; Dematawewa, and Berger, 1998). Although fertility has declined with high milk yield it has been found that generally fertility is better in maiden heifers than in mature cows (Sartoriet et al., 2002; Pryce et al., 2004). For example observed conception rates to first service are 64% and 71% respectively in lines of maiden heifers of high and average genetic merit, while conception rates were 39% and 45% for mature cows of high and average genetic merit in the same herd (Pryce et al., 2004). Despite the decline of the reproductive efficiency in mature cows, several reports indicate that the pregnancy rates (PR) for heifers bred by Artificial Insemination (AI) have not markedly changed during the past 50 years (Nebel, 2002; Pursley et al., 1997). However, reproductive statistics for heifers have not been published recently and would be a valuable tool for assessing changes in PR associated with parity that occur independent of lactation. Defects in CL functions can affect cattle fertility. Luteal phase insufficiency may be defined as a luteal phase of normal duration with reduced secretion of P4 by the CL of a specific estrous cycle (Roberson, 1989). P4 is a hormone necessary for uterine function and embryonic development. It also influences maternal recognition of the embryo  49  (Kerbler et al., 1997; Mann and Lamming, 2001). Reduced PR in cattle may be due to low or abnormal P4 levels after AI (Hommeida et al., 2004). The landmark events in P4 production after AI include the beginning of the luteal phase with the formation of the CL (CL) and associated initial rise in P4 levels. This is followed by either the end or the prolongation of the luteal phase phase. In the case of an unsuccessful AI the luteal phase ends with a decline in P4 production. If the AI is successful and the embryo is recognized the luteal phase is prolonged and continued with elevated P4 levels. A positive relationship between P4 levels at the beginning of the luteal phase and pregnancy has been observed (Butler et al., 1996). P4 levels at the end of the luteal phase have also been reported as differing between pregnant and non-pregnant cows (Feliciano et al., 2003; Chagas e Silva et al., 2002). P4 concentrations in serum and milk are closely related to dynamics of the reproductive cycle and status of cows (Shamsuddin et al., 2006; Shearer, 2003; Nebel, 1988). Lactating dairy cattle have been shown to have lower blood P4 levels than they did 30 years ago (McSweeney, 2004). However, the effect of parity on peripheral P4 production is as yet unclear. Therefore, the objectives of this study were to a) compare PR between cows of different parity and heifers and b) describe differences between cows and heifers P4 levels as a means of examining reasons for decreased PR with increasing parity.  50  2.2. MATERIALS AND METHODS  2.2.1. Animals and management This experiment was carried out at the University of British Columbia Dairy Education and Research centre at Aggasiz in central Fraser Valley of British Columbia. Handling and management of animals was conducted in accordance with the guidelines of the Canadian Council on Animal care (1993). A total of 163 Holstein heifers and postpartum cows (in 1st parity, 2nd parity, and 3rd or 4th parity) were included for this study. All animals were housed in free stall barns and fed a total mixed ration of corn silage, hay, and concentrates.  2.2.2. Breeding Both heifers and cows were artificially bred at the time of natural estrus as part of the routine management of the herd. Pregnancy diagnosis was performed 35 days post Artificial Insemination (AI) by per-rectal ultrasound-scanning. A real-time ultrasound-scanning device (Aloka 500 V, Aloka Co. Ltd., Tokyo, Japan), equipped with a 7.5 MHz trans-rectal transducer was used. During scanning, the uterine horns and body of the uterus were scanned in several planes in order to examine uterine contents, and to identify embryonic vesicles and the embryo proper. Animals which returned to estrus or became non pregnant after first insemination, were bred second time. AI services and pregnancy diagnosis results were recorded until at least 30 animals were included in each of four groups: heifers (14 to 16 months), 1st parity, 2nd parity and 3rd  51  or 4th parity. Pregnancy rate was calculated based on number of animals that became pregnant in relation to the total number inseminated  2.2.3. Blood and milk sample collection for progesterone measurement. In addition, the luteal function of 10 heifers, and 10 cows in each of three parity groups: 1st parity, 2nd parity and 3rd or 4th parities were assessed based on P4 levels. For P4 assay blood samples were taken from heifers and whole milk samples were taken from mature cows. In total, 11 samples were collected every other day from each animal, from the day of AI (day 0) until 22 days post AI. Blood samples were taken from the tail vein between the second and third coxial vertebrae, centrifuged and the plasma frozen for the subsequent P4 analysis. Whole milk samples were obtained during the milking time in the parlor and frozen for the subsequent P4 analysis. 2.2.4. Radioimmunoassay for progesterone measurement. Concentration of P4 in milk and plasma samples were measured using commercially available, solid phase, radioimmunoassay (RIA) kit (Coat-A-Count, Diagnostic Products Corp., Los Angeles, CA) according to the University of British Columbia Radiation safety measures. This kit was previously validated for the measurement of P4 concentration in milk and plasma samples in the present laboratory (Rajamahendran and Taylor, 1990). At the time of assay, an aliquot of 100 µl of P4 standards was transferred into duplicate set of tubes (antibody coated) which were labeled as AA, BB, CC, DD, EE, FF, and GG. The standard tubes (AA through GG) corresponded to the P4 concentrations of 0, 0.1, 0.5, 2.0, 10.0, 20.0, and 40.0ng/ml. Similarly the required number of additional tubes (antibody coated) were supplied with  52  an aliquot of 100 µl of experimental samples (milk and plasma), and each tube was assigned with a unique identification number to match respective samples (milk and plasma). All tubes were arranged in serial order (Tube A to Tube N in numbers), and each tube was supplied with progesterone-buffered I  125  labeled P4. (1.0ml). The tube  contents were gently agitated, and incubated at room temperature for 3 h to achieve the equilibrium of antibody-antigen reaction. At the end of 3 h incubation, the liquid portion of the assay mixture was decanted from the tubes and any remaining liquid residue was removed by holding the tubes, in an inverted position on a blotting surface. The solid portion of assay mixture (in tubes) that contained radioactivity was counted for 1 min using a gamma counter (Packard Auto gamma 500, Packard Instruments, Downers Grove, II, USA). The counter had built in program that directly gave sample progesterone concentrations in ng/ml.  2.2.5. Reproductive status of the animals based on progesterone concentrations Animals that were in estrus was based on P4<1ng/ml on the day of AI and ovulation rates were based on P4>1ng/ml on day 7 post breeding. Animals were considered as pregnant which P4 levels <1ng/ml on day 0 and was maintained >1ng/ml on day 7 through 21 post AI.  2.2.6. Statistical analysis A χ-square test was used to compare pregnancy rates among groups of different parity, with a α value set at 0.05. Mean P4 levels among each parity group for each day were calculated for assessment of luteal function. For the comparison among groups of  53  parity, animals with short cycles or P4 levels that remained basal during sampling were not included in mean P4 values. P4 levels were compared using by one-way analysis of variance (ANOVA). A two sample t-test was used to compare mean P4 levels between the pregnant and non pregnant animals.  2.3. RESULTS Pregnancy rate following first insemination was 67.9%, 42.9%, 20.0%, and 11.9% among heifers, 1st parity, 2nd parity and 3rd/4th parity cows, respectively (figure 2.1). Statistical analysis showed that pregnancy rate (PR) was greater in heifers following first insemination (p<0.05) compared to 1st parity, 2nd parity and 3rd/4th parity cows. First insemination PR among 1st parity cows was also higher (p<0.05) compared to 3rd/4th parity cows. Pregnancy rate following second insemination increased to 84.3%, 51.5%, 31.4%, and 19.5% among heifers, 1st parity, 2nd parity and 3rd/4th parity cows respectively. Heifers PR following second insemination remained higher (p<0.05) than PR for all parity cow groups (figure 2.2). In all experimental groups P4 levels followed the same pattern. Starting with <1ng/ml on day 0, then increased with number of post AI days and reached maximum level between day 16-18 post AI (Table 2.1). On the day of estrus and on day 18 post AI heifers, 1st, 2nd and 3rd/4th parity cows had mean P4 levels 0.07, 0.15, 0.12, 0.21 ng/ml and 5.40, 7.36, 5.30, 6.68 ng/ml respectively. P4 levels were not significantly different between experimental groups on any of the days post AI (figure 2.3). Animals diagnosed pregnant had significantly higher P4 levels on day 8 post AI than non-pregnant (Figure  54  2.4). On day 8 post AI, P4 level in pregnant animals was 4.15 ng/ml, whereas it was 2.68 ng/ml in non pregnant animals.  2.4. DISCUSSION In this study heifers had the highest pregnancy rates compared to mature cows following first and second inseminations. This present finding is in agreement with several of the related studies reported in the literature (Lucy, 2001; Butler, 2000; Pursley et al., 1997; Chagas e Silva et al., 2002; Lamming and Darwash, 1998). Pregnancy rates for first parity cows are higher than 3rd/4th parity cows in first and second inseminations. Research has been shown that conception rate for primiparous cows are higher than multiparous (Tenhagen et al., 2003). With each calving, fertility goes down until cow reaches maturity (Butler, 2006). One of the reasons for such fertility decline in mature cows is poor estrus detection. Nearly 50% of the normally cycling mature cows fail to show estrus signs (Van Eerdenburg, 2002; Pankowski et al., 1995). Poor estrus detection increases days of open and lengthens the calving intervals beyond 12 months, which is the recommended length (Pankowski et al., 1995). Compared to mature cows, estrus detection efficiency is much greater in heifers. In mature cows the average estrus period is 7.3 hours and average number of stand to be mounted from the beginning of estrus to the end is only 7.2 times, whereas in heifers estrus length is 11.3 hours and number of stand to be mounted is 16.8 (Nebel et al., 1997). Nearly 12 hours of estrus period in heifers makes estrus observation easier.  