Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification, regulation and lineage tracing of embryonic olfactory progenitors Murdoch, Barbara 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2008_fall_murdoch_barbara.pdf [ 127.85MB ]
Metadata
JSON: 24-1.0066464.json
JSON-LD: 24-1.0066464-ld.json
RDF/XML (Pretty): 24-1.0066464-rdf.xml
RDF/JSON: 24-1.0066464-rdf.json
Turtle: 24-1.0066464-turtle.txt
N-Triples: 24-1.0066464-rdf-ntriples.txt
Original Record: 24-1.0066464-source.json
Full Text
24-1.0066464-fulltext.txt
Citation
24-1.0066464.ris

Full Text

IDENTIFICATION, REGULATION AND LINEAGE TRACING OF EMBRYONIC OLFACTORY PROGENITORS by BARBARA MURDOCH A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2008  Barbara Murdoch, 2008 ii ABSTRACT Neurogenesis occurs in exclusive regions in the adult nervous system, the subventricular zone and dentate gyrus in the brain, and olfactory epithelium (OE) in the periphery. Cell replacement after death or injury, occurs to varying degrees in neural tissue, and is thought to be dependent upon the biological responses of stem and/or progenitor cells. Despite the progress made to identify adult OE and central nervous system (CNS) progenitors and lineage trace their progeny, our spatial and temporal understanding of embryonic OE neuroglial progenitors has been stalled by the paucity of identifiable genes able to distinguish individual candidate progenitors. In the developing CNS, radial glia serve as both neural progenitors and scaffolding for migrating neuroblasts and are identified by the expression of a select group of antigens, including nestin. Here, I show that the embryonic OE contains a novel radial glial-like progenitor (RGLP) that is not detected in adult OE. RGLPs express the radial glial antigens nestin, GLAST and RC2, but not brain lipid binding protein (BLBP), which, distinct from CNS radial glia, is instead found in olfactory ensheathing cells, a result confirmed using lineage tracing with BLBP-cre mice. Nestin-cre-mediated lineage tracing with three different reporters reveals that only a subpopulation of nestin-expressing RGLPs activate the “CNS-specific” nestin regulatory elements, and produce spatially restricted neurons in the OE and vomeronasal organ. The dorsal-medial restriction of transgene-activating cells is also seen in the embryonic OE of Nestin-GFP transgenic mice, where GFP is found in a subpopulation of GFP+ Mash1+ neuronal progenitors, despite the fact that endogenous nestin expression is found in RGLPs throughout the OE. In vitro, embryonic OE progenitors produce three biologically distinct colony subtypes, that when generated from Nestin-cre/ZEG mice, produce GFP+ neurons, recapitulating their in vivo phenotype, and are enriched for the most neurogenic colony subtype. Neurogenesis in vitro is driven by the proliferation of nestin+ progenitors in response to FGF2. I thus provide evidence for a novel neurogenic precursor, the RGLP of the OE, that can be regulated by FGF2, and provide the first evidence for intrinsic differences in the origin and spatiotemporal potential of distinct progenitors during OE development. iii TABLE OF CONTENTS ABSTRACT................................................................................................................. ii TABLE OF CONTENTS............................................................................................. iii LIST OF TABLES .................................................................................................... viii LIST OF FIGURES .................................................................................................... ix LIST OF ABBREVIATIONS ...................................................................................... xii ACKNOWLEDGEMENTS........................................................................................ xiv CHAPTER 1 LITERATURE REVIEW AND INTRODUCTION...........................................1 1.1 Definitions of neural stem and progenitor cells .................................................... 1 1.2 Origins and identification of CNS neural progenitor cells ..................................... 3 1.2.1 Neuroepithelial cells are precursors for radial glia ...................................... 3 1.2.2 Identification and function of CNS radial glia .............................................. 4 1.2.3 Neurogenesis in the adult mammalian brain: the subventricular and subgranular zones ........................................................................................ 6 1.2.3.1 The subventricular zone contains progenitors and stem cells........... 7 1.2.3.2 Neural progenitors in the subgranular zone of the dentate gyrus.... 10 1.3 Development of the olfactory epithelium............................................................ 10 1.3.1 The olfactory epithelium is derived from the olfactory placode ................. 10 1.3.2 Ontogenic changes in the embryonic, postnatal and adult olfactory epithelia....................................................................................................... 11 1.3.3 Structure and cellular constituents of the postnatal OE............................ 11 1.3.4 Structure and cellular constituents of the embryonic OE.......................... 14 1.4 Regulation of olfactory neurogenesis................................................................. 16 1.4.1 Growth factors .......................................................................................... 17 1.4.2 Extracellular matrix molecules in OE and CNS neurogenic regions ......... 24 1.4.3 Transcription factors ................................................................................. 25 1.5 In vitro assays of neural progenitors .................................................................. 31 1.5.1 SVZ-derived neurospheres: The neurosphere assay ............................... 31 1.5.2 Explants, colony assays and cell lines from the embryonic OE................ 34 1.5.3 Colony assays in the postnatal OE........................................................... 35 iv 1.6 Methods for lineage tracing neural stem/progenitor cells................................... 36 1.6.1 Dye, vector and DNA-based lineage tracing strategies ............................ 36 1.6.2 Genetic labeling using transgenic mice and Cre-mediated recombination ............................................................................................. 37 1.7 Introduction and project summary...................................................................... 40 CHAPTER 2 MATERIALS AND METHODS ...................................................................43 2.1 Tissue Preparation............................................................................................. 43 2.2 Immunofluorescence and immunohistochemistry .............................................. 43 2.3 Calculating the percentage and distribution of proliferating cells in OE ............. 45 2.4 Immunocytochemistry ........................................................................................ 45 2.5 Quantification of antigen expressing cells.......................................................... 45 2.6 Histochemistry ................................................................................................... 46 2.7 Image Analysis................................................................................................... 46 2.8 OE and SVZ cell isolation .................................................................................. 46 2.8.1 OE tissue.................................................................................................. 47 2.8.2 SVZ tissues .............................................................................................. 47 2.8.3 Adult SVZ ................................................................................................. 48 2.9 In vitro progenitor assays................................................................................... 48 2.10 Enhancement of colony production.................................................................. 50 2.10.1 ECM substrates...................................................................................... 50 2.10.2 Olfactory ensheathing cell conditioned media ........................................ 50 2.10.3 E13.5 OE semi-adherent colony conditioned media............................... 51 2.11 FGF signal blockade and BrdU labeling........................................................... 51 2.12 Transgenic mice............................................................................................... 52 2.13 Genotyping and phenotyping transgenic mice ................................................. 54 2.14 In vitro progenitor assays-Nestin Cre/ZEG mice.............................................. 54 2.15 SDS-PAGE and Western blotting..................................................................... 55 2.16 Immunoprecipitation......................................................................................... 55 2.17 Reverse transcription polymerase chain reaction (RT-PCR) ........................... 56 2.18 Statistics .......................................................................................................... 56 vCHAPTER 3 IDENTIFICATION AND LINEAGE TRACING OF NESTIN-EXPRESSING RADIAL GLIAL-LIKE OLFACTORY PROGENITORS.....................................................59 3.1 Introduction ........................................................................................................ 59 3.2 Results............................................................................................................... 62 3.2.1 During early development, the OE contains radial glia-like cells .............. 62 3.2.2 E13.5 OE forms semi-adherent colonies containing mitotic Nestin+ lineage-negative cells in vitro ...................................................................... 68 3.2.3 Cells derived from E13.5 OE colonies express neuronal, glial and radial glial antigens ..................................................................................... 75 3.2.4 Lineage tracing of nestin-expressing olfactory progenitors:a subpopulation of nestin-expressing progenitors are neuronal precursors... 78 3.2.5 GFP+ Nestin-cre/ZEG progenitors enriched in neurogenic colony subtypes...................................................................................................... 84 3.2.6 Temporal detection of nestin-expressing olfactory progenitors in vivo ..... 87 3.2.7 Early embryonic detection of nestin transgene-activating olfactory progenitors .................................................................................................. 87 3.2.8 Lineage tracing of BLBP-expressing olfactory progenitors: Evidence  for glial-restricted precursors...................................................................... 89 3.3 Discussion ......................................................................................................... 94 CHAPTER 4 ONTOGENIC CHANGES IN OE PROGENITOR BIOLOGY DURING ADULT, PERINATAL AND EMBRYONIC DEVELOPMENT .........................................100 4.1 Introduction ...................................................................................................... 100 4.2 Results............................................................................................................. 103 4.2.1 The changing distribution and frequency of proliferating olfactory cells during ontogeny ........................................................................................ 103 4.2.2 In vitro readouts of postnatal day 5 and adult OE: spheres and adherent colonies...................................................................................... 105 4.2.3 Isolation of E13.5 OE for in vitro progenitor readouts ............................. 110 4.2.4 Testing for clonal density........................................................................ 112 4.2.5 Continued neurogenesis in self-renewing embryonic OE colonies......... 114 vi 4.2.6 Testing conditions for the enhancement of embryonic progenitor colony production...................................................................................... 116 4.3 Discussion ....................................................................................................... 119 CHAPTER 5  REGULATION OF NESTIN+ EMBRYONIC OLFACTORY PROGENITORS BY FGF SIGNALING .........................................................................124 5.1 Introduction ...................................................................................................... 124 5.2 Results............................................................................................................. 126 5.2.1 FGF receptor 1,2 expression in E13.5 OE.............................................. 126 5.2.2 FGF receptor 1,2 expression in postnatal day 5 OE............................... 126 5.2.3 FGF signaling regulates E13.5 OE colony number and subtypes .......... 129 5.2.4 EGF regulates E13.5 OE colony number and subtypes, partly via FGF signaling............................................................................................ 134 5.2.5 FGF signaling increases the number of colonies containing Mash1+ neuronal progenitors ................................................................................. 134 5.2.6 FGF2 dose dependence of OE neurosphere number and size on collagen..................................................................................................... 139 5.2.7 In vitro paracrine factors support colony production in absence of exogenous growth factors ......................................................................... 139 5.2.8 OE neurospheres express progenitor and neuronal markers ................. 142 5.2.9 FGF2 increases neurogenesis via a nestin+ progenitor ......................... 145 5.3 Discussion ....................................................................................................... 147 CHAPTER 6 DISCUSSION...........................................................................................152 6.1 Summary of results and conclusions ............................................................... 152 6.2 Future directions .............................................................................................. 160 6.2.1 Model of embryonic and postnatal neurogliogenesis.............................. 160 6.2.2 FGF2 regulation of Nestin+ progenitors in the ORN lineage .................. 162 6.2.3 Is there a Nestin-negative stem cell in the OE?...................................... 164 6.2.4 Identification of molecular signatures distinguishing Nestin transgene activators from non-activators .................................................. 165 vii 6.2.5 Do Nestin transgene-activating progenitors contribute to postnatal OE neurogenesis? .......................................................................................... 166 REFERENCES.............................................................................................................171 APPENDIX 1 ANIMAL CARE CERTIFICATE............................................................... 203 viii LIST OF TABLES Table 2.1 Antibodies and methods for their usage. ........................................................ 57 Table 3.1 Percentage of antigen expressing cells detected in E13.5 OE cells plated in vitro for 2.5 to 48 hours..................................................................... 71 Table 3.2 The percentage of E13.5 OE colony core cells expressing nestin or PCNA for individual colony subtypes. ..................................................................... 73 Table 3.3 Distribution of OE E13.5 colony subtypes with FGF2 or EGF. ....................... 74 Table 4.1  Frequency of progenitor output from E13.5, P5 and adult OE cultured using similar conditions in EGF and FGF2. ............................................. 108 ix LIST OF FIGURES Figure 1.1 Hierarchical compartments from stem to differentiated cells. .......................... 2 Figure 1.2 Role of CNS radial glia in cortical histogenesis ............................................... 5 Figure 1.3 Composition and organization of the CNS SVZ and SGZ ............................... 8 Figure 1.4 Organization and structure of embryonic and adult OE................................. 12 Figure 1.5 The OE zones. .............................................................................................. 15 Figure 1.6 Model of FGF2 regulation of the olfactory receptor neuron lineage .............. 23 Figure 1.7 CNS SVZ neurosphere assay ....................................................................... 32 Figure 1.8 Fate mapping using Cre-loxP........................................................................ 38 Figure 3.1 Progenitors in E13.5 OE expressing radial glia antigens declines by early postnatal development............................................................................... 63 Figure 3.2 Co-localization of radial glial antigens with Nestin using two independent Nestin antibodies................................................................................ 65 Figure  3.3 Nestin expression in cells ensheathing olfactory receptor neuron axons ..... 69 Figure 3.4 E13.5 OE forms novel semi-adherent colonies in vitro containing a subpopulation of dividing Nestin+ progenitors .................................... 70 Figure  3.5 Cells in E13.5 OE colony cores and their progeny express neuronal, glial and radial glial antigens ................................................................................... 76 Figure  3.6 Constructs of transgenic mice used in this study ......................................... 79 Figure 3.7 Nestin-cre/ZEG lineage tracing reveals zonally restricted production of olfactory and vomeronasal neurons................................................... 80 Figure 3.8 Nestin regulatory elements direct reporter expression to a subpopulation of cells in the OCAM negative dorsal-medial zone........................... 83 Figure 3.9 Nestin- and OMP- cre/ZEG β galactosidase histochemistry in the olfactory epithelium ................................................................................................. 85 Figure 3.10 E13.5 colonies from Nestin-cre/ZEG OE produce predominantly neuronal, GFP-expressing progeny ........................................................................ 86 Figure  3.11 Detection of radial glial-like progenitors in the early embryonic OE ........... 88 Figure 3.12 Regional restriction of GFP+ reporter cells in both embryonic Nestin-cre/ZEG and Nestin-GFP transgenic mice................................................... 90 xFigure  3.13 BLBP is expressed in the olfactory ensheathing glia lineage ..................... 93  Figure 4.1 Changes in the distribution and frequency of mitotic E13.5 to adult OE progenitors ............................................................................................. 104 Figure 4.2 Postnatal day 5 OE forms spheres and adherent colonies with increased plating efficiency after passaging .................................................. 106 Figure 4.3 In vivo and in vitro correlates of progeny cells of postnatal and adult OE progenitors ...................................................................................... 109 Figure 4.4 Isolation of OE from E13.5 embryos ........................................................... 111 Figure 4.5 Testing for the clonality of plated cells ........................................................ 113 Figure 4.6 Neurogenesis continues in passaged E13.5 OE semi-adherent colonies ... 115 Figure 4.7 Testing conditions for the enrichment of colony production......................... 117 Figure 5.1 FGFR1,2 expression in E13.5 OE............................................................... 127 Figure 5.2 FGFR1,2 expression in P5 OE.................................................................... 130 Figure 5.3 FGF signaling regulates E13.5 OE colony number and subtypes ............... 132 Figure 5.4 EGF regulates E13.5 OE colony number and subtypes, partly via FGF signaling .................................................................................................. 135 Figure 5.5 FGF signaling increases the number of E13.5 OE colonies containing Mash1+ neuronal progenitors .............................................................. 137 Figure 5.6 FGF signaling increases the number of Mash1+ neuronal progenitors per colony, especially in the fusiform subtype .................................... 138 Figure 5.7 FGF2 dose dependence of OE neurosphere number and size on collagen................................................................................................................. 140 Figure 5.8 OE neurosphere number and size are regulated by FGF signaling ............ 141 Figure 5.9 In vitro paracrine factors support spherical colony production in absence of exogenous growth factors................................................................... 143 Figure 5.10 OE neurospheres express neuronal and non-neuronal progenitor markers ................................................................................................................. 144 Figure 5.11 FGF signaling increases Nestin progenitor proliferation and differentiation......................................................................................................... 146 xi Figure 6.1 Model of embryonic and postnatal neurogliogenesis .................................. 161 Figure 6.2 Working model of FGF2 regulation of neurogenesis via Nestin+ progenitors ............................................................................................................ 163 Figure 6.3   OE regeneration kinetics after methimazole treatment ............................. 169 xii LIST OF ABBREVIATIONS bHLH basic helix-loop-helix BLBP brain lipid binding protein BMP bone morphogenetic protein CNS central nervous system Cre cyclization recombination Cre-ER cyclization recombination-estrogen receptor DLX Distal-less E embryonic day ECM extracelllar matrix EGF epidermal growth factor EGFR epidermal growth factor receptor FGF fibroblast growth factor FGFR fibroblast growth factor receptor FoxG1 forkhead box G1 GAP43 growth associated protein 43 GBC globose basal cell GDF 11 growth and differentiation factor 11 GFAP glial fibrillary acidic protein GLAST glutamate aspartate transporter HBC horizontal basal cell Hes hairy and enhancer of split ICAM-1 intercellular adhesion molecule-1 INP immediate neuronal precursor Lhx Lim homeobox LIF leukemia inhibitory factor lox P locus of cross over LV lateral ventricle Mash1 mammalian achaete-scute homolog 1 xiii NCAM neural cell adhesion molecule NCSC neural crest stem cell NFI nuclear factor I Ngn1 Neurogenin1 NST neuron-specific β III tubulin OB olfactory bulb OCAM olfactory cell adhesion molecule OE olfactory epithelium OEC olfactory ensheathing cell OMP olfactory marker protein OP olfactory placode ORN olfactory receptor neuron P postnatal day Pax paired box PEDF pigment epithelium-derived factor PNS peripheral nervous system PSA-NCAM polysialated neural cell adhesion molecule RA retinoic acid Roaz rat O/E-1-associated protein SGZ subgranular zone Shh Sonic hedge hog SOX Sry-related (high mobility group) box Sus sustentacular cell SV40 simian virus 40 SVZ subventricular zone TGF-α transforming growth factor alpha TGF-β transforming growth factor beta xiv ACKNOWLEDGEMENTS The work outlined in my thesis was made possible by the group dynamics and jovial environment provided by the Roskams’ lab members, present and past. I thank my colleagues for challenging and supporting my work. It has been a pleasure and an honor to cross paths with each of you and I look forward to celebrating your significant future contributions in your chosen fields. I thank my supervisor, Dr. Jane Roskams, for bringing a diverse group together and for providing me with the challenges that have made me a better scientist. Special thanks goes to Nicole Janzen who was always willing to lend a hand and is a conscientious, caring and ever so patient individual-these skills are rare and invaluable. For their helpful discussions and continuing support, I thank my advisory committee, Drs. Fabio Rossi, Connie Eaves and Jamie Piret. Doctoral scholarship funding was provided by the Heart and Stroke Foundation of Canada, The Canadian Stroke Network and the Michael Smith Foundation for Health Research -thank-you, your contributions made a huge difference! Because you can’t be in the lab all of the time, I am extremely grateful for the opportunities provided to me on many hockey rinks throughout BC, and the ongoing support I have received from Paul Willing. Paul is responsible for maintaining my interest in refereeing recreational ice hockey and introducing me to officiating elite level hockey and the Hockey BC High Performance Program. Paul created a sense of community and mentoring for me on the hockey rink that I carry forward and seek the opportunity to pass on to others. Many thanks to the several friends I have made through officiating numerous recreational games, UBC varsity games and a single game in March 2008 with our national women’s team-Team Canada, before their trek to the world championships in China. It has all been exceptionally thrilling. xv None of this could have been possible without the strength and courage instilled in me by my parents, my six siblings and their families. They are with me always and they have dared me to dream-I love them all and am forever in their debt. My desire to succeed has been fueled in part, by the underlying need to provide the best possible example for my stepchildren and grandchildren, to lead by example (as my parents did), so that they may know that anything is possible; you just have to work hard and really believe in it. Most of all, words cannot express my gratitude towards my husband, Douglas Kidd, together we have seen the good, the bad, and the ugly. Without a doubt, we both know the best is yet to come. 1CHAPTER 1       LITERATURE REVIEW AND INTRODUCTION 1.1   Definitions of neural stem and progenitor cells Functional assays in the well-characterized hematopoietic system have defined distinct subclasses of primitive cells leading to the identification and hierarchical arrangement of stem/progenitor cells that can serve as a model for neural stem/progenitor cells (Dick et al., 1997)(Fig 1.1). Stem cells are typically rare, representing only a subset of a whole cell population in a given tissue and are characterized by their ability to produce progeny with the same proliferative and differentiative potential (Weissman, 2000). Stem cells have extensive proliferative capacity and are multipotent (Dick et al., 1997; Morrison, 2001). The nervous system has two main types of neural stem cells, central nervous system (CNS) stem cells and neural crest stem cells (NCSC) (Morrison, 2001). Multipotency in the nervous system refers to the ability to produce cells from the different neuroectodermal lineages and in the CNS includes neurons, astrocytes and oligodendrocytes (Weiss et al., 1996a; McKay, 1997; Temple and Alvarez-Buylla, 1999; Gage, 2000; Temple, 2001). NCSCs can give rise to peripheral nervous system (PNS) neurons and glia in addition to other connective tissue cell types like smooth muscle (Stemple and Anderson, 1992; Shah et al., 1994; Morrison et al., 1999). Different subtypes of neural stem cells can be identified at different developmental stages or in different regions of the CNS and PNS, illustrating their considerable heterogeneity (Palmer et al., 1997; Doetsch et al., 1999a; Tropepe et al., 1999; Tropepe et al., 2000). In contrast to stem cells, progenitor cells have limited, or no self-renewal capacity and can be restricted to a single lineage (neuronal, glial, astroglial or oligodendroglial CNS progenitors) or contribute to two defined lineages (for example, a multipotent progenitor producing neurons and glia in the CNS) (Gage et al., 1995; Gage, 2000; Morrison, 2001). Progenitor cells can still retain extensive proliferative potential, but they are more committed in their developmental cell fate than stem cells (Weissman, 2000; Molofsky et al., 2004).  Progenitors differentiate into mature cells with defined function, usually with little capacity for further cell production, thus, stem, progenitor and differentiated cells 2Figure 1.1 Hierarchical compartments from stem to differentiated cells. Stem, progenitor and differentiated cells, can be organized into 3 sequential compartments of increasing cell numbers, where the cells in each compartment are the amplified progeny of the preceding compartment. The passage of cells through sequential compartments is irreversible and associated with loss of self-renewal, and progressive decline in cell production potential. 3can be organized into 3 sequential compartments of increasing cell numbers (Fig 1.1). The cells in each compartment are the amplified progeny of the preceding compartment and the passage of cells through sequential compartments is irreversible and associated with loss of self-renewal, and progressive decline in cell production potential (Morrison, 2001; Molofsky et al., 2004). Because neural stem and progenitor cells represent heterogeneous populations (outlined above) and markers to identify them are limited, they are usually defined and distinguished by their function (Morrison et al., 1999; Gage, 2000; Rietze et al., 2001; Capela and Temple, 2002). I use the term “precursor” to denote a cell that is a forerunner to another cell in a given lineage, and hence “precursor” can refer to either a stem or progenitor cell. I restrict the use of the term “stem cell” to reflect its rigorous definition and instead preferentially refer to mitotic cells that are multipotent or lineage restricted, as “precursors” or “progenitors”. 1.2   Origins and identification of CNS neural progenitor cells 1.2.1   Neuroepithelial cells are precursors for radial glia All cells in the CNS are originally derived from the neuroepithelium that, prior to neurogenesis, is a single cell layer that expands and folds to form the neural tube (Rao, 1999).Differentiation of neuroepithelial progenitors along the neural tube into neurons and glia is temporally and regionally-restricted with neurogenesis preceding gliogenesis (Sanes et al., 2000; Altmann and Brivanlou, 2001). The patterning of the neural tube is governed by inductive cellular interactions, creating organizing centers and expression of genes in discrete regions, that specify the duration of neurogliogenesis and neuronal or glial subtype identity for that region (Wolpert, 1994; Weinstein and Hemmati- Brivanlou, 1999; Altmann and Brivanlou, 2001). In the neuroepithelium, neuroepithelial cells are highly polarized along their apical-basal axis, like typical epithelial cells, and appear layered because their nuclei migrate up and down the apical-basal axis during the cell cycle (termed interkinetic nuclear migration), undergoing DNA synthesis at the basal lamina and cell division at the ventricular surface (Williams and Price, 1995; Gotz et al., 2005). With the advent of 4neurogenesis, the neuroepithelium becomes multilayered, and related, but distinct cells, radial glial appear. Gradually, radial glial cells become more frequent than their neuroepithelial cell precursors, and represent a population of comparatively more fate- restricted progenitors (Williams and Price, 1995; Malatesta et al., 2000). 1.2.2   Identification and function of CNS radial glia Radial glia are a special class of cells detected throughout the developing CNS but best characterized in the telencephalon (forebrain) (Kriegstein and Gotz, 2003). In the developing mammalian forebrain radial glia serve as both neuronal progenitors and scaffolding for migrating neuroblasts that first appear around embryonic day (E)12 (Fig 1.2) (Rakic, 1972; Malatesta et al., 2003; Anthony et al., 2004; Gotz et al., 2005). Radial glia are mitotically active cells whose nuclei undergo interkinetic nuclear migration with cell cycle progression, similar to neuroepithelial cells (Misson et al., 1988), and are anchored to the ventricular surface at one end with a process spanning to the pial surface. The term “radial glia” and concept of glial scaffolding was determined by analyzing primate forebrains at advanced stages of development, when neuronal and glial lineages are easily distinguished, and the radial glial phenotype is readily differentiated (Rakic, 1972, 2003). During the onset of cortical histogenesis in primates, when the migratory route is short, as it is in rodents, radial glia and postmitotic neurons are not as easily distinguished (Rakic, 2003). Although the basic characteristics of radial glia are conserved in vertebrates, structural, functional and molecular differences may arise in radial glia from different CNS regions during specific developmental stages, or between species (Rakic, 2003). For example, in the developing cerebral cortex of the primate brain, stability of the radial glial scaffolding is likely an essential adaptation for proper migration and appropriate layer destination of neurons (Rakic, 1995) and may be related to the expression of glial fibrillary acidic protein (GFAP), which does not occur in rodents until after the completion of cortical neurogenesis (Cameron and Rakic, 1991). Radial glia are defined by their morphology and antigen expression profile. They cannot be identified by the expression of a single antigen, but are characterized by a 5Figure 1.2 Role of CNS radial glia in cortical histogenesis Cerebral cortical development occurs in an inside-out manner, with the innermost layers produced first and forming the developing cortical plate (CP). Radial glia span from the ventricle to the pial surface, just above the marginal zone (MZ) of the developing cortex, and serve as both progenitors and scaffolding for newborn neurons, that migrate into a specified layer according to the developmental stage. The cortical plate expands as neurons are added, until 6 layers have formed in the adult cortex. 6combination of dynamic antigen expression including the intermediate filament protein nestin (Hockfield and McKay, 1985) and intermediate filament associated protein RC2 (Misson et al., 1988). Radial glia are distinguished from neuroepithelial cells by their astrocytic characteristics including glycogen granules and expression of antigens such as GFAP, vimentin (Gotz et al., 2005), the glutamate transporter, GLAST (Furuta et al., 1997), and brain lipid-binding protein (BLBP) (Feng et al., 1994; Hartfuss et al., 2001; Gotz et al., 2005). The fate of radial glial cells, in contrast to neuroepithelial cells, is usually restricted to a single cell type- astrocytes, oligodendrocytes or neurons, and is dependent upon the CNS region, developmental stage and species (Grove et al., 1993; Reid et al., 1995; Williams and Price, 1995; Malatesta et al., 2000; McCarthy et al., 2001; Miyata et al., 2001; Noctor et al., 2001; Malatesta et al., 2003; Rakic, 2003; Anthony et al., 2004; Noctor et al., 2004). In most regions of the mammalian brain, radial glia cells are thought to disappear soon after birth, but radial glia-like cells can be found in subregions of the adult CNS, Bergmann glia (cerebellum) (Misson et al., 1988; Rodriguez et al., 2005), tanycytes (hypothalamus) (Rodriguez et al., 2005), dentate gyrus radial glia (Rickmann et al., 1987; Cameron et al., 1993) and Muller glia (retina) (Eckenhoff and Rakic, 1984; Reh and Fischer, 2006). These radial glial-like cells retain characteristics more like neuroepithelial progenitors than radial glial cells (Gotz et al., 2005). During later stages of brain development, the temporal disappearance of radial glia and concomitant loss of antigen expression of RC2 and nestin in the CNS, correlates with the downregulation of neurogenesis, and upregulation of gliogenesis (Schmechel and Rakic, 1979; Levitt and Rakic, 1980; Voigt, 1989; Mission et al., 1991). 1.2.3   Neurogenesis in the adult mammalian brain: the subventricular and subgranular zones During embryonic to adult ontogeny in the CNS, cells with the morphology, antigenic and ultrastructural characteristics associated with radial glia are gradually lost. Radial glial cells are thought to transform into GFAP+ astrocytes and move into the brain parenchyma after losing their direct physical connections to the pial surface and 7ventricles (Schmechel and Rakic, 1979; Levitt and Rakic, 1980; Voigt, 1989; Mission et al., 1991). Despite the apparent loss of radial glia in the adult, neurogenesis continues in restricted regions of the adult brain, the subventricular zone (SVZ) of the lateral ventricle (LV) and the subgranular zone (SGZ) of the hippocampal dentate gyrus (Reynolds and Weiss, 1992; Cameron et al., 1993; Lois and Alvarez-Buylla, 1993, 1994; Morshead et al., 1994; Gage et al., 1998). 1.2.3.1   The subventricular zone contains progenitors and stem cells Throughout the lateral wall of the lateral ventricle, underneath the ependymal layer lining the ventricle, is the subventricular zone (Alvarez-Buylla et al., 2002). Stem/progenitor cells from the SVZ divide and migrate in a restricted path termed the rostral migratory stream (RMS) (Wichterle et al., 1997) to the olfactory bulb (OB) where they replace granule and periglomerular interneurons (Luskin, 1993; Lois and Alvarez- Buylla, 1994). That stem cells reside in the SVZ and contribute to OB neurogenesis has been best demonstrated after killing off the rapidly dividing progenitors and monitoring the repopulation of the SVZ progenitors, their migration to, and neuronal replacement within, the OB over time (Morshead et al., 1994; Doetsch et al., 1999a; Garcia et al., 2004; Ahn and Joyner, 2005). Cells from the SVZ can also be grown in vitro when stimulated by epidermal growth factor (EGF), fibroblast growth factor (FGF; also known as FGF2 or basic FGF) or both using the neurosphere assay (see 1.5.1), and demonstrate the stem cell attributes of self-renewal and multipotency (Reynolds and Weiss, 1992; Morshead et al., 1994; Weiss et al., 1996b; Gritti et al., 1999; Rietze et al., 2001; Garcia et al., 2004). Cells comprising the SVZ have been identified and termed A, B, and C cells and are separated from the ventricle by ependymal cells (Fig 1.3) (Lois and Alvarez-Buylla, 1994; Lois et al., 1996; Doetsch et al., 1997). Type A cells are neuroblasts that appear in clusters and migrate from the anterior SVZ in chains through tunnels formed by the slowly dividing Type B cells, enroute to the OB (Wichterle et al., 1997). Type C cells are the rapidly dividing transit amplifying cells of the SVZ that are found scattered along the network of Type A cells in focal clusters (Fig 1.3) (Lois and Alvarez-Buylla, 1994; 8Figure 1.3 Composition and organization of the CNS SVZ and SGZ A) The SVZ is adjacent to the LV, separated by ciliated ependymal cells (E; light grey). Neuroblasts (Type A cells; red) migrate in chains to the OB through tunnels formed by the processes of slowly dividing B cells (blue). Transit-amplifying C cells (green) are found in focal clusters along the network of chains. B cells act as stem cells and occasionally extend a process with a single cilium into the ventricle. In the OB neuronal lineage, B cells give rise to C and A cells. B) The SGZ of the hippocampus (magnified on the right) B cells have long processes penetrating the upper granule cell layer and short tangential processes parallel to the SGZ. Dividing B cells give rise to immature dark cells (D cells; skintone), which divide and mature producing new granule neurons (G; red). Blood vessels (BV) are found in the neurogenic regions of SVZ and SGZ, where in the SVZ, a basal lamina (BL) extends from the BV to terminate adjacent to ependymal cells. With permission, adapted from Doetsch 2003. 9Doetsch et al., 1997; Alvarez-Buylla et al., 2002). Lineage relationships using kill paradigms, transgenic mice and retroviral labeling have shown that B cells (GFAP+) can divide to give rise to C cells [GFAP-/DLX2+ and (Mash1+)] that differentiate into Type A (GFAP-/DLX2+/PSA-NCAM+) neuroblast cells (Doetsch et al., 1997; Doetsch et al., 1999b; Doetsch et al., 1999a; Doetsch, 2003). DLX2 (Distal-less family of genes) is a transcription factor expressed in neurogenic progenitors (Luo et al., 2001; Panganiban and Rubenstein, 2002), PSA-NCAM (polysialated neural cell adhesion molecule) is expressed in neuroblasts. Because B cells are precursors to OB neurons via C and A progenitor cells, and form self-renewing multipotent neurospheres in response to EGF, they are proposed to be SVZ stem cells (Doetsch et al., 1999b). Since B cells display stem cell characteristics and express the astrocytic marker GFAP, it has been suggested that astrocytes are SVZ stem cells, leading to much confusion, since not all GFAP+ cells are stem cells (Doetsch et al., 1999b; Alvarez-Buylla et al., 2002). Similarly, although several candidate markers have been proposed for the identification of SVZ stem cells, there are no known markers that are exclusive to stem cells (Morrison et al., 1999; Gage, 2000; Uchida et al., 2000; Rietze et al., 2001; Capela and Temple, 2002; Kim and Morshead, 2003) (Pincus et al., 1998; Keyoung et al., 2001; Corti et al., 2007; Coskun et al., 2008). Ependymal cells too, have been proposed as stem cells (Johansson et al., 1999), although multiple laboratories have failed to support these findings, and instead refer to ependymal cells as progenitors because of their limited self-renewal capacity (Chiasson et al., 1999; Doetsch et al., 1999b; Doetsch et al., 1999a; Laywell et al., 2000; Capela and Temple, 2002). Ependymal cells may contribute to the regulation of adult neurogenesis since they secrete noggin, a molecular inhibitor of bone morphogenetic proteins (BMPs), resulting in a blockade of the antineurogenic effects imposed by BMPs that are produced by astrocytes (Lim et al., 2000; Coskun et al., 2001). 10 1.2.3.2   Neural progenitors in the subgranular zone of the dentate gyrus The subgranular zone is located between the granule cell layer and the hilus of the hippocampal formation (Gage, 2000; Alvarez-Buylla et al., 2002), where migratory cells have a short route to their granule layer destination, unlike the extensive migratory path of SVZ progenitors along the RMS to the OB (Doetsch et al., 1999b; Gage, 2000; Alvarez-Buylla et al., 2002; Doetsch, 2003). Cells cultured in vitro from the adult dentate gyrus may demonstrate characteristics of stem cells (Palmer et al., 1997; Gage, 2000), that are designated as progenitor cells by others (Seaberg and van der Kooy, 2002), dependent upon the rigor of the stem cell definition (Seaberg and van der Kooy, 2003). Within the SGZ, dividing cells, a majority of which express GFAP, rapidly down regulate GFAP and this is accompanied by a corresponding increase in small dark cells prior to the appearance of granule neurons (Fig 1.3B) (Cameron et al., 1993; Palmer et al., 2000; Seri et al., 2001). Cell ablation and retroviral labeling experiments similar to those described for the SVZ were used to determine the lineage relationships between cells in the SGZ. GFAP+ B cells give rise to PSA-NCAM+ D cells (the small dark cells), followed by granule neurons (Fig 1.3B) (Cameron et al., 1993; Palmer et al., 2000; Seri et al., 2001). These results suggest that adult neurogenesis can be initiated by GFAP+ precursors in both the dentate gyrus and the SVZ (Cameron et al., 1993; Palmer et al., 2000; Seri et al., 2001). 1.3   Development of the olfactory epithelium 1.3.1   The olfactory epithelium is derived from the olfactory placode The olfactory epithelium (OE) arises from the olfactory placode where the ectoderm of the presumptive olfactory placode thickens and invaginates to form the olfactory pit by E10.5, with concurrent formation of the medial and lateral nasal processes (Jacobson, 1963; Cuschieri and Bannister, 1975). Interactions between the frontonasal mesenchyme and surface epithelium create distinct spatial expression of localized signaling molecules, defining axial information, thus inducing the initial differentiation of the olfactory pathway and producing neural precursors that will continue 11 to generate olfactory receptor neurons (ORNs) for the life of the organism (LaMantia et al., 2000; Balmer et al., 2005; Kawauchi et al., 2005; Rawson and LaMantia, 2006). 1.3.2   Ontogenic changes in the embryonic, postnatal and adult olfactory epithelia Development of the mouse olfactory epithelium can be divided into three sequential stages: 1. embryonic establishment [E10-postnatal day 0 (P0)]; 2. postnatal expansion (P1-P30); and 3. adult maintenance (P30 - death). Each developmental stage occurs in a distinct spatiotemporal pattern and in different cellular and extracellular environments (Fig 1.4A-D) (Farbman, 1992). During the embryonic stage, vast proliferation of olfactory progenitors throughout the apical and basal epithelium occurs, which decreases and transitions to the basal epithelium, during the postnatal expansion period (Fig 1.4C,D) (Smart, 1971; Weiler and Farbman, 1997; Murdoch and Roskams, 2007). Here, neurogenesis increases and the laminar structure begins to take form concurrent with the organization of the OE into zones. In the adult, the laminar structure that mediates chemosensation is established and undergoes neurogenesis based on replacement after neuron loss (Fig 1.4B,D) (Farbman, 1990; Carr and Farbman, 1992; Schwob, 2002). 