UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Estrogen in ovarian cancer cell metastasis Park, Se Hyung 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_fall_park_se hyung.pdf [ 2.57MB ]
Metadata
JSON: 24-1.0066503.json
JSON-LD: 24-1.0066503-ld.json
RDF/XML (Pretty): 24-1.0066503-rdf.xml
RDF/JSON: 24-1.0066503-rdf.json
Turtle: 24-1.0066503-turtle.txt
N-Triples: 24-1.0066503-rdf-ntriples.txt
Original Record: 24-1.0066503-source.json
Full Text
24-1.0066503-fulltext.txt
Citation
24-1.0066503.ris

Full Text

 ESTROGEN IN OVARIAN CANCER CELL METASTASIS  by  Se Hyung Park  D.V.M., Chung-buk National University, 1996 M.Sc., Chung-buk National University, 1998       A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  The Faculty of Graduate Studies  (Reproductive and Developmental Sciences)    THE UNIVERSITY OF BRITISH COLUMBIA (VANCOUVER)  August, 2008  © Se Hyung Park, 2008 ABSTRACT Benign ovarian tumors and majority of epithelial ovarian cancers possess steroid receptors including estrogen receptors (ERs). However, the estrogen-ER signaling in ovarian carcinomas is not completely understood. Tumorigenesis is a multiple-step process involving dysregulated cell growth and metastasis. Tumor cells acquire the capacity of migration and invasion by temporal phenotypical and genotypical changes termed epithelial-mesenchymal transition (EMT). Considerable evidence implicates a mitogenic action of estrogen in early ovarian carcinogenesis. In contrast, its influence in the metastatic cascade of ovarian tumor cells remains obscure. In this study, I have focused on the role of 17β-estradiol (E2) in ovarian tumorigenesis. EMT related genes including E-cadherin, Snail, Slug, and Twist were examined. E2 treatment led to clear morphological changes and an enhanced cell migratory propensity. These morphologic and functional alterations were associated with changes in the abundance of EMT-related genes. Upon E2 stimulation, expression and promoter activity of the epithelial marker E- cadherin was strikingly suppressed, whereas EMT-associated transcription factors Snail and Slug were significantly up-regulated. This up-regulation was attributed to the increase in gene transcription activated by E2. Depletion of the endogenous Snail or Slug using small interfering RNA (siRNA) attenuated E2-mediated control in E-cadherin. In addition, the E2-induced cell migration was neutralized by Snail and Slug siRNAs, implying that both transcription factors are indispensable for the pro-metastatic actions of E2. Importantly, by using selective ER agonists as well as over-expression and siRNA approaches, it was identified that E2 triggered the metastatic behaviors exclusively through an ERα-dependent pathway. In contrast, overexpression of ERβ opposed the ii phenotypic changes and down-regulation of E-cadherin induced by ERα. In addition, microarray analysis was performed to characterize more putative downstream mediators of E2. Expression levels of 486 genes were found to be altered by at least 50% upon E2 treatment, and included several genes involved in oncogenesis, cell cycle control, apoptosis, signal transduction and the gene expression machinery. These candidate genes may be valuable for better delineating the ER pathways and functions. In summary, this study provides compelling arguments that estrogen can potentiate tumor progression by EMT induction, and highlight the crucial role of ERα in ovarian tumorigenesis.  iii TABLE OF CONTENTS  Abstract   ···················································································································· ii Table of contents ········································································································ iv List of tables·············································································································· vii List of figures ···········································································································viii List of abbreviations··································································································· xi Acknowledgements ·································································································· xiv  1. Introduction    1.1 Estrogen and its receptors··················································································· 1       1.1.1 Estrogen ······································································································· 1          1.1.1.1 Overview ······························································································· 1          1.1.1.2 Synthesis of estrogen ············································································· 1          1.1.1.3 Physiological function of estrogen ························································· 4       1.1.2. Nuclear receptor superfamily······································································· 4       1.1.3. Structure of estrogen receptors ···································································· 7       1.1.4. Action mechanism of estrogen ···································································· 9          1.1.4.1. Classical mechanism of estrogen action: Ligand-dependent ·················· 9          1.1.4.2. Ligand-independent activation of ER: Cross-talk with peptide growth factors···················································································· 11          1.1.4.3. ERE-independent genomic actions of ER············································ 13          1.1.4.4. Nongenomic action of estrogen ··························································· 14    1.2. Ovarian surface epithelium and its neoplastic counterparts, ovarian carcinomas····································································································· 17       1.2.1. Overview··································································································· 17       1.2.2. Proposed causes of epithelial ovarian cancer············································· 17       1.2.3. Steroid hormones in ovarian cancer cells··················································· 20          1.2.3.1 Androgen and progesterone in ovarian cancer cells······························ 20          1.2.3.2 Estrogen in ovarian cancer cells ··························································· 20 iv       1.2.4. Estrogen receptor expression in ovary and ovarian tumor cells ················· 22    1.3. Epithelial-mesenchymal transition in cancer ··················································· 24       1.3.1. E-cadherin ································································································· 25       1.3.2. The role of E-cadherin in metastasis·························································· 26       1.3.3. The role of E-cadherin in oncogenesis······················································· 27       1.3.4. Mechanism of inactivation of E-cadherin ·················································· 28          1.3.4.1. Gene mutations···················································································· 28          1.3.4.2. Promoter methylation ·········································································· 29          1.3.4.3. Transcriptional repression···································································· 29          1.3.4.4. Disruption of the E-cadherin-catenin complex ···································· 30       1.3.5. Expression of E-cadherin in ovarian cancer··············································· 31    1.4. Hypotheses and Aims······················································································ 32 2. Materials and methods    2.1. Cell culture ····································································································· 33    2.2. Treatments······································································································· 33    2.3. [3H]-Thymidine incorporation assay ······························································· 34    2.4. Microarray analysis ························································································· 34    2.5. Transfection of siRNA ···················································································· 37    2.6. Transient over-expression of ERα and ERβ ···················································· 37    2.7. Reverse transcription and real-time quantitative PCR ····································· 38    2.8. Immunoblot analysis ······················································································· 38    2.9. Reporter gene assay························································································· 39    2.10. Scratch assay ································································································· 40    2.11. Statistics ········································································································ 41 3. Results    3.1. E2 stimulates DNA synthesis of BG-1 cells ···················································· 42    3.2. E2 stimulates EMT and migration of BG-1 cells ············································· 45    3.3. E2 suppresses E-cadherin expression in dose- and time-dependent manner ···· 49    3.4. Transcriptional repression of E-cadherin by E2··············································· 52    3.5. E2 enhances expression and promoter activities of Snail and Slug·················· 55 v    3.6. Snail and Slug are responsible for E2-induced repression of E-cadherin and cell migration·························································································· 61    3.7. ERα, but not ERβ, mediates E2-induced EMT················································ 68    3.8. ERβ opposes the pro-metastasis effects of ERα ·············································· 80    3.9. ERα to ERβ expression ratio may be important in determining the pro- metastatic effects of E2 in ovarian cancer cells ············································· 89    3.10. Identification of E2 target genes using microarray profiling ························· 94 4. Discussion ············································································································· 98 5. Conclusion and future studies    5.1. Conclusion ···································································································· 109    5.2. Further studies ······························································································· 111       5.2.1. Identification of the signaling cascade that mediates estrogen-induced cell motility ··························································································· 111       5.2.2. Investigation on the regulatory mechanism(s) of the EMT-inducers, Snail and Slug, by E2 ············································································ 112 6. References··········································································································· 113 7. Appendix············································································································· 138 vi LIST OF TABLES Table 1. Quantitation of genes affected upon E2 treatment by microarray analysis·········································································································· 95 Table 2. List of genes showing at least 50 % changes after E2 treatment for 1, 8, and 24 h······································································································· 138 vii LIST OF FIGURES Fig. 1. Estrogen biosynthesis in ovary. ······································································· 3 Fig. 2. Schematic representation of the functional domains of the nuclear receptor superfamily (A) and diagrams of human ERα and human ERβ showing percentage homology between the different receptor functional domains (B). ··································································································· 8 Fig. 3. E2 increases DNA synthesis in BG-1 cells.···················································· 43 Fig. 4. ER mediates E2 induced DNA synthesis in BG-1 cells.································· 44 Fig. 5. BG-1 cells are induced by E2 to undergo EMT.············································· 46 Fig. 6. Migratory activity of BG-1 cells is increased by E2.······································ 47 Fig. 7. Effect of E2 on the growth of BG-1 cells in vitro.·········································· 48 Fig. 8. E2 down-regulates E-cadherin expression.····················································· 50 Fig. 9. Down-regulation of E-cadherin by E2 is ER-mediated. ································· 51 Fig. 10. Expression of E-cadherin mRNA is down-regulated by E2. ························ 53 Fig. 11. E2 reduces E-cadherin synthesis through transcriptional repression. ··········· 54 Fig. 12. Effect of E2 on the expression of Snail, Slug, and Twist.····························· 57 Fig. 13. E2 regulates mRNA expression of Snail and Slug. ······································ 58 Fig. 14. Effect of E2 on Snail and Slug mRNA stabilities.········································ 59 Fig. 15. E2 regulates gene promoter activities of Snail and Slug.······························ 60 Fig. 16. Expression of Snail and Slug after transfection with siRNAs in BG-1 cells. ·············································································································· 62 Fig. 17. Snail and Slug mediate the regulation of E-cadherin by E2.························· 63 Fig. 18. Expression of Snail and Slug after transfection with additional siRNAs. ····· 64 viii Fig. 19. Snail and Slug mediate the regulation of E-cadherin by E2.························· 65 Fig. 20. Snail and Slug regulate the promoter activity of E-cadherin by E2. ············· 66 Fig. 21. Snail and Slug mediate migration of BG-1 cells by E2. ······························· 67 Fig. 22. Effect of PPT and DPN on the expression of E-cadherin. ···························· 70 Fig. 23. Expression of estrogen receptor subtypes after transfection with siRNAs in BG-1 cells. ················································································· 71 Fig. 24. ERα is required for the regulation of E-cadherin expression.······················· 72 Fig. 25. ERα is required for the regulation of promoter activity of E-cadherin. ········ 73 Fig. 26. ERα is required for EMT induction by E2. ·················································· 74 Fig. 27. Knock-down of ERα blocks E2-induced cell migratory capacity. ··············· 75 Fig. 28. Expression of estrogen receptor subtypes after ERα overexpression in SKOV-3 cells. ···························································································· 76 Fig. 29. ERE luciferase activity is increased by E2 in ERα overexpressed SKOV-3 cells. ······························································································· 77 Fig. 30. Overexpression of ERα in SKOV-3 cells increases markers of EMT induction by E2. ···························································································· 78 Fig. 31. ERα is required for EMT induction by E2 in SKOV-3 cells. ······················· 79 Fig. 32. Expression of ERβ after transfection with siRNAs in SKOV-3 cells. ·········· 81 Fig. 33. ERβ upregulates E-cadherin in SKOV-3 cells.············································· 82 Fig. 34. ERβ inhibits cell migration. ········································································· 83 Fig. 35. Expression of ERβ after transfection with pRST7-ERβ in BG-1 cells. ········ 84 Fig. 36. ERβ opposes ERα-induced down-regulation of E-cadherin expression. ······ 85 ix Fig. 37. ERβ opposes ERα-induced down-regulation of E-cadherin promoter activity.·········································································································· 86 Fig. 38. ERβ blocks ERα-induced EMT. ·································································· 87 Fig. 39. ERβ opposes ERα-induced cell migratory activity. ····································· 88 Fig. 40. Expression profiles of ERα and ERβ in ovarian cancer cell lines. ··············· 91 Fig. 41. E2 had no effect on migration and E-cadherin expression of OVCAR-3 cells. ·············································································································· 92 Fig. 42. Effect of E2 on migration of OV266 cells. ··················································· 93   x LIST OF ABBREVIATIONS AIB1 Amplified in breast cancer-1 AF Activation function domain ANOVA Analysis of variance APC    Adenomatous polyposis coli AR Androgen receptor Arom P450 Aromatase P450 Bp   Base pair °C Celcius Ca2+ Calcium cAMP Cyclic adenosine monophosphate CBP Creb-binding protein CCC Cadherin-catenin complex (CCC) cDNA Complementary deoxyribonucleic acid CRE Cyclic AMP-response elements CTE COOH-terminal extension DBD DNA-binding domain DMEM/F12 Dulbecco’s modified eagle medium/Ham's F-12 DNA Deoxyribonucleic acid DPN Diarylpropionitrile E2 Estradiol E2-BSA-FITC Fluorescein-labeled BSA-E2 E-Cad E-Cadherin ECL Enhanced chemiluminescence EGF Epidermal growth factor EMT Epithelial-mesenchymal transition ERα Estrogen receptor alpha ERβ Estrogen receptor beta ERE Estrogen response element FBS Fetal bovine serum xi FSH Follicle-stimulating hormone GnRH Gonadotropin-releasing hormone G-protein GTP-binding protein GPR G-protein coupled receptor GR Glucocorticoid receptor GRIP1 Glutamate receptor interacting protein 1 GSK-3  Glycogen synthase kinase-3  GTFs General transcription factors ICI ICI 182,780 IGF-1 Insulin-like growth factor-1 LBD Ligand-binding domain LH Luteinizing hormone MAPK Mitogen-activated protein kinase MDCK Madin-Darby canine kidney MMP Matrix metalloproteinases mRNA Messenger ribonucleic acid OSE Ovarian surface epithelium P4 Progesterone PAGE Polyacrylamide gel electrophoresis PBS Phosphatase buffered saline PCR Polymerase chain reaction PPAR Peroxisome proliferator–activated receptor PPT Propylpyrazole-triol PR Progesterone receptor RAR All-trans retinoic acid receptor SD Standard deviation SDS Sodium dodecyl sulphate siRNA Small interference RNA SRA Steroid receptor RNA activator SRC Steroid receptor coactivator TR Thyroid hormone receptor xii TRAP Thyroid hormone receptor-associated protein Tris Tris(hydroxy methyl) aminomethane VDR Vitamin D receptor VEGF Vascular endothelial growth factor (VEGF) xiii ACKNOWLEDGMENTS  I would like to express my greatest gratitude to my supervisor, Dr. Peter C.K. Leung for his invaluable support and guidance during the study. In addition, I also would like to express gratitude to my supervisory committee members, Drs. Gregory Lee, Keith K.C. Choi, Geoffrey Hammond, David Huntsman for their supervision and scientific advice. I also would like to thank Dr. Ki Yon Kim, Dr. Takayo Ota, Ms. Lydia Cheung, Ms Roshni Nair and my all labmates for their helpful discussion and friendship. Lastly, I wish to thank my family members for their endless love and understanding throughout my study.      xiv 1. INTRODUCTION  1.1 Estrogen and its receptors 1.1.1 Estrogen 1.1.1.1 Overview Estrogen is a class of steroid compounds produced by the ovary under the stimulation of follicle-stimulating hormone (FSH) and luteinizing hormone (LH). Estradiol, estriol, and estrone are three types of estrogen found in the body. Among them, 17β-estradiol (E2) is the primary estrogen in women of reproductive age. During the menstrual cycle of healthy women for example, the plasma concentrations of E2 is 200-1300 pmol/L and plasma concentration of progesterone (P4) is 2-40 nmol/L (Groome et al, 1996). During pregnancy, estriol is made by the human placenta in greater quantities than estrone or estradiol. Other than the production of estrogen by the ovary, some tissues such as the liver, adrenal glands, and breast also produce small amounts of estrogen, which is particularly important in postmenopausal women. Estrogen is also present in men, but the blood circulation levels are usually significantly higher in women of reproductive age.  1.1.1.2 Synthesis of estrogen The production of steroid hormones in the gonad is regulated by FSH and LH released from the pituitary gonadotropes under the control of gonadotropin releasing hormone (GnRH). GnRH is secreted in a pulsatile manner by specific neurons located in the brain, specifically the anterior and mediobasal hypothalamus, which stimulates the pituitary gonadotroph cell to produce FSH and LH. In women, FSH and LH function in 1 the ovary to regulate folliculogenesis, ovulation and steroidogenesis. Steroid hormones including E2 and P4 mediate the ovarian effects on the hypothalamic-pituitary system, constituting a feedback regulatory system. Menstrual cyclicity in women is greatly dependent on this feedback system. During the follicular phase for example, E2 plays a key functional role, while P4 in low concentrations contributes to the control of LH and FSH secretion. During the luteal phase, both E2 and P4 regulate the maintenance of FSH and LH levels. The varying levels of LH and FSH during the menstrual cycle is important in understanding. Biosynthesis of estrogen in the ovary occurs in two distinct cell types—theca cells and granulosa cells. This process is briefly summarized in Figure 1. Theca cells of the pre-antral and antral follicles have LH receptors and steroidogenic enzymes that are necessary for androgen biosynthesis, such as 17α-hydroxylase. LH stimulates theca cells to produce androstenedione and testosterone from cholesterol.  FSH receptors are present in the granulosa cells of ovarian follicles where the enzyme aromatase P450 (AromP450) is responsible for the conversion of androgens to estrogens. Under the stimulation of FSH, cholesterol is converted into androstenedione in the theca interna cells of the ovary. Androstenedione moves to granulosa cells where it is converted into estrone by AromP450. 2 Fig. 1. Estrogen biosynthesis in ovary. In response to LH, theca cells produce androgens, which are then converted to estrogens in granulosa cells via aromatization. FSH, follicle stimulating hormone; LH, luteinizing hormone. Theca cell Granulosa cell Cholesterol Androstenedione Testosterone Androstenedione Testosterone Estrogen Aromatase FSHR FSH LHR LH 3 1.1.1.3 Physiological function of estrogen  Estradiol is the most active among the three types of estrogen. It is the most important and significant estrogen throughout a woman's productive life. Estrogens promote the development of female secondary sex characteristics, and are essentially involved in the thickening and maintenance of the endometrium - a mucous membrane that lines the uterus. Estrogen also helps stimulate the growth of egg follicles.  In the male, traces of estrogens can be detected in the blood and urine. However, their function in the male reproductive system is not completely understood. It has been suggested that one of the roles of estrogen in men may be to control the maturation of sperm (Hess et al. 1997).  The function of estrogen is also involved in other kinds of physiological functions, including metabolism. For example, estrogen may increase the biosynthesis of high density lipoprotein cholesterol (referred to as ‘good cholesterol') and reduce low density lipoprotein cholesterol (‘bad’ cholesterol) (Rossouw 1999).  1.1.2. Nuclear receptor superfamily Nuclear receptors are intracellular transcription factors that control many biological functions through regulation of specific genes involved in development, differentiation, metabolism, and reproduction. These nuclear receptors are categorized into three families, or classes (Laudet 1997). The steroid receptor family (class I) includes the progesterone receptor (PR), estrogen receptor (ER), gulucocorticoid receptor (GR), androgen receptor 4 (AR), and mineralocorticoid receptor. The thyroid/retinoid family (class II) includes the thyroid receptor (TR), vitamin D receptor (VDR), retinoic acid receptor (RAR), and peroxisome proliferator–activated receptor (PPAR). The third class of receptors has been termed the orphan receptor family which defines a set of proteins identified by comparative sequence analysis as belonging to the nuclear receptor superfamily but for which the cognate ligand is unknown.  Although the nuclear receptors have common structural features, divergence of subclasses is supported by the differences in their functional characteristics, as well as by their different recognitions of cis-acting hormone response elements. Class I receptors, in the absence of ligand, are typically sequestered in inactive complexes with heat shock proteins. Class II receptors bind DNA in the absence of ligand and sometimes have a repressive effect on target promoters (Tsai et al. 1994). Class I receptors usually bind specific palindromic repeats in a homodimeric arrangement in the presence of ligand, whereas class II receptors generally bind response elements that contain direct repeats. In addition, class II receptors exhibit promiscuous dimerization patterns.  Nuclear receptor proteins contain two structural subunits which are called the C- terminal ligand-binding domain (LBD) and the DNA-binding domain (DBD). LBD, a moderately conserved domain, contains a binding pocket specific for its cognate hormone or ligand. It also contains a ligand-regulated transcriptional regulational activation function (AF-2) which is necessary for recruiting various coactivating proteins. These coactivating proteins in turn interact with chromatin-remodeling proteins and the general 5 transcriptional activation machinery. Furthermore, the LBD is necessary for receptor dimerization. Unlike the LBD, the DBD is a highly conserved region that mediates binding of the receptor dimer to specific DNA response element binding sequences within nuclear receptor regulated promoters. The DBD is connected to the LBD through a short amino acid sequence termed the hinge region. The functional role of the hinge region is not clear yet. Most nuclear receptors contain amino acid sequences that bind the amino-terminal region to the DBD. These residues contain a transcriptional activation function termed AF1.  The functional domain of AF1 reflects an intricate, but well characterized, ligand- dependent receptor activation pathway that requires a multistep-process. This process starts with (1) the activation of a receptor by binding to the cognate hormone, followed by (2) a change in receptor structure, (3) dissociation of the heat shock proteins, (4) nuclear translocation of the activated receptor (in the case of ER, GR, MR, AR, and PR), and (5) dimerization and apposition of the nuclear translocated receptor to its DNA response elements. While the role of general transcription factors (GTFs) in mediating transcriptional control by ERs is well documented, it has recently been suggested that these nuclear receptors may also recruit coregulators that create either a transcriptionally permissive or nonpermissive state at the promoter site. These coregulators may communicate with the GTFs to constitute a transcription regulation machinery (McKenna et al. 2002). The role of coregulators in ER-mediated gene regulation will be discussed further in section 1.1.4.  6 1.1.3. Structure of estrogen receptors Estrogen receptors are a part of the nuclear receptor superfamily, which is thought to be derived from a common ancestor (Evans 1988). To investigate the structure of estrogen receptors, two estrogen receptor subtypes were cloned in mammals. The first reported cloning for an estrogen receptor was done successfully in 1986 by two groups (Green et al. 1986; Greene et al. 1986). Until 1995, it was regarded that all effects of estrogen were mediated by this receptor which is now known as estrogen receptor alpha (ERα). However, in 1996, a second estrogen receptor subtype was cloned from a rat prostate cDNA library (Kuiper et al. 1996). This estrogen receptor was termed estrogen receptor beta (ERβ).  