55  It has been found that long term single-trait selection for milk production is known to lead to impaired fertility and consequently to shorter lifespan (Ranberg et al., 2003; Roxström. 2001). Several United States and United Kingdom studies show production has a negative genetic correlation with reproductive performance (Murray, 2003; Pryce, 2004; Lo´pez-Gatius, 2006). Continued genetic gain in production traits, declined the fertility. It has been suggested that for every 1,000 kilogram increase in milk production, the average days open go up by eight days (Murray, 2003). Selection for milk yield has changed the endocrine profiles of the cow which favors the blood concentration of hormones for lactation (Nebel and McGllllard, 1993). Further high milk production exerts a negative effect on oocyte quality and embryonic development (Sartori et al., 2002; Hansen, 2002.). Stress increases such negative effect (Dobson and Smith, 2000). For example high producing cows under heat stress have more tendencies to have ovarian abnormalities (Mirzaei, 2007). First, second and subsequent ovulations have higher number of multiple ovulations in high producing animals (Lopez et al 2005). There is a very good correlation with milk yield and twinning (Lopez et al 2005). In cows double ovulation increases with parity (Lo´pez-Gatius., et al 2005). It has been stated that selection for milk yield appears to result in improved fertility of virgin heifers (Hansen, L. B. 2000). Differences in follicular development and circulating hormone concentrations are the two possible other factors which are related to the fertility difference between heifers and mature cows. The origin of pre ovulatory follicle is being considered important to the fertility of cattle (Wolfenson et al., 2004). It has long been known that fertility following insemination of cows with persistent dominant follicles is low (Savio et al., 1993; Revah  56  and Butler, 1996; Austin et al., 1999). Heifers have higher growing follicle: persistent follicle ratio compared to mature cows. In other words cows preovulatory follicle is large and dominance is longer than 4 days than heifers with high concentration of FSH (Wolfenson et al., 2004). This explains why cows had much greater incidence of multiple ovulations than heifers. The average range of multiple ovulation rates for high producing cows is 15-39% (Lopez et al., 2005). It has been stated that oocytes from persistent dominant follicles undergo premature meiosis (Revah and Butler, 1996; Mihm et al., 1999). They also exhibit various abnormalities including an enlargement of the perivitelline space, intracellular vacuoles and irregular vesicles, and increased numbers of mitochondria and lipid droplets (Mihm et al., 1999). It has been also found that estradiol concentrations around estrus and LH surge were higher in heifers than cows (cooperative Regional Research Project 1996; Sartori et al., 200; Wolfenson et al., 2004). Interestingly, it has been reported that longer than ‘normal’ estrous cycles are becoming increasingly common in high-yielding cows (Lucy, 2001). It has been shown that another factor influencing fertility in dairy herds is first calving. Heifers have conception rates close to theoretical optimal values. First calving reduces the conception rate 35 to 50% (Nebel, 2002). This study also agrees with this statement. Disease after parturition could cause this tremendous reduction in fertility. The onset of normal ovarian activity is one of the most important events for the modern dairy cow to regain her maximum breeding potential after calving. It has been shown that resumption of ovarian activity in the postpartum and the ovarian dysfunctions mainly delayed cyclicity and longer luteal phase are highly occurring disorders in high producing dairy cows (Opsomer et al., 2000). Many herds experience at least 50% of cows calving  57  having one or more postpartum disease. Uterine abnormalities and inability of the uterus to produce prostaglandins also affect fertility (Opsomer et al., 2000). The uterine environment changes after the first calving, with 50 to 90% of cows experiencing some level of uterine infection (Nebel, 2002). Mature cows have a much greater incidence of ovulation failure after luteolysis and multiple ovulations than heifers. Further, late embryonic mortality is higher in mature cows than heifers (Chagas e Silva et al., 2002). Overall heifers have lower reproductive abnormalities compared to mature cows (Sartori et al., 2004). The conception rate in normal cows and the proportion of normal cows in a herd determine the conception rate ceiling of the overall herd. In several studies, average milk P4 concentration at mid-luteal phase in cows was >2.0 ng/ml; P4 concentrations that increase a few days after estrus and remain elevated for approximately 2 weeks are the hallmark of a normal estrous cycle (Hommeida et al., 2004). Any deviation from this pattern is likely to be associated with reduced fertility. This study showed that P4 levels were elevated in pregnant animals compared to non pregnant animals but not significantly different between heifers and mature cows. Most of the studies including this study agree that plasma P4 concentrations significantly deviated from those of pregnant and non pregnant dairy cattle on day 17 of the estrus cycle (Shearer, 2003; Lamming. and Darwash, 1998; Larson et al., 1997; Hansel, 1981; Fonseca et al., 1983). This study agrees with Sartori et al. (2002), and Cooperative Regional Research Project, NE-161. (1996). They found in spite of cows having large CL (Sartori et al., 2004) circulating P4 levels are same in both heifers and cows. Disagrees with Wolfensen et al. (2004), they found difference. Peripheral P4 concentrations can be affected by metabolic statues of the animal (O’Callaghan et al., 1999) and milk yield  58  (Hommeida et al., 2004) Cows in severe negative energy balance during early lactation have lower conception rate (Butler et al., 2006). There is good evidence that milk yield, feed intake and energy balance are heritable traits, and that selection for a higher yield alone increases feed intake (Veerkampa et al., 2003). The concentrations of P4 in blood are related to its production and clearance rates. The liver is the primary site for P4 metabolism. Feed intake was known to modify the blood flow rate to the liver and thus be expected to substantially alter the P4 clearance rate, which has an influence on the circulating concentrations of P4 (Hommeida et al., 2004; Sangsritavong et al., 2002). It is possible that local (uterine tissue and lumen) concentrations of P4 are more relevant for embryo survival than peripheral concentrations. This could partially explain the maintenance of pregnancy in cattle with low plasma P4 concentrations (Chagas e Silva and Lopes da Costa, 2004). Considering all these, peripheral P4 levels may be same in high fertile and low fertile animals and may not show the significant differences.  2.5. CONCLUSION This study clearly demonstrates that cow parity has a significant effect on pregnancy rate. Markedly lower pregnancy rate was observed in animals of higher parity. P4 levels were not affected by parity, and therefore are likely not directly involved in the mechanism of parity’s influence on Pregnancy rate.  59  Table 2.1. Comparison on progesterone levels among cows of different parity  Animals P4 D0  P4 D2  P4 D4  P4 D6  P4 D8  P4 D10  P4 D12  P4 D14  P4 D16  P4 D18  P4 D20  Heifers  0.07 + 0.07  0.18 + 0.27  1.00 + 0.88  2.87 + 1.47  3.88 + 2.12  4.68 + 2.65  5.16 + 2.10  4.96 + 2.12  5.81 + 2.42  5.40 + 2.51  4.60 + 4.07  1st parity  0.15 + 0.16  0.24 + 0.16  1.22 + 0.59  2.42 + 1.42  3.87 + 1.70  6.27 + 3.05  5.91 + 1.72  6.81 + 1.78  9.20 + 4.28  7.36 + 1.74  5.48 + 3.68  2nd parity  0.12 + 0.07  0.11 + 0.11  0.74 + 0.43  2.46 + 1.75  2.70 + 1.08  3.93 + 2.11  4.94 + 1.33  5.16 + 1.71  6.05 + 2.00  5.30 + 2.86  5.38 + 4.19  3rd/4th parity  0.21 + 0.18  0.45 + 0.32  1.24 + 0.86  2.78 + 1.22  3.12 + 1.27  4.91 + 2.70  5.08 + 3.17  6.35 + 2.13  6.58 + 3.09  6.68 + 4.08  6.58 + 3.50  P4 D- mean progesterone value (ng/ml) on day .  60  90  80  Heifers  a  1st parity  60  2nd parity  50  3rd and 4th parity  40  b  30  b,c  20  c  10 0  Heifers  80  Percent Pregnant (%)  P e rc e n t P re g n a n t (% )  70  a  1st parity  70  2nd parity  60  b  50 40  3rd and 4th parity b,c  30  c  20 10 0  N=53  N=33  N=35  N=42  Figure 2.1. First insemination pregnancy rates. Columns with different superscripts differ significantly (p<0.05)  N=51  N=33  N=35  N=41  Figure 2.2. First and second insemination pregnancy rates. Columns with different superscripts differ significantly (p<0.05)  61  14  12  Heifers (N=9) 1st Parity (N=7)  [Progesterone] ng/mL  10  2nd Parity (N=7) 3rd and 4th Parity (N=7)  8  6  4  2  0 Day 0 -2  Day 2  Day 4  Day 6  Day 8  Day 10 Day 12 Day 14 Day 16 Day 18 Day 20  Days Post AI  Figure 2.3. Comparison of progesterone levels among cows of different parity. Animals include only those with normal cycles.  62  12  10  Progesteron (ng/mL)  8  Pregnant Cow 6  Non Pregnant (animals with irregular cycles not  *  4  2  0 Day 0 Day 2 Day 4 Day 6 Day 8 Day 10  Day 12  Day 14  Day 16  Day 18  Day 20  Days Post AI  Figure 2.4. Pregnant Vs Non pregnant P4 levels.  