Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Protein kinase A-dependent phosphorylation and degradation of CDK8 : implications for yeast filamentous… Lourenço, Pedro Daniel Mira 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_fall_lourenco_pedro.pdf [ 2.68MB ]
Metadata
JSON: 24-1.0066450.json
JSON-LD: 24-1.0066450-ld.json
RDF/XML (Pretty): 24-1.0066450-rdf.xml
RDF/JSON: 24-1.0066450-rdf.json
Turtle: 24-1.0066450-turtle.txt
N-Triples: 24-1.0066450-rdf-ntriples.txt
Original Record: 24-1.0066450-source.json
Full Text
24-1.0066450-fulltext.txt
Citation
24-1.0066450.ris

Full Text

PROTEIN KINASE A-DEPENDENT PHOSPHORYLATION AND DEGRADATION OF CDK8: IMPLICATIONS FOR YEAST FILAMENTOUS GROWTH by PEDRO DANIEL MIRA LOURENÇO B.Sc., The University of British Columbia, 2006  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) June 2008 ! Pedro Daniel Mira Lourenço, 2008  i  ABSTRACT  S. cerevisiae have developed the ability to forage for nutrients when presented with conditions of starvation. This dimorphic adaptation is particularly noticeable when yeast are subject to nitrogen depravation and has been termed filamentous growth, as cells form filament-like projections away from the center of the colony. The regulation of this response is under the control of the well-characterized MAPK and cAMP pathways. Previous work showed that Cdk8p phosphorylated a key transcriptional activator of the filamentous response, Ste12p, and subsequently targeted the factor for degradation under conditions of limiting nitrogen. Data presented in this thesis suggests that Cdk8p is regulated by another kinase, Tpk2p. In vitro kinase assays demonstrate that Tpk2p directly phosphorylates Cdk8p on residue Thr37, leading to the destabilization of Cdk8p after growth for 4 hours in SLAD media. Lack of phosphorylation on Thr37 yields a hypofilamentous phenotype, whereas a phospho-mimic mutant, T37E displays a hyperfilamentous phenotype.  ii  TABLE OF CONTENTS ABSTRACT .......................................................................................................... ii TABLE OF CONTENTS ...................................................................................... iii LIST OF TABLES ................................................................................................ vi LIST OF FIGURES ............................................................................................. vii NOMENCLATURE ............................................................................................ viii ABBREVIATIONS ............................................................................................... ix ACKNOWLEDGEMENTS ....................................................................................x  1. INTRODUCTION 1.1 OBJECTIVE .........................................................................................1 1.2 CONTROL OF EUKARYOTIC TRANSCRIPTION ...............................2 1.3 GENE-SPECIFIC TRANSCRIPTIONAL ACTIVATORS AND REPRESSORS ....................................................................................2 1.4 RNA POLYMERASE II HOLOENZYME 1.4.1 The Core ...................................................................................3 1.4.2 RNA Polymerase Carboxy-Terminal Repeat Domain (CTD) .....4 1.4.3 General Transcription Factors ...................................................4 1.4.4 Mediator Complex .....................................................................6 1.5 FILAMENTOUS AND INVASIVE GROWTH 1.5.1 Diploid Pseudohyphal Growth ...................................................7 1.5.2 Haploid Invasive Growth ............................................................8 1.5.3 Mitogen-Activated Protein (MAP) Kinase Pathway ..................10 1.5.3.1 MAPK Pathway in Regulation of Pheromone Response....10 1.5.3.2 MAPK Pathway in Regulation of Filamentous Growth ......11 1.5.3.3 Assumed Transference of Function: MAPK Regulation of the Filamentous and Pheromone Response .................................14 1.5.4 cAMP-Dependent Pathway .....................................................15 1.5.4.1 Taskashi’s Protein Kinases ...............................................16 1.5.4.2 Targets of the TPK Isoforms .............................................18 1.5.4.3 Ras2-Dependent Regulation of cAMP ..............................19 1.5.4.4 Nitrogen Sensing ..............................................................20 1.5.5 Snf1 Protein Kinase Pathway ..................................................20 1.5.6 Cyclin-Dependent Kinase 8 (CDK8) Pathway .........................21  iii  1.6 CELL-CYCLE DEPENDENCE OF FILAMENTOUS GROWTH ..........24 1.6.1 General Characteristics of Cyclins and Cyclin-Dependent Kinases ....................................................................................25 1.6.2 Yeast CDK’s ............................................................................26 1.6.3 Cyclin-Dependent Kinase 8 and Cyclin C ................................27 1.6.4 CDK8-Dependent Regulation of Filamentous Growth .............28 1.6.5 Other Roles and Substrates of Cdk8p in S. cerevisiae ............28 1.7 TRANSCRIPTIONAL REGULATORS OF FILAMENTOUS GROWTH 1.7.1 Ste12p and Tec1p ...................................................................30 1.7.2 Msn1p ......................................................................................32 1.7.3 Sfl1p ........................................................................................33 1.7.4 Sok2p ......................................................................................34 1.7.5 Flo8p .......................................................................................34 1.7.6 Ash1p ......................................................................................35 1.7.7 Phd1p ......................................................................................35 1.8 EFFECTOR PROTEINS OF FILAMENTOUS GROWTH 1.8.1 FLO11 and the STA1-3 Genes ................................................36 1.8.2 Other Effector Proteins Involved in Pseudohyphae Formation 36 2. MATERIALS AND METHODS 2.1 MEDIA, YEAST AND E.COLI MANIPULATION 2.1.1 Growth Media ..........................................................................39 2.1.2 Yeast Transformations ............................................................39 2.1.3 Yeast Mating ...........................................................................39 2.1.4 Filamentous Growth Assays ....................................................40 2.2 YEAST STRAINS, PLASMIDS, AND OLIGONUCLEOTIDES ............41 2.3 MEASUREMENT OF TRANSCRIPTION 2.3.1 ß-galactosidase assays ...........................................................44 2.4 PROTEIN PREPARATION, ISOLATION AND MANIPULATION 2.4.1 Site-directed mutagenesis .......................................................44 2.4.2 TAP and HIS-tag Purification ...................................................44 2.4.3 Western-blotting ......................................................................45 2.4.4 In vitro Kinase Assays .............................................................45 2.4.5 Reticulocyte in vitro transcription/translation system ...............45  iv  3. RESULTS AND DISCUSSION 3.1 In vivo degradation of Cdk8p in response to nitrogen depravation .....47 3.2 cdk8 null strains hyperfilament and over-expression represses filamentation .......................................................................................49 3.3 Cdk8p is insensitive to nitrogen depravation in tpk2 null strains ........53 3.4 tpk2 null strains are nonfilamenting and overexpression of TPK2 activates filamentous response in absence of stimuli .........................55 3.5 Cdk8p contains typical PKA phosphorylation consensus sequence ..60 3.6 T37A and T37E Cdk8p mutants exhibit, respectively, hypo-filamenting and hyper-filamenting phenotypes .....................................................62 3.7 Tpk2p specifically phosphorylates Cdk8p at position Thr37 ...............65 3.8 Phosphorylation of Cdk8p on Thr37 results in its degradation ...........67 3.9 Over-expression of CDK8 reverses the tpk3 null phenotype ..............71 3.10 Human CDK8 complements a cdk8 null phenotype and is insensitive to nitrogen signaling ................................................................................73 4. CONCLUSION AND PERSPECTIVES ...................................................75 5. FUTURE DIRECTIONS ...........................................................................80 6. REFERENCES ........................................................................................81  v  LIST OF TABLES Table 1. The general transcription factors of RNA Pol II and their functions ........5 Table 2. Yeast Strains ........................................................................................41 Table 3. Plasmids ...............................................................................................42 Table 4. Oligonucleotides ...................................................................................43  vi  LIST OF FIGURES Figure 1.1 Life cycle of yeast Saccharomyces cerevisiae ....................................9 Figure 1.2 Pheromone-dependent activation of Ste12p via MAPK pathway ......12 Figure 1.3 MAPK-dependent induction of the filamentous response ..................13 Figure 1.4 cAMP-dependent regulation of filamentous response .......................17 Figure 1.5 Cdk8p represses filamentous growth via an inhibitory phosphorylation on Ste12p ...........................................................................................................23 Figure 3.1 Nitrogen depravation leads to degradation of Cdk8p ........................48 Figure 3.2 CDK8 is a repressor of filamentous growth .......................................51 Figure 3.3 CDK8 over-expression inhibits filamentous growth ...........................52 Figure 3.4 Deletion of TPK2 stabilizes Cdk8p during nitrogen starvation ...........54 Figure 3.5 TPK2 is required for filamentous growth and CDK8 functions downstream of TPK2 ..........................................................................................56 Figure 3.6 Yeast lacking TPK2 show decreased expression of Ste12-dependent filamentous responsive genes ............................................................................58 Figure 3.7 TPK2 over-expression induces filament formation in rich media .......59 Figure 3.8 Cdk8p contains a typical PKA/TPK consensus phosphorylation site 61 Figure 3.9 T37A CDK8 mutants are hypofilamentous and T37E CDK8 mutants are hyperfilamentous ..........................................................................................64 Figure 3.10 Tpk2p phosphorylates Cdk8p in vitro specifically on Thr37 .............66 Figure 3.11 T37A Cdk8p is stabilized in SLAD media and T37E Cdk8p is destabilized in rich and SLAD media ..................................................................68 Figure 3.12 Phospho-mimic mutant T37E Cdk8p destabilizes and targets Cdk8p for truncation ......................................................................................................70 Figure 3.13 TPK3 and CDK8 exert their effects on filamentation via opposing pathways ............................................................................................................72 Figure 3.14 Human CDK8 is homologous to S. cerevisiae CDK8 and displays sensitivity to nitrogen depletion ..........................................................................74 Figure 4.1 Schematic representation of the destabilization of Cdk8p by phosphorylation by Tpk2p ..................................................................................76 Figure 4.2 Integration of the pathways that regulate filamentous response .......78  vii  NOMENCLATURE Wild-type alleles in Saccharomyces cerevisiae are represented by italicized capital letters (e.g. CDK8), while mutant recessive alleles are denoted in lower case italics (e.g. cdk8). Gene products are written with the first letter capitalized, followed by the letter “p” at the end to denote “protein” (e.g. Cdk8p).  