The chromosomes on which the ERα and ERβ genes are located are different. The former is located at chromosome 6q25.1 whereas the later is located on chromosome 14q23-24.1 (Paech et al. 1997; Couse et al. 1999). ERα contains 595 amino acids while ERβ contains 530 amino acids. Despite these differences, the ERs share similar structural characteristics with other members of the nuclear receptor family. Both ERs consist of a variable amino-terminal region (A/B), a conserved DNA binding domain (DBD) or region C, a linker region D, and a conserved E region that contains the ligand binding domain (LBD). Schematic representation of their structures is shown in Figure 2. 7 A/B             C       D                 E                    F AF-1 AF-2DNA Ligand Fig. 2. Schematic representation of the functional domains of the nuclear receptor superfamily (A) and diagrams of human ERα and human ERβ showing percentage homology between the different receptor functional domains (B). (adapted from Cheung et al 2003) A B AF-1 DNA Ligand / AF-2 A/B C D E F 28% 96% 58% 1 180 263 302 552 595 N C 1 143 216 255 503 530 N C hERα hERβ 8 The amino-terminal A/B region is most variable in the ER subtypes, showing only 18% amino acid identity. Within this region, there is an activation domain, AF-1. The DNA binding domain, which is the most conserved region in ERs, has the ability to recognize a specific sequence in target genes, called an estrogen response element (ERE) (Mosselman et al. 1996). The DNA binding domain contains two asymmetric zinc fingers with a carboxy-terminal extension, (CTE) that facilitates the interaction with an ERE present in the target genes. The D domain, which is not well-conserved, serves as a hinge between the DBD and the LBD and also allows rotation of the LBD. The LBD contains an AF-2 domain which is involved in heat shock protein interaction that binds with agonist or antagonist and is involved with the interaction of cofactors. The LBD contains 12 conserved α-helical regions, which show different conformational changes by binding of various agonists or antagonists.  1.1.4. Action mechanism of estrogen 1.1.4.1. Classical mechanism of estrogen action: Ligand-dependent The ligand-dependent activation mechanism is the well known characteristics of the Class I members of the nuclear steroid receptor superfamily, of which the ERα and ERβ are members. This is also regarded as the typical genomic action of ERs. In the absence of hormone, the receptor which is located in cytoplasm or nucleus of cell is attached to receptor-associated proteins. These proteins such as heat shock protein (HSP)-90 and gamma-synuclein serve as chaperones that stabilize the receptor in an unactivated state or mask the DNA binding domain of the receptor (Jiang et al. 2004; Fiskus et al. 2007). As free estrogen diffuses into the cell, it binds to the ligand-binding domain of the receptor, 9 which dissociates from its cytoplasmic chaperones; the complex of estrogen and estrogen receptor then diffuses into the cell nucleus. These estrogen–estrogen receptor complexes form homodimers or heterodimers and bind to specific sequences of DNA called estrogen-response elements, the EREs, which are cis-acting enhancers located within the regulatory regions of target genes. The consensus DNA sequence of ERE is an inverted repeat sequence separated by three non-specific nucleotides, 5′-GGTCAnnnTGACC-3’ (Klein-Hitpass et al. 1988).  The estrogen–estrogen receptor complexes bind not only to the response elements but also to nuclear-receptor coactivators or repressors.The DNA-bound receptors recruit the general transcription apparatus either directly or indirectly via cofactor proteins including SRC-1, GRIP1, AIB1, CBP/p300, TRAP220, PGC-1, and SRA (Onate et al. 1995; Anzick et al. 1997; Heery et al. 1997; Murphy et al. 2000). Depending on the cell and promoter context, the DNA-bound receptor exerts either a positive or negative effect on expression of the downstream target genes.  The ligand-dependent transcriptional activity of ERα is mediated by two separate activation domains, a constitutive activation function-1 (AF-1) located within the amino- terminus (A/B domain) and a hormone-dependent AF-2, located in the ligand-binding domain. The AF-2 functional domain includes a highly conserved amphipathic α-helix (H12) that is essential for ligand-dependent transcriptional activity and interaction with coactivators. AF-1 activity is also dependent on the recruitment of coactivators, both similar and unique from those utilized by AF-2. The AFs function in a synergistic manner 10 in most ligand-activated mechanisms but may also function independently depending on certain cell and promoter contexts. Whereas the activation domains of ERα are well characterized, it is not yet clear how the homologous regions of ERβ contribute to the transcriptional activity of the receptor. There is some indication in the literature that ERβ also contains an AF-2 domain within the carboxy-terminus. However, the finding that this region functions independently within ERβ  may imply different roles of the AF-2 domains in the two ER subtypes. The high degree of sequence divergence in the amino- terminus, including the lack of a functional AF-1 in the human ERβ subtype, also suggests that this region may function differently. Therefore although murine ERβ contains an AF-1 region very similar to that of ERα in terms of both sequence and structure, it is unlikely that they share similar physiological actions.  1.1.4.2. Ligand-independent activation of ER: Cross-talk with peptide growth factors In addition to hormone-mediated activation, it is now well accepted that ER function can be modulated by extracellular signals in the absence of a ligand. These findings focus primarily on the ability of polypeptide growth factors such as epidermal growth factor (EGF), insulin-like growth factor-1 (IGF-1), and the intracellular effector analog 8- bromo-cyclic adenosine monophosphate to activate ER and increase the expression of ER target genes. Many of these findings have been corroborated with in vivo studies, such as the ability of EGF to mimic the effect of E2 on the female reproductive tract (Curtis et al. 1996). Although the molecular mechanisms involved in ligand-independent activation of ER have been characterized, the biological role of these processes remains undefined. It is 11 possible that hormone-independent pathways allow ER activation in the presence of low E2 levels, as found in males. Alternatively, this phenomenon may serve as a mechanism to amplify growth factor pathways and thereby enhance mitogenesis within ER-positive tissues.  The mechanisms by which the ER and growth factor pathways converge are not entirely clear. However, studies do indicate that each pathway may be dependent on the other for full manifestation of the respective ligand-mediated responses. For example, in the mouse uterus, co-treatment with anti-EGF antibodies was found to attenuate the uterine response to E2; in turn, administration of the ER antagonist ICI 164,384 reduced the uterine response to EGF (Ignar-Trowbridge et al. 1992). These studies, together with similar observations made in the mammary gland, led to the proposed model that the mitogenic action of E2 in these tissues are at least partially mediated by EGF; conversely, the mitogenic effects of EGF require the presence of ERα (Ankrapp et al. 1998). More definitive evidence of the proposed model, comes from studies of the uteri of αER-knock out female mice, which despite expressing wild-type levels of functional EGF and EGF receptor and showing evidence of EGF signaling, remain unresponsive to the mitogenic actions of EGF.  Specific receptor domains of the ER are critical to the ligand-independent activation. Specifically, the effects of elevated intracellular cyclic adenosine monophosphate (cAMP) are mediated through AF-2, whereas growth factor activation of ER requires the amino- terminal AF-1 domain of the receptor (El-Tanani et al. 1997). There is evidence that 12 modification of the phosphorylation state of the ER by cellular kinase may serve as an important mechanism of ligand-independent activation. The serine 118 residue of the human ERα AF-1 is phosphorylated by the mitogen-activated protein kinase (MAPK) pathways following treatment with EGF or IGF, enabling the receptor to interact with the ERα-specific coactivator and activate target gene transcription (Kato 2001). Interestingly, the MAPK pathway also enhances the activity of the murine ERβ through stimulating the recruitment of SRC-1 to the amino-terminus (Tremblay et al. 1999). Recent evidence has emerged indicating that coactivators may also serve as points of convergence between ER and growth factor signaling pathways, as it was shown that SRC-1 and AIB1 are phosphorylated by MAPK, an event thought to enhance their transcriptional activities (Rowan et al. 2000).  1.1.4.3. ERE-independent genomic actions of ER The ER signaling mechanisms discussed thus far provide an explanation for the regulation of genes in which a functional ERE-like sequence can be found within the promoter. However, concurrent studies reporting E2-ER induction of genes, in which no ERE-like sequence were present, have  led to the discovery that agonist-bound ER can indeed lead to gene regulation in the absence of direct DNA binding. Notably, alternative sites have been proposed. For example, ERα activation of IGF-1 and collagenase expression is mediated through the interaction of receptor with Fos and Jun at AP-1 binding sites, whereas several genes containing GC-rich promoter sequences are activated via an ERα-Sp1 complex (Bruning et al. 2003). The molecular mechanism of ER action at these alternative sites is becoming increasingly clear. For example, it has been 13 observed that that E2-ERα activation of AP-1-responsive elements require both AF-1 and AF-2 domains of the receptor, which bind and enhance the activity of the p160 components such as SRC-1 and GRIP1 of the coactivator complex recruited to the site by Fos/Jun (Jakacka et al. 2001). Interestingly, human ERβ, which lacks a functional AF-1, is unable to activate transcription of AP-1-regulated genes when bound with ER agonists, indicating the possibility of distinct physiological actions of the two ERs via the regulation of unique subsets of genes (Kushner et al. 2000). Although demonstration of interaction between ER and AP-1 pathways in vivo has been more difficult, the ER knock-out models should provide valuable information for further investigation of the contribution of this pathway to estrogen signaling. Expression of Cyclin D1 induced by estrogen is another example of ERE-independent genomic action of ER. Cyclin D1(CCND1) is a well recognized oncogene which is induced by estrogen in mammary epithelial cells (Ewen et al. 2004). However, no ERE or ERE half-site is present within the CCND1 gene regulatory regions. Interestingly, several transcription factors recruited to the CCND1 regulatory regions have been shown to physically interact with hormone-activated ERα and could therefore tether it to these regions. These transcription factors include C/EBPβ, c-jun, and Sp1 (Kushner et al. 2000; Safe 2001; Chang et al. 2005).  1.1.4.4. Nongenomic action of estrogen As discussed in section 1.1.4.1, the biological actions of estrogen are triggered by binding between hormone and specific receptors which are located in the cytosol and the nucleus. Ligand-receptor complexes bind to specific sequences of target genes with 14 several coregulator proteins that subsequently modulate the transcription level. However, there is growing evidence that several estrogen-dependent effects are induced through cell membrane-associated signaling rather than through the classical genomic signaling pathway previously described.  Cell membrane associated signaling has been characterized by an insensitivity to inhibitors of transcription and protein synthesis, and by their rapid onset of action. The rapid onset of action is significantly faster, and occurs within seconds to minutes, when compared to the slower genomic effects which usually take hours to days (Falkenstein et al. 2000). These membrane mediated-effects include changes in intracellular calcium concentration, MAPK activation, cAMP levels, or nitric oxide release, and occur in several cell types such as neuronal, breast cancer, vascular smooth muscle cells, and leukocytes (Cato et al. 2002). In addition, some studies have shown that fluorescein- labeled BSA-E2 (E2-BSA-FITC), which does not cross the plasma membrane, is bound to a putative ER, present on intact cell membranes. This binding can be competed by preincubation with E2 in a dose dependent manner and with ICI 182,780.  Despite these observations, the nature and characteristic of the membrane receptor, which is responsible for these non-genomic effects is not yet clear. It has recently been suggested that these non-genomic effects can be explained by the following two models. First, it is proposed that the effects are mediated by the classical ERα, which initiates a cascade of signals including G protein and receptor tyrosine kinases. However there are discrepancies in this model and these relate to which molecules and pathways the ER 15 may interact with and which signals may result. In the second type of model, classical ER is not involved and another membrane associated estrogen binding protein is believed to mediate the response to estrogen. Recently, It has been reported that G protein-coupled receptor (GPR) 30, an orphan receptor unrelated to nuclear estrogen receptors, has all the binding and signaling characteristics of a membrane bound ER in human breast cancer cells (Thomas et al. 2005). Intriguingly, it also has been reported that GPR30 is uniquely localized to the endoplasmic reticulum, where it specifically binds estrogen and fluorescent estrogen derivatives and modulates intracellular calcium mobilization and synthesis of phosphatidylinositol 3,4,5-trisphosphate in the nucleus (Revankar et al. 2005). Although recent studies make GPR30 a candidate for the membrane bound estrogen receptor, contradictory observations have also been reported by others (Chen et al. 1999; Watson et al. 1999). The absence of GPR30 in several well-characterized cell models of rapid, nongenomic estrogen actions, sheep endothelial cells and rat pituitary and hypothalamic cells, suggests that not all of these ER related actions are mediated via GPR30 and that at least two classes of membrane ERs are present in vertebrates.  The homeodynamic regulation and function of estrogen is thought to be mediated through a complex array of convergent and divergent signaling pathways (Hall et al. 2001). These signaling cascades are initiated by the genomic and non-genomic events mentioned above, which regulate the expression of a number of genes responsible for proliferation and differentiation (Charpentier et al. 2000; Inoue et al. 2002). However, the relative physiological importance of signaling pathways, and their contribution to the pathophysiology of E2 signaling are yet to be explored. 16 1.2. Ovarian surface epithelium and its neoplastic counterparts, ovarian carcinomas 1.2.1. Overview Ovarian carcinoma is the fourth leading cause of death, due to cancer, in the female population and the most fatal gynecologic malignancy (Barnes et al. 2002). Epithelial ovarian cancer can be classified into several subtypes according to its histological characteristics and patterns of differentiation. The major subtypes include serous, endometrial, mucinous and clear cell carcinoma (Modugno et al. 2001). Recent worldwide statistics indicated that the incidence of ovarian cancer is approximately 204,000 cases per year with about 125,000 deaths (Sankaranarayanan et al. 2006). The reason behind this high of death rate is due to late diagnosis and metastatic behaviour. The majority of patients (70-80%) having ovarian cancer are diagnosed at an advanced stage when the tumors have already spread and metastasized.  The survival rate after diagnosis of late stage ovarian cancer is only 5–10 %, making this the most lethal gynecological cancer (Nguyen et al. 1993; Hoskins 1995; Christian et al. 2001). These observations have stimulated substantial research interest in the etiology, detection, prevention, and treatment of ovarian cancer.  1.2.2. Proposed causes of epithelial ovarian cancer The factors contributing to the incidence of ovarian cancer include age, heredity, and exposure to environmental pollutants (Miki et al. 1994; Persson 2000; Auersperg et al. 2001). In addition, epidemiological studies have shown a positive correlation between the number of times a woman has ovulated with risk of ovarian cancer (Casagrande et al. 17 1979). A growing body of evidence indicates that several key reproductive hormones influence the incidence of ovarian cancer. In distinguishing the probable causes of ovarian cancer, four theories have been proposed. Three out of these four theories put the ovarian surface epithelium (OSE) forward as cells of origin of ovarian carcinomas. The OSE surrounding the ovary is a sheet of squamous to cuboidal mesothelial cells with pluripotential capacities, retaining both epithelial and mesenchymal potential. The functional biology of the OSE is poorly understood, with OSE thought to be acting as a simple mesothelium (Fathalla 1971), therefore investigating its function is of critical importance. The first theory is the gonadotropin theory, which postulates a direct tumor promoting activity of reproductive hormones on OSE and is supported by studies of women undergoing in vitro fertilization (IVF). This procedure has been purported to place women at an increased risk for ovarian cancer due to the persistent stimulation of the ovaries by gonadotropins, coupled with local effects of endogenous hormones such as steroids that are used to increase the surface of epithelial proliferation and subsequent mitotic activity (Choi et al. 2007). The gonadotropin theory can be juxtaposed against two other leading theories: the incessant ovulation theory, first proposed by Fathalla in 1971 (Fathalla 1971), and the inclusion cyst theory, proposed by Cramer and Welch in 1983 (Cramer et al. 1983). Each model is well supported by data, yet they ascribe different factors to the risks associated with ovarian cancer. The incessant ovulation theory, suggests that repeated wounding of the OSE due to ovulation increases the likelihood of neoplastic progression in cells undergoing repeated proliferation. Thus, the protective effects of pregnancy and oral contraceptives on the 18 incidence of ovarian cancer could be attributed to decreased lifetime ovulations. The inclusion cyst theory is based on the observation that epithelium-lined bodies within the ovary are precancerous lesions. In this theory, clefts form on the ovarian surface and involute into the underlying stroma, thereby entrapping OSE cells. Both ovulation and age are contributors to cyst formation, as these create the potential for cleft formation. Proliferative or differentiative effects of hormones or other factors on trapped OSE cells are also considered risk factors in tumor formation. The fourth theory, the fallopian tube theory, is different from the other theories because it proposes that the serous type of epithelial ovarian cancer may not arise from the OSE. This theory suggests that especially high grade serous ovarian carcinomas (HGSCs) may arise in the distal part of the fallopian tubes and then metastasize to the ovary (Crum et al. 2007). This theory originated from the observation that early cancerous growths were found to be located in the fallopian tube rather than on the ovarian surface in most cases (Piek et al. 2001). Most of these early cancerous areas were found at the end of the tube, called the fimbria, which actually sweeps across the surface of the ovary. Therefore, it is probable that the early cancerous growths start in the fallopian tube and the cancer cells are deposited on the ovarian surface while the fallopian tube sweeps across the ovary. Moreover, these in situ lesions of the fallopian tube epithelium share many characteristics with the serous carcinoma, including indication of p53 inactivation/mutation and evidence of DNA damage (Lee et al. 2007).  19 1.2.3. Steroid hormones in ovarian cancer cells Adult human OSE cells express receptors for estrogen (ER), progesterone (PR) and androgen (AR) (Karlan et al. 1995; Lau et al. 1999). This opens the possibility that these steroids may carry some functional roles in the ovarian carcinoma.  1.2.3.1 Androgen and progesterone in ovarian cancer cells It has been shown that high levels of androgen stimulate cell proliferation and inhibit cell death of the human OSE (Edmondson et al. 2002). Consistent with this observation, women with polycystic ovary syndrome, a pathological condition associated with high levels of androgen and symptoms that include anovulation and hyperandrogenaemia, have a higher risk of developing ovarian cancer (Schildkraut et al. 1996). In contrast to androgen, evidence has indicated that progesterone decreases ovarian cancer risk suggesting that this hormone has a protective role against ovarian cancer. It has been suggested that pregnancy reduces the incidence of ovarian cancer development, which is at least in part associated with the significantly higher levels of progesterone during this period (Adami et al. 1994). Specifically, progesterone can inhibit proliferation of some primary cultures of human OSE (Syed et al. 2001). Progesterone can also induce apoptosis and inhibit invasion in vivo and in vitro as shown in the monkey ovary, human OSE and ovarian cancer cells (McDonnel et al. 2001; Wright et al. 2002).  1.2.3.2 Estrogen in ovarian cancer cells The ovary is not only a main source of estrogen during premenopause, but also a major target tissue of estrogen. Although the risk of ovarian cancer when undergoing 20 hormonal replacement therapy is still controversial, accumulating evidence has implicated estrogen as a causative factor in the development of ovarian cancer . In animal studies for example, continuous exposure to estradiol stimulated cell proliferation of sheep (Murdoch et al. 2002) and rabbit OSE (Bai et al. 2000).  In addition to the proliferation of cells, exposure to estradiol in these studies resulted in the formation of a papillary ovarian surface resembling human serous neoplasms of low malignant potential (Bai et al. 2000). Furthermore, prospective epidemiological studies on post-menopausal women suggested that long duration of estrogen-only replacement therapy increases ovarian cancer incidence (Rodriguez et al. 2001; Lacey et al. 2002; Lacey et al. 2006).  In addition, hormone replacement therapy using estrogen enhanced the survival of several ER-positive ovarian carcinoma cell lines in vitro (Galtier-Dereure et al. 1992; Choi et al. 2001). Nevertheless, the specific mechanism by which estrogen directly contributes to the risk of ovarian cancer remains unknown. One possibility however, may be through the regulation of genes involved in ovarian tumorigenesis. Although few estrogen target genes have been identified, cyclin D1 has been identified to be responsible for cell cycle regulation and bcl-2 which is an anti-apoptotic gene (Choi et al. 2001; Bardin et al. 2004).  Therefore, it is of importance to further investigate these target genes in identifying the mechanism by which estrogen contributes to ovarian cancer.  It is also possible that the effects of estrogen may be indirect.  For example,  estrogen reduces GnRH receptor expression in both OSE and ovarian cancer cells, thereby suppressing the growth inhibitory effects of GnRH (Kang et al. 2001). Estrogen also 21 modulates levels of hepatocyte growth factor which stimulates OSE cells growth (Liu et al. 1994). Collectively, the mitogenic effect of estrogen may provide one possible explanation of the increased risk of ovarian cancer. Whether estrogen has any additional roles in ovarian cancer cells remains to be unknown.  1.2.4. Estrogen receptor expression in ovary and ovarian tumor cells In benign tumors and up to 60% of epithelial ovarian cancer, there is expression of ER suggesting its role in ovarian cancer (Brandenberger et al. 1998; Pujol et al. 1998; Rutherford et al. 2000). The expression level of ER has also been reported to be higher in well differentiated malignant tumors and in metastatic tumors relative to the primary tumor (Quinn et al. 1988). However, there are also reports that show no significant correlation between the expression level of ER and tumor stage (Vihko et al. 1983; Quinn et al. 1988), and further reports that observed high tumor ER positivity is associated with better patient survival (Slotman et al. 1990; Kieback et al. 1993).  Since the discovery of ERα and ERβ detailed analysis on the expression pattern of these subtypes in the normal ovary and ovarian cancer cells has lead to a proliferation of projects investigating the expression profile of the ER subtypes. This expression profile has profound implications on the role of estrogen and each ER subtype in ovarian physiology and carcinogenesis. Interestingly, as shown by Andrew et al., the ratio of ERα to ERβ expression was significantly higher in primary ovarian cancer cultures (n=23) compared to normal ovarian surface epithelium cultures (n=23) (Li et al. 2003). This observation has been supported by more ovarian tissue samples from other independent 22 investigations (Brandenberger et al. 1998; Pujol et al. 1998). Moreover, a recent study positively correlated the expression of ERs with clinical risk factors in 58 normal, 25 borderline, and 161 malignant ovarian tissue samples (Chan et al. 2008). More specifically, ERβ expression, and not ERα, was significantly higher in normal tissue compared with malignant tissue. ERβ expression was also significantly higher in stage I disease compared with stage II-IV disease. Therefore, high levels of ERβ could be associated with a longer disease-free survival and overall survival.  Collectively, these data suggest a differential expression of the two ER subtypes in the ovary tissue. ERβ is the dominant subtype in the ovary. However, in metastatic ovarian carcinomas, ERα is dominant and ERβ expression is minimal. Although these observations suggest a differential contribution of the subtypes to ovarian tumorigenesis, supporting evidence is limited and further investigation is necessary to ascertain this relationship. 23 1.3. Epithelial-mesenchymal transition in cancer Epithelial-mesenchymal transition (EMT) is a developmental process of crucial importance in cell differentiation, morphogenesis, and growth. This process allows cells to dissociate from the epithelial tissue and adopt a motile phenotype. During this process, epithelial cells become elongated, lose their polarity and cellular junctions and show mesenchymal, fibroblast-like properties.  Accumulating evidence has proposed that similar processes to EMT occur during carcinoma progression by which tumor cells acquire the capacity to  migrate and invade otherwise healthy cells (Thiery 2002). Due to the similarity to tumor metastasis, intensive research has been undertaken to identify reliable molecular markers and key mediators of EMT. These include proteins that actively control cell junction formation, cytoskeletal remodeling and cell motility such as cadherins, matrix metalloproteinases, and several transcription factors (Lee et al. 2006). Turning an epithelial cell into a mesenchymal cell requires alterations in morphology, cellular architecture, adhesion, and migration capacity. Commonly used molecular markers for EMT includes increased expression of N- cadherin, vimentin, nuclear localization of β-catenin, increased production of the transcription factors such as Snail1 (Snail) (Batlle et al. 2000), Snail2 (Slug) (Savagner et al. 1997), Twist (Yang et al. 2004), EF1/ZEB1, SIP1/ZEB2 (Shirakihara et al. 2007) and E47 (Bolos et al. 2003) and all of these EMT molecular markers inhibit E-cadherin production. In addition, phenotypic markers for EMT include an increased capacity for migration, three-dimensional invasion, and resistance to anoikis/apoptosis (Orford et al. 24 1999).  