63  2.6. REFERENCES Austin EJ, Mihm M, Ryan MP, Williams DH, Roche JF. 1999. Effect of duration of dominance of the ovulatory follicle on onset of estrus and fertility in heifers. Journal of Animal Science 77: 2219–26 Butler, W.R. 2000. Nutritional interactions with reproductive performance in dairy cattle. Animal Reproduction Science 60: 449-457 Butler, W.R. 1998. Review effect of protein nutrition on ovarian and uterine physiology in dairy cattle. Journal of Dairy Science 81: 2533-2539 Butler, W.R. 2006. Relationships of negative energy balance with fertility. Penn State Dairy Cattle Nutrition Workshop Butler, W.R., Calaman, J.J., Beam, S.W. 1996. Plasma and milk urea nitrogen in relation to pregnancy rate in lactating dairy cattle. Journal of Animal Science 74: 858-865 Chagas e Silva, J., and Lopes da Costa, L. 2004. Luteotrophic influence of early bovine embryos and the relationship between plasma progesterone concentrations and embryo survival. Theriogenology 64: 49–60 Chagas e Silva, J., Lopes da Costa, L., Robalo Silva, J. 2002. Plasma progesterone profiles and factors affecting embryo-fetal mortality following embryo transfer in dairy cattle. Theriogenology 58: 51-59 Cooperative Regional Research Project, NE-161. 1996. Relationship of fertility to patterns of ovarian follicular development and associated hormonal profiles in dairy cows and heifers. Journal of Animal Science 74: 1943–52 Dematawewa, C.M.B. and Berger, P.J. 1998. Genetic and phenotypic parameters for 305day yield, fertility and survivals in Holsteins. Journal of Dairy Science 81: 2700-2709 Dillon,P., and Veerkamp, R.F. 2001. http://www.teagasc.ie/publications/2001/ndc/ndc-dillon.htm  Breeding  strategies  Dobson, H., and Smith, R.F. 2000. What is stress, and how does it affect reproduction? Animal Reproduction Science 60–61: 743–752 Feliciano, C.M., Mateus, L., daCosta, L.L. 2003. Luteal function and metabolic parameters in relation to conception in inseminated dairy cattle. Revista Portuguesa de Ciências Veterinárias 98: 25-31 Fonseca, F.A., Britt, J.H., McDaniel, B.T., Wilk, J.C., Bakes, A.H. 1983. Reproductive traits of Holsteins and Jerseys. Effect of age, milk yield, clinical abnormalities on  64  involution of cervix and uterus, ovulation, estrous cycles, detection of estrus, conception rate and days open. Journal of Dairy Science 66: 1128–47 Hansel, W. 1981. Plasma hormone concentrations associated with early embryo mortality in heifers. Journal of Reproduction and Fertility (Supplement) 30: 231–239 Hansen, L. B. 2000. Symposium: Selection for milk yield. Consequences of selection for milk yield from a geneticist’s viewpoint. Journal of Dairy Science 83: 1145–1150 Hansen, P.J. 2002. Embryonic mortality in cattle from the embryo’s perspective. Journal of Animal Science 80: E33–E44 Hommeida A, Nakao T, and Kubota H. 2004. Luteal function and conception in lactating cows and some factors influencing luteal function after first insemination. Theriogenology 62: 217–225 Jeffrey, S. 2001. Reproductive management of dairy cows in high milk – producing herds. Journal of Dairy Science 84: E128-143 Kerbler, T.L., Buhr, M.M., Jordan, L.T., Leslie, K.E., and Walton, J.S. 1997. Relationship between maternal plasma progesterone concentration and interferon-tau synthesis by the conceptus in cattle. Theriogenology 47: 703–714 Kuhn, M. T, Hutchison, J.L, and Wiggans, G.R 2006. Characterization of holstein heifer fertility in the United States. Journal of Dairy Science 89: 4907–4920 Lamming, G.E., and Darwash, A.O. 1998. The use of milk progesterone profiles to characterise components of subfertility in milked dairy cows. Animal Reproduction Science 52: 175-190 Larson, S.F., Butler, W.R., Currie, W.B. 1997. Reduced fertility associated with low progesterone postbreeding and increased milk urea N2 in lactating cows. Journal of Dairy Science 80: 1288–95 Liu, H.C. and Rosenwake, Z.He. 2001. Application of complementary DNA microarray (DNA chip) technology in the study of gene expression profiles during folliculogenesis. Fertility and Sterility 75: 947-955 Lo´pez-Gatius, F., Garcı´a-Ispierto, I., Santolaria, P., Ya´niz, J., Nogareda, C., Lo´pezBe´jar, M. 2006. Screening for high fertility in high-producing dairy cows. Theriogenology 65: 1678–1689 Lo´pez-Gatius, F., Lo´pez-Be´jar, M., Fenech, M., and Hunter, R.H.F. 2005. Ovulation failure and double ovulation in dairy cattle: Risk factors and effects. Theriogenology 63: 1298–1302  65  Lopez, H., Caraviello, D.Z., Satter, L.D., Fricke, P.M., and Wiltbank, M.C. 2005. Relationship between level of milk production and multiple ovulations in lactating dairy cows. Journal of Dairy Science 88: 2783–2793 Lucy, M.C. 2001. Reproductive loss in high-producing dairy cattle: Where will it end? Journal of Dairy Science 84: 1277-1293 Mann, G.E., Lamming, G.E. 2001. Relationship between the maternal endocrine environment, early embryo development and the inhibition of the luteolytic mechanism in the cow. Reproduction 121: 175–80 McSweeney, K. 2004. Embryonic loss:What causes it, what amount is normal, and how do I manage it? Colorado daily news 10: No1 Mihm, M., N. Curran, P. Hyttel, P. G. Knight, M. P. Boland and J. F. Roche. 1999. Effect of dominant follicle persistence on follicular fluid oestradiol and inhibin and on oocyte maturation in heifers. Journal of Reproduction and Fertility 116: 293–304 Mirzaei, M., Kafi, M., Ghavami, M., Mohri, M., and Gheisari, H-Z. 2007. Ovarian activity in high and average producing holstein cows under heat stress conditions. Comparative Clinical Pathology 16: 235-241 Murray, B. 2003. Balancing act - Research shows we are sacrificing fertility for production Traits. August ruminations column of the Ontario Milk Producer magazine. Nebel, R. L., Jobst, S.M., Dransfield, M.B.G., Pansolfi, S.M. and Bailey., T. L. 1997. Use of a radio frequency data communication system, HeatWatchÒ, to describe behavioral estrus in dairy cattle. Journal of Dairy Science 80 (Supplement1): 179 Nebel, R.L. 2002. What should your AI conception rate be? Dairy Pipeline May. Nebel, R.L., and McGllllard, M.L. 1993. Interactions of high milk yield and reproductive performance in dairy cows. Journal of Dairy Science 76: 3257-3268 O’Callaghan, D., Boland, M.P. 1999. Nutritional effects on ovulation, embryo development and the establishment of pregnancy in ruminants. Animal Science (United Kingdom) 68: 299–314 Opsomer, G., Grohn, Y.T., Hertl, J., Coryn, M., Deluyker, H., and Kruif’ de, A. 2000. Risk factors for post partum ovarian dysfunction in high producing dairy cows in Belgium: A field study. Theriogenology 53: 841-857 Pankowski, J.W., Galton, D.M., Erbp, H.N., Guard, C.L., and Grohn, Y.T. 1995. Use of prostaglandin Fz, as a postpartum reproductive management tool for lactating dairy cows. Journal of Dairy Science 78: 1477-1488  66  Pryce, J.E., Royal, M.D., Garnsworthy, P.C., and Mao, I.L. 2004. Fertility in highproducing dairy cow. Livestock Production Science 86: 125-135 Pursley, J.R., Wiltbank, M.C., Stevenson, J.S., Ottobre, J.S., Garverick, H.A., and Anderson, L.L. 1997. Pregnancy rates per artificial insemination for cows and heifers inseminated at a synchronized ovulation or estrus. Journal of Dairy Science 80: 295-300 Quintela, L.A., Peña, A.I., Taboada, M.J., Alonso, G., Varela-Portas, B., Díaz, C., Barrio, M., García, M.E., Becerra, J.J., and Herradón, P.G. 2004. Risk factors for low pregnancy rate in dairy cattle: a retrospective study in the north west of spain. Archivos de Zootecnia 53: 69-76 Rajamahendran, R., and Taylor, C. 1990. Characterization of ovarian activity in postpartum dairy cows using ultrasound imaging and progesterone profiles. Animal Reproduction Science 22: 171-180 Ranberg, I.M.A., Heringstad, B., Klemetsdal, G., Svendsen, M., and Steine, T. 2003. Heifer fertility in Norwegian dairy cattle: Variance components and genetic change. Journal of Dairy Science 86: 2706–2714 Revah, I., and W. R. Butler. 1996. Prolonged dominance of follicles reduces the viability of bovine oocytes. Journal of Reproduction and Fertility 106: 39 Roberson, M.S, Wolfe, M.W, Stumpf, T.T, K11tok, R.J, and Kinder, J.E 1989. Luteinizing hormone secretion and corpus luteum function in cows receiving two levels of progesterone. Biology of Reproduction 41: 997-1003 Roxström, A. 2001. Genetic aspects of fertility and longevity in dairy cattle. Thesis: (doctoral)-Swedish University of Agricultural Sciences. Royal, M., Mann, G.E., and Flint, A.P.E. 2000. Strategies for reversing the trend towards subfertility in dairy cattle. The Veterinary Journal 60: 53-60 Sangsritavong, S., Combs, D. K., Sartori, R., Armentano, L., and Wiltbank, M.C. 2002. High feed intake increases liver blood flow and metabolism of progesterone and 17βestradiol in dairy cows. Journal of Dairy Science 85: 2831–2842 Sartori R, Haughian J, Rosa GJM, Shaver RD, Wiltbank MC. 2000. Differences in lactating cows and nulliparous heifers in follicular dynamics. Journal of Animal Science 78(Suppl 1): 212 Sartori, R., et al. 2002. Ovarian structures and circulating steroids in heifers and lactating cows in summer and lactating and dry cows in winter. Journal of Dairy Science 85: 28132822  67  Sartori, R., Haughian, J.M., Shaver, R.D., Rosa, G.J.M., and Wiltbank, M.C. 2004. Comparison of ovarian function and circulating steroids in sstrous cycles of holstein heifers and lactating cows. Journal of Dairy Science 87: 905-920 Savio, J. D., Thatcher, W.W., Badinga, L., de la Sota, R.L., and Wolfenson, S. 1993a. Regulation of dominant follicle turnover during the estrous cycle in cows. Journal of Reproduction and Fertility 97: 197 Shamsuddin, M., Bhuiyan, M.M.U., Chanda, P.K., and Alam, M.G.S., and Galloway, D. 2006. Radioimmunoassay of milk progesterone as a tool for fertility control in smallholder dairy farms. Tropical Animal Health and Production 38: 85–92 Shearer, J. K. 2003. The milk progesterone test and its applications in dairy cattle reproduction. http://edis.ifas.ufl.edu. Nebel, R.L. 1988. Symposium: Cow side tests. On-farm milk progesterone tests. Journal of Dairy Science 71: 1682-1690 Tenhagen, B.A., Wittke, M., Drillich, M., and Heuwieser, W. 2003. Timing of ovulation and conception rate in primiparous and multiparous cows after synchronization of ovulation with GnRH and PGF2α. Reproduction in Domestic Animals 38: 451–454 Van Eerdenburg, F. J. C. M., Karthaus, D., Taverne, M. A. M., Merics, I., and Szenci, O. 2002. The relationship between estrous behavioral score and time of ovulation in dairy cattle. Journal of Dairy Science 85: 1150–1156 Veerkampa, R.F., Beerdaa, B., Lendeb van der, T. 2003. Effects of genetic selection for milk yield on energy