1.3.3   Structure and cellular constituents of the postnatal OE The postnatal OE is a pseudostratified epithelium composed primarily of three main cell types arranged with mature cells closer to the apical surface, atop a defined basal lamina that separates the OE proper from its underlying lamina propria (Farbman, 1992). The OE proper contains (1) basal cell progenitors, (2) immature and mature ORNs, and (3) sustentacular (Sus) cells (Fig 1.4B). The lamina propria contains axon bundles, olfactory ensheathing cells (OECs; Fig 1.4B), connective tissue, blood vessels and Bowman’s glands (Farbman, 1992; Schwob, 2002). Each cell type can be distinguished by location, morphology, and antigen expression profile (Schwob, 2002). Sustentacular cells, whose nuclei are aligned in a single row at the apical surface, span the height of the OE and regulate the passage of molecules between the apical surface and lamina propria by forming tight junctions (Hempstead and Morgan, 1983, 1985; Farbman, 1992). Sus (or supporting) cells comprise approximately 15% of the 12 Figure 1.4 Organization and structure of embryonic and adult OE (A,C) The embryonic OE contains apical and basal PCNA-expressing progenitors with processes that span the height of the OE. Immature olfactory receptor neurons (iORN) are flanked by apical and basal dividing progenitors. The developing lamina propria contains olfactory ensheathing cell (OEC) precursors and immature (i) OECs, which ensheathe olfactory receptor neuron axons. (B, D) The adult OE contains immature and mature ORNs in the middle layer, flanked by sustentacular cell (Sus) bodies in the apical layer, and progenitors in the basal layers. The (C) E16.5 OE contains proliferating progenitors (PCNA+; red; arrowheads) that flank immature Dcx+ ORNs (green), that in the (D) adult are reduced in frequency and located basally (arrowhead). Nuclear stain DAPI (blue); dotted line denotes basal lamina; OE, olfactory epithelium; LP, lamina propria. Scale bar represents 50um in C,D. 13 cells within the OE and express the Sus4 antigen (Goldstein and Schwob, 1996). They function in detoxification, degradation of olfactory stimuli and regulation of ionic composition (Hempstead and Morgan, 1983, 1985; Farbman, 1992) (Getchell et al., 1984; Chen et al., 1992). Beneath sustentacular cells, the middle layers of the OE contain bipolar ORN cell bodies comprising 75–80% of the adult OE, where mature olfactory neurons express olfactory marker protein (OMP) (Farbman and Margolis, 1980) and immature olfactory neurons express neuron-specific β III tubulin (NST) (Roskams et al., 1998). Ciliated dendrites from developing ORNs are exposed at the mucosal surface in the nasal cavity awaiting odorant stimulation and extend their axons, exiting through the lamina propria, to reach their convergent target the OB upon maturity (Schwob, 2002). The basal cell layer (5–10% of the OE) lies between the lamina propria and the ORN layer and contains globose basal cells (GBCs) and horizontal basal cells (HBCs) (Graziadei and Graziadei, 1979a). The basal cells are responsible for the regenerative capacity of the adult OE (Schwob, 2002; Beites et al., 2005; Murdoch and Roskams, 2007). Globose basal cells (GBCs) serve predominantly as transit amplifying neuronal precursors for olfactory receptor neurons and a subpopulation express the basic helix- loop-helix (bHLH) transcription factor Mash1 (mammalian achaete-schute homolog 1), during both development and regeneration (Graziadei and Graziadei, 1979a; Schwartz Levey et al., 1991; Caggiano et al., 1994; Gordon et al., 1995; Huard and Schwob, 1995; Cau et al., 1997; Shou et al., 1999; Calof et al., 2002). Transplantation and retroviral lineage tracing experiments suggest that GBCs can also generate sustentacular cells (Huard et al., 1998; Chen et al., 2004). In contrast, HBCs are more quiescent than GBCs, express epidermal growth factor receptor (EGFR) and intercellular adhesion molecule-1 (ICAM-1) (Farbman and Buchholz, 1996; Goldstein and Schwob, 1996; Getchell et al., 2000), and can produce clonal colonies in vitro in response to EGF, whose progeny include more HBCs, GBCs, neurons and glia (Carter et al., 2004). Lineage tracing after extensive OE lesion indicates that HBCs can contribute to neurons, sustentacular cells and Bowman’s glands (Leung et al., 2007; Iwai et al., 2008). HBCs thus possess characteristics expected of a multipotent OE progenitor. 14 The adult olfactory epithelium is not however, homogenous, as diversity exists throughout its dorsal-medial and ventral-caudal axes (Schwob, 2002). The OE has been classically divided into roughly four zones based on patterns of expression of olfactory receptors, roughly one olfactory receptor in each mature ORN (Vassar et al., 1993; Ressler et al., 1994; Strotmann et al., 1994a; Strotmann et al., 1994b; Yoshihara et al., 1997) and differential expression of cell surface molecules (for example, OCAM-olfactory cell adhesion molecule; Fig 1.5A-C) (Mori et al., 1985; Schwob and Gottlieb, 1986; Alenius and Bohm, 1997).  Zone 1 is commonly designated the most dorsal-medial, Zone 4 the most ventral-lateral (Fig 1.5A) (Ressler et al., 1994). OMP is detected in Zones 1 to 4 (Fig 1.5C), with expression of OCAM detected in all Zones except for Zone 1 (Fig 1.5B). Similarly, sustentacular and Bowman’s glands cells can express different enzymes dependent upon their location (Miyawaki et al., 1996). Recent evidence suggests that odorant receptor expression is overlapping and does not always fit into one of the four conventional Zones (Miyamichi et al., 2005; Kobayakawa et al., 2007; Iwai et al., 2008). 1.3.4   Structure and cellular constituents of the embryonic OE In contrast, to the postnatal OE, the embryonic OE is a highly dynamic tissue containing regions that are mostly quiescent together with actively dividing regions. The early embryonic OE is comprised mostly of dividing progenitors, lacking expression of lineage markers, and a few immature ORNs (Smart, 1971; Cuschieri and Bannister, 1975; Murdoch and Roskams, 2007). As OE development proceeds, the number of immature and mature ORNs increases, and progenitors constitute a progressively smaller proportion of the epithelium (Fig 1.4C) (Smart, 1971; Cuschieri and Bannister, 1975; Murdoch and Roskams, 2007). Unlike the postnatal OE, the embryonic OE is largely devoid of sustentacular cells, and horizontal basal cells have yet to emerge (Farbman, 1992; Murdoch and Roskams, 2007). There are two classes of dividing embryonic olfactory progenitors, located in the apical and basal regions, flanking immature olfactory receptor neurons in the intermediate OE (Fig 1.4C) (Smart, 1971; Cuschieri and Bannister, 1975; Murdoch and Roskams, 2007). Apical progenitors are thought to be derived from the neuroepithelial 15 Figure 1.5 The OE zones. A) The OE can be divided into roughly 4 zones, numbered from the most dorsal-medial (Zone 1; arrowhead) to the most ventral-lateral (Zone 4) regions and indicated by the different colors. B,C) Schematic showing transcript expression of OMP throughout all OE Zones 1-4, with OCAM expression restricted to Zones 2-4, and not found in Zone 1. Double asterisks denote the dorsal recess in coronal sections. 16 cells of the olfactory placode (E10.5) and constitute the only progenitor population present at the placodal stage (Smart, 1971; Cuschieri and Bannister, 1975; Murdoch and Roskams, 2007). Apical progenitors are thought to give rise to Sus cells (Smart, 1971; Cuschieri and Bannister, 1975; Murdoch and Roskams, 2007). After expansion, apical progenitors progressively lose their apical contacts and translocate to the basal epithelium, producing secondary progenitors, that are first detected at E12.5, where they undergo limited divisions prior to ORN differentiation (Smart, 1971; Cuschieri and Bannister, 1975; Theriault et al., 2005; Murdoch and Roskams, 2007). Neurogenin1 (Ngn1) and NeuroD, transcription factors involved in neural cell determination and differentiation (Guillemot, 1999; Cau et al., 2002), are sequentially expressed, downstream of Mash1, by dividing basal, but not apical progenitors (Guillemot, 1999; Cau et al., 2002). Mash1 expression can be detected in the apical, intermediate and basal progenitors and the Mash1 null mutation results in the loss of basal, but not apical progenitors, and consequent loss of most ORNs. This suggests that in neuroepithelial precursors, Mash1 serves to generate basal progenitors, but it is not known if apical and basal Mash1+ progenitors are lineally related (Guillemot, 1999; Cau et al., 2002). Hence, at the earliest stages of development, the embryonic OE is comprised of different progenitor subpopulations, but whose lineage relationships, contributions and regulation are largely unknown. 1.4   Regulation of olfactory neurogenesis The proliferation and differentiation of OE precursors is highly regulated, spatially and developmentally, to maintain the integrity of the OE over a lifetime. OE homeostasis is controlled by the balance of positive regulatory factors from cells (e.g. apoptotic ORNs, macrophages, OECs) that sense a need for more ORNs and stimulate mitosis and differentiation, and negative factors that feed back from mature ORNs to inhibit additional ORN production during homeostasis (Calof et al., 1998b; Shou et al., 2000; Bauer et al., 2003; Wu et al., 2003). Neurogenesis is governed by extrinsic signals contributed by the local microenvironment (or niche) including growth factors and extracellular matrix molecules and intrinsic signals derived from expression of 17 transcription factors (Doetsch, 2003; Li and Xie, 2005; Ninkovic and Gotz, 2007). Factors regulating OE neurogenesis have been studied using in vitro assays, cell lines and using transgenic mice and models of ORN degeneration and regeneration in vivo (Schwob, 2002; Murdoch and Roskams, 2007). Growth factors, extracellular matrix molecules and transcription factors shown to contribute to OE neurogenesis are discussed below. 1.4.1   Growth factors Retinoic acid is a vitamin A derivative and member of the steroid/thyroid superfamily of non-peptide hormones that signal via a family of nuclear receptors, retinoic acid receptors (RARs) and retinoid X receptors (RXRs) (Giguere et al., 1987; Giguere, 1994). Ligand-bound retinoic acid receptors act as transcription factors that in turn regulate gene expression (Giguere et al., 1987; Tsai and O'Malley, 1994). First expressed in the olfactory placode (Bhasin et al., 2003), RA receptors RARα and RXRγ can be detected throughout the E11.5 to E13.5 OE (Whitesides et al., 1998). RARβ expression is more restricted in the embryonic OE, being limited to the apical region of the dorsal E13.5 OE (Whitesides et al., 1998). Detection of RA responsive cells in the adult OE, suggests the persistence of RA receptor expression in the adult (Whitesides et al., 1998). Neural crest derived retinoic acid is produced in the frontonasal mesenchyme, which is essential for the induction of the adjacent olfactory primordium (LaMantia et al., 1993; Anchan et al., 1997; LaMantia et al., 2000). Mutant mice failing to produce retinoic acid in the frontonasal mesenchyme (Pax6 Sey/Sey), do not form the olfactory epithelium, even though they express RA receptors and remain responsive to RA (Anchan et al., 1997). Mesenchymal/epithelial explants have also shown the importance of RA concentration, receptor expression and signaling on OE induction and ORN differentiation (LaMantia et al., 2000; Bhasin et al., 2003). Endogenous RA activates expression of a RA-responsive transgene in a subset of ORNs in the dorsal-lateral E13.5 OE that segregates their axons in the olfactory nerve. This axonal segregation may be aided by localized laminin expression (Whitesides and LaMantia, 1996), since RA can potentiate neurite outgrowth in vitro on laminin but not fibronection or collagen IV 18 (Whitesides et al., 1998). RA signaling thus, has several roles during development of the olfactory pathway, from induction and regional neuronal diversity to establishing axon projections. Sonic hedgehog (Shh) is a member of the Hedgehog family of secreted proteins (Echelard et al., 1993) that signal via smoothened (Alcedo et al., 1996) and patched receptors (Chen and Struhl, 1996). During adult neurogenesis in the SVZ and DG, Shh signaling is required for the proliferation and maintenance of stem and progenitor cells, determined using conditional null mutants of Shh or Smo (Machold et al., 2003; Han et al., 2008), or blocking Shh signaling with cyclopamine (Palma et al., 2005). These results have also been supported by experiments showing increased proliferation after Shh infusion or constitutive activation of Smo (Machold et al., 2003; Han et al., 2008). Genetic fate mapping of cells responsive to Shh identified stem and progenitor cells that provide new neurons to the postnatal forebrain (Ahn and Joyner, 2005).  In the olfactory pit, Shh is expressed at the medial epithelial margin of the frontonasal process (LaMantia et al., 2000; Bhasin et al., 2003) and Shh addition in vitro results in larger mesenchymal/epithelial explants (LaMantia et al., 2000). No apparent change in medial or lateral patterning or axon fasciculation was seen with Shh addition, suggesting Shh functions as a general growth signal in the olfactory primordia (LaMantia et al., 2000). Despite craniofacial and forebrain abnormalities associated with loss of Shh signaling in Gli3 -/- and Shh -/- mutants, the OE patterning, ORN differentiation and cell composition appear normal (Balmer and LaMantia, 2004). ORN axon trajectories however, are disrupted and ORN axons rarely entered the brain (Balmer and LaMantia, 2004). Thus, unlike the neurogenic regions of the CNS, Shh has not been identified as a key regulator of OE progenitors. Shh plays a role in the generation of ventral motoneurons (Wichterle et al., 2002) and dopaminergic neurons (Perrier et al., 2004) in the CNS. Human adult OE cell lines, when treated with retinoic acid plus Shh for 7 days, increase their proliferation and produce NST+ neurons. Some neurons express tyrosine hydroxylase, a required enzyme for dopamine sythesis, while others express transcription factors indicative of motoneurons, HB9, Isl1/2 (Zhang et al., 2006b). 19 Leukemia inhibitory factor (LIF) is a mitogen that can contribute to proliferation in embryonic and postnatal OE in vitro and in vivo (Satoh and Yoshida, 1997; Nan et al., 2001; Getchell et al., 2002b; Bauer et al., 2003; Carter et al., 2004). Mice deficient in LIF have increased OMP+ ORNs, consistent with the inhibition of mature ORN marker acquisition in vitro with LIF (Moon et al., 2002). LIF and its receptor transcripts are up- regulated and required acutely following bulbectomy, removal of the OB, for an adequate proliferation response, and ORN production (Getchell et al., 2002b; Bauer et al., 2003). To maintain the normal adult OE, HSF1 (heat shock transcription factor 1) binds to the Lif gene to inhibit its expression, an effect that is opposed by HSF4 (Takaki et al., 2006). The transforming growth factor (TGF) -β superfamily of growth factors includes TGF-β, activins and BMPs. They are highly conserved proteins that play active roles during differentiation and development in a variety of tissues, and signal via a serine- threonine kinase receptor complex (Attisano and Wrana, 2002). Transcripts for growth and differentiation factor 11 (GDF11), a TGF-β family member, and its receptors are expressed in E12.5 to adult ORNs and their progenitors (Wu et al., 2003). GDF11 causes inhibition of neurogenesis through division arrest in FGF2-stimulated neurogenin1+ immediate neuronal precursors (INPs), via upregulation of the cyclin- dependent kinase inhibitor p27Kip1 (Wu et al., 2003). Proliferative arrest is reversed by either genetic loss or antagonism of GDF11 (Wu et al., 2003). GDF11 therefore appears to act as a negative regulator of OE neurogenesis, in addition to similar roles in the retina (Kim et al., 2005). In contrast, the TGF-β super family members, TGF-β1 and TGF-β2, can promote neuronal differentiation when assayed using primary cultures and cell lines (Mahanthappa and Schwarting, 1993; Newman et al., 2000). TGF-β signaling is also thought to regulate the terminal differentiation of ORNs in vivo (Getchell et al., 2002a). BMPs are morphogenetic proteins whose effects can vary according to their concentration and context (Mehler et al., 2000). Explant assays have shown that BMP signaling is required and sufficient to induce the olfactory placode and lens cells from progenitor cells at the anterior neural plate border (Sjodal et al., 2007). The timing of 20 BMP expression is key to the differential specification of olfactory lens and placodal cells (Sjodal et al., 2007). BMP4 transcript is detected in the mid-late gestation embryonic OE and the ORN layers in the adult (LaMantia et al., 2000; Peretto et al., 2002). BMPs can inhibit OE neurogenesis at high concentrations and stimulate neurogenesis at low concentrations. Exogenous addition of high concentrations (10-20 ng/ml) of BMP 2, 4 or 7 to in vitro colony assays with E14.5 to 15.5 OE inhibits progenitor proliferation and the formation of neuronal colonies, without affecting non-neuronal subtypes (Shou et al., 1999). BMPs block neurogenesis by targeting Mash 1 for proteolysis via the proteasome pathway (Shou et al., 1999). Alternatively, BMPs at low concentrations (0.1-0.2 ng/ml) promote the survival (but not the proliferation) of newly generated ORNs (Shou et al., 2000). Thus BMPs exert opposing effects on OE cells at various stages of the ORN lineage and various TGF-β subfamily members regulate OE progenitors using differential regulatory mechanisms. During homeostasis, when the OE is undergoing baseline neurogenesis, concentrations of negative regulatory molecules remain high due to the number of ORNs contributing to the overall concentration, thus inhibiting neurogenesis. Neurogenesis, as stimulated post bulbectomy when large numbers of ORNs die, may decrease the concentration of negative regulators to critically low concentrations and increase positive regulatory molecules causing OE basal progenitors to proliferate and generate new ORNs (Calof et al., 1998a; Shou et al., 2000; Bauer et al., 2003). Epidermal growth factor and TGF-α bind to, and signal through, the EGFR, part of the EGF receptor family of tyrosine kinases (Schlessinger, 2000). The EGFR is most prominently expressed in HBCs and Sus cells while TGF-α and EGF stimulate mitosis of basal cells in vitro, and in vivo (Mahanthappa and Schwarting, 1993; Holbrook et al., 1995; Farbman and Buchholz, 1996; Goldstein and Schwob, 1996; Ezeh and Farbman, 1998; Carter et al., 2004). Transgenic mice with the cytokeratin 14 promoter-TGF-α transgene, to specifically overexpress TGF-α in HBCs, demonstrate a 6-fold increase in HBC proliferation, without any proliferative effect on GBCs, presumably via a paracrine path (Getchell et al., 2000). Cells staining for TGF-α antibodies include sustentacular, 21 Bowman’s glands and basal cells (Farbman and Buchholz, 1996).These results suggest that HBCs are the primary EGF/TGF-α-responsive OE cell. Fibroblast growth factors are secreted proteins that signal via four tyrosine kinase receptors, FGF receptors 1-4 (FGFR1-4), and are stabilized by a proteoglycan receptor (Ornitz and Itoh, 2001; Knox et al., 2002). In the olfactory placode/pit FGFR1, FGFR2, and FGFR3 transcripts are detected (Gill et al., 2004), and FGF8 is expressed in the medial epithelium of the frontonasal mass. The expression levels of FGFs are critical for normal placodal and lens development and may be regulated in part by HSF4 together with HSF1 (Fujimoto et al., 2004). FGF8, together with factors from neural crest cells, act to progressively restrict lens specification in the head ectoderm and promote an olfactory fate (Bailey et al., 2006). FGF8 is required for the generation and survival of putative OE Sox2+ stem cells and subsequent neurogenesis in the olfactory placode (LaMantia et al., 2000; Gill et al., 2004; Kawauchi et al., 2005). In addition to increased cell death in the olfactory placode/epithelium, the conditional deletion of FGF8 in transgenic mice causes abnormal nasal cavity and OE development, and loss of vomeronasal organ, an auxillary rodent chemosensory organ. Microarray analysis was used to screen for targets of FGF signaling by hybridizing cDNAs from whole FGF3 and FGF10 homozygous and compound mutant embryos (~E10.5) onto gene chips (Lioubinski et al., 2006). They found vomeronasal receptors, especially V2R transcripts, which are normally expressed in the olfactory placode, retina, dorsal route ganglia and neural tube, were down regulated in these mutants (Lioubinski et al., 2006). FGFs may control embryonic V2R receptor expression and contribute to the development of regions expressing V2R transcripts. Thus FGFs, play critical roles in OE and vomeronasal development (Kawauchi et al., 2005). FGFR1,2, not FGFR3,4, transcripts are expressed in the E15 OE (DeHamer et al., 1994) and FGFR1 in the adult OE (Hsu et al., 2001), but the specific cells expressing these receptors have not been clearly identified in vivo (DeHamer et al., 1994; Hsu et al., 2001). FGF1 (acidic FGF) and FGF2 are the FGF ligands that most highly activate FGFRs. FGF1 has been detected in the lamina propria, but not OE, associated with, and mitogenic for, OECs (Key et al., 1996). Expression levels of FGF2 are variable, but have 22 been detected throughout the OE (Chuah and Teague, 1999; Hsu et al., 2001). FGF2 is associated with nuclei of ORNs and sustentacular cells (Goldstein et al., 1997), but whose cell source has yet to be definitively established (Goldstein et al., 1997; Chuah and Teague, 1999; Hsu et al., 2001). Perinatal and adult OECs proliferate in response to FGF2 in vitro (Barraud et al., 2007). Cell lines derived from immortalized embryonic OE respond to FGF2 by suppressing neuronal differentiation (Goldstein et al., 1997). In E15 OE explants or when dissociated, migratory GBC-like cells proliferate in response to FGF2, allowing for one to two divisions prior to differentiation into neural cell adhesion molecule (NCAM)+ ORNs (DeHamer et al., 1994; Mumm et al., 1996) or βIII tubulin- positive neurons in the adult OE (Newman et al., 2000). A small subpopulation of embryonic neuronal progenitors responds to FGF2 by undergoing a pronounced proliferative response before neuron differentiation, but the identity of these progenitors remains to be determined (DeHamer et al., 1994). These studies suggest FGF2 acts to regulate the number of divisions that neuronal precursors undergo, likely GBCs, prior to neuronal differentiation (Fig 1.6). FGF2 may also contribute to neuronal differentiation (MacDonald et al., 1996b) by regulating the subcellular location of FoxG1 (Regad et al., 2007). Immortalized cell lines derived from the olfactory placode with gene expression characteristic of olfactory progenitors retain FoxG1 in their nucleus. Stimulation by FGF2 causes FoxG1 to exit the nucleus and translocate to the cytoplasm, and is concomitant with neuronal differentiation (Regad et al., 2007). Cytoplasmic translocation of FoxG1 can be blocked with FGF signal inhibition and is recapitulated in primary cortical cells (Regad et al., 2007). These results suggest that FGF2 may act at multiple levels within the ORN lineage and provides an example of similar regulatory mechanisms governing OE and cortical progenitors. Similar mechanisms may also regulate OE neurogenesis in vivo (Herzog and Otto, 1999). The normal rate of tissue recovery and OB reinnervation following chemical lesion is enhanced in a dose-dependent manner, after infusion of FGF2, EGF, but best with TGF-α (Herzog and Otto, 1999). 23 Figure 1.6 Model of FGF2 regulation of the olfactory receptor neuron lineage The olfactory receptor neuron lineage is defined by the irreversible passage of cells through sequential progenitor stages associated with loss of self-renewal and progressive decline in cell potential. Self-renewing (*) stem cells divide and give rise to highly proliferative transit amplifying progenitors expressing Mash1, which give rise to Ngn1+ immediate neuronal precursors (INPs). INPs divide and differentiate into postmitotic neuron-specific tubulin- expressing (NST+), olfactory receptor neurons (ORNs). FGF2 acts on INPs to increase the number of divisions occurring before ORN differentiation and is proposed to increase the proliferation of presumptive olfactory stem cells. 24 1.4.2   Extracellular matrix molecules in OE and CNS neurogenic regions Stem cells reside in a microenvironment (or niche) that serves to regulate their proliferation, self-renewal and differentiation and thus maintain the stem cell pool over time. Sources of regulatory signals within the niche include cells, the basal lamina (BL) and extracellular matrix molecules (ECM) (Spradling et al., 2001; Doetsch, 2003; Li and Xie, 2005; Xie et al., 2005; Ninkovic and Gotz, 2007). In multiple tissues ECM and BL can act by changing cell adhesion, sequestering ligands creating bound stores, or by potentiating ligand activity (Spradling et al., 2001; Doetsch, 2003; Li and Xie, 2005; Xie et al., 2005; Ninkovic and Gotz, 2007). Additionally, matrix metalloproteinases found in the ECM and BL can cleave bound growth factors creating active ligands or soluble inhibitors. For example, metalloproteinase-9 creates soluble c-kit ligand after cleavage to recruit hematopoietic stem cells from the bone marrow (Heissig et al., 2002). Constituents of the ECM and BL include collagen, laminin, tenascin, heparan sulphate proteoglycans and can be enriched in growth factors (Erickson and Couchman, 2000). The adult CNS SVZ has a specialized BL, termed fractones, which forms an integral part of the neurogenic niche and contacts stem and progenitor cells (B, C, A type cells) as well as ependymal cells and microglia (Mercier et al., 2002). Fractones are projections of the perivascular BL in the subependymal zone forming a continuous BL (Mercier et al., 2002). The fractone base is found at the tip of perivascular macrophages with “stems” that cross the subependymal layer and “bulbs” underneath the ependyma (Mercier et al., 2002). Both fractone base and bulbs are extensively branched (Mercier et al., 2002). Fractones in adult rats, mice and humans are highly enriched in laminin and express collagen IV, nidogen and perlecan (Kerever et al., 2007). Restricted subregions of fractones that express N-sulphate heparan sulfate proteoglycan, are enriched with mitotic cells and specifically bind FGF2 (Kerever et al., 2007). Thus fractones appear to modulate the activity of signaling molecules (Kerever et al., 2007), which may be produced from niche cells like astrocytes and endothelial cells (Spradling et al., 2001; Doetsch, 2003; Shen et al., 2004; Li and Xie, 2005). SVZ neural progenitors have been identified and neurosphere-forming cells prospectively isolated, using the ECM receptor, 25 β1 integrin, whose loss results in reduced proliferation and increased cell death in nestin+ progenitor cells (Campos et al., 2004; Leone et al., 2005). Underlying the basal lamina region of the olfactory epithelium, in the lamina propria, fibroblasts and OECs secrete growth factors and ECM molecules that may contribute to the OE progenitor niche, but the OE niche is not yet well defined (Carter et al., 2004; Au et al., 2007). Conditioned media derived from purified OECs in particular has been shown to contain the ECM molecules fibronectin, collagen, laminin, and pigment epithelium-derived factor (PEDF), a factor secreted in the adult SVZ niche and known for its regulation of adult neural stem cells (Chuah and West, 2002; Ramirez- Castillejo et al., 2006; Au et al., 2007). Embryonic ORNs and OE progenitors express integrins including β1, that in HBCs, are downregulated after widespread ORN death following bulbectomy, during the proliferative phase of ORN regeneration (Calof et al., 1994; Carter et al., 2004). In vitro, the number and size of HBC-derived colonies can be regulated by ECM molecule substrates like collagen, laminin and fibronectin (Carter et al., 2004). Thus ECM molecules and growth factors in close proximity to OE and CNS neurogenic regions can play a critical role in the regulation of their progenitors, similar to other stem cell bearing tissues (Spradling et al., 2001; Doetsch, 2003; Shen et al., 2004; Li and Xie, 2005). 1.4.3   Transcription factors DLX is a family of homeodomain transcription factors that regulate development of multiple cell types in the telencephalon (Qiu et al., 1995) where DLX5 expression is detected in neuronal precursors (Liu et al., 1997; Stuhmer et al., 2002). Dlx5 is expressed in the olfactory placode and OE and is required for the normal development of the OE. In the OE, Dlx5 -/- mutants show variable severity and asymmetry in their defects that demonstrate a hypoplastic OE, with reduced ORNs that fail to target and innervate the OB (Depew et al., 1999; Long et al., 2003) because of an intrinsic defect (Merlo et al., 2007). The OB lacks glomeruli, has a disorganized structure and reduced numbers of specific neuronal subsets (Levi et al., 2003; Long et al., 2003). 26 FoxG1 is a winged-helix or forkhead-box (Fox) transcription factor (previously known as BF-1) (Kaestner et al., 2000), expressed in forebrain where it is thought to prevent premature differentiation of neuronal progenitors (Xuan et al., 1995; Hanashima et al., 2004). Mice null for Foxg1 have reduced cerebral hemispheres because of progenitor pool depletion, premature exit from the cell cycle and subsequent neuronal differentiation (Xuan et al., 1995). FoxG1’s role during olfactory development has not been widely studied, but its expression pattern has been used in transgenic mice to target the removal of floxed genes (Hebert and McConnell, 2000) to study the development of the OP and OE (Kawauchi et al., 2005). FoxG1 expression has been found in the tadpole olfactory placode and a mouse olfactory placode-derived cell line, OP27, produced by infecting placodal cells with a retrovirus having temperature sensitive alleles of SV40 large T antigen (Illing et al., 2002). Gene expression profiles indicate that the OP27 line resembles progenitors, which can differentiate into ORNs when placed at a temperature not permissive for continued SV40 large T antigen expression (Illing et al., 2002; Regad et al., 2007). Nuclear FoxG1 was detected in OP27 cells at their progenitor stage that was translocated into the cytoplasm after differentiation. This subcellular localization of FoxG1 is regulated by the phosphorylation of specific FoxG1residues, where export from the nucleus is regulated by FGF2, and whose mechanism is shared by olfactory and cortical progenitors (Regad et al., 2007). Runx1 is a member of the Runt/Runx family of transcription factors that are important for the regulation of cell proliferation and differentiation during development (Lund and van Lohuizen, 2002; Coffman, 2003). Mouse Runx1 is expressed in subtypes of motor and sensory neurons, whose postmitotic development is perturbed when Runx1 function is disrupted (Theriault et al., 2004). First detected in the olfactory placode, expression of Runx1 is found predominantly in basal progenitors and immature neurons in the embryonic OE (Theriault et al., 2005). Runx1 mutant mice have decreased proliferation and NeuroD+ cells, but increased number of NST+ ORNs in the dorsal- lateral region. OE neurospheres show an increase in proliferating cells when infected with Runx1-GFP expressing adenoviruses compared to GFP controls (Theriault et al., 27 2005). These results suggest Runx1 is important for the proliferative maintenance of neuronal precursors to prevent premature differentiation (Theriault et al., 2005). Six1 is a homeodomain protein expressed throughout the OP and in neurogenic precursors in the embryonic OE (Tietjen et al., 2003; Ikeda et al., 2007). Neurogenesis is disrupted in Six1-/- mutants that show no change in Mash1+ neuronal progenitors, but a decrease in Ngn1+ and NeuroD+ cells and increase in expression of Hes1 and Hes5 (Cau et al., 2000; Ikeda et al., 2007). Pioneer neurons are absent, ORN axons fail to extend to the OB and GnRH+ neurons fail to migrate to the forebrain in Six1 mutants (Ikeda et al., 2007). Activation of the Notch pathway results in the upregulation of Hes genes (Jarriault et al., 1995; Ohtsuka et al., 1999) mammalian homologues of Drosophila Hairy and enhancer of split genes (Akazawa et al., 1992; Sasai et al., 1992). The bHLH transcription factors, Hes1 and Hes5, serve as negative regulators of neurogenesis in the mammalian CNS (Ishibashi et al., 1995; de la Pompa et al., 1997; Ohtsuka et al., 1999). In the olfactory placode, Hes1 is expressed in a broad domain and is maintained even in Mash1-/- mutants (Cau et al., 2000). Hes 5 is expressed in clusters of progenitors and cannot be detected in Mash1-/- mutants (Cau et al., 2000). Mash1 expression is detected outside of its normal placodal domain in E10.5 Hes1-/- mutants, but expression of SCG10, a pan neuronal marker, remains unchanged. By E12.5, increased neuronal density is detected in the Hes1-/- OE, suggesting a delay in differentiation (Cau et al., 2000). Contrary to this Hes5-/- mutants had no apparent defect, but double mutants, Hes1-/- Hes5-/- demonstrated synergistic defects with increased Ngn1+ cells and neuronal density in the olfactory placode (Cau et al., 2000). These results suggest dual roles for Hes1 to regulate Mash1 transcription thus imposing a regional domain of placodal neurogenesis and as a neurogenic gene to control the density of neuronal progenitors within this domain (Cau et al., 2000). Hes5 acts later than Hes1 in the ORN lineage (Cau et al., 1997; Cau et al., 2002) and can synergize with Hes1 to regulate Ngn1 neuronal precursors (Cau et al., 2000). 28 In the adult rat Hes1 expression is found in sustentacular cells, which immediately after chemical lesion that destroys neuronal and non-neuronal cells, but not after OB removal that kills neurons only, is detected in cells above HBCs (Manglapus et al., 2004). These Hes1 expressing cells are proposed to become new sustentacular cells derived from GBCs (Manglapus et al., 2004). Hes5 is expressed in a subset of GBCs and OECs in the normal OE and expression transiently lost after chemical lesion or bulbectomy (Manglapus et al., 2004). During the recovery of the adult OE from lesion, the sequential expression of Mash1-Ngn1-NeuroD, and Hes1 and Hes5 appears to recapitulate that seen during embryonic OE development (Cau et al., 1997; Cau et al., 2000; Cau et al., 2002; Manglapus et al., 2004). Thus, Hes genes can influence cell fate determination and can act as negative regulators to inhibit the action of bHLH-positive regulators, like Mash1 (Cau et al., 2000). Pax6 is a protein with paired box and homeobox DNA binding domains that is expressed in the olfactory pit (Walther et al., 1991), basal and apical embryonic OE and in basal cells, sustentacular cells and Bowman’s gland cells postnatally (Davis and Reed, 1996; Behrens et al., 2000). Pax6 expression promotes adult CNS neurogenesis and migration of neuroblasts in the RMS and directs them towards a dopaminergic phenotype in periglomerular and granule neurons in the OB (Hack et al., 2005; Kohwi et al., 2005). Pax6 Sey/Sey mutants die neonatally and fail to form OBs or induce lens and olfactory placodes leading to the absence of, or reduction in, their eyes and nose (Hogan et al., 1986; Hill et al., 1991). Retinoic acid signaling is undetected in the remnant frontonasal epithelium of Pax6 Sey/Sey mutants, even though RA receptors and binding proteins are present (Anchan et al., 1997; Whitesides et al., 1998; Bhasin et al., 2003). Failure of retinoic-acid producing neural crest cells to migrate to the frontonasal process may partially account for the placodal induction failure seen in Pax6 Sey/Sey mutants (Hill et al., 1991; Matsuo et al., 1993; Whitesides et al., 1998; LaMantia et al., 2000). Sox2, an Sry-related HMG (high mobility group) box transcription factor, is expressed in the olfactory placode in presumptive olfactory stem cells (Kawauchi et al., 2005), in embryonic OE apical and basal progenitors (Beites et al., 2005; Larouche and 29 Roskams, 2008) and in sustentacular cells and basal cells in the postnatal OE (Larouche and Roskams, 2008). OE expression of Sox2 is similar to that of Pax6 (Larouche and Roskams, 2008), consistent with Sox2 and Pax family members acting as co-factors, as they do in lens-specific enhancer elements to induce the lens placode (Kamachi et al., 2001). Recently Oct-1, encoded by the Pou2f1 gene from the POU family, has been shown to complex with Sox2 and synergistically activate Pax6 expression by cooperatively binding the Pax6 lens ectoderm enhancer (Donner et al., 2007). Supporting this role in vivo, Oct-1, Sox2 and Pax6 are co-expressed during lens and placode induction and subsequent developmental stages (Donner et al., 2007). Additionally, lens and placode development are disrupted in compound Oct-1-/- Sox2+/- mutants (but not Oct-1-/- mutants). These results demonstrate the cooperative roles that can be used by different transcription factors during development. Lhx2 is a LIM homeobox gene (Xu et al., 1993) that is expressed in basal progenitors and post-mitotic ORNs in the E12.5 OE (Cau et al., 2002; Hirota and Mombaerts, 2004; Kolterud et al., 2004) and whose expression is lost in Mash1-/- mutants (Cau et al., 2002). Lhx2 binds to the homeodomain site in the mouse M71 olfactory receptor gene promoter (Hirota and Mombaerts, 2004). Lhx2-/- mutants have an OE morphology that appears grossly normal, with no apparent change in Mash1+ or Ngn1+ cells (Hirota and Mombaerts, 2004; Kolterud et al., 2004). Lhx2-/- mutants have an increase in NeuroD+ cells and decrease in GAP43+ immature neurons, with little to no OMP expression, indicative of mature neurons (Hirota and Mombaerts, 2004; Kolterud et al., 2004). These results suggest a role for Lhx2 in the determination of late stage ORN development, whose defects occur during the terminal differentiation of immature ORNs (Hirota and Mombaerts, 2004; Kolterud et al., 2004). Lhx2 may also control regional gene expression in gene subsets, since in Lhx2-nulls expression of OCAM and mammalian-specific class II odorant receptor genes is lost (Hirota and Mombaerts, 2004; Kolterud et al., 2004), but not fish-like class I odorant receptor expression (Hirota and Mombaerts, 2004). 30 Olf-1 (Wang and Reed, 1993) (renamed O/E-1) binds to sequences in the OMP promoter (Wang et al., 1997; Tsai and Reed, 1998) (and other genes preferentially detected in ORNs), and can activate reporter genes downstream of these elements (Walters et al., 1996; Behrens et al., 2000). O/E-1 proteins are predominantly expressed in distinct brain regions, retina and together with the related sequences of O/E-2 and O/E-3 in OE neuronal precursors and ORNs (Wang et al., 1997). The zinc finger protein, Roaz (rat O/E-1-associated zinc finger protein), detected in ORN precursors and immature ORNS (but not mature ORNs), can bind to, sequester, and negatively regulate O/E proteins and thus plays a role in the temporal and spatial pattern of ORN-specific gene expression (Tsai and Reed, 1998). Roaz may function to negatively modulate the transcriptional activity of O/E-1 and act as a developmental switch coordinating the balance between ORN precursors and their differentiation (Tsai and Reed, 1998). Similar functions for O/E-2,3 may account for the normal OE phenotype seen in O/E-1 null mice (Lin and Grosschedl, 1995). NFI (nuclear factor I) is a DNA-binding protein with binding sites found in several genes that are preferentially expressed in ORNs (Behrens et al., 2000). Co-transfection of O/E-1 into HEK 293 cells with OMP promoter-luciferase reporters containing NFI binding sites, upregulates OMP-reporter expression (Wang et al., 1997; Tsai and Reed, 1998; Behrens et al., 2000), which is attenuated by NFI addition (Behrens et al., 2000). Augmented expression of OMP-luciferase is detected when the NFI binding sites are mutated. These reporter assays combined with in situ NFI expression data in the developing and adult OE, determined that NFI could also negatively regulate the expression of OMP (Behrens et al., 2000). The extensive cell potential of OE progenitors and the crucial role of transcription factors in determining cell fate and differentiation is further demonstrated by gain of function experiments using transcription factors from other cell types. Transfection of Olig2 plus Nkx2.2 into cell lines derived from adult OE neurospheres produced cells with oligodendrocyte morphology and antigen expression (myelin basic protein) (Zhang et al., 2005), similar to results when using embryonic neural stem cells (Copray et al., 2006). 31 Using electron microscopy, Olig2/Nkx2.2 co-transfected OE cells appeared to make contacts and ensheath dorsal route ganglion cells in co-cultures (Zhang et al., 2005). The production of oligodendrocyte-like cells from adult human OE cells was also seen after transfection of Sox10 with Nkx2.2 (Zhang et al., 2005). Similarly, when Olig2 or Ngn2 were co-transfected with HB9, a motoneuron transcription factor (Zhang et al., 2005), into these same adult OE cell lines, the resulting cells expressed motoneuron markers (for example, Isl1/2) and made contact with chick muscle, mimicking neuromuscular junctions in co-cultures (Zhang et al., 2006a). Thus, although oligodendrocytes and motoneurons are not normally produced by endogenous OE progenitors, these experiments demonstrate the vast cell potential of adult OE progenitors. 1.5   In vitro assays of neural progenitors In vitro assays are used to gain a better understanding of how individual factors influence lineage determination and cellular differentiation. Such assays allow one to monitor individual progenitors or colony forming cells and test their responsiveness to extrinsic factors and delineate the underlying regulatory mechanism(s) (Morrison, 2001). Care must be taken in making conclusions based on in vitro assays, since cells may acquire certain characteristics over time in culture, that differ from those in vivo. Because of this, the culture of cells may more accurately test a cell’s developmental potential and not necessarily its endogenous cell fate, since the in vivo environment may not be recapitulated in vitro (Morrison, 2001). 1.5.1   SVZ-derived neurospheres: The neurosphere assay Single cell suspensions of murine adult brain cells, microdissected from the subependyma of the lateral ventricles, proliferate and expand to form non-adherent clonal colonies, termed neurospheres, when cultured in serum-free media supplemented with growth factors, like EGF and/or FGF2 (Fig 1.7) (Reynolds and Weiss, 1992; Weiss et al., 1996b; Tropepe et al., 1999). After growth factor withdrawal and addition of serum, cells from individual neurospheres can differentiate into neurons and glia (astrocytes and oligodendrocytes), demonstrating their multipotency (Weiss et al., 1996b). Individual 32  Figure 1.7 CNS SVZ neurosphere assay Cells microdissected from the subependyma of the lateral ventricles, proliferate and expand to form non-adherent clonal colonies, termed neurospheres, when cultured in serum-free media supplemented with growth factors. Individual neurospheres can self-renew while maintaining cells that can differentiate into neurons (NST+ green) and glia (astrocytes-GFAP+ green, and oligodendrocytes-O4+ red). Top diagram, with permission from Reynolds and Weiss 1996. 33 neurospheres can self-renew (form new neurospheres) and expand after dissociation into single cells and passaging, while retaining their multipotency (Weiss et al., 1996b). Thus neurospheres are thought to contain stem cells. But, what constitutes a neural stem cell is debated since, despite several efforts, there are no in vivo repopulation functions equivalent to that seen in the hematopoietic system, and the markers commonly used to identify neural stem cells can be found on non-stem cell types too (Pincus et al., 1998; Uchida et al., 2000; Keyoung et al., 2001; Rietze et al., 2001; Capela and Temple, 2002; Kim and Morshead, 2003; Capela and Temple, 2006; Corti et al., 2007; Coskun et al., 2008). The production of neurospheres is often mistakenly equated as a retrospective and quantitative indicator of neural stem cells in the initial population (Seaberg and van der  Kooy, 2003). Since neural progenitors can also form neurospheres, but with limited self-renewal compared to stem cells, not all neurospheres are stem cell-derived (Seaberg and van der Kooy, 2003; Louis et al., 2008). Neurospheres are comprised of a heterogeneous cell population, whose stem cell composition is estimated to be less than 1%, as determined by the percentage of single cells from dissociated primary spheres capable of forming new spheres with multipotency (Morshead and van der Kooy, 2004). Because of this, SVZ neurospheres are more appropriately said to demonstrate stem cell attributes. Cells isolated from the embryonic ventricular zone, postnatal and adult subventricular zones can all produce multipotent neurospheres in culture (Reynolds and Weiss, 1992; Weiss et al., 1996b; Tropepe et al., 1997; Hitoshi et al., 2002). The disadvantages of using neurosphere formation as a stem cell indicator are that the assay requires cell proliferation and progeny survival. The absence of neurosphere formation may indicate a lack of stem cells in the initial population, or the inability of stem cells or their progeny progenitors to expand (because of inhibitory or lack of permissive signals) or survive (Morshead and van der Kooy, 2004). Nonetheless, the neurosphere assay has been used as a correlate for stem/progenitor cell activity and to determine cell potentials in response to extrinsic and intrinsic signals (Gritti et al., 1999; Hitoshi et al., 2002; Theriault et al., 2005). 34 1.5.2   Explants, colony assays and cell lines from the embryonic OE Explant cultures have been used to identify olfactory neuronal progenitors, place them at specific stages in the ORN lineage and to study the effects of growth factors on these progenitors (DeHamer et al., 1994; Shou et al., 1999; Shou et al., 2000). In embryonic OE explants, small pieces of epithelial tissue are cultured on merosin (a form of laminin) in defined media with growth factors, where within a few hours, cells that migrate away from the explant are immunohistochemically identified as ORNs and proliferating ORN precursors. Over 2 days, most proliferating cells divide once, producing two INPs, which differentiate into NCAM+ ORNs that are short lived (Calof et al., 1998a). Clonal colony assays, dependent upon OE-derived stroma, have shown that after 7 days in vitro single cell suspensions of progenitor-enriched embryonic OE (by immunopanning ORNs), from β-galactosidase-expressing ROSA26 mice, form four colony subtypes, with 5-50 cells per colony (Mumm et al., 1996; Shou et al., 1999; Shou et al., 2000). Only 0.07-0.1% of the progenitor-enriched input cells produce colonies, and only 1/4 morphological colony subtypes is neurogenic, representing 25% of all colonies, comprised of a subpopulation of ORNs and ORN precursors (Mumm et al., 1996). These colony assays correlate the number of neuronal colonies produced with a specific treatment, (for example, using growth factors) for use as a quantitative index of neurogenesis (Mumm et al., 1996; Shou et al., 1999; Shou et al., 2000). Immortalized clonal cell lines derived from the E10.5 olfactory placode have also been used to study the regulation of OE neurogenesis (Illing et al., 2002; MacDonald et al., 2005; Regad et al., 2007). Cell lines represent varying stages of ORN development, as determined by their gene expression, morphology and immunocytochemistry, before and after differentiation, induced by retinoic acid and a temperature increase to block SV40 large T antigen expression (Illing et al., 2002; MacDonald et al., 2005). Adult OE- derived clonal cell lines have also been produced using retroviral infection of dividing basal cells with oncogenic v-myc to study neurogenesis in vitro (MacDonald et al., 1996a; Zehntner et al., 1998). 