Upon investigation of these molecular markers and mediators, it is clear that EMT has a critical role in ovarian cancer.  1.3.1. E-cadherin In addition to EMT, cadherins have also been implicated in tumorigenisis.  Cadherins constitute a large family of glycoproteins comprised of an extracellular domain responsible for cell-cell interactions, a transmembrane domain, and a cytoplasmic domain that is frequently linked to the cytoskeleton. Cadherins play a key role in calcium- dependent cell-cell interactions and functions not only to establish tight cell-cell adhesion but also to define adhesive specificities of cells. The cadherin family of proteins can be devided into several subfamilies based on molecular characteristics. Subfamilies include Type I cadherins, Type II cadherins, desmosomal cadherinis, protocadherins, and seven- pass transmembrane or Flamingo cadherins (Angst et al. 2001). In addition, there are some cadherin family members that do not fit into a defined subfamily.  Some common cadherins expressed by epithelial cells are E-cadherin, N-cadherin, and P-cadherin. Cadherin forms one of the four classes of adhesion molecules, commonly reagarded as a core cadherin-catenin complex (CCC) (Yagi et al. 2000; Goodwin et al. 2004). The intracellular domains of classical cadherins interact with β-catenin, γ-catenin (also called plakoglobin) and p120catenin to assemble the cytoplasmic cell adhesion complex that is critical for the formation of extracellular cell-cell adhesion (Ozawa et al. 1989). β-catenin and γ-catenin bind directly to α-catenin, which links the CCC to the actin cytoskeleton (Grunwald 1993). These cadherins are responsible for the homotypic 25 cell-cell adhesion. However, knowledge gained in the recent few decades showed that cadherin does not only act as adhesive glue. The cadherin, together with the catenin molecules, may also participate in the transduction of downstream signaling (discussed in following section 3.3).  1.3.2. The role of E-cadherin in metastasis Most studies implicating cadherins in tumorigenesis have focused on E-cadherin because it is the major cadherin expressed in epithelial cells, which are the origin of most human cancers). Decreased expression of the E-cadherin is found in various cancers including gastric, hepatocellular, oesophageal, breast, prostatic, bladder, gynaecological carcinomas and is also correlated with infiltrative and metastatic ability (Takeichi 1993). It also has been proposed that the loss of E-cadherin-mediated cell-cell adhesion is a prerequisite for tumor cell invasion and metastasis formation (Birchmeier et al. 1994). Re-establishing the functional cadherin complex by forced expression of E-cadherin, results in a reversion from an invasive, mesenchymal, to a benign, epithelial phenotype of cultured tumour cells (Vleminckx et al. 1991). Hence, the E-cadherin gene is referred to as an invasion suppressor gene. The observation that certain human cancers expressing an abundance of cadherins can metastasize poses the question of how they leave the primary tumor. One possible mechanism for such a process would be a transient and local loss of cadherins due to down regulation or proteolysis. Another possible mechanism is the perturbation of the cadherin cell adhesion system without loss of cadherin. Perturbation of the cadherin adhesion system may also occur as a result of the biochemical modification of catenins. Phosphorylation of catenins might also interfere with cadherin 26 action, therefore bringing about unstable cell-cell adhesion. It has been shown that several oncogenic pathways such as the epidermal growth factor receptor, c-erb-2, hepatocyte growth receptor c-met, and the onco-protein pp60vsrc all phosphorylate β- catenin and destabilize the cell-cell adhesion system, providing further possible mechanisms of the role of E-cardherin in metastasis (Fang et al. 2008).  1.3.3. The role of E-cadherin in oncogenesis Carcinogenesis is a multi-step process involvingdys regulated cell growth and metastasis. Recently, it has been postulated that the role of E-cadhern in carcinogenesis is not only limited to metastatsis and invasion. It is increasingly recognized that there is also a possible role of E-cadherin in modulating intracellular signaling, and thus promoting tumor growth. Cadherin-mediated cell-cell adhesion can affect the Wnt-signalling pathway (Bienz et al. 2000). β-catenin (and γ-catenin) is usually sequestered by cadherins in the cadherin-catenin complex. Upon loss of E-cadherin function, nonsequestered free β-catenin is usually phosphorylated by glycogen synthase kinase 3β (GSK-3β) in the adenomatous polyposis coli (APC)-axin-GSK-3β complex and subsequently degraded by the ubiquitin-proteasome pathway. In many cancer cells, loss of function of the tumor suppressor APC, mutations in β-catenin, or inhibition of GSK-3β by the activated Wnt- signaling pathway, leads to the stabilization of β-catenin in the cytoplasm. Subsequently, it translocates to the nucleus, where it binds to members of the Tcf/Lef-1 family of transcription factors and modulates expression of Tcf/Lef-1-target genes, including the proto-oncogene c-Myc and cyclin D1 (Hsu et al. 1998). These results demonstrate that 27 the loss of function of E-cadherin may play an important role in the susceptibility to initial tumor development in addition to its role as an inhibitor of tumor invasion.  1.3.4. Mechanism of inactivation of E-cadherin 1.3.4.1. Gene mutations The E-cadherin gene can be genetically inactivated by a number of mechanisms. In 1989, E-cadherin was mapped to chromosome 16q22.1 (Natt et al. 1989). Since then, two reports identified a loss of heterozygosity in this region through the investigation of hepatocellular carcinoma and breast cancer (Sato et al. 1990; Tsuda et al. 1990). The first mutations of the E-cadherin gene were reported in two gastric carcinoma cell lines (Sato et al. 1990). Subsequently, mutations were reported in tumor samples in gynecologic cancers (Risinger et al. 1994), diffuse type gastric carcinomas (Becker et al. 1994) and infiltrative lobular breast cancer (Kanai et al. 1994). Although down-regulation of E- cadherin expression is commonly seen in many tumor types, mutations in E-cadherin were not found to be common and appeared to be specific for certain types of cancer. In Risinger’s study for example, only 4 out of 135 carcinomas exhibited detectable mutations and of these only 2 appeared to have loss of the remaining wild type allele. In breast cancer, E-cadherin mutations are common in lobular breast cancer, but not in ductal or medullary samples (Berx et al. 1995). Similarly, in gastric cancer, mutations are common in diffuse type carcinomas, but not seen in intestinal type gastric cancer. These data collectively suggest that, although deletion of one E-cadherin allele is seen widely, mutation of E-cadherin is frequent in only two specific tumor types: i.e. lobular breast cancer and diffuse type gastric carcinoma. 28 1.3.4.2. Promoter methylation Methylation is frequently associated with disease progression and metastasis (Nass et al. 2000; Tamura et al. 2000). In recent years, it has become increasingly apparent that increased methylation within the promoter region of genes plays a key role in the inactivation of genes during the development of cancer (Costello et al. 2001). The epigenetic silencing of the E-cadherin gene has been reported in a wide variety of human tumors including gastric (Waki et al. 2002), prostatic (Woodson et al. 2003), cervical (Chen et al. 2003), colorectal (Garinis et al. 2002), bladder (Bornman et al. 2001), breast (Toyooka et al. 2002), esophageal (Yeh et al. 2002), and head and neck squamous cell carcinoma (Yeh et al. 2002). Methylation of the E-cadherin promoter in invasive ductal carcinoma of the breast tissue begins early in tumorigenesis, and prior to the invasive stage, showing that methylation of E-cadherin promoter may facilitate the dynamic phenotypic heterogeneity that drives metastatic progression.  1.3.4.3. Transcriptional repression Decreased expression or loss of function of E-cadherin during tumor progression can be induced by transcriptional repressors including Snail, Slug, SIP1, E2A, and Twist that bind to the three E-boxes within the promoter of human E-cadherin. A series of experimental results show that Snail plays a role in the regulation and expression of E- cadherin as well as cell phenotypes. For example, transfection of antisense Snail RNA was found to restore E-cadherin expression in a pancreatic tumor cell line (Batlle et al. 2000). Over-expression of Snail in Madin-Darby canine kidney (MDCK) cells resulted in loss of E-cadherin and induction of an invasive phenotype. It has also been shown that 29 tumors induced in nude mice were invasive and that these invasive tumors showed a complete lack of E-cadherin expression (Cano et al. 2000). The transcription repressors involved in E-cadherin regulation appear to be cell-context dependent. Hajra et. al. showed that Snail and the closely related protein, Slug, could repress the expression of E- cadherin when transfected into human breast cancer cell lines, and that expression of Slug, but not Snail, was closely correlated with repression of the E-cadherin gene in vivo (Hajra et al. 2002). These authors suggested that Slug is likely to function as an E-cadherin repressor in the progression of breast cancer.  1.3.4.4. Disruption of the E-cadherin-catenin complex An alternative mechanism for inactivating E-cadherin function in tumor cells is to disrupt the connection between cadherin and cytoskeleton. For example, mutations in β- catenin that disrupt its binding to α-catenin result in a non-adhesive phenotype. In addition to mutations that disrupt the connection of E-cadherin to the cytoskeleton, the adhesive strength of E-cadherin can be altered during tumorigenesis by posttranslational modification.  E-cadherin has a number of serines and threonines within the β-catenin binding domain that are putative phosphorylation sites for casein kinase I, II and glycogen synthase kinase-3β phosphorylation. The phosphorylation of these sites serves to modulate the affinity of E-cadherin for β-catenin and thus determines the strength of the resulting cell-cell interactions. Serine/threonine phosphorylation of β-catenin may also regulate its affinity for α-catenin, which would impact cell adhesion by modulating the 30 association of the cadherin/catenin complex with the cytoskeleton (Bek et al. 2002). It has also been shown that Src-transformed epithelial cells display decreased cell-cell adhesion (Daniel et al. 1997). β-catenin, plakoglobin, and p120 catenin are phosphorylated on tyrosine in Src-transformed epithelial cells, resulting in the modulation of cadherin/catenin complex formation in the cells (Ozawa et al. 2001).  1.3.5. Expression of E-cadherin in ovarian cancer Epithelial ovarian carcinomas are the most common and lethal of all gynecological malignancies. These tumors arise from ovarian surface epithelium (OSE) which is a single layer of simple epithelial cells that covers the surface of the ovary. Once an ovarian epithelial cell undergoes transformation, it detaches easily from the underlying basement membrane and can metastasize through the peritoneal cavity, carried by the flow of peritoneal fluids. In ovarian cancer, E-cadherin expression in the cancer cells floating in ascites and at metastatic sites is lower than in the primary ovarian tumor. Moreover, ovarian cancer cells with low E-cadherin expression are more invasive (Veatch et al. 1994), and the absence of E-cadherin expression in ovarian cancers predicts poor patient survival when compared with ovarian tumors that express E-cadherin (Maines-Bandiera et al. 1997).  31 1.4. Hypotheses and Aims Considerable evidence implicates a mitogenic action of estrogen in early ovarian carcinogenesis. In contrast, its influence in the metastatic cascade of ovarian tumor cells remains obscure. The hypothesis of this study is: Estrogen induces ovarian tumorigenesis through increased metastatic activity of the cells which is a major characteristic of epithelial-mesenchymal transition. Specific objectives 1. To examine the effect of estrogen on ovarian cancer cell metastasis, particularly in terms of cell morphological changes and migration. 2. To characterize the role of estrogen in the regulation of E-cadherin in ovarian cancer cells. 3. To elucidate the regulation mechanism of estrogen in terms of E-cadherin expression. 4. To investigate the contribution of estrogen receptor subtypes in E2-induced EMT in ovarian cancer. 5. To perform expression profiling of estrogen-responsive genes 32 2. MATERIALS AND METHODS 2.1. Cell culture Human ovarian adenocarcinoma cell line BG-1 was kindly provided by Dr. K.S. Korach (National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC)(Geisinger et al. 1989). The ovarian adenocarcinoma cell lines, A2780, Caov-3, and OVCAR-3 and breast cancer cell line, MCF-7 were obtained from American Type Culture Collection (Manassas, VA). OV167 and OV266 were kindly provided by Dr. K.R. Kalli (Mayo Clinic College of Medicine, Rochester, MN) The cells were maintained in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin (Life Technologies, Inc., Rockville, MD) in a humidified atmosphere of 5% CO2 at 37°C.  2.2. Treatments Cells were depleted of endogenous steroids by changing the medium to phenol red- free DMEM/F12 containing 10% charcoal-dextran stripped FBS (HyClone Laboratories, Inc., Logan, UT) 48 h before treatment. Cells were then incubated in fresh medium with 17β-estradiol (E2) (Sigma, St. Louis, MO), ICI 182,780 (ICI; estrogen receptor antagonist) (Tocris, Ballwin, MO), alone or in combination for indicated times. In some cases, cells were treated with either ERα agonist propylpyrazole-triol (PPT) or ERβ agonist diarylpropionitrile (DPN) for 48 h (Tocris). Control cultures received the same amount of vehicle (0.1% ethanol). To study mRNA stability, cells were treated with ethanol or E2 disolved in ethanol for 1 h. Actinomycin D (5 µg/ml) (Sigma) was then 33 added to the cultures, and total RNA was prepared at times indicated for up to 8 h. All treatments were performed in duplicate or triplicate in each experiment.  2.3. [3H]-Thymidine incorporation assay [3H]-Thymidine incorporation assay was performed to analyze the effect of E2 on DNA synthesis in ovarian cancer cells. The cells were plated in 24-well plates at 2 X 104 cells/well in 0.5 ml phenol red free DMEM/F12 supplemented with 10 % FBS and antibiotics, and incubated for 24 h. The cells were washed with PBS and cultured in the phenol red free DMEM/F12 with 5% of charcoal dextran treated FBS for 48 h. Then, the cells were incubated with different concentrations of E2 for 24 h. One μCi of [3H]thymidine (5.0 Ci/mmol) also was added to the medium at the same time. At the end of the incubation period, the culture medium was removed and the cells were washed three times with cold PBS, followed by precipitation with 0.5 ml 10% trichloroacetic acid for 20 min at 4 °C. The precipitate was washed in methanol twice and solubilized in 0.5 ml 0.1 N sodium hydroxide, and the incorporated radioactivity was measured in a liquid scintillation counter.  2.4. Microarray analysis BG-1 cells were plated in 100mm cell culture dishes at 1 X 106 cells/dish in phenol red free DMEM/F12 supplemented with 10 % FBS and antibiotics, and incubated for 24 h. The cells were washed with PBS and cultured in the phenol red free DMEM/F12 with 2% of charcoal dextran treated FBS for 48 h. Then, the cells were incubated with 10-7M 34 of E2 for 1, 8, and 24 h. Extraction of RNA was performed with Rneasy mini kit (Qiagen Ltd, Germantwon, MD).  2.4.1. cDNA synthesis and Cy3/Cy5 labelling Twenty μg of total RNA was dissolved in 21.5μl of diethylpyrocarbonate (DEPC)- treated water, heated at 65 °C for 3 minutes, and immediately chilled on ice. Eight μl of 5 X First strand buffer, 4.0 μl of 0.1 M dithiothreitol (DTT), 1.5 μl of 100 μM Anchor T primer, 3.0 μl of 20 μM dATP, dCTP, and dGTP (6.7 μM each), and 1.0 μl of 2 μM dTTP were serially provided to the RNA. For the control RNAs, 1.0 μl of 1 μM Cy3 dUTP was added in the reaction. For the E2 treatment group, Cy5 dUTP was used.   The reaction was incubated at 65 °C for 5 min, then 42 °C for 5 min. Two μl Superscript II and 1 μl RNasin were added to the reaction and incubated at 42 °C for 2 h. The RNA was degraded by adding 8 μl of 1 M NaOH followed by 15 min incubation at 65°C. The sample was neutralized by addition of 8 μl of 1 M HCl and 4 μl of 1 M Tris-Cl (pH 7.5).  2.4.2. Purification of Cy3/Cy5 labelled cDNA PCR product was purified with PCR purification kit (Quigen Ltd.) as per the manufacturer’s instruction. Briefly, 1 volume of the PCR product was mixed with 5 volumes of Buffer PB. This mixture was placed a QIAquick spin column in a 2 ml collection tube. After centrifugation for 30 sec, 0.75 ml of Buffer PE was added to the QIAquick column. After additional centrifugation for 30 sec, 100 μl of Buffer EB was added to the column to elute DNA. This volume was centrifuged for 1 min. 35 The purified cDNAs with Cy-3 and Cy-5 then were mixed with 1.5 μl of labeled GFP and 1 μl of glycogen. The probe was precipitated at -20 °C for at least 1 h with 1/10 volume of 3 M sodium acetate and 2.5 volumes of 95 % ethanol. Purified probe was obtained via centrifugation for 10 min, washing with 70 % ethanol, and finally resuspending in 80 μl of hybridization solution containing 40 μl of formamide, 20 μl of 20 X SSC, 0.8 μl of 10 % SDS, 8 μl of 2 mg/ml BSA, 8 μl of 5 mg/ml yeast tRNA and 3.2 μl of 10 mg/ml salmon testes DNA.  2.4.3. Hybridization, scanning and analysis Eighty μl of purified cDNA mixture was heated at 95 °C for 3 min, and kept at 65 °C until use. Prior to hybridization, the array slide was incubated with prehybridization buffer containing 5 X SSC, 0.1 % SDS and 1 % BSA at 48 °C for 45 min. The slide was washed by dipping in deionized water for 30 sec and dipped in isopropanol for 10 sec and spun-dried in a centrifuge for 2 min. To hybridize probe with the array slide, probe was added to the denatured array slide and a cover slip was placed on top. This slide was transferred to a hybridization chamber and incubated overnight at 42 °C. The slide was washed twice with wash buffer containing 1X SSC and 0.2 % SDS at 42 °C and then twice with 0.1 X SSC at RT, before being spun dried for 5 min. This microarray slide was scanned as described by the scanner’s manufacturer. Microarray results were categorized into several functional groups related to apoptosis, cell cycle, growth factor/hormone, and signal transduction. 36 2.5. Transfection of siRNA Snail and Slug specific siRNA oligos (pre-designated siRNA) were purchased from QIAGEN (Valencia, CA). Sense sequences of Snail #1: 5’- GCGAGCUGCAGGACUCUAA; Snail #2: 5’-GGUGUGACUAACUAUGCAA; Slug #1: 5’-GGACCACAGUGGCUCAGAA; and Slug #2: 5’- CUCCGAAGCCAAAUGACAA. ERα and ERβ specific siRNAs were purchased from Invitrogen (Burlington, ON, Canada). Sense sequence of ERα: 5’- GGGCUCUACUUCAUCGCAU and ERβ: 5’-GCAGACCACAAGCCCAAAU. Cells cultured in 6-well plates were transfected with siRNA duplexes using Lipofectamine 2000 (Invitrogen). Nonspecific siRNA duplexes were used as negative controls (QIAGEN). Cells were treated for 48 h to allow maximum knockdown.  2.6. Transient over-expression of ERα and ERβ Full-length human ERα (pCMV5-ERα) and ERβ (pRST7-ERβ) expression plasmids were kindly provided by Dr. B. S. Katzenellenbogen (Department of Molecular and Integrative Physiology, University of Illinois at Urbana Champaign, IL) and Dr. D. P. McDonnell (Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, NC), respectively. Transfection was performed by Lipofectamine 2000 (Invitrogen) as per the manufacturer’s instruction. Optimal DNA amounts for over- expression were determined by Western blot analysis of ERs expression levels, compared to the endogenous levels in mock-transfected cells without DNA. The optimal plasmid amounts were found to be 1 μg for pCMV5-ERα and 500ng for pRST7-ERβ.  37 2.7. Reverse transcription and real-time quantitative PCR Total RNA was isolated using TRIzol reagent (Invitrogen). Single-stranded cDNA was synthesized from 2 µg of total RNA (Amersham Bioscience, Quebec, Canada). Quantitative real-time polymerase chain reaction was carried out using the ABI Prism 7300 Sequence Detector System (Applied Biosystems, Foster City, CA) and SYBR green PCR master mix (Applied Biosystem). Gene-specific primers were designed using Applied Biosystems' Primer Express 3.0 software. The following oligonucleotides (Invitrogen) were used for PCR amplification: E-cadherin, sense, 5'- ACAGCCCCGCCTTATGATT and antisense, 5'-TCGGAACCGCTTCCTTCA; Snail, sense, 5'-CCCCAATCGGAAGCCTAACT and antisense, 5'- GCTGGAAGGTAAACTCTGGATTAGA; and Slug, sense, 5'- TTCGGACCCACACATTACCT and antisense, 5'-GCAGTGAGGGCAAGAAAAAG. The relative mRNA level was normalized by GAPDH levels with the following specific primers: 5’-CCTCCCGCTTCGCTCTCT (forward), 5’-TGGCGACGCAAAAGAAGAT (reverse). The thermal profile consisted of 2 min at 50°C, 10 min at 95°C, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. The melting temperature profiles of amplicons were determined to show the specificity of amplification. Data were calculated as fold expression relative to the average of the vehicle control group.  2.8. Immunoblot analysis Cells were harvested in lysis buffer (1% triton-X, 0.1% SDS, 0.5% sodium deoxycholate) with protease inhibitors cocktail (Sigma) and protein concentrations determined by the Bradford protein assay (Bio-Rad, Hercules, CA). Twenty μg of protein 38 were subjected to SDS-PAGE followed by electrotransfer onto nitrocellulose membrane. Membranes were incubated overnight at 4°C with mouse monoclonal human E-cadherin antibody (1:2000) (BD Transduction Laboratories, Heidelberg, Germany), human Snail antibody (1:1000) (Abgent, San Diego, CA), human Slug antibody (1:1000) (Abgent), human Twist antibody (1:1000) (Abgent), human ERα antibody (1:1000) and ERβ antibody (1:1000) (Santa Cruz Biotechnology). Blots were reprobed with anti-β-actin antibody (1:2000) (Santa Cruz Biotechnology) to confirm equal loading. The immunocomplex was detected with appropriate horseradish peroxidase-conjugated secondary antibodies (Amersham Biosciences) and visualized using enhanced chemiluminescence detection system (ECL) (Amersham Biosciences). All blots were repeated in at least three different experiments. Quantitative densitometry was performed using Scion Image software (Scion Corp., Frederick, MD).  2.9. Reporter gene assay Luciferase reporter vector containing human E-cadherin promoter (–178 to +66) was kindly provided by Dr. Yoshito Ihara (Nagasaki University, Japan) (Hayashida et al. 2006). Plasmid containing the human Slug promoter (− 3371/+1) was a kind gift of Dr. Kaname Kawajiri (Research Institute for Clinical Oncology, Saitama, Japan) (Ikuta et al. 2006). The human Snail promoter reporter plasmid (-869/+59) was a generous gift of Dr. Antonio Garcia de Herreros (Universitat Pompeu Fabra, Barcelona, Spain) (Barbera et al. 2004). All plasmids were cloned in the promoterless pGL3-Basic vector. Cells were transfected with 1 µg of each firefly luciferase reporter construct together with 0.5 µg pSV-βGal plasmid as normalization reference for transfection efficiency. Transfections 39 were performed with Lipofectamine 2000 (Invitrogen). Six h after transfection, cells were treated with E2, ICI or vehicle. Where indicated, cells were also co-transfected with Snail or Slug siRNA. Cells transfected with promoterless vector (pGL3-Basic) were used as control for background luciferase activity. Cells were then harvested in reporter lysis buffer (Promega, Madison, WI) at designated time points. Luciferase activity and β- galactosidase enzyme activity were determined with luciferase reagent and the β- galactosidase enzyme assay system (Promega). Luciferase units were calculated as luciferase activity/β-galactosidase activity and are presented as the mean ± SD of three individual experiments with triplication. The fold change was calculated by comparison with the promoterless pGL3-Basic.  2.10. Scratch assay Cells were grown to confluence and formed a monolayer covering the surface of the entire plate. Cells were kept in medium with appropriate treatments for 24 h before scratching. A linear scratch (about 0.7 mm wide) was made gently with a sterile pipette tip across the diameter of the well and rinsed with PBS to remove debris. The cells were then received fresh media with the same treatments as before. For each well, at least 6 pictures were taken with microscope at a 10x magnification at 0, 4, and 24 h after scratch. The percentage of nonrecovered wound area was calculated by dividing the nonrecovered area after treatments by the initial wound area at time zero.  40 2.11. Statistics All assays were repeated at least three times in duplicate or triplicate and the graphic data were presented as the mean ± SD. Statistical analysis was performed where appropriate using the Student's t test or ANOVA followed by Tukey’s post hoc test (GraphPad Software, San Diego, CA). Differences with p < 0.05 were considered to be statistically significant. 41 3. RESULTS 3.1. E2 stimulates DNA synthesis of BG-1 cells The BG-1 cell line was chosen as the cell model in this study because it is estrogen responsive. To confirm the responsiveness of the cells to E2, the effect of E2 on DNA synthesis was determined. This assay was performed because previous data has suggested an increase in DNA amounts in the cells after E2 exposure (Bardin et al. 2004). BG-1 cells were treated with increasing dose of E2 (10-15 to 10-7M) for 24 h, which showed that DNA synthesis was not affected by the lowest concentrations of E2 (10-15 and 10-13M). However, the stimulatory effect became clear (Fig. 3) at doses of 10-11, 10-9, and 10-7 M of E2 (P < 0.05).  To examine the involvement of ER, the [3H]-thymidine incorporation assay was performed again in the presence of pure ER antagonist ICI 182,780 or siRNA targeting ERα. As shown in the upper panel of Fig. 4, E2-induced DNA synthesis was blocked by ICI cotreatment. siRNA for ERα also blocked the effect of E2 (lower panel of Fig. 4). From these observations, it could be concluded that E2 increases DNA synthesis in BG-1 cells, and that this is mediated by ERα specifically. 42 Cont 10-15 10-13 10-11 10-9 10-7 0 50 100 150 200 E2 [3 H ]- Th ym id in e in co rp or at io n (%  c on tr ol ) *** Fig. 3. E2 increases DNA synthesis in BG-1 cells. BG-1 cells were treated with vehicle (Cont) or different concentration of E2 (10-15 to 10-7M) for 24 h. DNA synthesis was measured using the [3H]-thymidine incorporation assay. Values are the mean ± SD for three individual experiments, each with quadruplicate samples. * P<0.05 compared with control. M 43 050 100 150 200 Cont E2 [3 H ]- Th ym id in e in co rp or at io n (%  c on tr ol ) ** NS siRNA ERα siRNA Fig. 4. ER mediates E2 induced DNA synthesis in BG-1 cells. (Upper panel) BG-1 cells were treated with either vehicle (Cont), 10-7 M E2 or 10-7 M ICI 182,780 (ICI) alone or E2 plus ICI for 24 h. (Lower panel) BG-1 cells were treated with vehicle (Cont) or 10-7M of E2 after transfection of siRNA for ERα or non- specific siRNA (NS). DNA synthesis was measured using the [3H]-thymidine incorporation assay. Values are the mean ± SD for three individual experiments, each with quadruplicate samples. * P<0.05 compared with control. Cont E2(10-7M) ICI(10-7M) E2+ICI 0 50 100 150 200 [3 H ]- Th ym id in e in co rp or at io n (%  c on tr ol ) * 44 3.2. E2 stimulates EMT and migration of BG-1 cells Next, the functional role of E2 in EMT of BG-1 cells was elucidated. Cell morphology was observed constantly after E2 treatment under a light microscope. BG-1 cells underwent apparent changes in morphology compatible with EMT after 48 h of E2 (10–7 M) treatment (Fig. 5). The phenotypic changes observed included conversion from cuboidal, epithelial morphology to spindle-shaped morphology, increased intercellular separation, scattered and increased formation of pseudopodia.  