viii  ABBREVIATIONS ATP BSA cAMP cdc CDK CTD DNA E. Coli FRE GDP GTP IPTG kb kDa LB MAPK mRNA NAT OD PAGE PCR PIC PKA PRE S. cerevisiae SD SDS SDM SLAD RNA RNAPII Thr T37A T37E TPK UAS URA YPD ZEO  adenosone triphosphate bovine serum albumin cyclic adenosine monophosphatae cell-cycle division cyclin dependent kinase c-terminal domain deoxyribonucleic acid Escherichia coli filamentous response element guanine diphosphate guanine triphosphate isopropyl ß-D-thiogalacto-pyranoside kilo base pairs kilodalton luria broth mitogen activated protein kinase messenger ribonucleic acid nourseothricin optical density polyacrylamide gel electrophoresis polymerase chain reaction pre-initiation complex protein kinase A pheromone response element Saccharomyces cerevisiae synthethic dropout sodium dodecylsulfate site-directed mutagenesis synthetic low ammonium dextrose ribonucleic Acid rNA polymerase II threonine threonine 37 to alanine 37 threonine 37 to glutamate 37 takashi's protein kinases upstream activating sequence uracil yeast extract peptone dextrose zeocin  ix  ACKNOWLEDGEMENTS First and foremost, I would like to extent my extreme gratitude to Dr. Ivan Sadowski for the opportunity to study under his supervision, for his daily contagious enthusiasm about science, and for the exceptional guidance only a high-caliber scientist like he could offer. Thank you also to my committee members and excellent scientists Dr. Leann Howe and Dr. Vivien Measday for the fine advice and for bearing with my deadlines. Thanks also to lab members Dr. Thomas Malcolm, Ting-Cheng Su and Jennifer Parent, for their daily support and encouragement throughout the years I spent in the lab.  x  Introduction CHAPTER 1 – INTRODUCTION  1.1 OBJECTIVE Cdk8p is an important cyclin-dependent kinase (Cdk) involved in numerous transcriptional processes. While its role in the regulation of the GAL response and in the phosphorylation of the RNA Pol II CTD has been clearly established, little is known about its involvement in the regulation of filamentous growth. Previous work by Nelson et al. (2003) demonstrated that Cdk8p phosphorylates Ste12p, leading to its degradation, and that Cdk8p is destabilized in response to nitrogen depletion. This series of events is thought to regulate the induction of filamentous growth. My research objectives are to investigate how Cdk8p is destabilized in response to nitrogen depletion, what effects stabilization of Cdk8p has on pseudohyphae formation and to determine what signals upstream of Cdk8p transmit the signal for nitrogen depletion.  1  Introduction  1.2 CONTROL OF EUKARYOTIC TRANSCRIPTION Eukaryotic transcription is a precisely regulated process. Due to limited cellular resources and selective physiological needs, only a subset of genes is expressed at a given time-point. Therefore, mechanisms of transcriptional activation and repression are of utmost importance. Gene-specific activators function to initiate transcription via two main routes: (1) promoting the formation of the pre-initiation complex (PIC) by recruiting the RNA polymerase II holoenzyme complex and its associated factors; and (2) formation of open chromatin structure, which is transcriptionally active (Kornberg 1999). Gene-specific repressors, on the other hand, function by either: (1) inhibiting the formation of the PIC, presumably by preferentially binding to the promoter DNA and preventing the binding of transcriptional activators; and (2) formation of closed chromatin structure, which is transcriptionally inactive due to the inability of the transcriptional machinery to bind to promoters physically interacting with histone proteins (Maldonado et al. 1999). 1.3 GENE-SPECIFIC TRANSCRIPTIONAL ACTIVATORS AND REPRESSORS Saccharomyces cerevisiae are hypothesized to contain 5,651 genes (Kellis et al. 2003), thus cells are required to regulate gene expression, as simultaneous expression of all genes would result in cellular havoc. Simplistically, each gene is compromised of a coding sequence and an upstream promoter region. An eukaryotic promoter is comprised of a core promoter, which contains the transcription initiation site and the TATA box, and specific sequence elements that can interact with transcriptional activators, enhancers or repressors. Transcriptional activators and enhancers are factors capable of interacting with upstream activating sequences (UASs) or enhancer sequences, respectively. Activators and enhancer proteins possess DNA-binding domains that specifically recognize and bind to these elements; once bound, these activators form favorable protein-protein interactions with members of the RNA polymerase II  2  Introduction (RNAPII) complex and, thus, facilitate its recruitment to the promoter (Blackwood and Kadonaga 1998). While UASs are typically found within 2kb of the transcription start-site, enhancers have been documented to exist as far away as 85kb. Transcriptional repressors, on the other hand, interact with upstream repression sequences that inhibit transcription by out-competing activators for promoter binding, preventing recruitment of RNAPII and causing local chromatin structure modifications that prevent binding of either the general transcription machinery or the gene-specific factors (Maldonado et al. 1999), thus exerting their repressive effect. Transcriptional activators and repressors typically bind to and exert their functions on promoters in a gene-specific manner, thus precisely regulating expression. Therefore, understanding the mechanisms of these proteins and how their activities are regulated is of utmost importance and relevance.  1.4 RNA POLYMERASE II HOLOENZYME RNA Polymerase II holoenzyme is recruited to specific promoters of proteincoding genes. Due to a complex interplay of factors, the RNA polymerase II complex binds the promoter and initiates transcription. 1.4.1 The Core The Saccharomyces cerevisiae RNA polymerase II (RNAP II) core was initially purified as a 12 subunit complex and is in itself incapable of promoter recognition (Myer and Young 1998). The core RNAP II consists of 12 subunits, Rpb1p – Rpb12p, ranging in size from 6 to 200 kDa. Rpb1p and Rpb2p, the largest and, arguably, the most important subunits, are involved in the binding of DNA and the nucleotide substrates, respectively (Gnatt et al. 2001). The remaining subunits,  3  Introduction Rpb3p – Rpb12p, form a variety of complexes implicated in positioning of the DNA, transcription initiation and stress response (Choder and Young 1993). 1.4.2 RNA Polymerase Carboxy-Terminal Repeat Domain (CTD) The largest subunit of the RNAP II complex, Rpb1p, contains tandem repeats of the heptapeptide YSPTSPS. In yeast, the CTD is compromised of 26 or 27 repeats of the heptapeptide (Hampsey 1998). The CTD is essential and truncation results in a cold sensitive phenotype (Thompson et al. 1993). Modifications of the CTD alter the activity of the holoenzyme. The hypophosphorylated CTD, termed IIA, is correlated to transcriptionally inactive RNAP II, while the hyperphosphorylated form, IIO, is associated with the transcriptionally active enzyme (Riedl and Egly 2000). The phosphorylated form of the CTD also functions as a binding scaffold for numerous nuclear factors, such as elongation factors and mRNA capping enzyme, which emphasizes the global role of the CTD as a regulator of transcription (Phatnani and Greenleaf 2006).  1.4.3 General Transcription Factors The general transcription factors were initially purified for their capacity to enhance promoter recognition by the core RNAP II complex. By this assay, five factors were identified: TFIIB, TFIID, TFIIE, TFIIF, TFIIH (Orphanides et al. 1996). The broad roles of the general transcription factors are outlined in table 1.  4  Introduction  Table 1. The general transcription factors of RNA Pol II and their functions Factor TFIIB TFIID  TFIIE TFIIF TFIIH  Gene SUA7 SPT15 TAF1 TAF2 TAF3 TAF4 TAF5 TAF6 TAF7 TAF8 TAF9 TAF10 TAF11 TAF12 TAF13 TAF14 TFA1 TFA2 SSU1 TFG2 ANC1 TFB1 TFB2 TFB3 TFB4 RAD3 SSL1 SSL2 KIN28 CCL1  Function Transcription start site selection TATA box recognition and binding  Recruitment of TFIIH Suppression of non-specific binding of RNAP II; stablization of pre-initiation complex DNA-dependent ATPase; ATPdependent helicase; CTD kinase  5  Introduction  1.4.4 Mediator Complex In conjunction to the roles of transcriptional activators and repressors, there exists an additional module involved in regulating transcription. The mediator complex was initially identified in an experiment where it was hypothesized that over-expression of one activator would interfere with the efficiency of another (Gill and Ptashne 1988). All attempts to titrate this effect by addition of known general transcription factors and RNAPII components failed to relieve this phenomena and it was later determined that there was an additional factor contributing to this effect, the mediator. The mediator complex is comprised of 20 to 30 subunits, depending on the scheme and conditions of purification (Bjorklund and Gustafsson 2005). The mediator complex can function as an intermediary, relaying regulatory information from enhancers or repressors to the basal RNAPII transcription machinery. Given the mediator’s ability to interact with both transcriptional activators and repressors, the complex is capable of both gene repression and activation. Cdk8p, and by association Cyclin C, are components of the eukaryotic mediator complex. Cdk8p has been implicated as a general relay point of environmental stress, as is evidenced by the fact that introduction of kinase-dead alleles results in the de-repression of numerous genes involved in different stress responses (Holstege et al. 1998). It has been noted that Cdk8p levels decrease as yeast cells approximate the diauxic shift (Holstege et al. 1998), that Cyclin C is responsive to a magnitude of cellular stresses (Cooper et al. 1997) and that cdk8 or cycc null strains mimic nutrient starvation phenotypes (Holstege et al. 1998). The mediator, and in particular Cdk8p/CycCp, have been shown to be involved in nutrient sensing and stress-coping responses (Chang et al. 2001; Nelson et al. 2003).  6  Introduction The mediator has the ability to regulate transcription in response to a wide range of environmental signals and stresses, adding to eukaryotic cells’ repertoire of transcriptional regulatory mechanisms; thus, highlighting the complex interplay of factors and conditions that are involved in the regulation of gene expression in yeast.  1.5 FILAMENTOUS AND INVASIVE GROWTH It is well established that in response to the stress of nutrient depletion, Saccharomyces cerevisiae adopt a growth pattern and cell morphology that direct daughter cells to grow away from the colony as a means of foraging for nutrients. The pseudohyphae dimorphic change was first identified in the late 19th century (Hansen 1886), but only became notorious when re-discovered and implicated as an adaptation to nitrogen limitation (Gimeno et al. 1992); later evidence also implicated limited carbon source or presence of poor carbon source (Lambrechts et al. 1996) or fusel alcohols (Dickinson 1996) as environmental signals that lead to similar phenotypical responses.  1.5.1 Diploid Pseudohyphal Growth As a response to nitrogen depletion, diploid yeast strains undergo a series of morphological changes in which progeny cells are continuously placed in locations away from the center of the colony (Gimeno et al. 1992). During diploid pseudohyphal growth, cells become elongated, budding patterns switch from bipolar to unipolar and buds do not separate, thus producing chains of elongated and thin cells called pseudohyphae (Gancedo 2001). Nitrogen-depleted cells also exhibit a modified cell cycle, with progeny cells beginning to bud immediately following cytokinesis (Kron et al. 1994). As demonstrated in Figure 1, the shift in budding pattern results in buds emerging from the same pole of the elongated cell, allowing daughter cells to grow far beyond the perimeter of the colony and to  7  Introduction dig into the agar (Gimeno et al. 1992). This response typically occurs during conditions of nutrient starvation and, therefore, likely allows yeast cells to forage for nutrients. 1.5.2 Haploid Invasive Growth Unlike their diploid counterparts, haploid yeast cells are unable to form long, protruding filaments under conditions of limiting nutrients (Gimeno et al. 1992). However, their ability to forge for nutrients is still existent, although limited. Phenotypically, haploid cells, when in conditions of depleted nutrients, undergo a series of transformations similar to that of diploids: cells switch from a round to elongated shape; the budding pattern switches from axial to unipolar; and, buds emerge from the same side of the elongated cell (Roberts and Fink 1994). However, colonies fail to exhibit long, protruding filaments, Figure 1. Haploid filaments form and dig into the area confined below the colony and, thus, this response has been appropriately termed invasive growth (Gimeno et al. 1992; Dickinson 1996).  