35 1.5.3   Colony assays in the postnatal OE After plating adult human olfactory tissue in serum-containing cultures for several weeks, non-adherent spherical cell clusters akin to CNS neurospheres emerge, which can be passaged and contain cells that differentiate into neurons and glia (Roisen et al., 2001; Othman et al., 2003). Because of the length of time between the initial seeding and the emergence of these spheres, it is difficult to determine if they have a single cell origin. Others have dissociated the lamina propria from the OE prior to culture in serum- free media with EGF for 5 days to enrich for cells expressing antigens associated with HBCs, GBCs and sustentacular cells, before testing for responsiveness to various growth factors (Newman et al., 2000). These cultures can be used to characterize progenitors and their lineage but cannot provide insight into the cells initiating the cultures or the association between cells, as seen in colony-based assays. Using ECM-derived substrates, a subpopulation of prospectively isolated postnatal day 5 (P5) ICAM-1+ HBCs form clonally-derived adherent colonies when grown in serum-containing cultures supplemented with growth factors (Carter et al., 2004). Cloning efficiency and colony size is increased when collagen together with laminin, compared to either alone (or fibronectin) are used, highlighting the importance of ECM molecules in progenitor regulation. Because of the varying methods of cell enrichment, culture, and culture time prior to assessments, it is difficult to draw comparisons between progenitors detected in different assays and from varying ontogenic stages. Regardless of the developmental stage being tested, the aforementioned growth factor regulation studies could be confounded by the presence of contaminating factors in serum or paracrine factors arising from explant tissue or stroma. In order to better understand the differences in progenitor enrichment, cellular potential and growth factor responsiveness during ontogeny, it is important to begin by using the same assay in defined medium for all developmental stages and design experiments that control for paracrine effects. 36 1.6   Methods for lineage tracing neural stem/progenitor cells Lineage tracing is used to follow progeny of labeled cells through their development (Zinyk et al., 1998; Stern and Fraser, 2001). Identification of the precursors of mature cells can then be used to detail the temporal steps leading towards cell fate restriction. Additionally, by labeling progenitor cells they can be identified and isolated to study their growth, differentiation and gene expression profiles in vitro (Gu et al., 2003). Methods used to label cells for lineage tracing can be subdivided into dye, vector and DNA-based strategies and genetic labeling techniques using transgenic mice. 1.6.1   Dye, vector and DNA-based lineage tracing strategies Physical protocols used to label cells for lineage tracking include using vital dye reagents (for example, DiI or lysinated rhodamine dextran) (Bronner-Fraser and Fraser, 1988; Collazo et al., 1993), nucleotide analogues that incorporate into the DNA of dividing cells (for example, tritiated thymidine, bromo-, iodo-, chloro-deoxyuridine) (Angevine and Sidman, 1961; Graziadei and Graziadei, 1979b; Schwartz Levey et al., 1991) or methods such as in utero electroporation or transfection of plasmids expressing reporter proteins (Scherson et al., 1993; Borrell et al., 2005). The main disadvantage of these methods is that the label can be diluted in progeny cells with subsequent proliferation, and may be too dilute for detection. Dividing progenitor cells have also been labeled using low titre, replication-incompetent retroviruses that stably integrate into the host genome and thus persistently label single cells and their progeny (Cepko et al., 1984; Orban et al., 1992; Grove et al., 1993; Luskin, 1993; Reid et al., 1995; Morshead et al., 1998; McCarthy et al., 2001; Noctor et al., 2001). Retroviral vectors require that cells be dividing for their transduction, but don’t readily target rare quiescent stem cells (Miller, 1992). When they do, their expression in these cells can be prone to silencing (Ellis, 2005; Ellis and Yao, 2005). But the biggest disadvantage of retroviral tagging is that they transduce cells indiscriminately, and similar to other physical marking strategies, the cells they initially transduce cannot be readily identified (Huard et al., 1998; Doetsch et al., 1999b). Nonetheless physical methods have been successfully used to lineage trace dividing and migratory cells in the nervous system (Stern and 37 Fraser, 2001). Retroviral lineage tracing in the OE has established that cells that divide after bulbectomy (Caggiano et al., 1994) or methylbromide chemical lesion (Huard et al., 1998), most of which are GBCs (Huard et al., 1998; Chen et al., 2004), can produce neurons (Caggiano et al., ; Huard et al.) or rare clones of HBCs only (Caggiano et al., 1994). Other clones were comprised of Sus cells only, GBCs plus ORNs, Sus cells with Bowman’s gland/duct cells, or ORNs together with Sus cells, HBCs and GBCs (Huard et al., 1998). 1.6.2   Genetic labeling using transgenic mice and Cre-mediated recombination Genetic methods to tag progenitor cells take advantage of endogenous gene expression patterns and thus identify cells by the expression of a particular gene (Zinyk et al., 1998). Tissue specific or cell type specific promoter/enhancer elements are used to drive Cre (cyclization recombination) recombinase expression, a protein from bacteriophage P1, that mediates site-specific recombination between loxP (locus of cross over) sites to irreversibly tag cells from the first time the promoter is activated, but can’t distinguish between newly tagged members as cells accumulate (Sauer, 1998). Cre recombinase activity is used to either eliminate an endogenous gene or transgene, or activate a transgene by removing sequences blocking transgene expression (Gu et al., 2003; Malatesta et al., 2003; Anthony et al., 2004; Joyner and Zervas, 2006; Miyoshi and Fishell, 2006). To perform Cre-mediated lineage tracing, two transgenic lines are required. The reporter drives expression of a reporter gene using a ubiquitous or tissue-specific promoter, and the activator that uses a tissue-specific or cell type-specific promoter to drive Cre recombinase (Fig 1.8) (Mathis et al., 1997). A number of reporter lines are available including Z/EG (Novak et al., 2000), ROSA26R (Soriano, 1999), ROSA YFP (Srinivas et al., 2001) (see Fig 3.6). Without Cre expression, a loxP-flanked poly- adenylation sequence upstream of the reporter prevents its expression, which is removed in double transgenic animals by Cre expression, and thus allows reporter expression and labeling of all progeny cells. Following excision, labeled cells accumulate in the Cre-expressing lineage, and permit detection of progeny cells no longer expressing the gene of interest. 38 Figure 1.8 Fate mapping using Cre-loxP Fate mapping using Cre-loxP recombination requires two transgenic mouse lines: 1. the transgene activator that uses a tissue-specific or cell type-specific promoter to drive Cre recombinase; 2. the reporter that will express a specific reporter protein (EGFP) after excision of the sequences flanked by loxP sites (βgeo/polyA sequence). Only double transgenic mice have the potential to excise intervening sequences and express the reporter, in all progeny cells following the excision event. 39 Cell lineage may also be inferred after removal or inactivation of a specific gene or cell-specific ablation, and determining the cell types lost compared to the wildtypes. Tissue-specific promoters expressing a cell toxin in transgenic animals, like the Diphtheria toxin A subunit, kill cell populations whose precursors expressed the transgene (Chen et al., 2005). The herpes simplex virus thymidine kinase gene, driven by the GFAP promoter, has also been used in transgenic mice to kill off GFAP+ putative stem cells, after the administration of gancyclovir, but spares cells not expressing the transgene (Morshead et al., 2003; Garcia et al., 2004). The absence of a cell type after ablation is taken as evidence that a gene labels the precursors of the lost cells. Lineage may not always be accurately reflected with cell ablation since one can’t distinguish if the ablated cells themselves are progeny, reflecting a cell autonomous mechanism, or cells necessary for the production of the absent cell types, demonstrating a non-cell autonomous action of a specific protein. Disadvantages to Cre-mediated/reporter-dependent methods are that there may be a lag time between Cre expression, excision and detection of the reporter protein, Cre excision may fail to occur or reporter expression go undetected due to critically low levels of expression, or the promoter may not recapitulate endogenous gene expression (Joyner and Zervas, 2006; Miyoshi and Fishell, 2006). To overcome this, reporter gene expression can be under the direct activation of the promoter, so that promoter activation coincides with reporter expression, and thus help to alleviate lag times in reporter expression that are Cre-dependent (Anthony et al., 2004; Mignone et al., 2004). Refinement of the Cre/loxP system allows for promoter driven Cre to be temporally activated by fusing the catalytic domain of CRE recombinase to the ligand- binding domain of a modified estrogen receptor (Cre-ER) (Metzger et al., 1995; Feil et al., 1996; Danielian et al., 1998; Hayashi and McMahon, 2002). Tamoxifen administration is required for nuclear translocation of Cre protein and to subsequently catalyze loxP-mediated recombination, that can be used to selectively label cells expressing Cre-ER at specific times by administration of tamoxifen (Danielian et al., 1998; Hayashi and McMahon, 2002). Rapid activation and subsequent down regulation of Cre expression occurs with tamoxifen administration and withdrawal (Hayashi and McMahon, 2002). This inducible system allows one to follow the progeny of precursor 40 cells born at defined developmental stages or during regeneration, and to circumvent problems associated with early gene ablation or over expression at certain developmental time points (Danielian et al., 1998). When expressed from promoters found in radial glial cells (like Nestin, GFAP and GLAST), inducible Cre transgenic mice have been used to label and identify the progeny of CNS radial glia perinatally and in the adult brain. These studies collectively detected labeled cells in SGZ and SVZ, soon after induction, identified as putative stem cells, and at later times found Dcx+ neuroblasts in the RMS, dentate gyrus SGZ and differentiated neurons in the OB and dentate gyrus (Beech et al., 2004; Ganat et al., 2006; Hirrlinger et al., 2006; Mori et al., 2006; Burns et al., 2007; Lagace et al., 2007). Because expression of these promoters is not exclusive to radial glia at the developmental stages tested, labeled cells included subpopulations of oligodendrocytes, astrocytes, ependymal cells and neurons in the cerebral cortex (Beech et al., 2004; Ganat et al., 2006; Hirrlinger et al., 2006; Mori et al., 2006; Burns et al., 2007; Lagace et al., 2007). Although these studies used various promoter and enhancer elements and performed induction and assessments at varying postnatal developmental stages, their results showed that most labeled cells arising from either the SGZ or the SVZ become neurons, thus linking activation of promoters like Nestin with neuronal cell fate (Beech et al., 2004; Ganat et al., 2006; Hirrlinger et al., 2006; Mori et al., 2006; Burns et al., 2007; Lagace et al., 2007). Although transgenic approaches to trace lineages are now commonly used in the CNS, they have not yet been used in the embryonic OE. 1.7   Introduction and project summary Cell replacement after death or injury occurs to varying degrees in neural tissue and is dependent upon the recruitment and differentiation of stem and/or progenitor cells (Doetsch et al., 1999a; Garcia et al., 2004; Ahn and Joyner, 2005; Sohur et al., 2006). But despite the discovery of neural stem cells in the postnatal CNS, there is an extremely limited capacity for endogenous CNS neuronal replacement (Doetsch et al., 1999a; Garcia et al., 2004; Ahn and Joyner, 2005; Sohur et al., 2006). Since adult neural progenitors are thought to resemble those in the embryo, identifying neural progenitors 41 during development may help elucidate the molecular controls that allow for the directed differentiation of specific cell types, the maintenance and expansion of their precursors, and factors required for the recruitment of endogenous postnatal progenitor cells (Manglapus et al., 2004; Sohur et al., 2006). The olfactory epithelium is an ideal tissue to study neural stem/progenitor cells and neural development, because it provides a simplistic model of lifelong neurogenesis consisting of a single neuronal subtype, fueled by OE stem/progenitor cells (Schwob, 2002). The overall goal of my thesis is to better understand how olfactory progenitors contribute to neurogenesis. To achieve this goal I first need to identify candidate olfactory progenitors, develop an assay to study the regulation of neurogenesis in vitro, and employ methods to label and lineage trace the candidate progenitors in vivo and in vitro. I do so while testing the following hypotheses in 3 Aims: Aim 1. Test for radial glial-like progenitors in the embryonic OE and fate map their progeny. I hypothesize that the embryonic OE contains radial glial-like progenitors that can contribute to olfactory neurogenesis. I will test for CNS radial glial-like progenitors in vivo and in vitro, identified by using antigens indicative of radial glia, in the embryonic and/or postnatal OE. Using transgenic mice, I will lineage trace the progeny of precursor cells that activate either nestin or BLBP regulatory elements, using cell type specific antigens. This will determine if multipotent radial glial-like progenitors reside outside of the CNS. Aim 2. Does OE progenitor frequency and function change during embryonic, postnatal and adult ontogeny? I hypothesize that OE progenitor frequency, neurogenesis and self-renewal, when assayed under similar conditions using in vitro neurosphere assays, will decrease with aging. I will test the frequency, passaging capacity and differentiation potential of OE progenitors during embryonic, postnatal and adult ontogeny using in vitro neurosphere 42 assays and antigens for specific cell types. This will establish the developmental stage having the most robust in vitro progenitor capacity to test progenitor regulation by FGF signaling. Aim 3. Test how embryonic OE nestin+ progenitors are regulated by FGF signaling. I hypothesize that FGF signaling will enhance neurogenesis by increasing nestin+ progenitor proliferation leading to increased ORNs.  I will test for FGF receptor expression in OE nestin+ progenitors in vivo, and the effects of modulating FGF signaling in vitro, using gain and loss of function experiments, on embryonic OE progenitor output (colonies/spheres), nestin+ progenitor proliferation and neuronal differentiation. I will test the effects of FGF signaling on the abundance of Mash1+ neuronal progenitors. These experiments will tell me where in the ORN lineage FGF signaling could be acting and how embryonic OE nestin+ progenitors contribute to OE neurogenesis via FGF signaling. 43 CHAPTER 2       MATERIALS AND METHODS 2.1   Tissue Preparation Adult and postnatal mice were anaesthetized with Xylaket: 25 mg/ml Ketamine HCL (MTC Pharmaceuticals), 2.5 mg/ml Xylazine (Bayer Inc.), 15% ethanol, 0.55% NaCl (120 mg/kg Ketamine and 12 mg/kg Xylazine), perfused with cold PBS and 4% paraformaldehyde (PFA) in PBS. Olfactory epithelia, brains and olfactory bulbs were dissected out and post-fixed for 2 hours in 4% PFA at 4ºC (Carter et al 2004). Tissues were cryoprotected at 4ºC in 10% and 30% sucrose/PBS, 24 hours each, and after suctioning for 5 minutes under gentle vacuum, embedded in Tissue-Tek medium (OCT; Sakura Finetek, Torrance, CA) before freezing in liquid nitrogen. Coronal, sagittal or transverse 12-14 µm sections were taken on a HM 500 cryostat (Micron), mounted onto charged Superfrost glass slides (Fisher) and stored at –20°C for subsequent analysis (Carson et al 2006). For embryos, pregnant dams were anaesthetized (outlined above), embryos dissected out and rinsed in PBS before being immersion-fixed in 4% PFA overnight and cryoprotected (outlined above). The day of vaginal plug was defined as E0.5. 2.2   Immunofluorescence and immunohistochemistry Standard conditions: Frozen sections were placed on a slide warmer (42°C) for 10 minutes, post-fixed in 4% PFA, PBS washed twice, 5 minutes each. Sections were permeabilized in 0.1% Triton-X-100/PBS for 30 minutes, PBS washed twice for 5 minutes each, and blocked with 4% normal serum for 20 minutes prior to primary antibody incubation (see Table 2.1), over night (15-20 hours) at 4ºC. Sections were twice PBS washed, 5 minutes each before adding secondary antibodies (1:200) in 2% normal serum for 30-60 minutes. Secondary antibodies used were biotin, Alexa 594 or Alexa 488 conjugated (Invitrogen Molecular Probes) raised in donkey or goat. Sections were twice PBS washed before incubation with 0.5ug/ml diaminopyridine imidazole (DAPI) and a PBS wash at room temperature, each for 5 minutes. Coverslips were stabilized 44 with nail polish and mounted with Vectashield (Vector Laboratories, Burlingame, CA) for fluorescent antigens or Aquapolymount (Polysciences Inc) for VIP. For immunohistochemistry only, after washing to remove unbound secondary antibodies, sections were incubated for 10 minutes in 0.5% hydrogen peroxide in PBS to quench endogenous peroxidase activity and washed in PBS. Secondary antibodies were conjugated to avidin using the Vectastain ABC kit (Vector Laboratories), following the manufacturer’s suggestions, for 30 minutes at room temperature before washing twice in PBS, 5 minutes. Sections were developed in VIP (Vector Laboratories) and stopped by submerging in tap water for 10-60 minutes before mounting. Nuclear antigens required antigen retrieval that required microwaving on high for 10 minutes immersed in 0.01M citric acid, cooled for 10 minutes before washing in PBS (5 minutes) and proceeding to permeabilization and serum blocking. Exceptions: Prior to blocking, Sus4 detection required a 60 second incubation of the sections with 0.12% trypsin/EDTA (Gibco), followed by washing in PBS. Co-labeling with Sus4 and PCNA was performed sequentially with fixation in 4% PFA after the Sus4 primary and secondary antibodies, followed by washing and re-blocking before antigen retrieval (MacDonald et al., 2005) and the PCNA primary and secondary antibodies. Nestin monoclonal antibody (Rat401 clone), but not Nestin polyclonal rabbit antibody (Nestin clone 20), required antigen retrieval in 0.01M citric acid microwaved for 10 minutes before blocking. Cre detection required antigen retrieval before blocking/permeabilization in 10% serum/0.1% Triton-X-100/PBS. Cre antibodies were incubated in blocking solution and washed in 0.1% Triton-X-100/PBS. Cre and Mash1 signals were amplified using the Vectastain ABC Kit (Vector Laboratories) and Amplex Red Elisa Kit#2, Horseradish Peroxidase conjugate (Molecular Probes), following the manufacturer’s instructions, and developed for 5 minutes before washing in PBS. For co-detection of antigens with Cre, tissues were re-blocked in 10% serum/0.1% Triton-X-100/PBS prior to sequential primary antibody incubation. 45 2.3   Calculating the percentage and distribution of proliferating cells in OE Proliferating cells were identified in embryonic (E13.5), postnatal (P5) and adult OE using antibodies detecting PCNA, on 3 to 5 mice, 3 sections per mouse (rostral, middle and caudal OE) sampling from the septum, ectoturbinate 1 and endoturbinate IIa or IIb for each mouse. Total PCNA+ and DAPI+ cells in 100 to 200um were counted to determine the percentage of PCNA+ cells: (#PCNA+ cells/total # DAPI+ cells) x 100% and expressed per 500um. Distribution of PCNA+ cells-apical and basal OE compartments were defined by dividing the OE into equal upper (apical) and lower (basal) halves at 100um intervals and connecting the points using Northern Eclipse software. The percentage of apical and basal PCNA+ cells was determined as follows: (# apical or basal PCNA+ cells/total # apical and basal PCNA+ cells) x 100. 2.4   Immunocytochemistry Immunocytochemistry was performed with cells plated onto collagen:laminin coated glass coverslips. Coverslips were placed into each well of a 12 or 24 well plate and covered with 1 ml of PBS containing collagen (2.5-5ug/cm2) and laminin (1-2ug/cm2, from Engelbreth-Holm-Swarm sarcoma; both Roche) and left at room temperature for 2- 24 hours. Just prior to use, each well was washed with PBS before adding media and cells. Immunocytochemistry was performed as outlined for immunohistochemistry except that for nuclear antigen detection, cells were fixed for 3 minutes in -20°C methanol and washed in PBS prior to proceeding directly to serum blocking. For BrdU detection, coverslips were treated with 4M HCl for 10 minutes prior to serum block and treated with primary and secondary antibodies sequentially for NST-Rat BrdU. 2.5   Quantification of antigen expressing cells The percentage of antigen-positive cells was determined by counting 10-20 fields of view under 400x magnification for 2-3 coverslips per experiment, in 3 independent experiments. The percentage of antigen-positive cells per colony was determined by counting: (# antigen-positive cells/total # cells per colony measured by counting DAPI- 46 stained nuclei) x 100. Counts of cells expressing specific antigens in embryonic semi- adherent colonies included 2-4 coverslips per antigen (average of 33 colonies tested / antigen; minimum of 3 experiments). 2.6   Histochemistry Lac Z histochemistry was performed on cryosections postfixed in 4% PFA for 10 minutes, permeabilized in 0.1% Triton-X-100 for 30 minutes and washed in PBS before adding staining buffer (2 mM MgCl2, 0.01% deoxycholate, 0.02% Nonidet-P40, and 100 mM NaPO4, pH 7.3) containing 1 mg/mL X-gal, 5 mM potassium ferrocyanide, and 5 mM potassium ferricyanide. Staining proceeded at 37°C protected from light for 1-10 hours. Negative controls did not demonstrate β-galactosidase staining and included CD-1 non- transgenic mice, Nestin-Cre or OMP-Cre transgenic mice without the ZEG transgene. Results were confirmed using antibodies to β-galactosidase, however the detection level and reproducibility were not as good as with histochemistry. 2.7   Image Analysis All images were visualized with an Axioskop 2 MOT microscope (Zeiss, Jena GER) using a SPOT camera (Diagnostic Instruments Inc., Sterling Heights MI) with Northern Eclipse software (Empix Imaging Inc.) and compiled using Adobe Photoshop 7.0. 2.8   OE and SVZ cell isolation E13.5, P5 and adult OE and SVZ were dissected from the same mice and transferred to PBS with 100 U/ml penicillin, 100 ug/ml streptomycin plus 0.6% glucose. Embryonic head primordia were dissected at the level of the first brachial arch, the lower jaw removed and the OE isolated in its entirety, prior to removing the epidermal ectoderm and dissection of the ganglionic emini (Reynolds and Weiss, 1992). The 47 medial and lateral walls of the lateral ventricle subependyma were isolated from postnatal mice (Tropepe et al., 1997) after removal of the OE. 2.8.1   OE tissue Pooled OE tissue was minced into 1 mm2 pieces with an ethanol-sterilized razor blade in a 60 mm petri dish, transferred to a 50 ml tube, and dish washed in PBS/glucose/penicillin, streptomycin (up to 20 ml) prior to spinning at 160 rcf (relative centrifugal force, or G force), 10 minutes. Postnatal OE was filtered (40 um), before the first spin. All but 3 ml of liquid were removed before triturating the cells 25 times with a FBS pre-wetted P1000 tip, followed by triturating 30 times with a pre-wetted polished Pasteur pipette. Tube sidewalls were rinsed with PBS/glucose/penicillin, streptomycin (up to 20 ml) and cells spun at 460 rcf, 5 minutes.  All liquid was removed and cells resuspended in 2 ml of Neurocult media prior to counting cells. Cells were counted on a hemocytometer with trypan blue exclusion used to identify live cells. Cells were resuspended in media (0.7 -3 x 105 cells/ml) and for E13.5 OE, centrifuged at 100 rcf for 1 minute prior to plating, to pellet tissue aggregates. Because lower yields of spheres and/or colonies resulted after enzymatic digestion of adult and P5 OE using conditions routinely used for the isolation of basal cell adherent colony forming cells (per ml- DNase I 1 mg, Liberase blendzyme I 0.45 mg, hyaluronidase 1 mg) (Carter et al., 2004) or olfactory ensheathing cells (per ml-DNase 100 U, Dispase I 0.5 mg, collagenase D 1.2 mg, hyaluronidase 0.3 mg, BSA 1 mg)(Au and Roskams, 2003), trituration was routinely used for OE cell isolations. 2.8.2   SVZ tissues SVZ tissues were processed according to protocols received from S. Weiss (University of Calgary, Calgary, AB) and D. van der Kooy (University of Toronto, Toronto, ON). E13.5 ganglionic emini or P5 striatal tissues were pooled and transferred to a 15 or 50 ml tube from plates that were rinsed with PBS/glucose/penicillin, streptomycin. Tissues were triturated 20 times with a pre-wetted polished Pasteur pipette to form a 48 single cell suspension and cells spun at 460 rcf, 5 minutes before resuspending cells in 1 ml medium for counting. 2.8.3   Adult SVZ Adult SVZ required enzyme digestion in 0.33 mg/ml trypsin, 0.67 mg/ml hyaluronidase and 0.2 mg/ml kynurenic acid (all from Sigma) dissolved in the plating media by gentle shaking (about 2.5 ml per adult mouse), for 1 hour at room temperature, filtered sterile and stored at 37oC while dissecting the SVZ tissue. Pooled SVZ regions from both hemispheres, were cut into 1 mm2 fragments using a sterile razor blade and placed in enzyme solution. Tissue was triturated 30 times with a P1000 tip and incubated at 37oC for 15 minutes. The tissue was triturated until completely dissociated (up to 60 times) and digestion stopped with 2 ml of 0.7 mg/ml trypsin inhibitor (Roche). Adult SVZ tissue was triturated 30-40 times and spun at 100 rcf, 5 minutes. Supernatant was aspirated leaving 0.5 ml and 4 ml trypsin inhibitor was added. The trituration and spin were repeated once more. All but 0.5 ml of media was removed and cells resuspended in plating media for counting. 2.9   In vitro progenitor assays Cells from ganglionic emini/SVZ and OE were cultured in CNS neurosphere media: Neurocult, 1x proliferation supplement (Stem Cell Technologies), 20 ng/ml growth factors: EGF, FGF2, or EGF+FGF2  (Sigma), 100 U/ml penicillin, 100 ug/ml streptomycin, 2 mM L-glutamine (Invitrogen). A single cell suspension was determined by inspecting the cells on a hemocytometer at the time of counting and after plating, by observing the cells directly in each well. OE cells were plated either without substrates, or with substrates that coated glass coverslips in wells to facilitate subsequent immunocytochemistry. Substrates included collagen (2.5-5 ug/cm2; rat tail, mostly type I, Roche), laminin (1-2 ug/cm2; Roche, from EHS), collagen combined with laminin or Matrigel (1:100, approximately 4.5 ug/cm2; growth factor reduced; Becton-Dickinson). Collagen and laminin concentrations used were previously shown to enhance adherent colony number and size from P5 OE 49 (Carter et al, 2004). Substrates were suspended in PBS with 0.5-1 ml added to each 24 or 12 well (Falcon, Becton-Dickenson), respectively, and left at room temperature for 2- 24 hours. OE cells were plated into 12 or 24 well plates with 1.5 ml or 750 ul media, respectively, and 0.7-2 x 105 cells/ml (E13.5), or 1.4-3 x 105 cells/ml (P5); cell densities tested for their clonality. Clonal density was defined as the cell density, or densities, where progenitor readouts arise from the expansion of single cells, and was determined by mixing cells expressing GFP (from β-actin GFP mice) with cells that do not express GFP (from CD-1 mice), and testing for the cell concentrations where only GFP+ and GFP- colonies were detected, and not mixed colonies. Alternatively, clonal density was tested by analyzing the cell densities where only GFP+ and GFP- colonies were produced from Nestin-cre/ZEG transgenic mice, where only a subpopulation of all progenitors and their progeny express GFP after activating Cre recombinase (see Chapters 3,5). The total numbers of semi-adherent colonies or OE neurospheres (E13.5 OE; dependent upon the substrates used), adherent colony or sphere numbers (P5 OE), were counted in each well before fixation and processing for immunocytochemistry. OE non-adherent neurospheres were transferred onto collagen-laminin coated glass coverslips for immunocytochemistry and allowed to adhere for 3-6 hours prior to fixation. SVZ cells were plated at 10-25 cells/ul, 5,000 to 10,000 cells per well in 96 well plates without substrates. Primary cultures were grown for 7-10 days before counting non-adherent cell aggregates (neurospheres from the embryonic to adult SVZ, E13.5 OE neurospheres on collagen or laminin substrates alone), or spheres from the P5 and adult OE or adherent colonies or semi-adherent colonies from the P5/adult and E13.5 OE respectively. A neurosphere/sphere was counted if >25 um in diameter; adherent colonies or semi- adherent colonies comprised of >8 cells were counted. Passaging-individual neurospheres, spheres or colonies were mechanically dissociated in 150 ul of media (same media and growth factors as in primary culture) and transferred to 96 well plates. Pooled OE spheres or colonies were passaged and plated at their primary cell density (or as close as possible where cell numbers were limiting) using primary culture 50 conditions with fresh media and growth factors. Self-renewal was assessed by counting neurospheres, spheres or colonies after a further 7-10 days. 2.10   Enhancement of colony production 2.10.1   ECM substrates Collagen, laminin or Matrigel substrates alone, on glass coverslips in 24-wells, at the concentrations above, were used to test for their ability to enrich for E13.5 OE semi- adherent colonies compared to collagen with laminin substrates. Cultures were initiated with equal cell numbers and resulting colonies (adherent or non-adherent) counted after 10 days. 2.10.2   Olfactory ensheathing cell conditioned media Colony enrichment was also tested using conditioned medium harvested from purified passage 2 P5 OECs. Lamina propria olfactory ensheathing cell conditioned media (LP-OCM) was procured in serum-free media as described previously (Au and Roskams, 2003; Au et al., 2007). Briefly, passage 2 LP-OECs were grown for 96 hours prior to LP-OCM harvest in serum-free DMEM-BS (DMEM Bottenstein-Sato) media that contains 0.5 nM bovine pancreatic insulin, 100 ug/ml human transferrin, 0.2 nM progesterone, 0.1 nM putrescine, 0.49 nM triiodo-1-thyronine, 0.45 nM 1-thyroxine, 0.224 nM sodium selenite (all Sigma) and 2 mM L-glutamine (Invitrogen). LP-OCM was filtered (Ultrafiltration Cell, Millipore) under nitrogen gas to concentrate protein constituents greater than 1 kDa, and filtered sterile (O.22 um filter) before storage at - 80°C. The fold concentration of the filtrate was determined by measuring the volume of LP-OCM applied and that retrieved (volume applied/ volume retrieved = “x” concentration). Each batch of LP-OCM was standardized by counting the number of cells conditioning 1 ml of LP-OCM. Arbitrarily, 30,000 cells/ml LP-OCM was considered full strength. LP-OCM was added at final concentrations of 0.25-1x, at the time of plating, together with 20 ng/ml FGF2 in plating media (see above). LP-OCM alone did not support colony growth. 51 2.10.3   E13.5 OE semi-adherent colony conditioned media Conditioned media was produced from cultures of E13.5 OE (100,000 cells per 24-well, in triplicate, with 750 ul medium), plated onto collagen-laminin substrates (semi- adherent colony conditions with glass coverslips) with 20 ng/ml FGF2 (see Fig 4.10). After 24 or 48 hours, or 10 days, the medium from like wells was pooled and spun at 460 rcf, and frozen in 4-500 ul aliquots at -80°C. To test for FGF2 efficacy over time in culture, media was harvested from wells having FGF2 without cells. Embryonic OE cultures on collagen substrate, forming non-adherent spheres, were used in all subsequent tests of the OE conditioned media for colony growth because of the enhanced colony numbers produced compared to collagen-laminin. Conditioned media (thawed on ice; 20% vol:vol) from each timepoint -24, 48hr; 10 days- was tested for its ability to support E13.5 OE non-adherent colony production in fresh primary cultures, where FGF2 was added only to the positive controls. Since bioactive FGF2 and colony growth was supported at the latest timepoint, likely the most enriched for paracrine factors, 10 days in culture was used for further testing of paracrine factors affecting colony growth beyond FGFs. E13.5 OE cells were plated on collagen with 10 day-conditioned media with or without FGF blocking antibodies (1.2 ug/ml), to test for the ability to support colony production, by counting the number of colonies after 10 days and comparing to the positive controls containing fresh FGF2. The antibody concentration used to block FGF signaling was previously tested and shown to block almost 100% of non-adherent colony production in 20 ng/ml FGF2 (see Fig 4.9). Colonies produced with 10 day-conditioned medium, while FGF signaling was blocked, would be attributed to paracrine factors produced from E13.5 OE cells. 2.11   FGF signal blockade and BrdU labeling Blockade of FGF signaling in embryonic OE in vitro cultures was accomplished by adding 10 uM SU5402 (Calbiochem), to block receptor phosphorylation, or 0.12-4.8 ug/ml bFM-1 (Cell Signaling), an antibody that blocks ligand binding to the receptor, 52 together with 20 ng/ml FGF2. Controls included FGF2 alone or FGF2 with either vehicle or isotype control antibodies (IgG). FGF signal blockers were added at the time of plating or after 7 days, as indicated in the text. To test for cell proliferation in culture, 0.4 uM BrdU (Sigma) was added into individual wells in 10 ul media after 7 days and after a further 1-3 days cells were transferred to collagen-laminin coated coverslips and fixed prior to immunodetection of BrdU+ cells. 2.12   Transgenic mice Nestin-cre mice were obtained from P. Orban (University of British Columbia, Vancouver, BC; C57Bl/6) (Tronche et al., 1999). Hemizygous C57Bl/6 male Nestin-cre mice were crossed with female ZEG reporter mice from C. Lobe (Sunnybrook and Women’s College Health Science Centre, Toronto, Ontario) (Novak et al., 2000), that were either C57Bl/6 or CD-1 strains. ZEG mice express β-Galactosidase until Cre- mediated excision allows for EGFP expression. Nestin-Cre/ZEG double transgenic mice, where Cre recombinase expression is under the control of the nestin promoter and nervous system specific second intron regulatory elements of the rat nestin gene (Zimmerman et al., 1994a), express GFP throughout the CNS. An independently derived Nestin-Cre line (#2472; FVB/N strain) crossed with a reporter expressing β- Galactosidase from the ROSA locus following Cre-excision, Gtrosa26tm1Sor, (kindly provided by R. Slack, University of Ottawa, Ottawa Health Research Institute, Ottawa, Ontario) (Berube et al., 2005), showed strong β-Galactosidase expression in the forebrain and developing CNS as anticipated. OMP-Cre transgenic mice were generated in our lab after pronuclear injection of an 11kb EcoR1 digested fragment, containing the regulatory sequences controlling the olfactory neuron-specific expression of the OMP gene (Danciger et al., 1989) and Cre recombinase coding sequence. The pG-ROMP plasmid, containing an 11 kb EcoRI genomic rat OMP fragment (kindly provided by Frank Margolis), was digested with AatII/Aar I to remove the OMP gene, and a 1057bp AatII/Eco31l fragment from PCR amplified NLS-Cre (plasmid kindly provided by Dr. Corrine Lobe) was subcloned into the 53 vector. C57Bl/6 OMP-cre mice were crossed with female Z/EG mice (C57Bl/6 or CD-1) to obtain double transgenic mice. Expression and efficiency of Cre-lox P recombination was verified by the specific co-localization of Cre with OMP and OMP with GFP proteins in the OE of OMP-cre/ZEG double transgenic mice. Rosa26R-EYFP reporter mice Gt(ROSA)26Sortm(EYFP)Cos reporter mice (C57Bl/6J) express enhanced yellow fluorescent protein from the ROSA26 locus and were obtained from Jackson Laboratories. When Nestin-cre or OMP-cre males were crossed with either female Gt(ROSA)26Sortm(EYFP)Cos or ZEG mice, similar reporter expression patterns were produced. Nestin-GFP transgenic mice (C57Bl/6) were obtained from Grigori Enikolopov (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York) (Mignone et al 2004) and drive expression of enhanced green fluorescent protein (GFP) via the identical nestin promoter (5.8kb) and regulatory regions (1.8kb second intron enhancer) to those found in the Nestin-cre mice, used in our study and elsewhere (Zimmerman et al 1994; Yaworsky and Kappen 1999), without the intervening need for an excision event before detecting GFP expression. BLBP-cre/Gtrosa26tm1Sor mice were obtained from N. Heintz and T. Anthony (Howard Hughes Medical Institute, The Rockefeller University, New York) and express β-Galactosidase in cells expressing Cre recombinase and their subsequent progeny, following Cre-mediated excision, driven by the activation of the 1.6 kb 5’ flanking genomic sequence of the BLBP promoter (Feng and Heintz, 1995; Soriano, 1999; Anthony et al., 2004). This 1.6 kb 5’ BLBP promoter region recapitulates endogenous BLBP expression in transgenic BLBP-cre/Gtrosa26tm1Sor mice (Anthony et al., 2004). β-actin-GFP mice were obtained from Andres Nagy (University of Toronto) and contain the chicken β-actin promoter and first intron together with the CMV immediate early enhancer and rabbit β-globin polyadenylation sequence. Widespread and robust transgene expression has been seen in cells, embryos and adult mice using this promoter/enhancer combination. 54 2.13   Genotyping and phenotyping transgenic mice Genomic DNA from tail clips was extracted using the Qiagen DNeasy kit, following manufacturer’s instructions, and 100ng samples genotyped by PCR for Cre and/or GFP. PCR reaction mixture: 20mM Tris (pH8.4), 50 mM KCl, 1 mM MgCl, 200 uM dNTP (Roche), 0.5 uM each primer, 0.5-1 unit Taq polymerase (all Invitrogen). Cre pr imers:  NLS CreA 5’CCCGGCAAAACAGGTAGTTA3’;  NLS CreS 5’CATTTGGGCCAGCTAAACAT3’; 94°C 30 seconds, 55°C 30 seconds, 72°C 90 seconds; 454 bp product. GFP primers: XFPf 5’ AAGTTCATCTGCACCACCG3’; XFPr 5’TCCTTGAAGAAGATGGTGCG3’; 35 cycles of 94°C 30 seconds, 60°C 60 seconds, 72°C 60 seconds; 173 bp product; each for 35 cycles. Murine ear clips were used to phenotype by Lac Z histochemistry. Double transgenic mice were further confirmed by expression of EGFP on sections containing CNS and OE with or without antibody detection. In embryos, EGFP could be readily detected in the brains of whole embryos. 2.14   In vitro progenitor assays-Nestin Cre/ZEG mice E13.5 embryos were geno/phenotyped by PCR for Cre, and Lac Z histochemistry. All Nestin-cre/ZEG double transgenic embryos (but not littermate controls) expressed detectable endogenous GFP in the CNS. OE cells were pooled from either Nestin- cre/ZEG embryos or littermate controls, from each litter, where the average number of cells/embryo was 2.6 x 105. From a total of 4 litters assayed, 15/44 embryos were Nestin-cre/ZEG. Single cell suspensions were plated at 0.7 x 105 cells/ml into CNS neurosphere media (as above) onto collagen/laminin coated glass coverslips in 12-well plates. Cells were processed for immunocytochemistry and counting of semi-adherent colony subtypes after 10 days in vitro. Immunocytochemistry was performed as described above, with cells fixed in 4% PFA for 5 minutes and washed in PBS prior to blocking. Mouse monoclonal (Molecular Probes) and rabbit polyclonal antibodies (Chemicon; both 1:100) reliably detected GFP in vitro, using GFP-expressing olfactory ensheathing  cells from β–actin GFP mice as positive controls, littermate OE cells and secondary antibody only, as negative controls. 55 2.15   SDS-PAGE and Western blotting Protein was isolated from the E18, P7 OE, P7 brain and P5 OECs and homogenized in lysis buffer with protease inhibitors containing 50 mM Tris-HCl pH8, 150 mM NaCl, 1% Triton X-100, 1 ug/ml aprotenin, leupeptin and 100 ug/ml PMSF. Protein concentrations were determined using the BioRad Protein Assay Reagent, following the manufacturer’s suggestions. After immunoprecipitation (see below), proteins were diluted 1:1 in 2x SDS protein sample buffer, heated at 70°C for 20 minutes, centrifuged prior to running on a 7.5% SDS-polyacrylamide gel and transferring onto a nylon membrane (BioRad Trans-Blot). Membranes were blocked in Tris-buffered saline (TBS) with 5% skim milk powder for 1-2 hours prior to incubating with the primary antibody 12- 20 hours at 4°C in 2% milk/TBS. Blots were washed in 0.05% Tween-20 in TBS, 3 times for 10 minutes each before incubating with peroxidase-conjugated goat anti-mouse IgG or goat anti-rabbit IgG (1:5000; both BioRad) diluted in 2% milk/TBS for 1 hour at room temperature. Membranes were washed 3 times, 10 minutes each, in 0.05% Tween- 20/TBS before treatment with ECL chemiluminescence substrate (Amersham), according to the manufacturer’s suggestions, and exposure onto X-ray film (Kodak). 2.16   Immunoprecipitation Protein homogenates (100ug) were immunoprecipitated by resuspending in 250ul of immunoprecipitation (IP) buffer (150 mM NaCl, 10 mM Tris-HCl pH 7.9, 0.1% IGEPAL CA-630, 10% glycerol) with protease inhibitors (see SDS-PAGE). Samples were incubated with primary antibody for 1-4 hours at 4°C with gentle rocking. Protein G sepharose beads (30 ul; Pierce Biotechnology) were incubated with the samples at 4°C with gentle rocking for 2 hours at room temperature. Samples were spun at 3800 rcf for 1 minute and washed 3 times in IP buffer with protease inhibitors. After the final wash step, the beads were resuspended in 20 ul of 2X SDS sample buffer and either stored at - 20°C or 2.5 ul subjected to SDS-PAGE. 56 2.17   Reverse transcription polymerase chain reaction (RT-PCR) mRNA was extracted from tissues or cells directly using the QuickPrep Micro mRNA Purification  Kit (Amersham Biosciences), following the manufacturer’s suggestions. mRNA was heated to 65°C for 10 minutes before first strand cDNA was reverse transcribed at 39°C for 1 hour, using pd(N)6 primers and the First Strand cDNA Synthesis Kit (Amersham Biosciences), following the manufacturer’s suggestions. The reaction was stopped by heating to 90°C for 5 minutes. cDNA integrity was tested by RT-PCR for β-actin using primers ACT5 (F) 5’AGAGCAAGAGAGGTATCC3’; ACT3 (R) 5’TACTCCTGCTTGCTGATC3’ and a 58°C  annealing temperature (35 seconds) producing a 920 bp product after 32 cycles. 2.18   Statistics Values are means +/- SEM. Variance between groups was determined using ANOVA and statistical significance using the Tukey HSD post hoc test. Correlations were determined using Pearson’s coefficient. 57 Table 2.1 Antibodies and methods for their usage. ANTIBODY SUPPLIER DILUTION (1 IN X) DETECTION METHOD rabbit anti-BLBP N. Heintz (Howard Hughes Medical Institute, The Rockefeller University, New York); Chemicon 2000 standard mouse anti-rat βIII tubulin (neuron-specific tubulin- NST; TUJ1) Covance 500 standard rabbit anti-β-galactosidase Biogenesis 500 standard mouse anti-β- galactosidase Jackson 500 standard mouse anti-BrdU (Bromodeoxyuridine) Becton-Dickinson 1000 antigen retrieval; methanol fix in vitro Rat anti-BrdU Accu-Specs 200 antigen retrieval; methanol fix in vitro rabbit anti-Cre Novagen, CN Biosciences Inc 5000 antigen retrieval goat anti-human Doublecortin (Dcx; C-18) Santa Cruz Biotechnology Inc 200 standard FGFR1 (Flg; C15) Santa Cruz 100 standard FGFR2 (Bek; C17) Santa Cruz 100 trypsin in vivo rabbit anti-GFP Abcam 400 standard rabbit anti-GFP Chemicon 400 standard mouse anti-GFP Chemicon 100 standard rabbit anti-nGLAST J. Rothstein (Johns Hopkins University, Baltimore, MD). 100 standard hamster anti-mouse CD54 (ICAM-1) BD Biosciences 100 standard mouse anti-Mash1 J.Johnson (University of Texas), BD Biosciences, Pharmingen 100 antigen retrieval mouse anti-rat nestin (RAT 401) BD Biosciences, Pharmingen 100 antigen retrieval 58 ANTIBODY SUPPLIER DILUTION (1 IN X) DETECTION METHOD rabbit anti-mouse Nestin (Nestin clone 20) Covance 500 standard anti-mouse OCAM R & D Systems 500 standard goat polyclonal olfactory marker protein Frank L. Margolis (University of Maryland) 5000 standard mouse anti-PCNA (clone PC10) Sigma 5000 antigen retrieval mouse anti-rat RC2 Developmental Studies Hybridoma Bank (developed by Yamamoto, M) 100 antigen retrieval mouse anti-S100β (clone SH-B1 Sigma 400 standard mouse anti-rat Sus4 J. Schwob (Tufts University, Boston MA) 100 trypsin treatment 59 CHAPTER 3         IDENTIFICATION AND LINEAGE TRACING OF NESTIN- EXPRESSING RADIAL GLIAL-LIKE OLFACTORY PROGENITORS Figures 3.1-3.5, 3.6A-C, 3.7-3.10 and 3.12 are accepted for publication in Murdoch, B and Roskams, AJ (2008) A novel embryonic nestin-expressing radial glia- like progenitor gives rise to zonally restricted olfactory and vomeronasal neurons; Journal of Neuroscience in press. Figures 3.11 and 3.13 were published in Murdoch, B and Roskams, AJ (2007) Olfactory epithelium progenitors: insights from transgenic mice and in vitro biology; Journal of Molecular Histology 39(6): 581-99. 3.1   Introduction To better understand the mechanisms that underscore neurogenesis during development and regeneration of the nervous system, we need to establish the temporal and spatial origins of specific cell types, determine the lineage contribution of each progenitor subtype and how their progeny contribute to the patterning of different nervous system regions. In the adult nervous system, regeneration and neurogenesis is restricted to exclusive niches, one of which includes the olfactory epithelium (OE) (Graziadei and Graziadei, 1979b; Schwob, 2002).  