Epithelial cells that undergo EMT are characterized by increased motility; therefore we asked whether E2 could increase migratory abilities in BG-1 by the wound healing assay. E2 was administered 24 h before the wounds were generated, and the rate of cell migration was measured at 0, 4 and 24 h after treatment. The wounded area of BG-1 cell monolayers healed slowly in vehicle-treated cells (Fig. 6). In contrast, in the presence of E2, the closure of the wounded gap was significantly accelerated at 24 h (Fig. 6). The percentage of the cell-free area at the indicated time points compared with that at time 0 was determined (Fig. 6, lower panel). In E2-treated cells, the cell-free area was decreased by over 2-fold compared with control cells at 24 h (P < 0.05). During the incubation period, cells moved forward and closed the gap independently of cell division. There was no significant increase in cell growth within 48 h under the same treatment conditions as revealed by direct cell counting (Fig. 7). This was also consistent with previous studies showing insignificant increases in cell number until 5 days of E2 treatment (Giacalone et al. 2003; Stopper et al. 2003). These data indicate that E2 promotes EMT which leads to increased migration of BG-1 cells. 45 Cont E2 Fig. 5. BG-1 cells are induced by E2 to undergo EMT. BG-1 cells were treated with vehicle (Cont) or 10-7 M E2 for 48 h. Morphologic changes were observed by phase-contrast microscope and representative photographs of at least three independent experiments are shown. Original magnification, x200. 46 0 4 24 0.00 0.25 0.50 0.75 1.00 1.25 Cont E2 Cont E2 0 h 4 h 24 h h * U nc ov er ed  a re a (R el at iv e to  C on t a t 0 h) Fig. 6. Migratory activity of BG-1 cells is increased by E2. Confluent monolayers of BG-1 cells were wounded with a uniform scratch, washed to remove cell debris, and cultured for indicated times in the presence of vehicle (Cont) or 10-7 M E2. Images of cell cultures were captured at 0, 4 and 24 h after scratching, representative pictures are shown in the upper panel. The arrow indicates wound edge. The amount of wound repair was expressed as uncovered area at indicated time compared with initial uncovered area of vehicle-treated control at time 0 (lower panel). Values are the mean ± SD of three separate experiments. *P<0.05 compared with control. 47 Fig. 7. Effect of E2 on the growth of BG-1 cells in vitro. For the proliferation assay, BG-1 cells were seeded at the density of 2x106 cells per dish in the presence of phenol red-free medium supplemented with 5% charcoal dextran treated FBS. Cells were collected and counted under the microscope with hematocytometer at 24 h and 48 h. Values are the mean ± SD for three individual experiments, each in triplicate. 0 24 48 0 1 2 3 4 5 6 Cont E2 h C el l n um be r (x  1 06 / d is h) 48 3.3. E2 suppresses E-cadherin expression in a dose- and time-dependent manner Decrease of E-cadherin, a widely accepted characteristic associated with EMT, is often correlated to a higher mobility of tumor cells (Hirohashi et al. 2003). Given the role of E2 in controlling EMT as demonstrated in Fig.5, the effect of E2 on the expression of this epithelial marker was investigated by Western blot analysis. Dose-response studies showed that lower concentrations of E2 (10-11 M to 10-15 M) did not affect E-cadherin expression. The down-regulation effect became apparent with doses of 10-9 M and 10-7 M of E2 and was maximal at 10–7 M (Fig. 8) (P < 0.05). Densitometric analyses of three independent experiments confirmed this finding (Fig. 8. lower panel). Cells were also treated with 10-7 M E2 for different time courses. As shown in a representative blot in Fig. 9, protein levels of E-cadherin were significantly decreased after E2 treatment. Maximal inhibition was seen at 48 h (a 70 % decline) (P < 0.05), and the effect was still detectable after 72 h.  To see whether ER activation was involved, the effect of E2 was examined in the presence of the pure ER antagonist, ICI 182,780 (ICI). As shown in Fig. 9, the down- regulation was prevented by 10-7 M ICI. These results suggest ER as mediator of the suppression effects on E-cadherin by E2. 49 Cont 10-7 10-9 10-11 10-13 10-15 M E-Cad β-actin Cont 10-7 10-9 10-11 10-13 10-15 0.00 0.25 0.50 0.75 1.00 1.25 * * E- ca d ex pr es si on  re la tiv e to  C on t E2 M Fig. 8. E2 down-regulates E-cadherin expression. BG-1 cells were treated with vehicle (Cont) or increasing concentrations of E2 (10-15 to 10-7 M) for 48 h. Whole cell lysates were prepared and E-cadherin protein (E-cad) was detected by Western blot. β-actin was used as a loading control. The immunoblot shown is representative of three independent experiments. Cumulative results for quantitative densitometry of the three experiments are shown in the lower panel. Mean ± SD values are depicted for protein abundance expressed as percentage in control cells. *P<0.05 compared with control. 50 E2 IC I E2 +I C I 24 h 48 h 72 h C on t E2 IC I E2 +I C I C on t E2 IC I E2 +I C I C on t 0.0 0.5 1.0 1.5 2.0 + + + + E-Cad E- ca d ex pr es si on  re la tiv e to  C on t 24 h 48 h 72 h β-actin Fig. 9. Down-regulation of E-cadherin by E2 is ER-mediated. BG-1 cells were treated with vehicle (Cont), 10-7 M E2 or 10-7 M ICI 182,780 (ICI) alone or E2 plus ICI for 24, 48, and 72 h. Whole cell lysates were prepared and E- cadherin protein (E-cad) was detected by Western blot. β-actin was used as a loading control. The immunoblot shown is representative of three independent experiments. Cumulative results for quantitative densitometry of the three experiments are shown in the lower panels. Mean ± SD values are depicted for protein abundance expressed as percentage in control cells. +P<0.05 compared with the corresponding time-matched vehicle control. E2 IC I E2 +I CI Co ntE2 IC I E2 +I CI Co nt E2 IC I E2 +I CI Co nt 51 3.4. Transcriptional repression of E-cadherin by E2 To assess whether the reduction in E-cadherin expression was because of transcriptional regulation, E-cadherin mRNA levels were evaluated by real-time PCR with gene-specific primers after E2 (10–7 M) treatment. E-cadherin mRNA expression was decreased by approximately 50 % as early as 12 h upon E2 administration, with sustained decreases observed thereafter (Fig. 10) (P < 0.05). This suggests that E- cadherin expression is suppressed in BG-1 cells at the transcriptional level.  To confirm this, cells were transfected with a reporter construct under the control of the E-cadherin proximal promoter, and treated with E2 for up to 72 h. Concurrent with the loss of mRNA expression, treatment with E2 inhibited E-cadherin promoter activity (Fig. 11). The promoter activity was significantly decreased by 25 % after 24 h. This inhibitory effect persisted after 48 to 72 h, producing up to 50 % decrease (P < 0.05). ICI was able to overcome this inhibitory effect because E2 and ICI in combination increased the transcription activity compared with E2-treated cells (Fig. 11). 52 0 12 24 48 72 0.00 0.25 0.50 0.75 1.00 1.25 Cont E2 E- C ad  m R N A  e xp re ss io n re la tiv e to  C on t a t 0 h h * * * * Fig. 10. Expression of E-cadherin mRNA is down-regulated by E2. BG-1 cells were cultured in the presence of vehicle (Cont) or 10-7 M E2 for various time periods indicated. Total RNA was isolated and used for real-time PCR analysis of E-cadherin mRNA expression with gene-specific primers. GAPDH primers were used to normalize data, and results are expressed as fold change relative to time 0. The data are shown as mean ± SD of three repeated experiments. *P<0.05 compared with the corresponding time-matched vehicle control. 53 24 48 72 0.00 0.25 0.50 0.75 1.00 1.25 Cont E2 ICI E2+ICI R el at iv e E- C ad pr om ot er  a ct iv ity h * * * Fig. 11. E2 reduces E-cadherin synthesis through transcriptional repression. BG-1 cells were transfected with 1 µg reporter construct of E-cadherin promoter. All cells were cotransfected with 0.5 µg pSV-βGal as an internal control for transcription efficiency. Eight h after transfection, cells were then treated with vehicle (Cont), 10-7 M E2 or 10-7 M ICI 182,780 (ICI) alone or E2 plus ICI for additional 24, 48 or 72 h. The luciferase activities were calculated relative to the promoterless vector (pGL3-Basic) and expressed as fold change relative to vehicle control at corresponding time point. The data are shown as mean ± SD of three repeated experiments. *P<0.05 compared with the corresponding time-matched vehicle control. 54 3.5. E2 enhances expression and promoter activities of Snail and Slug Transcription of E-cadherin is known to be regulated by the Snail and Slug repressors. To elucidate the mechanisms through which E2 suppresses E-cadherin, the protein levels of Snail and Slug after E2 treatment were investigated by Western blot. As shown in Fig. 12, both Snail and Slug were significantly elevated in a dose-dependent manner after 8 h of E2 treatment (P < 0.05). In comparison, analysis of Twist which is another known E- cadherin repressor (Yang et al. 2004) showed no change in protein level with the same treatment (Fig. 12)  The time-course effects of E2 on Snail and Slug mRNA levels were determined by real-time PCR as shown in Fig. 13. E2 caused a marked induction of Snail mRNA at 1 h (about 2-fold increase), with significantly increased mRNA levels being maintained at 1-4 h. Similarly, E2 treatment elevated Slug mRNA with a maximal stimulation reached in 1 h. However, the induction was transient and the level of Slug mRNA returned to basal level at 4 h.  Having established a correlation between E2 and Snail or Slug expression, I asked whether E2 stabilized their mRNA transcripts in an actinomycin D chase experiment. The apparent half-lives of both Snail and Slug mRNA transcripts were approximately 1 h in control cells and were not changed upon E2 treatment (Fig. 14). Thus, the induction of Snail and Slug in response to E2 was not due to an effect on message stability.  55 Next, whether E2 can regulate the transcription of Snail or Slug was investigated. To this end, I performed luciferase promoter assays and examined the ability of E2 to transactivate luciferase reporter plasmids under the control of the human Snail or Slug promoters. Figure 15 showed that both Snail and Slug promoters were strongly activated by E2. These activations were already evident after 2 h of E2 treatment (P < 0.05). Induction of the activities peaked at 4 h (2-3 fold) and started to decrease at 8 h. 56 Cont 10-7 10-9 10-11 10-13 10-15 0.0 0.5 1.0 1.5 2.0 2.5 Snail Slug Twist Cont 10-7 10-9 10-11 10-13 10-15 M β-actin β-actin Snail Slug Ex pr es si on  le ve l re la tiv e to  C on t M * * * * * Fig. 12. Effect of E2 on the expression of Snail, Slug, and Twist. BG-1 cells were treated with vehicle (Cont) or increasing concentrations of E2 (10- 15 to 10-7 M) for 8 h. Whole cell lysates were prepared and Snail, Slug and Twist were detected by Western blot. β-actin was used as a loading control. The immunoblot shown is representative of three independent experiments. Cumulative results for quantitative densitometry of the three experiments are shown in the lower panel. The data are shown as mean ± SD of three repeated experiments.*P<0.05 compared with control. Twist β-actin 57 0 1 2 4 8 12 0.0 0.5 1.0 1.5 2.0 2.5 Cont E2 0 1 2 4 8 12 0.0 0.5 1.0 1.5 2.0 2.5 Cont E2 Snail Slug Sn ai l m R N A  e xp re ss io n re la tiv e to  C on t a t 0 h Sl ug  m R N A  e xp re ss io n re la tiv e to  C on t a t 0 h h h + + + + + + Fig. 13. E2 regulates mRNA expression of Snail and Slug. BG-1 cells were cultured in the presence of vehicle (Cont) or 10-7 M E2 for various time periods indicated and harvested for RNA extraction. The data are shown as mean ± SD of three repeated experiments. +P<0.05 compared with the corresponding time- matched vehicle control. 58 0 1 2 4 6 8 0.00 0.25 0.50 0.75 1.00 1.25 Cont E2 0 1 2 4 6 8 0.00 0.25 0.50 0.75 1.00 1.25 Cont E2 R el at iv e Sn ai l m R N A  le ve l R el at iv e Sl ug m R N A  le ve l h h Snail Slug Fig. 14. Effect of E2 on Snail and Slug mRNA stabilities. Cells were treated with 10-7 M E2 or vehicle (Cont) for 1 h. Then, at time ‘0 h’, the transcription inhibitor actinomycin D (5 μg/ml) was added to the medium and cells were harvested at indicated time points. Total RNA was isolated and used for real-time PCR analysis of Snail or Slug mRNA levels with gene-specific primers. GAPDH primers were used to normalize data, and results are expressed as fold change relative to time 0. The data are shown as mean ± SD of three repeated experiments. 59 1 2 4 8 12 0 1 2 3 4 Cont E2 1 2 4 8 12 0 1 2 3 4 Cont E2 R el at iv e Sn ai l pr om ot er  a ct iv ity R el at iv e Sl ug  Pr om ot er  a ct iv ity Snail Slug h h + + + + Fig. 15. E2 regulates gene promoter activities of Snail and Slug. BG-1 cells were transfected with human Snail or Slug promoter-reporter gene constructs and pSV-βGal for normalization. The luciferase activities were determined in cell lysates 2 to 8 h after initiation of E2 exposure. The luciferase activities were calculated relative to the promoterless vector (pGL3-Basic) and expressed as fold change relative to vehicle control at corresponding time point. The data are shown as mean ± SD of three repeated experiments. +P<0.05 compared with the corresponding time-matched vehicle control. 60 3.6. Snail and Slug are responsible for E2-induced repression of E-cadherin and cell migration The ability of E2 to increase Snail and Slug expression suggests that these two repressors are involved in the transcriptional repression of E-cadherin in BG-1 cells. To confirm this, a siRNA approach was used to knockdown Snail and Slug expressions in BG-1 cells. Depletion of endogenous Snail and Slug with siRNAs (sequence #1) was verified by Western blot (Fig. 16). We also showed that knockdown of Snail or Slug significantly interrupted the E2-mediated down-regulation of E-cadherin (Fig. 17), whereas a non-specific siRNA had no observable effect. Another set of siRNA with different sequences to Snail and Slug (sequence #2) was used to rule out off-target effects and the same results were obtained (Fig. 18 & 19). Concomitantly, suppression of E- cadherin promoter activity by E2 was significantly abolished by transfection with Snail or Slug siRNA, but not with non-specific siRNA (Fig. 20).  To further investigate the potential contribution of Snail and Slug in E2-induced cell migration, a wound healing assay was performed with their corresponding siRNAs. As shown in Fig. 21, cells treated with E2 efficiently migrated into the wound compared with control BG-1 cells or cells treated with control siRNA. In contrast, cells transfected with Snail or Slug siRNA reversed E2-induced migration into the wound. Together these findings indicate that Snail and Slug play pivotal roles in mediating EMT induction by E2. 61 Snail Slug NS  s iR NA Sn ai l s iR NA #1 Sl ug  s iR NA #1 β-actin Fig. 16. Expression of Snail and Slug after transfection with siRNAs in BG-1 cells. BG-1 cells were transfected with either 250 nM of Snail siRNA (sequence #1), Slug siRNA (sequence #1) or non-specific siRNA (NS siRNA) for 48 h. Efficacy of the siRNAs was determined by Western blot analysis. Cumulative results for quantitative densitometry of the three experiments are shown in the right panel. The data are shown as mean ± SD of three repeated experiments.*P<0.05 compared with control. 0.0 0.5 1.0 1.5 Snail Slug NS siRNA Snail siRNA Slug siRNA * * Sn ai l/S lu g ex pr es si on  re la tiv e to  C on t 62 NS  s iR NA Sn ai l s iR NA #1 Sl ug  s iR NA #1 Cont β-actin E-Cad E2 Cont E2Cont Cont E2E2 Fig. 17. Snail and Slug mediate the regulation of E-cadherin by E2. Eight h after transfection with the siRNAs, BG-1 cells were treated with vehicle (Cont) or 10-7 M E2 for an additional 48 h. Whole cell lysates were prepared and E- cadherin protein (E-cad) was detected by Western blot. β-actin was used as a loading control. Cumulative results for quantitative densitometry of the three experiments are shown in the lower panel. The data are shown as mean ± SD of three repeated experiments.*P<0.05 compared with control. 0.00 0.25 0.50 0.75 1.00 1.25 Cont E2 Cont E2Cont Cont E2E2 NS siRNA Snail siRNA Slug siRNA E- ca d ex pr es si on  re la tiv e to  C on t * * 63 Snail Slug NS  s iR NA Sn ai l s iR NA #2 Sl ug  s iR NA #2 β-actin Fig. 18. Expression of Snail and Slug after transfection with additional siRNAs. Additional siRNAs specific to Snail and Slug (sequence #2) were used to rule out off-target effects. BG-1 cells were transfected with either 250 nM of Snail siRNA, Slug siRNA or non-specific siRNA (NS siRNA) for 48 h. Efficacy of the siRNAs was determined by Western blot analysis. β-actin was used as a loading control. 64 NS  s iR NA Sn ai l s iR NA #2 Sl ug  s iR NA #2 Cont β-actin E-Cad E2 Cont E2Cont Cont E2E2 Fig. 19. Snail and Slug mediate the regulation of E-cadherin by E2. Additional siRNAs specific to Snail and Slug (sequence #2) were used to rule out off-target effects. 8 h after transfection with the siRNAs, BG-1 cells were treated with vehicle (Cont) or 10-7 M E2 for an additional 48 h. Whole cell lysates were prepared and E-cadherin protein (E-cad) was detected by Western blot. β-actin was used as a loading control. 65 Cont E2 Cont E2 Cont E2 Cont E2 0.0 0.5 1.0 1.5 2.0 NS siRNA Snail siRNA #1 Slug siRNA #1 * *R el at iv e E- C ad pr om ot er  a ct iv ity Fig. 20. Snail and Slug regulate the promoter activity of E-cadherin by E2. BG-1 cells were transfected with the human E-cadherin promoter luciferase construct and pSV-βGal in combination with either one of the siRNAs. Eight h after transfection, cells were incubated with vehicle (Cont) or 10-7 M E2 for further 48 h. The luciferase activities were calculated relative to the promoterless vector (pGL3- Basic) and expressed as fold change relative to vehicle control. The data are shown as mean ± SD of three repeated experiments. *P<0.05 compared with control. 66 Cont E2 Cont E2 Cont E2 Cont E2 0.00 0.25 0.50 0.75 NS siRNA Snail siRNA #1 Slug siRNA #1 U nc ov er ed  a re a (R el at iv e to  C on t a t 0  h ) * * Fig. 21. Snail and Slug mediate migration of BG-1 cells by E2. A scratch-wound was made by scraping the monolayer 24 h after transfection of the siRNAs, and cells were incubated with medium containing vehicle (Cont) or 10-7 M E2. The scratch-wound closure was photographed after 24 h of cell migration. The amount of wound repair was expressed as uncovered area at indicated time compared with initial uncovered area of vehicle-treated control at time 0. Values are the mean ± SD of three separate experiments. *P<0.05 compared with control. 67 3.7. ERα, but not ERβ, mediates E2-induced EMT To dissect which ER subtype plays a dominant role in the pro-metastatic effect of E2, several approaches were used. First, BG-1 cells were treated with selective ER subtype ligands. The ERα-specific agonist, Propyl pyrazole triol (PPT), is 410-fold more potent in binding to ERα than ERβ (Sun et al. 1999), while diarylpropionitrile (DPN) is an ERβ agonist with more than 70-fold higher binding affinity for ERβ than ERα (Meyers et al. 2001). BG-1 cells were treated with either 10-7/10-8 M PPT or 10-7/10-8 M DPN for 48 h and harvested for E-cadherin detection by Western blot. PPT induced a comparable reduction in E-cadherin protein expression as E2 (Fig. 22). In contrast, DPN induced an approximately 50% increase in the expression. Second, this result was confirmed by abrogating endogenous ERs in the cells. The efficiency and the specificity of the siRNAs was confirmed by Western blot (Fig. 23). siRNA against ERα could significantly silence ERα expression, but with no effect on ERβ. Selective knockout of ERα dramatically reversed the down-regulation of E-cadherin expression by E2, but not by non-specific siRNA nor ERβ-specific siRNA. (Fig. 24). Also, E-cadherin promoter activity was increased after ERα knock-down although E2 was added (Fig. 25). As expected, depletion of ERα also significantly abolished the cell morphological changes and cell migration induced by E2 (Fig. 26 & 27).  As a third approach to address further the involvement of the ER subtypes, ERα in SKOV-3 cells was restored by transient transfection of full-length ERα (pCMV5-ERα). This ovarian cancer cell line is ERβ-positive but ERα-negative due to an inactivating mutation, which renders the cells insensitive to estrogen in terms of cell proliferation and 68 gene induction (Hua et al. 1995; Lau et al. 1999). Overexpression of ERα was confirmed by Western blot (Fig. 28) and the receptor functionality was confirmed by profound activation of an estrogen-responsive reporter (TK-ERE-Luc) in the presence of E2 (Fig. 29). Mock-transfected cells were used as control. Remarkably, untransfected or mock- transfected SKOV-3 cells showed significant elevation of E-cadherin protein expression in response to E2 (Fig. 30). However, E2 decreased E-cadherin expression with parallel increases in both Snail and Slug in cells overexpressing ERα (Fig. 30). In line with this, pronounced morphological changes were also observed (Fig. 31). These data are consistent with the results obtained from BG-1 cells (Fig. 22, 24-27) and further illustrate that the acquisition of the metastatic properties is ERα-dependent. 69 PPT DPN Cont 10-7 10-8 10-7 10-8 ME2 β-actin E-Cad 1.0    0.4    0.4 0.5    1.5    1.5 Fig. 22. Effect of PPT and DPN on the expression of E-cadherin. BG-1 cells were treated with vehicle (Cont), 10-7 M E2, 10-7/10-8 M DPN or PPT for 48 h. The experiments were done in triplicate and repeated thrice. *P<0.05 compared with control. Numerical values below each lane of the immunoblots represent quantification of the relative protein level by densitometry (normalized to β-actin protein level). 70 ERβ ERα β-actin NS siRNA ERβ siRNA ERα siRNAcont Fig. 23. Expression of estrogen receptor subtypes after transfection with siRNAs in BG-1 cells. BG-1 cells were transfected with either 250 nM of ERα siRNA, ERβ siRNA or non- specific siRNA (NS siRNA) for 48 h. Efficacy of the siRNAs was determined by Western blot analysis. 71 NS siRNA ERβ siRNA ERα siRNA Cont E2 Cont E2Cont Cont E2E2 β-actin E-Cad 1.0      0.3     1.0     0.4     1.0     0.4     1.0     1.1 Fig. 24. ERα is required for the regulation of E-cadherin expression. BG-1 cells were transfected with non-specific siRNA (NS siRNA), ERα siRNA or ERβ siRNA and subsequently treated with 10-7 M E2 for 48 h. E-cadherin protein (E- cad) and β-actin were detected by Western blot. The experiments were done in triplicate and repeated thrice. Numerical values below each lane of the immunoblots represent quantification of the relative protein level by densitometry (normalized to β-actin protein level). 72 Cont E2 Cont E2 Cont E2 0.00 0.25 0.50 0.75 1.00 1.25 NS siRNA ERα siRNA R el at iv e E- C ad pr om ot er  a ct iv ity * * Fig. 25. ERα is required for the regulation of promoter activity of E-cadherin. Cells were transfected with E-cadherin promoter construct and pSV-βGal in combination with the indicated siRNAs. Eight h after transfection, cells were incubated with vehicle (Cont) or 10-7 M E2 for further 48 h. The luciferase activities were calculated relative to the promoterless vector (pGL3-Basic) and expressed as fold change relative to vehicle control. The experiments were done in triplicate and repeated thrice. *P<0.05 compared with control. 73 NS siRNA ERα siRNA Cont E2 Untransfected Fig. 26. ERα is required for EMT induction by E2. Morphologic changes of cells were observed by phase-contrast microscope and representative photographs are shown. Original magnification, x200. 74 Cont E2 Cont E2 Cont E2 0.00 0.25 0.50 0.75 1.00 1.25 NS siRNA ERα siRNA * *Un co ve re d ar ea  (R el at iv e to  C on t a t 0  h ) Fig. 27. Knock-down of ERα blocks E2-induced cell migratory capacity. A scratch-wound was made by scraping the monolayer 24 h after siRNA transfection, and cells were incubated with medium containing vehicle (Cont) or 10-7 M E2. The scratch-wound closure was photographed after 24 h. The amount of wound repair was expressed as uncovered area compared with initial uncovered area of vehicle-treated control at time 0. Values are the mean ± SD of three separate experiments. The experiments were done in triplicate and repeated thrice. *P<0.05 compared with control. 75 ERβ ERα β-actin Cont      mock   pCMV5-ERα SKOV-3 BG-1 Fig. 28. Expression of estrogen receptor subtypes after ERα overexpression in SKOV-3 cells. SKOV-3 cells were transfected with ERα overexpression vector (pCMV5-ERα) or mock-transfected. Expression of each ER subtype was determined by Western blot. Lysate of BG-1 cells was included as reference. 76 Cont -7 -8 Cont -7 -8 0 1 2 3 4 pCMV5-ERα + - ER E lu ci fe ra se  a ct iv ity Fig. 29. ERE luciferase activity is increased by E2 in ERα overexpressed SKOV-3 cells. SKOV-3 cells cells were transfected with 1 μg ERE-luciferase reporter construct in the presence or absence of 1 μg of pCMV5-ERα.  All cells were cotransfected with 0.5 µg pSV-βGal as an internal control for transcription efficiency. 24 h after transfection, cells were then treated with vehicle (Cont), 10-7 and 10-8 M E2 for additional 24 h. The luciferase activities were expressed as fold change relative to vehicle control. The data are shown as mean ± SD of three repeated experiments. 77 β-actin E-Cad Cont E2 Cont Cont E2E2 Mock pCMV5-ERα Snail Slug β-actin Cont Cont E2 pCMV5-ERα 1.0    1.6    1.0     1.6    0.9     0.3 1.0     1.0 2.4 1.0     1.0 2.4 Fig. 30. Overexpression of ERα in SKOV-3 cells increases markers of EMT induction by E2. SKOV-3 cells were transfected with pCMV5-ERα or without plasmid DNA (mock) for 8 h and subsequently treated with 10-7 M E2 or vehicle (Cont) alone for another 48 h. E-cadherin (E-cad), Snail, Slug and β-actin were detected by Western blot. The experiments were done in triplicate and repeated thrice. Numerical values below each lane of the immunoblots represent quantification of the relative protein level by densitometry (normalized to β-actin protein level). 78 Cont E2 Mock pCMV5-ERα Untransfected Fig. 31. ERα is required for EMT induction by E2 in SKOV-3 cells. Morphological changes of SKOV-3 cells under same treatment were also observed by phase-contrast microscope and representative photographs are shown. Original magnification, x200. 79 3.8. ERβ opposes the pro-metastasis effects of ERα The findings in Figs. 22 and 30 suggest that ERβ may have an opposite effect to ERα on metastasis. To further examine the role of ERβ signaling in the metastatic activities of ovarian cancer cells, siRNA to knockdown ERβ in SKOV-3 cells was utilized. Figure 32 shows that ERβ siRNA specifically inhibited the expression of ERβ but not ERα. ERβ siRNA abolished upregulation of E-cadherin (Fig. 33). More importantly, cell mobility was significantly retarded with E2 treatment (P < 0.05), and this inhibition could be efficiently blocked by ERβ siRNA (Fig. 34).  As an alternative approach, we introduced ERβ (pRST7-ERβ) into BG-1 cells by transient transfection. The overexpression of ERβ was verified by Western blotting (Fig. 35). Fig. 36 & 37 show that ERβ expression significantly inhibited the E2-mediated down-regulation of E-cadherin protein and gene transcription. ERβ overexpression also exhibited significant effects on cell morphology and migration induced by E2 (Fig. 38 & 39). These results suggest that ERβ may function as a negative modulator of ERα in ovarian cancer cell metastasis. 