8  Introduction  Figure 1.1 Life cycle of yeast Saccharomyces cerevisiae Saccharomyces cerevisiae adopt a growth pattern and cell morphology that direct daughter cells to grow away from the colony as a means of foraging for nutrients when in conditions of limiting nitrogen or fermentable carbon or due to presence of fusel alcohol. Haploid yeast undergo invasive growth, while diploid yeast undergo pseudohyphal growth. 9  Introduction 1.5.3 Mitogen-Activated Protein (MAP) Kinase Pathway Historically, the MAP kinase pathway has been implicated in regulation of the morphogenetic switches of pheromone and filamentous response in yeast. The MAP kinase signaling module is dependent on multiple protein kinases, which are capable of transmitting a signal to their downstream targets via a series of consecutive phosphorylation events, which can directly regulate the various transcriptional activators involved both the pheromone and filamentous response (Levin and Errede 1995).  1.5.3.1  MAPK Pathway in Regulation of Pheromone Response  The MAPK signaling cascade is also implicated in the regulation of the pheromone response, albeit with a few minor difference in relation to its role in the filamentous response. The detection of pheromone and, subsequently, signaling to initiate the pheromone response is triggered when pheromone binds to the to G-coupled receptor of cells of the opposite mating type, Figure 1.2. These peptides are recognized by the opposite mating-type cells and, upon binding, cause a conformational change in the receptors, Ste2p in MATa cells and Ste3p in MAT! cells (Bender and Sprague 1986). Peptide mating pheromones, a- and !-factor, are known to cause haploid cells to transiently arrest in G1 phase and express genes required for mating with cells of the opposite mating type. MATa cells produce and secrete a-factor, a 12 aminoacid peptide that stimulates MAT! cells (Caldwell et al. 1995). MAT! cells, on the other hand, secrete !-factor, a 13 amino acid long peptide, which stimulates MATa cells. Binding of the pheromones to the seven-transmembrane receptors (Ste2p or Ste3p in MATa and MAT! cells, respectively) causes Gpa1p (! subunit) to dissociate from Ste4p/Ste18p (" and # subunits, respectively) (Herskowitz 1995). Dissociated Ste4p/18p interacts with the Rho-family GTPase Cdc24p and the Ste20p kinase, which in turn activate the first component of the MAPK pathway, the MAPKKK Ste11p. Ste11p ultimately phosphorylates and 10  Introduction activates Ste7p (the MAPKK), which subsequently activates Fus3p or Kss1p. Fus3p is the primary MAP kinase responsible for the activation of the mating response, although Kss1p has been found to have redundant roles, however Kss1p does not associate with Ste5p as does Fus1p (Elion et al. 1991). Activated Fus3p can activate two major substrates: Far1p a cyclin-dependent kinase inhibitor required for pheromone-induced cell-cycle arrest in G1 phase, and Ste12p, the transcriptional activator of both the filamentous and the mating-type response.  1.5.3.1  MAPK Pathway in Regulation of Filamentous Response  The MAP kinase pathway involved in the filamentous response includes many of the players implicated in the pheromone response. A proposed model (Figure 1.3) is that the signal for nitrogen starvation is transmitted to Ras2p, a small GTP-binding protein, that, once activated, activates the guanine nucleotide exchange factor Cdc24p (Roberts et al. 1997). Cdc24p facilitates the exchange of GDP for GTP on Cdc42p, enabling it to interact with protein kinase Ste20p and causing the kinase to dissociate from its negative inhibitor Hsl7p (Peter et al. 1996). Activated Ste20p is also found to interact with Bmh1p and Bmh2p, which appear to not be involved with invasive growth, but rather are required for cellular elongation. It is speculated that these proteins might play a role in cell elongation independently of the MAP kinase pathway (Roberts et al. 1997). Activated Ste20p then activates the MAP kinase cascade, leading the phosphorylation and subsequent activation of Ste11p, Ste7p and Kss1p (Gustin et al. 1998). Prior to phosphorylation by Ste7p, Kss1p interacts with transcriptional activator Ste12p and the negative regulators Dig1p and Dig2p, forming a complex that sequesters Ste12p and Tec1p from interacting with the well-defined Filamentous Response Element (FRE) (Cook et al. 1996; Bardwell et al. 1998). Kss1p phosphorylates Ste12p and Dig1/Dig2p, causing dissociation of Dig1p/Dig2p and de-represses the target genes to which Ste12p and Tec1p may bind (Bardwell et al. 1998).  11  Introduction  Figure 1.2 Pheromone-dependent activation of Ste12p via MAPK pathway Presence of pheromone triggers activation of the MAPK signaling cascade to activate either one of the redundant MAP Kinases Kss1p or Fus3p to relieve the inhibitory effects on the transcriptional activator Ste12p, allowing for the transcription of genes involved in mating. See text for details.  12  Introduction  Figure 1.3 MAPK-dependent induction of the filamentous response It is hypothesized that nitrogen deprivation leads to the activation of the MAPK pathway, resulting in the activation of the MAP kinase Kss1p, which, in turn, relieves the inhibitory effects of Dig1/2p on Ste12p. Note that it is not known how or if nitrogen deprivation stimulates this pathway. See text for details.  13  Introduction 1.5.3.2 Assumed transference of function: MAPK regulation of the filamentous and pheromone response As described previously, the MAPK pathway is implicated in activation of both the filamentous and the pheromone response. However, any inference of the MAPK pathway in the filamentous response is far stretched. There are numerous genetic studies implicating that the MAPK pathway is necessary for filament formation, yet, to date, there is no evidence to suggest that nitrogen signaling occurs via the MAPK pathway. A reasonable explanation is that the relation between filamentous growth and the MAPK pathway is an artifact of the shared requirement for the transcriptional activator Ste12p. The current models propose that both the filamentous and pheromone response are ultimately induced due to activation of Ste12p. However, since the STE12 promoter contains multiple Ste12p binding sites and STE12 expression is itself dependent on Ste12p, a basal level of the Ste12p activator is required for STE12 expression upon stimulation. The same occurs for TEC1 expression. Even without pheromone stimulation, there is basal signaling via the MAPK pathway due to spontaneous dissociation of the "# subunits from the G-protein coupled receptor (Siekhaus and Drubin 2003). This basal signaling likely allows for a small de-repression of Ste12p by relieving the inhibitory effects of the Dig1/2p and Kss1p proteins. The basal expression of STE12 is, thus, due to a leaky receptor. However, in strains that lack components of the MAPK pathway, Ste12p is under constant inhibition by Dig1/2p and Kss1p and, thus, Ste12-dependent expression of STE12 and TEC1 is eliminated. Therefore, induction of the filamentous response cannot occur because of the absence of uninhibited Ste12p; thus, the “requirement” of the MAPK pathway for the induction of the filamentous response.  14  Introduction 1.5.4 CAMP-Dependent Pathway Multiple signaling pathways regulate filamentous growth: in addition to the MAP kinase pathway, the cAMP-dependent pathway has also been extensively characterized and implicated with the filamentous response. Cyclic Adenosine Mono-Phosphate (cAMP) is a universal signaling molecule in most, if not all, living organisms. This secondary messenger controls multiple targets by regulating the activity of cAMP-dependent kinases. As depicted in Figure 1.4, Intracellular cAMP levels are dependent on two opposite activities: conversion of ATP into cAMP by adenylate cyclase, which is encoded by the CYR1 gene in yeast; and reduction in intracellular cAMP levels by action of the phosphodiesterases Pde1p and Pde2p (D'Souza and Heitman 2001). The activity of the Cyr1p adenylate cyclase is dependent on Ras2p, the small GTP-binding protein also implicated in the MAP kinase pathway (D'Souza and Heitman 2001). Under conditions of nutrient depletion, Gpa2, also regulates cAMP production via the activation of Cyr1p (Colombo et al. 1998). Increased cAMP levels result in the activation of the cAMP-dependent kinase, protein kinase A (PKA). In yeast, the PKA consists of a negative regulatory subunit, Bcy1p, in combination with one of the three isoforms of catalytic subunits: Tpk1p, Tpk2p and Tpk3p (Cannon and Tatchell 1987). Extracellular cAMP can enhance pseudohyphal differentiation in most wild-type strains and this effect is particularly evident in a pde2/pde2 mutant diploid. Concomitantly, extracellular cAMP was found to suppress the pseudohyphal differentiation defect in a gpa2/gpa2 (Lorenz and Heitman 1997). These previous findings serve to highlight the importance of cAMP-dependent kinases in the regulation of the filamentous response.  15  Introduction 1.5.4.1 Takashi's Protein Kinases The major downstream elements directly regulated by cAMP are the cAMPdependent kinases Tpk1p, Tpk2p, and Tpk3p. These kinases appear to have relatively redundant functions, as deletion of any combination of two isoforms does not result in considerable growth defects, whereas a triple deletion mutant is non-viable (Cannon and Tatchell 1987). Each of the three isoforms of TPK1-3 is directly inhibited by the Bcy1p regulatory subunit. Upon binding of cAMP to Bcy1p, a conformational change is induced that causes the regulatory subunit to dissociate from Tpk1p, Tpk2p or Tpk3p, liberating the active kinase (Toda et al. 1987). Of the three isoforms, Tpk2p appears to have the most pronounced effect on filamentation: a tpk2/tpk2 mutant strain fails to form filaments on nitrogen limiting media, whereas overexpression of TPK2 shows enhanced pseudohyphal growth (Robertson and Fink 1998). TPK3, on the other hand, was found to be an inhibitor of filamentous growth, while a role for TPK1 is less obvious, as one group has reported no effects of tpk1 deletions (Robertson and Fink 1998) and another implicated TPK1 as an inhibitor of the filamentous response, similarly to the effects of TPK3 (Pan and Heitman 1999). Tpk1p and Tpk3p are 88% identical over the kinase domain, while Tpk2p is approximately 76% identical to either Tpk1p or Tpk3p (Toda et al. 1987). This extensive similarity may be at the root of the redundancy between the three isoforms. Given the similarity in structure and, most likely, substrate recognition, cellular compartmentalization of the different isoforms is likely to be important with respect to signal specificity. In fact, Tpk2p was the only isoform localized to the nucleus, while Tpk1p and Tpk3p are both cytoplasmic kinases (Huh et al. 2003). Collectively, the three isoforms of TPK have an effect on filamentous growth by regulating multiple targets.  16  Introduction  Figure 1.4 cAMP-dependent regulation of filamentous response The Mep2p ammonia permease senses nitrogen levels. When ammonia is depleted, Mep2p activates Ras2p, which in turn activates the adenylate cyclase Cyr1p, resulting in the accumulation of cAMP. cAMP binds to the PKA inhibitory subunit Bcy1p, resulting in the release of free, active Tpk1p, Tpk2p or Tpk3p. Active Tpk2p phosphorylates the inhibitor Sfl1p, leading to its inactivation; the activator Flo8p is also phosphorylated by Tpk2p, a modification that leads to its activation. Collectively, phosphorylation of these two factors results in the activation of FLO11, a hallmark gene of filamenting yeast. 