In response to neuronal death in the OE, immature olfactory receptor neurons become mature olfactory receptor neurons, OE progenitor cells divide and differentiate to produce new olfactory receptor neurons, that reintegrate into the existing circuitry and sustain the sense of smell for the lifetime of the organism (Farbman, 1990; Roskams et al., 1996). Two adult-residing progenitors have been identified, globose and horizontal basal cells. A subpopulation of globose basal cells (GBCs) serve as transit amplifying neuronal precursors for olfactory receptor neurons that express the basic helix-loop-helix (bHLH) transcription factor Mash1, during both development and regeneration (Cau et al., 1997; Calof et al., 2002). Transplantation and retroviral lineage tracing experiments suggest that GBCs can also generate sustentacular cells (Huard et al., 1998; Chen et al., 2004), a unique supporting cell for the OE. In contrast, horizontal basal cells (HBCs) are more quiescent than GBCs, express EGFR and ICAM-1 (Farbman and Buchholz, 1996; 60 Goldstein and Schwob, 1996; Getchell et al., 2000), and can produce clonal colonies in vitro in response to EGF, whose progeny include more HBCs, GBCs, neurons and glia (Carter et al., 2004). HBCs thus possess some characteristics expected of a multipotent progenitor. Despite the progress made to identify adult OE progenitors and lineage trace their progeny, our spatial and temporal understanding of embryonic OE neuroglial progenitors has been stalled by the paucity of identifiable genes we can use to distinguish, and assay the potential of individual candidate progenitors, a common problem in stem cell bearing tissues (Weissman et al., 2001). In the developing CNS, however, radial glia have been identified as both embryonic neural progenitors (Miyata et al., 2001; Noctor et al., 2001; Malatesta et al., 2003; Anthony et al., 2004) and serving as structural scaffolding for migrating neuroblasts (Rakic, 1972; Sidman and Rakic, 1973) that are transient and generally undetected soon after birth (Hockfield and McKay, 1985; Rakic, 2003). Radial glia are a heterogeneous population of progenitor cells found throughout the CNS neuraxis and identified by the shared expression of a select group of antigens such as nestin, glutamate astrocyte transporter (GLAST) and brain lipid binding protein (BLBP) (Gotz et al., 2005). Temporal expression of radial glial antigens is not uniform throughout the CNS in vivo, and can be divided into multiple antigenically distinct subpopulations in vitro that change characteristically during development (Hartfuss et al., 2001; Noctor et al., 2001; Malatesta et al., 2003; Anthony et al., 2004). This heterogeneity in radial glial cells reflects their temporal and spatial development, rather than a restricted lineage potential (Anthony et al., 2004). Lineage tracing using Cre recombinase driven by radial glial gene promoters and enhancers (like nestin or BLBP) has revealed that radial glia function as progenitors for the majority of CNS neurons, and not just those in the cerebral cortex (Anthony et al., 2004; Imayoshi et al., 2006). Progeny of neonatal radial glia include neurons, oligodendrocytes and astrocytes and serve as precursors to adult SVZ stem cells as determined by using Cre-expressing adenoviruses to infect radial glia in transgenic mice with loxP flanked GFP or β- galactosidase reporters (Merkle et al., 2004). Hence CNS radial glia are a transient 61 progenitor population that can produce multipotent progeny, but which have not yet been detected outside of the CNS. Although genetic fate mapping with promoters restricted to distinct progenitor stages driving site-specific recombinases has already proven valuable in evaluating progenitor contributions in the adult OE (Leung et al., 2007), these approaches have yet to be applied in the embryonic olfactory system. Since both the OE and CNS subventricular zones undergo continual neurogenesis, and most (if not all) CNS neurons have a radial glial lineage (Anthony et al., 2004) and nestin expression can identify CNS neural stem cells (Hockfield and McKay, 1985; Lendahl et al., 1990), I hypothesized that the embryonic OE contained a nestin-expressing radial glial-like progenitor that could contribute to olfactory neurogenesis. Nestin has not been previously detected in embryonic olfactory progenitors, but has been detected in postnatal/adult olfactory ensheathing cells (Pixley, 1996; Au and Roskams, 2003), neurospheres derived after several weeks of culture from human OE (Zhang et al., 2004; Othman et al., 2005), a cytokeratin-expressing neurogenic basal cell line in vitro (Satoh and Yoshida, 2000) and in the endfeet of sustentacular cells in vivo (Doyle et al., 2001). In this chapter I test for OE-based radial glial-like progenitors, and combine in vitro assays with in vivo genetic lineage tracing to test the neurogenic potential of embryonic nestin transgene-activating OE progenitors. I reveal the existence of a distinct neural progenitor phenotype unique to the embryonic OE, and demonstrate a previously unappreciated spatial regulation of olfactory receptor neuron and vomeronasal receptor neuron genesis developmentally. 62 3.2   Results 3.2.1   During early development, the OE contains radial glia-like cells During OE embryonic development, dividing cells are distributed between the apical and basal OE, but gradually transition to a mostly basal region during postnatal to adult OE maturation (see Fig 4.1) (Smart, 1971). This organization is reminiscent of that found in the embryonic CNS ventricular/subventricular zone progenitors (Gotz et al., 2005), where the apical OE correlates to the embryonic ventricular zone. I thus tested if embryonic OE might contain progenitors that morphologically or antigenically resemble multipotent CNS radial glia focusing on a developmental stage enriched in embryonic progenitors in vivo (see Fig 4.1). Nestin, an intermediate filament protein characteristic of CNS neuroepithelial stem cells (Hockfield and McKay, 1985), was detected in E13.5 OE in cells with a radial glial-like morphology, similar to those found in the embryonic olfactory bulb, that were detected in every developing turbinate of the embryonic OE (Fig 3.1A). Because nestin has not been previously detected in olfactory progenitors, I confirmed that my nestin detection in the embryonic CNS matched the reported radial glial expression pattern (Fig 3.2) (Anthony et al., 2004). Nestin protein was detected throughout the developing brain with particularly intense expression found in the developing cortex in cells morphologically resembling radial glia, whose processes spanned from the subventricular zone to the pial surface (Fig 3.2B-D; H-J). Cells expressing nestin surrounding the subventricular zone also expressed the radial glial antigens nGLAST, RC2 and brain lipid binding protein (BLBP) (Fig 3.2K-M). Cells with radial glial morphology were also detected throughout the developing OE (Fig 3.2B-G). Similar patterns of nestin expression were detected in both the CNS and the OE using two independent nestin antibody clones (Fig 3.2). These antibodies were also able to immunoprecipitate a protein demonstrating a band of the appropriate size for nestin from postnatal brain, embryonic OE, and olfactory ensheathing cells on a Western blot (Fig 3.2A). These results suggest that both nestin antibodies are indeed detecting nestin in the embryonic CNS and OE. Because the detection of nestin appeared more intense 63 Figure 3.1 Progenitors in E13.5 OE expressing radial glia antigens declines by early postnatal development Nestin-expressing cells (green) are detected in the OB and OE at (A) E13.5. (B, C) Processes of nestin-expressing cells span the height of the OE and surround PCNA+ nuclei (red) from the basal (arrow), and apical OE (arrowheads). Cells undergoing cytokinesis in the apical OE (asterisk) are detected across the nasal cavity from each other throughout the OE (seen in inset-arrowheads). (D) Nestin (green) is co-expressed with Glast (red, arrow) in OE spanning processes, having similar morphology to (E) RC2+ cells (green, arrow) which are adjacent to cells expressing the immature neuronal antigen doublecortin (Dcx, red, arrowhead). (F) Brain lipid binding protein (BLBP, green, arrow) is restricted to immature proliferating (PCNA+, red) olfactory ensheathing cells (OECs) along the olfactory nerve (ON), and (G) surrounding Dcx+ (red, arrowhead) axon bundles in the underlying lamina propria (LP) where (H, I) individual migratory Dcx+ cells are detected in the ON (arrowhead), ensheathed by BLBP+ OECs (arrow). (J) Dcx+ (red; arrowhead) neurons do not co-express nestin (green; arrow) in the OE or LP. By P5 (K, L) process-bearing nestin-expressing PCNA+ cells (green, red, respectively) are infrequent in the OE (arrows), but nestin+ cells are predominantly OECs surrounding axon bundles (Ax) in the LP. (M, N) Nestin (green, arrow) is not co-expressed with Sus4 (red, asterisk) in sustentacular cells in the OE or Bowman’s gland cells in the LP. Dotted line-basal lamina. Boxes outline magnified area in adjacent picture. Scale bar in A equals 100 um; in B equals 25 um (B, D, G, H, M); in C equals 10 um (C,E,I,L,N); in F equals 50 um (F,J, K). 64 65 Figure 3.2 Co-localization of radial glial antigens with Nestin using two independent Nestin antibodies A) Western blot of proteins immunoprecipitated (IP) using a Nestin polyclonal antibody (pab; rabbit; Covance) and probed using a Nestin monoclonal antibody (mab; Rat401; BD Biosciences) indicating bands of the appropriate size range for Nestin (198-240kDa) from Postnatal day 7 (P7) brain (positive control), P7 and embryonic (E18) olfactory epithelium (OE) and P5 olfactory ensheathing cells (OECs). Immunoprecipitating with the Nestin monoclonal antibody and probing with polyclonal Nestin gave similar results (data not shown). Sagittal sections from a CD-1 E13.5 embryo showing expression of Nestin proteins identified by (B,E,H) Nestin pab (green) and (C,F,I) Nestin mab (Rat401; red) and their (D,G,J) co-localization (yellow) throughout cells of the (D,G) OE and CNS including the (D) olfactory bulb (OB) and (D,J) subventricular zone (SVZ). Immunoreactivity to (K-M) Nestin (green) together with other radial glial antigens, (K) nGLAST, (L) RC2 and (M) BLBP (all red) show typical expression patterns in radial glial cells of the E13.5 SVZ (Anthony et al., 2004; Gregg et al., 2003). Pial surface and SVZ are located at the top and bottom, respectively (H-M). Boxes indicate magnified areas in subsequent panels from the OE and SVZ. Scale bars equal: 100 um in B (B-D); 50 um in E  (E- J); 50 um in K (K-M). 66 67 with the polyclonal nestin antibody, it was preferentially used when possible for my immunodetection. At E13.5, nestin+ cells displayed processes spanning the OE from the basement membrane to the apical surface (Fig 3.1B,C) and most co-expressed proliferating cell nuclear antigen (PCNA), a protein associated with the replication fork during S-phase (Fig 3.1A-C) (Waseem and Lane, 1990). Intense nuclear accumulation of punctate PCNA, indicative of the peak of S-phase, was found in the vertically elongated nuclei of nestin+ progenitors situated at the base of the OE (Fig 3.1C). In contrast, nestin+ progenitors undergoing cytokinesis segregated PCNA into their cytoplasm, and were found in clusters at the apical OE surface, frequently located directly across opposing neurogenic epithelial surfaces (Fig 3.1B). Since radial glia cannot be identified by the expression of a single antigen, I tested for the expression of other antigens commonly associated with CNS radial glia. Some nestin+ progenitors also co-expressed the glutamate transporter, GLAST (Fig 3.1D) (Furuta et al., 1997).  RC2, an intermediate filament-associated protein, (Misson et al., 1988) is expressed in a similar pattern, and in cells having a similar morphology to, nestin+ cells and is devoid of the immature neuronal antigen doublecortin (Dcx) in the OE (Fig 3.1E). Unlike CNS radial glia, brain lipid binding protein (BLBP), a member of the fatty acid-binding protein (FABP) family, associated with early neurogenesis and neuronal differentiation in the brain (Feng et al., 1994; Feng and Heintz, 1995; Hartfuss et al., 2001), was not detected in the OE proper at any developmental stage. Instead, BLBP was expressed in cells surrounding the olfactory nerve, many of which are proliferating (Fig 3.1F), and ensheathments of doublecortin-positive axons in the lamina propria (Fig 3.1G). Doublecortin, which labels neuroblasts and immature neurons in the CNS, was detected in immature olfactory receptor neurons in the OE, distinct from nestin+ cells, and neuronal axons in the lamina propria (Fig 3.1E,G,J). However, doublecortin+ neuroblast-like cells were detected in the olfactory nerve, ensheathed by BLBP+ cells (Fig 3.1H, I). CNS radial glia are thought to be a transient population of cells that declines postnatally (Hockfield and McKay, 1985; Rakic, 2003). I tested the postnatal day 5 (P5) OE for the detection of nestin expressing radial glia-like cells to see if their frequency or 68 antigen expression profile had changed. At postnatal day 5, the OE contained only rare, isolated OE-spanning nestin+ progenitors that co-expressed PCNA (Fig 3.1K, L). These nestin-expressing cells were undetectable in the adult, and at no time examined co- expressed Sus4, a marker for sustentacular cells and Bowman’s glands and ducts that is undetectable in the E13.5 OE (Fig 3.1M, N; Fig 4.1). At all stages of development tested (including P5), a subpopulation of olfactory ensheathing cells, identified by their location, morphology and expression of S100β and GFAP antigens (Fig 3.3E-G), surrounding doublecortin+ axon bundles in the lamina propria expressed nestin (Fig 3.1K, Fig 3.3A- D). Thus, the embryonic OE contains cells with a radial glial morphology and expressing antigens associated with radial glia, that share some similarities with CNS radial glia. Distinct from CNS radial glia, cells expressing BLBP appear to be segregated to the olfactory glial lineage in the lamina propria. 3.2.2  E13.5 OE forms semi-adherent colonies containing mitotic Nestin+ lineage- negative cells in vitro Since the E13.5 OE contains a high proportion of proliferating, nestin-expressing radial glial-like progenitors in vivo compared with later developmental time windows (data not shown), I used in vitro assays of progenitor activity to test if E13.5 OE would yield multipotent neurosphere- or colony-forming nestin-expressing cells similar to the subventricular zone (SVZ) (Reynolds et al., 1996; Mignone et al., 2004). OE-derived cells were plated at clonal density, 133 cells per ul, and expanded for 10 days prior to counting and assay of cellular composition by immunocytochemistry. As early as 2.5 hours in vitro, the majority of the first antigenically distinguishable adherent cells expressed nestin and PCNA and expanded over 48 hours producing mostly mitotic nestin+ cells in developing colony cores (Fig 3.4A,B; Table 3.1). In contrast to the non- adherent neurospheres commonly obtained from embryonic to adult SVZ, E13.5 OE formed semi-adherent colonies that were classified into three distinct subtypes according to their morphologies; fusiform, polygonal and spherical (Fig 3.4C-E). After 10 days, each colony subtype had a colony core of 20 to greater than 200 microns in diameter, 69 Figure 3.3 Nestin expression in cells ensheathing olfactory receptor neuron axons At postnatal day 5 (P5), (A-D) most Nestin+ cells (green) are detected throughout the lamina propria (LP), and not the olfactory epithelium (OE), in (E-G) S100β+ and/or GFAP+ olfactory ensheathing cells. A subset of Nestin+ cells surround doublecortin+ (Dcx, red) axon bundles (Ax; A-C). Dotted line-basal lamina. Box indicates magnified area in (B-D). Scale bar in A is 50 um, in B is 25 um (B-G). 70 Figure 3.4 E13.5 OE forms novel semi-adherent colonies in vitro containing a subpopulation of dividing Nestin+ progenitors A,B) E13.5 OE cultured for 2.5 hours using CNS SVZ neurosphere media with FGF demonstrated mostly (A, inset) single nestin+ cells (green) with PCNA+ nuclei (red), which divide to form larger cell clusters, not detected at 2.5 hours, that retain nestin+ PCNA+ cells after (A) 24 hours and (B) 48 hours of culture. After 10 days, E13.5 OE produced semi-adherent colonies with morphologies that are (C) fusiform, (D) polygonal, or (E) spherical. F-J) Cores of all colony subtypes contain nestin+ PCNA+ cells in varying proportions. K) EGF+FGF produces significantly more E13.5 OE colonies than either growth factor alone (*p<0.001; Tukey post-hoc). Boxes show regions for higher magnification in next panel. Blue nuclear stain is DAPI. Scale bar in A is 100 um (A,B); J  is 80 um, all others 50 um. Same magnifications in C,F,H,  and G,I. EGF- epidermal growth factor; FGF fibroblast growth factor; E+F EGF+FGF; eOE embryonic olfactory epithelium. 71 Table 3.1 Percentage of antigen expressing cells detected in E13.5 OE cells plated in vitro for 2.5 to 48 hours. E13.5 OE cells were plated (133 cells/ul) using serum-free culture with FGF2 on collagen and laminin substrates. After 2.5 to 48 hours, the cultures were fixed and stained for nestin, PCNA and/or Mash1. Cells were counted at 400x magnification, from 10-15 fields of view per coverslip, 3 coverslips per time point. For nestin and PCNA, 156 to 368 total cells were counted per time point; 0-95 cells per timepoint for Mash1. ND-not done. Data represented as averages +/- SEM. Percentage of antigen-expressing cells 2.5 hours 24 hours 48 hours 10 days Nestin 93.5 ± 1.6 72.0 ± 5 65.4 ± 1.5 30 ± 1 PCNA 81 ± 1.4 56.6 ± 5 55.1 ± 2.2 ND Mash1 undetected 2.1 ± 1.6 4.4 ± 1.5 12 ± 2.7 72 containing cells of distinct sizes and morphologies, sitting on top of a lawn of surrounding adherent cells of multiple phenotypes. Fusiform colony cores contained loosely packed, tear-drop shaped clusters of large cells (Fig 3.4C,F,G), whereas polygonal colony cores contained a higher density of compacted smaller cells, often corralled on their periphery by tightly juxtaposed, elongated bipolar cells (Fig 3.4D,H,I). Spherical colonies contain cells in a raised sphere at the core of each colony, with small blast-like cells that can emerge on the surface of the surrounding flattened, adherent cell lawn (Fig 3.4E,J). By 10 days in vitro, greater than 90% of all colonies contained bipolar, nestin- expressing cells either within, or immediately adjacent to, their colony cores (Fig 3.4F-J). Fusiform colony cores contained a significantly higher percentage of nestin-expressing cells (85+/-0.7%, p<10-8, Table 3.2) compared to spherical (43+/-2.6%) or polygonal (31+/-3.6%) cores. In polygonal colonies nestin-expressing cells were largely found circling the core (Fig 3.4H, I). Similarly, the percentage of PCNA+ cells was significantly greater in fusiform colony cores (81 ± 0.8%; p<10-8) compared to either spherical (41 ± 2.8%) or polygonal (27 ± 3.2%; Table 3.2). Nestin-expressing cells almost always co- expressed PCNA at 10 days in vitro (Table 3.2; R2=0.99-0.87), with mitotic PCNA+ nestin+ cells most abundant in fusiform, and least abundant in polygonal, colonies (Fig 3.4F-J; Table 3.2). Embryonic OE cells plated with EGF and FGF2 together increased colony production by 1.8-fold, compared to either EGF or FGF2 alone (Fig 3.4K; p<0.001). FGF2 specifically enhanced the production of spherical colonies (52% of all colonies in FGF2 alone), with the remainder of colonies equally contributed by fusiform and polygonal colonies (Table 3.3). Overall colony yield was less in EGF alone, which significantly increased the production of spherical (44% of total), and polygonal colonies (40%), at the expense of fusiform colonies (only 16% of the total, Table 3.3, p<0.001). Thus, different growth factor combinations alter colony outputs. These results suggest that the E13.5 OE contains cells that initiate the formation of semi-adherent colonies with distinct morphologies and that contain nestin+ cells at differing frequencies. 73 Table 3.2 The percentage of E13.5 OE colony core cells expressing nestin or PCNA for individual colony subtypes. E13.5 OE cells  (133 cells/ul) were cultured in EGF with FGF2 for 10 days before testing each colony subtype for antigen-expressing cells using immunocytochemistry. Total cell numbers were determined with DAPI nuclear staining. Data shows averages +/- SEM from 2 independent experiments; counts based on 6-13 colonies from each subtype.*p<10-8 **p<10-9. E13.5 OE Colony Subtypes Fusiform Spherical Polygonal Antigen (% positive cells in colony cores) Nestin 85 ± 0.7%* 43 ± 2.6%** 31 ± 3.6% PCNA 81 ± 0.8%* 41 ± 2.8%** 27 ± 3.2% Pearson’s coefficient (R2) for nestin and PCNA 0.99 0.93 0.87 74 Table 3.3 Distribution of OE E13.5 colony subtypes with FGF2 or EGF. E13.5 colony subtypes were assessed after 10 days in vitro in serum-free cultures with FGF2 or EGF. In EGF, spherical and polygonal colonies are significantly greater than fusiform (p<0.001). Percentage of colony subtypes (+/- SEM) growth factor spherical fusiform polygonal FGF2 n=5 52 +/- 6 25 +/- 5 23 +/- 2 EGF n=6 44 +/- 4 * 16 +/- 2 40 +/- 4 * 75 3.2.3  Cells derived from E13.5 OE colonies express neuronal, glial and radial glial antigens To determine the cellular potential of embryonic OE colony-derived cells, I tested for the expression of combinations of developmentally regulated neuronal and glial antigens found in vivo, in the different colony subtypes. BLBP, a fatty acid binding protein associated with CNS radial glia (Feng et al., 1994), was primarily found in cells in the centre of fusiform colony cores, and at the edges of polygonal and spherical colony cores (Fig 3.5A-C). The majority of BLBP-expressing cells at 10 days in vitro did not co- express S100β, but S100β was expressed by cells immediately adjacent to BLBP- expressing cells in polygonal and spherical colonies, and at the edges of fusiform colonies (Fig 3.5A-C). Blast-like cells, seen adjacent to a subpopulation of spherical colonies, contained localized areas within each cell of BLBP and S100β proteins (Fig 3.5D). Fusiform colonies primarily contained cells expressing nestin, with rare peripheral cells expressing the glial and neuronal lineage markers S100β and βIII neuron-specific tubulin (NST) (Fig 3.5E, H). In all colony subtypes, a significant percentage of S100β+ cells, lacking nestin expression, appeared to be produced at the periphery (Fig 3.5E-G). In comparison, cells radiating out from some spherical colony cores consisted of nestin+ lineage-negative cells whose radial morphology and antigen expression were distinct from the underlying S100β+ cells that resemble olfactory ensheathing cells (Fig 3.5G). Typically, β III neuron-specific tubulin+ (NST+) neuronal cell bodies clustered at the edges or on top of colony cores, with processes that surrounded and penetrated the colony (Fig 3.5H-J). NST was first detected, however, in nestin+ precursors, within which it appeared to be distributed equally or unequally to daughter cells (Fig 3.5K). The three colony subtypes showed no significant difference in the proportion of BLBP+ or S100β+ cells they contained, but fusiform colonies contain 2-3 times more nestin-expressing cells and the highest percentage of NST+ cells, compared with spherical or polygonal cores (Fig 3.5L). These data indicate that each colony subtype contains a complement of cell types that express antigens associated with CNS radial 76 Figure 3.5 Cells in E13.5 OE colony cores and their progeny express neuronal, glial and radial glial antigens A-C) Fusiform, polygonal and spherical colony cores contain cells expressing BLBP (green) and/or S100β (red). D) BLBP and S100β are asymmetrically expressed in dividing (arrowheads) and non-dividing (arrow) spherical colony progeny cells. E-J) Nestin (green) is expressed in the cores of each colony subtype, (E-G) S100β (red) expressing cells are outside colony cores and clustered at their edges (E,F, insets). G) Nestin+ cells with radial glia-like morphology (arrowhead) radiate out from a spherical colony, and are distinct from either nestin+ S100β+ (asterisk) or nestin- S100β+ (arrow) cells with glial morphology. Dividing cells segregate nestin and S100β to individual daughter cells (inset G). H-J) NST+ (red) nestin negative neurons (arrowheads) are atop nestin+ cells found in all colony subtype cores. K) A dividing colony progeny cell co-expresses nestin and perinuclear NST (arrowhead), which can be distributed to individual daughter cells after division (arrow). L) The percentage of nestin, BLBP, S100β, or NST positive cells in cores of individual colony subtypes cultured in EGF+FGF for 10 days. There are significantly more nestin+ cells in fusiform colony cores compared to spherical or polygonal cores, and significantly more in spherical cores than polygonal cores (**p<0.001, *p<0.01). Blue nuclear stain is DAPI. Dotted line-edge of colony core. Scale bars in A, B are 50 um (A,E; B,I; respectively); C is 25 um (C,D,G,H,J,K); F is 100 um. 77 78 glia, and can produce neurons and glia, to varying degrees, dependent upon the colony subtype. 3.2.4  Lineage tracing of nestin-expressing olfactory progenitors: a subpopulation of nestin-expressing progenitors are neuronal precursors To test if nestin+ progenitors demonstrate neurogenic potential in vivo, I crossed Nestin-cre transgenic mice, where Cre recombinase is under the control of the 5.8 Kb rat nestin promoter regulatory elements and a 1.8 Kb second intron enhancer (Fig 3.6A), whose expression is specific to the CNS (Zimmerman et al., 1994b), with a ZEG (LacZ/enhanced GFP) reporter line (Novak et al., 2000).  ZEG mice express β galactosidase until Cre excision removes β galactosidase and a STOP transcription signal (Fig 3.6E), allowing for GFP expression in Cre-expressing cells and their progeny. To test whether olfactory receptor neurons faithfully drive, and not silence, the ZEG transgene in a temporal or zonal manner, our lab generated olfactory marker protein (OMP)-cre transgenic mice, where Cre expression is driven by regulatory sequences controlling mature olfactory receptor neuron-specific expression of the OMP gene (Fig 3.6B) (Danciger et al., 1989). When OMP-cre mice were crossed with ZEG reporters, Cre expression was only detected in the mature olfactory receptor neuron layers of the OE at both postnatal day 14 (P14; data not shown) and adult OE  (Fig 3.7A-C), although the level of expression was highly variable (Fig 3.7B), where Cre was only detected in a subpopulation of OMP+ olfactory receptor neurons at any given time (Fig 3.7C). However, excision by Cre had clearly occurred, resulting in GFP expression coincident with OMP expression in mature olfactory receptor neurons and throughout their axon bundles (Fig 3.7D, E). In contrast, in Nestin-cre/ZEG mouse crosses at P14 and adult, only a subpopulation of mature OMP+ olfactory receptor neurons expressed GFP in a spatially- restricted pattern. GFP was markedly absent from many OE zones (Fig 3.7F), despite widespread expression in the CNS (Fig 3.7J). Serial reconstruction of the adult Nestin- cre/ZEG OE revealed GFP+ olfactory receptor neurons are largely restricted to the OE zone commonly referred to as zone 1, the most dorsal-medial zone (Ressler et al., 1994) 79 Figure 3.6 Constructs of transgenic mice used in this study A)The 5.8kb Rat nestin promoter and 1.8kb second intron enhancer (Zimmerman et al 1994; Yaworsky and Kappen, 1999) were used to drive Nestin-cre-mediated excision (Tronche et al 1999), in 2 independently derived lines, and subsequent reporter expression in Nestin-cre- (E) ZEG (Novak et al., 2000), (F) Rosa26R (Soriano, 1999)  or (G) Rosa YFP transgenic mice (Srinivas et al., 2001), and analyzed in the olfactory epithelium. B) The 11kb OMP-Cre transgene contains the regulatory sequences controlling the olfactory neuron-specific expression of the OMP gene (Danciger et al. 1989) and directs Cre expression/excision to mature OMP expressing olfactory neurons (Murdoch, Janzen and Roskams in preparation). C) The 8.7kb Nestin-GFP construct, previously shown to direct GFP expression to CNS neural progenitors (Mignone et al 2004), contains the same promoter and regulatory regions used to drive Nestin- cre-mediated excision, together with cDNA of the enhanced green fluorescent protein (GFP) and simian virus 40 polyadenylation (pA) sequences. D) The 1.6kb BLBP promoter (Feng et al., 1995; Anthony et al., 2004) was used to drive BLBP-cre-mediated excision (Anthony et al., 2004) and subsequent reporter expression in Rosa26R (F) transgenic mice and analyzed in the adult olfactory epithelium. Note (D-G) not necessarily drawn to scale. 80 Figure 3.7 Nestin-cre/ZEG lineage tracing reveals zonally restricted production of olfactory and vomeronasal neurons A-E) In adult OMP-cre/ZEG mice, (A-C) Cre transgene expression (red) is detected in the neuronal layer throughout the OE. Cre is expressed at variable levels (B) in a subpopulation of (C) OMP+ (green) olfactory receptor neurons (ORN). Throughout the OE, (D,E) GFP reporter expression overlaps with OMP+ ORNs. F-L) Nestin-cre/ZEG mice express (F) GFP (green) in a subpopulation of ORNs in restricted zones. Most GFP+ ORNs co-express (F,G) OMP (red), and a smaller subpopulation co-express (H,I) NST (red). J) At P14, endogenous GFP is detected in the olfactory bulb (OB), olfactory epithelium (OE) and (K) OMP (red) and (L) NST (red) in neuronal subpopulations in the vomeronasal organ (VNO). Dotted line-basal lamina. Sus- sustentacular cells; OMP-olfactory marker protein; Sep-septum; Ax-axon bundles; BC-basal cells; NST-neuron-specific β III tubulin. Asterisks indicate dorsal recess. Scale bars in A,F are 100 um (A,D and F,H, respectively); B is 50 um (B,C,K,L); E is 50 um (E,G,I); J is 50 um. 81 82 (see zones in Fig 3.8B and data not shown). Some GFP+/OMP- cells were also detected in the adult basal progenitor and immature olfactory receptor neuron layers of zone 1 (Fig 3.7G). GFP was occasionally detected in a subpopulation of immature olfactory receptor neurons, which co-expressed NST (Fig 3.7H, I). GFP expression was not detected in sustentacular cells or horizontal basal cells of the OE, or olfactory ensheathing cells or Bowman’s glands of the lamina propria of Nestin-cre/ZEG mice (Fig 3.7F-I, and data not shown). GFP expression was also more readily detected in a distinct subset of OMP+ and NST+ neurons of the vomeronasal organ (VNO), restricted to zones consistent with the nGi/V1R vomeronasal sub-region (Fig 3.7K, L). This OE and vomeronasal GFP expression pattern was consistent when C57Bl/6 Nestin-cre mice were crossed with ZEG reporters from either C57Bl/6 or CD-1 strains. To confirm the regional restriction of GFP expressing cells in the Nestin-cre/ZEG mice, I tested for co-expression with OCAM, a cell adhesion protein found throughout the OE, but excluded from zone 1 (Yoshihara et al., 1997). GFP+ olfactory receptor neurons in the dorsal-medial OE were devoid of OCAM expression (Fig 3.8A,B), a pattern that was consistent in crosses of this Nestin-cre line with an alternative reporter line, Gt(ROSA)26Sortm(EYFP)cos (Fig 3.6G) (Srinivas et al., 2001), that expresses yellow fluorescent protein (YFP) from the Rosa26 locus (Fig 3.8C,D). These data also clearly demonstrate a zonal segregation of axons within axon bundles of the OE, where some axon bundles appear to derive exclusively from zone 1 (Fig 3.8C,C’), whereas others at the interface are mixed, with mesaxon groups of OCAM+/GFP- axons distinct from each other. I also crossed an independently-derived Nestin-cre line in a FVB/N strain background that employed identical nestin regulatory elements (Berube et al., 2005) with a Rosa26 line expressing β-galactosidase after excision (Fig 3.6F), and obtained reporter expression in a subpopulation of olfactory receptor neurons within zone 1 (Fig 3.8E,F). Together these results demonstrate that cells that can activate Nestin transgene expression show a consistent and restricted pattern of olfactory receptor neuron-specific expression in only the dorsal-medial OE, that is not due to differences in transgene integration site, copy number, mouse line or strain. To ensure that the ZEG transgene was not silenced in some immature olfactory receptor neurons, or in specific OE zones, I performed β-galactosidase histochemical 83 Figure 3.8 Nestin regulatory elements direct reporter expression to a subpopulation of cells in the OCAM negative dorsal-medial zone  A) Nestin-cre/ZEG and (C,D) Nestin-cre/Rosa YFP mice express GFP/YFP (green) in the dorsal-medial OE, zone 1 (zones 1-4 indicated in (B), devoid of (A,C,D) OCAM expression (red). C’ inset) Olfactory receptor neuron (ORN) axons segregate to form axon bundles (Ax) that are mostly OCAM+ (arrows), YFP+ (arrowheads), or OCAM+ YFP+. (E,F) Identical patterns of reporter expression (β-galactosidase, blue), in a subpopulation of zone 1 neurons, are seen in an independently derived *Nestin-cre line when crossed with a Rosa26R reporter mouse. Sep- septum; OE-olfactory epithelium; asterisks indicate dorsal recess. Dotted lines indicate (A) zone 1 (GFP+ OCAM-), (B) zones 1-4; (D,F) basal lamina. Scale bar in A is 200 um; C,E is 50 um; D is 50 um (D,F). 84 staining of Nestin-cre/ZEG mice for the detection of Lac Z expression, indicative of cells not having as of yet undergone a Cre-mediated excision event. In Nestin-cre/ZEG mice I detected Lac Z in cells of all olfactory receptor neuron developmental stages, in basal cells, sustentacular cells and Bowman’s glands cells, in all regions of the OE (Fig 3.9A). Because Cre excision and GFP expression occurred in only a subpopulation of Nestin-cre/ZEG cells, it was difficult to detect a void in the Lac Z expression in zone 1 in Nestin-cre/ZEG mice. However, in OMP-cre/ZEG mice, in GFP-expressing mature olfactory receptor neurons, little Lac Z staining was detected where β-galactosidase excision had occurred. Sustentacular, basal and Bowman’s gland cells remained Lac Z+ because β-galactosidase excision had not occurred (Fig 3.9B). These results confirm that the regionally restricted pattern of GFP reporter expression in Nestin-cre/ZEG mice did not result from ZEG transgene silencing. 3.2.5   GFP+ Nestin-cre/ZEG progenitors enriched in neurogenic colony subtypes To test if embryonic progenitors in vitro demonstrate a similar restricted neurogenic potential to that observed in vivo, I plated OE cells from E13.5 Nestin- cre/ZEG mice in FGF2. After 10 days in vitro, 56% of all colonies derived from Nestin- cre/ZEG mice contained mostly GFP+ cells after immunodetection with anti-GFP antibodies (Fig 3.10A, B, E, F, L). Occasional cells within the GFP+ colonies appeared to be GFP-negative. If these GFP-negative cells were due to contamination from a GFP- negative cell, and not due to low GFP expression in a GFP+ cell, I should also find occasional GFP+ cells contaminating GFP-negative colony cores, but I never did. Likewise, because mixtures of the different colony subtypes in a single colony are not detected, and I tested for clonal density of my cultures (see chapter 4), the colonies appear to be derived from single cells. Hence those colonies comprised of mostly GFP+ cells were probably initiated by a single GFP expressing cell, but a few cells fall below my detection limits for GFP. In the same cultures, 44% of all colonies were comprised of GFP-negative cells, since only a subpopulation of progenitor progeny express GFP in vivo (Fig 3.7; Fig 3.10I-L). All colony subtypes were represented in both GFP+ and GFP- 85 Figure 3.9 Nestin- and OMP- cre/ZEG β galactosidase histochemistry in the olfactory epithelium A,B) In ZEG reporter mice, β galactosidase histochemistry is detected in the absence of Cre-mediated excision events and found in some cells in the lamina propria (LP), but mostly in the neuronal layers of (A) Nestin-cre/ZEG mice, while largely absent in (B) OMP-cre/ZEG mice because of prior excision events in OMP+ mature olfactory neurons. Sus-sustentacular; ORN- olfactory receptor neuron; BC-basal cells; BG-Bowman’s glands. Dotted line-basal lamina. Size bar in B is 100 um (A,B). 86 Figure 3.10 E13.5 colonies from Nestin-cre/ZEG OE produce predominantly neuronal, GFP- expressing progeny After 10 days in FGF2, dissociated E13.5 OE cells from Nestin-cre/ZEG (NCZ) mice produced primarily fusiform colonies with cells co-expressing (A, D) Nestin (red) and (A, B) GFP (green; detected with monoclonal anti-GFP). E, F) Most cells in fusiform GFP+ colony cores express GFP (green; detected with a polyclonal anti-GFP) and some co-express (E, G) β III neuron-specific tubulin (NST, red; arrowhead), with cells negative for either antigen indicated by (E, H) DAPI-stained (blue) nuclei. GFP-negative colony cores from NCZ OE (I-K) do not express GFP (I,J), but do express Nestin (I,K). L) Only NCZ colony cores, and not littermate negative controls, contained GFP+ cells. The distribution of colony subtypes varied between GFP+ and GFP negative colony cores in NCZ cultures. Scale bar in C is 50 um in all. 87 negative colonies, but their distributions varied (Fig 3.10L). Neither GFP+ cells nor GFP+ colonies were detected in littermate control cultures (Fig 3.10L). The most neurogenic colony subtype, fusiform, was predominant in GFP+, but not GFP-negative colonies (Fig 3.10L). GFP+/nestin+ and GFP+/NST+ cells were highly represented in GFP+ colonies (Fig 3.10A-H, L). In contrast, only 29% of GFP-negative colonies were fusiform and contained nestin+/GFP- bipolar cells (Fig 3.10I-L), while spherical colonies predominated (48% of total GFP-negative colonies (Fig 3.10L). The distribution of GFP-negative colony subtypes derived from Nestin-cre/ZEG OE was similar to that seen with non-transgenic CD-1 OE, at the same developmental stage and culture conditions (compare Table 3.3 with Fig 3.10L). Collectively these in vitro/vivo results suggest that as early as E13.5, a subset of committed neurogenic progenitors is destined to generate subsets of both nestin+ GFP+ olfactory receptor neurons, and nestin-negative GFP-negative progenitors destined to seed alternate OE regions, ie. the subpopulation of nestin-expressing neurogenic radial glia-like progenitors that drive the nestin promoter/enhancer elements of the Nestin-cre transgene, give rise to regionally- restricted olfactory and vomeronasal receptor neurons. 3.2.6   Temporal detection of nestin-expressing olfactory progenitors in vivo To better determine the temporal origin of nestin-expressing progenitors during the earliest stages of OE development, I performed immunohistochemistry on the E10.5 presumptive OE. Nestin expression was detected throughout both the developing brain and the presumptive OE (Fig 3.11A). Nestin+ cells in the presumptive OE had a radial glial morphology and were distinct from immature olfactory receptor neurons expressing the neuronal antigens NST and doublecortin (Fig 3.11B-E). These results indicate that nestin-expressing radial glial-like progenitors are detected at the earliest stages of olfactory development in the presumptive OE. 3.2.7   Early embryonic detection of nestin transgene-activating olfactory progenitors To determine when nestin transgene-activating progenitors could first be detected in vivo, I tested for GFP expression in E13.5 Nestin-cre/ZEG embryos, the same 88 Figure 3.11 Detection of radial glial-like progenitors in the early embryonic OE At E10.5, presumptive olfactory epithelium (pOE) contains cells expressing (A-C) nestin (green) exclusive of (A, B) neuron-specific β III tubulin (NST) or (C) Dcx (both red) in immature ORNs. Dcx (red) and NST (green) co-localize in (D) E10.5 pOE but in (E) more highly developed regions of OE E17.5, Dcx is not found in the most basal neuronal layers, where NST is induced prior to Dcx (arrowhead). OB, olfactory bulb; VZ, ventricular zone; LV, lateral ventricle; NC, nasal cavity; OE, olfactory epithelium; LP-lamina propria. Dotted line indicates basal lamina. Scale bar in A is 200 um; in B is 50 um (B-E). 89 developmental stage used for in vitro OE progenitor assays. Despite the obvious contribution of E13.5 OE progenitors to the production of GFP+ neurons in vitro (Fig 3.10), the OE of E13.5 Nestin-cre/ZEG embryos was negative for GFP (Fig 3.12A,B). GFP+ cells were first detectable at E15.5 in regions largely devoid of OCAM expression (Fig 3.12C), in a subpopulation of immature neurons and rare nestin+ progenitors (Fig 3.12D,E). To test if transgene-expressing precursors were present, but undetectable due to a lag between the time taken to activate Cre and drive excision to produce GFP to detectable levels, I used the identical Nestin regulatory elements to directly drive GFP expression, and tested for co-expression and distribution of nestin+/GFP+ cells (Fig 3.6C) (Mignone et al., 2004). In Nestin-GFP mice, GFP was detected throughout the E13.5 CNS (Fig 3.12F, and data not shown), as previously shown (Mignone et al., 2004), but was restricted to the dorsal-medial OE, where it was found in a subpopulation of nestin-expressing cells, even though endogenous nestin protein was evident throughout the rest of the embryonic OE (Fig 3.12F-I). Because GFP is broken down inefficiently, its retention allows one to test if GFP+ cells that are the progeny of transgene-expressing precursors, also express markers characteristic of different olfactory receptor neuron developmental stages. In the Nestin-GFP OE, GFP was also found in dividing apical cells (Fig 3.12J-L), a subpopulation of Mash1+ neuronal progenitors (Fig 3.12M,N), and olfactory receptor neurons in the dorsal-medial region. These data indicate that only a subpopulation of endogenous nestin-expressing cells activate the regulatory elements of this particular Nestin transgene in the OE, and generate at least some GFP+ olfactory receptor neurons via Mash1-expressing intermediate precursors. 3.2.8  Lineage tracing of BLBP-expressing olfactory progenitors: Evidence for glial- restricted precursors Unlike other CNS radial glial antigens examined, BLBP was detected in cells found in the lamina propria (Fig 3.1F-I), prompting me to determine if BLBP expressing cells were restricted to a glial and not neuronal lineage. Nestin is not detected in the doublecortin+ axons of the E13.5 olfactory nerve, but BLBP is found in presumptive 90 Figure 3.12 Regional restriction of GFP+ reporter cells in both embryonic Nestin-cre/ZEG and Nestin-GFP transgenic mice A) In E13.5 Nestin-cre/ZEG mice, endogenous GFP (green) is readily detected in the CNS olfactory bulb (OB), but not the olfactory epithelium (OE), where (A,B) NST (red) is highly expressed in olfactory receptor neurons. C) First detected at E15.5 in the dorsal-medial OE, and separate from emerging regions of OCAM expression (indicated by arrowheads), are the progeny of Nestin transgene-activation, GFP+ cells. D) GFP+ cells either co-express NST (asterisk), or are NST negative, both above (arrow) and below (arrowhead) the NST+ ORNs. E) Rare GFP+ cells, close to the basal lamina, co-express nestin (red; arrowhead; inset-nestin alone). F) E13.5 Nestin-GFP embryos highly express Nestin transgene-activated GFP that is restricted to a subpopulation of cells in the dorsal-medial OE, despite endogenous Nestin expression throughout the OE. GFP can be detected in (G-I) a subpopulation of Nestin+ cells and cell processes spanning the OE (thick and thin arrowheads, respectively), (J-L) surrounding cells undergoing cytokinesis at the apical OE (arrowheads), and in (M,N) neuronal precursors expressing Mash1 (arrowheads). Ax-axon bundles; asterisks indicate dorsal recess. Boxes show regions for higher magnification in next panel. Dotted lines indicate basal lamina. Scale bars are 50 um in A, C, F (F,N), M; 25 um in B, D (D,E), G (G-L). 91 92 olfactory ensheathing cells aligning these immature olfactory neuron axons (Fig 3.13A- C), a pattern confirmed by transgenic BLBP-GFP reporter mice (Gong et al., 2003). In vitro, cells with an olfactory ensheathing cell morphology have been detected that express BLBP with or without nestin (Fig 3.13D). Mitotic blast-like cells derived from semi-adherent spherical colonies expressing BLBP, which unevenly distribute the glia antigen S100β, have also been detected (Fig 3.13E). These in vivo/vitro results suggest that BLBP expression may identify a precursor whose progeny would include olfactory ensheathing cells. To test if BLBP+ precursors could contribute to the olfactory ensheathing cell lineage, I analyzed the olfactory tissue of adult transgenic BLBP-cre/ROSA mice. In these crosses, β galactosidase is induced after Cre-mediated excision of a STOP transcription signal, regulated by the induction of the BLBP promoter (Fig 3.6D,F; 3.13F- I) (Anthony et al., 2004). Co-labeling of Lac Z reporter expression with BLBP suggests that the regulatory elements in the BLBP transgene reproduce endogenous BLBP expression (Fig 3.13F-H), as they do in the CNS (Anthony et al., 2004). That BLBP+ cells contribute to the olfactory ensheathing cell lineage, is suggested by the co- expression of β galactosidase with BLBP in cells immediately surrounding mesaxons (smaller groups of axons within a large axon bundle), in the lamina propria of transgenic BLBP-cre/ROSA mice (Fig 3.13F,G). Co-expression of BLBP and reporter predominates in the olfactory bulb nerve fibre layer, where Cre expression can also be detected (Fig 3.13H, I). These results suggest that BLBP reporter-positive cells are restricted to the glial lineage, contrary to neuronal-restricted Nestin transgene-activating cells (Murdoch and Roskams, 2007). 93 Figure 3.13 BLBP is expressed in the olfactory ensheathing glia lineage A) In OE radial glial-like cells, nestin (green) expression is exclusive of Dcx+ (red) immature ORNs, but in CNS OB radial glia, nestin can co-localize with Dcx in migrating neuroblasts and immature neurons. B) CNS radial glia express BLBP (green) but it is not expressed in the OE. Instead, BLBP is highly expressed in B,C) migratory, mitotic olfactory ensheathing cells that are aligned along Dcx+ ORN axons. In vitro, semi-adherent colonies are formed after serum-free culture of E13.5 OE with FGF +/- EGF (D,E), whose cores can express E) BLBP (green) +/- S100β, especially on the periphery, which can be asymmetrically distributed at division (inset; arrows point to DAPI+ nuclei). D) Cells close to a BLBP colony express both BLBP and nestin (red); some appear to be dividing (inset). In adult transgenic BLBP-cre/Rosa 26 mice (F-I) BLBP (green) and β galactosidase (red; LacZ) are coexpressed (arrowheads) in OECs surrounding axon bundles. BLBP neg β galactosidase+ OECs (arrows) are also detected in the LP. H) BLBP+/ β galactosidase+ OEC processes are detected in the nerve fibre layer of the OB, some of which express detectable levels of (I) nuclear Cre  (red). Scale bars are 100 um in A (A,B), D,E; 50 um in C, H (F-I). 