80 NS siRNA ERβ siRNA ERα siRNAcont ERβ β-actin 1.0          0.9           0.9 0.2 Fig. 32. Expression of ERβ after transfection with siRNAs in SKOV-3 cells. SKOV-3 cells were transfected with non-specific siRNA (NS siRNA), ERα siRNA or ERβ siRNA. Efficiencies of the siRNA were confirmed by Western blot with ERβ antibody. Numerical values below each lane of the immunoblots represent quantification of the relative protein level by densitometry (normalized to β-actin protein level). 81 β-actin E-Cad NS siRNA ERα siRNA Cont E2 Cont Cont E2E2 ERβ siRNA Cont E2 1.0    1.6    1.0     1.6    1.0    1.5     0.9    1.0 Fig. 33. ERβ upregulates E-cadherin in SKOV-3 cells. SKOV-3 cells were transfected with the siRNAs and subsequently treated with 10-7 M E2 for 48 h. E-cadherin (E-cad) and β-actin were detected by Western blot. Numerical values below each lane of the immunoblots represent quantification of the relative protein level by densitometry (normalized to β-actin protein level). 82 Cont E2 Cont E2 Cont E2 Cont E2 0.00 0.25 0.50 0.75 1.00 NS siRNA ERα siRNA ERβ siRNA U nc ov er ed  a re a (R el at iv e to  C on t a t 0  h ) * * * Fig. 34. ERβ inhibits cell migration. A scratch-wound was made by scraping the monolayer 24 h after siRNA transfection, and cells were incubated with medium containing vehicle (Cont) or 10-7 M E2. The scratch-wound closure was photographed after 24 h. The amount of wound repair was expressed as uncovered area compared with initial uncovered area of vehicle-treated control at time 0. *P<0.05 compared with control. 83 Cont     Mock  pRST7-ERβ ERβ ERα β-actin 1.0          1.0 8.1 1.0          1.0 1.0 Fig. 35. Expression of ERβ after transfection with pRST7-ERβ in BG-1 cells. BG-1 cells were transfected with pRST7-ERβ or without plasmid DNA (mock). Cell lysates were extracted for ERβ detection by Western Blot. Numerical values below each lane of the immunoblots represent quantification of the relative protein level by densitometry (normalized to β-actin protein level). 84 β-actin E-Cad 1.0        0.4        0.4 1.0 Cont E2 Mock +E2 pRST7-ERβ +E2 Fig. 36. ERβ opposes ERα-induced down-regulation of E-cadherin expression. BG-1 cells were transfected for 8 h and subsequently treated with 10-7 M E2 or vehicle (Cont) for another 48 h. E-cadherin (E-cad) and β-actin were detected by Western blot. Numerical values below each lane of the immunoblots represent quantification of the relative protein level by densitometry (normalized to β-actin protein level). 85 Cont E2 Cont E2 0.00 0.25 0.50 0.75 1.00 1.25 pRST7-ERβ R el at iv e E- C ad pr om ot er  a ct iv ity * Fig. 37. ERβ opposes ERα-induced down-regulation of E-cadherin promoter activity. Cells were transfected with pRST7-ERβ, E-cadherin promoter construct and pSV- βGal. Eight h after transfection, cells were incubated with vehicle (Cont) or 10-7 M E2 for further 48 h. The luciferase activities were calculated relative to the promoterless vector (pGL3-Basic) and expressed as fold change relative to vehicle control. *P<0.05 compared with control. 86 Mock Cont E2 pRST7-ERβ Untransfected Fig. 38. ERβ blocks ERα-induced EMT. Morphological changes of BG-1 cells transfected with pRST7-ERβ or without plasmid DNA (mock) were also observed by phase-contrast microscope and representative photographs are shown. Original magnification, x200. 87 U nc ov er ed  a re a (R el at iv e to  C on t a t 0  h ) Cont E2 Cont E2 Cont E2 0.00 0.25 0.50 0.75 1.00 Mock pRST7-ERβ * * Fig. 39. ERβ opposes ERα-induced cell migratory activity. A scratch-wound was made by scraping the monolayer 24 h after transfection, and cells were incubated with medium containing vehicle (Cont) or 10-7 M E2. The scratch- wound closure was photographed after 24 h. The amount of wound repair was expressed as uncovered area compared with initial uncovered area of vehicle-treated control at time 0. *P<0.05 compared with control. 88 3.9. ERα to ERβ expression ratio may be important in determining the pro- metastatic effects of E2 in ovarian cancer cells Because ERα is required for the pro-metastatic effects of E2 and ERβ has contrasting actions, it would be interesting to determine whether the ERα:ERβ expression ratio affects the responses of ovarian cancer cells to E2.  Protein expression levels of ERα and ERβ were first assessed in a panel of ovarian cancer cell lines. These cell lines are A2780, BG-1, Caov-3, OV167, OV266, and OVCAR-3. MCF-7, which is a breast cancer cell line, was also included. It is well- established that MCF-7 is estrogen-responsive and E2 can induce proliferation, migration and EMT of the cells (Addeo et al. 1996; Planas-Silva et al. 2007).  As shown in Fig. 40, Western blot revealed that ERα expression levels were comparatively higher in BG-1 and MCF-7 cells among all cell lines. A previous study has shown that BG-1 has a high ERα:ERβ ratio using competitive PCR assay (Pujol et al. 1998). Therefore, BG-1 cells can serve as a reference with high ERα: ERβ ratio. Consistent with previous reports (Pujol et al. 1998; O'Donnell et al. 2005), the other cell lines expressed low levels of ERα. ERß was expressed to varying degrees in all cell lines tested. The ERα:ERβ ratio in these cells was relatively low compared with BG-1 and MCF-7 cells.  The effect of E2 on the migratory propensity of OVCAR-3 cells was first determined. This cell line has minimal ERα expression and moderate level of ERβ. As shown in Fig. 89 41, the migration rate of OVCAR-3 cells was not changed even after 48 h of E2 (10-7M) treatment. E-cadherin expression was also examined upon administration of E2 (10-9 M, 10-8 M and 10-7 M) as well as the ER-specific agonists DPN and PPT. However, no observable change in expression could be detected.  Another cell line, OV266, was also chosen for the experiment because it showed moderate expression of ERα and low expression of ERβ. Intriguingly, although the effect was not statistically significant, E2 increased the mobility of the cells to some extent after 48 h of treatment (Fig. 42). Collectively, these data suggest that a high ERα:ERβ ratio is critical for the induction of EMT and cell migration by E2 in ovarian cancer cells. The induction effects may be more prominent as the ERα:ERβ ratio increases. 90 M C F- 7 A 27 80 B G -1 C aO V- 3 O V1 67 O V2 66 O VC A R -3 ERα ERβ β−actin Fig. 40. Expression profiles of ERα and ERβ in ovarian cancer cell lines. Expression of ERα and ERβ was assessed in a panel of ovarian cancer cell lines including A2780, BG-1, Caov-3, OV167, OV266, and OVCAR-3 by Western blot. MCF-7 breast cancer cells were used as a positive control. 91 Fig. 41. E2 had no effect on migration and E-cadherin expression of OVCAR-3 cells. Confluent monolayers of OVCAR-3 cells were wounded with a uniform scratch, washed to remove cell debris, and cultured for indicated times in the presence of vehicle (Cont) or 10-7 M E2. Migratory capacity was measured at 0, 24 and 48 h after scratching, representative pictures are shown in the upper panel. Values are the mean ± SD of three separate experiments. Expression of E-cadherin in OVCAR-3 cells was examined upon administration of E2 (10-9 to 10- 7 M) as well as ER subtype specific agonists DPN (10-7 M )and PPT (10-7 M) by Western blot analysis (lower panel). E-Cad β-actin Cont 10-7 10-8 DPN PPT 0 24 48 0.00 0.25 0.50 0.75 1.00 1.25 Cont E2 U nc ov er ed  a re a (R el at iv e to  C on t a t 0 h) h 10-9 92 U nc ov er ed  a re a (R el at iv e to  C on t a t 0 h) h Fig. 42. Effect of E2 on migration of OV266 cells. Confluent monolayers of OV266 cells were wounded with a uniform scratch, washed to remove cell debris, and cultured for indicated times in the presence of vehicle (Cont) or 10-7 M E2. Migratory capacity was measured at 0, 24 and 48 h after scratching. Values are the mean ± SD of three separate experiments. 0 24 48 0.00 0.25 0.50 0.75 1.00 1.25 Cont E2 93 3.10. Identification of E2 target genes using microarray profiling In an attempt to identify novel downstream mediators of E2, microarray technology was used to identify genes that are transcriptionally regulated by E2 treatment in the BG- 1 cell line at 3 time points: 1, 8 and 24 h. This assay allows robust examination of gene expression status simultaneously.  RNA derived from untreated and E2-treated BG-1 cells was reverse transcribed, labeled, and hybridized to the oligo microarray. A total of 486 genes which showed at least 50 % change were selected. These genes were categorized into 6 group including (1) cancer related genes, (2) cell cycle related genes, (3) apoptosis related genes, (4) signaling related genes and (5) nucleic acid binding related genes. Data of the microarray of all these genes are shown in the appendix. The data was analyzed to screen for significantly altered genes upon E2 treatment. The numbers of genes with the expression levels changed by at least 1-fold or 2-fold at any of the three time-points was counted. The results are summarized in Table 1.  Out of the 486 genes analyzed, 9 genes (1.9%) were found to be increased in their expression levels by more than 2-fold upon E2 administration, whereas 81 genes (16.7%) were increased by over 1-fold. In contrast, 5 (1%) and 56 (11.5%) genes were decreased by more than 2-fold and 1-fold by E2 respectively. Interestingly, the number of genes up- regulated by E2 is more than that was down-regulated, indicating that E2 treatment resulted in transcriptional activation in general. 94  T ab le  1 . Q ua nt ita tio n of  g en es  a ff ec te d up on  E 2 tre at m en t b y m ic ro ar ra y an al ys is       G en e ca ta go ry  T ot al  g en es  an al ys ed  D ec re as e >1 -f ol d (% ) D ec re as e >2 -f ol d (% ) In cr ea se  > 1- fo ld  (% ) In cr ea se  > 2- fo ld  (% ) 1.  C an ce r r el at ed  g en es  26  2 (7 .7 % ) 0 (0 % ) 11  (4 2% ) 3 (1 1% ) 2.  C el l c yc le  re la te d ge ne s 40  2 (5 % ) 0 (0 % ) 9 (2 2. 5% ) 1 (2 .5 % ) 3.  A po pt os is  re la te d ge ne s 30  5 (1 6. 7% ) 0 (0 % ) 4 (1 3. 3% ) 0 (0 % ) 4.  S ig na lin g re la te d ge ne s 13 8 19  (1 3. 8% ) 4 (2 .9 % ) 19  (1 3. 8% ) 2 (1 .4 % ) 5.  N uc le ic  a ci d bi nd in g re la te d ge ne s 25 2 28  (1 1. 1% ) 1 (0 .4 % ) 38  (1 5. 1% ) 3 (1 .2 % ) To ta l n um be r 48 6 56  (1 1. 5% ) 5 (1 % ) 81  (1 6. 7% ) 9 (1 .9 % )  95 Remarkably, within the five categories, cancer related genes encompassed a relatively high percentage of genes (42%) that were up-regulated by E2. These genes include the avian myelocytomatosis viral oncogene homologs and members in the RAS oncogene family, and were activated by more than 2-fold. In the cell cycle related gene category, expression levels of 9 (22.5%) genes were increased. Within them, the cyclin D1 gene (a well-known estrogen–responsive gene) was upregulated for more than 1-fold. This result is concordant with previous data, showing comparable increase in the cyclin D level after E2 treatment in ovarian cancer cells (Bardin et al. 2004). This data can also help to indicate that the cells used for the microarray analysis had been properly treated. The cyclin A2 and cyclin-dependent kinase 4 was also significantly upregulated. It has been reported that estrogen may control apoptosis in ovarian cancer cells (Choi et al. 2001). Here, several potential apoptosis-related target genes of E2 have also been identified. These genes include caspase 6, apoptosis inhibitor 1, apoptosis-associated tyrosine kinase and programmed cell death Protein 8 (Apoptosis-inducing factor).  Estrogen also influence a number of genes related to signaling. Genes activated include amphiregulin (schwannoma-derived growth factor), insulin-like growth factor binding proteins, interleukin-1 receptor-associated kinase and placental growth factor (vascular endothelial growth factor (VEGF)-related protein). On the other hand, genes which were inhibited include fibroblast growth factor 16, platelet-activating factor acetylhydrolase 2 and TNF receptor-associated factor.  96 Given the well-established role of estrogen in mediating transcription regulation, it may not be surprising that E2 could affect expression of genes involved in nucleic acid binding. Not only genes encoding transcription factors were affected, it appears that genes coding proteins responsible for the translation process were also under control of E2. These proteins are the eukaryotic translation elongation factors and translation initiation factors. This data suggests that role of estrogen may not be limited to transcriptional regulation, and that translational regulation is also possible. Of particular note, one potential group of genes regulated by E2 is the RNA helicase (the DEAD/DEAH box polypeptides and putative nucleolar RNA helicase). These helicases share several highly conserved motifs and have known or putative ATP-dependent ability to unwind RNA in helical structure (Fuller-Pace 1994). And the structure of nucleic acid is critical in determining the availability to transcription factors binding and hence affects transcription rate. Therefore, the potential ability of E2 to regulate these proteins suggests that gene regulation by E2 may also occur through local unwinding of complex RNA structures.  With these microarray data, several putative estrogen-responsive genes can be identified. The identification of these genes can help postulate the functions of estrogen in ovarian cancer cells (discussed in Discussion session). Certainly, whether these putative genes are truly estrogen regulated needs to be further verified by quantitative real-time PCR and Western blot analysis. 97 4. DISCUSSION  The role of estrogen in ovarian tumorigenesis remains unclear and controversial. However, there is compelling evidence that estrogen is associated with increased ovarian cancer incidence. Clinical and epidemiological studies have shown that long term use of estrogen replacement therapy increases risk of ovarian cancer and points to a direct etiologic importance of a persistently elevated estrogen concentration (Lacey et al. 2002). Breastfeeding and use of oral contraceptives, which appear protective in a number of studies, are associated with reduced serum concentrations of estradiol (Runnebaum et al. 2001; Brekelmans 2003). Some experimental results also implicate a functional role of estrogen in ovarian carcinogenesis. For example, experimental ovarian neoplasms could be induced by estrogen administration (Silva et al. 1998; Bai et al. 2000). Estrogen could also enhance cell survival and proliferation of several ovarian carcinoma cell lines in vitro (Choi et al. 2001; Song et al. 2005).  Given the importance of estrogen as demonstrated by these studies, understanding the mechanistic basis through which it controls ovarian tumorigenesis might have profound biological and medical implications. In fact, the proliferative effects of estrogen were found to be mediated through regulation of genes involved in cell cycle or cell growth control, such as cyclin D1 (Bardin et al. 2004), bcl-2 (Choi et al. 2001) and ezrin (Song et al. 2005). In contrast to the role in regulating cell proliferation, very little is known about if and how estrogen promotes the formation of metastases. Moreover, previous data on the effects of cell invasiveness and motility by estrogen were inconsistent (Hayashido et 98 al. 1998; Song et al. 2005). Based on these previous results, the hypothesis that estrogen may contribute to ovarian carcinogenesis through influencing cancer cell metastasis was supported in this study.  Herein, the findings extend the understanding of the involvement of estrogen and its receptors in EMT and regulation of EMT-associated proteins. Supporting evidence of the involvement of estrogen in promoting ovarian carcinogenesis was provided, and demonstrated that E2 can induce EMT of ovarian cancer cells for the first time. The data also demonstrated an enhanced cell migratory ability through transcriptional regulation of E–cadherin and its repressors Snail and Slug upon E2 stimulation. Moreover, the results clearly established that the ERα subtype is an essential mechanistic link in mediating the induction of EMT by E2. Last but not least, ERβ can act counteract the pro-metastatic activities of ERα in ovarian cancer cells.  EMT in cancer is a prerequisite for tumor infiltration and metastasis by which epithelial cancer cells modulate their phenotype and acquire mesenchymal properties through the disruption of intercellular adhesion. The resulting mesenchymal-like phenotype enhances cell migration, invasion, and dissemination to complete metastasis. In this context, EMT has attracted much attention in studies of tumor progression. The E2-induced morphological changes demonstrated in this study are consistent with changes seen during EMT (Thiery 2002). Changes in cell morphology, from a cobblestone-like appearance to a more elongated shape, cell dissociation with reduced cell-cell contacts and pseudopodia formation were evident. Exactly how E2 promotes 99 EMT and cell motility remain to be elucidated. In this regard, the data imply that E2- induced EMT is in part mediated through its repression of E-cadherin.  E-cadherin is a protein found at adherens junctions that allows cell–cell adherence and is a well known marker of EMT. Reduced cell surface expression of E-cadherin in ovarian cancers is associated with poor tumor cell differentiation and cancer recurrence, while preserved cell surface expression of E-cadherin predicts favourable recurrence-free survival (Darai et al. 1997; Voutilainen et al. 2006). An immunohistochemical study on E-cadherin expression in benign, borderline, and malignant ovarian tumors found a homogeneous expression pattern in benign tumors but heterogeneous or undetectable expression in the majority of borderline and malignant tumors (Darai et al. 1997). In vitro experiments have shown transformation of normal epithelial cells into invasive cells by E-cadherin neutralizing antibody (Burdsal et al. 1993). In addition, invasive ovarian carcinoma cells were converted to less-invasive cells by exogenous expression of E- cadherin (Yuecheng et al. 2006). These observations collectively suggested that loss or reduced E-cadherin expression is associated with poor histological dedifferentiaton and increased frequency of invasion and metastasis in ovarian cancer.  Interestingly, unlike other types of epithelial malignancy, E-cadherin expression is frequently increased in primary ovarian carcinomas in concert with epithelial differentiation and subsequently represses in late-stage invasive tumors that are capable of metastasis together with a de-differentiantion of epithelial cells (Veatch et al. 1994; Maines-Bandiera et al. 1997). However, the cause for this subsequent loss of expression 100 in the tumor cells remains unclear. And it is likely that the regulation mechanisms are complex. In ovarian cancer cells, E-cadherin gene mutation is infrequent (Risinger et al. 1994). Rather, down-regulation of E-cadherin function has been shown to occur through gene methylation (Rathi et al. 2002) and up-regulation of E-cadherin transcriptional repressors (Imai et al. 2003). From the present data, it appears that estrogen might represent one of the mechanisms in the down-regulation of E-cadherin in the later stages of ovarian carcinogenesis in ER-positive ovarian cancer cells. In agreement with this, previous studies also suggested a role for estrogen in regulating E-cadherin expression in for example breast cancer cells. However, the underlying mechanism has not been fully investigated (Oesterreich et al. 2003; Ding et al. 2006). Because numerous transcription repressors have been characterized in controlling E-cadherin transcription, it is likely that the specific repressors involved are cell type- and cell context-dependent. Our data clearly revealed that two transcription factors, Snail and Slug, act in concert in the suppression of the E-cadherin promoter activity by E2.  The Snail gene family of transcription factors is best known for its ability to trigger EMT. Ectopic expression of Snail or Slug is sufficient to convert epithelial cells into mesenchymal cells with migratory properties (Batlle et al. 2000; Cano et al. 2000; Bolos et al. 2003). Their role as EMT inducers is partially due to the direct repression of E- cadherin expression. It is also known that Snail and Slug are involved in regulation of other epithelial markers and mesenchymal markers. Snail represses expression of tight junction proteins such as claudin, occludin (Ikenouchi et al. 2003) and ZO-1 (Ohkubo et al. 2004), and MMP-2 and MMP-9 expressions are increased by Snail (Yokoyama et al. 101 2003; Jorda et al. 2005). Slug inhibits the expressions of the cytokeratin 8 and 19 (Tripathi et al. 2005). High expression of Snail and Slug is often found in metastatic ovarian tumor cells compared with primary tumors (Elloul et al. 2006). Consistent with these observations, we demonstrated the importance of Snail and Slug in E2-induced cell migration by inhibiting transcription of E-cadherin in ovarian cancer cells. Several signaling pathways have been shown to activate the expression of Snail and Slug genes. In particular, growth factors that typically induce EMT such as transforming growth factor-β and fibroblast growth factor are involved in activation of the genes (Spagnoli et al. 2000). The EGFR pathway can activate STAT3, resulting in up-regulation of Snail which is mediated by the zinc-finger transporter LIV1 (Yamashita et al. 2004). Identification of upstream activators of Snail and Slug can provide valuable information about factors that may be important in tumor progression. The identification of Snail and Slug as novel estrogen-responsive genes helps to confirm the role of estrogen in ovarian carcinogenesis.  According to Elloul et al., it has been suggested that Snail is regulated at the post- transcriptional level in ovarian carcinoma (Peinado et al. 2007), whereas Slug is probably regulated transcriptionally (Elloul et al. 2006). Estrogen has been shown to regulate downstream genes by modulation of mRNA stability (Ing 2005). However, it was found that both Snail and Slug transcripts were not stabilized upon E2 treatment. Therefore it is unlikely that estrogen acts via a post-transcriptional mechanism to regulate the two proteins. Rather, the data in this study revealed that the up-regulation of both Snail and Slug by E2 was predominantly mediated through transcriptional mechanism by activation 102 of their promoter activities. As discussed in the introduction, the ERs elicit gene transcription by interacting with the classical ERE or non-ERE elements that bind heterologous transcription factors, including AP-1 sites (Webb et al. 1995), Sp1 sites (Porter et al. 1997) and cyclic AMP-response elements (CRE) (Sabbah et al. 1999). Of particular note, putative ERE sites can be found in the Snail promoter region (Moggs et al. 2005), but not in the Slug promoter. By sequence homology search, several potential Sp- 1, AP-1 and CRE sites within the 5’-flanking regions of Snail and Slug can be found. Whether E2 activates the two promoters through ERE or other non-ERE sites has yet to be determined. To understand the transcriptional regulation of Snail and Slug genes by E2, it is crucial to characterize the cis-acting elements in the promoters and identify co- regulators involved.  The data implied that the action of E2 on EMT induction is ER-dependent as the pure antiestrogen ICI 182780 could attenuate the effects. In metastatic ovarian cancer cells, only ERα is present and ERβ expression is often lost (Brandenberger et al. 1998; Pujol et al. 1998; Rutherford et al. 2000). This suggests that ER subtypes may play distinct roles in ovarian carcinogenesis. However, their functions and the molecular mechanisms in ovarian carcinognesis have just begun to be unveiled. ERα promotes ovarian cancer cell growth and several potential ERα-regulated genes have been identified by cDNA microarray (O'Donnell et al. 2005). These genes include junctional and extracellular matrix proteins (e.g. cadherin 6, fibronectin and vimentin), metastasis-related proteinases (e.g. matrix metalloproteineses and urokinase-type plasminogen activator) and regulators of cell cycle (e.g. Cyclin B1). Consistently, it has been shown in other cancer types that 103 ERα promotes carcinogenesis through activation of genes linked to cell proliferation and invasion, such as cyclin D1 (Liu et al. 2002), c-myc (Lazennec et al. 2001) and fibulin- 1C (Moll et al. 2002). In contrast, over-expression of ERβ induced apoptosis and exerted a protective role against ovarian cancer development (Bardin et al. 2004). Therefore, over-expression of ERα may represent a more metastatic behavior of ovarian cancer cells.  Accordingly, we provided several lines of evidence that induction of EMT by E2 is mediated specifically by ERα, but not by ERβ. First, ERα is predominant while ERβ is barely detectable in BG-1 cells (our data and (Pujol et al. 1998)), implicating ERα as the major mediator of estrogen signaling in the cells. Second, using pharmacological agonists selective for ERα and ERβ, it could be determined that the EMT induction by E2 was ERα-dependent. This could be further confirmed by ERα siRNA, which abolished the effects by E2. Third, the transforming capabilities of E2 could be observed in SKOV-3 cells with ERα restored by overexpression. This cell line is ERα-negative but ERβ- positive due to mutation in the ERα transcript and is insensitive to estrogen with respect to cell growth (Hua et al. 1995; Lau et al. 1999).  Intriguingly, another remarkable finding in this study demonstrated the tumor suppressor activities of ERβ by counteracting ERα signaling. ERβ induced E-cadherin expression and inhibited migration of the ERα-negative SKOV-3 cells. Moreover, introduction of ERβ potently blocked the pro-metastatic effects of E2 in BG-1 cells. It is interesting to note that ERβ negatively regulates the decrease of E-cadherin by ERα, and this balancing effect of ERβ was mediated at the promoter level. Indeed, it has been 104 proposed that modulation of ERα-targeted genes by ERβ may contribute to the contrasting actions between the two ER subtypes (Liu et al. 2002; Lindberg et al. 2003). Our data also suggest that this might be the case in our paradigm since ERα is responsible for E2-induced Snail and Slug expression, which could be reversed by ERβ. However, the molecular mechanisms underlying this differential regulation by each ER subtype warrant further examination.  Given the oncogenic role of ERα and the tumor suppression function of ERβ as shown in BG-1 cells, it is tempting to speculate that a high ERα:ERβ ratio would benefit tumor progression. The data in this study preliminarily suggest that the pro-metastatic effects of E2 is more prominent in ovarian cancer cells with higher ERα:ERβ ratio. Therefore, determination of ER subtypes expression may be useful in deciding the choice of hormone therapy for women, particularly postmenopausal women or cancer patients.  Microarray analysis was performed to characterize more putative downstream mediators of E2. This stage, these putative genes have not been confirmed, but most of the changes in gene expression were linked to those involved in oncology, cell cycle regulation, apoptosis, signaling component and gene expression. Intriguingly, a rather high proportion of cancer-related genes were upregulated by E2. These are oncogenes such as the v-myc avian myelocytomatosis viral oncogene homolog (known as c-myc in human) and the Rab genes. c-Myc is a key participant in the cell-cycle pathway and malignant transformation. Overexpression of this protein has been frequently associated with epithelial ovarian carcinomas (Chen et al. 2005). The function of Rab protein, a 105 member in the Raps family, is not clear. However, it has been reported that Rab protein levels are higher in many solid tumors compared to their normal counterparts, such as breast cancer and ovarian cancer (Culine et al. 1992). The role of these Rab proteins in ovarian carcinogenesis may be worth investigating.  