17  Introduction 1.5.4.2  Targets of the Tpk isoforms  The FLO11 gene is required for both haploid invasive and diploid pseudohyphal growth, thus it is an excellent reporter for assaying filamentous responsive transcription. Flo11p is a glycosylphosphatidylinositol-anchored cell-surface protein required for calcium-dependent cell-to-cell adhesion, a process also known as flocculation and highly characteristic of pseudohyphae (Lo and Dranginis 1998). The FLO11 promoter is one of the largest known yeast promoters, spanning approximately 4kb and containing multiple well characterized positive and negative regulatory elements for many of the factors involved in the filamentous response, such as Ste12p, Tec1p, Flo8p, Phd1p, Sfl1p, and Ash1p (Rupp et al. 1999). The cAMP-dependent pathway has been implicated in regulation of multiple factors involved in the expression of FLO11. Sfl1p is a DNA binding protein involved in the recruitment of the Ssn6-Tup1p repressor to the promoter region of the FLO11 gene (Figure 1.4) and can, therefore, be regarded as an inhibitor of FLO11 (Conlan and Tzamarias 2001). In a two-hybrid screen, Tpk2p was found to interact with Sfl1p, thus it is likely that Tpk2p regulate filamentous growth by alleviating repression of the FLO11 gene via its interaction with Sfl1p (Robertson and Fink 1998). In fact, FLO11 mRNA levels are increased in a sfl1 mutant, highlighting the negative effects of this transcriptional regulator. Further studies confirmed this interaction and found that Tpk2p phosphorylates Sfl1p, a modification that prohibits dimerization and DNA binding of this transcriptional repressor (Pan and Heitman 2002). The activity of Flo8p, a transcriptional activator, is also dependent on the cAMP pathway. Phosphorylation by Tpk2p promotes Flo8p binding and activation of the FLO11 promoter (Pan and Heitman 2002). In fact, common non-filamenting lab strains from the W303 and S288C backgrounds contain a non-functional allele of FLO8 which possesses a single point mutation that creates a premature stop codon and significantly reduces the ability of these strains to filament (Liu et al. 1996). 18  Introduction  1.5.4.3  Ras2 Dependent Regulation of cAMP  Ras2p is a small GTP-binding protein localized to the plasma membrane. It possesses a C-terminus with membrane anchoring lipids containing palmitoyl and farnesyl groups, which contribute to the cytoplasmic membrane localization of this signaling protein (Bhattacharya et al. 1995). Ras2p has been implicated in numerous signaling pathways, such as sporulation and filamentous growth, via its activating effects on the Cyr1p adenylate cyclase. The activity of Ras2p is itself dependent on other factors, such as Cdc25p, Ira1p and Ira2p. Cdc25p, a membrane bound guanine nucleotide exchange factor, binds to and activates Ras2p by directly promoting the exchange of GDP for GTP (Broek et al. 1985). Once activated, Ras2p directly stimulates the Cyr1p adenylate cyclase and, thus, cAMP levels are increased (Lai et al. 1993). On the other hand, the GTPases Ira1p and Ira2p can inactivate Ras2p by stimulating the hydrolysis of GTP to GDP (Parrini et al. 1996). In fact, Ras2p has early been associated with invasive and pseudohyphal growth, as the original results presented by Gimeno et al. (1992) showed that expression of a constitutively active form of Ras2p, the Ras2val19 allele, stimulated both types of growth even in nitrogen-rich conditions. Further studies have linked Ras2p activity to Cyr1p and, consequently, cAMP levels: cells harboring the hyperactive RAS2val19 allele when over-expressing PDE2, a cAMPdegrading phosphodiesterase, were suppressed in terms of pseudohyphal growth, as were cells expressing wild-type RAS2 (Ward and Garrett 1994; Ward et al. 1995).  19  Introduction 1.5.4.4 Nitrogen Sensing Nutrient sensing in yeast is often associated with nutrient specific transporters or permeases (Kruckeberg et al. 1998). With respect to nitrogen sensing, the ammonium permease Mep2p is responsible for sensing and providing the signal required for pseudohyphal differentiation (Lorenz and Heitman 1998). Three ammonium permeases have been identified to date, Mep1p, Mep2p, and Mep3p, however Mep2p is the only permease involved in sensing ammonium. A mep2 strain is incapable of filamentous growth in ammonium limiting media, yet cells’ ability to filament in response to limitations in other nitrogen sources such as glutamine or aspargaine remains intact. In fact, deletion of MEP2 does not result in any growth defects, suggesting that Mep2p has redundant functions with Mep1p and Mep3p in terms of ammonium transport, but plays a prominent role in the sensing and signaling of ammonium limitation (Lorenz and Heitman 1998). The Mep2p permease has been found to interact, via genetic studies, with Ras2p, a small membrane bound GTP-binding protein (Lorenz and Heitman 1998) and this interaction is likely the link between nitrogen sensing and the filamentous signaling cascades. However, the possibility of other signaling intermediates between Mep2p and Ras2p cannot be excluded at this point. Cdc25p, an additional membrane bound guanine nucleotide exchange factor, might also be involved in transmitting the signal from Mep2p to Ras2p.  1.5.5 Snf1 Protein Kinase Pathway Snf1p, an AMP-activated protein kinase, has been extensively implicated as a key player in the response of yeast to a wide variety of cellular stresses; it has been characterized as a general stress sensor and alters cellular dynamics to cope with the different stress via numerous stress-related processes such as phosphorylation of histone H3; direct regulation of RNA polymerase II holoenzyme; regulation of translation, glycogen and lipid biosynthesis; and regulation of general, salt and heat stress responses (reviewed in (Sanz 2003)).  20  Introduction  However, Snf1p is most well characterized due to its role in the signaling of glucose availability. Snf1p kinase is required for regulating the transcriptional changes associated with glucose phosphorylation-dependent derepression via the activation of two transcriptional activators, Cat8p and Sip4p, and inhibition of the transcriptional repressor Mig1p (Vallier and Carlson 1994; Hedges et al. 1995; Conlan and Tzamarias 2001). Further studies linked a single phosphorylation to the increased activity of the kinase in response to glucose deprivation. This phosphorylation has mapped to the conserved activation loop Thr210 residue and it was found to be performed by the redundant upstream kinases Sak1p, Tos3p and Elm1p (Hong et al. 2003; Sutherland et al. 2003) While historically Snf1p has been implicated in the glucose deprivation response, recent studies have shown that this AMP-activated kinase is also involved in coping with nitrogen limitation and subsequent pseudohyphal differentiation. It has been demonstrated by Kuchin et al. that Snf1p is required for filamentous growth, as is evidenced by the fact that a snf1 deletion mutant is incapable of forming pseudohyphae (Kuchin et al. 2002). It was later shown that phosphorylation on the Snf1p-activation-loop residue, Thr210, is required for pseudohyphae formation and that nitrogen limitation actually induces phosphorylation of this residue (Orlova et al. 2006). Activation of Snf1p by nitrogen starvation leads to increased activity of this kinase, a requirement for differentiation, as snf1 deletion mutants expressing the catalytically inactive Snf1K84R mutant are unable to filament, suggesting that Snf1p is involved in transmission of the signal for nitrogen starvation (Orlova et al. 2006).  21  Introduction 1.5.6 Cyclin-Dependent Kinase 8 (Cdk8) Pathway An additional player involved in the regulation of the filamentous response is Cyclin-Dependent Kinase 8 (Cdk8p) and, by association, Cyclin C. Under normal growth conditions, Cdk8p inhibits filamentous growth by phosphorylating and, consequently, destabilizing Ste12p (Nelson et al. 2003). However, when cells are placed in nitrogen-deprived conditions, Cdk8 is destabilized via what was until now an unknown mechanism and there is loss of Ste12p phosphorylation, resulting in its accumulation. Ste12p levels are of utmost importance for regulation of the filamentous response. Deletion of STE12 results in a non-filamenting and non-invasive phenotype, whereas over-expression of the transcription factor yields a significant increase in the rate of filamentation (Liu et al. 1993). Deletion of CDK8, on the other hand, results in a hyperfilamentous phenotype, due to the stabilization of Ste12p (Nelson et al. 2003). However, cdk8 null diploids are not constitutively filamentous in rich media, suggesting that other players are involved in the regulation of the filamentous response.The role of Cdk8p and Cyclin C in the control of filamentous growth will be discussed in more detail in subsequent sections.  22  Introduction  Figure 1.5 Cdk8p represses filamentous growth via an inhibitory phosphorylation on Ste12p Cdk8p inhibits filamentous growth in cells growing under nitrogen abundant conditions via constitutive phosphorylation of Ste12p and subsequent destabilization. Under conditions of limiting nitrogen, Cdk8p itself becomes destabilized via an unknown mechanism, resulting in loss of Ste12p phosphorylation, ultimately resulting the in the stabilization of the filamentous response transcriptional activator Ste12p.  23  Introduction 1.6 CELL-CYCLE DEPENDENCE OF FILAMENTOUS GROWTH In yeast, there are two major regulatory Cyclin-Dependent Kinases (CDK) that are involved in determining the passage of cells from most stages of the cellcycle: Cdc28p and Pho85p (Andrews and Measday 1998). There is a growing body of evidence to suggest that CDKs are required for the morphological changes and polarized growth associated with pseudohyphal differentiation (Madden and Snyder 1998). For example, in G1 phase, Cdc28p binding to either Cln1p or Cln2p cyclin is required for polarized growth, and over-expression either cyclin results in hyperpolarization and an elongated morphology. Concomitantly, a similar response is mimicked by delaying entry into G2 by eliminating Clb1p and Clb2p cyclins (Madden and Snyder 1998). However, the major evidence that the cell cycle is involved in pseudohyphal differentiation can be attributed to the fact that filamenting cells exhibit a modified cell cycle: the daughter cells of filamenting yeast begin to bud immediately following cytokinesis and, thus, bypass the size checkpoint (Kron et al. 1994). Later studies served to further emphasize the role of CDKs in regulating filamentous growth. A strain harbouring the CDC28-C127Y mutant, displays a constitutively filamenting morphology, including all previously identified characteristics, such as elongated shape, modified bud-site selection and altered cell cycle (Edgington et al. 1999). Through a series of genetic studies, the authors were also able to implicate Elm1p, Hsl1p and Swe1p as upstream regulators of Cdc28p. According to the model proposed by Edgington et al. (1999), Elm1p, a serine-threonine kinase, activates Hsl1p, another protein kinase. Deletion of either ELM1 or HSL1 result in constitutive filamentation, whereas dominant mutations of the HSL1 gene suppress filamentation, even in an eml1 deletion mutant strain, thus suggesting that Hsl1p is downstream of Elm1p. Hsl1p, once activated, has the ability to phosphorylate another protein kinase, Swe1p, although this modification is thought to inhibit this third kinase. According to this model, Swe1 constitutively phosphorylates Cdc28p, a modification that inhibits induction of the filamentous response. Deletion of either 24  Introduction ELM1 or HSL1 results in a hyperactive form of Swe1p and the corresponding filamentous phenotype. However, mutations or deletions in ELM1, HSL1 or SWE1 all fail to affect the phenotype of the cdc18-127 allele, this placing these regulatory kinases upstream of Cdc28p (Edgington et al. 1999). 1.6.1 General Characteristics of Cyclins and Cyclin-Dependent Kinases Cyclin-Dependent Kinases (CDKs) are a category of serine/threonine protein kinases whose activities are dependent on their association with other regulatory proteins termed cyclins (Pines 1995), which have gained popularity and their name due to their association with the cell cycle. Although the CDKs were originally identified due to their intricate association with the cell cycle, these kinases are constantly being implicated in a wide range of cellular processes, such as in the regulation of filamentous growth. In addition to conserved catalytic domains, members of the CDK family also share an evolutionarily conserved 16 amino acid sequence near N-terminus, known as the PSTAIRE motif (Li et al. 2004). Another characteristic common to the CDKs is the fact that these kinases phosphorylate S/T-P motifs (Langan et al. 1989); therefore, it is reasonable to expect that additional factors contribute to the specificity of this group of kinases and the interactions with cyclins is an excellent candidate to explain this differential kinase specificity. Cyclins are proteins whose levels vary throughout the cell cycle, as the name indicates. While only a certain subset actually displays cell cycle-dependent fluctuations, this family of proteins is very diverse, and members of this class range in size from 35 to 90 kDa. However, cyclins do have a conserved 100 residue ‘cyclin box’ domain, which is involved in CDK binding and activation (Lees and Harlow 1993). Cyclin binding results in activation of the kinase domain of the CDK through the induction of conformational changes associated with the protein-protein interaction. The physical contact typically occurs between the aforementioned PSTAIRE motif and the cyclin box domain, which induces a  25  Introduction conformational change that exposes the substrate-binding domain and specific residues that require phosphorylation by CDK-activating kinases, such as Thr169 in Cdc28p (Jeffrey et al. 1995; Russo et al. 1996). The activity of the all CDKs is dependent on their association with a cyclin, as per definition; however the requirement for an activating phosphorylation is not a universal characteristic of all CDKs. Similarly, the CDKs can be inhibited, via interaction with CDK inhibitors (CKIs). Well-characterized examples of these negative regulators include Far1p, which binds to Cdc28p-G1 cyclin complex to negatively regulate their activity (Peter and Herskowitz 1994) and p40, which inhibits mitotic Cdc28p complexes (Mendenhall and Hodge 1998). Phosphorylations that inhibit the activity of the CDKs have also been documented. For example, phosphorylations on Thr18 and Tyr19 within the ATP binding site of Cdc28p are known to have inhibitory roles (Berry and Gould 1996).  