balance, levels of hormones, and metabolites in lactating cattle, and possible links to reduced fertility. Livestock Production Science 83: 257–275 Wolfenson, D., Inbar, G., Roth, Z., Kaim, M., Bloch, A., Braw-Tal, R. 2004. Follicular dynamics and concentrations of steroids and gonadotropins in lactating cows and nulliparous heifers. Theriogenology 62: 1042–1055  68  CHAPTER 3 COMPARISON OF EXPRESSION LEVELS OF GENES ASSOCIATED WITH PROGESTERONE SYNTHESIS IN DAIRY HEIFERS AND MATURE COWS  3.1. INTRODUCTION Decreased reproductive efficiency in high-yielding dairy cows has led to a growing interest to gain a better understanding of the molecular basis of fertility with the objective to find out novel ways that can be used to improve fertility. One approach to this is the identification of genes expressed in tissues related of reproduction (Bonsdorff et al., 2003). Unlike most other endocrine organs, the ovary is not a steady state tissue. Beginning at puberty, CL proceeds through cycles of differential gene and hormone expression (Hartung et al., 1995). This cyclic pattern of gene expression is interrupted at pregnancy, when the CL instead of undergoing luteolysis at the end of the cycle is maintained until parturition or shortly thereafter. CL a yellowish body is a transient endocrine gland developed from a graffian follicle after ovulation (Levy et al., 2000). Formation and regression of the CL are processes that require rapid changes in the expression of specific genes and thus have an important role in regulating the cyclicity of the cow (Richard et al., 1995). To date, genes such as Steroidogenic Acute Regulatory  ______________ *A version of this chapter will be submitted for publication- Balendran, A.,,.Singh, R., Giritharan, G., Pretheeban, T., and Rajamahedran, R. Comparison of expression levels of genes associated with progesterone synthesis in dairy heifers and mature cows  69  protein (StAR), Cyochrome P-450 (SCC), Alpha2 collagen (COLIA2), metalloproteinase inhibitor mRNA (TIMP2), Vimentin (VIM), Osteonectinn (SPARC), 3-beta-hydroxy-5 steroid dehydrogenase (HSD3B1), Elongation factor (EEF1A1), Apolipoprotein A-1 (APOA1), Ribosomal protein (RPL10), Insulin-like growth factor-1 ((IGF-1), Insulin-like growth factor binding protein-2 & 3, and apoptotic genes have been identified to be expressed in bovine CL (Bonsdorff et al., 2003; Kirby et al., 1996; Taniguchi et al., 20006; Okuda et al., 2004). None of these studies looked at the differential expression pattern of these genes in heifers compared to lactating cows. Studying the expression levels of StAR, Cytochrome P450, 3-β HSD, heat shock protein 70 and apoptotic genes in heifers and lactating cows may reveal reason(s) for reduced pregnancy rates in lactating dairy cows. P4 is the primary steroid produced by the CL, and it is an essential requirement for the process of embryo implantation and maintenance of pregnancy. The patterns of activity and messenger RNA abundance of the steroidogenic enzymes StAR, 3-β HSD, and P450 have been described for the CL during the bovine luteal phase (Pescador et al., 1996). StAR is responsible for the transport of free cholesterol from outer mitochondrial membrane into inner mitochondrial membrane (Conley et al., 1995). This protein can induce acute changes in the rate of steroidogenesis (Pescador et al., 1996). In the mitochondria the enzyme P450 converts the free form of cholesterol into pregnenolone and another key enzyme 3-β HSD converts pregnenolone into P4 (Gordon, et al., 2000). In general, the mRNA coding for P450 and 3-β HSD increases during luteal development and are strongly expressed during mid luteal phase. These messages decline during luteal regression in vivo in the cow and ewe (Conley et al., 1995; Tian et al. 1994). In bovine  70  mRNA, coding for StAR and StAR protein low during luteal development, elevated in active CL, and virtually absent in regressed CL (Pescador et al., 1996). It has been found that regression of the bovine CL is associated with the loss of expression of StAR and its gene products. Based on the above findings it is anticipated that steroidogenic enzymes are highly expressed in high fertile animals compared to low fertile animals. Apoptosis is a process of programmed cell death. It has been found this is the most common form of cell death (Steller, 1995). In apoptosis unwanted cells are eliminated during cell proliferation. Every cell has an apoptotic cell death pathway. This is highly genetically regulated, ATP required multi step death mechanism (Antonsson, 2001). In the ovary there are several specific regulators of apoptosis, including hormones, growth factors and cytokines (Chun et al., 1994). The stimuli for apoptosis can be intra cellular or extra cellular. The mitochondrial pathway and the death receptor pathway have been identified as two major pathways for apoptosis (Schmitz et al., 2000). It has been found Bcl-2 protein family members regulate mitochondrial pathway. Bcl-2 proteins can be subdivided into two major groups as pro and anti apoptotic proteins (Antonsson, 2001). Expression of pro apoptotic (Bax) protein causes cell death, whereas anti apoptotic (Bcl-2) protein prevents cell death. Therefore balance between anti and pro apoptotic proteins expression regulates the fate of the cell (Okuda et al., 2004). Bad, Mcl-1, Bcl-XL and Bok are some Bcl-2 family members that have been isolated from the ovary. Apoptosis has been considered as one of the key mechanism that occurs during the process of luteal demise in different species including bovine (Juengal et al., 1993; Ruede, B.R., et al. 1995 and 1997; Quirk, S.M. et al. 1995). Onset of apoptosis is not observed in the bovine CL until P4 production has declined (Okuda et al., 2004). Further  71  it has been shown that during human menstrual period Bcl-2 mRNA levels are highest in the mid luteal phase and lowest in the regression CL whereas Bax mRNA levels are highest in regressing CL (Sugino et al., 2000). Further it has been showed that increased apoptosis in bovine CL is associated with significant increase of Bax mRNA expression (Ruede et al., 1997). Therefore the Bax: Bcl-2 ratio in heifers and lactating cows might give some useful information on cattle fertility. Heat shock proteins function to protect cells from irreversible cell damage. Different kinds of stresses like heat stress, hormones and oxygen radicals induce the expression of heat shock proteins. It has been shown that expression levels of HSP70 in human endometrium are higher in non fertile group as compared to fertile group (Nip et al., 1994). The reasons for the reduced fertility in dairy cows as compared to heifers could be differential expression of genes associated with luteal steroidogenesis, apoptosis or heat stress and there is lack of information looking at the differential expression pattern of these genes in heifers compared to lactating cows. Therefore we studied the comparative expression of genes associated with i) luteal steroidogenesis – Steroidogenic acute regulatory protein (StAR), Cytochrome P-450, 3- β- hydroxysteroid dehydrogenase (3-β HSD); ii) Luteal apoptosis - Bax and Bcl-2; and iii) heat shock protein 70 (HSP70) in CL’s obtained from heifers and 2nd/3rd parity lactating cows.  72  3.2. MATERIALS AND METHODS  3.2.1. Animals and treatment Sixteen animals, heifers (n=8) and cows (n=8) were selected for the experiment. Animals were treated with standard ovulation synchronization protocol to synchronize ovulation. An initial injection of GnRH (100 µg/IM) preparation used followed 7 days later by PGF  2α  (25 mg/IM) preparation and 48 h later a second dose of GnRH (100 µg  IM). All animals were examined for ovulation and development of CL using ultrasonography. Enucleation of the CL was carried out on days 8-10 days after the second GnRH injection.  3.2.2. Corpus luteum enucleation In cows, under epidural anesthesia an incision was made in the vagina and CL was removed according to the method described by Ali et al., (2004). In heifers, surgery was performed to enucleate CL. On the day of surgery, heifers were anaesthetized using Lidocaine HCl 2% to effect a paralumbar block. A flank incision was made, and the CL was located. The CL was enucleated using gentle pressure applied to the area surrounding the gland. Care was taken to ensure that bleeding from the site of enucleation was stopped before suturing of the flank incision. Cows and heifers received a single IM injection of antibiotic immediately after the surgery. All animals were moved and housed in individual recovery free stalls where they remained under continuous observation during the first 12 h, and were kept in the individual free stall pens for more than 3 days.  73  Blood samples were also taken two days prior to surgery and on the day of surgery for P4 determination.  3.2.3. Processing of corpus luteal tissues Well developed CL, orange in color externally and internally with diameter of 1.6- 2cm was obtained from six heifers and three cows, all the other animals were having regressing corpora lutea which were not used in the experiment. Soon after enucleation luteal tissue was washed using normal saline supplemented with penicillin 100000 IU/L and Streptomycin 100000 µg/L then, transported to the laboratory in liquid nitrogen tank. In the laboratory, tissues were minced into smaller pieces in a large Petri dish containing normal saline supplemented with antibacterial agents. Minced tissue was placed in multi layer Kim wipes to remove fluid and then 100 mg of tissue was weighed and stored at 800C for RNA extraction.  