94 3.3   Discussion The identity and spatiotemporal regulation of embryonic OE progenitors and comparisons with their CNS counterparts, has not been previously established. Here, I provide evidence for a nestin+ lineage-negative precursor that shares antigenic and morphologic characteristics with, but is distinct from, multipotent CNS radial glia. Nestin- cre-mediated lineage analysis demonstrated that only a subset of nestin-expressing precursors of embryonic OE and vomeronasal organ drive nestin transgene expression to produce ORNs and vomeronasal receptor neurons in a zonally-restricted pattern, whose neuronal restriction is recapitulated in colonies derived from E13.5 OE. These data suggest common conserved regulatory mechanisms of neurogenesis amongst related chemosensory neuron progenitors. In contrast, lineage tracing using BLBP-cre mice showed that BLBP-expressing precursors were restricted to the olfactory glial lineage, contrary to their neurogenic fate in the CNS (Anthony et al., 2004). The evidence supporting the existence of radial glial-like cells in the OE includes the detection of embryonic OE cells with a radial morphology that express antigens commonly associated with CNS radial glia in vivo or in vitro. Nestin-expressing radial glial-like cells appear to have a progenitor phenotype since they are located in a known progenitor region, are highly proliferative and lack antigens associated with neurons and glia (PCNA+ lineage-negative). Radial glial-like progenitors expressing nestin are not detected in the adult OE, and less frequent in the P5 OE compared to the embryonic OE, suggesting they are a transient progenitor population, like their CNS counterparts. BLBP was not detected in the OE, like other radial glial antigens, but was instead detected in the lamina propria in olfactory ensheathing cells. Lineage tracing of olfactory progenitors with BLBP-cre/ROSA mice indicated that BLBP was restricted to the glial lineage, and not neuronal lineage, as in the CNS (Anthony et al., 2004). This result is supported by the expression of endogenous BLBP in S100β+ olfactory ensheathing cells in the lamina propria surrounding axon bundles (Carson et al., 2006) and olfactory nerve, and in vitro in BLBP+ cells having a morphological and antigenic profile consistent 95 with olfactory glia (Fig 3.5, 3.13). These results have also been confirmed by others using BLBP-GFP transgenic mice (Gong et al., 2003). Nestin has been well established as a stem cell marker in the CNS (although not exclusive to CNS stem cells) (Lendahl et al., 1990; Reynolds et al., 1996), but has not been previously detected in olfactory progenitors at any ontogenic stage. The sustentacular end feet of adult rat cells in vivo, purified lamina propria-derived olfactory ensheathing cells, basal cell lines and OE-derived neurospheres in vitro, have all been reported to express nestin (Doyle et al., 2001; Au and Roskams, 2003; Zhang et al., 2004). This seemingly obvious omission in identifying nestin expression in olfactory progenitors is likely due to a failure to detect nestin protein because of the antibody chosen, species analyzed (rat, mouse), tissue processing, or immunohistochemical detection method utilized. Admittedly, I was initially unable to detect reproducible and convincing nestin protein in mouse OE until using the polyclonal nestin antibody. But as seen in Fig 3.2, I can detect nestin-expressing radial glial-like cells with 2 independent nestin antibodies, albeit after using entirely different methods for antigen detection for each independent antibody clone. Thus, for the first time and outside of the CNS, these results support the hypothesis that the embryonic OE contains a radial glial-like progenitor. Nestin is also the earliest detectable antigen in adherent cells forming colonies from E13.5 OE, where the majority of actively cycling cells after 10 days are bipolar nestin-expressing cells similar to the radial glial-like progenitors found in vivo (Fig 3.4, 3.5; Table 3.1), and may represent the earliest OE progenitor identified to date. Embryonic OE yields three distinct colonies of a 3-dimensional (semi-adherent) phenotype. Colony heterogeneity, coupled with distinct morphological and antigen expression profiles of progeny after 10 days (Fig 3.4, 3.5), suggests each colony subtype is likely formed by progenitors at different stages of induction or commitment. All colonies contain mitotic nestin+ cells, where nestin+ cells at a distance from the colony core assume a more differentiated glial (BLBP or S100β-expressing) phenotype. Fusiform colonies contain the highest percentage of mitotic bipolar PCNA+, nestin+ cells, NST+ neurons and Mash1+ mitotic cells (Fig 3.5; Table 3.2; and Ch 5). That fusiform colony and NST+ ORN production is specifically enhanced by FGF2 96 (Table 3.3), a known regulator of neurogenesis in both the CNS (Vescovi et al., 1993) and OE (Calof et al., 1998a), suggests that fusiform colonies contain the highest proportion of transit amplifying neurogenic precursors. Polygonal colonies preferentially respond to EGF, which specifically enhances gliogenesis developmentally (Kuhn et al., 1997; Qian et al., 2000) (Table 3.3), and contain a high proportion of BLBP+/S100β- expressing cells, in close proximity to expansive populations of S100β+ OEC-like cells (Au and Roskams, 2003; Carson et al., 2006).  Polygonal colonies are thus more likely founded by progenitors committed to (or default towards) gliogenesis. Bipotential spherical colonies expand in response to both EGF and FGF2 (Table 3.3). Spherical colonies contain a high percentage of nestin+ mitotic cells, with NST+ neurons and blast-like cells of both neuronal and glial lineages loosely attached to the surface of the surrounding adherent cell layer (Fig 3.4, 3.5). FGF2 can enhance the production of radially-arrayed nestin+ lineage-negative cells from spherical colonies, which are dramatically reduced with FGF signal inhibition (see Ch 5). These data suggest that spherical colonies may represent a more primitive embryonic bipotent progenitor. OE cells cultured from E13.5 Nestin-cre/ZEG embryos produce GFP+ colonies together with GFP-negative colonies, with all colony subtypes represented in each GFP+/- group. GFP+ colonies produced GFP+/nestin+ cells and GFP+/NST+ neurons, but not GFP+ glia, and were enriched in fusiform colonies, the most neurogenic. In contrast, GFP-negative colonies were enriched for spherical (neurogliogenic) colonies, but none of the GFP-negative colony subtypes contained GFP+ cells. GFP-negative colonies may represent the products of nestin-transgene non-activating progenitors, indicative of GFP-negative OE progenitors in vivo. Since such a low proportion of the E13.5 OE expresses OCAM in vivo (identifying zones 2-4), and GFP+ progenitors from zone 1 are highly enriched in vitro, this suggests that zone 1, where nestin transgene- activation occurs, may be patterned prior to zones 2-4 in the E13.5 OE. If nestin identifies a stem cell in the OE, as it can in the CNS, one would expect that it could produce both neuronal and glial progeny. But, contrary to this, the progeny of Nestin-cre transgene-activating cells appeared restricted to the neuronal lineage, 97 forming only a subpopulation of all olfactory receptor neurons detected in the dorsal- medial OE. Since a subpopulation of Mash1+ cells in Nestin-GFP mice are also GFP+, at least some GFP+ neuronal progeny of nestin transgene-activating precursors arise via Mash1+ neuronal progenitors. Although ZEG transgene silencing in alternative OE zones could account for this restriction, it is unlikely, since many olfactory receptor neurons outside of zone 1 that do not express GFP, continue to express Lac Z. Additionally, OMP-cre/ZEG mice demonstrated Cre-mediated excision as fully penetrant in mature olfactory receptor neurons in all OE zones. But despite the expression of endogenous nestin in radial glial-like progenitors throughout the OE as early as E10, the use of additional reporters and reporter strains and an alternative Nestin-cre mouse line and strain, consistently demonstrated Nestin transgene-activating cells are restricted to the same discrete regions of the OE and vomeronasal organ. Since the same nestin regulatory elements as those used for both Nestin-cre lines, shows reporter expression in the same dorsal-medial region in Nestin-GFP mice, and Mash1+/GFP+ neuronal progenitors contribute to the transgene-activating neuronal lineage, this suggests that the Nestin regulatory elements used here are not simply being misexpressed by a subpopulation of olfactory receptor neurons. Collectively, the in vitro/vivo data support the unexpected results demonstrated by Nestin-cre/ZEG and Nestin-GFP transgenic mice showing a regional and cell type-specific restriction in progeny cells. In the CNS of E13.5 Nestin-cre/ZEG mice, GFP is easily detected, but I could not detect OE GFP reporter expression until E15.5 (Fig 3.12). The lack of GFP detection could be attributed to a lag time between transgene induction and Cre-mediated excision, followed by insufficient time for GFP accumulation (Miyoshi and Fishell, 2006). In support of this, in vitro assays suggest that the E13.5 OE of Nestin-cre/ZEG mice is enriched in progenitors that give rise to GFP+ colonies. Additionally, using the same Nestin regulatory elements to directly drive GFP in Nestin-GFP transgenic mice, transgene-activating GFP+ cells are already detected at E13.5 and segregated to the dorsomedial OE. This indicates that the identity of the zones that produce GFP+ olfactory and vomeronasal receptor neurons is induced prior to E13.5. The division of the adult OE into 4 distinct zones was based upon the regional expression of olfactory neuron odorant receptors, where each member of the odorant 98 receptor gene family was expressed in only one zone (Ressler et al., 1994). Since this initial attempt to organize patterns of odorant receptor expression, our understanding of OE zones has revealed a greater complexity in OR distribution than previously understood (Oka et al., 2003; Iwema et al., 2004; Miyamichi et al., 2005; Kobayakawa et al., 2007), in addition to the V1R region of the VNO. But our knowledge on what these broadly defined zones mean or how they function remains limited. O-MACS (medium- chain acyl-CoA synthetase), an OE-specific enzyme involved in fatty acid metabolism and found in olfactory and sustentacular cell mitochondria, is expressed exclusively in zone 1. The function of O-MACS may involve the zone-specific processing or detoxification of odorant molecules in the OE, but its expression throughout zone 1 together with that of endogenous nestin does not explain why only a subpopulation of olfactory receptor neurons are derived via nestin-transgene activation. Alternatively, because of its detection in the early E11.5 OE, O-MACS may help to pattern the developing OE by regulating the level of acyl-CoA, and in turn affect the function of developmentally regulated molecules like sonic hedgehog (Kohtz et al., 2001; Oka et al., 2003), resulting in local signals that activate the nestin-transgene in discrete regions, or induce neuronal differentiation in their progeny. Although the nestin second intron enhancer is commonly used to drive CNS nestin expression, and is required for CNS-specific expression, it is not sufficient for full expression in all nestin-expressing CNS progenitors (Zimmerman et al., 1994b; Yaworsky and Kappen, 1999; Johansson et al., 2002; Mignone et al., 2004) and can be differentially regulated in the CNS by hormone response elements and/or Class III POU domain-containing proteins (Brn 1,2 4) (Josephson et al., 1998). Here, the restricted activation of the “CNS-specific” nestin transgene to neuronal precursors in different OE and vomeronasal zones suggests that regional subpopulations of nestin-expressing embryonic olfactory/vomeronasal receptor neuron precursors may use different transcriptional mechanisms to regulate nestin expression (and expression of other zonally-restricted proteins, like chemosensory receptors). In particular, a combination of molecules, spatiotemporally expressed at specific levels, and thus forming a unique molecular signature in neuronal precursors, may be found in olfactory nestin transgene- activating cells and not non-transgene activators. One candidate molecule contributing 99 to this proposed complex is the POU domain transcription factor Brn-2, which is most highly induced in restricted OE regions from E12.5-E14.5 (Hagino-Yamagishi et al., 1998). In summary I provide evidence for a unique chemosensory cell, a nestin- expressing radial glial-like progenitor, which represents a subpopulation of nestin- expressing OE and vomeronasal cells, and appears restricted to the neuronal lineage in vivo and in vitro. In contrast, olfactory ensheathing cells appear to arise via an alternative or divergent BLBP-expressing lineage. Nestin- and BLBP-expressing precursors, may thus represent the earliest olfactory/vomeronasal neuronal and glial progenitors, respectively, identified to date. 100 CHAPTER 4        ONTOGENIC CHANGES IN OE PROGENITOR BIOLOGY DURING ADULT, PERINATAL AND EMBRYONIC DEVELOPMENT Figure 4.3 and text accompanying Figures 4.1 to 4.3 and 4.6, was published in Murdoch, B and Roskams, AJ (2007) OE progenitors: insights from transgenic mice and in vitro biology; Journal of Molecular Histology 39(6): 581-99. 4.1   Introduction Neurogenesis during the ontogeny of the OE can be thought of as occurring in three phases: embryonic establishment (E10-P0), postnatal expansion (P1-P30), and adult maintenance (P30 - death). At each phase, neurogenesis takes place in distinct cellular and extracellular microenvironments, which temporally and spatially pattern the developing OE. The adult OE supports chemosensory function and maintains the integrity of the OE by replacing dying neurons upon demand. Little is known about the identity of the progenitors responding to endogenous neurogenic signals, the regulatory mechanisms involved, and whether the same factors regulate neurogenesis from adult and embryonic progenitors (Calof et al., 1998b; Getchell et al., 2002b; Schwob, 2002; Bauer et al., 2003; Kawauchi et al., 2005). Horizontal basal cells (HBCs) and globose basal cells (GBCs) reside in the basal cell compartment of the OE and serve as adult olfactory progenitors (reviewed in (Schwob, 2002)). GBCs have a limited self-renewal capacity (Calof and Chikaraishi, 1989; DeHamer et al., 1994; Shou et al., 1999), and can produce olfactory receptor neurons and sustentacular cells (Huard et al., 1998; Chen et al., 2004). HBCs are relatively quiescent, can produce more HBCs, GBCs, and differentiate into neurons, glia and sustentacular cells after cell loss in vivo or in response to growth factors in vitro (Holbrook et al., 1995; Carter et al., 2004; Leung et al., 2007; Iwai et al., 2008). These features suggest HBCs may be postnatal precursors to GBCs. Surprisingly little is known about embryonic olfactory progenitors, largely due to a lack of identifiable markers that allow one to distinguish and assay the potential of individual candidate progenitors, in vivo or in vitro (Weissman et al., 2001).  A long-held 101 assumption is that progenitors in the adult OE resemble embryonic OE progenitors in both identity and regulation. However, the OE undergoes significant changes during ontogeny, and HBCs and sustentacular cells, two cell types that may contribute to postnatal/adult neurogenesis, are generated after many olfactory receptor neurons have been produced, in late embryonic and early postnatal development (Farbman, 1992; Carter et al., 2004). In vitro assays of olfactory progenitors at varying developmental timepoints have been utilized to examine the growth factor requirements and progenitor output during olfactory neurogenesis. These assays have shown that retinoic acid can induce olfactory cell types and that Shh acts as a general proliferative stimulus (LaMantia et al., 2000). EGF stimulates the proliferation and survival of HBCs (Newman et al., 2000; Carter et al., 2004), LIF, FGF2, BMPs promote neurogenesis by increasing GBC proliferation and survival (DeHamer et al., 1994; Newman et al., 2000; Shou et al., 2000; Carter et al., 2004). Some BMPs and GDF-11 act on olfactory progenitors to inhibit neurogenesis (Shou et al., 1999; Wu et al., 2003), while TGF-β promotes terminal ORN differentiation (Newman et al., 2000). The assays utilized include embryonic explants producing migratory cells or single cell suspensions forming colonies on stromal layers (DeHamer et al., 1994; Mumm et al., 1996; Shou et al., 1999; LaMantia et al., 2000; Shou et al., 2000; Wu et al., 2003); prospective isolation of postnatal ICAM-1+ HBCs and growth in serum-containing cultures (Carter et al., 2004), or enrichment of adult OE cells by dissociation of the lamina propria and outgrowth of EGF-responsive cells prior to testing their subsequent growth factor regulation (Newman et al., 2000) both producing adherent colonies; or growth of human adult OE for several weeks in serum prior to the emergence of non-adherent spherical cell clusters (Roisen et al., 2001; Othman et al., 2003). Because of the multitude of methods used for cell isolation, with or without enrichment, and subsequent culture, it is difficult to draw comparisons between progenitors derived from different ontogenic stages. Using a standardized and well established assay, the neurosphere assay (Reynolds and Weiss, 1992), I culture OE progenitors from different ontogenic stages under the same conditions, to test for differences in their frequency, phenotype and function. Because of their proliferative effects on OE progenitors (DeHamer et al., 1994; Newman et al., 2000; Carter et al., 102 2004), and CNS progenitors in the neurosphere assay (Reynolds and Weiss, 1992; Morshead et al., 1994; Reynolds et al., 1996; Weiss et al., 1996b), I chose to test the effects of EGF, FGF2 or both. I hypothesize that progenitor frequency, neurogenesis and self-renewal capacity, when assayed using in vitro neurosphere assays, will decrease with aging. 103 4.2   Results 4.2.1  The changing distribution and frequency of proliferating olfactory cells during ontogeny To study OE progenitor changes during ontogeny, I assayed the in vivo OE from embryonic day 13.5 (E13.5), postnatal day 5 (P5) and the adult (> 2 months of age). To identify the location, distribution and identity of mitotic cells, proliferating cell nuclear antigen (PCNA), a nuclear protein associated with DNA polymerase, was used at each of these stages, and the upper (apical) or lower (basal) OE was independently assayed. PCNA is maximally expressed during S phase and segregated to the cytoplasm during cytokinesis (Waseem and Lane, 1990). At E13.5, PCNA-expressing cells were found in equal proportions in the apical and basal OE, whereas from P5 to adult the majority of PCNA+ cells were found in the basal, not apical, OE (Fig 4.1A-D).  E13.5 OE contained the highest percentage of proliferating progenitors, approximately 3.6 and 8.8 times more than at P5 and adult, respectively (Fig 4.1A; p<0.001). The frequency of proliferating cells continued to decline significantly from P5 to adult OE (Fig 4.1A-D; p<0.001). To test if dividing cells (PCNA+) at the apex of the OE might represent developing sustentacular cells, I assessed the expression and distribution of the Sus4 antigen, found on sustentacular cells and Bowman’s glands in the OE and lamina propria, respectively (Goldstein and Schwob, 1996). Sus4-expressing cells were not detected in E13.5 OE (Fig 4.1B), even after signal amplification (Fig 4.1B right panel). However, Sus4-positive cells were readily detected in the P5 and adult apical OE, where a small subpopulation of Sus4+ cells co-expressed PCNA at P5, but rarely in the adult (Fig 4.1C,D; and data not shown). Thus, the potential contribution of apical progenitors to OE development diminishes nearing the end of embryonic development, as the apical OE becomes increasingly occupied by sustentacular cells, and the pool of proliferating cells becomes predominantly relocated to the basal OE sub-compartment postnatally. 104  Figure 4.1 Changes in the distribution and frequency of mitotic E13.5 to adult OE progenitors (A) The percentage (line graph) and distribution (bar graph) of apical-basal proliferating cells expressing proliferating cell nuclear antigen (PCNA+), in the E13.5, postnatal day 5 (P5) and adult OE. (A-D) As development proceeds from E13.5 to P5 and adult, the percentage of PCNA+ cells (red) declines (*p<0.001, Tukey post-hoc test), and gradually transitions from the apical (arrowheads) to the basal OE (arrows). A subset of PCNA+ cells express SUS4 (green), a sustentacular cell marker, at P5 and adult (adult data not apparent in this picture), but SUS4 is undetected in the E13.5 OE, even with amplification (compare right panels of B, C). Nuclei (blue) stained with DAPI. Dotted line-basal lamina. Scale bar in B is 100 um; in C is 50 um (C-D). 105 4.2.2   In vitro readouts of postnatal day 5 and adult OE: spheres and adherent colonies The changes in the frequency and location of proliferating OE cells at different stages of development in vivo, suggested that progenitor readouts in vitro might likewise show ontogenic changes. I assayed OE progenitors from these same ontogenic stages to test their in vitro colony-forming potential, under conditions first developed for producing neurospheres from the subventricular zone (SVZ) of the lateral ventricles (Reynolds and Weiss, 1992). The neurosphere-forming activity of SVZ cells from the same mice was used as a positive control for growth factor efficacy and enabled me to directly compare the in vitro colony-forming activity of these SVZ and OE neural progenitor populations. In initial experiments, cells from adult OE displayed an extremely limited capacity to generate in vitro colonies or spheres, even though SVZ-derived neurospheres were readily detected. Because of this, I preferentially assayed postnatal day 5 (P5) OE (Figure 4.2), which contains a higher percentage of proliferating cells in vivo than adult OE (Figure 4.1). Additionally, our lab has previously identified P5 OE as a source of rare, selectable, adherent colony-forming HBC progenitors (Carter et al., 2004). Under the same culture conditions producing non-adherent neurospheres from the SVZ (Fig 4.2 Ai), the P5 OE produces non-adherent spheres (Fig 4.2 Aii,iii) together with adherent colonies (Fig 4.2 Di,ii), whose phenotype resembled colonies produced from ICAM-1+ HBCs (Carter et al., 2004). Approximately 0.7% of SVZ cells from P5 mice yielded neurospheres, consistent with reports from early postnatal tissue (Hitoshi et al., 2002), while only 0.03% of total cells from P5 OE produced spheres and colonies. The relative frequency of combined P5 OE sphere and colony formation was only 4.2% that of SVZ neurospheres (Fig 4.2 B). In some, but not all experiments, rare colonies comprised of adherent cells topped by a semi-adherent cluster of cells were detected. OE-derived spheres were produced in equivalent numbers when EGF, FGF2  or both together were used, and were consistently more abundant (5 times greater) than adherent colonies, when grown in either EGF or FGF2 (Fig 4.2C,E). Within adherent colonies, FGF2 alone and EGF with FGF2, produced significantly more colonies compared to EGF alone (Fig 4.2E; p<0.05 – 0.001). P5 OE was 3.3 to 13.6 times more 106 Figure 4.2 Postnatal day 5 OE forms spheres and adherent colonies with increased plating efficiency after passaging Postnatal day 5 (P5) subventricular zone (SVZ) and OE cells were isolated from the same mice and expanded for 10 days in neurosphere media, supplemented with EGF and/or FGF (20ng/ml). A) Typical morphology of P5: i) SVZ neurosphere and ii-iii) OE-derived spheres. B) OE neurosphere and adherent colony formation is 4.2% that of SVZ neurosphere frequency. C) Similar P5 OE sphere numbers are obtained from 2x105 cells with EGF, FGF or both. Di-ii) Typical P5 OE adherent colonies. E) EGF plus FGF produce significantly more OE adherent colonies (per 2x105 cells) compared with EGF or FGF alone (**p<0.001, p<0.05), with FGF significantly more than EGF (p<0.05). F) Adult OE spheres do not passage, P5 have a limited passaging capacity, under the conditions tested. EGF-epidermal growth factor; FGF-fibroblast growth factor; E+F-EGF plus FGF; OE-olfactory epithelium. All scale bars are 50 um (Ai-iii same magnification). 107 enriched for spherical and adherent colony-forming cells than adult OE, respectively, when cultured in EGF and FGF2 (Table 4.1). To determine if primitive OE progenitors capable of self-renewal were maintained under these conditions in vitro, I tested the ability of P5 OE spheres to passage. Primary spheres were triturated and replated under the same conditions, with their ability to form secondary spheres and adherent colonies assessed after a further 10 days in vitro. Replated P5 primary spheres self-renewed to form secondary spheres and adherent colonies, whose number was reduced by approximately 90%, compared to primary spheres and colonies. Unlike typical P5 and adult (shown in Fig 4.3A) SVZ neurospheres, whose numbers expand with passaging (data not shown), P5 OE was unable to produce colonies/spheres with tertiary passaging. Under these same conditions, primary passaged adherent colonies produced only secondary adherent colonies, with extremely low efficiency, but no spheres. Individually, neither primary colonies nor spheres were capable of passaging under the conditions tested. Contrary to P5 OE, adult OE spheres and colonies (shown in Fig 4.3B,C) failed to passage when replated using the same serum-free media and growth factors used in the primary culture (Fig 4.2F). Thus, when plated in serum-free media with EGF, FGF2 or both, adult and P5 OE-derived progenitors produce morphologically distinct spheres and colonies with limited self-renewal capacity, which are biologically distinct from age-matched SVZ- derived neurospheres. To determine the identity and relationship between cells found in vivo to those of P5 OE spheres and adherent colonies in vitro, immunochemistry was performed using antigens marking CNS progenitors and neuroblasts, together with neurons and glia. The CNS putative neural stem cell marker, nestin, is not expressed in candidate HBC progenitors of the P5 OE, but is found mostly in olfactory ensheathing cells (OECs) of the lamina propria (LP), a subpopulation of which express S100β, a calcium binding protein (Fig 4.3D, F) (Au and Roskams, 2003). Doublecortin, a microtubule-associated protein expressed in migrating neuroblasts of the rostral migratory stream and immature CNS neurons (Gleeson etal. 1999), is likewise detected in immature olfactory neurons and their axons (Fig 4.3E). Immunocytochemical analysis of sectioned neurospheres and adherent colonies from P5 OE reveals multiple cell types throughout their cores and 108 Table 4.1  Frequency of progenitor output from E13.5, P5 and adult OE cultured using similar conditions in EGF and FGF2. Numbers in brackets indicate the fold enrichment of 1. P5 compared to adult spheres and colonies; 2. E13.5 compared to P5 or adult spheres and colonies, respectively. Ontogenic Age Frequency of progenitor output (the number of cells required to form a single colony/sphere) spheres colonies Postnatal day 5 n= 7 wells; 4 independent experiments 3, 246 (3.3) 14, 925 (13) Adult n=15 wells; 3 independent experiments 10, 869 204, 081 semi-adherent colonies E13.5 n=6 wells; 3 independent experiments 2,739 (P5 -1.1, 5.4) (Adult –3.3, 74) 109 Figure 4.3 In vivo and in vitro correlates of progeny cells of postnatal and adult OE progenitors Cells plated in serum-free medium supplemented with FGF2 and/or EGF from postnatal day 5 (P5) or adult mice, produce (A) SVZ-derived non-adherent neurospheres (B) OE-derived non-adherent spheres and (C) adherent OE colonies. D-F) At P5 in vivo, nestin (green) is found in rare cells within the OE (F, arrowheads), but mainly localizes to olfactory ensheathing cells of the lamina propria, some of which co-express S100β (F, arrows, red). Nestin expression does not coincide with (D) ICAM-1+ basal cells (arrowhead, red), or (E) immature neurons (Dcx+, red). G-I) Sectioned P5 OE-derived spheres and (J-L) adherent colonies contain nestin+ cells (arrowheads) that are mostly distinct from (G,J) ICAM-1+ basal cells (red; arrow) and (H,K) βIII neuron-specific tubulin+ neurons (NST; red; arrow) that may or may not  express (I,L) the glial antigen S100β (arrow). L) Inset shows nestin+ S100β+/- expressing cells beside a colony. Nuclear stain DAPI (blue); dotted line denotes basal lamina; OE, olfactory epithelium; LP, lamina propria; ORN, olfactory receptor neuron; Ax, axon bundle; SVZ, subventricular zone. Scale bar in A is 100 um (A,C); in B is 50 um; in E is 50 um (D-F); in I is 50 um (G-I); in J is 50 um; in K is 100 um (K,L). 110 on their periphery (Fig. 4.3G–L). Nestin is found in cells predominantly on the periphery of spheres and colonies, in close apposition to ICAM1 + HBCs (Fig. 4.3G), and near immature olfactory receptor neurons expressing neuron-specific βIII tubulin (NST; Fig. 4.3H). Olfactory ensheathing glia, expressing S100β, are usually found closer to the centre of spheres, in a similar arrangement to that seen in CNS neurospheres (Fig. 4.3I) (Campos et al., 2004). Subpopulations of cells expressing ICAM-1 or nestin are found in adherent colony cores, or more often at their periphery, where they are usually clustered adjacent to S100β+ cells (Fig 4.3J–L). NST+ olfactory neurons are usually on the surface of adherent colonies, and in the periphery of spheres, adjacent to nestin + and/or S100β + cells (Fig 4.3H, I, K, L). With passaging of primary spheres, the production of neurons decreases (similar to CNS neurospheres), and glial production predominates (data not shown). Thus, unlike CNS neurospheres, the P5 OE produces 2 different types of progenitor readout –adherent colonies and non-adherent spheres in vitro, with limited self-renewal capacity, that can differentiate to form both neurons and glia. In the adult OE under the conditions tested for P5 OE, the frequency of sphere/colony-forming progenitors declines and self-renewal is undetectable. 4.2.3   Isolation of E13.5 OE for in vitro progenitor readouts Since E13.5 OE contained the highest percentage of proliferating cells in vivo, I used in vitro assays of progenitor output to test if E13.5 OE would yield self-renewing multipotent sphere or colony-forming cells. OE dissected from E13.5 embryos was pooled and triturated to yield cells for in vitro assays. To ensure the tissue isolated was indeed embryonic OE, and in the absence of definitive markers to specifically identify embryonic OE, dissected tissue was fixed, cryopreserved and sectioned onto slides for immunohistochemical analyses. As shown in Fig 4.4, most cells in the isolated E13.5 tissue were proliferating (PCNA+) and found in apical and basal regions devoid of NST+ immature ORNs, a subpopulation of which expressed nestin (Fig 4.4A-D). NST+ immature neurons were detected in the mid-embryonic OE, and their axon bundles were seen in the underlying lamina propria (Fig 4.4C,D). The tissue structure, morphology, location and antigenic profiles of cells found within pieces of dissected tissue from E13.5 111 Figure 4.4 Isolation of OE from E13.5 embryos Immunohistochemistry was performed on presumptive OE tissue, dissected from E13.5 embryos. A,B) The tissue organization and expression pattern of Nestin+ (green; arrowheads) cells, together with proliferating PCNA+ cells and (C,D) NST+ immature neurons (both- red; arrows) was identical to that seen in intact E13.5 OE. E,F) No colonies form after 10 days under the same conditions used to grow E13.5 OE colonies (G), when cells are isolated from the frontonasal area, immediately surrounding, but not including, the OE. Nuclear stain DAPI (blue). LP-lamina propria; OE-olfactory epithelium; ORN-olfactory receptor neuron. Scale bars in A,B are 50 um (A,C,E; B,D,F,G; respectively). 112 embryos resembled that of intact OE at the same developmental stage (see Fig 3.1). Cells adjacent to the E13.5 OE, from the frontonasal mass, were isolated and plated side-by-side with OE cells under the same conditions but did not produce cell clusters indicative of progenitor activity, or cells expressing nestin or NST antigens, (Fig 4.4E,F), like those in the E13.5 OE (Fig 4.4 G). Taken together, these results provide evidence that semi-adherent colonies forming after culture in vitro do not arise from cells of the adjacent frontonasal mass but are specific to the E13.5 OE. 4.2.4   Testing for clonal density The cell density where spheres/colonies are formed by a single cell is termed clonal density. Clonal density was first determined by mixing equal cell numbers at increasing densities from ubiquitous β actin driven GFP-expressing mice (Hadjantonakis et al., 1998) with GFP non-expressing mice to determine the density where only GFP expressing or non-expressing colonies were obtained. Cells from the E13.5 presumptive subventricular zone served as a positive control, producing only GFP+ or GFP-negative neurospheres at cell densities ranging from 1-20 cells/ul (Fig 4.5A,B) (Tropepe et al., 1999; Morshead et al., 2003). Similarly, cells from the OE of the same mice, when plated at 133 cells/ul, produced colonies comprised of cells that were predominantly either GFP+ or GFP-negative. Because weak GFP expression occurred in OE colonies formed in positive controls where only GFP+ OE cells were plated, even after antibody detection, I confirmed my results using Nestin-cre/ZEG transgenic mice. Cre-mediated excision in a subpopulation of olfactory progenitors from Nestin-cre/ZEG mice results in 56% of colonies comprised of cells expressing GFP (Ch 3), 44% GFP-negative colonies, in the same cultures, and without detection of mixed colonies (Fig 4.5C-E). All colony subtypes are represented in both GFP+ and GFP-negative colony subpopulations, and mixtures combining different colony subtypes were not detected. Collectively, these results suggest that my plating density of 133 cells/ul for olfactory cells is clonal and that their progeny likely arise from the expansion of a single cell. 113 Figure 4.5 Testing for the clonality of plated cells Equal mixtures of GFP-expressing and non-expressing E13.5 SVZ cells were plated in serum-free cultures with FGF2 at varying cell densities to determine those densities resulting in only GFP-expressing or non-expressing neurospheres after 7-10 days. (A) Bright field and (B) GFP fluorescence of SVZ neurospheres, showing 2/3 comprised of non-GFP+ cells (arrows), 1/3 comprised of GFP+ cells (arrowhead). Insets show there is no background detection of GFP in the red channel. (C,D) E13.5 OE cells plated at 133 cells/ul from Nestin-cre/ZEG mice formed semi-adherent colonies that were either GFP-negative (C; Nestin in red) or GFP+ (D) without mixed GFP+/- colonies detected (E). Blue nuclear stain is DAPI. Scale bars in A,C are 50 um (A,B; C,D; respectively). 114 4.2.5   Continued neurogenesis in self-renewing embryonic OE colonies Under the same culture conditions producing neurospheres from the embryonic SVZ, the E13.5 OE produces semi-adherent colonies of 3 subtypes, fusiform, polygonal and spherical, that can each produce neurons and glia, to varying degrees (Ch 3). The frequency of E13.5 OE semi-adherent colonies was only 10% of CNS neurospheres, where 0.5% of cells from E13.5 ganglionic emini formed neurospheres, similar to previous reports (Hitoshi et al., 2002), but only 0.03% of E13.5 OE cells yielded colonies (Fig 4.6A and data not shown). Semi-adherent E13.5 colonies were similar in frequency to P5 spheres, but 5.4-fold enriched compared to P5 adherent colonies (Table 4.1) and 3.3 to 74-fold enriched compared to adult spheres and adherent colonies, respectively (Table 4.1). Thus, compared to adult progenitors, E13.5 OE progenitors are highly enriched, but less so when compared to P5. To determine if self-renewing E13.5 OE progenitors were maintained in vitro using serum-free conditions with growth factors (my primary plating conditions), I tested the ability of E13.5 OE colonies to passage when grown in FGF2, EGF or both. Pooled primary colonies were triturated and replated using the same serum-free growth factor conditions used for their primary culture, with their ability to form secondary and tertiary colonies assessed after a further 10-15 days in vitro. The number of colonies produced after secondary and tertiary passaging continually declined, but was best maintained in FGF2-containing cultures with or without EGF (20% of primary cultures by tertiary passage) compared to EGF alone (4% of primary culture by tertiary passage; Fig 4.6B). Although fusiform colonies were not detected in passaged cultures, spherical and polygonal colonies maintained their morphological features seen in primary cultures and demonstrated continued neuron and glia production even after tertiary passage (Fig 4.6C,D). Thus using CNS neurosphere cultures, the E13.5 OE demonstrates continued neurogenesis and progenitor self-renewal over prolonged periods of time. 115 Figure 4.6 Neurogenesis continues in passaged E13.5 OE semi-adherent colonies E13.5 subventricular zone (SVZ) and OE cells were isolated from the same mice and expanded for 10 days in neurosphere media, supplemented with EGF and/or FGF2 (20 ng/ml) before passaging pooled colonies. A) E13.5 OE semi-adherent colony formation is 10.9% that of SVZ neurosphere frequency. B) Semi-adherent colonies decline with passaging. C,D) Tertiary passaged spherical colonies look similar to primary colonies (arrowheads) and retain the ability to produce NST+ (green; arrow) neurons and S100β+ (red; arrow) olfactory glia. EGF-epidermal growth factor; FGF-fibroblast growth factor 2; E+F-EGF plus FGF2; OE-olfactory epithelium. All scale bars are 50 um. 116 4.2.6   Testing conditions for the enhancement of embryonic progenitor colony production Regulatory signals governing progenitor cell division and differentiation arise in locations closely associated with progenitor regions, in the stem/progenitor niche. Olfactory progenitors are found in the basal OE, next to the ECM-rich basement membrane and in close proximity to olfactory ensheathing cells, which are known to secrete factors that can regulate neural progenitors (Vincent et al., 2005). Our lab previously found that matrix components can effect the production and output of adult OE progenitors (Carter et al., 2004). To determine if OE-based basal lamina components, together with FGF2, effect embryonic OE progenitor production and output, I tested conditioned media from enriched lamina propria-derived olfactory ensheathing cells (LP-CM) and ECM molecules. Compared to FGF2 alone, OE semi-adherent colony number was attenuated, in a dose-dependent manner, by the addition of olfactory ensheathing cell conditioned media, plated on collagen together with laminin substrates (Fig 4.7A). In contrast, FGF2 treated cultures plated onto either laminin or collagen substrates alone, compared to both together at the same concentrations, increased the total colony output by 2.3 to 4.6-fold, respectively (Fig 4.7B, p<0.01 to 0.001). Matrigel, an enriched source of basement membrane extracellular matrix molecules with low growth factor activity, supported similar colony numbers and subtypes to mixed collagen and laminin (Fig 4.7B,C). About 95% of all colonies produced on collagen or laminin alone, were non-adherent cell clusters, and not semi-adherent spherical colonies, as seen with collagen and laminin combined, (Fig 4.7C; seen in Fig 5.7A). The frequency of embryonic OE non-adherent cell clusters was 2.4-fold higher than semi-adherent colonies, representing 1 in every 1,141 cells plated and the most frequent type of colonies from the embryonic, postnatal or adult OE. I termed these non-adherent cell clusters, OE neurospheres, because they morphologically resembled SVZ neurospheres, and could expand with passaging (n=1 experiment; data not shown). 117 Figure 4.7 Testing conditions for the enrichment of colony production A single cell suspension of E13.5 OE was cultured in FGF2-supplemented serum-free media with or without olfactory ensheathing cell conditioned media or combinations of extracellular matrix molecules, and grown for 10 days before counting the total numbers and distribution of colony subtypes. A) Lamina-propria olfactory ensheathing cell conditioned media (LP-CM) attenuates total colony number per well in a dose dependent manner (2 independent experiments, 5-6 wells total). (B) Colony output per well is increased with collagen or laminin alone, compared to both together or Matrigel (2 independent experiments, 5-6 wells total). (C) Collagen mixed with laminin or Matrigel produce similar distributions of the three semi-adherent colony subtypes. Collagen or laminin alone produce cultures enriched mostly for non-adherent spherical clusters of cells (termed OE neurospheres) that appear morphologically different from semi-adherent spherical colonies. 118 These results suggest that, under the conditions tested, colony production and subtype from embryonic progenitors is differentially regulated by individual and mixed ECM molecules. 119 4.3   Discussion In this chapter I tested for progenitors from the OE at varying ontogenic stages in vivo and used the same in vitro assays to test progenitor frequency, neurogenesis and self-renewal under similar conditions. Under the same culture conditions used to grow neurospheres from the CNS SVZ (Reynolds and Weiss, 1992), postnatal day 5 and adult OE progenitors produced adherent colonies, similar to those detected previously from the perinatal or adult OE (Newman et al., 2000; Carter et al., 2004), together with non- adherent spheres. Postnatal sphere formation, with varying self-renewal and differentiative capacities, has been reported previously in the dentate gyrus, skin and after several weeks of culture, human OE (Roisen et al., 2001; Toma et al., 2001; Seaberg and van der Kooy, 2002). Using serum-free cultures with FGF2 and/or EGF, together with conditions to avoid cell attachment, non-adherent spheres, without adherent colonies, have recently been detected in the postnatal day 0-3 OE (Barraud et al., 2007). Unlike my P5 spheres, the Barraud (2007) spheres were unable to passage, but the cells detected in primary spheres (after adhesion and differentiation on collagen and laminin substrates) included basal cells, neurons and glia, similar to those shown here (Barraud et al., 2007). Comparisons between my P5 OE spheres and adherent colonies and P0-P3 OE spheres in the Barraud study are difficult, because the frequency of the Barraud 2007 spheres was not reported and each study used different methods to isolate and culture the postnatal OE cells. In contrast, E13.5 OE forms semi-adherent colonies, of three distinct morphologies, under the same culture conditions used for postnatal OE. Although not routinely seen, rare semi-adherent colonies could be detected in the postnatal day 5 OE, but not the adult, which may represent residual embryonic progenitors. Phenotypic changes in embryonic compared to postnatal/adult progenitor readouts in vitro using the same conditions, together with the absence of expression of HBC-associated progenitor antigens in the mid-gestation embryo, or nestin+ progenitors postnatally, suggests there may be independent embryonic and postnatal OE progenitors. This is similar to the hematopoietic system where fetal liver stem cells predominate in the embryo, and 120 perinatally bone marrow-derived stem cells become the main source of blood cells for the postnatal organism (Zon, 1995; Medvinsky and Dzierzak, 1998). Independently derived OE embryonic and postnatal progenitors may be required to accommodate the changing functional demands imposed by their neuronal progeny during development. Contrasting this, cells from the ventricular/subventricular zone, regardless of their ontogenic stage, readout as non-adherent neurospheres under these same conditions and can give rise to neurons and glia, although their frequency, growth factor responsiveness and self-renewal capacities change with aging (Tropepe et al., 1999). These results suggest that embryonic, postnatal and adult SVZ progenitors have some characteristics in common that persist during ontogeny. In support of this, transgenic mice used to lineage trace radial glial progenitor progeny showed that most, if not all neurons in the developing brain are derived from radial glia (Anthony et al., 2004). Similarly, postnatal radial glia show persistent neurogenesis in the SVZ and dentate gyrus that produces olfactory bulb and subgranular zone neurons (Merkle et al., 2004; Merkle et al., 2007). By changing the extracellular matrix environment in my cultures from collagen combined with laminin, to using each independently, I enhanced the formation of embryonic colonies with a non-adherent phenotype that appeared similar to CNS neurospheres. Collagen alone supported the formation of a greater number of OE non- adherent spheres than laminin, both at the expense of semi-adherent colonies of every subtype. Collagen- and laminin-responsive cells signal via β1 integrins, together with either α1,2,10,11 or α1,3,4,6, respectively (Leitinger and Hohenester, 2007). β1 integrins can identify neural stem/progenitor cells since they are expressed in the SVZ, on the outer surface of CNS-derived neurospheres, and select for in vitro stem cell activity (Campos et al., 2004), and on postnatal olfactory progenitors in vivo and in vitro (Carter et al., 2004; Barraud et al., 2007). The response to ECM molecules is a function of the number and types of receptors found on cells and a balance between receptor recognition of adhesion and anti-adhesion domains within the ECM molecules. The reduced colony production detected using CM from postnatal OECs is likely due to the presence of combinations of secreted ECM molecules that may maintain OE progenitor quiescence (Chuah and West, 2002; Vincent et al., 2005). Consistent with my results, 121 collagen types I,IV and laminin, when used independently as substrata for embryonic olfactory neurons and their precursors, demonstrated weak adhesion (Calof and Lander, 1991), suggesting that collagen or laminin alone, can shift the balance to a more anti- adhesive phenotype. Under the conditions tested, the frequency of OE progenitors detected in vitro and their ability to self-renew declines with aging, from E13.5 to postnatal day 5 and adult, resembling their in vivo proliferative profiles. The OE progenitor frequencies reported here probably underestimate the actual progenitor frequencies seen during olfactory ontogeny, due in part to suboptimal culture conditions, since the conditions used were developed for SVZ progenitors (Reynolds and Weiss, 1992). Changing the extracellular environment by altering the growth factor concentration or providing paracrine factors from conditioned media derived from OE neural progenitors and their progeny during culture, may augment the readout of progenitors and their self-renewal capacity, as did substrates (DeHamer et al., 1994; Shou et al., 2000). A previously reported embryonic OE colony assay, first enriched for neuronal progenitors prior to plating, required feeder layers derived from the leftover cells to support four morphologically defined colony subytpes, where only one colony subtype was capable of producing neurons (Mumm et al., 1996; Shou et al., 2000). In the assay I used, the colony morphologies appear completely different from those of Mumm et al (1996), and neuron production, together with glial cell production (not tested in Mumm 1996), arise from each colony subtype. Assuming single cells initiated colonies in both assays, bipotent neuroglial progenitors can be detected in the in vitro assay presented here, with neuron-restricted progenitors in Mumm’s (1996). These distinctions likely reflect the differing in vitro conditions used to assay embryonic OE progenitors. These differences aside, the OE embryonic progenitor assay described here (and Ch 3), is the first demonstration of the production of self-organizing embryonic OE colonies with defined culture conditions, in the absence of feeder layers Depending upon the colony subtype produced and developmental stage assayed (E13.5 or P5 OE), each colony/sphere subtype produced neurons and glia, to varying degrees. In order to test if these progeny may be derived from a single initiating cell in the embryonic OE, I tried to test and demonstrate clonal density. I performed mixing 122 experiments and plated equal mixtures of GFP expressing and non-expressing cells to find the cell density where mixed colonies did not form. Additionally, I analyzed colony production from transgenic mice where only a subpopulation of all progenitors express GFP and tested to see if any mixed colonies appeared. In either case, I did not detect GFP+/- mixed colonies. However, some individual cells in GFP+ colonies did not appear to express GFP or did so weakly. This event was not considered as a mixed colony phenotype and more likely reflected weak and not absent GFP expression. Variegated levels of GFP expression were detected in individual cells comprising colonies produced either solely from GFP+ input cells or from transgenic Nestin-cre/ZEG mice. Also, single GFP+ cells were not detected on GFP-negative colonies, as would be anticipated if GFP+ and GFP-negative cells were intermixing. Plating and confirming the deposition of single cells into individual wells, or low cell numbers together with time-lapse videomicroscopy, to track individual cells as they expand and differentiate, would test clonality more definitively, similar to cortical progenitor analyses (Qian et al., 1997; Qian et al., 2000). However, because the plating efficiency of OE progenitors is so low (only one in approximately 3,000 cells results in a colony/sphere), this approach is not currently practical. Enrichment of embryonic OE progenitors using antibodies attached to magnetic beads or fluorescent activated cell sorting prior to plating would help increase colony yields, but good candidate markers are not presently available, unlike the postnatal OE (Carter et al., 2004; Leung et al., 2007). Regardless of mixing experiments, combinations of different embryonic colony subtypes in a single colony were not detected. Individual colonies appear to be initiated by single cells, since 2.5 hours after plating most adherent cells are individual PCNA+nestin+ cells, lacking Mash1 expression, that expand during 48 hours to form small PCNA+nestin+ cell clusters (Ch 3). Mixing experiments together with analyses of cultures soon after plating provide evidence suggesting that each colony arises from the expansion of an individual progenitor cell. The in vitro assays described herein provide methods to screen factors to test their ability to enhance OE progenitor survival, proliferation and differentiation, independently of potentially confounding extracellular signals found in feeder layers. Using the same assay for each ontogenic stage, I found that OE progenitor frequency, 123 neurogenesis and self-renewal was most enhanced in the embryonic OE, and provides an ideal developmental stage to test how factors regulate embryonic OE neurogenesis. 