1.6.2 Yeast CDKs To date, multiple cyclin-dependent kinases have been identified in yeast S. cerevisiae. Cdc28p, perhaps the most prominent and important of the yeast CDKs, is involved in regulating cell-cycle progression via its association with 9 different cyclins (Mendenhall and Hodge 1998). Pho85p is another CDK known to interact with multiple cyclin partners. Pho85p associates with 10 distinct cyclin subunits in response to a wide array of nutritional and environmental conditions and regulates nutritional coping and cellcycle progression (Huang et al. 2007).  26  Introduction Cdk7p (Kin28p) is known to associate specifically with Ccl1p and is involved with the general transcriptional complex by aiding with the initiation at RNA polymerase II promoters and with recruitment of mRNA processing machinery (Rodriguez et al. 2000). The CDKS Ctk1p and Bur1p, and their respective cyclins Ctk2p and Bur2p, are also involved with the regulation of transcription. Both Ctk1p and Bur1p are known to phosphorylate the C-terminal repeated domain of the RNA polymerase Rpo21p subunit and this is believed to affect transcription (Lee and Greenleaf 1991; Murray et al. 2001). Cdk8p, which functions in association with Cyclin C, and is discussed in detail in the following section.  1.6.3 Cyclin-Dependent Kinase 8 (CDK8) and Cyclin C Cdk8p was initially identified as a suppressor of Snf1p (Carlson et al. 1984). Since then, Cdk8p has been isolated in a wide array of screens and its name has morphed over the years to GIG2, NUT7, SRB10, UME5, RYE5 and SSN3. For example, CDK8 was identified as a suppressor of SNF1 mutations and, at the time, named SSN3 (Kuchin et al. 1995). Cdk8p is a 555 amino-acid threonine/serine protein kinase and shares approximately 40% sequence homology to Cdc28p. This kinase possesses several distinct features common to the general CDK family, such as a noncanonical DFG motif in the VII kinase subdomain and a SACRE sequence in the PSTAIRE domain (Tassan et al. 1995). This information is based on the characterized structure of the highly homologous human Cdk8p counterpart, as, unfortunately, yeast Cdk8p has yet to be crystallized and subject to structural determination.  27  Introduction Cyclin C, on the other hand, is a 323 amino-acid protein required for activation of Cdk8p. Thus, it comes as no surprise that Cyclin C has also been identified, in conjunction with CDK8, in the screens mentioned above as GIG3, NUT9, SRB11, UME3, SSN8 and RYE2.  1.6.4 Cdk8-dependent regulation of filamentous growth Under normal growth conditions, Cdk8p inhibits filamentous growth by phosphorylating and, consequently, destabilizing Ste12p (Nelson et al. 2003). However, when cells are placed in nitrogen-deprived conditions, Cdk8p is destabilized via what was until now an unknown mechanism, and there is loss of Ste12p phosphorylation, resulting in its accumulation. Ste12p levels are of utmost importance for regulation of the filamentous response. Deletion of STE12 results in a non-filamenting and non-invasive phenotype, whereas over-expression of the transcription factor yields a significant increase in the rate of filamentation (Liu et al. 1993). Deletion of CDK8, on the other hand, results in a hyperfilamentous phenotype, due to the stabilization of Ste12p, when cells are grown in SLAD media (Nelson et al. 2003). In rich media, a cdk8 null diploid FLO11 expression is induced 15-fold, even in the absence of nitrogen signaling (Holstege et al. 1998). While FLO11 expression is induced in the cdk8 null genotype in rich media, cells are not constitutively filamentous, suggesting that other factors are required for induction of filamentous growth.  1.6.5 Other roles and substrates of Cdk8 in S. cerevisiae Cdk8p, and by association Cyclin C, are components of the eukaryotic mediator complex. Cdk8p has been implicated as a general relay point of environmental stress, as is evidenced by the fact that introduction of kinase-dead alleles results in the de-repression of numerous genes involved in different stress responses  28  Introduction (Holstege et al. 1998). It has been noted that Cdk8p levels decrease as yeast cells approximate the diauxic shift (Holstege et al. 1998), that Cyclin C is responsive to a magnitude of cellular stresses (Cooper et al. 1997) and that cdk8 or cycc null strains mimic nutrient starvation phenotypes (Holstege et al. 1998). The mediator, and in particular Cdk8p/CycCp, have been shown to be involved in nutrient sensing and stress-coping responses (Chang et al. 2001; Nelson et al. 2003). More specifically, Cdk8p is involved in phosphorylation of the RNA polymerase II C-terminal domain. Cdk8p has the ability to phosphorylate the CTD prior to formation of the initiation complex on promoter DNA and this phosphorylation leads to the general inhibition of transcription (Hengartner et al. 1998). In addition to Ste12p, Cdk8p has been found to regulate 3 additional transcriptional activators via phosphorylation. Cdk8-dependent phosphorylation of Gal4p is required for full induction of the GAL response (Rohde et al. 2000); Msn2p and Gcn4p are also phosphorylated by Cdk8p. Phosphorylation of Msn2p promotes nuclear export of the this transcriptional activator, whereas phosphorylation of Gcn4p results in its destabilization (Chi et al. 2001). Cdk8p has also been found to interact with the transcription factors Sip4p and Sfl1p and regulate their stability; however, current studies have failed to demonstrate a direct phosphorylation by Cdk8 (Song and Carlson 1998; Vincent et al. 2001).  29  Introduction 1.7 TRANSCRIPTIONAL REGULATORS OF FILAMENTOUS GROWTH In the above sections, much emphasis was given to the different signaling pathways that communicate nitrogen limitation to the cells and, therefore, initiate a cascade of events that eventually leads to the up-regulation of the filamentous response. However, the molecular response required for pseudohyphae formation is dependent on the activation or repression of a wide range of specific target genes. This specificity in transcriptional regulation is accomplished via the specific interactions between the filamentous response transcription factors and the filamentous response target gene promoters.  1.7.1 Ste12p and Tec1p Although Ste12p is heavily implicated with the pheromone response, its role in regulating the transcription of filamentous-specific genes is also preponderant. Ste12p was initially identified as being required for the expression of genes involved in cell mating (Fields and Herskowitz 1985). Further studies came to show that Ste12p was capable of binding specific DNA sequences within pheromone response elements (Dolan et al. 1989), and that pheromonedependent phosphorylation by the MAP kinase Fus3p was required for positive regulation of this transcription factor (Song et al. 1991). Similarly, Ste12p was also the first transcription factor found to be required for filamentous growth in yeast (Liu et al. 1993). Deletion of STE12 resulted in a non-filamenting and noninvasive phenotype, whereas over-expression of the transcription factor yielded a significant increase in the rate of filamentation. Later studies by Madhani and Fink (1997) demonstrated that Ste12p has the ability to bind to conserved binding sequences on FREs and that in response to nitrogen deprivation, there is a FRE-dependent induction of the filamentation genes. An FRE consists of a conserved Ste12p binding site (sequence: TGAAACA) closely associated with a Tec1p binding site (sequence: CATTCT) and this element is capable of recruiting, in vivo and in vitro, Ste12p and Tec1p to their sites on the FRE.  30  Introduction Tec1p functions in a similar manner to Ste12p with respects to activation of the filamentous response. This transcriptional activator was originally identified due to its involvement in the activation of Ty-1 transposons insertions (Laloux et al. 1990). Tec1p possesses a conserved DNA-binding domain, the TEA/ATTS motif, which is known to recognize and bind to CATTCC and CATTCT sequences; expression in yeast of the protein AbaAp, a transcriptional activator from Aspergillus nidulans that contains a TEA/ATTS motif, resulted in induction of pseudohyphal growth, even in the absence of Ste12p (Gavrias et al. 1996). The same group also demonstrated that deletion of TEC1 results in a significantly reduced ability for yeast cells to filament and penetrate into agar. Ste12p and Tec1p have been found to co-operatively bind to FREs (Madhani and Fink 1997) and the activation of FRE-mediated genes is dependent on this synergistic relationship. Therefore, it might be the combination of Tec1p on the promoters of filamentation genes with Ste12p that confers specificity in the activation of expression. Ste12p is constitutively bound to 38 promoters, however, upon treatment with the fusel alcohol butanol, which mimics nitrogendependent filamentous growth, both Ste12p and Tec1p were found to associate with 57 promoters of genes implicated in filamentous growth (Zeitlinger et al. 2003). This increase in promoter occupancy and recruitment of Tec1p is likely due to the inhibiting effect of Kss1p on inhibitory Dig1p and Dig2p. Without a stimulatory signal, Ste12p complexes to unphosphorylated Kss1p, Dig1p and Dig2p, which serves to inhibit transcription activation and the interaction of Ste12p with Tec1p, as Dig2p and Tec1p both compete for the N-terminal binding sites on Ste12p (Chou et al. 2006). Upon stimulation, Kss1p exerts its effects on Ste12p, causing Dig2p to dissociate and, thus allowing Tec1p to interact with Ste12p and, thus, activate transcription. This response is specific to the filamentous response, as evidenced by the fact that treatment with pheromone results in the accumulation of Ste12p on the promoters of genes involved in mating (Ren et al. 2000).  31  Introduction 1.7.2 Msn1 Msn1p and Mss11p are transcriptional activators that when over-expressed strongly activate the expression of FLO11 and, subsequently, the filamentous response (Lambrechts et al. 1996; Webber et al. 1997). Although these activators have yet to be implicated with the expression of other genes involved in the filamentous response, their role on activation of FLO11 expression is sufficient to cause the morphological changes associated with pseudohyphae formation. Based on genetic evidence, it seems unlikely that Msn1p and Mss1p are involved regulating the expression of other filamentation genes as is evidenced by the fact their absence can be compensated for by the expression of FLO11 from an alternative promoter (Gagiano et al. 1999). In addition, Msn1p requires Msn11p in order to induce filamentation; however, over-expression of MSS11 is able to trigger filamentation. Therefore, is likely that Mss11p is situated downstream of Msn1p. Genetic evidence suggests that Msn1p is downstream of Ras2p and independent of the MAPK pathway (Gagiano et al. 1999). While an exact model for these two transcriptional activators is still to be elucidated, it may be that Mss11p is capable of binding DNA and directly causing activation of FLO11 expression, while Msn1p may be regulating the activity or stability of Mss11p. MSS11 was initially characterized as a suppressor of the STA10 phenotype (Webber et al. 1997). This phenotype is characterized by the repression of the STA1-3 genes, which encode the extracellular glucoamylase isozymes. In fact, most yeast laboratory strains are repressed in terms of STA10 expression by an undefined repressor, designated STA10. In fact, the STA genes are possible candidates to contribute for the invasive nature of the filamentous response, as the excreted glucoamylases encoded by the STA1-3 genes might aid in the digestion of the agar and, therefore, facilitate penetration into the agar. Mss11p also possesses a high degree of homology with other well characterized DNAbinding transcriptional activators, such as Flo8p (Kobayashi et al. 1996).  