3.2.4. RNA isolation Total RNA was extracted using a single step RNA isolation method (Chomczynski and Sacchi, 1987), using a commercially available total RNA isolation solution, Tri Reagent (Sigma Aldrich). Using mortar and pestle about 100 mg of luteal tissue was pulverized in liquid nitrogen, and immediately transferred into sterile DNAase/RNAase free 2.0ml micro centrifuge tubes containing 1 ml of Tri Reagent. The tube contents were mixed thoroughly by vortexing. Then tubes were allowed to stand for 5 min at room temperature in order to facilitate complete dissolution of nuclear proteins, and cytoskeletal components. For each ml of Tri Reagent (initial) solution, 200 µl of  74  chloroform was added to each tube, and samples were agitated vigorously for 30 s. Samples were allowed to stand at room temperature for 15 min, centrifuged at 12000 G for 15 min at 40C. The top layer with clear transparent solution containing the total RNA molecules was carefully transferred into new sterile DNAs/RNAs free centrifuge tubes. Each tube was supplied with an excess amount of isopropanol (0.75 ml), slowly inverted 2/3 times, and allowed to stand at room temperature for 30 min. Then samples were centrifuged at 12000 g for 10 min at 40C. Supernatant was discarded. The resultant pellet at the bottom of the tube containing the RNA was washed two times in ice-cold 75% ethanol by centrifuging at 12000 G for 5 min and air dried for 10-15 min, and finally dissolved in 100 µl of sterile DEPC treated water. The quantity and quality of RNA was assessed by measuring optical densities using Nanodrop ND-1000 spectrophotometer (http://www.nanodrop.com/) and by observing clear bands for 28S, and 18S, ribosomal RNA species on ethidium bromide stained agarose gel (1%). Total RNA was aliquot and stored at -800C for cDNA synthesis.  3.2.5. Semi-quantitative Reverse Transcription-Polymerase Chain Reaction  3.2.5.1. Reverse transcription Reverse Transcription-Polymerase Chain Reaction (RT-PCR) was performed by using commercially available first strand cDNA synthesis kits (Cells-to-cDNA II kit, Ambion Inc. The RNA Company, Austin, Texas, USA). The reverse transcription reactions were carried out according to the manufacturer’s protocol with necessary modifications. During initial steps, the amount of template RNA, magnesium  75  concentration, and random decamer primers were tested to determine optimum conditions for reverse transcription, which produced sufficient amount of first strand cDNA for PCR amplification of the genes of interest. Using kit supplied random decamer primers; 2µL of the total RNA sample was reverse transcribed into 20µl reaction volume. The following components were included in the RT reaction: 10X RT buffer pH 7.4 (2 µl, dNTP (0.5 mM each) 1 µL, M-MLV reverse transcriptase 1 µl (10U), RNAase inhibitor 1 µl, random decamers 5 µM and total RNA 2 µg. The final volume was adjusted to 20 µl using nuclease free water. RT step was performed at 420C for 60 min, and then incubated at 950C for 10 min to inactivate the reverse transcriptase enzyme. RT samples were stored at -200C for future use in PCR amplification.  3.2.5.2. Gene specific PCR amplification The polymerase chain reaction was performed using JumpStart RED Taq Ready Mix PCR reaction mix (Jumpstart; Sigma- Aldrich Canada Ltd, Oakville, On) and gene specific primers for Bcl-2, Bax, HSP70, StAR, 3-β HSD, P450 and the house keeping gene G3PDH. The gene specific primers were obtained from previously published data Table 3.2. The PCR reaction was performed by following manufacturer’s protocol with necessary modification to fit the experimental conditions. Briefly, gene specific primers, MgCl2, nuclease free water, and 2 µl of cDNA template were added to 12.5 µl of Jumpstart to make 25 µl reaction mixtures. The reaction mixture was composed of 10mM Tris-HCl, 50 mM KCL, 2.5 mM MgCl2, 0.0001% gelatin, 0.2 mM of each dNTP (dATP, dCTP, dGTP, dTTP), inert dye, stabilizers, 0.03 U/µl taq DNA polymerase, Jumpstart  76  Taq antibody, 0.8-1.6 µM gene specific primers, cDNA template and nuclease free water. Optimum reaction cycles and conditions were applied. The primer sequence, fragment size, annealing temperature, number of PCR cycles, and gene reference identification number are provided in Table 3.2. For the amplification of the HSP70 gene sequence instead using 2.5 mM MgCl2, 4mM MgCl2 was used in the reaction mixture. The typical reaction cycles for G3PDH, Bax, and HSP70 consisted of an initial denaturation step at 940C for 2 minutes followed by 34-38 cycles of denaturation at 940c for 30 sec, annealing at 56-62 0C for 30 sec and elongation at 72 0C for 45 sec with a final elongation step at 72 0C for 5 minutes. The PCR conditions for StAR, 3-β HSD, and P450 were as follows. Initial denaturation for 3 min at 94 0C, followed by subsequent cycles with denaturation at 93 0C for 40 sec, annealing at 58 0C for 50 sec and extension for 1 min at 72 0C, and an additional extension for 10 min at 72 0C. The PCR condition for Bcl-2 consisted of an initial denaturation at 940C for 3 minutes, followed by 27 cycles of denaturation at 930C for 40sec, annealing at 620C for 50sec and elongation at 720C for 1 minute with a final elongation step at 720C for 10 minutes. For each gene of interest, PCR amplification was calibrated to determine the optimal number of cycles that would allow detection of the appropriate mRNA transcripts, while still keeping the amplification of these genes in log phase. For StAR and P450 23 cycles were allowed, where as for 3-β HSD 22 cycles were allowed. The PCR products were analyzed by gel electrophoresis using ethidium bromide (0.4µg/ml) and stained with 1% agarose gel. The gels were photographed under ultraviolet illumination. The optical densities of individual bands were analyzed using  77  Scion Image Beta 4.02 for windows computerized image analyzing software (Scion Corporation, Frederick, Maryland, USA; http://www.sciocorp.com/) Figure 3.1.  3.2.6. Statistical analysis Data analysis was done by one-way analysis of variance (ANOVA). Mean separation procedure was performed when analysis of variance showed significant FValues using Fisher’s Least Significant Difference. The results were reported as the mean values for each set data + standard error of means and the level of statistical significance was defined at probability level less than 0.05.  3.3. RESULTS 3.3.1. RNA quality Spectrophotometry results for RNA samples are given in Table 3.1. Good quality RNA will have an OD 260/280 ratio of 1.8 to 2 and an OD 260/230 of 1.8 or greater. This is because nucleic acids are detected at 260 nm, whereas protein, salt and solvents are detected at 230 and 280 nm. A high OD 260/280 and OD 260/230 ratio therefore indicates that extracted RNA is devoid of any of these contaminants. Therefore based on the OD ratios good quality RNA samples were selected for cDNA synthesis.  3.3.2. Expression levels of luteal steroidogenic genes in heifers and lactating cows The semi-quantitative RT-PCR results of luteal tissue mRNA levels for steroidogenic genes are shown in Figure 3.2. Analysis of variance revealed that  78  steroidogenic genes are more expressed (p<0.05) in cows than heifers. The expression level of StAR, P450 and 3-β HSD were 1.97 + 0.15 vs. 1.17 + 0.04; 2.03 + 0.11 vs. 1.10 + 0.03; and 1.74 + 0.22 vs. 1.12 + 0.03 in cows and heifers respectively. StAR, P450, and 3-β HSD expressions were 59%, 54%, and 64% lower in heifers when compared to cows.  3.3.3. Expression levels of luteal apoptotic genes in heifers and lactating cows The semi-quantitative RT-PCR results of luteal tissue mRNA levels for Bax and Bcl-2 are shown in Figure 3.3. Relative Bax mRNA expressions were higher (p<0.05) in cows; whereas there was no difference in Bcl-2 expressions in cows and heifers. The relative mRNA expression for Bax and Bcl-2 were 1.39 + 0.09 vs. 0.80 + 0.10 and 1.13 + 0.32 vs. 0.86 + 0.07 respectively in cows and heifers. Bcl-2 is expressed in cows 1.13 + 0.32 vs. 0.86 + 0.07 in heifers. Bax and Bcl-2 expressions were 57% and 75% lower in heifers as compared to cows.  3.3.4. HSP70 mRNA expression in heifers and lactating cows The semi-quantitative RT-PCR results of luteal tissue mRNA level for HSP70 are shown in Figure 3.3. Analysis of variance revealed that there was no significant difference (p<0.05) in HSP70 expression between cows and heifers. HSP70 is expressed 1.20 + 0.10 in cows and 1.02 + 0.07 in heifers. HSP70 is 85% less expressed in heifers than cows.  79  3.4. DISCUSSION Several studies including Chapter 2 of this thesis have shown that there is no significant difference in peripheral P4 levels between heifers and lactating cows (Sartori et al., 2002; Cooperative Regional Research Project, NE-161, 1996). On the other hand this study shows that steroidogenic enzymes- Steroidogenic acute regulatory protein (StAR), Cytochrome P-450 (scc), 3-β-hydroxysteroid dehydrogenase (3-β HSD) expressions are higher in mature cows than heifers. Chapter 2 of this thesis showed high pregnancy rates in heifers compared to mature cows. This study also supports that by showing more apoptosis and luteal regression in mature cows which can lead to low pregnancy rate than heifers. The CL is a complex tissue comprised of steroidogenic, small and large luteal cells, and non-steroidogenic cells, such as fibroblasts, endothelial and immune cells (Webb et al., 2002). The regulation of CL growth and regression is a unique process when compared to other steroidogenic tissues (Christenson and Devoto, 2003). Although LH and PGF2α are two of the primary endocrine factors controlling bovine CL function, several local factors like IGF system, angiogenic factors and immune cells, producing factors such as MCP-1, have key roles within the CL. They play essential roles in the development, maintenance and regression of the CL. Insulin-like-growth factors are homologous  polypeptide  growth  factors  which  are  important  promoters  of  steroidogenesis and act at multiple sites (Webb et al., 2002). It has been shown that IGF-1 increases P4 secretion and gives anti apoptotic effect in bovine CL (Townson, 2006; Neuvians et al., 2003).  