124 CHAPTER 5         REGULATION OF NESTIN+ EMBRYONIC OLFACTORY PROGENITORS BY FGF SIGNALING A modified version of this chapter will be submitted for publication Murdoch,B and Roskams, AJ (2008) Regulation of nestin+ embryonic olfactory progenitors by FGF signaling. 5.1   Introduction Normal nervous system development, and in turn function, is dependent upon the appropriate temporal and spatial induction, proliferation and differentiation of neuronal progenitors into functional neurons (Sanes et al., 2000). Tight regulation of neurogenesis serves to maintain the size of neuronal populations. In vivo and in vitro assays have been used to identify progenitor cell subtypes by their function, frequency and molecular expression profiles and to define the progressive and sequential steps leading to the production of ORNs (DeHamer et al., 1994; Mumm et al., 1996; Shou et al., 2000; Kawauchi et al., 2005; Murdoch and Roskams, 2008). In the neuronal lineage downstream of olfactory stem cells, Mash1+ neuronal progenitors give rise to Neurogenin1 (Ngn1)-expressing, immediate neuronal precursors (INPs) that divide 1 to 2 times before terminal differentiation into ORNs (see Fig 1.7) (DeHamer et al., 1994; Beites et al., 2005). The number of ORNs produced and divisions required to produce them, from a single Mash1+ neuronal progenitor or olfactory stem cell is not known. Signaling molecules governing olfactory neurogenesis in vitro and in vivo include members of the transforming growth factor-β (TGF-β) superfamily, leukemia inhibitory factor (LIF), EGF/TGF-α and fibroblast growth factors (FGFs) (Mahanthappa and Schwarting, 1993; Shou et al., 1999; Getchell et al., 2000; Newman et al., 2000; Shou et al., 2000; Getchell et al., 2002b; Bauer et al., 2003; Wu et al., 2003; Carter et al., 2004). Fibroblast growth factors comprise a family of 22 secreted proteins that signal via four tyrosine kinase receptors, FGF receptors 1-4 (FGFR1-4), and are stabilized by a proteoglycan receptor (Ornitz and Itoh, 2001; Knox et al., 2002). FGF2 can bind each of the four FGF receptors (FGFR1-4) but the level of activation is dependent upon the 125 receptor subtypes (Ornitz et al., 1996; Mason). FGFR1,2,3 have been detected in placode-derived cell lines (Illing et al., 2002), while only FGFR1,2, and not 3,4 transcripts have been detected in the embryonic OE (DeHamer et al., 1994). Whether the E13.5 OE contains putative progenitors expressing FGFR1,2 has not been determined. FGF8 is required for the proper development of the CNS, OE, VNO and nasal cavity (Ortega et al., 1998; Kawauchi et al., 2005). FGF2 has known neurogenic effects in the nervous system (Kuhn et al., 1997) and is required for normal cortical development (Ortega et al., 1998; Kawauchi et al., 2005). FGF2 can promote proliferation, survival and differentiation of CNS neural stem and progenitor cells (Temple and Qian, 1995; Reynolds et al., 1996) (Kilpatrick and Bartlett, 1995; Palmer et al., 1999) and in embryonic OE explants permits the division of immediate neuronal precursors before producing ORNs (DeHamer et al., 1994). Because paracrine signals endogenous to OE explants likely contribute to OE neurogenesis in response to FGF2 stimulation (DeHamer et al., 1994), the specific role of FGF signaling in embryonic OE neurogenesis, in addition to the identification of cells other than Ngn1+ immediate neuronal precursors that can respond to FGFs, remains to be determined. I have developed in vitro assays for embryonic olfactory progenitors that either form self-organizing semi-adherent colonies of 3 subtypes, or non-adherent OE neurospheres under defined culture conditions (Ch 3,4). Using gain and loss of function studies with these assays, I test how FGF signaling affects neuronal progenitors preceding immediate neuronal precursors. I hypothesize that FGF signaling can promote neurogenesis via Nestin+ progenitor proliferation leading to increased numbers of ORNs. 126 5.2   Results 5.2.1   FGF receptor 1,2 expression in E13.5 OE Immunohistochemistry was used to test for FGFR1 and FGFR2 expression in putative embryonic OE progenitors and ORNs. Expression of FGFR1 and FGFR2 was detected throughout the embryonic OE spanning from the basal to apical surface (Fig 5.1 A-H). A more regional apical expression of FGFR1 was detected (Fig 5.1G), compared to FGFR2, which showed a higher expression level and broader apical distribution than in the basal OE (Fig 5.1D). Unlike FGFR1 (Fig 5.1A,A’), FGFR2 was highly expressed in the septal cartilage, in cells within the olfactory bulb (OB), in olfactory ensheathing cells, many of which were proliferating, in the olfactory nerve fibre layer (ON) and the olfactory nerve (Fig 5.1B,B’). Proliferating cells were detected in the apical, intermediate and basal OE, where a subpopulation appeared to express FGFR1 (Fig 5.1C). A subpopulation of apical FGFR2+ cells was also dividing (PCNA+; Fig 5.1B’,D). Testing for single cells expressing both FGFR1 and FGFR2, was not possible due to antibody incompatibility. Both FGFR1,2 are detected in the apical and basal OE, in regions where nestin is expressed (Fig 5.1E,F). Bright FGFR2+ cells are detected in the lamina propria (LP) immediately subjacent to the basement membrane and close to sites of nestin expression (Fig 5.1 E,F). Both FGF receptors also appeared to have limited expression that localized with NST in a subpopulation of immature neurons (Fig 5.1 G,H). Consistent with its expression in the olfactory nerve fibre layer, FGFR2 was also detected in olfactory ensheathing cells directly surrounding NST+ axon bundles in the lamina propria (Fig 5.1 H,I). These results suggest that FGFR1 is detected mostly in basal progenitors and regional apical progenitors, while FGFR2 is expressed mostly in apical progenitors and olfactory ensheathing cells. 5.2.2   FGF receptor 1,2 expression in postnatal day 5 OE FGFR1,2 expression was tested in postnatal day 5 (P5) OE where the laminar structure is more defined and progenitor cell types better defined than the embryonic OE. On low power images, FGFR1 was seen predominantly in the septal cartilage (Fig 127 Figure 5.1 FGFR1,2 expression in E13.5 OE A,A’) FGFR1 (gray; green) is detected throughout the OE, but not the lamina propria (LP). B,B’) In contrast, FGFR2 (gray; green) is detected in olfactory ensheathing cells surrounding the olfactory bulb (OB) in the olfactory nerve fibre layer (ON), around axon bundles (Ax), the and olfactory nerve in the lamina propria, and in developing cartilage. C) A subpopulation of cells expressing FGFR1 appear to co-label with PCNA (red; arrow), especially in the basal OE, while a subset don’t (arrowhead). D) FGFR2 expression appears most robust in cells at the apex of the OE, many of which are dividing (PCNA+; red, arrow), a subset are PCNA-negative (arrowhead). E,F) Radial glial-like cells detected with nestin (red) appear in regions where FGFR1 or FGFR2 are expressed, in  both the apical (arrows) and basal (arrowheads) OE. F) FGFR2 bright cells are also detected immediately below the basal membrane, in the lamina propria, in a region where nestin expression is high. G,H) Expression of FGFR1 or FGFR2 can appear in sites where β III neuron-specific tubulin (NST, red) is also detected in immature neurons in the OE,  (G, arrow), but not always (G, arrowhead). However, H,I) FGFR2 is expressed in olfactory ensheathing cells adjacent to, and not overlapping with NST+ axon bundles (arrowheads). Boxes indicate magnified areas. Sep septum, NC nasal cavity. Dotted line indicates basal lamina. 128 129 5.2 A,B), unlike FGFR2 that was detected in a more restricted pattern in subregions of the lamina propria and the OE (Fig 5.2C,D). FGFR1 was detected in cells found in the apical OE that appeared above the uppermost layer of NST+ ORN cell bodies (Fig 5.2E,F) and lack the sustentacular cell antigen Sus4 (Fig 5.2F,J). Basal cells all along the basement membrane also expressed FGFR1 (Fig 5.2 E,F,J,M), and co-localized with the HBC marker, ICAM-1 (Fig 5.2N,O), a subpopulation of which were proliferating (PCNA+; Fig 5.2M). FGFR2 was detected in S100β+ olfactory ensheathing cells surrounding NST+ axon bundles (Fig 5.2G-I). Duct-like structures in the OE, devoid of NST (Fig 5.2G), and the nuclei of a subpopulation of Sus4+ cells in the OE, and gland-like cells in the lamina propria, also expressed FGFR2 (Fig 5.2K,L). Nuclear expression of FGFR2 was also detected in cells in the lamina propria lacking Sus4 expression (Fig 5.2 K,L). These results suggest the divergent expression of FGFR1 into putative postnatal progenitors and FGFR2 into olfactory ensheathing cells, gland and duct-like cells. 5.2.3   FGF signaling regulates E13.5 OE colony number and subtypes Thus, the E13.5 OE contains putative progenitor cells expressing FGF receptors (Fig 5.1) and when cultured in FGF2 under serum-free conditions, forms 3 different semi- adherent colony subtypes -spherical, fusiform and polygonal- (Fig 5.3A; Ch 3), each capable of producing neurons and glia, to varying degrees (Ch 3). I tested how embryonic OE colony production was regulated by FGF signaling. Without FGF2, only rarely were colonies detected, but the total colony number showed a dose-dependent increase with increasing FGF2 concentrations (Fig 5.3B). Colony output in FGF2 supplemented cultures was attenuated significantly (p<0.001) to similar levels (approximately 4-fold) by blocking FGF signaling with either SU5402 (10uM) to block FGFR phosphorylation, or an FGF binding antibody (1.2ug/ml) to block ligand-receptor binding, compared to FGF2 controls (Fig 5.3C). Colony production with FGF signal blockade was higher than without FGF2, suggesting paracrine factors other than FGF may enhance colony formation (Fig 5.3B,C). Vehicle and isotype antibody controls produced similar colony numbers to FGF2 positive controls (Fig 5.3C and data not 130 Figure 5.2 FGFR1,2 expression in P5 OE A,B,E,F) FGFR1 (gray,red) is most intensely expressed in the septal cartilage and cells in the basal OE (arrowhead), and apical OE (arrow) exclusive of β III neuron-specific tubulin + (NST, green). B,F) FGFR1 alone. C,G) FGFR2 (red) is expressed in duct-like cells (arrow) and cells adjacent to axon bundles in the lamina propria. D) FGFR2 alone. H) NST+ axon bundles are surrounded by FGFR2+ cells, which appear to be S100β+ olfactory ensheathing cells. J) The sustentacular and duct cell antigen, SUS4 (green), does not co-label FGFR1+ cells, but nuclear FGFR2 is detected in duct- and gland-like cells (arrow) in the OE and lamina propria. M) Most FGFR1+ cells in the basal OE are dividing (PCNA+, green; arrowhead) and N) co-label with the HBC antigen ICAM-1 (arrowhead). O) ICAM-1 alone. 131 132 Figure 5.3 FGF signaling regulates E13.5 OE colony number and subtypes A single cell suspension of E13.5 OE was cultured in serum-free media supplemented with FGF2, with or without FGF signal blocking, for 10 days, and colony number and subtype counted. A) Pictures of the three colony subtypes produced from E13.5 OE. B) Total colony number at varying concentrations of FGF2 (0-50 ng/ml). More colonies are produced with 50 ng/ml FGF2 compared to no FGF2 (**p<0.001). C) Total colony number is reduced by blocking FGF2 signaling by either blocking phosphorylation of the receptor with 10 um SU5402, or blocking FGF2 from binding to its receptor with an FGF-blocking antibody (1.2 ug/ml; *p<0.001). Vehicle and antibody isotype controls produced similar colony numbers to FGF2. D) Blocking FGF signaling reduces the number of all colony subtypes, but fusiform colonies are the most severely affected (values above bars (C,D) represent the fold reduction in numbers of total and specific colony subtypes when FGF signaling is blocked). E) Colony subtype distributions in FGF with or without signal blocker. F) A subpopulation of cells in colony cores and on their edges can express FGFR1 (red) and nuclear FGFR2 (red). Processes of cells immediately adjacent to colony cores (arrow) and a subpopulation of cells on the core periphery (arrowheads) express FGFR2. Scale bar in F is 50 um. 133 ** *        * 134 shown). FGF signal blockade also altered the absolute number and proportion of each colony subtype with fusiform colonies being the most affected, demonstrating an 11-fold decrease compared to FGF2 with no blockade (Fig 5.3D,E). Each colony subtype appears to continue to produce cells capable of responding to FGF2 when cultured under these conditions, since FGFR1 and FGFR2 can be detected in cells within colony cores and on their periphery (Fig 5.3F; spherical colony shown). These results suggest that FGF signaling contributes to embryonic OE colony number and subtype, and the development of fusiform colonies appears more dependent upon FGF signaling than either spherical or polygonal colonies. 5.2.4   EGF regulates E13.5 OE colony number and subtypes, partly via FGF signaling EGF can also support the growth of embryonic OE colonies (Ch 3), but whether FGF produced in culture contributes to colony output in EGF-supplemented cultures, as it can for SVZ neurospheres (Vescovi et al., 1993), is unknown. Embryonic OE cultures supplemented with EGF +/- SU5402, which specifically blocks phosphorylation of FGF receptors and not EGF receptors (Mohammadi et al., 1997), showed a 1.9-fold reduction in total colony numbers (p<0.01) and altered subtype proportions, when FGF signaling was blocked compared to EGF alone (Fig 5.4A,C). Polygonal colony numbers were similar +/- SU5402, with fusiform colony number reduced the most (5-fold, p<0.001), and spherical colony number reduced by 2-fold (p<0.01, Fig 5.4B). These results suggest that unlike spherical and polygonal colony numbers, fusiform colony number is mostly dependent upon paracrine FGF in EGF treated cultures, and supports the predominant FGF dependence of fusiform colonies seen in FGF2 treated cultures. 5.2.5  FGF signaling increases the number of colonies containing Mash1+ neuronal progenitors Since FGF2 can support neurogenesis via immediate neuronal precursors in embryonic OE explants (DeHamer et al., 1994), I tested if FGF2 could contribute to the production of neuronal progenitors found earlier than immediate neuronal precursors in 135 Figure 5.4 EGF regulates E13.5 OE colony number and subtypes, partly via FGF signaling A single cell suspension of E13.5 OE was cultured in serum-free media supplemented with EGF, with or without FGF signal blocker (10uM SU5402), for 10 days and colony number and subtype counted. A,B) Specifically blocking FGF and not EGF signaling with SU5402, attenuated total and subtype colony numbers in EGF and C) changed the colony subtype distribution, where polygonal colonies were least and fusiform the most reduced. Values above bars (A,B) represent the fold reduction in numbers of total and specific colony subtypes, when FGF signaling is blocked. 136 the ORN lineage, by identifying cells in colony cores and specific colony subtypes expressing the basic helix-loop-helix transcription factor Mash1 (see Fig 5.6A) (Cau et al., 1997; Cau et al., 2002). When cells from the embryonic OE are cultured in either FGF2 or EGF, approximately 60% of all semi-adherent colonies contain at least one cell expressing Mash1 in their core (Fig 5.5A,B; see Fig 5.6A), with fusiform colonies having the highest proportion of colonies containing a Mash1+ cell (75-78%), followed by spherical (62-68%) and polygonal (53-41%; Fig 5.5C,D). Blocking FGF signaling with SU5402 attenuated the number of colonies whose cores contained Mash1+ cells in both EGF and FGF2 treated cultures, 2.9 to 6.2-fold, respectively (p<0.01, p<0.001, respectively, Fig 5.5A,B), suggesting that FGF signaling contributes to neuronal progenitors in both growth factor treatments. Colonies containing a Mash1+ neuronal progenitor were no longer detected in fusiform colonies in FGF2 supplemented cultures when treated with SU5402, and were reduced by 3.3 to 11-fold in spherical and polygonal colonies (p<0.001), respectively (Fig 5.5C). In EGF cultures treated with SU5402, the number of colonies containing a Mash1+ neuronal progenitor were least affected for the polygonal colony subtype, but attenuated about 5-fold in both spherical (p<0.01) and fusiform subtypes (Fig 5.5D). I next quantified the number of Mash1+ neuronal progenitors per colony and in each subtype, seen in Fig 5.6A. The average Mash1+ progenitor number per colony was highest in cultures treated with FGF2 (24.9±4.9, p<0.001) compared to EGF (13.8±1.8), and attenuated by blocking FGF signaling, 6.5 and 2.7-fold in FGF2 (p<0.001) and EGF (p<0.01), respectively (Fig 5.6B). Since Mash1+ progenitors were highest in FGF2 treated cultures, I quantified the number of Mash1+ neuronal progenitors in each colony subtype in cultures treated with FGF2. Fusiform colony cores contained almost 10 times more Mash1+ progenitors (55, p<0.001) compared to either spherical (6.7) or polygonal colonies (5.6). In fusiform colonies, the Mash1+ progenitor number increased with increasing colony size, a trend not seen with other colony subtypes (Fig 5.6C). These results show that the highest neurogenic potential, measured by Mash1+ output, is achieved via FGF signaling, regardless of initial growth factor treatment, and fusiform colonies are the most neurogenic colony subtype. 137 Figure 5.5 FGF signaling increases the number of E13.5 OE colonies containing Mash1+ neuronal progenitors A single cell suspension of E13.5 OE was cultured in serum-free media supplemented with FGF2 or EGF for 10 days and total colony number or colony number having at least one Mash1+ cell in their core were counted. A,B) Blocking FGF signaling with SU5402 reduces the total number of colonies and those containing Mash1+ progenitors when grown in either FGF2 (A) or EGF (B). Blocking FGF signaling in cultures supplemented with either C) FGF or D) EGF reduces the number of all colony subtypes containing Mash1+ cells. Fusiform colonies are the most severely affected since Mash1+ cells were undetected in FGF2 (C; number in brackets) and the most reduced in EGF (D) cultures. Numbers inset in graphs (A-D) represent the fold reduction in numbers of colonies with Mash1+ cells when FGF signaling is blocked. The percentages of each colony subtype containing Mash1+ cells in FGF2 (C) or EGF (D), in the absence of signal blocking, are below the graphs. 138 Figure 5.6 FGF signaling increases the number of Mash1+ neuronal progenitors per colony, especially in the fusiform subtype A single cell suspension of E13.5 OE was cultured in serum-free media supplemented with FGF2 or EGF for 10 days and the number of Mash1+ cells counted per colony core. A) Immunocytochemistry showing each colony subtype contains cells expressing nestin (green) and Mash1 (red, nuclear) to varying degrees. B) The total number of Mash1+ cells per colony is reduced more in FGF2 than EGF when FGF signaling is blocked with SU5402. C) Fusiform colonies contain almost 10 fold more Mash1+ cells than either spherical or polygonal colonies. The larger a fusiform colony, the more Mash1+ cells it contains. Each circle represents a single colony whose size is indicated by color. Red horizontal bar indicates average Mash1+ cells per colony as indicated by numbers below the graph. 139 5.2.6   FGF2 dose dependence of OE neurosphere number and size on collagen I next tested if FGF2 stimulation supported the production of embryonic OE neurospheres. I cultured embryonic OE cells on collagen substrate alone at 0.2-50 ng/ml FGF2 and quantified the resulting total OE neurosphere number and size after 10 days. I found an increase in OE neurosphere numbers and their size with increased FGF2 concentration (Fig 5.7A-C). These results suggest that FGF signaling contributes to non- adherent OE neurosphere production and size of OE neurospheres. I tested this further by blocking FGF signaling with SU5402 and an antibody that binds FGF ligands. In the FGF signal blocking experiments, greater than 96% of all embryonic OE colonies detected were non-adherent OE neurospheres and not semi-adherent colonies, similar to FGF2 treatments. Both FGF2 alone and antibody isotype controls (with FGF2) produced similar OE neurosphere numbers and sizes (Fig 5.8A-C). In contrast, FGF- blocking antibodies reduced both the number (p<0.01 to 0.001; Fig 5.8A) and sizes of OE neurospheres in a dose-dependent manner (Fig 5.8B,C). OE neurosphere number was similarly reduced by omission of FGF2 or using SU5402 to block FGF signaling, whereas no difference in colony numbers was seen when FGF2 was compared to vehicle controls (p<0.001, Fig 5.8D). These results suggest that FGF signaling contributes to the production and size of embryonic OE non-adherent neurospheres. 5.2.7  In vitro paracrine factors support colony production in absence of exogenous growth factors I previously observed that increasing the density of embryonic OE cells in cultures plated onto mixed collagen and laminin substrates, produced increased numbers, sizes and altered subtype proportions of resulting semi-adherent colonies (Ch 3). In addition, the reduction of semi-adherent colonies and Mash1+ neuronal progenitors when FGF signaling was blocked in EGF treated cultures (Fig 5.4-5.6), suggested paracrine factor contributions to colony number and size. To test if paracrine factors contribute to embryonic OE non-adherent neurosphere production, conditioned media (CM) was 140 Figure 5.7 FGF2 dose dependence of OE neurosphere number and size on collagen A single cell suspension of E13.5 OE was cultured in FGF2-supplemented serum-free media on collagen substrate and grown for 10 days before counting the total number and sizes of OE neurospheres. (A) Pictures, (B) total numbers and (C) sizes of OE neurospheres seen in cultures supplemented with 0.2-50 ng/ml FGF2. 141 Figure 5.8 OE neurosphere number and size are regulated by FGF signaling A single cell suspension of E13.5 OE was cultured in FGF2-supplemented serum-free media on collagen substrate and grown for 10 days before counting the total number and sizes of OE neurospheres. (A) Total OE neurosphere number (pictured in B) and (C) size are reduced by low FGF2 concentrations (0.2 ng/ml) and blocking FGF signaling, with antibodies that bind FGF, in a dose dependent manner. (D) OE neurospheres are rarely detected in the absence of growth factor (GF) or when FGF signaling is blocked by SU5402, even though vehicle controls (or (A,C) antibody isotype controls) produce similar outputs to FGF2 alone. 142 collected from FGF2 treated, collagen plus laminin substrate cultures, plated with or without embryonic OE cells, after 24, 48 hours and 10 days (Fig 5.9A). CM derived in the absence of OE cells contains residual FGF2 (CM1), while CM derived from cultures containing OE cells is comprised of paracrine factors produced in culture together with residual FGF2 (CM2). New primary cultures of embryonic OE, without freshly added FGF2, were used to test each CM for their capacity to support colony outgrowth and determine a specific time point for further testing (Fig 5.9A). All CM tested were able to support non-adherent OE neurosphere production on collagen alone, but the number of neurospheres produced was decreased compared to fresh FGF2 controls (pos), and further decreased with latent timing of CM harvest (Fig 5.9C). At each timepoint, the number of colonies produced in CM was similar for CM1 (FGF2) and CM2 (FGF2 + paracrine factors), and indicates that bioactive FGF2 is still found in culture after 10 days (Fig 5.9C). These results suggest that residual FGF2 alone is sufficient for colony production, without the necessity of paracrine factors (Fig 5.9C). To test if FGFs are necessary and if paracrine factors produced by embryonic OE cells in vitro are sufficient to support non-adherent neurosphere formation, I tested for colony production from new primary OE cultures supplemented with 10 day-CM2 (FGF2 + paracrine factors) and treated with FGF-binding antibodies to block FGF signaling (Fig 5.9B). After 10 days, OE neurospheres were detected in the FGF antibody-treated culture, but they were significantly fewer in number compared to 10 day-CM2 without antibodies (*p<0.001; Fig 5.9C). These results suggest that FGF2 is sufficient but not necessary for the production of embryonic OE non-adherent neurospheres and that embryonic OE cells produce colony-supporting paracrine factors other than FGFs when cultured in FGF2. 5.2.8   OE neurospheres express progenitor and neuronal markers To better understand the neurogenic potential of OE neurospheres, I tested for the expression of transcription factors indicative of neuronal and non-neuronal progenitor subtypes from pooled OE neurospheres grown in FGF2, after 10 days (Fig 5.10A). OE 143 Figure 5.9 In vitro paracrine factors support spherical colony production in absence of exogenous growth factors A,B) Experimental outline for conditioned media (CM) production and testing of colony supporting capacity. See text for details C) After 24, 48 hours and 10 days, conditioned media was collected from collagen/laminin substrate cultures produced by FGF2 in media, in the absence of embryonic OE cells (CM1 FGF2), or FGF2 in media plus embryonic OE cells (CM2 FGF2 + paracrine factors), whose capacity to support colony production was tested on fresh primary cultures grown on collagen alone. Compared to the positive control (pos) containing fresh FGF2, colony production with CM in the absence of freshly added FGF2, is decreased at all times tested, but indicates bioactive FGF2 is still found in cultures after 10 days. When FGF antibodies are added to CM2 FGF2 + paracrine factors, to block FGF ligand-receptor binding, OE neurosphere production is supported, but decreased. 144 Figure 5.10 OE neurospheres express neuronal and non-neuronal progenitor markers A) A single cell suspension of E13.5 OE was cultured in FGF2-supplemented serum-free media on collagen substrate and grown for 10 days forming OE neurospheres. B) Pooled OE neurospheres express transcripts for the transcription factors Mash1, associated with neuronal progenitors and Pax6, associated with non-neuronal basal and sustentacular cells, identified using RT-PCR. C) Immunocytochemistry performed after transferring 10 day OE neurospheres onto collagen and laminin substrates shows the majority of cells in OE neurospheres express nestin (green) and are enriched for NST (red) neurons. Size bars are 50 um. 145 neurospheres express the neuronal progenitor marker Mash1 (Cau et al., 1997) and Pax6, associated with basal progenitors and sustentacular cells, specialized OE glia (Fig 5.10B) (Davis and Reed, 1996). Immunocytochemistry on individual OE neurospheres showed that the majority of cells express nestin and are highly enriched for NST+ neurons (Fig 5.10C). Thus, OE neurospheres are highly neurogenic and express a variety of neuronal and non-neuronal progenitor antigens. 5.2.9   FGF2 increases neurogenesis via a nestin+ progenitor Since OE neurospheres were highly enriched for nestin+ progenitors and NST+ neurons, I next determined if FGF signaling contributed to embryonic OE neurogenesis by increasing proliferation of nestin+ progenitors. E13.5 OE was plated into FGF2 supplemented cultures and grown for 7 days before adding BrdU, to identify cells undergoing DNA synthesis, with SU5402 in half of the cultures, to block FGF signaling. After one day (the 8th day), OE neurospheres were transferred to adhesive substrates (collagen with laminin) and fixed for immunocytochemistry to assess the percentage of nestin+ cells that had divided since the addition of BrdU. As previously seen, the majority of cells in individual OE neurospheres expressed nestin, a subpopulation of which BrdU was detected in their cell nuclei (Fig 5.11 A). When quantified, the percentage of nestin+ cells that were BrdU+ was significantly attenuated after FGF signaling was blocked during culture days 7-8, from 63 +/- 1.5% (1553 total cells counted) to 29 +/- 0.7% (4839 total cells counted; Fig 5.11B; p<0.001). To test the effects of FGF signaling on progenitor differentiation, BrdU was added to FGF2 treated cultures after 7 days and processed for immunocytochemistry after 3 more days (the 10th day), to allow for the differentiation of recently divided neuronal progenitors. The percentage of NST+ ORNs that were BrdU+ was 35 +/- 2.5% (338 NST+ cells counted) in FGF2 cultures, but was decreased to 17 +/- 3.7% (344 NST+ cells counted) with FGF signal blockade (Fig 5.11C,D). Since most, if not all, cells in OE neurospheres are nestin+, these results suggest that FGF2 acts directly on nestin+ progenitors to enhance OE neurogenesis. 146 Figure 5.11 FGF signaling increases Nestin progenitor proliferation and differentiation A single cell suspension of E13.5 OE was cultured in FGF2-supplemented serum-free media on collagen substrate and grown for 7 days before adding BrdU +/- SU5402. Subsequently, after 1 day (8th day) or 3 days (10th day), non-adherent OE neurospheres were transferred to collagen/laminin substrates and fixed for immunocytochemistry. A,B) Most cells in colonies express nestin (red) by the 8th day, but the proportion that co-label with nestin and BrdU (green, nuclear; arrowheads) is significantly decreased by blocking FGF signaling (878 to 1335 total BrdU+ cells counted without and with SU5402, respectively; 3 experiments). C,D) Similarly, by the 10th day, the percentage of newly divided neurons, BrdU+ NST+ (red), is decreased by blocking FGF signaling (338-344 total NST+ ORNs counted without and with SU5402, respectively; 3 experiments). Blue nuclei are stained with DAPI. Scale bars are 50 um. 147 5.3   Discussion Using in vitro assays to readout colonies derived from embryonic OE progenitors, I provide evidence that FGF signaling contributes to neurogenesis via Mash1+ neuronal progenitors and the proliferation and differentiation of nestin+ progenitors (Figs 5.5,5.6,5.10,5.11). I have identified individual components of ECM that can support nestin+ and Mash1+ progenitor production in OE neurospheres (Figs 5.7,5.10,5.11) and show that factors produced by FGF2-stimulated embryonic OE cells in vitro can support OE neurosphere growth without exogenously added factors (Fig 5.9). Previous studies showed that when FGF2 was added to OE explants it increased the proliferation of immediate neuronal precursors before they produced neurons, and attributed their results to FGF signaling (DeHamer et al.). But in the absence of FGF signal blockade, it is difficult to distinguish between the contributions of FGF signaling from those arising due to explant-derived paracrine factors. During my experiments, I blocked FGF signal transduction using 2 independent approaches, to ensure the specificity of FGF signal blockade and to test the efficacy using each method. SU5402 specifically blocks the phosphorylation of FGFRs without affecting the phosphorylation of EGFRs (Mohammadi et al., 1997) and has been used to effectively block FGF signaling in multiple cell types including neural and human ES cells (Delaune et al., 2005; Bendall et al., 2007). I also used an antibody that binds FGFs and thus prevents the ligand from binding to its receptor. The results were similar regardless of the approach used to block FGF signaling, demonstrating the specificity of the FGF signal blockade. The efficacy of my FGF signal blockades were evident since, compared to FGF2-treated controls, up to a 99% reduction in colony number could be achieved by adding FGF blockers (Figs 5.3, 5.8). SU5402 cultured in media for 10 days still retained its ability to block colony production when tested in fresh primary cultures supplemented with 20 ng/ml FGF2, showing SU5402 has a previously unknown efficacy, at the concentration tested, lasting several days. I found that FGF2 regulates the production of semi-adherent colonies and non- adherent OE neurospheres, whose number, subtype and proportion of cell types 148 produced can be altered by blocking FGF signaling, either with or without EGF (Figs 5.3- 5.6, 5.7-5.11). Because embryonic OE nestin+ proliferating progenitors express FGFR1,2 in vivo and in vitro, and are presumably FGF responsive, and OE semi- and non-adherent colonies are enriched for mitotic nestin+ lineage-negative cells, as early as 2.5 hours in culture (Ch 3), proliferating nestin-expressing cells are potential candidates for colony-initiating cells. Identification of colony-initiating cells awaits the prospective isolation and subsequent successful culture of potential candidates. FGF2 is sufficient but not necessary for the production of Mash1+ neuronal progenitor cells from semi-adherent colonies, since blocking FGF signaling in FGF2 or EGF treated cultures attenuates, but still supports the production of Mash1+ cells. However FGF2, compared to EGF, produces the most Mash1+ progenitors per colony, which are 10 times more enriched in fusiform colonies than spherical or polygonal. Accordingly, Mash1+ neuronal progenitors were not detected in fusiform colonies after FGF signal blockade, since they are the most FGF-sensitive colony subtype. FGF2 combined with BMP inhibition maintains human embryonic stem cells (hESCs) in an undifferentiated state (Xu et al., 2005) and may act similarly in the OE. FGF signaling together with BMP inhibition could stabilize Mash1 in ORN precursors, thus deterring Mash1 proteolysis and opposing Mash1 degradation by BMPs (Shou et al., 1999). That EGF cultures showed reduced colony numbers and altered subtypes when treated with FGF signal blockers suggests paracrine effects of culture and the possibility that EGF induces FGF production in vitro, as it does in the CNS (Kuhn et al., 1997). Enzyme linked immunosorbent assays (ELISAs) for the detection of FGFs would help to support this hypothesis. Paracrine effects beyond FGFs are likely since colonies are produced in fresh primary cultures supported only by conditioned media derived from 10 day FGF2-supplemented semi-adherent cultures, and treated with antibodies to block FGF signaling. Members of the TGF-β superfamily are potential candidates, since they and their receptors are expressed in the developing OE and in embryonic OE explants, BMPs have been shown to modulate neuron and neuronal precursor numbers, dependent upon the ligand, its concentration and the cell type acted upon (Shou et al., 1999; Shou et al., 2000) (Mahanthappa and Schwarting, 1993). Studies from the same lab as Shou, found that using their in vitro colony assay, colonies containing neurons 149 produced from embryonic OE, are dependent upon co-culturing on embryonic OE stroma (Mumm et al., 1996), conditioned media from which can augment neuronal colony numbers, with or without exogenously added factors (Mumm et al., 1996; Shou et al., 2000). Together these results suggest that the embryonic OE produces paracrine factors that can support neurogenesis. Using collagen together with laminin as substrata, I detected semi-adherent colonies from the embryonic OE (Ch 3,4). All embryonic OE colony cores contain mitotic nestin+ cells (Ch 3), cells expressing FGFRs and Mash1+ neuronal progenitors, but their differing proportions of antigen-expressing cells combined with their varying frequencies in relation to growth factor responsiveness, makes each distinct. Fusiform colonies contain the highest number of Mash1+ neuronal precursors, and are likely to contain a high proportion of neuronal transit-amplifying cells because of their high proliferative capacity and lack of self-renewal (passaging) (Fig 5.6; Ch 3,4). Colony production, and the production of mitotic bipolar Nestin+ and Mash1+ cells is enhanced by FGF signaling, in both FGF2 and EGF-stimulated cultures, a signal transduction pathway known to regulate neurogenesis in both the CNS (Vescovi et al., 1993; Bartlett et al., 1995; Reuss and von Bohlen und Halbach, 2003) and OE (DeHamer et al., 1994; Kawauchi et al., 2004; Kawauchi et al., 2005). Polygonal colonies are primarily EGF-responsive and the least affected by FGF signal inhibition, and contain the fewest neurons and Mash1+ progenitors (Fig 5.6; Ch 3). They are similar in morphology and growth factor responsiveness to P5 OE ICAM-1+ adherent colonies, most of which are predominantly gliogenic (expressing S100β or GFAP) under the conditions used here (Carter et al., 2004). Spherical colonies appear to be neuro-gliogenic. Their frequency is similar in either EGF or FGF2, their cores contain glia, neurons and Mash1+ neuronal progenitors, which are attenuated, as are spherical colonies themselves, with FGF signal inhibition. Thus spherical colonies may represent a population of more primitive embryonic bipotent OE progenitors, largely undetected in the adult. Colonies with a non-adherent phenotype (OE neurospheres) were most highly enriched by changing the ECM from mixed collagen with laminin, to collagen alone (Ch 4). OE neurospheres are highly enriched in nestin+ proliferating progenitors, and 150 immature neurons, express progenitor markers Mash1 and Pax6, and can expand when passaged from primary to secondary cultures when grown in FGF2 (Ch4), unlike semi- adherent colonies. OE neurospheres are more FGF2 than EGF responsive, since they increase their number and size with increasing FGF2 concentrations, and this effect is dose-dependently attenuated by blocking FGF signaling. The relationship between semi-adherent and non-adherent OE neurospheres is unclear, but they are likely derived from nestin+ cells that require collagen together with laminin to adhere. Cells contributing to the formation of both semi-adherent colonies and OE neurospheres are responsive to FGF2 and EGF, contain mitotic nestin+ cells, and contain Mash1 expressing cells. Both semi-adherent colonies and OE neurospheres can produce neurons and glia, with the first cells detected after 2.5 hours in vitro on collagen and laminin being nestin+ mitotic cells (Ch 3). Nestin+ precursors of these colony/sphere types may represent lineally related clones at different states of induction, with OE neurospheres being less committed to differentiation than semi-adherent colony precursors because of their increased frequency and self-renewal capacity. Adherent or non-adherent colony precursors may be located within different apical/basal or zonal regions of the embryonic OE, as suggested by the restricted expression of transcription factors identifying neural progenitors (Davis and Reed, 1996; Cau et al., 2000; Cau et al., 2002; Hirota and Mombaerts, 2004; Kolterud et al., 2004; Theriault et al., 2005), and since levels of FGFR expression, that can affect cellular responsiveness, are not homogeneous throughout the OE. Additionally, because ECM components are known to regulate stem/progenitor proliferation, self-renewal and differentiation in neural and non- neural tissues (Spradling et al., 2001; Mercier et al., 2002; Doetsch, 2003; Campos, 2004; Li and Xie, 2005; Kerever et al., 2007), the differential response to collagen and laminin in vitro may reflect subtle microenvironments found, but presently unappreciated, in vivo. However, when primary embryonic OE neurospheres were dissociated and replated onto collagen and laminin after 10 days, they did not produce semi-adherent colonies (data not shown). Since most, if not all, cells in OE neurospheres after 8-10 days are nestin+, FGF2 likely acts directly on nestin+ progenitors to increase their proliferation and differentiation into NST+ neurons (Fig 5.11). FGF2 does not act by changing progenitor 151 survival or cell fate because the proportion of nestin+ progenitors that form ORNs by 10 days is similar (56-59%), even with FGF signal blockade (Fig 5.11 and data not shown). Since virtually all cells in OE neurospheres express nestin, and a subpopulation express FGFR1 or FGFR2, I provide the first in vitro evidence for the identification of an FGF- responsive nestin+ neuronal progenitor. In this chapter, I provide evidence that FGF signaling regulates the size, colony and progenitor subtypes comprising semi-adherent colonies or non-adherent OE neurospheres. I have demonstrated the direct action of FGF2 on nestin+ progenitors that govern OE neurogenesis, which likely represent the earliest embryonic OE progenitor identified to date. 152 CHAPTER 6       DISCUSSION Figure 6.1 was published in Murdoch, B and Roskams, AJ (2007) OE progenitors: insights from transgenic mice and in vitro biology; Journal of Molecular Histology 39(6): 581-99. 6.1   Summary of results and conclusions Neurogenesis was once thought to occur only during mammalian nervous system development and not in the adult (Gage et al., 1998; Doetsch et al., 1999b; Alvarez- Buylla et al., 2002; Garcia et al., 2004; Sohur et al., 2006). We now know that adult neurogenesis occurs in specialized niches in the brain and olfactory epithelium, where cell replacement occurs to varying degrees, but is dependent upon the biological responses of stem and/or progenitor cells (Spradling et al., 2001; Doetsch, 2003; Ninkovic and Gotz, 2007). Because in vitro functional assays and markers used to identify stem cells, also readout and label non-stem cells, the identification of an individual cell as representing a neural stem cell remains ambiguous (Weiss et al., 1996a; Weiss and van der Kooy, 1998; Weissman et al., 2001; Brazel et al., 2005; Louis et al., 2008). Adult neural progenitors are thought to resemble those found in the embryo and respond to similar molecular factors, thus providing the rationale for studying the regulation and identity of embryonic progenitors (Gotz et al., 2005). A better understanding of the biology of neural precursors will allow one to molecularly direct the differentiation of specific cell types, maintain and expand their precursors, and recruit endogenous progenitors upon demand (Morrison, 2001; Doetsch, 2003; Gotz et al., 2005). The olfactory epithelium provides a simplistic neural system to study neural stem/progenitor cells and neural development, which undergoes lifelong neurogenesis (Schwob, 2002; Murdoch and Roskams, 2007). In my thesis I sought to identify OE embryonic progenitors, test their lineage potential, and determine how FGF signaling regulates neurogenesis via Nestin+ neuronal progenitors. In so doing, I tested the following hypotheses in 3 Aims: 153 Aim 1. Test for radial glial-like progenitors in the embryonic OE and fate map their progeny. I hypothesize that the embryonic OE contains radial glial-like progenitors that can contribute to olfactory neurogenesis. The embryonic OE contains nestin-expressing progenitors with morphological and antigenic characteristics similar to, but distinct from CNS radial glia. Nestin-expressing radial glial-like cells in the OE appear to have a progenitor phenotype since they are located in known embryonic progenitor regions, are highly proliferative (PCNA+) and lack antigens associated with differentiated cells (lineage-negative). Radial glial-like progenitors expressing nestin are not detected in the adult OE, and are less frequent in the P5 OE compared to the embryonic OE, suggesting they are lost postnatally, like their CNS counterparts. Colonies formed after 10 days from embryonic OE contain within their cores mitotic nestin+ cells, neurons and glia, to varying degrees dependent upon the growth factor and colony subtype, and whose first detectable cells are enriched for dividing nestin+ cells. Lineage tracing of nestin-expressing precursors showed only a subpopulation activates a nestin transgene and produces progeny restricted to the neuronal lineage (in vivo and in vitro), at least some of which arise through Mash1+ progenitors. Multiple transgenic mouse lines confirmed these results and helped to rule out potential transgenic silencing events in the OE. Expression of GFP in Nestin-GFP transgenic mice supported the regional expression pattern and lineage restriction seen in Nestin-cre/reporter mice. Additionally Nestin-GFP mice had an increased frequency of cells in the OE that expressed endogenous nestin and GFP or Mash1 and GFP, confirming these same events that were detected rarely in the OE of Nestin-cre/ZEGs. In contrast, lineage tracing using BLBP-cre/ROSA mice showed that BLBP- expressing precursors were restricted to the olfactory glial lineage, contrary to their neurogenic fate in the CNS (Anthony et al., 2004). Unlike other radial glial antigens, BLBP was not detected in the OE, but instead in the lamina propria in S100β+ olfactory ensheathing cells surrounding axon bundles, in the olfactory nerve and in vitro in cells having a morphological and antigenic profile consistent with olfactory glia. Collectively these data support the glial fate restriction of BLBP-expressing precursors in the OE and its divergent role from CNS radial glia. 154 BLBP has only recently been identified as a marker for OECs (Carson et al., 2006) and its contribution to the OEC lineage, determined using BLBP-cre/ROSA mice, is novel. The BLBP contribution to the OEC lineage has been confirmed by others using BLBP-GFP transgenic mice (Gong et al., 2003). Contrary to this, in the CNS, BLBP is detected in radial glia, whose lineage, determined using the same BLBP-cre/ROSA mice, is restricted to neurons (Anthony et al., 2004). Thus factors other than, and together with, BLBP must dictate the distinct lineage restrictions seen in olfactory and CNS precursors. Nestin has been well established as a stem cell marker in the CNS (although not exclusive to CNS stem cells) (Lendahl et al., 1990; Reynolds et al., 1996), but has not been previously detected in olfactory progenitors at any ontogenic stage. The sustentacular end feet of adult rat cells in vivo, purified lamina propria-derived olfactory ensheathing cells, basal cell lines and OE-derived neurospheres in vitro, have all been reported to express nestin (Doyle et al., 2001; Au and Roskams, 2003; Zhang et al., 2004). Thus, for the first time and outside of the CNS, my results support the hypothesis that the embryonic OE contains a radial glial-like progenitor. If nestin identified a stem cell in the OE, as it can in the CNS (Lendahl et al., 1990; Reynolds et al., 1996), one would expect that it could produce both neuronal and glial progeny. But, contrary to this, the progeny of Nestin-cre transgene-activating cells appeared restricted to the neuronal lineage, forming only a subpopulation of all olfactory receptor neurons detected in the dorsal-medial OE. The detection of Mash1 with GFP in Nestin-GFP mice, of nestin and Mash1 in cells from adherent colonies and OE neurospheres (Ch 5), and detection of nestin+ cells before Mash1+ cells in vitro (Ch 3), suggests that nestin+ progenitors precede Mash1 in the neuronal lineage. Collectively, my data suggest that nestin-expressing progenitors may represent the earliest OE neuronal progenitor identified to date. OE cells cultured from E13.5 Nestin-cre/ZEG embryos produce GFP+ colonies together with GFP-negative colonies, with all colony subtypes represented in each GFP+/- group. GFP+ colonies produced GFP+/nestin+ cells and GFP+/NST+ neurons, but not GFP+ glia, and were enriched in fusiform colonies, the most neurogenic, simulating their in vivo phenotype. In contrast, GFP-negative colonies were enriched for 155 spherical (neurogliogenic) colonies, but none of the GFP-negative colony subtypes contained GFP+ cells. GFP-negative colonies may represent the products of nestin- transgene non-activating progenitors, indicative of GFP-negative OE progenitors in vivo. Since such a low proportion of the E13.5 OE expresses OCAM in vivo (identifying zones 2-4), and GFP+ progenitors from zone 1 are enriched in vitro, this suggests that zone 1, where nestin transgene-activation occurs, may be patterned prior to zones 2-4 in the E13.5 OE. Furthermore, the progenitors driving neurogenesis in zone 1 are distinguished from those in other regions by their activation of the nestin transgene, even though nestin is expressed throughout the embryonic OE. These results suggest that neither neuronal progenitors themselves, nor the temporal and spatial induction of neurogenesis in the embryonic OE are homogeneous and reveals that the development of the embryonic OE is more complex than previously appreciated. Aim 2. Does OE progenitor frequency and function change during embryonic, postnatal and adult ontogeny?  