Consistent with previous data, E2 could regulate a number of cyclin genes, the most well known being cyclin D1. Among the genes that were significantly altered by E2 treatment, all of them were upregulated except for cyclin-dependent kinase 9 and cyclin G2. These are very interesting results, because unlike other classical cyclins that promote cell cycle progression, cyclin G2 appears to block cell cycle entry (Shimizu et al. 1998). Down-regulation of cyclin G2 gene by E2 may therefore contribute to the mechanism of the growth stimulation effects of estrogen.  Estrogen can significantly inhibit the expression of the apoptosis-associated tyrosine kinase, that is often upregulated during the apoptosis cascade (Gaozza et al. 1997). Other apoptosis-inducers, programmed cell death 8 and the PRKC apoptosis WT1 regulator protein (PAWR), were also down-regulated. Surprisingly, the caspase genes (caspase 6 and caspase 10) were activated upon E2 treatment. These caspases are believed to induce apoptosis. Whether these caspases are involved in estrogen signaling needs to be confirmed.  Examination of signaling-related genes revealed higher expression of the insulin-like growth factor binding protein, known to be a carrier protein for the insulin-like growth 106 factor 1 (IGF-1). The IGF-1 and its binding proteins are overexpressed in ovarian malignant tissues and in the serum and cystic fluid of ovarian cancer patients, suggesting an important role of IGF signaling in the biology of ovarian cancer (Dal Maso et al. 2004; Lee et al. 2005). The ability of estrogen to upregulate the IGF binding protein suggests that estrogen may enhance cell proliferation through activation of this mitogenic signaling system. In fact, there is growing evidence of a complex cross-talk between IGF and estrogen (Martin et al. 2002). The interaction between the two signaling pathways in ovarian carcinogenesis remains to be defined.  Angiogenesis is crucial to a number of physiological and pathological processes such as reproduction, tumor growth and metastasis. Vascular endothelial growth factor (VEGF) and placenta growth factor (PLGF) are implicated as the most important angiogenesis inducers because of their potency in a variety of normal and tumor cells (Otrock et al. 2007). Other angiogenic factors include fibroblast growth factor (FGF) and platelet-derived growth factor (PDGF) (Murakami et al. 2008). Excitingly, the microarray data revealed that PLGF, VEGF and FGF were all up-regulated by estrogen. Considering that angiogenesis is an important process in many human cancers, it would be very interesting to determine whether estrogen also plays a key role in ovarian tumor angiogenesis.  The identification of E2-responsive nucleic acid binding genes may provide insight on how estrogen signaling is translated to gene control. First, estrogen may affect the expression of transcription factors (such as transcription factor AP-2 gamma and POU 107 domain transcription factors), which in turn affect the transcription rate of the target genes. Second, estrogen may regulate protein synthesis by influencing the expressions of eukaryotic translation elongation factors and translation initiation factors. Another unexplored mechanism would be the regulation of transcription through affecting the conformation and arrangement of RNA templates. From the microarray data, E2 upregulated a number of helicase proteins. The helicases unwind the double-stranded structure of RNA and facilitate transcription. In addition, the helicases may also be involved in gene transcription by stabilizing nascent transcripts or releasing completed transcripts from the template (Eisen et al. 1998). 108 5. CONCLUSION AND FUTURE STUDIES 5.1 Conclusion During carcinogenesis, acquisition of metastatic phenotypes is accompanied by the EMT process. Given the indispensable role of EMT in promoting progression of many carcinomas, it is important to unravel the mechanisms that govern this process. Although still under debate, a growing body of evidence supports the contribution of estrogen as an etiological factor in the development of ovarian cancer. In this thesis, the metastatic, migratory and gene regulatory aspects of estrogen signaling in ovarian cancer cells have been described.  The findings herein have provided supporting evidence of a pivotal role of estrogen in ovarian cancer cell metastasis. The data demonstrated for the first time that E2 can profoundly induce EMT of ovarian cancer cells. E2 could promote spindle-like and mesenchymal phenotypes and significantly enhance cell motility, which are the characteristics of EMT. To better understand the molecular mechanism(s) in E2- stimulated EMT and migration, the work also focused on identifying the downstream mediators of E2. The results showed that E2 can regulate expression of E-cadherin, Snail and Slug, and these proteins contribute at least in part in the pro-metastatic effects of E2. The identification of these genes as novel transcriptional targets of estrogen signaling also confirms the carcinogenicity of the hormone. It will also be interesting to investigate if estrogen may promote ovarian tumor progression through other mechanism(s). Cell migration is a critical step in tumor invasion and metastasis, and the driving force for cell movement is mainly provided by dynamic reorganization of the actin cytoskeleton, such 109 as disassembly and reassembly of stress fibers. The key mediators of actin cytoskeleton reorganization are the Rho family of small GTPases (Hall 1998). The involvement of the Rho family GTPase signaling cascade in E2-induced cell motility warrants further investigation.  Because two ER subtypes have been discovered, and the roles of these receptors in the effects of estrogen in ovarian cancer cells remain elusive, this work also investigated the signaling involved in the induction of EMT by E2. The data revealed a differential role of ERα and ERβ in ovarian tumor progression. While the induction of EMT, E- cadherin, Snail and Slug expressions are both mediated through ERα in the cells, ERβ appears to elicit opposite responses.   Microarray analysis revealed other candidate E2-regulated genes. These strategies could be useful for analyzing downstream targets of estrogen and ERα, and may contribute to elucidating the extensive signaling network of estrogen stimuli.  The identification of several oncogenes, apoptosis regulators, signaling molecules and transcription machinery components brings new insights into understanding of estrogen actions in ovarian cancer cells.  In summary, these data emphasize the potential role of estrogen in promoting ovarian tumor progression in ERα-positive cells. The discovery that ERα and ERβ differentially mediate the EMT process provides a possible explanation for the observed increase in the 110 ERα:ERβ expression ratio during ovarian carcinogenesis. It also carries clinical implications for selective targeting of the ERs in therapeutic and prevention strategies against ovarian cancer.  5.2. Future studies 5.2.1. Identification of the signaling cascade that mediates estrogen-induced cell motility Cell migration is a critical step in tumor invasion and metastasis, and regulation of this process could therefore be a potential strategy for treating cancer. The driving force for cell movement is mainly provided by dynamic reorganization of the actin cytoskeleton, such as disassembly and reassembly of stress fibers. In moving cells, membrane protrusions (lamellipodia and filopodia) at the cell front and retraction at the cell rear are prominent protrusive organelles generated by actin remodeling. The key mediators of actin cytoskeleton reorganization are the Rho family of small GTPases (Hall 1994; Hall 1998). Members of the small GTPases consist of the Rho, Rac, and Cdc42 subfamilies. These proteins exert cell-type specific regulation on the formation of stress fibers, focal adhesions, lamellipodia, membrane ruffling and filopodia. The Rho families cycle between the GDP-bound inactive and GTP-bound active forms. Once activated, these small GTPases transmit extracellular signals to downstream effectors to regulate cellular architecture. Rho-associated protein kinase (ROCK) and p21-activated kinase (PAK) are the two major immediate downstream effectors of the GTPases. However, as yet, the effect of estrogen on actin remodeling in ovarian cancer cells has not been explored. Moreover, to enhance our understanding of the intracellular signaling underlying 111 estrogen-induced migration, we plan to determine the involvement of the Rho family GTPases in this process.  5.2.2. Investigation on the regulatory mechanism(s) of the EMT-inducers, Snail and Slug, by E2 This study revealed that E2 can enhance ovarian tumor cell motility by up-regulation of two important EMT inducers, Snail and Slug at the transcription level. Examination of the 5'-flanking region of Snail revealed more than one putative ERE, while, no consensus ERE in Slug promoter region was found. However, both promoters contain several putative binding sites for AP-1, SP-1 and CRE. To date, the transcriptional regulation of Snail and Slug genes by growth factors or hormones including E2 has not been studied. To understand the transcriptional regulation of Snail and Slug genes by E2, it is crucial to characterize the cis-acting elements in the promoters and identify co-regulators involved. Future studies should identify (1) the promoter regions that contribute to transactivation by E2, and (2) the profiles of coregulators regulated by E2-ERs complex. This experiment will provide the detailed molecular mechanisms by which E2 controls EMT as well as better understanding of the role of ER subtypes in ovarian tumor metastasis. 112 6. REFERENCES Adami, H. O., C. C. Hsieh, M. Lambe, D. Trichopoulos, D. Leon, I. Persson, A. Ekbom and P. O. Janson (1994). "Parity, age at first childbirth, and risk of ovarian cancer." Lancet 344(8932): 1250-4. Addeo, R., L. Altucci, T. Battista, I. M. Bonapace, M. Cancemi, L. Cicatiello, D. Germano, C. Pacilio, S. Salzano, F. Bresciani and A. Weisz (1996). "Stimulation of human breast cancer MCF-7 cells with estrogen prevents cell cycle arrest by HMG-CoA reductase inhibitors." Biochem Biophys Res Commun 220(3): 864-70. Angst, B. D., C. Marcozzi and A. I. Magee (2001). "The cadherin superfamily: diversity in form and function." J Cell Sci 114(Pt 4): 629-41. Ankrapp, D. P., J. M. Bennett and S. Z. Haslam (1998). "Role of epidermal growth factor in the acquisition of ovarian steroid hormone responsiveness in the normal mouse mammary gland." J Cell Physiol 174(2): 251-60. Anzick, S. L., J. Kononen, R. L. Walker, D. O. Azorsa, M. M. Tanner, X. Y. Guan, G. Sauter, O. P. Kallioniemi, J. M. Trent and P. S. Meltzer (1997). "AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer." Science 277(5328): 965-8. Auersperg, N., A. S. Wong, K. C. Choi, S. K. Kang and P. C. Leung (2001). "Ovarian surface epithelium: biology, endocrinology, and pathology." Endocr Rev 22(2): 255-88. Bai, W., B. Oliveros-Saunders, Q. Wang, M. E. Acevedo-Duncan and S. V. Nicosia (2000). "Estrogen stimulation of ovarian surface epithelial cell proliferation." In Vitro Cell Dev Biol Anim 36(10): 657-66. Barbera, M. J., I. Puig, D. Dominguez, S. Julien-Grille, S. Guaita-Esteruelas, S. Peiro, J. Baulida, C. Franci, S. Dedhar, L. Larue and A. Garcia de Herreros (2004). 113 "Regulation of Snail transcription during epithelial to mesenchymal transition of tumor cells." Oncogene 23(44): 7345-54. Bardin, A., P. Hoffmann, N. Boulle, D. Katsaros, F. Vignon, P. Pujol and G. Lazennec (2004). "Involvement of estrogen receptor beta in ovarian carcinogenesis." Cancer Res 64(16): 5861-9. Barnes, M. N., W. D. Berry, J. M. Straughn, T. O. Kirby, C. A. Leath, W. K. Huh, W. E. Grizzle and E. E. Partridge (2002). "A pilot study of ovarian cancer chemoprevention using medroxyprogesterone acetate in an avian model of spontaneous ovarian carcinogenesis." Gynecol Oncol 87(1): 57-63. Batlle, E., E. Sancho, C. Franci, D. Dominguez, M. Monfar, J. Baulida and A. Garcia De Herreros (2000). "The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells." Nat Cell Biol 2(2): 84-9. Becker, K. F., M. J. Atkinson, U. Reich, I. Becker, H. Nekarda, J. R. Siewert and H. Hofler (1994). "E-cadherin gene mutations provide clues to diffuse type gastric carcinomas." Cancer Res 54(14): 3845-52. Bek, S. and R. Kemler (2002). "Protein kinase CKII regulates the interaction of beta- catenin with alpha-catenin and its protein stability." J Cell Sci 115(Pt 24): 4743-53. Berx, G., A. M. Cleton-Jansen, F. Nollet, W. J. de Leeuw, M. van de Vijver, C. Cornelisse and F. van Roy (1995). "E-cadherin is a tumour/invasion suppressor gene mutated in human lobular breast cancers." Embo J 14(24): 6107-15. Bienz, M. and H. Clevers (2000). "Linking colorectal cancer to Wnt signaling." Cell 103(2): 311-20. 114 Birchmeier, W. and J. Behrens (1994). "Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness." Biochim Biophys Acta 1198(1): 11-26. Bolos, V., H. Peinado, M. A. Perez-Moreno, M. F. Fraga, M. Esteller and A. Cano (2003). "The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors." J Cell Sci 116(Pt 3): 499-511. Bornman, D. M., S. Mathew, J. Alsruhe, J. G. Herman and E. Gabrielson (2001). "Methylation of the E-cadherin gene in bladder neoplasia and in normal urothelial epithelium from elderly individuals." Am J Pathol 159(3): 831-5. Brandenberger, A. W., M. K. Tee and R. B. Jaffe (1998). "Estrogen receptor alpha (ER-alpha) and beta (ER-beta) mRNAs in normal ovary, ovarian serous cystadenocarcinoma and ovarian cancer cell lines: down-regulation of ER-beta in neoplastic tissues." J Clin Endocrinol Metab 83(3): 1025-8. Brekelmans, C. T. (2003). "Risk factors and risk reduction of breast and ovarian cancer." Curr Opin Obstet Gynecol 15(1): 63-8. Bruning, J. C., P. Lingohr, J. Gillette, B. Hanstein, H. Avci, W. Krone, D. Muller- Wieland and J. Kotzka (2003). "Estrogen receptor-alpha and Sp1 interact in the induction of the low density lipoprotein-receptor." J Steroid Biochem Mol Biol 86(2): 113-21. Burdsal, C. A., C. H. Damsky and R. A. Pedersen (1993). "The role of E-cadherin and integrins in mesoderm differentiation and migration at the mammalian primitive streak." Development 118(3): 829-44. 115 Cano, A., M. A. Perez-Moreno, I. Rodrigo, A. Locascio, M. J. Blanco, M. G. del Barrio, F. Portillo and M. A. Nieto (2000). "The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression." Nat Cell Biol 2(2): 76-83. Casagrande, J. T., E. W. Louie, M. C. Pike, S. Roy, R. K. Ross and B. E. Henderson (1979). ""Incessant ovulation" and ovarian cancer." Lancet 2(8135): 170-3. Cato, A. C., A. Nestl and S. Mink (2002). "Rapid actions of steroid receptors in cellular signaling pathways." Sci STKE 2002(138): RE9. Chan, K. K., N. Wei, S. S. Liu, L. Xiao-Yun, A. N. Cheung and H. Y. Ngan (2008). "Estrogen receptor subtypes in ovarian cancer: a clinical correlation." Obstet Gynecol 111(1): 144-51. Chang, W., M. Parra, M. Centrella and T. L. McCarthy (2005). "Interactions between CCAAT enhancer binding protein delta and estrogen receptor alpha control insulin-like growth factor I (igf1) and estrogen receptor-dependent gene expression in osteoblasts." Gene 345(2): 225-35. Charpentier, A. H., A. K. Bednarek, R. L. Daniel, K. A. Hawkins, K. J. Laflin, S. Gaddis, M. C. MacLeod and C. M. Aldaz (2000). "Effects of estrogen on global gene expression: identification of novel targets of estrogen action." Cancer Res 60(21): 5977- 83. Chen, C. H., J. Shen, W. J. Lee and S. N. Chow (2005). "Overexpression of cyclin D1 and c-Myc gene products in human primary epithelial ovarian cancer." Int J Gynecol Cancer 15(5): 878-83. 116 Chen, C. L., S. S. Liu, S. M. Ip, L. C. Wong, T. Y. Ng and H. Y. Ngan (2003). "E- cadherin expression is silenced by DNA methylation in cervical cancer cell lines and tumours." Eur J Cancer 39(4): 517-23. Chen, Z., I. S. Yuhanna, Z. Galcheva-Gargova, R. H. Karas, M. E. Mendelsohn and P. W. Shaul (1999). "Estrogen receptor alpha mediates the nongenomic activation of endothelial nitric oxide synthase by estrogen." J Clin Invest 103(3): 401-6. Choi, J. H., A. S. Wong, H. F. Huang and P. C. Leung (2007). "Gonadotropins and ovarian cancer." Endocr Rev 28(4): 440-61. Choi, K. C., S. K. Kang, C. J. Tai, N. Auersperg and P. C. Leung (2001). "Estradiol up-regulates antiapoptotic Bcl-2 messenger ribonucleic acid and protein in tumorigenic ovarian surface epithelium cells." Endocrinology 142(6): 2351-60. Christian, J. and H. Thomas (2001). "Ovarian cancer chemotherapy." Cancer Treat Rev 27(2): 99-109. Costello, J. F. and C. Plass (2001). "Methylation matters." J Med Genet 38(5): 285-303. Couse, J. F. and K. S. Korach (1999). "Estrogen receptor null mice: what have we learned and where will they lead us?" Endocr Rev 20(3): 358-417. Cramer, D. W. and W. R. Welch (1983). "Determinants of ovarian cancer risk. II. Inferences regarding pathogenesis." J Natl Cancer Inst 71(4): 717-21. Crum, C. P., R. Drapkin, A. Miron, T. A. Ince, M. Muto, D. W. Kindelberger and Y. Lee (2007). "The distal fallopian tube: a new model for pelvic serous carcinogenesis." Curr Opin Obstet Gynecol 19(1): 3-9. 117 Culine, S., N. Honore, A. Tavitian and B. Olofsson (1992). "Overexpression of the ras- related rab2 gene product in peripheral blood mononuclear cells from patients with hematological and solid neoplasms." Cancer Res 52(11): 3083-8. Curtis, S. W., T. Washburn, C. Sewall, R. DiAugustine, J. Lindzey, J. F. Couse and K. S. Korach (1996). "Physiological coupling of growth factor and steroid receptor signaling pathways: estrogen receptor knockout mice lack estrogen-like response to epidermal growth factor." Proc Natl Acad Sci U S A 93(22): 12626-30. Dal Maso, L., L. S. Augustin, S. Franceschi, R. Talamini, J. Polesel, C. W. Kendall, D. J. Jenkins, E. Vidgen and C. La Vecchia (2004). "Association between components of the insulin-like growth factor system and epithelial ovarian cancer risk." Oncology 67(3-4): 225-30. Daniel, J. M. and A. B. Reynolds (1997). "Tyrosine phosphorylation and cadherin/catenin function." Bioessays 19(10): 883-91. Darai, E., J. Y. Scoazec, F. Walker-Combrouze, N. Mlika-Cabanne, G. Feldmann, P. Madelenat and F. Potet (1997). "Expression of cadherins in benign, borderline, and malignant ovarian epithelial tumors: a clinicopathologic study of 60 cases." Hum Pathol 28(8): 922-8. Ding, J. X., Y. J. Feng, L. Q. Yao, M. Yu, H. Y. Jin and L. H. Yin (2006). "The reinforcement of invasion in epithelial ovarian cancer cells by 17 beta-Estradiol is associated with up-regulation of Snail." Gynecol Oncol 103(2): 623-30. Edmondson, R. J., J. M. Monaghan and B. R. Davies (2002). "The human ovarian surface epithelium is an androgen responsive tissue." Br J Cancer 86(6): 879-85. 118 Eisen, A. and J. C. Lucchesi (1998). "Unraveling the role of helicases in transcription." Bioessays 20(8): 634-41. El-Tanani, M. K. and C. D. Green (1997). "Two separate mechanisms for ligand- independent activation of the estrogen receptor." Mol Endocrinol 11(7): 928-37. Elloul, S., I. Silins, C. G. Trope, A. Benshushan, B. Davidson and R. Reich (2006). "Expression of E-cadherin transcriptional regulators in ovarian carcinoma." Virchows Arch 449(5): 520-8. Evans, R. M. (1988). "The steroid and thyroid hormone receptor superfamily." Science 240(4854): 889-95. Ewen, M. E. and J. Lamb (2004). "The activities of cyclin D1 that drive tumorigenesis." Trends Mol Med 10(4): 158-62. Falkenstein, E., H.-C. Tillmann, M. Christ, M. Feuring and M. Wehling (2000). "Multiple Actions of Steroid Hormones---A Focus on Rapid, Nongenomic Effects " Pharmacol Rev 52(4): 513-556. Fang, W. B., R. C. Ireton, G. Zhuang, T. Takahashi, A. Reynolds and J. Chen (2008). "Overexpression of EPHA2 receptor destabilizes adherens junctions via a RhoA- dependent mechanism." J Cell Sci 121(Pt 3): 358-68. Fathalla, M. F. (1971). "Incessant ovulation--a factor in ovarian neoplasia?" Lancet 2(7716): 163. Fiskus, W., Y. Ren, A. Mohapatra, P. Bali, A. Mandawat, R. Rao, B. Herger, Y. Yang, P. Atadja, J. Wu and K. Bhalla (2007). "Hydroxamic acid analogue histone deacetylase inhibitors attenuate estrogen receptor-alpha levels and transcriptional 119 activity: a result of hyperacetylation and inhibition of chaperone function of heat shock protein 90." Clin Cancer Res 13(16): 4882-90. Fuller-Pace, F. V. (1994). "RNA helicases: modulators of RNA structure." Trends Cell Biol 4(8): 271-4. Galtier-Dereure, F., F. Capony, T. Maudelonde and H. Rochefort (1992). "Estradiol stimulates cell growth and secretion of procathepsin D and a 120-kilodalton protein in the human ovarian cancer cell line BG-1." J Clin Endocrinol Metab 75(6): 1497-502. Gaozza, E., S. J. Baker, R. K. Vora and E. P. Reddy (1997). "AATYK: a novel tyrosine kinase induced during growth arrest and apoptosis of myeloid cells." Oncogene 15(25): 3127-35. Garinis, G. A., P. G. Menounos, N. E. Spanakis, K. Papadopoulos, G. Karavitis, I. Parassi, E. Christeli, G. P. Patrinos, E. N. Manolis and G. Peros (2002). "Hypermethylation-associated transcriptional silencing of E-cadherin in primary sporadic colorectal carcinomas." J Pathol 198(4): 442-9. Geisinger, K. R., T. E. Kute, M. J. Pettenati, C. E. Welander, Y. Dennard, L. A. Collins and M. E. Berens (1989). "Characterization of a human ovarian carcinoma cell line with estrogen and progesterone receptors." Cancer 63(2): 280-8. Giacalone, P. L., J. P. Daures, L. Ouafik, P. M. Martin, F. Laffargue and T. Maudelonde (2003). "Steroids and adrenomedullin growth patterns in human ovarian cancer cells: estrogenic-regulation assay." Gynecol Oncol 91(3): 651-6. Goodwin, M. and A. S. Yap (2004). "Classical cadherin adhesion molecules: coordinating cell adhesion, signaling and the cytoskeleton." J Mol Histol 35(8-9): 839-44. 120 Green, S., P. Walter, V. Kumar, A. Krust, J. M. Bornert, P. Argos and P. Chambon (1986). "Human oestrogen receptor cDNA: sequence, expression and homology to v-erb- A." Nature 320(6058): 134-9. Greene, G. L., P. Gilna, M. Waterfield, A. Baker, Y. Hort and J. Shine (1986). "Sequence and expression of human estrogen receptor complementary DNA." Science 231(4742): 1150-4. Grunwald, G. B. (1993). "The structural and functional analysis of cadherin calcium- dependent cell adhesion molecules." Curr Opin Cell Biol 5(5): 797-805. Hajra, K. M., D. Y. Chen and E. R. Fearon (2002). "The SLUG zinc-finger protein represses E-cadherin in breast cancer." Cancer Res 62(6): 1613-8. Hall, A. (1994). "Small GTP-binding proteins and the regulation of the actin cytoskeleton." Annu Rev Cell Biol 10: 31-54. Hall, A. (1998). "Rho GTPases and the actin cytoskeleton." Science 279(5350): 509-14. Hall, J. M., J. F. Couse and K. S. Korach (2001). "The multifaceted mechanisms of estradiol and estrogen receptor signaling." J Biol Chem 276(40): 36869-72. Hayashida, Y., Y. Urata, E. Muroi, T. Kono, Y. Miyata, K. Nomata, H. Kanetake, T. Kondo and Y. Ihara (2006). "Calreticulin represses E-cadherin gene expression in Madin-Darby canine kidney cells via Slug." J Biol Chem 281(43): 32469-84. Hayashido, Y., A. Lucas, C. Rougeot, S. Godyna, W. S. Argraves and H. Rochefort (1998). "Estradiol and fibulin-1 inhibit motility of human ovarian- and breast-cancer cells induced by fibronectin." Int J Cancer 75(4): 654-8. 121 Heery, D. M., E. Kalkhoven, S. Hoare and M. G. Parker (1997). "A signature motif in transcriptional co-activators mediates binding to nuclear receptors." Nature 387(6634): 733-6. Hess, R. A., D. Bunick, K. H. Lee, J. Bahr, J. A. Taylor, K. S. Korach and D. B. Lubahn (1997). "A role for oestrogens in the male reproductive system." Nature 390(6659): 509-12. Hirohashi, S. and Y. Kanai (2003). "Cell adhesion system and human cancer morphogenesis." Cancer Sci 94(7): 575-81. Hoskins, W. J. (1995). "Prospective on ovarian cancer: why prevent?" J Cell Biochem Suppl 23: 189-99. Hsu, S. C., J. Galceran and R. Grosschedl (1998). "Modulation of transcriptional regulation by LEF-1 in response to Wnt-1 signaling and association with beta-catenin." Mol Cell Biol 18(8): 4807-18. Hua, W., T. Christianson, C. Rougeot, H. Rochefort and G. M. Clinton (1995). "SKOV3 ovarian carcinoma cells have functional estrogen receptor but are growth- resistant to estrogen and antiestrogens." J Steroid Biochem Mol Biol 55(3-4): 279-89. Ignar-Trowbridge, D. M., K. G. Nelson, M. C. Bidwell, S. W. Curtis, T. F. Washburn, J. A. McLachlan and K. S. Korach (1992). "Coupling of dual signaling pathways: epidermal growth factor action involves the estrogen receptor." Proc Natl Acad Sci U S A 89(10): 4658-62. Ikenouchi, J., M. Matsuda, M. Furuse and S. Tsukita (2003). "Regulation of tight junctions during the epithelium-mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail." J Cell Sci 116(Pt 10): 1959-67. 122 Ikuta, T. and K. Kawajiri (2006). "Zinc finger transcription factor Slug is a novel target gene of aryl hydrocarbon receptor." Exp Cell Res 312(18): 3585-94. Imai, T., A. Horiuchi, C. Wang, K. Oka, S. Ohira, T. Nikaido and I. Konishi (2003). "Hypoxia attenuates the expression of E-cadherin via up-regulation of SNAIL in ovarian carcinoma cells." Am J Pathol 163(4): 1437-47. Ing, N. H. (2005). "Steroid hormones regulate gene expression posttranscriptionally by altering the stabilities of messenger RNAs." Biol Reprod 72(6): 1290-6. Inoue, A., N. Yoshida, Y. Omoto, S. Oguchi, T. Yamori, R. Kiyama and S. Hayashi (2002). "Development of cDNA microarray for expression profiling of estrogen- responsive genes." J Mol Endocrinol 29(2): 175-92. Jakacka, M., M. Ito, J. Weiss, P. Y. Chien, B. D. Gehm and J. L. Jameson (2001). "Estrogen receptor binding to DNA is not required for its activity through the nonclassical AP1 pathway." J Biol Chem 276(17): 13615-21. Jiang, Y., Y. E. Liu, I. D. Goldberg and Y. E. Shi (2004). "Gamma synuclein, a novel heat-shock protein-associated chaperone, stimulates ligand-dependent estrogen receptor alpha signaling and mammary tumorigenesis." Cancer Res 64(13): 4539-46. Jorda, M., D. Olmeda, A. Vinyals, E. Valero, E. Cubillo, A. Llorens, A. Cano and A. Fabra (2005). "Upregulation of MMP-9 in MDCK epithelial cell line in response to expression of the Snail transcription factor." J Cell Sci 118(Pt 15): 3371-85. Kanai, Y., T. Oda, H. Tsuda, A. Ochiai and S. Hirohashi (1994). "Point mutation of the E-cadherin gene in invasive lobular carcinoma of the breast." Jpn J Cancer Res 85(10): 1035-9. 123 Kang, S. K., K. C. Choi, C. J. Tai, N. Auersperg and P. C. Leung (2001). "Estradiol regulates gonadotropin-releasing hormone (GnRH) and its receptor gene expression and antagonizes the growth inhibitory effects of GnRH in human ovarian surface epithelial and ovarian cancer cells." Endocrinology 142(2): 580-8. Karlan, B. Y., J. Jones, M. Greenwald and L. D. Lagasse (1995). "Steroid hormone effects on the proliferation of human ovarian surface epithelium in vitro." Am J Obstet Gynecol 173(1): 97-104. Kato, S. (2001). "Estrogen receptor-mediated cross-talk with growth factor signaling pathways." Breast Cancer 8(1): 3-9. Kieback, D. G., S. K. McCamant, M. F. Press, E. N. Atkinson, H. S. Gallager, C. L. Edwards, R. A. Hajek and L. A. Jones (1993). "Improved prediction of survival in advanced adenocarcinoma of the ovary by immunocytochemical analysis and the composition adjusted receptor level of the estrogen receptor." Cancer Res 53(21): 5188- 92. Klein-Hitpass, L., G. U. Ryffel, E. Heitlinger and A. C. Cato (1988). "A 13 bp palindrome is a functional estrogen responsive element and interacts specifically with estrogen receptor." Nucleic Acids Res 16(2): 647-63. Kuiper, G. G., E. Enmark, M. Pelto-Huikko, S. Nilsson and J. A. Gustafsson (1996). "Cloning of a novel receptor expressed in rat prostate and ovary." Proc Natl Acad Sci U S A 93(12): 5925-30. Kushner, P. J., D. A. Agard, G. L. Greene, T. S. Scanlan, A. K. Shiau, R. M. Uht and P. Webb (2000). "Estrogen receptor pathways to AP-1." J Steroid Biochem Mol Biol 74(5): 311-7. 