Cellular mechanisms of CL regression are not yet well  80  understood. Cell–cell interactions among immune, endothelial, and steroidogenic cells within the bovine CL are complex (Townson, 2006). Complexity of the CL and P4 synthesis may be the reason that is why so far studies have not been done on different expression levels of genes associated with P4 synthesis in lactating and non lactating cows or between heifers and mature cows. One of study, Wiltbank et al. (2006), showed that lactating cows have larger volume of luteal tissue with low circulation P4. For that, one of the hypotheses he proposed was lactating cows are less steroidogenic compared to heifers. But finally it was mentioned since steroidogenesis in lactating cows is not fully investigated at this time; this cannot be disregarded or advocated. But study one (and several other studies) and study two now have shown that there is a high possibility that this hypothesis may not be true and further extended studies are needed for the final confirmation of these aspects. One possible explanation could be that mature cows have more steroidogenic capacity and increased P4 metabolism (Wiltbank et al., 2006). It’s already been mentioned in Chapter 2 of this thesis that metabolism goes high in high producing animals especially if they are in negative energy balance. Based on this, it can be attributed that mature cows may have more steroidogenesis but the hormonal metabolism may vary between animals that could reflect the differences in circulating P4 concentrations. Although based on this study it may be concluded the steroidogenesis is not one of the factors causing fertility difference between mature cows and heifers, the fact that mature cows undergo more luteolysis cannot be discarded. Out of eight animals, intact CL were obtained only from three animals. CL from other animals were, low in weight  81  and diameter with low total RNA concentrations or degraded RNA which couldn’t use for the further study. During luteal regression, extractable amounts of total RNA drop when a highly endocrine gland changes to connective tissue (Neuvians et al., 2003). Skarzynski et al., (2001) mentioned that steroidogeic cells through autocrine mechanism may prevent luteolysis. Numbers of studies have shown decrease in expression of setroidogenic enzymes and low serum P4 concentrations are associated with luteal regression. Therefore it can be attributed that mature cows may have early luteal regression compared to heifers. The mature cows which have healthy cycle may have more steroidogenic capacity in order to prevent luteolysis. This needs to be studied in detail. So far in cattle the optimal P4 concentration for fertility is not well established (Nogueira et al., 2004). On one side, sub-optimal P4 concentrations can cause luteolysis and on the other hand high P4 concentration during early estrous cycle can cause premature PGF2α release and early luteolysis (Nogueira et al., 2004). Further P4 concentration from previous cycle can affect the fertility of next cycle. Cows with high P4 concentration in the previous cycle have more success pregnancies than cows with low concentrations (Shrestha et al., 2004). One recent review has mentioned that time of endometrial exposure to P4 determine the length of luteal phase (Goff, 2004). Prolonged P4 exposure advances PGF2α secretion by down regulation of P4 receptors and this can lead to early luteolysis. This is one of the hypotheses used to explain short estrous cycle in bovine (Nogueira et al., 2004). Another recent finding says timing of post ovulatory P4 rise is more important than final concentration (Robinson et al., 2005). There could be a  82  possibility that heifers might be having optimal P4 levels at right time compared to mature cows, which could leads to have less early luteal regression in heifers. Post partum dairy cows are more prone to disease conditions than heifers. Mastitis in cycling cows can lengthen the follicular phase and cause premature luteolysis (Huszenicza et al., 2005). At this time mechanisms which lead to reduced early luteal regression in mature cows should be further investigated. This study revealed no differences in expression levels of anti apoptotic gene Bcl2 between heifers and mature cows whereas pro apoptotic gene Bax was more expressed in mature cows then heifers. This clearly shows that CL’s in mature cows might be more prone to apoptosis than the heifers. In the cow, luteolysis is a result of the pulsatile release of endometrial PGF2α which initiates a complex cascade of events that finally interrupt steroidogenesis and induces structural regression of the CL (Okuda et al., 2004). Luteolysis has two phases. One is functional luteolysis where rapid P4 cessation occurs; the second one is structural luteolysis where cells in CL undergo weight loss and programmed cell death, apoptosis (Neuvians et al., 2003). Morphological evidence of apoptosis is the appearance of nuclear fragments containing degenerate chromatin, cell shrinkage, and appearance of membrane-bound cytoplasmic fractions (Niswender et al., 2000). These cell fragments, or apoptotic bodies, are targets for the phagocytotic cells of the immune system. Macrophages augment the apoptotic process in populations of luteal cells by phagocytosing membrane-enclosed fragments of those cells (Niswender et al., 2000). The Bax: Bcl-2 ratio of a cell determines its apoptotic potential. Nuclear protein p53 increases Bax transcription rate and represses Bcl-2 transcription which gives the  83  signal for apoptosis (Niswender et al., 2000). In luteal regression it has been found that Bax mRNA level is elevated while Bcl-2 mRNA is unchanged (Rueda et al., 1997). In this study Bax expression levels are higher in mature cows (1.39 + 0.09) compared to heifers (1.13 + 0.32); Bcl-2 expression level is same in both and mature cows (0.80 + 0.10) and heifers (0.86 + 0.07 ). Mature cows have more luteolytic potential through apoptosis than heifers. In cattle anti apoptotic mechanisms including promoting apoptotic genes/proteins can be regulated via P4 independent pathway (Okuda et al., 2004). There could be some intra luteal factors which can regulate apoptotic genes expression in CL. These factors have not been fully identified or studied yet (Okuda et al., 2004). PGF2α although considered as a potential luteolytic factor, in vivo this increases P4 secretion in CL steroidogenic cells. Therefore some other intra luteal factors secreted by immune, endothelial cells should regulate the CL luteolysis. Nitric Oxide (NO) is the universal mediator for luteolysis which is locally produced by bovine luteal steroidogenic, immune and endothelial cells (Korzekwa et al., 2007). NO plays a crucial role in estrus cycle regulation. In functional luteolysis it inhibits basal P4 synthesis. In vitro NO decreases steroidogenic enzymes expression. It may involve in the structural luteolysis because in vitro PGF2α doesn’t show cyto toxicity to luteal steroidogenic cells. NO is the potent factor which can cause structural apoptosis by increasing Bax expression (Korzekwa et al., 2006) in CL. Although NO regulates luteolysis, its function is stage dependent. At the early phase it is luteotropic and at the late cycle it causes luteolysis.  84  Environment and biological stressors affect cellular functions (Melissa et al., 2005). The HSP70 heat-shock proteins are molecular chaperones that help other proteins to undergo folding, transport, and assembly into multi-protein complexes, or to refold after heat shock or other stresses (Didelot et al., 2007). They safeguard endogenous proteins from stressors. In the rat there is evidence that heat shock protein HSP70 may be involved in mediating functional luteolysis by inhibiting luteinizing hormone (LH) stimulated P4 production in vitro (Khanna et al., 1995a). Further it has been found that HSP70 expression is increased in spontaneous PGF2α induced CL regression in rat’s in vivo (Khanna et al., 1995b). So far the mechanism for this rapid activation is not known (Stocco et al., 2007). Also in rats, it seems HSP70 inhibits the rate-limiting step in steroidogenesis (Narayansingh et al., 2004). Melissa et al. (2005) showed rapid increase of HSP90 with PGF2α in beef cows and late response of HSP70 by luteal cells with heat shock in dairy cows. There may be a chance that HSP90 is related to PGF2α induced luteolysis and apoptosis in dairy cattle. Since both heifers and mature cows were not kept under heat stress; there is no difference in HSP70 expression levels. This study may support Melissa et al. (2005) that cow’s CL may have specific HSP expression to heat and PGF2α. Further in cows HSP90 not HSP70 may involve in steroidogenic pathway. These all can be confirmed by studying HSP90 in CL of heifers and mature cows. Overall this study was carried by comparing the mRNA levels of steroidogenic apoptotic and HSP70 genes. Although the proteins are the actual biological effectors, and therefore mRNA levels may not reflect the protein concentrations of these genes. Still it may be useful data for the future studies of this complex system.  85  3.5. CONCLUSION It appears that steroidogenic enzymes gene expression, and HSP70 gene expression, play no role in the differences observed in the pregnancy rates between heifers and 2nd /3rd parity lactating cows. This supports our previous finding that plasma P4 levels during the estrous cycles were not different between the two groups. However, in this study there is no difference in anti apoptotic gene- Bcl-2 expression in heifers and mature cows, pro-apoptotic gene – Bax gene is more expressed in 2nd and 3rd parity cows indicating that CL’s from mature cow are more prone to apoptosis. In addition, only three out of eight 2nd and 3rd parity cows treated had mature, non regressed CL. Therefore, our finding tends to suggest that the lifespan of CL are compromised in 2nd and 3rd parity cows, resulting in early embryonic mortality and reduced pregnancy rates.  86  Table 3.1. Spectrophotometry results for RNA samples.  Concentration (ng/µl)  O.D at A260  O.D ratio 260/230  CA CB CC  2251.3 896.59 1078.3  56.282 22.415 26.958  2.24 2.32 2.31  2.02 1.95 1.98  40 40 40  HA HB HC HD HE HF1  938.08 883.01 777.72 1248.7 1121.4 976.39  23.452 22.075 19.443 31.218 28.037 24.41  2.33 2.26 2.23 2.31 2.32 2.25  1.94 1.94 1.94 1.97 1.97 1.97  40 40 40 40 40 40  RNA Sample  O.D ratio 260/280  constant  CA, CB & CC- Lactating cows HA, HB, HC, HD, HE & HE - Heifers Constant- wavelength-dependent extinction coefficient in ng-cm/microliter  87  Table 3.2. Primers used in the RT-PCR amplification of specific mRNA transcripts of luteal tissue in heifers and cows Gene  Primer Sequences (5’-3’)  Anneal PCR T 0C cycles  Frag. Accession Length Number  5’TGTTCCAGTATGATTCCACCC G3PDH  58  33-36 318bp U85402  58  34  223bp U92569  62  27  156bp  3’AGGAGGCATTGCTGACAATC 5’TGCTTCAGGGTTTCATCCAG BAX 3’AACATTTCAGCCGCCACTC 5’TTCGCCGAGATGTCCAGTCAGC Bcl-2  U92434  3’TTGACGCTCTCCACACACATGAC 5’CACTTCGTGGAGGAGTTCA HSP70  58  38  376bp AY149619  3’GGTTGATGCTCTTGTTGAGG 5’CATGGTGCTCCGCCCCTTGGCT StAR  58  23  590bp  BC110213  58  23  362bp BC133389  58  22  360bp BC111203  3’CATTGCCCACAGACCTCTTGA 5’AACGTCCCTCCAGAACTGTACC P450 3’CTTGCTTATTGCTCCCTCTGCC  5’TGTTGGTGGAGGAGAAGG 3-β HSD 3’GGCCGTCTTGGATGATCT  Frag. Length- Fragment Length  88  C lactating cows H heifers  C1 C2 C3 318bp 223bp  H1 H2 H3 H4 H5 H6 G3PDH Bax  156bp  Bcl-2  376bp  HSP70  590bp  StAR  362bp  P450  360bp  3-β HSD  Figure 3.1. Gel images showing expression levels of target genes in lactating cows and heifers  89  Lactating cows 2.5  *  *  Heifers *  Relative intensity of bands  2  1.5  1  0.5  0 StAR  P450  3-β HSD  Figure 3.2. Relative abundance of steroidogenic genes in lactating cows and heifers.