I hypothesize that OE progenitor frequency, neurogenesis and self-renewal, when assayed under similar conditions using in vitro neurosphere assays, will decrease with aging. Under the same culture conditions used to grow and expand neurospheres from the CNS SVZ (Reynolds and Weiss, 1992), postnatal day 5 (P5) and adult OE progenitors produced adherent colonies together with non-adherent spheres, whose frequencies decreased in the adult. Neurons and glial cells were found in both adult and postnatal primary spheres and colonies. Adult primary cultures did not passage, but P5 cultures showed limited self-renewal potential with sphere and colony formation in secondary but not tertiary passage. E13.5 OE forms clonal semi-adherent colonies distinct from postnatal and adult colonies, of three morphologies, each of which produce neurons and glia to varying degrees. Primary E13.5 OE continues to produce neurons and glia beyond tertiary passage and over extended periods of culture, even though fusiform colonies, the most neurogenic, are not detected after primary culture. 156 The proportion of proliferating progenitors in vivo declines from embryonic to adult developmental stages, and is paralleled by a progressive decrease in colony forming ability and passaging capacity in vitro. Hence, with equal cell inputs, adult OE cells produce the fewest number of colonies and have the least passaging capacity; adult < P5 < E13.5 OE. The postnatal day 5 and adult OE adherent colonies described here are similar to those detected previously from the perinatal or adult OE (Newman et al., 2000; Carter et al., 2004), together with non-adherent spheres. Postnatal sphere formation, with varying self-renewal and differentiative capacities, has been reported previously in the dentate gyrus, skin and after several weeks of culture, human OE (Roisen et al., 2001; Toma et al., 2001; Seaberg and van der Kooy, 2002). Using serum-free cultures with FGF2 and/or EGF, together with conditions to avoid cell attachment, non-adherent spheres, without adherent colonies, have recently been detected in the postnatal day 0-3 OE (Barraud et al., 2007). Unlike my P5 spheres, the Barraud (2007) spheres were unable to passage, but the cells detected in primary spheres (after adhesion and differentiation on collagen and laminin substrates) included basal cells, neurons and glia, similar to those shown here (Barraud et al., 2007). Comparisons between my P5 OE spheres and adherent colonies and P0-P3 OE spheres in the Barraud study are difficult, because the frequency of the Barraud 2007 spheres was not reported and each study used different methods to isolate and culture the postnatal OE cells. In contrast, E13.5 OE forms semi-adherent colonies, of three distinct morphologies, under the same culture conditions used for postnatal OE. A previously reported embryonic OE colony assay, first enriched for neuronal progenitors prior to plating, required feeder layers derived from the leftover cells to support four morphologically defined colony subytpes, where only one colony subtype was capable of producing neurons (Mumm et al., 1996; Shou et al., 2000). In the assay I used, the colony morphologies appear completely different from those of Mumm et al (1996), and neuron production, together with glial cell production (not tested in Mumm 1996), arise from each colony subtype. Assuming single cells initiated colonies in both assays, bipotent neuroglial progenitors can be detected in the in vitro assay presented here, with 157 neuron-restricted progenitors in Mumm’s (1996). These distinctions likely reflect the differing in vitro conditions used to assay embryonic OE progenitors. These differences aside, the OE embryonic progenitor assay described here, is the first demonstration of the production of self-organizing embryonic OE colonies with defined culture conditions, in the absence of feeder layers. The OE progenitor frequencies reported here may be enhanced by culture conditions optimized specifically for olfactory progenitors. Others have enhanced OE colony production using various growth factors and concentrations, or conditioned media derived from, or co-culturing with, OE stroma (DeHamer et al., 1994; Newman et al., 2000; Shou et al., 2000; Wu et al., 2003). The reduced colony production detected using CM from postnatal OECs is likely due to the presence of combinations of secreted ECM molecules that may maintain OE progenitor quiescence (Chuah and West, 2002; Vincent et al., 2005). Consistent with my results, collagen types I,IV and laminin, when used independently as substrata for embryonic olfactory neurons and their precursors, demonstrated weak adhesion (Calof and Lander, 1991), suggesting that collagen or laminin alone, can shift the balance to a more anti-adhesive phenotype.  Using either collagen or laminin alone as substrates, I enriched for embryonic colonies with a non- adherent phenotype that appeared similar to CNS neurospheres. Collagen- and laminin- responsive cells signal via β1 integrins (Leitinger and Hohenester, 2007). β1 integrins can identify neural stem/progenitor cells, select for in vitro stem cell activity (Campos et al., 2004), and have been detected on postnatal olfactory progenitors in vivo and in vitro (Carter et al., 2004; Barraud et al., 2007). Moreover, ECM constituents have been shown to regulate stem cell proliferation and differentiation via integrins in a variety of tissues (Spradling et al., 2001; Doetsch, 2003; Campos, 2004; Carter et al., 2004; Li and Xie, 2005; Xie et al., 2005). The mechanism behind the non-adherent phenotype seen with either collagen or laminin is unclear, but nonetheless represents a unique finding in embryonic OE progenitor biology. 158 Aim 3. Test how embryonic OE nestin+ progenitors are regulated by FGF signaling. I hypothesize that FGF signaling will enhance neurogenesis by increasing nestin+ progenitor proliferation leading to increased ORNs. The E13.5 OE contains putative nestin+ progenitors that express FGFR 1,2 and forms colonies in vitro in an FGF2 dose-dependent manner, that is decreased by blocking FGF signaling, using 2 independent methods. Of the three embryonic colony subtypes, the numbers of polygonal colonies (more gliogenic) are least affected by blocking FGF signaling, and fusiform  (more neurogenic) the most affected, even when stimulated by EGF, suggesting FGF paracrine effects in culture. Similarly, the number of colonies containing at least one Mash1+ neuronal progenitor is decreased by FGF signal blockade and affects Mash1-containing fusiform colonies the most. Overall, blocking FGF signaling in either FGF2 or EGF stimulated cultures decreases the number of Mash1+ cells per colony, and in turn their neurogenic potential. Fusiform colonies grown in FGF2 are the most neurogenic and produce about 10 times more Mash1+ cells than are present in either spherical or polygonal colonies. Thus, decreasing FGF signaling decreases the likelihood of any colony producing Mash1+ cells. Non-adherent OE spheres, termed OE neurospheres, because of their similarities to CNS neurospheres, where enriched using collagen instead of collagen/laminin substrates and expanded upon passaging, unlike E13.5 OE semi-adherent colonies. The number of OE neurospheres and their size was enhanced by FGF signaling in a dose- dependent manner, and decreased with FGF inhibition. After 10 days, transcripts from pooled OE neurospheres include neuronal (Mash1) and non-neuronal (Pax6) progenitor markers, and most cells in individual spheres express nestin and are enriched in NST+ neurons. FGF signaling increases neurogenesis in OE neurospheres by increasing the proliferation of nestin+ progenitors leading to increased ORNs. These results provide evidence for the role of FGF signaling on OE neurogenesis by increasing Mash1+ neuronal cells in specific colony subtypes and place nestin+ progenitors in the ORN lineage, together with, or as precursors to, Mash1+ neuronal cells. It is difficult to determine if FGF2 acts directly on colony-initiating cells, since their identity is currently unknown. FGF2 likely acts on the OE progenitors since OE 159 neurosphere/colony number and size is dose-dependently regulated by FGF signaling. Previous studies used OE explants to determine that FGF2 acted to increase the divisions from 1 to 2 times prior to ORN differentiation in immediate neuronal precursors and increased the proliferation of a small proportion of unidentified cells, presumed to be OE stem cells (DeHamer et al., 1994). The direct action of FGF2 remains unclear in the Dehamer experiments however, since the proliferating cells were not antigenically identified and explant-derived paracrine factors could modulate the results. I detected paracrine factors capable of supporting colony production (as have others) (Mumm et al., 1996; Shou et al., 2000), by blocking FGF signaling in EGF treated cultures and by using conditioned media taken from embryonic semi-adherent colonies to grow fresh OE primary cultures without exogenously added growth factors. Thus, to delineate the precise role of FGF signaling on OE progenitors and neurogenesis, and control for paracrine effects, it is critical to include loss of function experiments. Additionally, I tried to identify the FGF-responsive progenitors using nestin and Mash1 immunoreactivity at various times in culture and found cells in vivo that expressed both nestin and Mash1. My results provide the first evidence that FGF2 can act directly on nestin+ OE progenitors, since most cells in OE neurospheres appear to express nestin, and blocking FGF signaling from days 7-8 decreases the proportion of proliferating (BrdU+) nestin+ progenitors and their ORN production. Additionally, most nestin+ cells in the embryonic OE are dividing, and FGFR1 and FGFR2 are detected on nestin+ cells in vivo. That OE neurospheres comprised of mostly nestin+ cells express transcription factors associated with neuronal and non-neuronal progenitors, like Mash1 and Pax6, suggests heterogeneity amongst nestin+ progenitors that is reminiscent of my lineage tracing results with Nestin-cre/reporter mice. Most cells in OE neurospheres express nestin, and at least some express the neuronal progenitor marker Mash1. This in vitro data is consistent with the co-expression of GFP and nestin in the same cells in Nestin-GFP transgenic mice and suggests that FGF2 stimulated OE neurogenesis likely proceeds via a nestin+ Mash1+ progenitor. Moreover, because Nestin-GFP transgenic mice have GFP+ cells with the morphology of ORNs that no longer express nestin, ORN differentiation via Mash1+ progenitors likely occurs after down regulation of nestin. Semi-adherent colonies support this lineage 160 model, especially fusiform, since they are highly enriched in nestin+ Mash1+ progenitors, are the most neurogenic and FGF-responsive, but fail to self-renew upon secondary passage. Collectively my results suggest that in the embryonic OE nestin identifies a novel progenitor, which proliferates in response to FGF2, leading to the production of ORNs. ORN production likely proceeds via a Mash1+ progenitor, making nestin FGF2- responsive progenitors probably the earliest OE progenitors detected to date. 6.2   Future directions 6.2.1   Model of embryonic and postnatal neurogliogenesis From the Nestin- and BLBP-cre transgenic mice data, together with my in vitro progenitor studies, we can begin to construct models of embryonic and postnatal neurogliogenesis. The embryonic OE contains mitotic nestin expressing progenitors that span the height of the OE and bear resemblance to CNS radial glia. Nestin transgene- activating precursors, representing a subset of embryonic nestin+ progenitors, give rise to a subpopulation of regionally restricted neuronal progeny that proceed via a Mash1+ progenitor lineage (Fig 6.1). Contrary to this, BLBP expression is restricted to the olfactory glial lineage, and is found in immature olfactory ensheathing cells (Murdoch and Roskams, 2007). Radial glial-like nestin-expressing progenitors are largely undetected in the postnatal OE, where the most multipotent cells, a subset of HBCs, contributes to GBCs, neuronal, glial and sustentacular lineages in vivo and/or in vitro (Carter et al., 2004; Leung et al., 2007; Murdoch and Roskams, 2007; Iwai et al., 2008). Evidence of BLBP transgene activation is restricted to glial progeny in axon bundles of the lamina propria and in the olfactory nerve around the olfactory bulb (Murdoch and Roskams, 2007). This provides evidence for the regional development of the embryonic OE through the contribution of previously unappreciated novel nestin+ and BLBP+ progenitor subtypes and their segregation into neuronal and glial lineages, respectively. Why don’t all nestin+ cells in the embryonic OE activate the nestin transgene? Although the nestin second intron enhancer is commonly used to drive CNS nestin expression, and is required for CNS-specific expression, it is not sufficient for full 161 Figure 6.1 Model of embryonic and postnatal neurogliogenesis The embryonic OE contains mitotic nestin expressing radial glial-like progenitors (RGLP) that span the height of the OE and bear resemblance to CNS radial glia. Nestin transgene- activating (Tg+) precursors, representing a subset of embryonic nestin+ progenitors, give rise to a subpopulation of regionally restricted neuronal progeny that proceed via a Mash1+ progenitor lineage. Contrary to this, BLBP expression is restricted to the olfactory glial lineage, and found in immature olfactory ensheathing cells (iOEC) in the lamina propria (LP). Radial glial-like nestin- expressing progenitors are largely undetected in the postnatal OE, where the most multipotent cells, a subset of HBCs, contributes to GBCs, neuronal, glial and sustentacular lineages in vivo and/or in vitro. BLBP expression is restricted to glial progeny in axon bundles of the lamina propria and in the olfactory nerve around the olfactory bulb. INP immediate neuronal precursor, ORN olfactory receptor neuron, Ker 5/14 keratin 5/14, HBC horizontal basal cell, GBC globose basal cell. 162 expression in all nestin-expressing CNS progenitors (Zimmerman et al., 1994b; Yaworsky and Kappen, 1999; Johansson et al., 2002; Mignone et al., 2004). Additionally, the nestin second intron enhancer can be differentially regulated in the CNS by hormone response elements and/or Class III POU domain-containing proteins (Brn 1,2 4) (Josephson et al., 1998). The restricted activation of the “CNS-specific” nestin transgene to neuronal precursors in different OE and vomeronasal zones suggests that regional subpopulations of nestin-expressing embryonic olfactory/vomeronasal receptor neuron precursors may use different transcriptional mechanisms to regulate nestin expression (and expression of other zonally-restricted proteins, like chemosensory receptors). In particular, a combination of molecules, spatiotemporally expressed at specific levels, and thus forming a unique molecular signature in neuronal precursors, may be found in olfactory nestin transgene-activating cells and not non-transgene activators. One candidate molecule contributing to this proposed complex is the POU domain transcription factor Brn-2, which is most highly induced in restricted OE regions from E12.5-E14.5 (Hagino-Yamagishi et al., 1998). 6.2.2   FGF2 regulation of Nestin+ progenitors in the ORN lineage Are there nestin+ progenitors that precede Mash1+ neuronal progenitors in the ORN lineage? The first antigenically distinguishable OE cells in vitro are dividing nestin+ progenitors lacking lineage markers including Mash1, suggesting nestin+ progenitors precede Mash1+ progenitors (Fig 6.2). Supporting this, I was unable to detect the co- expression of Mash1 in nestin immunopositive cells in E13.5 OE of Nestin-GFP mice, although a subpopulation of GFP+ cells co-expressed Mash1, suggesting a tight temporal regulation between cells expressing nestin and Mash1. To adequately address this question, classical methods would test for Mash1 expression in vivo, and colony production in vitro, using nestin knock-out embryos, but there are no known viable nestin knock-outs. Alternatively, an inducible construct that would render nestin non-functional may answer this question. Does FGF2 act on self-renewing nestin+ progenitors? Support for this awaits the prospective isolation of nestin+ cells derived from primary OE neurospheres, using 163 Figure 6.2 Working model of FGF2 regulation of neurogenesis via Nestin+ progenitors Cells irreversibly pass through sequential progenitor stages, while losing their self- renewal, proliferative and cell potential. Self-renewing (*) stem cells divide and give rise to a subpopulation of Nestin+ neuronal progenitors that develop into Mash1+ neuronal progenitors. Mash1+ progenitors initially express, but later in their development down regulate, Nestin, before becoming Ngn1+ immediate neuronal precursors and finally postmitotic NST+ ORNs. FGF2 is proposed to regulate OE stem cell proliferation and may act on several OE neuron-restricted progenitors. FGF2 enhances neurogenesis by regulating by the proliferation of nestin+ progenitors, leading to increased ORNs, the production of Mash1+ progenitors and the division of immediate neuronal precursors before ORN production. 164 fluorescence activated cell sorting (FACS), and their secondary culture in FGF2, with and without FGF signal blocking, using a more tightly temporally governed and less stable reporter than GFP (see 6.2.4). 6.2.3   Is there a Nestin-negative stem cell in the OE? The neuronal lineage restriction of progeny in the OE of Nestin-cre/reporter mice suggests that there is a more primitive precursor capable of producing both neuronal and non-neuronal cells. Because some nestin+ cells in the embryonic OE did not activate the Nestin-cre transgene, and mitotic nestin+ cells expand to produce colonies comprised of both neurons and glia in vitro, endogenous nestin expression may identify a multipotent OE stem cell, similar to the developing CNS (Hockfield and McKay, 1985). Transgenic mice regulating nestin trangene activation via the NesPlacZ/3introns sequence, whose expression coincides with nestin expressing cells in the nervous system and in muscle during development (Zimmerman et al., 1994b), and thus demonstrates a broader range of reporter expression than the constructs used in my studies, does not support this. Using tamoxifen-inducible reporters in adult Nestin- CreERT2/R26R-YFP transgenic mice driven by nestin regulatory elements containing the 3 intronic sequences, reporter expression was restricted to neurons seen in the rostral migratory stream, olfactory bulb and subgranular zone of the dentate gyrus (Lagace et al., 2007). In a separate study, nestin transgene activation using similar regulatory regions was detected in a subset of proliferating cells in the SVZ and rostral migratory stream, that was limited to periglomerular neurons and absent from granule cell neurons in the olfactory bulb (Beech et al., 2004). These results highlight the ability of specific nestin regulatory elements to selectively target progenitors giving rise to defined neuronal subpopulations in the CNS and parallel my results in the olfactory epithelium. These data do not, however, support a multipotent nestin+ stem cell, even when using nestin regulatory elements with a broader range of cell type activation to label and fate map nestin transgene-activating progeny. 165 Sox2 is a candidate molecule that may identify precursors to nestin transgene- activating progenitors. The high-mobility group transcription factor Sox2 (SRY (sex determining region Y) -box 2), is expressed throughout ontogeny in putative CNS neural stem cells in vivo, and multipotent neurospheres in vitro (Ellis et al., 2004; Brazel et al., 2005). Inhibition of Sox2 signaling promotes the premature differentiation and cell cycle exit of neural precursors, while over expression inhibits neuronal differentiation (Graham et al., 2003), suggesting Sox2 is necessary for the maintenance of neural stem cells. Sox2 is expressed in progenitor regions in the embryonic and postnatal OE (Beites et al., 2005) (Larouche and Roskams, unpublished), and is co-expressed with nestin in neuroepithelial cells, precursors to radial glial cells (Cai et al., 2002). Together these data suggest that Sox2 expression could identify a multipotent OE stem/progenitor. 6.2.4  Identification of molecular signatures distinguishing Nestin transgene activators from non-activators One of the main questions prompted by my studies is to define the molecular signatures that distinguish between olfactory nestin-expressing subpopulations -those that activate the transgene from those that do not. Although nestin+ cells are found throughout the embryonic OE, only the most dorsal medial nestin-expressing cells activate the nestin transgene and contribute to neurogenesis via a subpopulation of neuronal progenitors in a restricted region. The Nestin-GFP transgenic mice utilized in my studies allow for marking of nestin- expressing cells that directly activate the transgene, without requisite excision events (Mignone et al., 2004). Once nestin transgene activation ceases, so does GFP expression. However, GFP protein can still be detected in nestin-negative cells that have down-regulated nestin, due to the latent fluorescent maturation and stability of GFP protein. For more strictly regulated detection of nestin transgene-activating cells, and to distinguish them from non-activating cells, one requires a destabilized fluorescent protein reporter. Modifications in an improved version of enhanced yellow fluorescent protein (EYFP), Venus (Nagai et al., 2002; Kohyama et al., 2005), termed dVenus (destabilized Venus) (Kohyama et al., 2005), allow for a rapid activation time and short-lived stability 166 of EYFP, that has been shown to more accurately detect nestin-expressing cells compared to GFP reporters, in the developing telencephalon, when using the identical nestin regulatory regions used in my Nestin -GFP and –Cre transgenic mice (Sunabori et al., 2007). Purification of dVenus+/- E14.5 telencephalic cells using flow cytometry confirmed most dVenus+ cells expressed nestin and not neuronal (NST) transcripts, while dVenus- cells expressed predominantly neuronal transcripts, indicating the specificity of nestin transgene-activated dVenus expression. dVenus has also been used to purify neural stem cells activating Notch signaling that subsequently produce multipotent neurospheres capable of passaging (Kohyama et al., 2005). Fluorescent activated cell sorting (FACS) could be used to segregate purified subpopulations of 1.) nestin+dVenus+/- or 2.) dVenus+ from dVenus- (giving a broader range of cell subtypes, increased cell numbers and negating the need for intracellular labeling), whose transcripts could be globally amplified and enriched prior to microarray analysis. When GFP-labeled cells were sorted and tested for neurosphere formation from the SVZ of adult Nestin-GFP mice, the frequency of neurosphere formation was 0.3% (Mignone et al., 2004), 2-fold lower than that from postnatal SVZ without prior enrichment (Hitoshi et al., 2002), which may reflect a loss of biological activity after sorting, similar to P5 OE (Carter et al., 2004) (data not shown). In the absence of co- staining for nestin with GFP, these results alternatively suggest that either only a small fraction of nestin+ cells in vivo are actually neurosphere forming cells and/or the GFP label is also detected in some nestin-negative cells, as it is in the OE (Ch5) (Mignone et al., 2004). Using a live reporter like dVenus allows for a more restricted temporal window of activation, and consequently smaller and more accurate pool of nestin transgene- activating precursors, whose spatial segregation in vivo designates their microenvironment for comparison to that of transgene non-activators. 6.2.5   Do Nestin transgene-activating progenitors contribute to postnatal OE neurogenesis? Although the GFP+ ORN progeny of nestin transgene-activation are detected in a subpopulation of postnatal and adult ORNs, it is unknown whether their nestin- 167 expressing precursors were induced during, and restricted to, embryonic development. I could not detect nestin expressing radial glial-like progenitors in the adult, but found a decreased number, compared to embryonic OE, in the early postnatal (P5) OE, suggesting there could be a perinatal nestin transgene-activating progenitor. To test for postnatally driven nestin transgene-activation in vivo, classical birthdating studies, where dividing cells are labeled with BrdU and whose progeny are followed over time, could be used by assaying for nestin+ BrdU+ GFP+ cells 30-60 minutes after postnatal day 0 (P0) BrdU injections, and after 5 days (P5) to assay for progenitor differentiation into NST+BrdU+GFP+ ORNs. These experiments pose some difficulty due to the triple antibody labeling needed and incompatibility of antigen retrieval for the detection of nuclear antigens with simultaneous detection of either endogenous or immuno-labeled GFP (Murdoch unpublished observations). Additionally, the lag time between cre- mediated excision and GFP detection in Nestin-cre/ZEG mice, makes GFP readily detectable in neuronal progeny, but very difficult in nestin-expressing progenitors (Ch 3). Hence, it may not be possible to distinguish between nestin+/- BrdU+ labeled progenitors at P0. I did search for postnatal day 5 (P5) nestin transgene-activating progenitors by performing in vitro colony assays on OE from Nestin-cre/ZEG mice to test for, and identify the progeny in, GFP+ colonies. In a total of three experiments I was unable to detect any P5 OE adherent colonies that were GFP immunopositive from either Nestin- cre/ZEG pups (284 total colonies) or littermate controls (579 total colonies), suggesting that under the conditions used, nestin transgene-activating cells do not contribute to postnatal OE neurogenesis. But does absence of evidence constitute evidence of absence? One study suggests that the adult OE contains distinct progenitor populations that mediate normal compared to injury induced ORN turnover (Leung et al., 2007), but more thorough experiments now refute this (Iwai et al., 2008). My data cannot rule out that there may be rare nestin+ progenitors not detected in my studies, which may contribute to postnatal olfactory neurogenesis given the appropriate stimulus and assay. This could be tested by removal of the olfactory bulb, causing widespread and specific ORN death and subsequent replacement, after basal progenitor proliferation and neuronal differentiation 168 (Carr and Farbman, 1992; Schwob, 2002). Alternatively, neuronal and non-neuronal OE cells could be killed using Methimazole (1-methyl-2-mercaptoimidazol), a drug used in humans to treat hyperthyroidism, thus creating a microenvironment supportive of the regeneration of multiple cell types (Bergman et al., 2002). Methimazole causes the rapid loss of ORNs, basal and sustentacular cells, and activates peak proliferation from the remnant basal layer within 3 days (Fig 6.3 A-C; G,H). Over the course of 2 weeks, mature and immature ORNs, sustentacular and basal cells are replenished and the OE recovers to 70% of its original thickness (Fig 6.3 B-K). These proposed experiments however, are largely restricted to adult mice and will not determine what the perinatal temporal effect of nestin transgene-activation is. The use of transgenic mice having inducible nestin regulatory elements for cre-mediated activation, like those in Nestin- CreERT2, would allow one to delineate the temporal contribution of nestin transgene- activating precursors and the cell fate of their progeny (Beech et al., 2004; Lagace et al., 2007). Additionally, GFP expression was detected in the OE of adult Nestin-GFP transgenic mice, in structures resembling ducts and found throughout the OE. This result was not expected, since endogenous nestin is not detected in adult OE, while the reasons for this pattern remain unexplained. I have provided evidence for a novel nestin-expressing radial glial-like progenitor in the OE and developed a defined in vitro assay to better understand how FGF2 regulates OE embryonic progenitors. I provide evidence that FGF2 can act to increase proliferation of nestin+ progenitors leading to increased ORNs. Combined with molecular profiling, my proposed future experiments will help define the differential spatial and temporal regulation and identification of nestin-expressing subpopulations in the OE, and allow one to test for similar CNS counterparts. 169 Figure 6.3   OE regeneration kinetics after methimazole treatment A) Experimental timeline. Mice were twice injected (ip), 3 days apart, with 50mg/kg methimazole (1-methyl-2-mercaptoimidazole). OE tissue was analyzed 3,6,14 days after the last treatment for B-E) β III neuron-specific tubulin (NST; green); G-J) mature neurons (OMP, red), proliferating cells (PCNA, green) and total cells (DAPI, blue). The kinetics of OE regeneration for specific antigens is summarized in F,K. OMP, olfactory marker protein; PCNA, proliferating cell nuclear antigen; OE, olfactory epithelium; LP, lamina propria; dotted line denotes basal lamina. Size bar in J represents 50 um in all panels. 170 171 REFERENCES Ahn S, Joyner AL (2005) In vivo analysis of quiescent adult neural stem cells responding to Sonic hedgehog. Nature 437:894-897. Akazawa C, Sasai Y, Nakanishi S, Kageyama R (1992) Molecular characterization of a rat negative regulator with a basic helix-loop-helix structure predominantly expressed in the developing nervous system. J Biol Chem 267:21879-21885. Alcedo J, Ayzenzon M, Von Ohlen T, Noll M, Hooper JE (1996) The Drosophila smoothened gene encodes a seven-pass membrane protein, a putative receptor for the hedgehog signal. Cell 86:221-232. Alenius M, Bohm S (1997) Identification of a novel neural cell adhesion molecule-related gene with a potential role in selective axonal projection. J Biol Chem 272:26083- 26086. Altmann CR, Brivanlou AH (2001) Neural patterning in the vertebrate embryo. Int Rev Cytol 203:447-482. Alvarez-Buylla A, Seri B, Doetsch F (2002) Identification of neural stem cells in the adult vertebrate brain. Brain Res Bull 57:751-758. Anchan RM, Drake DP, Haines CF, Gerwe EA, LaMantia AS (1997) Disruption of local retinoid-mediated gene expression accompanies abnormal development in the mammalian olfactory pathway. J Comp Neurol 379:171-184. Angevine JB, Jr., Sidman RL (1961) Autoradiographic study of cell migration during histogenesis of cerebral cortex in the mouse. Nature 192:766-768. Anthony TE, Klein C, Fishell G, Heintz N (2004) Radial glia serve as neuronal progenitors in all regions of the central nervous system. Neuron 41:881-890. Attisano L, Wrana JL (2002) Signal transduction by the TGF-beta superfamily. Science 296:1646-1647. Au E, Roskams AJ (2003) Olfactory ensheathing cells of the lamina propria in vivo and in vitro. Glia 41:224-236. Au E, Richter MW, Vincent AJ, Tetzlaff W, Aebersold R, Sage EH, Roskams AJ (2007) SPARC from olfactory ensheathing cells stimulates Schwann cells to promote neurite outgrowth and enhances spinal cord repair. J Neurosci 27:7208-7221. 172 Bailey AP, Bhattacharyya S, Bronner-Fraser M, Streit A (2006) Lens specification is the ground state of all sensory placodes, from which FGF promotes olfactory identity. Dev Cell 11:505-517. Balmer CW, LaMantia AS (2004) Loss of Gli3 and Shh function disrupts olfactory axon trajectories. J Comp Neurol 472:292-307. Balmer CW, LaMantia AS, Bhasin N, Rhodes K, Heemskerk J (2005) Noses and neurons: induction, morphogenesis, and neuronal differentiation in the peripheral olfactory pathway. Dev Dyn 234:464-481. Barraud P, He X, Zhao C, Ibanez C, Raha-Chowdhury R, Caldwell MA, Franklin RJ (2007) Contrasting effects of basic fibroblast growth factor and epidermal growth factor on mouse neonatal olfactory mucosa cells. Eur J Neurosci 26:3345-3357. Bartlett PF, Richards LR, Kilpatrick TJ, Talman PT, Bailey KA, Brooker GJ, Dutton R, Koblar SA, Nurcombe V, Ford MO, et al. (1995) Factors regulating the differentiation of neural precursors in the forebrain. Ciba Found Symp 193:85-99; discussion 117-126. Bauer S, Rasika S, Han J, Mauduit C, Raccurt M, Morel G, Jourdan F, Benahmed M, Moyse E, Patterson PH (2003) Leukemia inhibitory factor is a key signal for injury- induced neurogenesis in the adult mouse olfactory epithelium. J Neurosci 23:1792-1803. Beech RD, Cleary MA, Treloar HB, Eisch AJ, Harrist AV, Zhong W, Greer CA, Duman RS, Picciotto MR (2004) Nestin promoter/enhancer directs transgene expression to precursors of adult generated periglomerular neurons. J Comp Neurol 475:128- 141. Behrens M, Venkatraman G, Gronostajski RM, Reed RR, Margolis FL (2000) NFI in the development of the olfactory neuroepithelium and the regulation of olfactory marker protein gene expression. Eur J Neurosci 12:1372-1384. Beites CL, Kawauchi S, Crocker CE, Calof AL (2005) Identification and molecular regulation of neural stem cells in the olfactory epithelium. Exp Cell Res 306:309- 316. Bendall SC, Stewart MH, Menendez P, George D, Vijayaragavan K, Werbowetski- Ogilvie T, Ramos-Mejia V, Rouleau A, Yang J, Bosse M, Lajoie G, Bhatia M 173 (2007) IGF and FGF cooperatively establish the regulatory stem cell niche of pluripotent human cells in vitro. Nature 448:1015-1021. Bergman U, Ostergren A, Gustafson AL, Brittebo B (2002) Differential effects of olfactory toxicants on olfactory regeneration. Arch Toxicol 76:104-112. Berube NG, Mangelsdorf M, Jagla M, Vanderluit J, Garrick D, Gibbons RJ, Higgs DR, Slack RS, Picketts DJ (2005) The chromatin-remodeling protein ATRX is critical for neuronal survival during corticogenesis. J Clin Invest 115:258-267. Bhasin N, Maynard TM, Gallagher PA, LaMantia AS (2003) Mesenchymal/epithelial regulation of retinoic acid signaling in the olfactory placode. Dev Biol 261:82-98. Borrell V, Yoshimura Y, Callaway EM (2005) Targeted gene delivery to telencephalic inhibitory neurons by directional in utero electroporation. J Neurosci Methods 143:151-158. Brazel CY, Limke TL, Osborne JK, Miura T, Cai J, Pevny L, Rao MS (2005) Sox2 expression defines a heterogeneous population of neurosphere-forming cells in the adult murine brain. Aging Cell 4:197-207. Bronner-Fraser M, Fraser SE (1988) Cell lineage analysis reveals multipotency of some avian neural crest cells. Nature 335:161-164. Burns KA, Ayoub AE, Breunig JJ, Adhami F, Weng WL, Colbert MC, Rakic P, Kuan CY (2007) Nestin-CreER mice reveal DNA synthesis by nonapoptotic neurons following cerebral ischemia hypoxia. Cereb Cortex 17:2585-2592. Caggiano M, Kauer JS, Hunter DD (1994) Globose basal cells are neuronal progenitors in the olfactory epithelium: a lineage analysis using a replication-incompetent retrovirus. Neuron 13:339-352. Cai J, Wu Y, Mirua T, Pierce JL, Lucero MT, Albertine KH, Spangrude GJ, Rao MS (2002) Properties of a fetal multipotent neural stem cell (NEP cell). Dev Biol 251:221-240. Calof AL, Chikaraishi DM (1989) Analysis of neurogenesis in a mammalian neuroepithelium: proliferation and differentiation of an olfactory neuron precursor in vitro. Neuron 3:115-127. 174 Calof AL, Lander AD (1991) Relationship between neuronal migration and cell- substratum adhesion: laminin and merosin promote olfactory neuronal migration but are anti-adhesive. J Cell Biol 115:779-794. Calof AL, Mumm JS, Rim PC, Shou J (1998a) The neuronal stem cell of the olfactory epithelium. J Neurobiol 36:190-205. Calof AL, Campanero MR, O'Rear JJ, Yurchenco PD, Lander AD (1994) Domain- specific activation of neuronal migration and neurite outgrowth-promoting activities of laminin. Neuron 13:117-130. Calof AL, Rim PC, Askins KJ, Mumm JS, Gordon MK, Iannuzzelli P, Shou J (1998b) Factors regulating neurogenesis and programmed cell death in mouse olfactory epithelium. Ann N Y Acad Sci 855:226-229. Calof AL, Bonnin A, Crocker C, Kawauchi S, Murray RC, Shou J, Wu HH (2002) Progenitor cells of the olfactory receptor neuron lineage. Microsc Res Tech 58:176-188. Cameron HA, Woolley CS, McEwen BS, Gould E (1993) Differentiation of newly born neurons and glia in the dentate gyrus of the adult rat. Neuroscience 56:337-344. Cameron RS, Rakic P (1991) Glial cell lineage in the cerebral cortex: a review and synthesis. Glia 4:124-137. Campos LS (2004) Neurospheres: insights into neural stem cell biology. J Neurosci Res 78:761-769. Campos LS, Leone DP, Relvas JB, Brakebusch C, Fassler R, Suter U, ffrench-Constant C (2004) Beta1 integrins activate a MAPK signalling pathway in neural stem cells that contributes to their maintenance. Development 131:3433-3444. Capela A, Temple S (2002) LeX/ssea-1 is expressed by adult mouse CNS stem cells, identifying them as nonependymal. Neuron 35:865-875. Capela A, Temple S (2006) LeX is expressed by principle progenitor cells in the embryonic nervous system, is secreted into their environment and binds Wnt-1. Dev Biol 291:300-313. Carr VM, Farbman AI (1992) Ablation of the olfactory bulb up-regulates the rate of neurogenesis and induces precocious cell death in olfactory epithelium. Exp Neurol 115:55-59. 175 Carson C, Murdoch B, Roskams AJ (2006) Notch 2 and Notch 1/3 segregate to neuronal and glial lineages of the developing olfactory epithelium. Dev Dyn 235:1678-1688. Carter LA, MacDonald JL, Roskams AJ (2004) Olfactory horizontal basal cells demonstrate a conserved multipotent progenitor phenotype. J Neurosci 24:5670- 5683. Cau E, Casarosa S, Guillemot F (2002) Mash1 and Ngn1 control distinct steps of determination and differentiation in the olfactory sensory neuron lineage. Development 129:1871-1880. Cau E, Gradwohl G, Fode C, Guillemot F (1997) Mash1 activates a cascade of bHLH regulators in olfactory neuron progenitors. Development 124:1611-1621. Cau E, Gradwohl G, Casarosa S, Kageyama R, Guillemot F (2000) Hes genes regulate sequential stages of neurogenesis in the olfactory epithelium. Development 127:2323-2332. Cepko CL, Roberts BE, Mulligan RC (1984) Construction and applications of a highly transmissible murine retrovirus shuttle vector. Cell 37:1053-1062. Chen H, Kohno K, Gong Q (2005) Conditional ablation of mature olfactory sensory neurons mediated by diphtheria toxin receptor. J Neurocytol 34:37-47. Chen X, Fang H, Schwob JE (2004) Multipotency of purified, transplanted globose basal cells in olfactory epithelium. J Comp Neurol 469:457-474. Chen Y, Struhl G (1996) Dual roles for patched in sequestering and transducing Hedgehog. Cell 87:553-563. Chen Y, Getchell ML, Ding X, Getchell TV (1992) Immunolocalization of two cytochrome P450 isozymes in rat nasal chemosensory tissue. Neuroreport 3:749-752. Chiasson BJ, Tropepe V, Morshead CM, van der Kooy D (1999) Adult mammalian forebrain ependymal and subependymal cells demonstrate proliferative potential, but only subependymal cells have neural stem cell characteristics. J Neurosci 19:4462-4471. Chuah MI, Teague R (1999) Basic fibroblast growth factor in the primary olfactory pathway: mitogenic effect on ensheathing cells. Neuroscience 88:1043-1050. Chuah MI, West AK (2002) Cellular and molecular biology of ensheathing cells. Microsc Res Tech 58:216-227. 176 Coffman JA (2003) Runx transcription factors and the developmental balance between cell proliferation and differentiation. Cell Biol Int 27:315-324. Collazo A, Bronner-Fraser M, Fraser SE (1993) Vital dye labelling of Xenopus laevis trunk neural crest reveals multipotency and novel pathways of migration. Development 118:363-376. Copray S, Balasubramaniyan V, Levenga J, de Bruijn J, Liem R, Boddeke E (2006) Olig2 overexpression induces the in vitro differentiation of neural stem cells into mature oligodendrocytes. Stem Cells 24:1001-1010. Corti S, Nizzardo M, Nardini M, Donadoni C, Locatelli F, Papadimitriou D, Salani S, Del Bo R, Ghezzi S, Strazzer S, Bresolin N, Comi GP (2007) Isolation and characterization of murine neural stem/progenitor cells based on Prominin-1 expression. Exp Neurol 205:547-562. Coskun V, Venkatraman G, Yang H, Rao MS, Luskin MB (2001) Retroviral manipulation of the expression of bone morphogenetic protein receptor Ia by SVZa progenitor cells leads to changes in their p19(INK4d) expression but not in their neuronal commitment. Int J Dev Neurosci 19:219-227. Coskun V, Wu H, Blanchi B, Tsao S, Kim K, Zhao J, Biancotti JC, Hutnick L, Krueger RC, Jr., Fan G, de Vellis J, Sun YE (2008) CD133+ neural stem cells in the ependyma of mammalian postnatal forebrain. Proc Natl Acad Sci U S A 105:1026-1031. Cuschieri A, Bannister LH (1975) The development of the olfactory mucosa in the mouse: light microscopy. J Anat 119:277-286. Danciger E, Mettling C, Vidal M, Morris R, Margolis F (1989) Olfactory marker protein gene: its structure and olfactory neuron-specific expression in transgenic mice. Proc Natl Acad Sci U S A 86:8565-8569. Danielian PS, Muccino D, Rowitch DH, Michael SK, McMahon AP (1998) Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr Biol 8:1323-1326. Davis JA, Reed RR (1996) Role of Olf-1 and Pax-6 transcription factors in neurodevelopment. J Neurosci 16:5082-5094. 177 de la Pompa JL, Wakeham A, Correia KM, Samper E, Brown S, Aguilera RJ, Nakano T, Honjo T, Mak TW, Rossant J, Conlon RA (1997) Conservation of the Notch signalling pathway in mammalian neurogenesis. Development 124:1139-1148. DeHamer MK, Guevara JL, Hannon K, Olwin BB, Calof AL (1994) Genesis of olfactory receptor neurons in vitro: regulation of progenitor cell divisions by fibroblast growth factors. Neuron 13:1083-1097. Delaune E, Lemaire P, Kodjabachian L (2005) Neural induction in Xenopus requires early FGF signalling in addition to BMP inhibition. Development 132:299-310. Depew MJ, Liu JK, Long JE, Presley R, Meneses JJ, Pedersen RA, Rubenstein JL (1999) Dlx5 regulates regional development of the branchial arches and sensory capsules. Development 126:3831-3846. Dick JE, Bhatia M, Gan O, Kapp U, Wang JC (1997) Assay of human stem cells by repopulation of NOD/SCID mice. Stem Cells 15 Suppl 1:199-203; discussion 204- 197. Doetsch F (2003) A niche for adult neural stem cells. Curr Opin Genet Dev 13:543-550. Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A (1997) Cellular composition and three- dimensional organization of the subventricular germinal zone in the adult mammalian brain. J Neurosci 17:5046-5061. Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A (1999a) Regeneration of a germinal layer in the adult mammalian brain. Proc Natl Acad Sci U S A 96:11619-11624. Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A (1999b) Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97:703-716. Donner AL, Episkopou V, Maas RL (2007) Sox2 and Pou2f1 interact to control lens and olfactory placode development. Dev Biol 303:784-799. Doyle KL, Khan M, Cunningham AM (2001) Expression of the intermediate filament protein nestin by sustentacular cells in mature olfactory neuroepithelium. J Comp Neurol 437:186-195. Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP (1993) Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75:1417-1430. 