124 Lacey, J. V., Jr., L. A. Brinton, M. F. Leitzmann, T. Mouw, A. Hollenbeck, A. Schatzkin and P. Hartge (2006). "Menopausal hormone therapy and ovarian cancer risk in the National Institutes of Health-AARP Diet and Health Study Cohort." J Natl Cancer Inst 98(19): 1397-405. Lacey, J. V., Jr., P. J. Mink, J. H. Lubin, M. E. Sherman, R. Troisi, P. Hartge, A. Schatzkin and C. Schairer (2002). "Menopausal hormone replacement therapy and risk of ovarian cancer." Jama 288(3): 334-41. Lau, K. M., S. C. Mok and S. M. Ho (1999). "Expression of human estrogen receptor- alpha and -beta, progesterone receptor, and androgen receptor mRNA in normal and malignant ovarian epithelial cells." Proc Natl Acad Sci U S A 96(10): 5722-7. Laudet, V. (1997). "Evolution of the nuclear receptor superfamily: early diversification from an ancestral orphan receptor." J Mol Endocrinol 19(3): 207-26. Lazennec, G., D. Bresson, A. Lucas, C. Chauveau and F. Vignon (2001). "ER beta inhibits proliferation and invasion of breast cancer cells." Endocrinology 142(9): 4120-30. Lee, E. J., C. Mircean, I. Shmulevich, H. Wang, J. Liu, A. Niemisto, J. J. Kavanagh, J. H. Lee and W. Zhang (2005). "Insulin-like growth factor binding protein 2 promotes ovarian cancer cell invasion." Mol Cancer 4(1): 7. Lee, J. M., S. Dedhar, R. Kalluri and E. W. Thompson (2006). "The epithelial- mesenchymal transition: new insights in signaling, development, and disease." J Cell Biol 172(7): 973-81. Lee, Y., A. Miron, R. Drapkin, M. R. Nucci, F. Medeiros, A. Saleemuddin, J. Garber, C. Birch, H. Mou, R. W. Gordon, D. W. Cramer, F. D. McKeon and C. P. Crum 125 (2007). "A candidate precursor to serous carcinoma that originates in the distal fallopian tube." J Pathol 211(1): 26-35. Li, A. J., R. L. Baldwin and B. Y. Karlan (2003). "Estrogen and progesterone receptor subtype expression in normal and malignant ovarian epithelial cell cultures." Am J Obstet Gynecol 189(1): 22-7. Lindberg, M. K., S. Moverare, S. Skrtic, H. Gao, K. Dahlman-Wright, J. A. Gustafsson and C. Ohlsson (2003). "Estrogen receptor (ER)-beta reduces ERalpha- regulated gene transcription, supporting a "ying yang" relationship between ERalpha and ERbeta in mice." Mol Endocrinol 17(2): 203-8. Liu, M. M., C. Albanese, C. M. Anderson, K. Hilty, P. Webb, R. M. Uht, R. H. Price, Jr., R. G. Pestell and P. J. Kushner (2002). "Opposing action of estrogen receptors alpha and beta on cyclin D1 gene expression." J Biol Chem 277(27): 24353-60. Liu, Y., L. Lin and R. Zarnegar (1994). "Modulation of hepatocyte growth factor gene expression by estrogen in mouse ovary." Mol Cell Endocrinol 104(2): 173-81. Maines-Bandiera, S. L. and N. Auersperg (1997). "Increased E-cadherin expression in ovarian surface epithelium: an early step in metaplasia and dysplasia?" Int J Gynecol Pathol 16(3): 250-5. Martin, M. B. and A. Stoica (2002). "Insulin-like growth factor-I and estrogen interactions in breast cancer." J Nutr 132(12): 3799S-3801S. McDonnel, A. C. and W. J. Murdoch (2001). "High-dose progesterone inhibition of urokinase secretion and invasive activity by SKOV-3 ovarian carcinoma cells: evidence for a receptor-independent nongenomic effect on the plasma membrane." J Steroid Biochem Mol Biol 78(2): 185-91. 126 McKenna, N. J. and B. W. O'Malley (2002). "Combinatorial control of gene expression by nuclear receptors and coregulators." Cell 108(4): 465-74. Meyers, M. J., J. Sun, K. E. Carlson, G. A. Marriner, B. S. Katzenellenbogen and J. A. Katzenellenbogen (2001). "Estrogen receptor-beta potency-selective ligands: structure-activity relationship studies of diarylpropionitriles and their acetylene and polar analogues." J Med Chem 44(24): 4230-51. Miki, Y., J. Swensen, D. Shattuck-Eidens, P. A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L. M. Bennett and W. Ding (1994). "A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1." Science 266(5182): 66-71. Modugno, F., R. B. Ness and J. E. Wheeler (2001). "Reproductive risk factors for epithelial ovarian cancer according to histologic type and invasiveness." Ann Epidemiol 11(8): 568-74. Moggs, J. G., T. C. Murphy, F. L. Lim, D. J. Moore, R. Stuckey, K. Antrobus, I. Kimber and G. Orphanides (2005). "Anti-proliferative effect of estrogen in breast cancer cells that re-express ERalpha is mediated by aberrant regulation of cell cycle genes." J Mol Endocrinol 34(2): 535-51. Moll, F., D. Katsaros, G. Lazennec, N. Hellio, P. Roger, P. L. Giacalone, D. Chalbos, T. Maudelonde, H. Rochefort and P. Pujol (2002). "Estrogen induction and overexpression of fibulin-1C mRNA in ovarian cancer cells." Oncogene 21(7): 1097-107. Mosselman, S., J. Polman and R. Dijkema (1996). "ER beta: identification and characterization of a novel human estrogen receptor." FEBS Lett 392(1): 49-53. Murakami, M. and M. Simons (2008). "Fibroblast growth factor regulation of neovascularization." Curr Opin Hematol 15(3): 215-20. 127 Murdoch, W. J. and E. A. Van Kirk (2002). "Steroid hormonal regulation of proliferative, p53 tumor suppressor, and apoptotic responses of sheep ovarian surface epithelial cells." Mol Cell Endocrinol 186(1): 61-7. Murphy, L. C., S. L. Simon, A. Parkes, E. Leygue, H. Dotzlaw, L. Snell, S. Troup, A. Adeyinka and P. H. Watson (2000). "Altered expression of estrogen receptor coregulators during human breast tumorigenesis." Cancer Res 60(22): 6266-71. Nass, S. J., J. G. Herman, E. Gabrielson, P. W. Iversen, F. F. Parl, N. E. Davidson and J. R. Graff (2000). "Aberrant methylation of the estrogen receptor and E-cadherin 5' CpG islands increases with malignant progression in human breast cancer." Cancer Res 60(16): 4346-8. Natt, E., R. E. Magenis, J. Zimmer, A. Mansouri and G. Scherer (1989). "Regional assignment of the human loci for uvomorulin (UVO) and chymotrypsinogen B (CTRB) with the help of two overlapping deletions on the long arm of chromosome 16." Cytogenet Cell Genet 50(2-3): 145-8. Nguyen, H. N., H. E. Averette, W. Hoskins, B. U. Sevin, M. Penalver and A. Steren (1993). "National survey of ovarian carcinoma. VI. Critical assessment of current International Federation of Gynecology and Obstetrics staging system." Cancer 72(10): 3007-11. O'Donnell, A. J., K. G. Macleod, D. J. Burns, J. F. Smyth and S. P. Langdon (2005). "Estrogen receptor-alpha mediates gene expression changes and growth response in ovarian cancer cells exposed to estrogen." Endocr Relat Cancer 12(4): 851-66. 128 Oesterreich, S., W. Deng, S. Jiang, X. Cui, M. Ivanova, R. Schiff, K. Kang, D. L. Hadsell, J. Behrens and A. V. Lee (2003). "Estrogen-mediated down-regulation of E- cadherin in breast cancer cells." Cancer Res 63(17): 5203-8. Ohkubo, T. and M. Ozawa (2004). "The transcription factor Snail downregulates the tight junction components independently of E-cadherin downregulation." J Cell Sci 117(Pt 9): 1675-85. Onate, S. A., S. Y. Tsai, M. J. Tsai and B. W. O'Malley (1995). "Sequence and characterization of a coactivator for the steroid hormone receptor superfamily." Science 270(5240): 1354-7. Orford, K., C. C. Orford and S. W. Byers (1999). "Exogenous expression of beta- catenin regulates contact inhibition, anchorage-independent growth, anoikis, and radiation-induced cell cycle arrest." J Cell Biol 146(4): 855-68. Otrock, Z. K., J. A. Makarem and A. I. Shamseddine (2007). "Vascular endothelial growth factor family of ligands and receptors: review." Blood Cells Mol Dis 38(3): 258- 68. Ozawa, M., H. Baribault and R. Kemler (1989). "The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species." Embo J 8(6): 1711-7. Ozawa, M. and T. Ohkubo (2001). "Tyrosine phosphorylation of p120(ctn) in v-Src transfected L cells depends on its association with E-cadherin and reduces adhesion activity." J Cell Sci 114(Pt 3): 503-12. 129 Paech, K., P. Webb, G. G. Kuiper, S. Nilsson, J. Gustafsson, P. J. Kushner and T. S. Scanlan (1997). "Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites." Science 277(5331): 1508-10. Peinado, H., D. Olmeda and A. Cano (2007). "Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype?" Nat Rev Cancer 7(6): 415-28. Persson, I. (2000). "Estrogens in the causation of breast, endometrial and ovarian cancers - evidence and hypotheses from epidemiological findings." J Steroid Biochem Mol Biol 74(5): 357-64. Piek, J. M., P. J. van Diest, R. P. Zweemer, J. W. Jansen, R. J. Poort-Keesom, F. H. Menko, J. J. Gille, A. P. Jongsma, G. Pals, P. Kenemans and R. H. Verheijen (2001). "Dysplastic changes in prophylactically removed Fallopian tubes of women predisposed to developing ovarian cancer." J Pathol 195(4): 451-6. Planas-Silva, M. D. and P. K. Waltz (2007). "Estrogen promotes reversible epithelial- to-mesenchymal-like transition and collective motility in MCF-7 breast cancer cells." J Steroid Biochem Mol Biol 104(1-2): 11-21. Porter, W., B. Saville, D. Hoivik and S. Safe (1997). "Functional synergy between the transcription factor Sp1 and the estrogen receptor." Mol Endocrinol 11(11): 1569-80. Pujol, P., J. M. Rey, P. Nirde, P. Roger, M. Gastaldi, F. Laffargue, H. Rochefort and T. Maudelonde (1998). "Differential expression of estrogen receptor-alpha and -beta messenger RNAs as a potential marker of ovarian carcinogenesis." Cancer Res 58(23): 5367-73. 130 Quinn, M. A., R. M. Rome, M. Cauchi and D. W. Fortune (1988). "Steroid receptors and ovarian tumors: variation within primary tumors and between primary tumors and metastases." Gynecol Oncol 31(3): 424-9. Rathi, A., A. K. Virmani, J. O. Schorge, K. J. Elias, R. Maruyama, J. D. Minna, S. C. Mok, L. Girard, D. A. Fishman and A. F. Gazdar (2002). "Methylation profiles of sporadic ovarian tumors and nonmalignant ovaries from high-risk women." Clin Cancer Res 8(11): 3324-31. Revankar, C. M., D. F. Cimino, L. A. Sklar, J. B. Arterburn and E. R. Prossnitz (2005). "A Transmembrane Intracellular Estrogen Receptor Mediates Rapid Cell Signaling 10.1126/science.1106943." Science 307(5715): 1625-1630. Risinger, J. I., A. Berchuck, M. F. Kohler and J. Boyd (1994). "Mutations of the E- cadherin gene in human gynecologic cancers." Nat Genet 7(1): 98-102. Rodriguez, C., A. V. Patel, E. E. Calle, E. J. Jacob and M. J. Thun (2001). "Estrogen replacement therapy and ovarian cancer mortality in a large prospective study of US women." Jama 285(11): 1460-5. Rossouw, J. E. (1999). "Hormone replacement therapy and cardiovascular disease." Curr Opin Lipidol 10(5): 429-34. Rowan, B. G., N. L. Weigel and B. W. O'Malley (2000). "Phosphorylation of steroid receptor coactivator-1. Identification of the phosphorylation sites and phosphorylation through the mitogen-activated protein kinase pathway." J Biol Chem 275(6): 4475-83. Runnebaum, I. B. and E. Stickeler (2001). "Epidemiological and molecular aspects of ovarian cancer risk." J Cancer Res Clin Oncol 127(2): 73-9. 131 Rutherford, T., W. D. Brown, E. Sapi, S. Aschkenazi, A. Munoz and G. Mor (2000). "Absence of estrogen receptor-beta expression in metastatic ovarian cancer." Obstet Gynecol 96(3): 417-21. Sabbah, M., D. Courilleau, J. Mester and G. Redeuilh (1999). "Estrogen induction of the cyclin D1 promoter: involvement of a cAMP response-like element." Proc Natl Acad Sci U S A 96(20): 11217-22. Safe, S. (2001). "Transcriptional activation of genes by 17 beta-estradiol through estrogen receptor-Sp1 interactions." Vitam Horm 62: 231-52. Sankaranarayanan, R. and J. Ferlay (2006). "Worldwide burden of gynaecological cancer: the size of the problem." Best Pract Res Clin Obstet Gynaecol 20(2): 207-25. Sato, T., A. Tanigami, K. Yamakawa, F. Akiyama, F. Kasumi, G. Sakamoto and Y. Nakamura (1990). "Allelotype of breast cancer: cumulative allele losses promote tumor progression in primary breast cancer." Cancer Res 50(22): 7184-9. Savagner, P., K. M. Yamada and J. P. Thiery (1997). "The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition." J Cell Biol 137(6): 1403-19. Schildkraut, J. M., P. J. Schwingl, E. Bastos, A. Evanoff and C. Hughes (1996). "Epithelial ovarian cancer risk among women with polycystic ovary syndrome." Obstet Gynecol 88(4 Pt 1): 554-9. Shimizu, A., J. Nishida, Y. Ueoka, K. Kato, T. Hachiya, Y. Kuriaki and N. Wake (1998). "CyclinG contributes to G2/M arrest of cells in response to DNA damage." Biochem Biophys Res Commun 242(3): 529-33. 132 Shirakihara, T., M. Saitoh and K. Miyazono (2007). "Differential regulation of epithelial and mesenchymal markers by deltaEF1 proteins in epithelial mesenchymal transition induced by TGF-beta." Mol Biol Cell 18(9): 3533-44. Silva, E. G., C. Tornos, M. Deavers, K. Kaisman, K. Gray and D. Gershenson (1998). "Induction of epithelial neoplasms in the ovaries of guinea pigs by estrogenic stimulation." Gynecol Oncol 71(2): 240-6. Slotman, B. J., J. J. Nauta and B. R. Rao (1990). "Survival of patients with ovarian cancer. Apart from stage and grade, tumor progesterone receptor content is a prognostic indicator." Cancer 66(4): 740-4. Song, J., A. Fadiel, V. Edusa, Z. Chen, J. So, H. Sakamoto, D. A. Fishman and F. Naftolin (2005). "Estradiol-induced ezrin overexpression in ovarian cancer: a new signaling domain for estrogen." Cancer Lett 220(1): 57-65. Spagnoli, F. M., C. Cicchini, M. Tripodi and M. C. Weiss (2000). "Inhibition of MMH (Met murine hepatocyte) cell differentiation by TGF(beta) is abrogated by pre-treatment with the heritable differentiation effector FGF1." J Cell Sci 113 ( Pt 20): 3639-47. Stopper, H., E. Schmitt, C. Gregor, S. O. Mueller and W. H. Fischer (2003). "Increased cell proliferation is associated with genomic instability: elevated micronuclei frequencies in estradiol-treated human ovarian cancer cells." Mutagenesis 18(3): 243-7. Sun, J., M. J. Meyers, B. E. Fink, R. Rajendran, J. A. Katzenellenbogen and B. S. Katzenellenbogen (1999). "Novel ligands that function as selective estrogens or antiestrogens for estrogen receptor-alpha or estrogen receptor-beta." Endocrinology 140(2): 800-4. 133 Syed, V., G. Ulinski, S. C. Mok, G. K. Yiu and S. M. Ho (2001). "Expression of gonadotropin receptor and growth responses to key reproductive hormones in normal and malignant human ovarian surface epithelial cells." Cancer Res 61(18): 6768-76. Takeichi, M. (1993). "Cadherins in cancer: implications for invasion and metastasis." Curr Opin Cell Biol 5(5): 806-11. Tamura, G., J. Yin, S. Wang, A. S. Fleisher, T. Zou, J. M. Abraham, D. Kong, K. N. Smolinski, K. T. Wilson, S. P. James, S. G. Silverberg, S. Nishizuka, M. Terashima, T. Motoyama and S. J. Meltzer (2000). "E-Cadherin gene promoter hypermethylation in primary human gastric carcinomas." J Natl Cancer Inst 92(7): 569-73. Thiery, J. P. (2002). "Epithelial-mesenchymal transitions in tumour progression." Nat Rev Cancer 2(6): 442-54. Thomas, P., Y. Pang, E. J. Filardo and J. Dong (2005). "Identity of an Estrogen Membrane Receptor Coupled to a G Protein in Human Breast Cancer Cells 10.1210/en.2004-1064." Endocrinology 146(2): 624-632. Toyooka, K. O., S. Toyooka, A. Maitra, Q. Feng, N. C. Kiviat, A. Smith, J. D. Minna, R. Ashfaq and A. F. Gazdar (2002). "Establishment and validation of real-time polymerase chain reaction method for CDH1 promoter methylation." Am J Pathol 161(2): 629-34. Tremblay, A., G. B. Tremblay, F. Labrie and V. Giguere (1999). "Ligand-independent recruitment of SRC-1 to estrogen receptor beta through phosphorylation of activation function AF-1." Mol Cell 3(4): 513-9. 134 Tripathi, M. K., S. Misra and G. Chaudhuri (2005). "Negative regulation of the expressions of cytokeratins 8 and 19 by SLUG repressor protein in human breast cells." Biochem Biophys Res Commun 329(2): 508-15. Tsai, M. J. and B. W. O'Malley (1994). "Molecular mechanisms of action of steroid/thyroid receptor superfamily members." Annu Rev Biochem 63: 451-86. Tsuda, H., W. D. Zhang, Y. Shimosato, J. Yokota, M. Terada, T. Sugimura, T. Miyamura and S. Hirohashi (1990). "Allele loss on chromosome 16 associated with progression of human hepatocellular carcinoma." Proc Natl Acad Sci U S A 87(17): 6791-4. Veatch, A. L., L. F. Carson and S. Ramakrishnan (1994). "Differential expression of the cell-cell adhesion molecule E-cadherin in ascites and solid human ovarian tumor cells." Int J Cancer 58(3): 393-9. Vihko, R., H. Isotalo, A. Kauppila and P. Vierikko (1983). "Female sex steroid receptors in gynecological malignancies: clinical correlates." J Steroid Biochem 19(1C): 827-32. Vleminckx, K., L. Vakaet, Jr., M. Mareel, W. Fiers and F. van Roy (1991). "Genetic manipulation of E-cadherin expression by epithelial tumor cells reveals an invasion suppressor role." Cell 66(1): 107-19. Voutilainen, K. A., M. A. Anttila, S. M. Sillanpaa, K. M. Ropponen, S. V. Saarikoski, M. T. Juhola and V. M. Kosma (2006). "Prognostic significance of E-cadherin-catenin complex in epithelial ovarian cancer." J Clin Pathol 59(5): 460-7. 135 Waki, T., G. Tamura, T. Tsuchiya, K. Sato, S. Nishizuka and T. Motoyama (2002). "Promoter methylation status of E-cadherin, hMLH1, and p16 genes in nonneoplastic gastric epithelia." Am J Pathol 161(2): 399-403. Watson, C. S., A. M. Norfleet, T. C. Pappas and B. Gametchu (1999). "Rapid actions of estrogens in GH3/B6 pituitary tumor cells via a plasma membrane version of estrogen receptor-alpha." Steroids 64(1-2): 5-13. Webb, P., G. N. Lopez, R. M. Uht and P. J. Kushner (1995). "Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens." Mol Endocrinol 9(4): 443-56. Woodson, K., R. Hayes, L. Wideroff, L. Villaruz and J. Tangrea (2003). "Hypermethylation of GSTP1, CD44, and E-cadherin genes in prostate cancer among US Blacks and Whites." Prostate 55(3): 199-205. Wright, J. W., S. Toth-Fejel, R. L. Stouffer and K. D. Rodland (2002). "Proliferation of rhesus ovarian surface epithelial cells in culture: lack of mitogenic response to steroid or gonadotropic hormones." Endocrinology 143(6): 2198-207. Yagi, T. and M. Takeichi (2000). "Cadherin superfamily genes: functions, genomic organization, and neurologic diversity." Genes Dev 14(10): 1169-80. Yamashita, S., C. Miyagi, T. Fukada, N. Kagara, Y. S. Che and T. Hirano (2004). "Zinc transporter LIVI controls epithelial-mesenchymal transition in zebrafish gastrula organizer." Nature 429(6989): 298-302. Yang, J., S. A. Mani, J. L. Donaher, S. Ramaswamy, R. A. Itzykson, C. Come, P. Savagner, I. Gitelman, A. Richardson and R. A. Weinberg (2004). "Twist, a master 136 regulator of morphogenesis, plays an essential role in tumor metastasis." Cell 117(7): 927-39. Yeh, K. T., M. C. Shih, T. H. Lin, J. C. Chen, J. Y. Chang, C. F. Kao, K. L. Lin and J. G. Chang (2002). "The correlation between CpG methylation on promoter and protein expression of E-cadherin in oral squamous cell carcinoma." Anticancer Res 22(6C): 3971-5. Yokoyama, K., N. Kamata, R. Fujimoto, S. Tsutsumi, M. Tomonari, M. Taki, H. Hosokawa and M. Nagayama (2003). "Increased invasion and matrix metalloproteinase-2 expression by Snail-induced mesenchymal transition in squamous cell carcinomas." Int J Oncol 22(4): 891-8. Yuecheng, Y., L. Hongmei and X. Xiaoyan (2006). "Clinical evaluation of E-cadherin expression and its regulation mechanism in epithelial ovarian cancer." Clin Exp Metastasis 23(1): 65-74.   137 7. APPENDIX   Table 2. List of genes showing at least 50 % changes after E2 treatment for 1, 8, and 24 h Gene name and category Accession no. 1 hr 8 hr 24 hr  (I) CANCER RELATED GENES (Total number : 26) V-MYC AVIAN MYELOCYTOMATOSIS VIRAL ONCOGENE HOMOLOG 2 J03069 0.96 0.695 8.9 increase >2- fold RAB31_ MEMBER RAS ONCOGENE FAMILY U59877 1.325 3.259 4.151 V-MYC AVIAN MYELOCYTOMATOSIS VIRAL ONCOGENE HOMOLOG K02276 5.71 5.407 2.911 V-MYB AVIAN MYELOBLASTOSIS VIRAL ONCOGENE HOMOLOG-LIKE 1 X66087 1.503 1.548 2.849 increase >1- fold V-MYB AVIAN MYELOBLASTOSIS VIRAL ONCOGENE HOMOLOG U22376 1.407 3.088 2.714 V-HA-RAS HARVEY RAT SARCOMA VIRAL ONCOGENE HOMOLOG J00277 1.019 1.391 2.616 V-MAF MUSCULOAPONEUROTIC FIBROSARCOMA (AVIAN) ONCOGENE FAMILY_ PROTEIN G AF05919 5 1.256 1.227 2.336 decrease >2- fold RAN_ MEMBER RAS ONCOGENE FAMILY NM_006325 0.916 0.86 2.2 RAB30_ MEMBER RAS ONCOGENE FAMILY U57092 2.758 1.55 1.79 PIM-1 ONCOGENE M54915 1.296 1.899 1.525  decrease >1-fold RAB_ MEMBER OF RAS ONCOGENE FAMILY-LIKE 2A NM_013412 0.659 1.425 1.5 V-MYB AVIAN MYELOBLASTOSIS VIRAL ONCOGENE HOMOLOG-LIKE 2 X13293 0.6 1.162 1.487 RAB32_ MEMBER RAS ONCOGENE FAMILY U59878 0.871 1.371 1.46 FGFR1 ONCOGENE PARTNER Y18046 0.67 1.15 1.427 V-MAF MUSCULOAPONEUROTIC FIBROSARCOMA (AVIAN)ONCOGENE FAMILY_ PROTEIN F AL02197 7 0.851 2.036 1.31 SUPPRESSION OF TUMORIGENICITY 16 (MELANOMA DIFFERENTIATION) U16261 0.705 0.803 1.254 HOMOLOG OF MOUSE MAT-1 ONCOGENE L37385 0.713 1.265 1.12 V-ABL ABELSON MURINE LEUKEMIA VIRAL ONCOGENE HOMOLOG 1 NM_0051 57 0.512 1.958 1.104 GLIOMA TUMOR SUPPRESSOR CANDIDATE REGION GENE 2 AL12206 3 2.158 0.806 1.048 RAB9_ MEMBER RAS ONCOGENE FAMILY U44103 1.462 1.258 0.989 RAB2_ MEMBER RAS ONCOGENE FAMILY-LIKE AL050259 1.325 0.893 0.97 C-MER PROTO-ONCOGENE TYROSINE KINASE U08023 1.8 1.255 0.936   Number RAB5A_ MEMBER RAS ONCOGENE FAMILY M28215 0.355 0.289 0.935    3 UBIQUITIN SPECIFIC PROTEASE 6 (TRE-2 ONCOGENE) X63547 0.547 0.588 0.823    11 RAP1A_ MEMBER OF RAS ONCOGENE FAMILY M22995 1.094 1.084 0.788    0 V-ERB-B2 AVIAN ERYTHROBLASTIC LEUKEMIA VIRAL ONCOGENE HOMOLOG 3 M34309 1.489 1.35 0.348    2  138  Gene name and category Accession no. 1 hr 8 hr 24 hr  (II) CELL CYCLE RELATED GENES (Total number : 40) CYCLIN A2 X51688 1.735 1.142 3.259 CYCLIN D1 (PRAD1: PARATHYROID ADENOMATOSIS 1) X59798 2.377 1.485 2.47 CYCLIN B1 M25753 0.992 0.666 1.983 CYCLIN B2 AK001404 1.385 1.01 1.686 CYCLIN-DEPENDENT KINASE (CDC2-LIKE) 10 X78342 0.919 1.164 1.613 CYCLIN-DEPENDENT KINASE 4 U37022 0.898 4.016 1.593 CYCLIN K AF060515 1.064 0.885 1.574 CYCLIN E1 M74093 0.818 1.128 1.368 CYCLIN C M74091 1.258 0.89 1.339 CYCLIN-DEPENDENT KINASE 7 (HOMOLOG OF XENOPUS MO15 CDK-ACTIVATING KINASE) L20320 1.086 2.488 1.296 CYCLIN-DEPENDENT KINASE INHIBITOR 3 (CDK2- ASSOCIATED DUAL SPECIFICITY PHOSPHATASE) L25876 1.555 1.155 1.28 CYCLIN F Z36714 1.225 1.15 1.222 CYCLIN-DEPENDENT KINASE 9 (CDC2-RELATED KINASE) X80230 0.543 0.469 1.128 TETRACYCLINE TRANSPORTER-LIKE PROTEIN L11669 2.529 1.131 1.101 CELL CYCLE PROGRESSION 8 PROTEIN AB033080 0.546 1.101 1.1 CYCLIN-DEPENDENT KINASE-LIKE 1 (CDC2-RELATED KINASE) AK00148 8 1.121 1.491 1.084 CYCLIN-DEPENDENT KINASE 8 X85753 0.872 1.4 1.067 CYCLIN E2 AF091433 0.94 1.78 1.066 CYCLIN D3 M92287 1.999 1.349 1.045 CYCLIN-DEPENDENT KINASE 2 M68520 1.076 0.649 1.012 HOMO SAPIENS CDNA FLJ11211 FIS_ CLONE PLACE1007955_ HIGHLY SIMILAR TO HOMO SAPIENS CYCLIN-D BINDING AK00207 3 1.68 1.233 0.988 HEME OXYGENASE (DECYCLING) 2 NM_002134 2.482 1.9 0.984 CELL CYCLE PROGRESSION 2 PROTEIN AF011792 0.963 1.882 0.966 HIR (HISTONE CELL CYCLE REGULATION DEFECTIVE_ S. CEREVISIAE) HOMOLOG A X89887 0.752 1.174 0.923 GTPASE_ HUMAN HOMOLOG OF E. COLI ESSENTIAL CELL CYCLE PROTEIN ERA AF08265 7 0.834 0.939 0.911 CYCLIN-DEPENDENT KINASE 6 X66365 0.974 0.77 0.909 CYCLIN-E BINDING PROTEIN 1 AB027289 1.47 1.85 0.87 CYCLIN T1 AF048730 1.121 2.053 0.866 CYCLIN G ASSOCIATED KINASE D88435 0.595 1.087 0.866 CYCLIN T2 AF048731 0.825 0.831 0.847 CYCLIN-DEPENDENT KINASE INHIBITOR 1B (P27_ KIP1) S76988 0.679 0.629 0.803 PUTATIVE CYCLIN G1 INTERACTING PROTEIN U61837 2.178 0.61 0.737 CYCLIN-DEPENDENT KINASE 5 L04658 0.777 0.581 0.717 CYCLIN-DEPENDENT KINASE INHIBITOR 1A (P21_ CIP1) U03106 1.229 0.637 0.709 139  Gene name and category Accession no. 1 hr 8 hr 24 hr  D-TYPE CYCLIN-INTERACTING PROTEIN 1 AF082569 1.071 0.899 0.673 CYCLIN G1 X77794 0.774 0.958 0.655   Number CELL CYCLE PROGRESSION 3 PROTEIN AF011793 0.763 1.068 0.644    1 S100 CALCIUM-BINDING PROTEIN A6 (CALCYCLIN) J02763 1.237 1.066 0.625    9 CYCLIN I AF135162 2.233 1.164 0.562    0 CYCLIN G2 U47414 0.536 0.404 0.485    2  (III) APOPTOSIS RELATED GENES (Total number : 30) CASPASE 6_ APOPTOSIS-RELATED CYSTEINE PROTEASE U20536 0.789 2.499 2.216 APOPTOSIS INHIBITOR 4 (SURVIVIN) U75285 0.985 1.185 1.942 CASPASE 8_ APOPTOSIS-RELATED CYSTEINE PROTEASE X98172 1.674 1.657 1.88 TGFB1-INDUCED ANTI-APOPTOTIC FACTOR 1 D86970 1.411 1.109 1.791 NUCLEOLAR PROTEIN 3 (APOPTOSIS REPRESSOR WITH CARD DOMAIN) AF04324 4 0.777 0.925 1.573 CASPASE 2_ APOPTOSIS-RELATED CYSTEINE PROTEASE (NEURAL PRECURSOR CELL EXPRESSED_ DEVELOPMENTALLY DOW U13022 0.896 0.537 1.46 CASPASE 5_ APOPTOSIS-RELATED CYSTEINE PROTEASE U28015 1.007 0.753 1.447 SERINE/THREONINE KINASE 17A (APOPTOSIS- INDUCING) AB01142 0 0.601 0.674 1.336 CASPASE 10_ APOPTOSIS-RELATED CYSTEINE PROTEASE U60519 0.976 2.305 1.273 APOPTOSIS-ASSOCIATED SPECK-LIKE PROTEIN CONTAINING A CARD NM_0132 58 0.954 1.066 1.179 REGULATOR OF FAS-INDUCED APOPTOSIS AF057557 0.639 0.821 1.175 APOPTOSIS REGULATOR AF173003 1.637 0.65 1.1 NUCLEOSIDE DIPHOSPHATE KINASE TYPE 6 (INHIBITOR OF P53-INDUCED APOPTOSIS-ALPHA) AF05194 1 1.584 0.719 1.037 CASPASE 14_ APOPTOSIS-RELATED CYSTEINE PROTEASE AF09787 4 0.692 0.83 0.91 APOPTOSIS-ASSOCIATED TYROSINE KINASE AB014541 0.361 1.165 0.896 APOPTOSIS-RELATED PROTEIN PNAS-1 AF229831 1.334 2.6 0.88 BCL2-INTERACTING KILLER (APOPTOSIS-INDUCING) NM_001197 1.067 0.556 0.873 APOPTOSIS ANTAGONIZING TRANSCRIPTION FACTOR AJ249940 1.042 0.402 0.846 CASP8 AND FADD-LIKE APOPTOSIS REGULATOR Y14039 1.377 1.387 0.83 CASPASE 4_ APOPTOSIS-RELATED CYSTEINE PROTEASE AL050391 0.85 0.863 0.813 REQUIEM_ APOPTOSIS RESPONSE ZINC FINGER GENE AF001433 1.098 0.929 0.804 APOPTOSIS INHIBITOR 5 U83857 0.592 0.959 0.795 APOPTOSIS RELATED PROTEIN APR-3 NM_016085 0.803 0.786 0.781 HOMO SAPIENS MRNA FOR APOPTOTIC PROTEASE ACTIVATING FACTOR-1 (APAF-1 GENE) (SHORT FORM) AJ243107 1.405 1.367 0.715 PRKC_ APOPTOSIS_ WT1_ REGULATOR U63809 0.984 0.303 0.619 BCL2-LIKE 11 (APOPTOSIS FACILITATOR) AF032457 1.126 0.662 0.618 140  Gene name and category Accession no. 1 hr 8 hr 24 hr      Number APOPTOSIS INHIBITOR 1 U37547 1.655 2.036 0.551 CASPASE 7_ APOPTOSIS-RELATED CYSTEINE PROTEASE U67319 0.886 1.484 0.507    4 PROGRAMMED CELL DEATH 8 (APOPTOSIS-INDUCING FACTOR) AL04970 3 1.478 1.133 0.467    0 APOPTOTIC PROTEASE ACTIVATING FACTOR NM_013229 1.154 1.153 0.4    5  (IV) SIGNAILING RELATED GENES (Total number : 138) AMPHIREGULIN (SCHWANNOMA-DERIVED GROWTH FACTOR) M30704 1.486 4.216 4.47 HUMAN INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 5 (IGFBP5) MRNA L27560 0.799 1.06 2.621 TNF? ELASTIN MICROFIBRIL INTERFACE LOCATED PROTEIN NM_0070 46 1.387 1.016 2.603 INSULIN-LIKE GROWTH FACTOR-BINDING PROTEIN 4 U20982 1.685 2.017 2.572 NEPHROSIS 1_ CONGENITAL_ FINNISH TYPE (NEPHRIN) AF035835 1.513 0.693 2.392 TERATOCARCINOMA-DERIVED GROWTH FACTOR 3_ PSEUDOGENE M96956 1.656 0.733 2.347 STEM CELL GROWTH FACTOR; LYMPHOCYTE SECRETED C-TYPE LECTIN AF02004 4 1.35 1.335 2.347 PLATELET-ACTIVATING FACTOR ACETYLHYDROLASE_ ISOFORM IB_ ALPHA SUBUNIT (45KD) NM_0004 30 1.228 1.65 2.101 CHEMOKINE-LIKE FACTOR 3_ ALTERNATIVELY SPLICED NM_016326 2.071 1.758 1.839 TGFB1-INDUCED ANTI-APOPTOTIC FACTOR 1 D86970 1.411 1.109 1.791 LOW DENSITY LIPOPROTEIN-RELATED PROTEIN- ASSOCIATED PROTEIN 1 (ALPHA-2-MACROGLOBULIN RECEPTOR-ASSOCIA M63959 0.795 1.202 1.737 TGF BETA RECEPTOR ASSOCIATED PROTEIN -1 AF022795 1.446 1.398 1.725 FRIZZLED (DROSOPHILA) HOMOLOG 4 NM_012193 1.026 0.766 1.674 HUMAN GROWTH FACTOR-REGULATED TYROSINE KINASE SUBSTRATE U43895 0.625 2.255 1.632 EGF-LIKE-DOMAIN_ MULTIPLE 1 AF231023 1.141 1.057 1.625 PHOSPHOFRUCTOKINASE_ PLATELET D25328 1.311 1.207 1.615 CD27-BINDING (SIVA) PROTEIN U82938 1.149 1.381 1.603 TYROSINE KINASE WITH IMMUNOGLOBULIN AND EPIDERMAL GROWTH FACTOR HOMOLOGY DOMAINS X60957 0.648 0.764 1.6 TRANSFORMING GROWTH FACTOR_ BETA 1 X02812 1.423 1.524 1.6 ANTI-MULLERIAN HORMONE NM_000479 1.393 1.456 1.58 FIBROBLAST GROWTH FACTOR (ACIDIC) INTRACELLULAR BINDING PROTEIN AF01018 7 1.212 1.44 1.487 FIBROBLAST GROWTH FACTOR RECEPTOR 1 (FMS- RELATED TYROSINE KINASE 2_ PFEIFFER SYNDROME) X66945 1.307 1.116 1.46 INSULIN-LIKE GROWTH FACTOR 1 RECEPTOR NM_000875 1.037 0.493 1.457 HEPATOMA-DERIVED GROWTH FACTOR (HIGH- MOBILITY GROUP PROTEIN 1-LIKE) D16431 1.291 1.332 1.443 FGFR1 ONCOGENE PARTNER Y18046 0.67 1.15 1.427 COLONY STIMULATING FACTOR 3 RECEPTOR (GRANULOCYTE) M59820 0.578 1.192 1.422 FIBROBLAST GROWTH FACTOR RECEPTOR 