*different (p<0.05)  90  1.6  Lactating cows  *  Heifers  Relative intensity of bands  1.4 1.2 1 0.8 0.6 0.4 0.2 0 Bax  Bcl-2  HSP70  Figure 3.3. Relative abundance of apoptotic and HSP70 genes in lactating cows and heifers.*different (p<0.05)  91  3.6. REFERENCES Aali, M., Small, J.A., Giritharan, G., Ramakrishnappa, N., Cheng, K.M., and Rajamahendran, R. 2004. In vitro assessment of corpus luteum function in cattle following Ovsynch and CIDR ovulation synchronization protocols. Canadian Journal of Animal Science 84: 721–724 Antonsson, B. 2001. Bax and other pro- apoptotic Bcl-2 family ‘killer proteins’ and their victim, the mitochondrian. Cell and Tissue Research 306: 347-361 Bønsdorff, T., Eggen, A., Gautier, M., Åsheim, H.C., Rønningen, K., Lingaas, F., and Olsaker, I. 2003. Identification and physical mapping of genes expressed in the corpus luteum in cattle. Animal Genetics 34: 325-333 Chomczynski, P., and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry 162: 156-159 Christenson, K.L., and Devoto, L. (2003). Review Cholesterol transport and steroidogenesis by the corpus luteum. Reproductive Biology and Endocrinology 1: 90 Chun, S.Y., Billig, H., Tilly, J.J., Furuta, I., Tsafriri, A., and Hsueh. A.J. 1994. . Gonadotropin suppression of apoptosis in cultured preovulatory follicles: mediatory role of endogenous insulin-like growth factor-1. Endocrinology 135: 1845-1853 Conley, A.J., Kaminski, M.A., Dubowsky, S.A.,Jablonka-Shariff, A., Redmer, D.A., and Reynolds, L.P. 1995. Immunohistochemical localization of 3β–hydroxysteroid dehydrogenase and P450 17α–hydroxylase during follicular and luteal development in pigs, sheep, and cows. Biology of Rreproduction 52: 1081-1094 Cooperative Regional Research Project, NE-161. 1996. Relationship of fertility to patterns of ovarian follicular development and associated hormonal profiles in dairy cows and heifers. Journal of Animal Science 74: 1943–52 Didelot, C., Lanneau, D., Brunet, M., Joly, A.L., De Thonel, A., Chiosis, G., and Garrido, C. 2007. Anti-cancer therapeutic approaches based on intracellular and extracellular heat shock proteins. Current Medicinal Chemistry 14: 2839-47 Goff, K.A. 2004. Steroid hormone modulation of prostaglandin secretion in the ruminant endometrium during the estrous cycle. Biology of Reproduction 71: 11–16  92  Gordon D.N., Jennifer L. Juengel, Patrick J. Silva, M. Keith Rollyson, and Eric W. McIntush. 2000. Mechanisms controlling the function and lifespan of corpus luteum. Physiological Reviews 80: 1-29 Nogueira, G.M.F., Melo, S.D., Carvalho, M.L., Fuck, E.J., Trinca, L.A., and Barros, C.M. 2004. Do high progesterone concentrations decrease pregnancy rates in embryo recipients synchronized with PGF2α and eCG? Theriogenology 61: 1283–1290 Hartung, S., Rust, W., Balvers, M., and Ivell, R. 1995. Molecular cloning and in vivo expression of the bovine steroidogenic acute regulatory protein. Biochemical and Biophysical Research Communications 215: 646-653 Huszenicza, G.Y., Janosi, S.Z., Kulcsar, M., Korodi, P., J Reiczigel, L Ka tai, L., Peters, A.R., and De Rensis, F. 2005. Effects of Clinical Mastitis on Ovarian Function in Post-partum Dairy Cows. Reproduction in Domestic Animals 40: 199–204 Juengel, J.L., Garverick, H.A., Johnson, A.L., Youngquist, R.S., and Smith, M.F. 1993. Apoptosis during luteal regression in cattle. Endocrinology 132: 249-254 Khanna, A., Aten, R.F and Behrman, H.R. 1995a. Physiological and pharmacological inhibitors of luteiniing hormone-dependent steroidogenesis induce heat shock protein-70 in rat luteal cells. Endocrinology 136: 1775-1781 Khanna, A., Aten, R.F and Behrman, H.R. 1995b. Heat shock protein-70 induction mediates luteal regression in the rat. Molecular Endocrinology 9: 1431-1440 Kirby, C.J., Thatcher, W.W., Collier, R.J., Simmen, F.A., and Lucy, M.M. 1996. Effects of growth hormone and pregnancy on expression of growth hormone receptor, insulinlike growth factor-1, and insulin-like growth factor binding protein-2 and –3 genes in bovine uterus, ovary, and oviduct. Biology of Reproduction 55: 996-1002 Korzekwa, A., Woclawek-Potocka, I., Okuda, K., Acosta, J.T., and Skarzynski, D.J. 2007. Nitric oxide in bovine corpus luteum: Possible mechanisms of action in luteolysis. Animal Science Journal 78: 233- 242 Korzekwa, J.A., Okuda, K., Woclawek-Potocka, I., Murakami, S., and Skarzynski, D.J. 2006. Nitric oxide induces apoptosis in bovine luteal cells. Journal of Reproduction and Development 52: 353-361 Levy, N., Kobayashi, S., Roth, Z., Wolfenson, D., Miyamoto, A., and Meidan, R. 2000. Administration of prostaglandin F2α during the early bovine phase does not affect the  93  expression of ET-1 and its type A receptor: A possible cause for corpus luteum refractoriness. Biology of Reproduction 63: 377-382 Melissa, K., Jorge, F., Keith, and I., Paul, T. 2005. Heat shock and prostaglandin f2α differentially induce the expression of heat shock proteins 70 and 90 within the bovine corpus luteum. The Society for the Study of Reproduction: 38th annual meeting; July 2427 Narayansingh, R.M., Senchyna, M., Vijayan, M.M., Carlson, J.C. 2004. Expression of prostaglandin G/H synthase (PGHS) and heat shock protein-70 (HSP-70) in the corpus luteum of prostaglandin F 2α treated immature superovulated rats. Canadian Journal of Physiology and Pharmacology 82: 363-371 Neuvians, T.P., Pfaffl, M.W., Berisha, B., Schams, D. (2003). The mRNA expression of the members of the IGF-system in bovine corpus luteum during induced luteolysis. Domestic Animal Endocrinology 25: 359–372 Nip, M.M.C., Miller, D., Taylor, P.V., Gannon, M.J., and Hancock, K.W. 1994. Expression of heat shock protein 70 kDa in human endometrium of normal and infertile women. Human Reproduction 9: 1253-1256 Niswender, D.G., Juengel, L.J., Silva, J.P., Rollyson, M.K., and Eric, W.M. 2000. Mechanisms controlling the function and life span of the corpus luteum. Physiological Reviews 80: 1-29 Okuda, K., Korzekwa, A., Shibaya, M., Murakami, S., Nishimura, R., Tsubouchi, M., Woclawek-Potocka, I., and Skarzynski, D.J. 2004. Progesterone is a suppressor of apoptosis in bovine luteal cells. Biology of Reproduction 71: 2065–2071 Pescador, N., Soumano, K., Stocco, D.M., Price, C.A., and Murphy, B.D. 1996. Steroidogenic acute regulatory protein in bovine corpora lutea Biology of Reproduction 55: 485-491 Quirk, S.M., Cowan, R.G., Joshi, S.G., and Henrikson, K.P. 1995. Fas antigen-mediated apoptosis in human granulosa/luteal cells. Biology of Reproduction 52: 279-287 Richards, J.S., Fitzpatrick, S.L., Clemens, J.W., Morris, J. K., Alliston, T. Sirois, J. 1995. Ovarian cell differentiation- a cascade of multiple hormones, cellular signal, and regulated genes. Recent Progress in Hormone Research 50: 223-254 Robinson, R.S., Hammond, A.J., Hunter, M.G., and Mann, G.E. 2005. The induction of a delayed post-ovulatory progesterone rise in dairy cows: a novel model. Domestic Animal Endocrinology 28: 285–295 94  Rogers, P.A.W. 1992. Uterine receptivity. Reproduction, Fertility and Development 4: 645-652 Rueda, B. R., Tilly, K. I., Botros, I.W., JollY, P.D., Hansen, T.R., Hoyer, P.B., and Tilly. J.L. 1997. Increased bax and interleukin- 1b-converting enzyme messenger ribonucleic acid levels coincide with apoptosis in the bovine corpus luteum during structural regression. Biology of Reproduction 56: 186–193 Ruede, B.R., Wegner, J.A., Marion, S.L., Wahlen, D.D., and Hoyer, P.B. 1995. Intercleosomal DNA fragmentation in ovine luteal tissue associated with luteolysis: in vivo and in vitro analyses. Biology of Reproduction 52: 305-312 Sartori, R., et al. 2002. Ovarian structures and circulating steroids in heifers and lactating cows in summer and lactating and dry cows in winter. Journal of Dairy Science 85: 28132822 Schmitz, I.; Kirchhoff S.; Krammer P.H. 2000. Regulation of death-receptor mediated apoptosis pathways. The International Journal of Biochemistry and Cell Biology 32: 1123-1136 Shrestha H.K., Nakao, T., Higaki, T., Suzuki, S., Akita, M. 2004. Resumption of postpartum ovarian cyclicity in high-producing Holstein cows. Theriogenology 61: 637– 649 Skarzynski, J.D., Jaroszewski, J.J., Okuda, K. 2001. Luteotropic mechanisms in the bovine corpus luteum: Role of Oxytocin, Prostaglandin F2α, Progesterone and Noradrenaline. Journal of Reproduction and Development .47: 125-137 Steller, H. 1995. Mechanisms and genes of cellular suicide. Science 267: 1445-1449 Stocco, C., Telleria, C., and Geula Gibori. 