178 Eckenhoff MF, Rakic P (1984) Radial organization of the hippocampal dentate gyrus: a Golgi, ultrastructural, and immunocytochemical analysis in the developing rhesus monkey. J Comp Neurol 223:1-21. Ellis J (2005) Silencing and variegation of gammaretrovirus and lentivirus vectors. Hum Gene Ther 16:1241-1246. Ellis J, Yao S (2005) Retrovirus silencing and vector design: relevance to normal and cancer stem cells? Curr Gene Ther 5:367-373. Ellis P, Fagan BM, Magness ST, Hutton S, Taranova O, Hayashi S, McMahon A, Rao M, Pevny L (2004) SOX2, a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the embryo or the adult. Dev Neurosci 26:148- 165. Erickson AC, Couchman JR (2000) Still more complexity in mammalian basement membranes. J Histochem Cytochem 48:1291-1306. Ezeh PI, Farbman AI (1998) Differential activation of ErbB receptors in the rat olfactory mucosa by transforming growth factor-alpha and epidermal growth factor in vivo. J Neurobiol 37:199-210. Farbman AI (1990) Olfactory neurogenesis: genetic or environmental controls? Trends Neurosci 13:362-365. Farbman AI (1992) Cell Biology of Olfaction. Cambridge: Cambridge University Press. Farbman AI, Margolis FL (1980) Olfactory marker protein during ontogeny: immunohistochemical localization. Dev Biol 74:205-215. Farbman AI, Buchholz JA (1996) Transforming growth factor-alpha and other growth factors stimulate cell division in olfactory epithelium in vitro. J Neurobiol 30:267- 280. Feil R, Brocard J, Mascrez B, LeMeur M, Metzger D, Chambon P (1996) Ligand- activated site-specific recombination in mice. Proc Natl Acad Sci U S A 93:10887- 10890. Feng L, Heintz N (1995) Differentiating neurons activate transcription of the brain lipid- binding protein gene in radial glia through a novel regulatory element. Development 121:1719-1730. 179 Feng L, Hatten ME, Heintz N (1994) Brain lipid-binding protein (BLBP): a novel signaling system in the developing mammalian CNS. Neuron 12:895-908. Fujimoto M, Izu H, Seki K, Fukuda K, Nishida T, Yamada S, Kato K, Yonemura S, Inouye S, Nakai A (2004) HSF4 is required for normal cell growth and differentiation during mouse lens development. Embo J 23:4297-4306. Furuta A, Rothstein JD, Martin LJ (1997) Glutamate transporter protein subtypes are expressed differentially during rat CNS development. J Neurosci 17:8363-8375. Gage FH (2000) Mammalian neural stem cells. Science 287:1433-1438. Gage FH, Ray J, Fisher LJ (1995) Isolation, characterization, and use of stem cells from the CNS. Annu Rev Neurosci 18:159-192. Gage FH, Kempermann G, Palmer TD, Peterson DA, Ray J (1998) Multipotent progenitor cells in the adult dentate gyrus. J Neurobiol 36:249-266. Ganat YM, Silbereis J, Cave C, Ngu H, Anderson GM, Ohkubo Y, Ment LR, Vaccarino FM (2006) Early postnatal astroglial cells produce multilineage precursors and neural stem cells in vivo. J Neurosci 26:8609-8621. Garcia AD, Doan NB, Imura T, Bush TG, Sofroniew MV (2004) GFAP-expressing progenitors are the principal source of constitutive neurogenesis in adult mouse forebrain. Nat Neurosci 7:1233-1241. Getchell ML, Boggess MA, Pruden SJ, 2nd, Little SS, Buch S, Getchell TV (2002a) Expression of TGF-beta type II receptors in the olfactory epithelium and their regulation in TGF-alpha transgenic mice. Brain Res 945:232-241. Getchell TV, Margolis FL, Getchell ML (1984) Perireceptor and receptor events in vertebrate olfaction. Prog Neurobiol 23:317-345. Getchell TV, Narla RK, Little S, Hyde JF, Getchell ML (2000) Horizontal basal cell proliferation in the olfactory epithelium of transforming growth factor-alpha transgenic mice. Cell Tissue Res 299:185-192. Getchell TV, Shah DS, Partin JV, Subhedar NK, Getchell ML (2002b) Leukemia inhibitory factor mRNA expression is upregulated in macrophages and olfactory receptor neurons after target ablation. J Neurosci Res 67:246-254. Giguere V (1994) Retinoic acid receptors and cellular retinoid binding proteins: complex interplay in retinoid signaling. Endocr Rev 15:61-79. 180 Giguere V, Ong ES, Segui P, Evans RM (1987) Identification of a receptor for the morphogen retinoic acid. Nature 330:624-629. Gill JC, Moenter SM, Tsai PS (2004) Developmental regulation of gonadotropin- releasing hormone neurons by fibroblast growth factor signaling. Endocrinology 145:3830-3839. Goldstein BJ, Schwob JE (1996) Analysis of the globose basal cell compartment in rat olfactory epithelium using GBC-1, a new monoclonal antibody against globose basal cells. J Neurosci 16:4005-4016. Goldstein BJ, Wolozin BL, Schwob JE (1997) FGF2 suppresses neuronogenesis of a cell line derived from rat olfactory epithelium. J Neurobiol 33:411-428. Gong S, Zheng C, Doughty ML, Losos K, Didkovsky N, Schambra UB, Nowak NJ, Joyner A, Leblanc G, Hatten ME, Heintz N (2003) A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature 425:917-925. Gordon MK, Mumm JS, Davis RA, Holcomb JD, Calof AL (1995) Dynamics of MASH1 expression in vitro and in vivo suggest a non-stem cell site of MASH1 action in the olfactory receptor neuron lineage. Mol Cell Neurosci 6:363-379. Gotz M, Huttner WB, Haubensak W, Attardo A, Denk W (2005) The cell biology of neurogenesis Neurons arise in the basal neuroepithelium of the early mammalian telencephalon: a major site of neurogenesis. Nat Rev Mol Cell Biol 6:777-788. Graham V, Khudyakov J, Ellis P, Pevny L (2003) SOX2 functions to maintain neural progenitor identity. Neuron 39:749-765. Graziadei GA, Graziadei PP (1979a) Neurogenesis and neuron regeneration in the olfactory system of mammals. II. Degeneration and reconstitution of the olfactory sensory neurons after axotomy. J Neurocytol 8:197-213. Graziadei PP, Graziadei GA (1979b) Neurogenesis and neuron regeneration in the olfactory system of mammals. I. Morphological aspects of differentiation and structural organization of the olfactory sensory neurons. J Neurocytol 8:1-18. Gritti A, Frolichsthal-Schoeller P, Galli R, Parati EA, Cova L, Pagano SF, Bjornson CR, Vescovi AL (1999) Epidermal and fibroblast growth factors behave as mitogenic 181 regulators for a single multipotent stem cell-like population from the subventricular region of the adult mouse forebrain. J Neurosci 19:3287-3297. Grove EA, Williams BP, Li DQ, Hajihosseini M, Friedrich A, Price J (1993) Multiple restricted lineages in the embryonic rat cerebral cortex. Development 117:553- 561. Gu G, Brown JR, Melton DA (2003) Direct lineage tracing reveals the ontogeny of pancreatic cell fates during mouse embryogenesis. Mech Dev 120:35-43. Guillemot F (1999) Vertebrate bHLH genes and the determination of neuronal fates. Exp Cell Res 253:357-364. Hack MA, Saghatelyan A, de Chevigny A, Pfeifer A, Ashery-Padan R, Lledo PM, Gotz M (2005) Neuronal fate determinants of adult olfactory bulb neurogenesis. Nat Neurosci 8:865-872. Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A (1998) Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mech Dev 76:79-90. Hagino-Yamagishi K, Saijoh Y, Yamazaki Y, Yazaki K, Hamada H (1998) Transcriptional regulatory region of Brn-2 required for its expression in developing olfactory epithelial cells. Brain Res Dev Brain Res 109:77-86. Han YG, Spassky N, Romaguera-Ros M, Garcia-Verdugo JM, Aguilar A, Schneider- Maunoury S, Alvarez-Buylla A (2008) Hedgehog signaling and primary cilia are required for the formation of adult neural stem cells. Nat Neurosci 11:277-284. Hanashima C, Li SC, Shen L, Lai E, Fishell G (2004) Foxg1 suppresses early cortical cell fate. Science 303:56-59. Hartfuss E, Galli R, Heins N, Gotz M (2001) Characterization of CNS precursor subtypes and radial glia. Dev Biol 229:15-30. Hayashi S, McMahon AP (2002) Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev Biol 244:305-318. Hebert JM, McConnell SK (2000) Targeting of cre to the Foxg1 (BF-1) locus mediates loxP recombination in the telencephalon and other developing head structures. Dev Biol 222:296-306. 182 Heissig B, Hattori K, Dias S, Friedrich M, Ferris B, Hackett NR, Crystal RG, Besmer P, Lyden D, Moore MA, Werb Z, Rafii S (2002) Recruitment of stem and progenitor cells from the bone marrow niche requires MMP-9 mediated release of kit-ligand. Cell 109:625-637. Hempstead JL, Morgan JI (1983) Monoclonal antibodies to the rat olfactory sustentacular cell. Brain Res 288:289-295. Hempstead JL, Morgan JI (1985) A panel of monoclonal antibodies to the rat olfactory epithelium. J Neurosci 5:438-449. Herzog C, Otto T (1999) Regeneration of olfactory receptor neurons following chemical lesion: time course and enhancement with growth factor administration. Brain Res 849:155-161. Hill RE, Favor J, Hogan BL, Ton CC, Saunders GF, Hanson IM, Prosser J, Jordan T, Hastie ND, van Heyningen V (1991) Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354:522-525. Hirota J, Mombaerts P (2004) The LIM-homeodomain protein Lhx2 is required for complete development of mouse olfactory sensory neurons. Proc Natl Acad Sci U S A 101:8751-8755. Hirrlinger PG, Scheller A, Braun C, Hirrlinger J, Kirchhoff F (2006) Temporal control of gene recombination in astrocytes by transgenic expression of the tamoxifen- inducible DNA recombinase variant CreERT2. Glia 54:11-20. Hitoshi S, Alexson T, Tropepe V, Donoviel D, Elia AJ, Nye JS, Conlon RA, Mak TW, Bernstein A, van der Kooy D (2002) Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes Dev 16:846-858. Hockfield S, McKay RD (1985) Identification of major cell classes in the developing mammalian nervous system. J Neurosci 5:3310-3328. Hogan BL, Horsburgh G, Cohen J, Hetherington CM, Fisher G, Lyon MF (1986) Small eyes (Sey): a homozygous lethal mutation on chromosome 2 which affects the differentiation of both lens and nasal placodes in the mouse. J Embryol Exp Morphol 97:95-110. 183 Holbrook EH, Szumowski KE, Schwob JE (1995) An immunochemical, ultrastructural, and developmental characterization of the horizontal basal cells of rat olfactory epithelium. J Comp Neurol 363:129-146. Hsu P, Yu F, Feron F, Pickles JO, Sneesby K, Mackay_Sim A (2001) Basic fibroblast growth factor and fibroblast growth factor receptors in adult olfactory epithelium. Brain Research 896:188-197. Huard JM, Schwob JE (1995) Cell cycle of globose basal cells in rat olfactory epithelium. Dev Dyn 203:17-26. Huard JM, Youngentob SL, Goldstein BJ, Luskin MB, Schwob JE (1998) Adult olfactory epithelium contains multipotent progenitors that give rise to neurons and non- neural cells. J Comp Neurol 400:469-486. Ikeda K, Ookawara S, Sato S, Ando Z, Kageyama R, Kawakami K (2007) Six1 is essential for early neurogenesis in the development of olfactory epithelium. Dev Biol 311:53-68. Illing N, Boolay S, Siwoski JS, Casper D, Lucero MT, Roskams AJ (2002) Conditionally immortalized clonal cell lines from the mouse olfactory placode differentiate into olfactory receptor neurons. Mol Cell Neurosci 20:225-243. Imayoshi I, Ohtsuka T, Metzger D, Chambon P, Kageyama R (2006) Temporal regulation of Cre recombinase activity in neural stem cells. Genesis 44:233-238. Ishibashi M, Ang SL, Shiota K, Nakanishi S, Kageyama R, Guillemot F (1995) Targeted disruption of mammalian hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural helix-loop-helix factors, premature neurogenesis, and severe neural tube defects. Genes Dev 9:3136-3148. Iwai N, Zhou Z, Roop DR, Behringer RR (2008) Horizontal Basal Cells are Multipotent Progenitors in Normal and Injured Adult Olfactory Epithelium. Stem Cells. Iwema CL, Fang H, Kurtz DB, Youngentob SL, Schwob JE (2004) Odorant receptor expression patterns are restored in lesion-recovered rat olfactory epithelium. J Neurosci 24:356-369. Jacobson AG (1963) The Determination and Positioning of the Nose, Lens and Ear. I. Interactions within the Ectoderm, and between the Ectoderm and Underlying Tissues. J Exp Zool 154:273-283. 184 Jarriault S, Brou C, Logeat F, Schroeter EH, Kopan R, Israel A (1995) Signalling downstream of activated mammalian Notch. Nature 377:355-358. Johansson CB, Lothian C, Molin M, Okano H, Lendahl U (2002) Nestin enhancer requirements for expression in normal and injured adult CNS. J Neurosci Res 69:784-794. Johansson CB, Momma S, Clarke DL, Risling M, Lendahl U, Frisen J (1999) Identification of a neural stem cell in the adult mammalian central nervous system. Cell 96:25-34. Josephson R, Muller T, Pickel J, Okabe S, Reynolds K, Turner PA, Zimmer A, McKay RD (1998) POU transcription factors control expression of CNS stem cell-specific genes. Development 125:3087-3100. Joyner AL, Zervas M (2006) Genetic inducible fate mapping in mouse: establishing genetic lineages and defining genetic neuroanatomy in the nervous system. Dev Dyn 235:2376-2385. Kaestner KH, Knochel W, Martinez DE (2000) Unified nomenclature for the winged helix/forkhead transcription factors. Genes Dev 14:142-146. Kamachi Y, Uchikawa M, Tanouchi A, Sekido R, Kondoh H (2001) Pax6 and SOX2 form a co-DNA-binding partner complex that regulates initiation of lens development. Genes Dev 15:1272-1286. Kawauchi S, Beites CL, Crocker CE, Wu HH, Bonnin A, Murray R, Calof AL (2004) Molecular signals regulating proliferation of stem and progenitor cells in mouse olfactory epithelium. Dev Neurosci 26:166-180. Kawauchi S, Shou J, Santos R, Hebert JM, McConnell SK, Mason I, Calof AL (2005) Fgf8 expression defines a morphogenetic center required for olfactory neurogenesis and nasal cavity development in the mouse. Development 132:5211-5223. Epub 2005 Nov 5212. Kerever A, Schnack J, Vellinga D, Ichikawa N, Moon C, Arikawa-Hirasawa E, Efird JT, Mercier F (2007) Novel extracellular matrix structures in the neural stem cell niche capture the neurogenic factor fibroblast growth factor 2 from the extracellular milieu. Stem Cells 25:2146-2157. 185 Key B, Treloar HB, Wangerek L, Ford MD, Nurcombe V (1996) Expression and localization of FGF-1 in the developing rat olfactory system. J Comp Neurol 366:197-206. Keyoung HM, Roy NS, Benraiss A, Louissaint A, Jr., Suzuki A, Hashimoto M, Rashbaum WK, Okano H, Goldman SA (2001) High-yield selection and extraction of two promoter-defined phenotypes of neural stem cells from the fetal human brain. Nat Biotechnol 19:843-850. Kilpatrick TJ, Bartlett PF (1995) Cloned multipotential precursors from the mouse cerebrum require FGF-2, whereas glial restricted precursors are stimulated with either FGF-2 or EGF. J Neurosci 15:3653-3661. Kim J, Wu HH, Lander AD, Lyons KM, Matzuk MM, Calof AL (2005) GDF11 controls the timing of progenitor cell competence in developing retina. Science 308:1927- 1930. Kim M, Morshead CM (2003) Distinct populations of forebrain neural stem and progenitor cells can be isolated using side-population analysis. J Neurosci 23:10703-10709. Knox S, Merry C, Stringer S, Melrose J, Whitelock J (2002) Not all perlecans are created equal: interactions with fibroblast growth factor (FGF) 2 and FGF receptors. J Biol Chem 277:14657-14665. Kobayakawa K, Kobayakawa R, Matsumoto H, Oka Y, Imai T, Ikawa M, Okabe M, Ikeda T, Itohara S, Kikusui T, Mori K, Sakano H (2007) Innate versus learned odour processing in the mouse olfactory bulb. Nature 450:503-508. Kohtz JD, Lee HY, Gaiano N, Segal J, Ng E, Larson T, Baker DP, Garber EA, Williams KP, Fishell G (2001) N-terminal fatty-acylation of sonic hedgehog enhances the induction of rodent ventral forebrain neurons. Development 128:2351-2363. Kohwi M, Osumi N, Rubenstein JL, Alvarez-Buylla A (2005) Pax6 is required for making specific subpopulations of granule and periglomerular neurons in the olfactory bulb. J Neurosci 25:6997-7003. Kohyama J, Tokunaga A, Fujita Y, Miyoshi H, Nagai T, Miyawaki A, Nakao K, Matsuzaki Y, Okano H (2005) Visualization of spatiotemporal activation of Notch signaling: live monitoring and significance in neural development. Dev Biol 286:311-325. 186 Kolterud A, Alenius M, Carlsson L, Bohm S (2004) The Lim homeobox gene Lhx2 is required for olfactory sensory neuron identity. Development 131:5319-5326. Kriegstein AR, Gotz M (2003) Radial glia diversity: a matter of cell fate. Glia 43:37-43. Kuhn HG, Winkler J, Kempermann G, Thal LJ, Gage FH (1997) Epidermal growth factor and fibroblast growth factor-2 have different effects on neural progenitors in the adult rat brain. J Neurosci 17:5820-5829. Lagace DC, Whitman MC, Noonan MA, Ables JL, DeCarolis NA, Arguello AA, Donovan MH, Fischer SJ, Farnbauch LA, Beech RD, DiLeone RJ, Greer CA, Mandyam CD, Eisch AJ (2007) Dynamic contribution of nestin-expressing stem cells to adult neurogenesis. J Neurosci 27:12623-12629. LaMantia AS, Colbert MC, Linney E (1993) Retinoic acid induction and regional differentiation prefigure olfactory pathway formation in the mammalian forebrain. Neuron 10:1035-1048. LaMantia AS, Bhasin N, Rhodes K, Heemskerk J (2000) Mesenchymal/epithelial induction mediates olfactory pathway formation. Neuron 28:411-425. Larouche M, Roskams AJ (2008) unpublished. Laywell ED, Rakic P, Kukekov VG, Holland EC, Steindler DA (2000) Identification of a multipotent astrocytic stem cell in the immature and adult mouse brain. Proc Natl Acad Sci U S A 97:13883-13888. Leitinger B, Hohenester E (2007) Mammalian collagen receptors. Matrix Biol 26:146- 155. Lendahl U, Zimmerman LB, McKay RD (1990) CNS stem cells express a new class of intermediate filament protein. Cell 60:585-595. Leone DP, Relvas JB, Campos LS, Hemmi S, Brakebusch C, Fassler R, Ffrench- Constant C, Suter U (2005) Regulation of neural progenitor proliferation and survival by beta1 integrins. J Cell Sci 118:2589-2599. Leung CT, Coulombe PA, Reed RR (2007) Contribution of olfactory neural stem cells to tissue maintenance and regeneration. Nat Neurosci. Levi G, Puche AC, Mantero S, Barbieri O, Trombino S, Paleari L, Egeo A, Merlo GR (2003) The Dlx5 homeodomain gene is essential for olfactory development and connectivity in the mouse. Mol Cell Neurosci 22:530-543. 187 Levitt P, Rakic P (1980) Immunoperoxidase localization of glial fibrillary acidic protein in radial glial cells and astrocytes of the developing rhesus monkey brain. J Comp Neurol 193:815-840. Li L, Xie T (2005) Stem cell niche: structure and function. Annu Rev Cell Dev Biol 21:605-631. Lim DA, Tramontin AD, Trevejo JM, Herrera DG, Garcia-Verdugo JM, Alvarez-Buylla A (2000) Noggin antagonizes BMP signaling to create a niche for adult neurogenesis. Neuron 28:713-726. Lin H, Grosschedl R (1995) Failure of B-cell differentiation in mice lacking the transcription factor EBF. Nature 376:263-267. Lioubinski O, Alonso MT, Alvarez Y, Vendrell V, Garrosa M, Murphy P, Schimmang T (2006) FGF signalling controls expression of vomeronasal receptors during embryogenesis. Mech Dev 123:17-23. Liu JK, Ghattas I, Liu S, Chen S, Rubenstein JL (1997) Dlx genes encode DNA-binding proteins that are expressed in an overlapping and sequential pattern during basal ganglia differentiation. Dev Dyn 210:498-512. Lois C, Alvarez-Buylla A (1993) Proliferating subventricular zone cells in the adult mammalian forebrain can differentiate into neurons and glia. Proc Natl Acad Sci U S A 90:2074-2077. Lois C, Alvarez-Buylla A (1994) Long-distance neuronal migration in the adult mammalian brain. Science 264:1145-1148. Lois C, Garcia-Verdugo JM, Alvarez-Buylla A (1996) Chain migration of neuronal precursors. Science 271:978-981. Long JE, Garel S, Depew MJ, Tobet S, Rubenstein JL (2003) DLX5 regulates development of peripheral and central components of the olfactory system. J Neurosci 23:568-578. Louis SA, Rietze RL, Deleyrolle L, Wagey RE, Thomas TE, Eaves AC, Reynolds BA (2008) Enumeration of Neural Stem and Progenitor Cells in the Neural Colony Forming Cell Assay. Stem Cells. Lund AH, van Lohuizen M (2002) RUNX: a trilogy of cancer genes. Cancer Cell 1:213- 215. 188 Luo T, Matsuo-Takasaki M, Lim JH, Sargent TD (2001) Differential regulation of Dlx gene expression by a BMP morphogenetic gradient. Int J Dev Biol 45:681-684. Luskin MB (1993) Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone. Neuron 11:173-189. MacDonald JL, Gin CS, Roskams AJ (2005) Stage-specific induction of DNA methyltransferases in olfactory receptor neuron development. Dev Biol 288:461- 473. MacDonald KP, Mackay-Sim A, Bushell GR, Bartlett PF (1996a) Olfactory neuronal cell lines generated by retroviral insertion of the n-myc oncogene display different developmental phenotypes. J Neurosci Res 45:237-247. MacDonald KP, Murrell WG, Bartlett PF, Bushell GR, Mackay-Sim A (1996b) FGF2 promotes neuronal differentiation in explant cultures of adult and embryonic mouse olfactory epithelium. J Neurosci Res 44:27-39. Machold R, Hayashi S, Rutlin M, Muzumdar MD, Nery S, Corbin JG, Gritli-Linde A, Dellovade T, Porter JA, Rubin LL, Dudek H, McMahon AP, Fishell G (2003) Sonic hedgehog is required for progenitor cell maintenance in telencephalic stem cell niches. Neuron 39:937-950. Mahanthappa NK, Schwarting GA (1993) Peptide growth factor control of olfactory neurogenesis and neuron survival in vitro: roles of EGF and TGF-beta s. Neuron 10:293-305. Malatesta P, Hartfuss E, Gotz M (2000) Isolation of radial glial cells by fluorescent- activated cell sorting reveals a neuronal lineage. Development 127:5253-5263. Malatesta P, Hack MA, Hartfuss E, Kettenmann H, Klinkert W, Kirchhoff F, Gotz M (2003) Neuronal or glial progeny: regional differences in radial glia fate. Neuron 37:751-764. Manglapus GL, Youngentob SL, Schwob JE (2004) Expression patterns of basic helix- loop-helix transcription factors define subsets of olfactory progenitor cells. J Comp Neurol 479:216-233. Mason I (2007) Initiation to end point: the multiple roles of fibroblast growth factors in neural development. Nat Rev Neurosci 8:583-596. 189 Mathis L, Bonnerot C, Puelles L, Nicolas JF (1997) Retrospective clonal analysis of the cerebellum using genetic laacZ/lacZ mouse mosaics. Development 124:4089- 4104. Matsuo T, Osumi-Yamashita N, Noji S, Ohuchi H, Koyama E, Myokai F, Matsuo N, Taniguchi S, Doi H, Iseki S, et al. (1993) A mutation in the Pax-6 gene in rat small eye is associated with impaired migration of midbrain crest cells. Nat Genet 3:299-304. McCarthy M, Turnbull DH, Walsh CA, Fishell G (2001) Telencephalic neural progenitors appear to be restricted to regional and glial fates before the onset of neurogenesis. J Neurosci 21:6772-6781. McKay R (1997) Stem cells in the central nervous system. Science 276:66-71. Medvinsky A, Dzierzak E (1998) Development of the definitive hematopoietic hierarchy in the mouse. Dev Comp Immunop 22:289-301. Mehler MF, Mabie PC, Zhu G, Gokhan S, Kessler JA (2000) Developmental changes in progenitor cell responsiveness to bone morphogenetic proteins differentially modulate progressive CNS lineage fate. Dev Neurosci 22:74-85. Mercier F, Kitasako JT, Hatton GI (2002) Anatomy of the brain neurogenic zones revisited: fractones and the fibroblast/macrophage network. J Comp Neurol 451:170-188. Merkle FT, Mirzadeh Z, Alvarez-Buylla A (2007) Mosaic organization of neural stem cells in the adult brain. Science 317:381-384. Merkle FT, Tramontin AD, Garcia-Verdugo JM, Alvarez-Buylla A (2004) Radial glia give rise to adult neural stem cells in the subventricular zone. Proc Natl Acad Sci U S A 101:17528-17532. Merlo GR, Mantero S, Zaghetto AA, Peretto P, Paina S, Gozzo M (2007) The role of Dlx homeogenes in early development of the olfactory pathway. J Mol Histol 38:612- 623. Metzger D, Clifford J, Chiba H, Chambon P (1995) Conditional site-specific recombination in mammalian cells using a ligand-dependent chimeric Cre recombinase. Proc Natl Acad Sci U S A 92:6991-6995. 190 Mignone JL, Kukekov V, Chiang AS, Steindler D, Enikolopov G (2004) Neural stem and progenitor cells in nestin-GFP transgenic mice. J Comp Neurol 469:311-324. Miller AD (1992) Retroviral vectors. Curr Top Microbiol Immunol 158:1-24. Mission JP, Takahashi T, Caviness VS, Jr. (1991) Ontogeny of radial and other astroglial cells in murine cerebral cortex. Glia 4:138-148. Misson JP, Edwards MA, Yamamoto M, Caviness VS, Jr. (1988) Identification of radial glial cells within the developing murine central nervous system: studies based upon a new immunohistochemical marker. Brain Res Dev Brain Res 44:95-108. Miyamichi K, Serizawa S, Kimura HM, Sakano H (2005) Continuous and overlapping expression domains of odorant receptor genes in the olfactory epithelium determine the dorsal/ventral positioning of glomeruli in the olfactory bulb. J Neurosci 25:3586-3592. Miyata T, Kawaguchi A, Okano H, Ogawa M (2001) Asymmetric inheritance of radial glial fibers by cortical neurons. Neuron 31:727-741. Miyawaki A, Homma H, Tamura H, Matsui M, Mikoshiba K (1996) Zonal distribution of sulfotransferase for phenol in olfactory sustentacular cells. Embo J 15:2050-2055. Miyoshi G, Fishell G (2006) Directing neuron-specific transgene expression in the mouse CNS. Curr Opin Neurobiol 16:577-584. Mohammadi M, McMahon G, Sun L, Tang C, Hirth P, Yeh BK, Hubbard SR, Schlessinger J (1997) Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276:955-960. Molofsky AV, Pardal R, Morrison SJ (2004) Diverse mechanisms regulate stem cell self- renewal. Curr Opin Cell Biol 16:700-707. Moon C, Yoo JY, Matarazzo V, Sung YK, Kim EJ, Ronnett GV (2002) Leukemia inhibitory factor inhibits neuronal terminal differentiation through STAT3 activation. Proc Natl Acad Sci U S A 99:9015-9020. Mori K, Fujita SC, Imamura K, Obata K (1985) Immunohistochemical study of subclasses of olfactory nerve fibers and their projections to the olfactory bulb in the rabbit. J Comp Neurol 242:214-229. 191 Mori T, Tanaka K, Buffo A, Wurst W, Kuhn R, Gotz M (2006) Inducible gene deletion in astroglia and radial glia--a valuable tool for functional and lineage analysis. Glia 54:21-34. Morrison SJ (2001) Neuronal potential and lineage determination by neural stem cells. Curr Opin Cell Biol 13:666-672. Morrison SJ, White PM, Zock C, Anderson DJ (1999) Prospective identification, isolation by flow cytometry, and in vivo self-renewal of multipotent mammalian neural crest stem cells. Cell 96:737-749. Morshead CM, van der Kooy D (2004) Disguising adult neural stem cells. Curr Opin Neurobiol 14:125-131. Morshead CM, Craig CG, van der Kooy D (1998) In vivo clonal analyses reveal the properties of endogenous neural stem cell proliferation in the adult mammalian forebrain. Development 125:2251-2261. Morshead CM, Garcia AD, Sofroniew MV, van Der Kooy D (2003) The ablation of glial fibrillary acidic protein-positive cells from the adult central nervous system results in the loss of forebrain neural stem cells but not retinal stem cells. Eur J Neurosci 18:76-84. Morshead CM, Reynolds BA, Craig CG, McBurney MW, Staines WA, Morassutti D, Weiss S, van der Kooy D (1994) Neural stem cells in the adult mammalian forebrain: a relatively quiescent subpopulation of subependymal cells. Neuron 13:1071-1082. Mumm JS, Shou J, Calof AL (1996) Colony-forming progenitors from mouse olfactory epithelium: evidence for feedback regulation of neuron production. Proc Natl Acad Sci U S A 93:11167-11172. Murdoch B, Roskams AJ (2007) Olfactory epithelium progenitors: insights from transgenic mice and in vitro biology. J Mol Histol 38:581-599. Murdoch B, Roskams AJ (2008) A novel embryonic nestin-expressing radial glia-like progenitor gives rise to zonally restricted olfactory and vomeronasal neurons. Journal of Neuroscience in press. 192 Nagai T, Ibata K, Park ES, Kubota M, Mikoshiba K, Miyawaki A (2002) A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20:87-90. Nan B, Getchell ML, Partin JV, Getchell TV (2001) Leukemia inhibitory factor, interleukin-6, and their receptors are expressed transiently in the olfactory mucosa after target ablation. J Comp Neurol 435:60-77. Newman MP, Feron F, Mackay-Sim A (2000) Growth factor regulation of neurogenesis in adult olfactory epithelium. Neuroscience 99:343-350. Ninkovic J, Gotz M (2007) Signaling in adult neurogenesis: from stem cell niche to neuronal networks. Curr Opin Neurobiol 17:338-344. Noctor SC, Martinez-Cerdeno V, Ivic L, Kriegstein AR (2004) Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. Nat Neurosci 7:136-144. Noctor SC, Flint AC, Weissman TA, Dammerman RS, Kriegstein AR (2001) Neurons derived from radial glial cells establish radial units in neocortex. Nature 409:714- 720. Novak A, Guo C, Yang W, Nagy A, Lobe CG (2000) Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision. Genesis 28:147-155. Ohtsuka T, Ishibashi M, Gradwohl G, Nakanishi S, Guillemot F, Kageyama R (1999) Hes1 and Hes5 as notch effectors in mammalian neuronal differentiation. Embo J 18:2196-2207. Oka Y, Kobayakawa K, Nishizumi H, Miyamichi K, Hirose S, Tsuboi A, Sakano H (2003) O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner. Eur J Biochem 270:1995-2004. Orban PC, Chui D, Marth JD (1992) Tissue- and site-specific DNA recombination in transgenic mice. Proc Natl Acad Sci U S A 89:6861-6865. Ornitz DM, Itoh N (2001) Fibroblast growth factors. Genome Biol 2:REVIEWS3005. 193 Ornitz DM, Xu J, Colvin JS, McEwen DG, MacArthur CA, Coulier F, Gao G, Goldfarb M (1996) Receptor specificity of the fibroblast growth factor family. J Biol Chem 271:15292-15297. Ortega S, Ittmann M, Tsang SH, Ehrlich M, Basilico C (1998) Neuronal defects and delayed wound healing in mice lacking fibroblast growth factor 2. Proc Natl Acad Sci U S A 95:5672-5677. Othman M, Lu C, Klueber K, Winstead W, Roisen F (2005) Clonal analysis of adult human olfactory neurosphere forming cells. Biotech Histochem 80:189-200. Othman MM, Klueber KM, Roisen FJ (2003) Identification and culture of olfactory neural progenitors from GFP mice. Biotech Histochem 78:57-70. Palma V, Lim DA, Dahmane N, Sanchez P, Brionne TC, Herzberg CD, Gitton Y, Carleton A, Alvarez-Buylla A, Altaba ARi (2005) Sonic hedgehog controls stem cell behavior in the postnatal and adult brain. Development 132:335-344. Palmer TD, Takahashi J, Gage FH (1997) The adult rat hippocampus contains primordial neural stem cells. Mol Cell Neurosci 8:389-404. Palmer TD, Willhoite AR, Gage FH (2000) Vascular niche for adult hippocampal neurogenesis. J Comp Neurol 425:479-494. Palmer TD, Markakis EA, Willhoite AR, Safar F, Gage FH (1999) Fibroblast growth factor-2 activates a latent neurogenic program in neural stem cells from diverse regions of the adult CNS. J Neurosci 19:8487-8497. Panganiban G, Rubenstein JL (2002) Developmental functions of the Distal-less/Dlx homeobox genes. Development 129:4371-4386. Peretto P, Cummings D, Modena C, Behrens M, Venkatraman G, Fasolo A, Margolis FL (2002) BMP mRNA and protein expression in the developing mouse olfactory system. J Comp Neurol 451:267-278. Perrier AL, Tabar V, Barberi T, Rubio ME, Bruses J, Topf N, Harrison NL, Studer L (2004) Derivation of midbrain dopamine neurons from human embryonic stem cells. Proc Natl Acad Sci U S A 101:12543-12548. Pincus DW, Keyoung HM, Harrison-Restelli C, Goodman RR, Fraser RA, Edgar M, Sakakibara S, Okano H, Nedergaard M, Goldman SA (1998) Fibroblast growth 194 factor-2/brain-derived neurotrophic factor-associated maturation of new neurons generated from adult human subependymal cells. Ann Neurol 43:576-585. Pixley SK (1996) Characterization of olfactory receptor neurons and other cell types in dissociated rat olfactory cell cultures. International Journal of Developmental Neuroscience 14:823-839. Qian X, Davis AA, Goderie SK, Temple S (1997) FGF2 concentration regulates the generation of neurons and glia from multipotent cortical stem cells. Neuron 18:81- 93. Qian X, Shen Q, Goderie SK, He W, Capela A, Davis AA, Temple S (2000) Timing of CNS cell generation: a programmed sequence of neuron and glial cell production from isolated murine cortical stem cells. Neuron 28:69-80. Qiu M, Bulfone A, Martinez S, Meneses JJ, Shimamura K, Pedersen RA, Rubenstein JL (1995) Null mutation of Dlx-2 results in abnormal morphogenesis of proximal first and second branchial arch derivatives and abnormal differentiation in the forebrain. Genes Dev 9:2523-2538. Rakic P (1972) Mode of cell migration to the superficial layers of fetal monkey neocortex. J Comp Neurol 145:61-83. Rakic P (1995) A small step for the cell, a giant leap for mankind: a hypothesis of neocortical expansion during evolution. Trends Neurosci 18:383-388. Rakic P (2003) Developmental and evolutionary adaptations of cortical radial glia. Cereb Cortex 13:541-549. Ramirez-Castillejo C, Sanchez-Sanchez F, Andreu-Agullo C, Ferron SR, Aroca-Aguilar JD, Sanchez P, Mira H, Escribano J, Farinas I (2006) Pigment epithelium-derived factor is a niche signal for neural stem cell renewal. Nat Neurosci 9:331-339. Rao MS (1999) Multipotent and restricted precursors in the central nervous system. Anat Rec 257:137-148. Rawson NE, LaMantia AS (2006) Once and again: retinoic acid signaling in the developing and regenerating olfactory pathway. J Neurobiol 66:653-676. Regad T, Roth M, Bredenkamp N, Illing N, Papalopulu N (2007) The neural progenitor- specifying activity of FoxG1 is antagonistically regulated by CKI and FGF. Nat Cell Biol 9:531-540. 195 Reh TA, Fischer AJ (2006) Retinal stem cells. Methods Enzymol 419:52-73. Reid CB, Liang I, Walsh C (1995) Systematic widespread clonal organization in cerebral cortex. Neuron 15:299-310. Ressler KJ, Sullivan SL, Buck LB (1994) Information coding in the olfactory system: evidence for a stereotyped and highly organized epitope map in the olfactory bulb. Cell 79:1245-1255. Reuss B, von Bohlen und Halbach O (2003) Fibroblast growth factors and their receptors in the central nervous system. Cell Tissue Res 313:139-157. Epub 2003 Jul 2005. Reynolds BA, Weiss S (1992) Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255:1707-1710. Reynolds BA, Weiss S, Tetzlaff W (1996) Clonal and population analyses demonstrate that an EGF-responsive mammalian embryonic CNS precursor is a stem cell. Dev Biol 175:1-13. Rickmann M, Amaral DG, Cowan WM (1987) Organization of radial glial cells during the development of the rat dentate gyrus. J Comp Neurol 264:449-479. Rietze RL, Valcanis H, Brooker GF, Thomas T, Voss AK, Bartlett PF (2001) Purification of a pluripotent neural stem cell from the adult mouse brain. Nature 412:736-739. Rodriguez EM, Blazquez JL, Pastor FE, Pelaez B, Pena P, Peruzzo B, Amat P (2005) Hypothalamic tanycytes: a key component of brain-endocrine interaction. Int Rev Cytol 247:89-164. Roisen FJ, Klueber KM, Lu CL, Hatcher LM, Dozier A, Shields CB, Maguire S (2001) Adult human olfactory stem cells. Brain Res 890:11-22. Roskams AJ, Cai X, Ronnett GV (1998) Expression of neuron-specific beta-III tubulin during olfactory neurogenesis in the embryonic and adult rat. Neuroscience 83:191-200. Roskams AJ, Bethel MA, Hurt KJ, Ronnett GV (1996) Sequential expression of Trks A, B, and C in the regenerating olfactory neuroepithelium. J Neurosci 16:1294-1307. Sanes DH, Reh TA, Harris WA (2000) Development of the Nervous System. San Diego: Academic Press. 196 Sasai Y, Kageyama R, Tagawa Y, Shigemoto R, Nakanishi S (1992) Two mammalian helix-loop-helix factors structurally related to Drosophila hairy and Enhancer of split. Genes Dev 6:2620-2634. Satoh M, Yoshida T (1997) Promotion of neurogenesis in mouse olfactory neuronal progenitor cells by leukemia inhibitory factor in vitro. Neurosci Lett 225:165-168. Satoh M, Yoshida T (2000) Expression of neural properties in olfactory cytokeratin- positive basal cell line. Brain Res Dev Brain Res 121:219-222. Sauer B (1998) Inducible gene targeting in mice using the Cre/lox system. Methods 4:381-392. Scherson T, Serbedzija G, Fraser S, Bronner-Fraser M (1993) Regulative capacity of the cranial neural tube to form neural crest. Development 118:1049-1062. Schlessinger J (2000) Cell signaling by receptor tyrosine kinases. Cell 103:211-225. Schmechel DE, Rakic P (1979) A Golgi study of radial glial cells in developing monkey telencephalon: morphogenesis and transformation into astrocytes. Anat Embryol (Berl) 156:115-152. Schwartz Levey M, Chikaraishi DM, Kauer JS (1991) Characterization of potential precursor populations in the mouse olfactory epithelium using immunocytochemistry and autoradiography. J Neurosci 11:3556-3564. Schwob JE (2002) Neural regeneration and the peripheral olfactory system. Anat Rec 269:33-49. Schwob JE, Gottlieb DI (1986) The primary olfactory projection has two chemically distinct zones. J Neurosci 6:3393-3404. Seaberg RM, van der Kooy D (2002) Adult rodent neurogenic regions: the ventricular subependyma contains neural stem cells, but the dentate gyrus contains restricted progenitors. J Neurosci 22:1784-1793. Seaberg RM, van der Kooy D (2003) Stem and progenitor cells: the premature desertion of rigorous definitions. Trends Neurosci 26:125-131. Seri B, Garcia-Verdugo JM, McEwen BS, Alvarez-Buylla A (2001) Astrocytes give rise to new neurons in the adult mammalian hippocampus. J Neurosci 21:7153-7160. Shah NM, Marchionni MA, Isaacs I, Stroobant P, Anderson DJ (1994) Glial growth factor restricts mammalian neural crest stem cells to a glial fate. Cell 77:349-360. 197 Shen Q, Goderie SK, Jin L, Karanth N, Sun Y, Abramova N, Vincent P, Pumiglia K, Temple S (2004) Endothelial cells stimulate self-renewal and expand neurogenesis of neural stem cells. Science 304:1338-1340. Shou J, Rim PC, Calof AL (1999) BMPs inhibit neurogenesis by a mechanism involving degradation of a transcription factor. Nat Neurosci 2:339-345. Shou J, Murray RC, Rim PC, Calof AL (2000) Opposing effects of bone morphogenetic proteins on neuron production and survival in the olfactory receptor neuron lineage [In Process Citation]. Development 127:5403-5413. Sidman RL, Rakic P (1973) Neuronal migration, with special reference to developing human brain: a review. Brain Res 62:1-35. Sjodal M, Edlund T, Gunhaga L (2007) Time of exposure to BMP signals plays a key role in the specification of the olfactory and lens placodes ex vivo. Dev Cell 13:141- 149. Smart IH (1971) Location and orientation of mitotic figures in the developing mouse olfactory epithelium. J Anat 109:243-251. Sohur US, Emsley JG, Mitchell BD, Macklis JD (2006) Adult neurogenesis and cellular brain repair with neural progenitors, precursors and stem cells. Philos Trans R Soc Lond B Biol Sci 361:1477-1497. Soriano P (1999) Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21:70-71. Spradling A, Drummond-Barbosa D, Kai T (2001) Stem cells find their niche. Nature 414:98-104. Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, Costantini F (2001) Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1:4. Stemple DL, Anderson DJ (1992) Isolation of a stem cell for neurons and glia from the mammalian neural crest. Cell 71:973-985. Stern CD, Fraser SE (2001) Tracing the lineage of tracing cell lineages. Nat Cell Biol 3:E216-218. 198 Strotmann J, Wanner I, Helfrich T, Beck A, Breer H (1994a) Rostro-caudal patterning of receptor-expressing olfactory neurones in the rat nasal cavity. Cell Tissue Res 278:11-20. Strotmann J, Wanner I, Helfrich T, Beck A, Meinken C, Kubick S, Breer H (1994b) Olfactory neurones expressing distinct odorant receptor subtypes are spatially segregated in the nasal neuroepithelium. Cell Tissue Res 276:429-438. Stuhmer T, Anderson SA, Ekker M, Rubenstein JL (2002) Ectopic expression of the Dlx genes induces glutamic acid decarboxylase and Dlx expression. Development 129:245-252. Sunabori T, Suyama S, Tokunaga A, Okano H (2007) Inactivation of the SOX/POU complex during neural differentiation Society for Neuroscience abstract 236.10. Takaki E, Fujimoto M, Sugahara K, Nakahari T, Yonemura S, Tanaka Y, Hayashida N, Inouye S, Takemoto T, Yamashita H, Nakai A (2006) Maintenance of olfactory neurogenesis requires HSF1, a major heat shock transcription factor in mice. J Biol Chem 281:4931-4937. Temple S (2001) The development of neural stem cells. Nature 414:112-117. Temple S, Qian X (1995) bFGF, neurotrophins, and the control or cortical neurogenesis. Neuron 15:249-252. Temple S, Alvarez-Buylla A (1999) Stem cells in the adult mammalian central nervous system. Curr Opin Neurobiol 9:135-141. Theriault FM, Roy P, Stifani S (2004) AML1/Runx1 is important for the development of hindbrain cholinergic branchiovisceral motor neurons and selected cranial sensory neurons. Proc Natl Acad Sci U S A 101:10343-10348. Theriault FM, Nuthall HN, Dong Z, Lo R, Barnabe-Heider F, Miller FD, Stifani S (2005) Role for Runx1 in the proliferation and neuronal differentiation of selected progenitor cells in the mammalian nervous system. J Neurosci 25:2050-2061. Tietjen I, Rihel JM, Cao Y, Koentges G, Zakhary L, Dulac C (2003) Single-cell transcriptional analysis of neuronal progenitors. Neuron 38:161-175. Toma JG, Akhavan M, Fernandes KJ, Barnabe-Heider F, Sadikot A, Kaplan DR, Miller FD (2001) Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nat Cell Biol 3:778-784. 199 Tronche F, Kellendonk C, Kretz O, Gass P, Anlag K, Orban PC, Bock R, Klein R, Schutz G (1999) Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nat Genet 23:99-103. Tropepe V, Craig CG, Morshead CM, van der Kooy D (1997) Transforming growth factor-alpha null and senescent mice show decreased neural progenitor cell proliferation in the forebrain subependyma. J Neurosci 17:7850-7859. Tropepe V, Sibilia M, Ciruna BG, Rossant J, Wagner EF, van der Kooy D (1999) Distinct neural stem cells proliferate in response to EGF and FGF in the developing mouse telencephalon. Dev Biol 208:166-188. Tropepe V, Coles BL, Chiasson BJ, Horsford DJ, Elia AJ, McInnes RR, van der Kooy D (2000) Retinal stem cells in the adult mammalian eye. Science 287:2032-2036. Tsai MJ, O'Malley BW (1994) Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451-486. Tsai RY, Reed RR (1998) Identification of DNA recognition sequences and protein interaction domains of the multiple-Zn-finger protein Roaz. Mol Cell Biol 18:6447- 6456. Uchida N, Buck DW, He D, Reitsma MJ, Masek M, Phan TV, Tsukamoto AS, Gage FH, Weissman IL (2000) Direct isolation of human central nervous system stem cells. Proc Natl Acad Sci U S A 97:14720-14725. Vassar R, Ngai J, Axel R (1993) Spatial segregation of odorant receptor expression in the mammalian olfactory epithelium. Cell 74:309-318. Vescovi AL, Reynolds BA, Fraser DD, Weiss S (1993) bFGF regulates the proliferative fate of unipotent (neuronal) and bipotent (neuronal/astroglial) EGF-generated CNS progenitor cells. Neuron 11:951-966. Vincent AJ, West AK, Chuah MI (2005) Morphological and functional plasticity of olfactory ensheathing cells. J Neurocytol 34:65-80. Voigt T (1989) Development of glial cells in the cerebral wall of ferrets: direct tracing of their transformation from radial glia into astrocytes. J Comp Neurol 289:74-88. Walters E, Grillo M, Tarozzo G, Stein-Izsak C, Corbin J, Bocchiaro C, Margolis FL (1996) Proximal regions of the olfactory marker protein gene promoter direct olfactory neuron-specific expression in transgenic mice. J Neurosci Res 43:146-160. 200 Walther C, Guenet JL, Simon D, Deutsch U, Jostes B, Goulding MD, Plachov D, Balling R, Gruss P (1991) Pax: a murine multigene family of paired box-containing genes. Genomics 11:424-434. Wang MM, Reed RR (1993) Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast. Nature 364:121-126. Wang SS, Tsai RY, Reed RR (1997) The characterization of the Olf-1/EBF-like HLH transcription factor family: implications in olfactory gene regulation and neuronal development. J Neurosci 17:4149-4158. Waseem NH, Lane DP (1990) Monoclonal antibody analysis of the proliferating cell nuclear antigen (PCNA). Structural conservation and the detection of a nucleolar form. J Cell Sci 96:121-129. Weiler E, Farbman AI (1997) Proliferation in the rat olfactory epithelium: age-dependent changes. J Neurosci 17:3610-3622. Weinstein DC, Hemmati-Brivanlou A (1999) Neural induction. Annu Rev Cell Dev Biol 15:411-433. Weiss S, van der Kooy D (1998) CNS stem cells: where's the biology (a.k.a. beef)? J Neurobiol 36:307-314. Weiss S, Reynolds BA, Vescovi AL, Morshead C, Craig CG, van der Kooy D (1996a) Is there a neural stem cell in the mammalian forebrain? Trends Neurosci 19:387- 393. Weiss S, Dunne C, Hewson J, Wohl C, Wheatley M, Peterson AC, Reynolds BA (1996b) Multipotent CNS stem cells are present in the adult mammalian spinal cord and ventricular neuroaxis. J Neurosci 16:7599-7609. Weissman IL (2000) Stem cells: units of development, units of regeneration, and units in evolution. Cell 100:157-168. Weissman IL, Anderson DJ, Gage F (2001) Stem and progenitor cells: origins, phenotypes, lineage commitments, and transdifferentiations. Annu Rev Cell Dev Biol 17:387-403. Whitesides J, Hall M, Anchan R, LaMantia AS (1998) Retinoid signaling distinguishes a subpopulation of olfactory receptor neurons in the developing and adult mouse. J Comp Neurol 394:445-461. 201 Whitesides JG, 3rd, LaMantia AS (1996) Differential adhesion and the initial assembly of the mammalian olfactory nerve. J Comp Neurol 373:240-254. Wichterle H, Garcia-Verdugo JM, Alvarez-Buylla A (1997) Direct evidence for homotypic, glia-independent neuronal migration. Neuron 18:779-791. Wichterle H, Lieberam I, Porter JA, Jessell TM (2002) Directed differentiation of embryonic stem cells into motor neurons. Cell 110:385-397. Williams BP, Price J (1995) Evidence for multiple precursor cell types in the embryonic rat cerebral cortex. Neuron 14:1181-1188. Wolpert L (1994) Positional information and pattern formation in development. Dev Genet 15:485-490. Wu HH, Ivkovic S, Murray RC, Jaramillo S, Lyons KM, Johnson JE, Calof AL (2003) Autoregulation of neurogenesis by GDF11. Neuron 37:197-207. Xie T, Kawase E, Kirilly D, Wong MD (2005) Intimate relationships with their neighbors: tales of stem cells in Drosophila reproductive systems. Dev Dyn 232:775-790. Xu RH, Peck RM, Li DS, Feng X, Ludwig T, Thomson JA (2005) Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells. Nat Methods 2:185-190. Xu Y, Baldassare M, Fisher P, Rathbun G, Oltz EM, Yancopoulos GD, Jessell TM, Alt FW (1993) LH-2: a LIM/homeodomain gene expressed in developing lymphocytes and neural cells. Proc Natl Acad Sci U S A 90:227-231. Xuan S, Baptista CA, Balas G, Tao W, Soares VC, Lai E (1995) Winged helix transcription factor BF-1 is essential for the development of the cerebral hemispheres. Neuron 14:1141-1152. Yaworsky PJ, Kappen C (1999) Heterogeneity of neural progenitor cells revealed by enhancers in the nestin gene. Dev Biol 205:309-321. Yoshihara Y, Kawasaki M, Tamada A, Fujita H, Hayashi H, Kagamiyama H, Mori K (1997) OCAM: A new member of the neural cell adhesion molecule family related to zone-to-zone projection of olfactory and vomeronasal axons. J Neurosci 17:5830-5842. Zehntner SP, Mackay-Sim A, Bushell GR (1998) Differentiation in an olfactory cell line. Analysis via differential display. Ann N Y Acad Sci 855:235-239. 202 Zhang X, Klueber KM, Guo Z, Lu C, Roisen FJ (2004) Adult human olfactory neural progenitors cultured in defined medium. Exp Neurol 186:112-123. Zhang X, Cai J, Klueber KM, Guo Z, Lu C, Qiu M, Roisen FJ (2005) Induction of oligodendrocytes from adult human olfactory epithelial-derived progenitors by transcription factors. Stem Cells 23:442-453. Zhang X, Cai J, Klueber KM, Guo Z, Lu C, Winstead WI, Qiu M, Roisen FJ (2006a) Role of transcription factors in motoneuron differentiation of adult human olfactory neuroepithelial-derived progenitors. Stem Cells 24:434-442. Zhang X, Klueber KM, Guo Z, Cai J, Lu C, Winstead WI, Qiu M, Roisen FJ (2006b) Induction of neuronal differentiation of adult human olfactory neuroepithelial- derived progenitors. Brain Res 1073-1074:109-119. Zimmerman L, Parr B, Lendahl U, Cunningham M, McKay R, Gavin B, Mann J, Vassileva G, McMahon A (1994a) Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors. Neuron 12:11-24. Zimmerman L, Parr B, Lendahl U, Cunningham M, McKay R, Gavin B, Mann J, Vassileva G, McMahon A (1994b) Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors. Neuron 12:11-24. Zinyk DL, Mercer EH, Harris E, Anderson DJ, Joyner AL (1998) Fate mapping of the mouse midbrain-hindbrain constriction using a site-specific recombination system. Curr Biol 8:665-668. Zon L (1995) Developmental biology of hematopoiesis. Blood 86:2876-2891. 203 APPENDIX 1  ANIMAL CARE CERTIFICATE 204

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0066464/manifest

Comment

Related Items