4 L03840 1.056 1.54 1.421 141  Gene name and category Accession no. 1 hr 8 hr 24 hr  HUMAN DNA SEQUENCE FROM CLONE CTA-212A2 ON CHROMOSOME 22Q12 CONTAINS THE GENE FOR TNF- INDUCIBLE PROT Z95114 1.868 1.942 1.4 THYROID HORMONE RESPONSIVE SPOT14 (RAT) HOMOLOG Y08409 1.063 0.834 1.396 BRAIN AND REPRODUCTIVE ORGAN-EXPRESSED (TNFRSF1A MODULATOR) AK00009 7 1.283 1.768 1.363 MILK FAT GLOBULE-EGF FACTOR 8 PROTEIN U58516 1.347 0.999 1.362 TNF RECEPTOR-ASSOCIATED FACTOR 5 AB000509 0.58 1.244 1.326 COP9 (CONSTITUTIVE PHOTOMORPHOGENIC_ ARABIDOPSIS_ HOMOLOG) SUBUNIT 3 AF03164 7 1.064 1.135 1.322 FRIZZLED (DROSOPHILA) HOMOLOG 5 U43318 1.418 1.418 1.322 CHORIONIC SOMATOMAMMOTROPIN HORMONE 2 J03071 1.576 1.35 1.312 GROWTH FACTOR RECEPTOR-BOUND PROTEIN 14 L76687 2.125 1.048 1.29 INTEGRIN_ BETA-LIKE 1 (WITH EGF-LIKE REPEAT DOMAINS) AF07275 2 0.554 1.964 1.29 EPIDERMAL GROWTH FACTOR RECEPTOR PATHWAY SUBSTRATE 15 Z29064 0.739 1.42 1.26 NEUROTROPHIN 6_ ALPHA NM_004149 1.286 0.784 1.241 EGF-LIKE-DOMAIN_ MULTIPLE 5 AB011542 0.632 0.808 1.226 GUANINE NUCLEOTIDE EXCHANGE FACTOR(S. CEREVISIAE CDC25-RELATED_ SON OF SEVENLESS- RELATED) L26584 2.833 0.716 1.22 INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 2 (36KD) X16302 0.824 1.495 1.211 PLATELET-DERIVED GROWTH FACTOR ALPHA POLYPEPTIDE X06374 0.724 1.553 1.208 INTERLEUKIN-1 RECEPTOR-ASSOCIATED KINASE 1 L76191 1.979 3.932 1.201 FIBROBLAST GROWTH FACTOR 12B NM_004113 2.068 0.824 1.2 INTERLEUKIN-1 SUPERFAMILY E NM_014438 1.363 0.874 1.197 GROWTH FACTOR INDEPENDENT 1 U67369 1.054 1.046 1.185 LUTEINIZING HORMONE BETA POLYPEPTIDE X00264 0.865 0.812 1.159 INSULIN INDUCED GENE 1 U96876 0.61 0.825 1.146 EPHRIN-A4 AJ006352 1.025 1.942 1.121 PHOSPHOLIPASE A2_ GROUP VII (PLATELET- ACTIVATING FACTOR ACETYLHYDROLASE_ PLASMA) U24577 0.927 1.091 1.118 PLACENTAL GROWTH FACTOR_ VASCULAR ENDOTHELIAL GROWTH FACTOR-RELATED PROTEIN X54936 4.01 1.038 1.1 EPHRIN-A2 AJ007292 0.892 0.784 1.09 PLATELET-DERIVED GROWTH FACTOR RECEPTOR_ ALPHA POLYPEPTIDE M21574 1.515 0.667 1.075 VGF NERVE GROWTH FACTOR INDUCIBLE Y12661 0.914 0.561 1.074 PLATELET-ACTIVATING FACTOR ACETYLHYDROLASE_ ISOFORM IB_ GAMMA SUBUNIT (29KD) D63391 1.389 1.178 1.072 FRIZZLED (DROSOPHILA) HOMOLOG 3 NM_017412 0.922 1.309 1.07 CHORIONIC SOMATOMAMMOTROPIN HORMONE 1 (PLACENTAL LACTOGEN) U18919 1.331 1.388 1.05 EPHRIN-B3 U66406 2.039 1.272 1.027 TGFB INDUCIBLE EARLY GROWTH RESPONSE S81439 1.67 1.079 1.023 142  Gene name and category Accession no. 1 hr 8 hr 24 hr  TNFRSF1A-ASSOCIATED VIA DEATH DOMAIN L41690 1.58 1.171 1.022 DEATH RECEPTOR 6 AK001504 1.773 0.483 1.018 HYPOCRETIN (OREXIN) NEUROPEPTIDE PRECURSOR AF041240 0.818 0.938 1.004 LATENT TRANSFORMING GROWTH FACTOR BETA BINDING PROTEIN 2 Z37976 1.24 0.588 1 TNF RECEPTOR-ASSOCIATED FACTOR 2 U12597 0.379 1.572 0.995 PLATELET-DERIVED GROWTH FACTOR A-CHAIN [HUMAN_ GENOMIC_ 3559 NT 2 SEGMENTS] S50869 0.567 1.634 0.993 BUTYRATE RESPONSE FACTOR 2 (EGF-RESPONSE FACTOR 2) U07802 1.818 0.283 0.981 FIBROBLAST GROWTH FACTOR RECEPTOR 3 (ACHONDROPLASIA_ THANATOPHORIC DWARFISM) M64347 0.772 0.684 0.978 INSULIN-LIKE GROWTH FACTOR II (INTRON 7) [HUMAN_ GENOMIC_ 1702 NT] S73149 0.896 0.702 0.97 FIBROBLAST GROWTH FACTOR 9 (GLIA-ACTIVATING FACTOR) D14838 0.746 0.688 0.952 GROWTH FACTOR RECEPTOR-BOUND PROTEIN 10 D86962 0.919 1.207 0.948 GROWTH FACTOR_ ERV1 (S. CEREVISIAE)-LIKE (AUGMENTER OF LIVER REGENERATION) U31176 0.7 0.654 0.946 INSULIN-LIKE GROWTH FACTOR 1 (SOMATOMEDIN C) X57025 2.132 1.825 0.943 LYMPHOTOXIN BETA RECEPTOR (TNFR SUPERFAMILY_ MEMBER 3 L04270 1.042 1.138 0.934 EGF-LIKE-DOMAIN_ MULTIPLE 3 AB011539 0.962 0.821 0.925 PLATELET/ENDOTHELIAL CELL ADHESION MOLECULE (CD31 ANTIGEN) L34657 1.1 1 0.925 INSULINOMA-ASSOCIATED 1 M93119 0.488 1.175 0.919 TRANSFORMING GROWTH FACTOR_ BETA-INDUCED_ 68KD M77349 1.364 0.204 0.917 VASCULAR ENDOTHELIAL GROWTH FACTOR AF022375 0.869 0.553 0.914 PARATHYROID HORMONE-LIKE HORMONE J03580 1.074 0.965 0.909 GROWTH FACTOR RECEPTOR-BOUND PROTEIN 7 D43772 1.016 0.491 0.908 TRANSFORMING GROWTH FACTOR_ BETA RECEPTOR II (70-80KD) D50683 0.998 1.193 0.908 COLONY STIMULATING FACTOR 2 RECEPTOR_ BETA_ LOW-AFFINITY (GRANULOCYTE-MACROPHAGE) M59941 0.745 1.03 0.899 TNF RECEPTOR-ASSOCIATED FACTOR 6 U78798 0.62 0.678 0.882 BONE MORPHOGENETIC PROTEIN RECEPTOR_ TYPE IA Z22535 0.645 1.27 0.881 TNF RECEPTOR-ASSOCIATED FACTOR 3 U21092 0.726 1.64 0.878 PLATELET-ACTIVATING FACTOR RECEPTOR D10202 2.065 1.726 0.861 ENDOTHELIAL CELL GROWTH FACTOR 1 (PLATELET- DERIVED) S72487 0.619 0.787 0.854 FIBROBLAST GROWTH FACTOR 17 AB009249 1.225 1.484 0.853 FAS (TNFRSF6) ASSOCIATED FACTOR 1 AJ271408 0.861 1.099 0.834 LATENT TRANSFORMING GROWTH FACTOR BETA BINDING PROTEIN 1 M34057 0.647 0.848 0.831 B-CELL GROWTH FACTOR 1 (12KD) M15530 0.693 1.217 0.83 BONE MORPHOGENETIC PROTEIN 5 AL133386 0.864 0.623 0.829 EGF-LIKE-DOMAIN_ MULTIPLE 2 D87469 2.533 2.38 0.827 EPHRIN-B2 U81262 0.776 0.281 0.823 143  Gene name and category Accession no. 1 hr 8 hr 24 hr  FRIZZLED (DROSOPHILA) HOMOLOG 1 AB017363 1.204 0.887 0.82 INSULIN-LIKE GROWTH FACTOR 2 RECEPTOR Y00285 1.062 0.64 0.809 PLATELET-ACTIVATING FACTOR ACETYLHYDROLASE_ ISOFORM IB_ BETA SUBUNIT (30KD) D63390 0.929 0.346 0.789 BONE MORPHOGENETIC PROTEIN 4 U43842 0.768 0.663 0.786 MSH (DROSOPHILA) HOMEO BOX HOMOLOG 2 NM_002449 0.902 1.132 0.785 FAS (TNFRSF6)-ASSOCIATED VIA DEATH DOMAIN X84709 1.033 1.47 0.784 FEM-1-LIKE DEATH RECEPTOR BINDING PROTEIN AB007856 0.824 0.459 0.78 VASCULAR ENDOTHELIAL GROWTH FACTOR B U43368 0.991 1.159 0.775 FRIZZLED (DROSOPHILA) HOMOLOG 6 AB012911 0.745 0.621 0.774 EPIDERMAL GROWTH FACTOR RECEPTOR PATHWAY SUBSTRATE 8 U12535 0.857 0.773 0.77 INSULIN-LIKE 3 (LEYDIG CELL) AC005952 1.35 1.075 0.769 LATENT TRANSFORMING GROWTH FACTOR BETA BINDING PROTEIN 4 Y13622 0.642 0.531 0.757 INSULIN-LIKE GROWTH FACTOR 2 (SOMATOMEDIN A) X07868 0.899 0.799 0.751 GONADOTROPIN-RELEASING HORMONE 2 AF036329 1.112 0.696 0.749 EGF-LIKE-DOMAIN_ MULTIPLE 4 AB011541 0.818 0.227 0.737 TRAF AND TNF RECEPTOR-ASSOCIATED PROTEIN AL031775 0.951 0.781 0.733 GLYCOPROTEIN IX (PLATELET) X52997 1.025 0.674 0.73 COP9 (CONSTITUTIVE PHOTOMORPHOGENIC_ ARABIDOPSIS_ HOMOLOG) SUBUNIT 5 U65928 0.743 1.342 0.729 CARDIOTROPHIN-LIKE CYTOKINE; NEUROTROPHIN-1/B- CELL STIMULATING FACTOR-3 NM_0132 46 0.641 1.046 0.721 HUMAN HLA CLASS III REGION CONTAINING NOTCH4 GENE_ PARTIAL SEQUENCE_ HOMEOBOX PBX2 (HPBX) GENE_ RECE U89336 0.811 0.966 0.718 FRIZZLED (DROSOPHILA) HOMOLOG 7 AB017365 1.069 1.425 0.717 GROWTH FACTOR RECEPTOR-BOUND PROTEIN 2 M96995 1.067 1.998 0.713 LPS-INDUCED TNF-ALPHA FACTOR NM_004862 0.989 0.629 0.703 LATENT TRANSFORMING GROWTH FACTOR BETA BINDING PROTEIN 3 AF13596 0 0.655 1.03 0.699 FRIZZLED (DROSOPHILA) HOMOLOG 2 NM_001466 0.881 0.833 0.691 TNF RECEPTOR-ASSOCIATED FACTOR 4 X80200 0.683 0.992 0.672 INSULIN-DEGRADING ENZYME M21188 1.119 0.678 0.652 INTEGRIN_ ALPHA 2B (PLATELET GLYCOPROTEIN IIB OF IIB/IIIA COMPLEX_ ANTIGEN CD41B) NM_0004 19 0.85 1.277 0.648 NEUROPEPTIDE Y RECEPTOR Y2 NM_000910 0.965 1.162 0.626 GLYCOPROTEIN IB (PLATELET)_ BETA POLYPEPTIDE U59632 1.276 1.189 0.612 SON OF SEVENLESS (DROSOPHILA) HOMOLOG 1 L13857 1.284 0.632 0.607 FIBROBLAST GROWTH FACTOR 16 AB009391 0.01 0.542 0.599 SPROUTY (DROSOPHILA) HOMOLOG 1 (ANTAGONIST OF FGF SIGNALING) AF04103 7 1.382 0.588 0.597 144  Gene name and category Accession no. 1 hr 8 hr 24 hr  NOTCH (DROSOPHILA) HOMOLOG 3 U97669 0.761 0.642 0.572 HGF ACTIVATOR D50030 0.534 0.989 0.564 BONE MORPHOGENETIC PROTEIN 7 (OSTEOGENIC PROTEIN 1) X51801 1.224 0.502 0.51 NERVE GROWTH FACTOR RECEPTOR (TNFR SUPERFAMILY_ MEMBER 16) M14764 0.996 0.936 0.494 BONE MORPHOGENETIC PROTEIN RECEPTOR_ TYPE II (SERINE/THREONINE KINASE) NM_0012 04 0.149 1.497 0.441 TRANSFORMING GROWTH FACTOR BETA-STIMULATED PROTEIN TSC-22 AJ222700 0.858 0.961 0.436   Number BONE MORPHOGENETIC PROTEIN 1 NM_006129 1.002 0.839 0.434    2 TRANSFORMING GROWTH FACTOR_ BETA RECEPTOR I (ACTIVIN A RECEPTOR TYPE II-LIKE KINASE_ 53KD) L11695 0.739 0.519 0.393    19 EPHRIN-A1 M57730 0.713 0.54 0.345    4 PLATELET-ACTIVATING FACTOR ACETYLHYDROLASE 2 (40KD) D87845 0.712 0.466 0.179    19  (V) NUCLEIC ACID BINDING RELATED GENES (Total number : 252) EUKARYOTIC TRANSLATION INITIATION FACTOR 2B_ SUBUNIT 1 (ALPHA_ 26KD) X95648 0.654 1.117 6.099 BASIC TRANSCRIPTION FACTOR 3-LIKE 2 M90355 2.567 1.38 4.975 DEAD/H (ASP-GLU-ALA-ASP/HIS) BOX POLYPEPTIDE 5 (RNA HELICASE_ 68KD) X52104 1.026 0.741 3.877 BASIC TRANSCRIPTION FACTOR 3_ LIKE 1 M90354 1.189 0.998 3.14 GENERAL TRANSCRIPTION FACTOR IIE_ POLYPEPTIDE 1 (ALPHA SUBUNIT_ 56KD) X63468 1.157 0.657 2.93 HAIRLESS PROTEIN (PUTATIVE SINGLE ZINC FINGER TRANSCRIPTION FACTOR PROTEIN_ RESPONSIBLE FOR AUTOSOMA AJ277165 1.224 1.279 2.925 RNA POLYMERASE I AND TRANSCRIPT RELEASE FACTOR AK00071 5 1.253 0.665 2.89 TRANSCRIPTION FACTOR AJ130894 1.943 0.42 2.88 EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 ALPHA 1-LIKE 14 NM_0014 03 1.847 3.707 2.852 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN F AK001364 1.046 1.245 2.775 SMALL NUCLEAR RIBONUCLEOPROTEIN POLYPEPTIDES B AND B1 AL04965 0 2.1 0.83 2.756 HUMAN DNA SEQUENCE FROM CLONE 581F12 ON CHROMOSOME XQ21. CONTAINS EUKARYOTIC TRANSLATION INITIATION AL03131 3 1.055 0.519 2.677 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 6 (48KD) U62962 0.523 0.992 2.669 RNA BINDING MOTIF PROTEIN 6 AF069517 0.821 1.014 2.325 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN C (C1/C2) M16342 2.953 1.501 2.133 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A/B U76713 2.666 0.983 2.104 DEAD/H (ASP-GLU-ALA-ASP/HIS) BOX POLYPEPTIDE 10 (RNA HELICASE) U28042 0.728 3.15 1.971 GENERAL TRANSCRIPTION FACTOR IIH_ POLYPEPTIDE 3 (34KD SUBUNIT) Z30093 1.29 0.655 1.958 SMALL NUCLEAR RIBONUCLEOPROTEIN POLYPEPTIDE B AL03442 8 0.718 0.253 1.915 BASIC TRANSCRIPTION FACTOR 3 X53280 0.483 0.882 1.87 PROPHET OF PIT1_ PAIRED-LIKE HOMEODOMAIN TRANSCRIPTION FACTOR AF07621 5 1.619 0.611 1.85 145 Gene name and category Accession no. 1 hr 8 hr 24 hr  PAIRED-LIKE HOMEODOMAIN TRANSCRIPTIONFACTOR1 U70370 1.584 2.3 1.845 NUCLEAR TRANSCRIPTION FACTOR_ X-BOX BINDING 1 U15306 0.769 1.103 1.825 GENERAL TRANSCRIPTION FACTOR IIE_ POLYPEPTIDE 2 (BETA SUBUNIT_ 34KD) X63469 0.922 1.549 1.81 TELOMERIC REPEAT BINDING FACTOR 2 AF002999 1.021 1.182 1.789 MYC-ASSOCIATED ZINC FINGER PROTEIN (PURINE- BINDING TRANSCRIPTION FACTOR) M94046 0.992 1.16 1.753 GA-BINDING PROTEIN TRANSCRIPTION FACTOR_ BETA SUBUNIT 1 (53KD) U13045 1.551 0.61 1.75 INHIBITOR OF DNA BINDING 2_ DOMINANT NEGATIVE HELIX-LOOP-HELIX PROTEIN M96843 0.836 1.02 1.746 SMALL NUCLEAR RIBONUCLEOPROTEIN POLYPEPTIDE G X85373 1.377 1.93 1.714 RNA POLYMERASE II TRANSCRIPTIONAL REGULATION MEDIATOR (MED6_ S. CEREVISIAE_ HOMOLOG OF) AF07472 3 1.005 1.071 1.692 EUKARYOTIC TRANSLATION INITIATION FACTOR 2B_ SUBUNIT 2 (BETA_ 39KD) AF03528 0 0.678 2.193 1.683 SIMILAR TO DNA-DIRECTED RNA POLYMERASE I (135 KDA) AK00167 8 0.583 0.934 1.661 GENERAL TRANSCRIPTION FACTOR IIIC_ POLYPEPTIDE 4 (90KD) NM_0122 04 0.899 0.854 1.65 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 8 (110KD) AC00254 4 1.263 1.926 1.622 SMALL NUCLEAR RIBONUCLEOPROTEIN POLYPEPTIDE F X85372 1.363 1.577 1.621 TRANSCRIPTION FACTOR NSLP1; NOVEL SP1 LIKE ZINC FINGER TRANSCRIPTION FACTOR; RANTES FACTOR OF LATE A NM_0159 95 1.213 1.042 1.575 TRANSCRIPTION FACTOR AP-2 GAMMA (ACTIVATING ENHANCER-BINDING PROTEIN 2 GAMMA) U85658 2.618 2.334 1.572 TRANSCRIPTION FACTOR 1_ HEPATIC; LF-B1_ HEPATIC NUCLEAR FACTOR (HNF1)_ ALBUMIN PROXIMAL FACTOR M57732 1.415 0.528 1.546 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN D U02019 0.618 0.736 1.534 BASIC TRANSCRIPTION FACTOR 3-LIKE 3 M90356 0.548 1.388 1.533 EUKARYOTIC TRANSLATION INITIATION FACTOR 2C_ 1 NM_012199 1.292 1.032 1.527 RNA BINDING MOTIF PROTEIN 9 AL049748 1.969 1.221 1.525 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A1 X12671 1.926 3.121 1.521 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN D- LIKE D89678 1.162 1.05 1.52 ACTIVATED RNA POLYMERASE II TRANSCRIPTION COFACTOR 4 U12979 1.37 1.547 1.501 GENERAL TRANSCRIPTION FACTOR IIA_ 2 (12KD SUBUNIT) U14193 1.247 0.959 1.491 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 5 (EPSILON_ 47KD) U94855 1.674 1.213 1.475 PUTATIVE HOMEODOMAIN TRANSCRIPTION FACTOR 1 AJ011863 1 1.075 1.475 GENERAL TRANSCRIPTION FACTOR IIIC_ POLYPEPTIDE 5 (63KD) NM_0120 87 1.284 1.417 1.471 NUCLEAR TRANSCRIPTION FACTOR Y_ GAMMA AK000346 0.597 0.984 1.448 E2F TRANSCRIPTION FACTOR 4_ P107/P130-BINDING S75174 0.985 1.215 1.44 PUTATIVE NUCLEOLAR RNA HELICASE AJ131712 1.163 3.122 1.439 E2F TRANSCRIPTION FACTOR 3 D38550 0.945 1.127 1.432 TRANSCRIPTION FACTOR NRF AJ011812 1.467 1.13 1.408 TRANSCRIPTION FACTOR AP-4 (ACTIVATING ENHANCER-BINDING PROTEIN 4) S73885 1.25 1.848 1.406 146  Gene name and category Accession no. 1 hr 8 hr 24 hr  POU TRANSCRIPTION FACTOR NM_014352 1.308 0.662 1.403 U2 SMALL NUCLEAR RIBONUCLEOPROTEIN AUXILIARY FACTOR_ SMALL SUBUNIT 2 D49677 1.129 1.616 1.403 RNA POLYMERASE I SUBUNIT AF008442 1.898 1.189 1.4 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN L X16135 1.297 1.146 1.4 GENERAL TRANSCRIPTION FACTOR IIF_ POLYPEPTIDE 2 (30KD SUBUNIT) X16901 0.626 1.766 1.4 DEAD/H (ASP-GLU-ALA-ASP/HIS) BOX POLYPEPTIDE 9 (RNA HELICASE A_ NUCLEAR DNA HELICASE II; LEUKOPHYSIN L13848 0.845 0.903 1.383 EUKARYOTIC TRANSLATION TERMINATION FACTOR 1 X81625 1.325 0.785 1.352 SIMILAR TO MOUSE GLT3 OR D. MALANOGASTER TRANSCRIPTION FACTOR IIB NM_0132 42 0.867 1.191 1.347 SMALL NUCLEAR RIBONUCLEOPROTEIN D2 POLYPEPTIDE (16.5KD) U15008 1.022 3.533 1.345 LIM HOMEOBOX TRANSCRIPTION FACTOR 1_ BETA AF059575 1.207 1.42 1.343 EUKARYOTIC TRANSLATION INITIATION FACTOR 4E M15353 2.423 0.861 1.331 EUKARYOTIC TRANSLATION ELONGATION FACTOR 2 Z11692 0.804 0.744 1.317 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 2 (BETA_ 36KD) U39067 1.662 0.717 1.313 SMALL NUCLEAR RIBONUCLEOPROTEIN D3 POLYPEPTIDE (18KD) U15009 1.025 1.745 1.305 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A2/B1 M29064 2.519 2.967 1.299 SMALL NUCLEAR RIBONUCLEOPROTEIN POLYPEPTIDE E X12466 0.351 1.18 1.296 NUCLEAR FACTOR I/C (CCAAT-BINDING TRANSCRIPTION FACTOR) X12492 1.06 1.467 1.288 U2 SMALL NUCLEAR RIBONUCLEOPROTEIN AUXILIARY FACTOR (65KD) X64044 0.818 1.348 1.278 SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 3 (ACUTE-PHASE RESPONSE FACTOR) L29277 1.098 1.6 1.273 EUKARYOTIC TRANSLATION INITIATION FACTOR 2_ SUBUNIT 1 (ALPHA_ 35KD ) J02645 0.958 1.699 1.266 EUKARYOTIC TRANSLATION INITIATION FACTOR 5A M23419 1.219 1.116 1.263 NUCLEAR RNA HELICASE_ DECD VARIANT OF DEAD BOX FAMILY U90426 0.742 1.111 1.263 TRANSCRIPTION FACTOR DP-1 L23959 1.085 0.536 1.257 GENERAL TRANSCRIPTION FACTOR IIA_ 1 (37KD AND 19KD SUBUNITS) D14887 2.05 0.864 1.253 SMALL NUCLEAR RIBONUCLEOPROTEIN POLYPEPTIDE A X13482 0.666 1.221 1.247 TRANSCRIPTION FACTOR 3 (E2A IMMUNOGLOBULIN ENHANCER BINDING FACTORS E12/E47) M31523 0.765 0.323 1.245 EUKARYOTIC TRANSLATION INITIATION FACTOR 2B_ SUBUNIT 5 (EPSILON_ 82KD) U23028 1.723 1.297 1.239 TRANSCRIPTION FACTOR (SMIF GENE) AJ275986 0.64 0.919 1.239 BASIC LEUCINE ZIPPER TRANSCRIPTION FACTOR_ ATF- LIKE AF01689 8 0.872 0.808 1.238 TRANSCRIPTION FACTOR 15 (BASIC HELIX-LOOP-HELIX) U08336 1.968 0.508 1.231 RNA HELICASE NM_016130 0.58 0.931 1.225 GLUCOCORTICOID RECEPTOR DNA BINDING FACTOR 1 M73077 1.281 0.844 1.219 EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 EPSILON 1 AF05418 6 0.815 2.063 1.218 147  Gene name and category Accession no. 1 hr 8 hr 24 hr  GENERAL TRANSCRIPTION FACTOR IIIA D32257 0.834 2.669 1.217 RNA POLYMERASE I TRANSCRIPTION FACTOR RRN3 AF001549 0.666 0.72 1.215 GENERAL TRANSCRIPTION FACTOR IIIC_ POLYPEPTIDE 1 (ALPHA SUBUNIT_ 220KD ) U02619 0.655 1.027 1.208 EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 BETA 1 X60656 1.239 6.735 1.205 PROMOTER REGION OF GENE ENCODING THE 48 KD SUBUNIT OF RNA POLYMERASE III AND COMPLEMENTING THE BN51 L15301 0.846 1.118 1.181 UNDIFFERENTIATED EMBRYONIC CELL TRANSCRIPTION FACTOR 1 AB01107 6 0.91 2.597 1.159 GENERAL TRANSCRIPTION FACTOR IIH_ POLYPEPTIDE 2 (44KD SUBUNIT) NM_0015 15 0.506 0.669 1.152 GENERAL TRANSCRIPTION FACTOR IIH_ POLYPEPTIDE 4 (52KD SUBUNIT) Y07595 1.051 1.202 1.143 E74-LIKE FACTOR 3 (ETS DOMAIN TRANSCRIPTION FACTOR) AF01730 7 1.322 0.752 1.138 EUKARYOTIC TRANSLATION INITIATION FACTOR 2_ SUBUNIT 2 (BETA_ 38KD ) AL03166 8 1.779 2.937 1.137 NUCLEAR TRANSCRIPTION FACTOR Y_ BETA X59710 1.537 0.74 1.133 TRANSCRIPTION FACTOR A_ MITOCHONDRIAL X64269 0.824 1.631 1.125 TS TRANSLATION ELONGATION FACTOR_ MITOCHONDRIAL L37936 1.22 0.81 1.121 YY1 TRANSCRIPTION FACTOR NM_003403 0.625 1.375 1.119 E2F TRANSCRIPTION FACTOR 6 AF041381 0.807 1.235 1.114 AT-BINDING TRANSCRIPTION FACTOR 1 L32832 0.977 1.008 1.112 SMALL NUCLEAR RIBONUCLEOPROTEIN POLYPEPTIDE C X12517 1.255 1.409 1.108 HEAT SHOCK TRANSCRIPTION FACTOR 4 AB029348 0.843 1.25 1.1 ATP-DEPENDENT RNA HELICASE AK001652 1.029 1.658 1.081 U5 SNRNP-SPECIFIC PROTEIN_ 200 KDA (DEXH RNA HELICASE FAMILY) Z70200 1.172 0.612 1.08 TRANSCRIPTION TERMINATION FACTOR_ RNA POLYMERASE II AF07377 1 1.115 0.687 1.065 DAMAGE-SPECIFIC DNA BINDING PROTEIN 2 (48KD) U18300 1 3.915 1.064 TRANSCRIPTION FACTOR CA150 AF017789 0.793 1.125 1.06 EUKARYOTIC TRANSLATION INITIATION FACTOR 4E BINDING PROTEIN 1 L36055 1.085 0.727 1.047 PUTATIVE TRANSLATION INITIATION FACTOR AL050005 0.957 1.026 1.044 E2F TRANSCRIPTION FACTOR 2 L22846 0.934 0.994 1.043 SERUM RESPONSE FACTOR (C-FOS SERUM RESPONSE ELEMENT-BINDING TRANSCRIPTION FACTOR) J03161 1.035 1.477 1.038 NUCLEAR FACTOR I/X (CCAAT-BINDING TRANSCRIPTION FACTOR) L31881 1.053 0.588 1.033 EUKARYOTIC TRANSLATION INITIATION FACTOR 4E BINDING PROTEIN 2 L36056 0.536 0.726 1.032 E2F TRANSCRIPTION FACTOR 1 U47677 0.888 0.775 1.025 RUNT-RELATED TRANSCRIPTION FACTOR 3 Z35278 0.61 0.332 1.02 SP3 TRANSCRIPTION FACTOR X68560 1.296 0.968 1.016 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A0 U23803 0.88 0.685 1.011 148  Gene name and category Accession no. 1 hr 8 hr 24 hr  EUKARYOTIC TRANSLATION INITIATION FACTOR 2_ SUBUNIT 3 (GAMMA_ 52KD) L19161 1.6 0.75 1.01 EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 BETA 2 X60489 1.807 0.836 1.007 TU TRANSLATION ELONGATION FACTOR_ MITOCHONDRIAL S75463 2.145 0.745 1.005 RUNT-RELATED TRANSCRIPTION FACTOR 1 (ACUTE MYELOID LEUKEMIA 1; AML1 ONCOGENE) D43968 0.862 0.917 1.004 DNA2 (DNA REPLICATION HELICASE_ YEAST_ HOMOLOG)-LIKE D42046 0.685 0.951 0.991 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN H1 (H) L22009 0.959 0.863 0.988 SMALL NUCLEAR RIBONUCLEOPROTEIN POLYPEPTIDE A M60784 0.888 1.565 0.987 EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 DELTA (GUANINE NUCLEOTIDE EXCHANGE PROTEIN) Z21507 1.256 1.502 0.986 GENERAL TRANSCRIPTION FACTOR II_ I_ PSEUDOGENE 1 AF03661 3 0.901 0.807 0.986 TRANSCRIPTION TERMINATION FACTOR_ RNA POLYMERASE I X83973 0.733 0.48 0.986 SJOGREN SYNDROME ANTIGEN A1 (52KD_ RIBONUCLEOPROTEIN AUTOANTIGEN SS-A/RO) M62800 1.15 1.488 0.985 HUMAN TRANSLATION INITIATION FACTOR EIF-2ALPHA MRNA_ 3UTR U26032 0.852 1.591 0.983 GENERAL TRANSCRIPTION FACTOR IIIC_ POLYPEPTIDE 2 (BETA SUBUNIT_ 110KD) D13636 0.839 0.659 0.98 POLYPYRIMIDINE TRACT BINDING PROTEIN (HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN I) X66975 1.134 1.083 0.975 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 1 (ALPHA_ 35KD) AK00200 6 0.633 0.79 0.972 SJOGREN SYNDROME ANTIGEN A2 (60KD_ RIBONUCLEOPROTEIN AUTOANTIGEN SS-A/RO) M25077 0.547 0.507 0.966 ACTIVATING TRANSCRIPTION FACTOR 2 X15875 1.125 0.757 0.963 RNA BINDING MOTIF PROTEIN_ X CHROMOSOME Z23064 0.883 0.987 0.959 EUKARYOTIC TRANSLATION INITIATION FACTOR 4E BINDING PROTEIN 3 AB02900 8 1.024 1.011 0.957 CCAAT-BOX-BINDING TRANSCRIPTION FACTOR M37197 0.922 1.647 0.935 PUTATIVE DNA BINDING PROTEIN AJ010014 1.112 1.356 0.932 TRANSCRIPTION FACTOR AP-2 ALPHA (ACTIVATING ENHANCER-BINDING PROTEIN 2 ALPHA) X77343 1.11 1.015 0.932 TRANSCRIPTION FACTOR 19 (SC1) U25826 1.162 1.354 0.924 EUKARYOTIC TRANSLATION INITIATION FACTOR 1A AL079283 1.14 1.051 0.921 POU DOMAIN_ CLASS 2_ TRANSCRIPTION FACTOR 2 M36542 1.066 0.751 0.919 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN U (SCAFFOLD ATTACHMENT FACTOR A) AF06884 6 0.702 1.191 0.91 SMALL NUCLEAR RIBONUCLEOPROTEIN D1 POLYPEPTIDE (16KD) J03798 0.841 1.91 0.909 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 10 (THETA_ 150/170KD) D50929 0.762 0.905 0.908 LIVER-SPECIFIC BHLH-ZIP TRANSCRIPTION FACTOR AD000684 1.035 1.363 0.901 EUKARYOTIC TRANSLATION INITIATION FACTOR 4 GAMMA_ 2 U73824 1.497 1.867 0.9 TRANSCRIPTION FACTOR-LIKE 1 D43642 0.799 0.371 0.897 EUKARYOTIC TRANSLATION INITIATION FACTOR 4E- LIKE 3 AF03895 7 0.48 0.992 0.894 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN M L03532 1.175 1.247 0.89 149  Gene name and category Accession no. 1 hr 8 hr 24 hr  GENERAL TRANSCRIPTION FACTOR 3 NM_016328 1.451 0.815 0.888 TRANSCRIPTION FACTOR NM_013282 1.163 0.671 0.887 RNA BINDING MOTIF PROTEIN 10 AL137421 0.91 1.111 0.882 SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 5B U47686 0.559 1.023 0.877 TRANSCRIPTION FACTOR 17 AF116030 0.84 0.601 0.875 TRANSCRIPTION FACTOR 7-LIKE 2 (T-CELL SPECIFIC_ HMG-BOX) Y11306 1.23 0.389 0.872 EUKARYOTIC TRANSLATION INITIATION FACTOR 5 AL080102 0.794 0.838 0.872 SP2 TRANSCRIPTION FACTOR D28588 1.906 0.855 0.858 CHROMODOMAIN HELICASE DNA BINDING PROTEIN 1- LIKE AF05417 7 0.863 0.551 0.858 POU DOMAIN_ CLASS 3_ TRANSCRIPTION FACTOR 3 AB001835 0.945 2.405 0.854 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 7 (ZETA_ 66/67KD) AL02231 3 0.769 1.118 0.852 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 3 (GAMMA_ 40KD) U54559 0.938 1.876 0.851 APOPTOSIS ANTAGONIZING TRANSCRIPTION FACTOR AJ249940 1.042 0.402 0.846 METAL-REGULATORY TRANSCRIPTION FACTOR 1 X78710 1.158 0.921 0.844 TRANSCRIPTIONAL REPRESSOR U25435 0.683 1.144 0.843 HEAT SHOCK TRANSCRIPTION FACTOR 1 M64673 0.489 2.058 0.843 ACTIVATING TRANSCRIPTION FACTOR 5 AB021663 0.912 1.146 0.833 DEAD/H (ASP-GLU-ALA-ASP/HIS) BOX POLYPEPTIDE 8 (RNA HELICASE) D50487 1.17 1.072 0.83 RNA HELICASE FAMILY AJ223948 0.479 1.25 0.828 RNA BINDING MOTIF PROTEIN 3 U28686 1.022 0.823 0.827 PUTATIVE RNA BINDING PROTEIN AF227192 0.817 1.841 0.824 APEX NUCLEASE (MULTIFUNCTIONAL DNA REPAIR ENZYME) S43127 2.007 0.906 0.82 COFACTOR REQUIRED FOR SP1 TRANSCRIPTIONAL ACTIVATION_ SUBUNIT 8 (34KD) AF10425 2 0.963 1.179 0.819 SMALL NUCLEAR RIBONUCLEOPROTEIN 70KD POLYPEPTIDE (RNP ANTIGEN) AL11739 9 0.782 0.773 0.816 TELOMERIC REPEAT BINDING FACTOR (NIMA- INTERACTING) 1 U40705 1.293 1.226 0.809 COFACTOR REQUIRED FOR SP1 TRANSCRIPTIONAL ACTIVATION_ SUBUNIT 6 (77KD) AK00167 4 1.695 0.589 0.808 DEAD/H (ASP-GLU-ALA-ASP/HIS) BOX POLYPEPTIDE 6 (RNA HELICASE_ 54KD) D17532 1.099 0.724 0.808 GENERAL TRANSCRIPTION FACTOR IIF_ POLYPEPTIDE 1 (74KD SUBUNIT) X64037 1.599 1.022 0.787 TRANSCRIPTION FACTOR 8 (REPRESSES INTERLEUKIN 2 EXPRESSION) D15050 0.947 0.801 0.785 RNA BINDING MOTIF_ SINGLE STRANDED INTERACTING PROTEIN 1_ PSEUDOGENE D82351 0.601 1.6 0.782 TRANSCRIPTION FACTOR 6-LIKE 1 (MITOCHONDRIAL TRANSCRIPTION FACTOR 1-LIKE) M62810 0.839 0.529 0.777 EUKARYOTIC TRANSLATION INITIATION FACTOR 2 ALPHA KINASE 3 AF19333 9 0.718 1.616 0.766 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN K X72727 0.769 0.789 0.761 150  Gene name and category Accession no. 1 hr 8 hr 24 hr  TRANSCRIPTION FACTOR BINDING TO IGHM ENHANCER 3 AL16198 5 0.667 0.347 0.756 GA-BINDING PROTEIN TRANSCRIPTION FACTOR_ ALPHA SUBUNIT (60KD) U13044 0.805 0.803 0.751 E4F TRANSCRIPTION FACTOR 1 U87269 0.965 0.97 0.749 E2F TRANSCRIPTION FACTOR 5_ P130-BINDING U31556 1.348 1.214 0.747 ACTIVATING TRANSCRIPTION FACTOR 4 (TAX- RESPONSIVE ENHANCER ELEMENT B67) AL02231 2 0.787 1.201 0.745 DOUBLESEX AND MAB-3 RELATED TRANSCRIPTION FACTOR 1 AL16213 1 1.475 1.15 0.744 RNA BINDING MOTIF PROTEIN 4 U89505 2.069 1.787 0.742 CHROMODOMAIN HELICASE DNA BINDING PROTEIN 4 X86691 0.697 1.112 0.732 EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 ALPHA 1 X16869 0.869 0.741 0.728 PRE-B-CELL LEUKEMIA TRANSCRIPTION FACTOR 2 X59842 1.196 0.789 0.719 ACTIVATING TRANSCRIPTION FACTOR 6 AB015856 0.915 0.768 0.716 ACTIVATING TRANSCRIPTION FACTOR 1 X55544 0.84 0.366 0.714 EUKARYOTIC TRANSLATION INITIATION FACTOR 4 GAMMA_ 3 AF01207 2 0.803 0.687 0.714 RNA POLYMERASE I 16 KDA SUBUNIT NM_015972 0.781 1.404 0.71 EUKARYOTIC TRANSLATION INITIATION FACTOR 4A_ ISOFORM 2 AL13768 1 0.857 0.185 0.709 TRANSCRIPTION FACTOR-LIKE 5 (BASIC HELIX-LOOP- HELIX) AB01212 4 0.702 1.347 0.707 RNA HELICASE-RELATED PROTEIN AF083255 1.499 1.077 0.704 TRANSLATION INITIATION FACTOR IF2 AB018284 0.86 1.197 0.699 RNA BINDING MOTIF PROTEIN 8 NM_005105 0.703 0.889 0.693 ACTIVATING TRANSCRIPTION FACTOR 3 NM_004024 1.026 0.748 0.689 DNA BINDING PROTEIN FOR SURFACTANT PROTEIN B L10405 0.932 1.019 0.689 EUKARYOTIC TRANSLATION INITIATION FACTOR 4 GAMMA_ 1 AF10491 3 0.932 1.549 0.689 TRANSCRIPTION FACTOR 20 (AR1) AB006630 0.659 1.129 0.687 RNA BINDING PROTEIN AB016092 1.031 0.986 0.679 HYPOXIA-INDUCIBLE FACTOR 1_ ALPHA SUBUNIT (BASIC HELIX-LOOP-HELIX TRANSCRIPTION FACTOR) AF05012 7 0.837 0.122 0.679 PROSTATE EPITHELIUM-SPECIFIC ETS TRANSCRIPTION FACTOR AF07153 8 0.365 1.876 0.672 PRE-B-CELL LEUKEMIA TRANSCRIPTION FACTOR 1 M86546 0.941 0.507 0.67 E74-LIKE FACTOR 1 (ETS DOMAIN TRANSCRIPTION FACTOR) M82882 1.201 1.83 0.667 DAMAGE-SPECIFIC DNA BINDING PROTEIN 1 (127KD) U32986 0.968 0.898 0.665 RNA BINDING MOTIF_ SINGLE STRANDED INTERACTING PROTEIN 1 X77494 0.504 0.469 0.662 SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 1_ 91KD M97935 0.266 0.663 0.66 POU DOMAIN_ CLASS 2_ TRANSCRIPTION FACTOR 1 X13403 1.1 1.498 0.654 STEROL REGULATORY ELEMENT BINDING TRANSCRIPTION FACTOR 2 U02031 0.673 0.818 0.654 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 4 (DELTA_ 44KD) AF02083 3 0.848 1.134 0.653 151  Gene name and category Accession no. 1 hr 8 hr 24 hr  GENERAL TRANSCRIPTION FACTOR IIH_ POLYPEPTIDE 1 (62KD SUBUNIT) M95809 0.738 1.644 0.652 STEROL REGULATORY ELEMENT BINDING TRANSCRIPTION FACTOR 1 U00968 0.937 0.73 0.647 CHROMODOMAIN HELICASE DNA BINDING PROTEIN 1 AF006513 0.495 0.774 0.642 GENERAL TRANSCRIPTION FACTOR II_ I AF035737 0.569 1.053 0.627 UPSTREAM TRANSCRIPTION FACTOR 1 X55666 1.236 0.748 0.625 NUCLEAR TRANSCRIPTION FACTOR Y_ ALPHA AL031778 0.66 0.844 0.623 COFACTOR REQUIRED FOR SP1 TRANSCRIPTIONAL ACTIVATION_ SUBUNIT 3 (130KD) AB03304 2 0.75 1.086 0.622 BTB AND CNC HOMOLOGY 1_ BASIC LEUCINE ZIPPER TRANSCRIPTION FACTOR 1 AB00280 3 0.477 0.789 0.62 DEK ONCOGENE (DNA BINDING) X64229 0.739 0.681 0.619 TRANSCRIPTION FACTOR ELONGIN A2 AB030834 0.979 0.816 0.61 RECQ PROTEIN-LIKE (DNA HELICASE Q1-LIKE) L36140 0.73 1.102 0.605 EUKARYOTIC TRANSLATION INITIATION FACTOR 3_ SUBUNIT 9 (ETA_ 116KD) U78525 1.48 1.855 0.604 EUKARYOTIC TRANSLATION INITIATION FACTOR 4A_ ISOFORM 1 D13748 0.397 1.146 0.591 RNA HELICASE AF038963 0.572 0.905 0.583 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN R AF000364 1.329 2.465 0.575 EUKARYOTIC TRANSLATION ELONGATION FACTOR 1 GAMMA X63526 0.747 1.866 0.571 TRANSCRIPTION FACTOR 12 (HTF4_ HELIX-LOOP-HELIX TRANSCRIPTION FACTORS 4) NM_0032 05 0.742 0.398 0.569 PUTATIVE DNA/CHROMATIN BINDING MOTIF AJ243706 0.847 0.728 0.557 UPSTREAM TRANSCRIPTION FACTOR 2_ C-FOS INTERACTING Y07661 1.532 0.588 0.553 M-PHASE PHOSPHOPROTEIN 10 (U3 SMALL NUCLEOLAR RIBONUCLEOPROTEIN) X98494 0.716 0.933 0.549 E74-LIKE FACTOR 4 (ETS DOMAIN TRANSCRIPTION FACTOR) U32645 0.705 1.067 0.542 RNA BINDING MOTIF PROTEIN 5 NM_005778 0.849 1.309 0.533 CHROMODOMAIN HELICASE DNA BINDING PROTEIN 3 U91543 0.83 0.954 0.526 GENERAL TRANSCRIPTION FACTOR IIIC_ POLYPEPTIDE 3 (102KD) NM_0120 86 0.73 0.914 0.503 HEAT SHOCK TRANSCRIPTION FACTOR 2 NM_004506 1.397 1.652 0.478 TRANSCRIPTION FACTOR EC D43945 0.558 0.842 0.449 INHIBITOR OF DNA BINDING 1_ DOMINANT NEGATIVE HELIX-LOOP-HELIX PROTEIN S78825 0.682 0.644 0.418   Number SPI-B TRANSCRIPTION FACTOR (SPI-1/PU.1 RELATED) X66079 0.47 1.109 0.407    3 GENERAL TRANSCRIPTION FACTOR IIB NM_001514 1.7 0.753 0.403    38 INHIBITOR OF DNA BINDING 3_ DOMINANT NEGATIVE HELIX-LOOP-HELIX PROTEIN AL02115 4 0.718 0.527 0.385    1 INTERFERON-STIMULATED TRANSCRIPTION FACTOR 3_ GAMMA (48KD) M87503 0.822 0.943 0.34    28  152

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0066503/manifest

Comment

Related Items