2007. The molecular control of corpus luteum formation, function, and regression. Endocrine Reviews 28: 117–149 Sugino, N., Suzuki, t., Kashida, S., Karube, A., Takiguchi., S., and Kato, H. 2000. . Expression of Bcl-2 and Bax in the human corpus luteum during the menstrual cycle and in early pregnancy: regulation by human chorionic gonadotropin. Journal of clinical endocrinology and Metabolism 65: 4379-4386 Taniguchi, H., Yokomizo, Y., and Okuda, K. 2000. Fas-fas ligand ystem mediates luteal cell death in bovine corpus luteum. Biology of Reproduction 66: 754-759 Tian, X.C., Berndtson, A.K., and Fortune, J.E. 1994. Changes in levels of messenger ribonucleic acid for cytochrome P450 side- chain cleavage and 3β–hydroxysteroid  95  dehydrogenase during prostaglandin F2α-induced luteolysis in cattle. Biology of Reproduction 50: 349-356 Townson, H.D. (2006). Immune cell–endothelial cell interactions in the bovine corpus luteum. Integrative and Comparative Biology 46: 1055–1059 Webb, R., Woad, K.J., and Armstrong, D.G. (2002). Corpus luteum function: local control mechanisms. Domestic Animal Endocrinology 23: 277–285 Wiltbank, M., Lopez, L., Sartori, R., Sangsritavong, S., and Gumen, A. 2006. Changes in reproductive physiology of lactating dairy cows due to elevated steroid metabolism. Theriogenology 65: 17–29  96  CHAPTER 4 GENERAL DISCUSSION AND CONCLUSIONS 4.1. GENERAL DISCUSSION Reproductive efficiency has major impacts on profitability of livestock operations, including commercial dairy herds (Wiltbank et al., 2006). Reproduction is complex function. Genetics, environment, nutrition, disease status, timing and fertility of mate affect the success. In modern dairy sector, milk yield increases with decline in conception rate with average first conception rate 40% (McCoy et al., 2006). With changes in reproductive biotechnology and improved feeding and management today 9,000,000 Holstein cows produce more milk than 21 to 22 million cows did 50 years ago (Foote, 2005). Today’s high producing dairy cows are less fertile than cows 10 to 20 years ago (Vries, 2004). Clearly there is an antagonistic relationship between fertility and production. Decline in reproduction in dairy cattle has been occurred world wide (Mackey et al., 2007). Although pregnancy rates are declining in mature cows, in heifers’ pregnancy rates remain relatively high about 64% (Lucy, 2007). However recently to our knowledge none of the studies have focused on heifers’ reproductive statistics. CL plays major role in reproduction. The optimum concentration of P4 is must for the successful pregnancy. Therefore we prompt to explore if any difference in P4 levels and expression levels of genes associated with P4 synthesis between heifer and mature cows. In chapter 2, experiments were designed to compare first and second inseminations PR and peripheral P4 level between heifers and mature cows. First insemination PR was significantly higher in heifers (67.9%) than mature cows. Among mature cows 1st parity cows (42.9%) showed significantly higher PR than 3rd /4th parity  97  cows (11.9%). Heifers maintained significantly higher PR than 1st, 2nd and 3rd/4th parity cows following second insemination. This present findings are in agreement with previous studies that have reported in the literature (Lucy, 2001; Butler, 2000; Pursley et al., 1997; Chagas e Silva et al., 2002; Lamming and Darwash, 1998; Tenhagen et al., 2003; Butler, 2006). There was no significant difference in P4 levels between any of the experimental groups on any day of post AI. This agrees with some studies and contrast with some other studies reported in the past (Sartori et al., 2002; Sartori et al., 2004; Cooperative Regional Research Project, NE-161. 1996; Wolfensen et al., 2004). As accepted by several other studies this study also revealed significantly higher P4 levels in pregnant animals than non pregnant animals in all group of animals (Shearer, 2003; Lamming. and Darwash, 1998; Larson et al., 1997; Hansel, 1981; Fonseca et al., 1983). In chapter 3, using RT-PCR mRNA expression levels of steroidogenic enzymesStAR, P450, 3-β HSD, apoptotic genes Bax and Bcl-2 and HSP70 were studied in CL’s obtained from heifers and mature cows. Analysis of variance revealed that steroidogenic enzymes are more expressed in mature cows than heifers. Although there is no difference in expression levels of anti apoptotic gene (Bcl-2) pro apoptotic gene (Bax) was significantly more expressed in mature cows. No difference was seen in the expression levels of HSP70 between two groups. To our knowledge this is the first time genes associated with P4 synthesis were studied in heifers and mature cows. Though the current results are very preliminary, RT-PCR results suggest CL’s in the mature cows are more apoptotic than heifers. This could be a possible reason that only three CL’s were obtained from mature cows compared to eight from heifers. This study tends to suggest lifespan of CL’s are compromised in mature cows and may lead to early embryonic mortality. In  98  order to confirm these further studies are needed on other genes or factors associated with bovine CL apoptosis in heifers and mature cows. Due to the limitations of animals, time, and facilities further confirmatory attempts like Real Time PCR, genomic studies were not performed. Further due to the limitation of materials only few genes were studied in this thesis. Genomic techniques like Suppressive Subtractive Hybridization (SSH) or microarray may reveal the expression levels of all the possible genes which are associated with P4 synthesis in bovine. Reasons for decline in fertility are multifactor. Lucy, (2007) has described Four primary reasons for fertility problems in dairy cattle- 1) anestrus, 2) suboptimal and irregular estrous cycle - sub normal luteal function and ovarian diseases 3) abnormal preimplantation  embryo  development-  secondary  to  poor  oocyte  quality  4)  Uterine/placental incompetence. This thesis studied only part of one reason above mentioned. Further studies should be carried on uterus, oocyte and embryo in order to reveal the unexplained areas in bovine fertility problems.  4.2. GENERAL CONCLUSIONS This thesis confirms first and second insemination PR are higher in heifers compared to 1st, 2nd and 3rd/4th parity cows. Further confirms higher PR in 1st parity cows than 2nd and 3rd/4th parity cows. There is no difference in circulating P levels between any of the group of animals on any day of post AI. Pregnant animals showed significantly higher P4 level on day 8 post AI then non pregnant animals. Steroidogenic genes were more expressed in lactating cows than heifers. There is no difference in mRNA levels of Bcl-2, and HSP70 genes between heifers and mature cows. Bax is more expressed in  99  mature cows than heifers. To the best of our knowledge, some of the above mentioned findings that emerged from these studies are the first to be reported in the literature. Particularly this study demonstrated that CL’s of mature cows undergo more apoptosis than heifers. With the current findings for the confirmation more elaborated studies should be further carried out.  100  4.3. REFERENCES Butler, W.R. 2000. Nutritional interactions with reproductive performance in dairy cattle. Animal Reproduction Science 60: 449-457 Butler, W.R. 2006. Relationships of negative energy balance with fertility. Penn State Dairy Cattle Nutrition Workshop Chagas e Silva, J., Lopes da Costa, L., Robalo Silva, J. 2002. Plasma progesterone profiles and factors affecting embryo-fetal mortality following embryo transfer in dairy cattle. Theriogenology 58: 51-59 Cooperative Regional Research Project, NE-161. 1996. Relationship of fertility to patterns of ovarian follicular development and associated hormonal profiles in dairy cows and heifers. Journal of Animal Science 74: 1943–52 Fonseca, F.A., Britt, J.H., McDaniel, B.T., Wilk, J.C., Bakes, A.H. 1983. Reproductive traits of Holsteins and Jerseys. Effect of age, milk yield, clinical abnormalities on involution of cervix and uterus, ovulation, estrous cycles, detection of estrus, conception rate and days open. Journal of Dairy Science 66: 1128–47 Foote, R.H. 2005. Highlights in dairy cattle reproduction in the last 100 years. Hansel, W. 1981. Plasma hormone concentrations associated with early embryo mortality in heifers. Journal of Reproduction and Fertility (Supplement) 30: 231–9 Lamming, G.E., and Darwash, A.O. 1998. The use of milk progesterone profiles to characterise components of subfertility in milked dairy cows. Animal Reproduction Science 52: 175-190 Larson, S.F., Butler, W.R., Currie, W.B. 1997. Reduced fertility associated with low progesterone postbreeding and increased milk urea N2 in lactating cows. Journal of Dairy Science 80: 1288–95 Lucy, M.C. 2001. Reproductive loss in high-producing dairy cattle: Where will it end? Journal of Dairy Science 84: 1277-1293 Lucy, M.C. 2007. Reproduction in Domestic Ruminants VI by Juengel, J.L., Murray, J.F., and Smith, M.F. Mackey, D.R., Gordon, A.W., McCoy, M.A., Verner, M., and Mayne, C.S. 2007. Associations between genetic merit for milk production and animal parameters and the fertility performance of dairy cows. Animal 1: 29–43 McCoy, M.A., Lennox, S.D., Mayne, C.S., McCaughey, W.J., Edgar, H.W.J., Catney, D.C., Verner, M., Mackey, D.R., and Gordon, A.W. 2006. Milk progesterone profiles and  101  their relationship with fertility, production and disease in dairy cows in Northern Ireland. Animal Science 82: 213–222 Pursley, J.R., Wiltbank, M.C., Stevenson, J.S., Ottobre, J.S., Garverick, H.A., and Anderson, L.L. 1997. Pregnancy rates per artificial insemination for cows and heifers inseminated at a synchronized ovulation or estrus. Journal of Dairy Science 80: 295-300 Sartori, R., et al. 2002. Ovarian structures and circulating steroids in heifers and lactating cows in summer and lactating and dry cows in winter. Journal of Dairy Science 85: 28132822 Sartori, R., Haughian, J.M., Shaver, R.D., Rosa, G.J.M., and Wiltbank, M.C. 2004. Comparison of ovarian function and circulating steroids in estrous cycles of holstein heifers and lactating cows. J Dairy Sci 87: 905-920 Shearer, J. K. 2003. The milk progesterone test and its applications in dairy cattle reproduction. http://edis.ifas.ufl.edu. Tenhagen, B.A., Wittke, M., Drillich, M., and Heuwieser, W. 2003. Timing of ovulation and conception rate in primiparous and multiparous cows after synchronization of ovulation with GnRH and PGF2α. Reproduction in Domestic Animals 38: 451–454 Vries, A. 2004. Trends in reproductive performance in dairy cows: What do the numbers tell us? Proceedings Florida Dairy Reproduction Road Show Wiltbank, M., Lopez, H., Sartori, R., Sangsritavong, S., and Gumen, A. 2006. Changes in reproductive physiology of lactating dairy cows due to elevated steroid metabolism. Theriogenology 65: 17–29 Wolfenson, D., Inbar, G., Roth, Z., Kaim, M., Bloch, A., Braw-Tal, R. 2004. Follicular dynamics and concentrations of steroids and gonadotropins in lactating cows and nulliparous heifers. Theriogenology 62: 1042–1055  102  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066553/manifest

Comment

Related Items