32  Introduction MSN1, on the other hand, was initially identified as a multi-copy suppressor of snf1 mutants and over-expression of this factor was found to enhance the transcription of various genes involved in nutrient utilization (Estruch and Carlson 1990). Additional experiments demonstrated that Msn1p was capable of activating specific reporter expression when fused to a LexA DNA-binding domain. The latter evidence, and the fact that to date, Msn1p has still not been found to directly bind to DNA suggests that Msn1p is involved in regulating the activity of DNA-binding factors and is not itself a DNA-binding protein. Therefore, based on the genetic information and the functions of Msn1p and Mss11p in response to other cues, the model proposed above is within the logistics of all the evidence gathered to date.  1.7.3 Sf11p SFL1 was originally identified as a suppressor of flocculation genes (Fujita et al. 1989), and deletion of the SFL1 gene results in constitutive flocculation in yeast and enhanced pseudohyphae formation (Robertson and Fink 1998). The Nterminal region of Sfl1p is homologous to the DNA-binding domain of other wellcharacterized transcription factors, such as the heat-shock transcription factor Hsf1p (Fujita et al. 1989). Under conditions of abundant nitrogen sources, Sfl1p dimerizes and binds to the promoter region of the flocculation genes (Conlan and Tzamarias 2001). Sfl1p inhibits transcription of this class of genes by recruiting the transcriptional corepressor Cyc8p-Tup1p via a specific domain in the Sfl1p protein. However, under conditions of limiting nitrogen and subsequent activation of the cAMP signaling cascade, activated Tpk2p phosphorylates Sfl1p, a modification that prevents dimerization and the DNA-binding ability of Sfl1p (Pan and Heitman 2002).  33  Introduction It is curious to note that Sfl1p also interacts with the mediator complex, which often exhibits repressive properties (Song and Carlson 1998). While further studies must be performed, this evidence places a filamentous transcription factor in close proximity of Cdk8p and thus further implicates CDK8 as a general sensor for nitrogen limitation.  1.7.4 Sok2p SOK2 encodes a transcriptional repressor of filamentation, as evidenced by the fact that diploid sok2 strains show enhanced pseudohyphae formation (Ward et al. 1995). In addition, while this deletion has an effect on filamentous growth, it also enhances the growth defect of strains with compromised PKA systems. Specifically, deletion of SOK2 affects two PKA-dependent processes: glycogen accumulation (via regulation of GAC1) and increased expression of the heatshock resistance gene SSA3. While the exact mechanism of action of Sok2p has yet to be determined, given the similarities with the DNA-binding domain of Phd1p (Stoldt et al. 1997), it is likely that it directly binds to the promoters of the filamentous genes to cause repression of expression.  1.7.5 Flo8p FLO8 encodes a transcriptional activator of filamentation. Over-expression of FLO8 induces flocculation (Kobayashi et al. 1996), while deletion results in the loss of cells to form pseudohyphae (Liu et al. 1996). The activity of Flo8p is dependent on the cAMP pathway, as phosphorylation by Tpk2p upon limiting nitrogen conditions promotes Flo8p binding and activation of the FLO11 promoter (Pan and Heitman 2002). FLO8 is of utmost importance for the development of filaments, as can been seen by the fact that most laboratory strains, including the well-characterized strain S288C, are unable to filament in response to different environmental cues due to a premature stop codon in the sequence of FLO8 (Liu et al. 1996).  34  Introduction 1.7.6 Ash1p ASH1 encodes a positive regulator of filamentous growth. Originally identified for its role in the repression of the HO endonuclease involved in the mating-type switching response (Nasmyth 1993), ASH1 is now being implicated in the regulation of filamentous growth via regulation of FLO11 expression. Ash1p is required for formation of filaments, as is evidenced by the fact that ash1 null cells are incapable of forming pseudohyphae and cells over-expressing this transcriptional regulator are hyper-filamentous (Chandarlapaty and Errede 1998). Unfortunately, little is known regarding the regulation and mechanism of action of Ash1p with respect to filamentous growth. However, Ash1p is known to contain a zinc-finger domain (Long et al. 1997), which is a well-characterized DNA-binding motif; thus, it is plausible that Ash1p functions to regulate expression of FLO11 via its ability to directly bind and activate the FLO11 promoter. Ash1p is also a known subunit of the Rdp3p histone deacetylase complex (Carrozza et al. 2005), thus its role in chromatin modification might also be a factor involved in the expression of FLO11.  1.7.7 Phd1p PHD1 encodes a possible transcriptional activator of the filamentous response. Originally identified as part of the PHD (pseudohyphal determinant) screen, which aimed to identify regulators of filamentation via gene over-expression studies (Gimeno and Fink 1994). In their initial screen, Gimeno and Fink (1994) identified 7 S. cerevisiae genes that when over-expressed cause enhanced filamentation. ASH1 over-expression, therefore, causes increased filamentation. However, deletion of PHD1 does not affect the ability of cells to form pseudohyphae. Based on sequence similarities with StuAp, a well-characterized transcriptional activator from Aspergillus nidulans involved morphogenesis, Phd1p contains two DNA-binding domains, the SWI4p and MBP1p-like motifs (Gimeno and Fink  35  Introduction 1994). Thus, it is likely that Phd1p is capable of directly binding DNA. Further studies demonstrated that Phd1p localizes to the nucleus. Thus, it is likely that Phd1p functions to activate transcription by directly binding and activating the promoters of specific effector genes of filamentation.  1.8 EFFECTOR PROTEINS OF FILAMENTOUS GROWTH 1.8.1 FLO11 and the STA1-3 genes Flo11p is the most extensively characterized effector protein of the filamentous response due to its requirement for pseudohyphae formation and its unusually large promoter that is subject to numerous levels of transcriptional regulation. FLO11 was initially identified by Lambrechts et al. (1996) as required for the dimorphic switch, as deletion of FLO11 yielded a non-invasive and nonfilamenting phenotype. The FLO11 gene encodes a membrane-bound mucin protein, which is GPI-anchored to the cell wall and possesses a extra-cellular Nterminal domain (Lambrechts et al. 1996; Lo and Dranginis 1998). Flo11p is likely involved in the regulation of filamentous growth due to its role in the regulation of cell-to-cell attachment, as it allows cells to anchor to each other and provides resistance as cells invade the agar. The FLO11 promoter shares a great degree of homology with the promoter for the STA1-3 genes, which encode starch-degrading glucoamylases. This homology extends over the whole 3kb and expression of the STA genes has been found to be dependent on many of the transcriptional activators associated with the filamentous response (Gagiano et al. 1999). Expression of starchdegrading enzymes in response to nutrient or nitrogen deprivation may confer yeast the ability to invade nutrient-rich areas, as production and excretion of these enzymes would facilitate digestion of complex polysaccharide boarders and, thus, penetration of yeast into these compartments.  36  Introduction  1.8.2 Other effector proteins involved in pseudohyphae formation Pseudohyphae formation is a complex, multi-layered event. Since this event is characterized by cellular elongation, unipolar budding patterns, absence of bud separation and altered cell-cycle, multiple players must be involved in the coordination of such morphological changes. It has been suggested that a total of 27 genes are required for the specific morphological changes associated with filamentous growth (reviewed in Gancedo 2001). For instance, mutations of BUD1, BUD2 or BUD5 that cause random cellular distribution of budding site selection prevents the formation of pseudohyphae (Gimeno et al. 1992; Lo et al. 1997). Similar findings have been done that implicate other budding-site selection factors necessary for filament formation. Similarly, multiple genes related to the formation of elongated cells have been found necessary for filament formation. While not completely elucidated, it is likely that elongation is due to a delayed cell cycle and a defective switch from apical to isotropic growth (Gancedo 2001). Thus, the implications of various cell cycle-associated factors in the regulation of pseudohyphae formation. For example, the G1 cyclins Cln1p and Cln2p are required for pseudohyphae formation (Loeb et al. 1999), whereas over-expression of Clb1p or Clb2p, cyclins that activate Cdc28p to promote the transition from G2 to M phase, prevents pseudohyphae formation (Ahn et al. 1999). Actin, a key cytoskeleton protein, has also been implicated with filament formation. For example, certain alleles of actin have a marked defect in the invasive phenotype of stimulated cells (Cali et al. 1998). The authors suggest that actin is likely participating in the active secretion of hydrolyases to the growth tip, which permit invasive growth, in addition to any role actin may play in altering the cytoskeletal dynamics of filamenting cells.  37  Introduction These factors described in this section constitute only the tip of the iceberg of all players involved in causing the phenotypic changes associated with pseudohyphae formation. However, an in-depth description will not be provided, as this thesis aims to investigate the regulation of filamentous growth at the transcriptional level.  38  Materials and Methods CHAPTER 2 – MATERIALS AND METHODS 2.1 Media, yeast and E.coli manipulation 2.1.1 Growth media Standard growth media was used in all experiments involving S. cerevisiae and E. coli. Depending on the experiment, yeast were grown in either YPD (10 g yeast extract, 20 g peptone, 20 g glucose per liter of solution), synthetic dropout lacking uracil (7 g Difco Yeast Nitrogen Base without amino acids, 20 g glucose, 1 g complete amino-acid mix lacking uracil per liter of solution) or Synthetic lowammonium dextrose (SLAD) (7 g Difco Yeast Nitrogen Base without amino acids and ammonium sulfate, 10 g glucose, 6 mg of Ultrapure Ammonium Sulfate per liter of solution). For solid media, 20 g of agar was added to each liter of media. For production of SLAD plates, prior to addition to liquid media, the agar was rinsed in dH20 three times to remove any residual nitrogen. Plates used for yeast mating experiments consisted of YPD plates (pH ~7 by addition of 50 ml of 1M NaPO4, pH 7) with 100 µg/ml of nourseothricin (NAT) and/or 150 µg/ml of Zeocin (ZEO) antibiotics. All E. coli work was performed in Luria Broth (LB) media (5 g yeast extract, 10 g tryptone, 10 g NaCl per liter of solution).  2.1.2 Yeast transformation All yeast transformations were performed using the method conceived by (Gietz and Schiestl 2007). A loop full or an equivalent amount of cells grown over-night in liquid media of the desired yeast were re-suspended in 240 µl of PEG 3500 50% w/v, 36 µl of 1 M Lithium Acetate, 50 µl of boiled salmon-sperm carrier DNA (10 mg/ml) and approximately 2 µg of the intended plasmid. The mixture was vortexed, heat-shocked for 45 minutes at 42°C and plated on the appropriate selective media. Strains with the integrated Cdk8-3xFLAG-1x6HIS wild-type and mutant constructs were generated with digestion of pPL016, pPL017 and pPL018 39  Materials and Methods (fcy1 disintegrator-based vectors) with restriction enzyme AscI for plasmid linearization prior to yeast transformation, as described (Sadowski et al. 2007). 2.1.3 Yeast mating For strain construction, prior to mating, all strains were crossed-mated with known tester strains 227a and 227! to ensure compatible mating types and selected on synthetic dropout plates without amino acids. Desired strains were transformed with either pIS419 (NAT resistance) or pIS438 (ZEO resistance). Transformed !-strains were grown overnight in liquid SD –Ura media, cells collected, rinsed in sterile dH20 and plated on appropriate selection plates (YPD containing 100 µg/ml NAT and 150 µg/ml ZEO) to create a lawn of the desired transformed !-type cells. Concomitantly, transformed a-type cells were spotted, allowed to grow on to SD –Ura plates and, subsequently, replica-plated onto the lawn of !-type cells on the antibiotic selective plates.  2.1.4 Filamentous growth assays Assays for diploid filamentous growth were performed by streaking the appropriate cells on SLAD plates and cells were allowed to grow for 5 days at 30°C. After the indicated incubation period, colonies were photographed directly on the SLAD plates.  40  Materials and Methods 2.2 Yeast strains, plasmids, and oligonucleotides Table 2. Yeast Strains Yeast Strain  Genotype*  Reference/Source  HLY362 L5366 L5620 L5625 L5628 L5631  G. Fink G. Fink G. Fink G. Fink G. Fink G. Fink  XPY4a  MATa, ste12::LEU2, leu2::hisG, ura3-52 MATa/!, ura3-52 MATa/!, ste2::Leu2, leu2::hisG, ura3-52 MATa/!, ste11::LEU2, leu2::hisG, ura3-52 MATa/!, fus3::LEU2, leu2::hisG, ura3-52 MATa/!, fus3::LEU2, kss1::URA3, leu2::hisG, ura3-52 MATa, ura3-52, tpk1::Kan  XPY4a/!  MATa/!, tpk1::KAN/tpk1::KAN, ura3-52/ura3-52  XPY5a  MATa, ura3-52, tpk2::Kan  XPY5a/!  MATa/!, tpk2::KAN/tpk2::KAN, ura3-52/ura3-52  XPY6a  MATa, ura3-52, tpk3::Kan  XPY6a/!  MATa/!, tpk3::KAN/tpk3::KAN, ura3-52/ura3-52  YCN44 YCN45 YCN60 YPL01 YPL02 YPL03 YPL04 YPL05 YPL016 (WT) YPL017 (T37A) YPL018 (T37E) YPL20 (tpk1; cdk8) YPL21 (tpk2; cdk8) YPL22 (tpk3; cdk8) Z1976  MAT a, ura3-52, cdk8 MAT!, ura3-52, cdk8 MATa/!, ura3-52/ura3-52, cdk8/cdk8 BY4741, MATa. mca1, trp1 BY4741, MATa. wwm, trp1 BY4741, MATa. lap3, trp1 BY4741, MATa. nma111, trp1 BY4741, MATa. ysp3, trp1 MATa/!, fcy1::CDK8 MATa/!, fcy1::T37A CDK8 MATa/!, fcy1::T37E CDK8 MATa/!, tpk1::KAN/tpk1::KAN, cdk8/cdk8; ura352/ura3-52 MATa/!, tpk2::KAN/tpk2::KAN, cdk8/cdk8; ura352/ura3-52 MATa/!, tpk3::KAN/tpk3::KAN, cdk8/cdk8; ura352/ura3-52 MATa, his3, leu2, met15, ura3, TPK2::TAP:HIS3  (Pan and Heitman 1999) (Pan and Heitman 1999) (Pan and Heitman 1999) (Pan and Heitman 1999) (Pan and Heitman 1999) (Pan and Heitman 1999) (Nelson et al. 2003) (Nelson et al. 2003) (Nelson et al. 2003) This study. This study. This study. This study. This study. This study. This study. This study. This study. This study. This study. (Ghaemmaghami et al. 2003  *Unless indicated otherwise, all strains are of the !1278 background.  41  Materials and Methods Table 3. Plasmids Plasmid  Details  Reference  PBHM275 PIS028  TEC1 FRE::lacZ reporter 2µ CDK8 C-term 3xHA  (Madhani and Fink 1997) I. Sadowski  PJP018  2µ KIN28-6HIS  J. Parent val19  PMT430  GAL promoter expressing RAS2  mutation  PPL05  2µ hCDK8 C-term 3xHA  (Deschenes and Broach 1987) This study.  PPL09  2µ T37A CDK8 C-term 3xHA  This study.  PPL12  2µ T37E CDK8 C-term 3xHA  This study.  PPL16 PPL17 PPL18 PSG1  fcy1::CDK8 C-term 3xFLAG 1x6HIS fcy1::T37A CDK8 C-term 3xFLAG 1x6HIS fcy1::T37E CDK8 C-term 3xFLAG 1x6HIS 2µ CDK8 C-term 3xHA  This study. This study. This study. S. Goto  PXP2  2µ TPK1  (Pan and Heitman 1999)  PXP3  2µ TPK2  (Pan and Heitman 1999)  PXP4  2µ TPK3  (Pan and Heitman 1999)  42  Materials and Methods Table 4. Oligonucleotides Oligo  5’ to 3’ Sequence  Target  Use  OPL09  CGTTCGTTGGAAAGAAAAACGCAATCGGAAG TGTGCATGG CCATGCACACTTCCGATTGCGTTTTTCTTTCC AACGAACG CGTTCGTTGGAAAGAAAAACGAAATCGGAAG TGTGCATGG CCATGCACACTTCCGATTTCGTTTTTCTTTCC AACGAACG CAAAAATTACGGCTCCTCGCTGCAGACCTGC GAGCAGGGAA CCAACGCATTAAATGCATCTATTCTTTTAATT GGATCATAATTTAACAAGTGG GGCTCCGGATCCTAATACGACTCACTATAGG GAACAGCCACCATGTATAATGGCAAGGATAG AGCACAAAACTCCTATCAGCC TTTTTTTTTTTTTTTTTTTTTTTTTTACTAACCA TGATGGTGATGGTGGTGTCCCTTATCATCAT CGTCC  CDK8 mutation T37A CDK8 mutation T37A CDK8 mutation T37E CDK8 mutation T37E CDK8 mutations T37 to A/E CDK8 mutations T37 to A/E T7 CDK8  SDM  T7 CDK8  In vitro translation  OPL10 OPL39 OPL40 OPL67 OPL68 OPL69 OPL70  SDM SDM SDM SDM SDM In vitro translation  43  Materials and Methods 2.3 Measurement of transcription 2.3.1 ß-galactosidase assays Measurement of ß-galactosidase activity in selected yeast strains was performed as described by Olson et al. 2000. Yeast strains used for all ß-galactosidase assays were transformed with pBMH275, plasmid harbouring a TEC1 FRE::lacZ reporter construct (for details see table 1). 2.4 Protein preparation, isolation and manipulation 2.4.1 Site-directed mutagenesis Site-directed mutagenesis to construct T37A and T37E mutants on pSG1 was performed using the Stratagene QuickChange© protocol with respective mutagenic primers pairs oPL09/oPL10 and oPL39/oPL40 as directed by the manufacturer. Site directed mutagenesis reactions to construct T37A and T37E mutants on pPL16 was performed using the megaprimer method with respective mutagenic primers oPL09/oPL10 and oPL39/oPL40, coupled accordingly to either oPL67 oPL68, as described in detail by (Sarkar and Sommer 1990).  2.4.2 TAP and HIS-tag Purification Purification of TAP-tagged Tpk1, Tpk2, and Tpk3, was performed as described by (Rigaut et al. 1999). In vitro translated 3"Histidine tagged wild-type and T37A Cdk8 proteins were added a 50% slurry of nickel beads (Qiagen), prepared by washing three times in 1" PBS buffer, and equilibrating in lowimidazole storage buffer (50mM NaH2PO4, 300mM NaCl, 10mM imidazole, adjusted to pH 8.0). 60µl of the equilibrated beads were added to 30µl of the rabbit reticulocyte mixtures with the appropriate translated protein, and rotated for 3 hours at 4°C. The mix was then spun at 6,000 rpm and the supernatant discarded. The bead pellet was then washed 5" with imidazole wash buffer 44  Materials and Methods (50mM NaH2PO4, 300mM NaCl, 20mM imidazole, adjusted to pH 8.0). Wild-type and T37A Cdk8 proteins were then eluted from the beads with 30µl 50mM imidazole elution buffer (50mM NaH2PO4, 300mM NaCl, 250mM imidazole, 0.05% Tween-20, adjusted to pH 8.0) by incubating and rotating for 40 minutes at 4°C, and analyzed by SDS-PAGE followed by autoradiography.  2.4.3 Western blotting For western-blotting of HA or FLAG tagged proteins, approximately 10µg of soluble protein were loaded and resolved on 10% SDS-PAGE gels. Proteins were transferred to nitrocellulose membranes, which were blocked in 5% block solution and incubated with either 1:1000 dilution of monoclonal mouse anti-HA hybridoma supernatant or 1:5000 Sigma monoclonal mouse anti-FLAG antibodies. Following three ten minute washes in TBS-T (0.1 M Tris-HCL pH 8, 0.9% NaCl, 0.1% Tween20), the membranes were incubated with 1:10000 HRPconjugated goat anti-mouse antibody and protein was detected using standard ECL reagents as per manufacturer’s instructions (Pierce).  2.4.4 In Vitro Kinase Assays In vitro kinase assays with the different forms of purified Cdk8 were performed as described by (Hirst et al. 1999). Approximately 200 ng of purified protein was incubated with 3 µl of purified Tpk2 and 10µCi #32 ATP for 30 minutes at 30°C, prior to analyzing on SDS-PAGE and autoradiography.  2.4.5 Reticulocyte in vitro transcription/translation system In vitro transcription/translation expression of wild-type, T37A and T37E Cdk8 were carried out using the TNT7 PCR fragment rabbit reticulocyte expression 45  Materials and Methods system from Promega. All PCR products were amplified with primers oPL069 (containing a T7 RNA polymerase promoter) and oPL070 (containing a poly-A tail and T7 terminator sequence) from plasmids pIS427, pPL017 and pPL018. In vitro transcription/translation reactions contained 3µl PCR generated template, 40µl of rabbit reticulocyte lysate master mix, 2µl 35S (1mCi stock), 2µl of 1U/µl T7 RNA polymerase, to a final volume of 50µl DNA/RNA with nuclease free dH2O. The reactions were incubated at 30°C for 90 minutes and analyzed on 12.5% sodium dodecyl-sulphate (SDS) denaturing gels, run at 175V for 1 hour, dried and exposed for up to 2 days on Biomax film (Kodak).  46  Results and Discussion CHAPTER 3 – RESULTS AND DISCUSSION  3.1 In vivo degradation of Cdk8p in response to nitrogen depravation Based on the work performed in the laboratory by a previous student, it was known that in response to nitrogen depravation, there is a transient degradation of Cdk8p, with maximal loss of protein occurring at 4 hours following growth in SLAD media (Figure 3.1), and that degradation of Cdk8p corresponds with the appearance of an additional lower molecular weight protein band in the western blot (S. Goto, unpublished). As proposed at the time, since appearance of this band coincides with disappearance of Cdk8p, this lower molecular weight product likely constitutes a truncated form of Cdk8p. While I was able to reproduce the transient degradation of Cdk8p in response to nitrogen limitation, I was incapable of demonstrating appearance of the truncated fragment. I expect this to be a technical issue related to the antibodies utilized. At the time, Cdk8p was being detected with an !-Cdk8p antibody generously donated to the laboratory, which likely possessed its epitope in the central or N-terminal region of Cdk8p. Unfortunately, the !-Cdk8p antibody previously used was no longer accessible and all subsequent immunoblotting was done with antibodies against C-terminal HA and FLAG tags fused to Cdk8p. A cleavage event must occur in the proximity of the C-terminus, thus cleaving the tag off and rendering it impossible to detect the truncated fragment with !-HA or !-FLAG antibodies.  47  Results and Discussion  Figure 3.1. Nitrogen depravation leads to degradation of Cdk8p. Haploid yeast strain YCN45 (cdk8) was transformed with PPL016 (fcy1::CDK8) and was grown in SD –URA media, switched to SLAD media (T=0 hrs) and harvested following 4 hours. Cdk8p stability was measured by western blotting whole cell extracts of lysed cells with !-FLAG antibodies.  48  Results and Discussion 3.2 cdk8 null strains hyper-filament and over-expression of CDK8 inhibits filamentation The expression of the genes involved in altering the cyto-skeletal dynamics of S. cerevisiae in response to nitrogen depletion is under tight transcriptional regulation. The FLO11 promoter serves as an excellent model to study the ongoing clash between transcriptional activators and transcriptional repressors involved in controlling filamentous growth. Therefore, regulation of the transcriptional activators and repressors is itself of paramount importance. STE12 is a key player in the activation of filamentous growth, as is evidenced by the fact that deletion of STE12 yields a non-filamenting phenotype and overexpression results in hyperfilamentation (Liu et al. 1993). Ste12p stability is compromised via phosphorylation by Cdk8p on Ser261 and Ser451 (Nelson et al. 2003). Ste12p is a transcriptional activator, thus deletion of its direct inhibitor, Cdk8p, results in its stabilization and, consequently permits binding to FRE and activation of the adjacent promoter. As seen in Figure 3.2, YCN60 (cdk8/cdk8) transformed with PRS316 (empty vector) yields a hyperfilamenting phenotype, when compared to cells transformed with a plasmid expressing wild-type CDK8, as corroborated by Nelson et al. (2003). This hyperfilamenting phenotype categorizes CDK8 as a repressor of the filamentous response. However, in cdk8/cdk8 null strains, filamentation only occurs in SLAD media. Filamentation does not occur in conditions of abundant nitrogen, thus suggesting that additional factors must be involved in inhibiting filamentous growth. The Cdk8p-Ste12pdependent regulation of filamentous growth is a major component of this tightly regulated response, however, other parallel pathways also exert their effects, namely the Flo8p-Sfl1p-dependent pathway. In cells lacking cdk8, under conditions of abundant nitrogen, Tpk2p is inactive and, thus, Sfl1p represses expression of filamentous responsive genes, namely FLO11, and Flo8p is unphosphorylated and incapable of binding to DNA. Therefore, despite  49  Results and Discussion stabilization of Ste12p, Sfl1p exerts its inhibitory effects on the FLO11 promoter and Flo8p is inactive. However, in conditions of limiting nitrogen, Tpk2p becomes activated and phosphorylates Sfl1 and Flo8p. This phosphorylation event stimulates activation of the FLO11 promoter and, coupled with the activation by the largely stabilized pool of Ste12p existent due to lack of phosphorylationdependent degradation, hyperfilamentation occurs. On the other hand, over-expression of an inhibitor should, in theory, decrease the activity of any downstream effectors. In yeast L5366 (wild-type) transformed with a plasmid over-expressing CDK8 (Figure 3.3), there is an evident decrease in the rate of filamentation of cells grown on SLAD media. The hypo-filamenting phenotype observed in cells over-expressing CDK8 suggests that there is increased kinase activity and subsequent degradation-targeting phosphorylations on Ser261 and Ser 451 of Ste12p (Nelson et al. 2003). The decrease in active Ste12p levels causes a decline FRE occupancy by the transcriptional activator, an event that translates into decreased activation of promoters involved in the filamentous response. Additionally, as seen in Figure 3.2, over-expression of KIN28, which is also a cyclin-dependent kinase, does not affect filamentation, suggesting that Cdk8p has a specific role in the regulation of filamentous growth.  50  Results and Discussion  Figure 3.2 CDK8 is an inhibitor of filamentous growth. Yeast strain YCN60 (cdk8/cdk8) was transformed with PRS316 (empty vector control with complementing prototrophic markers); PPL015 (ARS-CEN CDK8); PSG1 (2µ CDK8); and PJP018 (2µ KIN28). Transformed yeast were streaked for single colonies on SLAD plates, incubated days at 30°C and inspected for filamentous growth after 5 days.  51  Results and Discussion  Figure 3.3 CDK8 over-expression inhibits filamentous growth. Yeast strain L5366 (cdk8/cdk8) was transformed with PRS316 (empty vector control with complementing prototrophic markers); PSG1 (2µ CDK8); and PJP018 (2µ KIN28). Transformed yeast were streaked for single colonies on SLAD plates, incubated days at 30°C and inspected for filament growth after 5 days.  52  Results and Discussion 3.3 Cdk8 is insensitive to nitrogen depravation in tpk2 null strains Given the obvious link between loss of Cdk8p in media depleted for nitrogen, and the hyperfilamenting phenotype of cdk8 null diploid yeast, it was evident that nitrogen signaling must somehow target Cdk8p for degradation. It was hypothesized that a phosphorylation on Cdk8p would target the enzyme for degradation or truncation. Thus, the rationale was to screen for Cdk8p stability in strains that were lacking kinases that would co-localize with and have access to Cdk8p. The S. cerevisiae gene deletion set was utilized to create prototrophic yeast lacking various nuclear kinases. The following strains were screened for lack of Cdk8p destabilization following an incubation a 4 hour incubation in SLAD media: YPL01 (mca1); YPL02 (wwm); YPL03 (lap3); YPL04 (nma111); YPL05 (ysp3); and XPY5a (tpk2). All strains, except XPY5a (tpk2) exhibited destabilization of Cdk8 at 4 hours of incubation in SLAD media (data not shown). In fact, further western-blotting reveled that Cdk8p was, indeed, stabilized in tpk2 null yeast (Figure 3.4). This result was also in accordance with a previous preliminary screen performed in the lab, which identified TPK2 as a possible regulator of CDK8 (Daisy Liu, unpublished). Cdk8p appears insensitive to nitrogen starvation even after a 24-hour incubation in SLAD media (Figure 3.4). Thus, Tpk2p, a nuclear kinase with other known substrates involved in the regulation of the filamentous response, was identified as a possible upstream regulator of Cdk8p stability and the filamentous response. Although pseudohyphae formation and filamentous response, at large, are characteristic of diploid yeast, the same biochemical properties and Cdk8p degradation pattern remain intact in haploid yeast (S. Goto, unpublished); hence, due to technical reasons, haploids were utilized for all western blotting experiments presented here. The question that arouse at this point was whether Tpk2p was exerting its effects on Cdk8p directly or was it merely an upstream kinase involved in a complex cascade of phosphorylation signaling events.  53  Results and Discussion  Figure 3.4 Deletion of TPK2 stabilizes CDK8 during nitrogen starvation. Haploid yeast strain XPY5a (tpk2) was grown in SD –URA media, switched to SLAD media (T=0 hrs) and harvested at the indicated time points. Cdk8p stability was measured by western blotting whole cell extracts of lysed cells with !-Cdk8 antibodies.  54  Results and Discussion 3.4 tpk2 null strains are nonfilamenting, and overexpression of TPK2 activates filamentous response in the absence of stimuli With strains generously donated from the Heitman lab, it became apparent that TPK2, in addition to modulating the stability of Cdk8p, it also exerted pronounced effects on the formation of filaments (Figure 3.5). Based on the phenotype of strain XPY5a/! (tpk2/tpk2), deletion of TPK2 results in non-filamenting cells; thus, categorizing Tpk2 as an activator of the filamentous response (Figure 3.5a). XPY4a/! (tpk1/tpk1) yeast exhibited wild-type phenotype in relation to filament formation, whereas XPY6a/! (tpk3/tpk3) yielded an increase in the rate of filamentation, as seen in Figure 3.5a, rendering it as an inhibitor of filamentous growth, as previously observed (Pan and Heitman 1999).  As expected, a cdk8/cdk8 tpk2/tpk2 double null was moderately hyperfilamentous (Figure 3.5b). However, the cdk8/cdk8 tpk2/tpk2 double mutant does not exhibit the same level of hyper-filamentation as does a cdk8/cdk8 single mutant (Figure 3.5b). One possibility is that this is likely due to the abolishment of the Tpk2-dependent phosphorylations on Sfl1p and Flo8p. Tpk2p likely phosphorylates Sfl1p and this event leads to the inhibition of this transcriptional repressor (Pan and Heitman 2002). Tpk2p also likely phosphorylates and activates Flo8p, a transcriptional activator of FLO11 (Pan and Heitman 2002). Thus, in a cdk8/cdk8 tpk2/tpk2 background there are competing forces. The lack of tpk2 likely results in the absence of phosphorylation on Sfl1p and Flo8p, while the lack of cdk8 results in the stabilization of Ste12p. Based on this genetic evidence, it appears that Ste12p exerts a stronger effect on FLO11 activation than Flo8p and Sfl1p, as Ste12p is itself alone capable of activating filamentous growth, despite Sfl1p repression.  55  Results and Discussion  (a)  . (b)  Figure 3.5 TPK2 is required for filamentous growth and CDK8 functions downstream of TPK2. (a) yeast strains L5366 (wild-type); XPY4a/! (tpk1/tpk1); XPY5a/! (tpk2/tpk2); and XPY6a/! (tpk3/tpk3) were transformed with PRS316 (empty vector control with complementing prototrophic markers). (b) yeast strains L5366 (wild-type); YCN60 (cdk8/cdk8); XPY5a/! (tpk2/tpk2); and YPL021 (cdk8/cdk8; tpk2/tpk2) were also transformed with PRS316. Transformed yeast were streaked for single colonies on SLAD plates, incubated days at 30°C and inspected for filament growth after 5 days  56  Results and Discussion To further investigate the relationship between TPK2 and CDK8, homozygous diploid strains L5366, YCN60, XPY4a/!, XPY5a/!, XPY6a/!, and YPL21 were transformed with PBHM275, a plasmid harbouring TEC1 FRE::lacZ reporter. With this construct, activation of filamentous responsive genes could be analyzed in more detail, as "-galactosidase activity ensuing from the TEC1 FRE::lacZ reporter is a direct measure of transcriptional activation from a FRE. Relative to wild-type, the tpk2/tpk2 null diploid exhibited a significant decrease in Ste12-dependent expression of filamentous responsive genes in both rich and SLAD media, as is evidenced by the decreased "-galactosidade activity (Figure 3.6a and 3.6b). However, and as expected, in the cdk8/cdk8 tpk2/tpk2 double null, the FRE-dependent activation was restored to wild-type levels when cells were grown in rich media and slightly increased when cells were grown in SLAD media (Figure 3.6a and 3.6b). This phenomenon likely results from the stabilization and increased FRE binding of Ste12p in the absence of Cdk8p. However, complete restoration of the cdk8 null phenotype is not restored likely due to the aforementioned lack of Tpk2p-dependent phosphorylation on Sfl1p and Flo8p. Given the pre-supposed upstream regulatory role of Tpk2p on Cdk8p, Flo8p and Sfl1p, it was expected that over-expression of TPK2 would mimic nitrogen starvation and cause cells to filament even in nitrogen-rich conditions. For this purpose, yeast strains L5366 (wild-type), XPY5a/! (tpk2/tpk2) and YCN60 (cdk8/cdk8) were transformed with PXP2 (2µ TPK1), PXP3 (2µ TPK2) and PXP (2µ TPK3) in order to induce over-expression of the TPK genes. As seen in Figure 3.7, over-expression of TPK2 in all three strains induced filamentous growth, even on rich media, whereas over-expression of TPK1 and TPK3 did not cause filament formation. These transformants all exhibited slower growth rates, likely due to the cellular havoc resulting from altering multiple signaling pathways that involve the TPK genes. Also shown in Figure 3.7, a tpk3/tpk3 strain exhibits increased FRE-dependent activity, further suggesting that Tpk3p functions as an inhibitor of the filamentous response, while a tpk1/tpk1 mutant appears to bear no effect on FRE-dependent expression. 57  Results and Discussion  2.20  (a) Relative !-Gal units  2.00 1.80 1.60 1.40 1.20 1.00 0.80 0.60 0.40 0.20  pk  )  pk 3  cd k8  )  2)  a/  pk 2  @  ;  (t  (t /@  1 YP L2  XP  XY  Y6  P5 a  (t  pk 1) (t /@ XY  YC  P4 a  N  L5  36  6  60 (c  (W  dk 8  t)  )  0.00  Strain/genotype  cd k8 )  pk 3  2)  ;  (t  (t YP  L2 1  Y6 a/ XP  pk 2  @  (t P5 XY  a/ @ P4 XY  a/ @  (t  (c 60 YC N  pk  pk 1)  8) dk  (W 6 36 L5  )  2.60 2.40 2.20 2.00 1.80 1.60 1.40 1.20 1.00 0.80 0.60 0.40 0.20 0.00  t)  Relative !-Gal units  (b)  Strain/genotype  Figure 3.6. Yeast lacking TPK2 show decreased expression of Ste12dependent filamentous responsive genes. Deletion of TPK2 decreases FREdependent transcription. Homozygous diploid strains L5366, YCN60, XPY4a/!, XPY5a/!, XPY6a/!, and YPL21 were transformed with PBHM275 (TEC1 FRE::lacZ reporter). Cells were grown at 30°C in (a) SD media or in (b) SLAD media and assayed for "-galactosidase activity, which was subsequently normalized to the activity of wild-type yeast for each growth media (arbitrarily referenced as 1 unit). Error bars depict the standard error for each category.  58  Results and Discussion  Figure 3.7 TPK2 over-expression induces filament formation in rich media. Yeast strains L5366 (wild-type), XPY5a/! (tpk2/tpk2) and YCN60 (cdk8/cdk8) were transformed with PXP2 (2µ TPK1), PXP3 (2µ TPK2) and PXP (2µ TPK3). Transformed yeast were streaked for single colonies on SD plates, incubated at 30°C and inspected for filament growth after 3 days.  59  Results and Discussion 3.5 Cdk8p contains typical PKA phosphorylation consensus sequence The genetic evidence for a relation between CDK8 and TPK2 was clearly established at this point. However, major questions regarding the actual nature of the interaction between these two kinases still remained unanswered. It was hypothesized that Tpk2p possibly directly phosphorylates Cdk8p, an event that may target Cdk8p for degradation. With this in mind, bioinformatical analysis of the sequence of Cdk8p was performed to identify possible phosphorylation sites. Tpk2p is the yeast orthologue of Protein Kinase A (PKA), which is a serine/threonine kinase with specific consensus phosphorylation sequence of R(R/K/S)X(S/T) (Kim and Johnston 2006). Inspection of the amino acid sequence of Cdk8p revealed one canonical PKA phosphorylation consensus site, in accordance to the defined sequence in human PKA (Figure 3.8) positioned between amino acids 34 and 37. This sequence is Lys34-Lys35-Asn36-Thr37. Given the low occurrence of PKA consensus sequences on Cdk8p, threonine 37 became an extremely good candidate for a phosphorylation site on Cdk8p.  60  Results and Discussion  Figure 3.8 Cdk8p contains a typical PKA/TPK consensus phosphorylation site. Schematic representation of Cdk8p and the consensus phosphorylation site [R(R/K/S)X(S/T)] near the N-terminus. Tpk2 is a serine/threonine kinase. The plausible phosphorylation site is threonine 37, the only PKA consensus phosphorylation sequence on Cdk8p.  61  Results and Discussion 3.6 T37A and T37E Cdk8 mutants exhibit, respectively, non-filamenting and hyper-filamenting phenotypes With only one Tpk2p consensus sequence on Cdk8p, it was likely that this site would be at the epitome of the interaction between the two kinases. Thus, in an attempt to further elucidate the exact nature of the interaction between Tpk2p and Cdk8p, the plausible phospho-site was mutated into a non-phosphorylatable residue. There is extensive literature supporting that mutation of a phospho-site, such as serine (S) or threonine (T), into an alanine residue abolishes phosphorylation, as the side chain of alanine (A) is lacks a hydroxyl and prevents formation of a covalent bond with the phosphate group transferred from ATP in the reaction catalyzed by the kinase (Nichols and Matthews 2002) (Morrison et al. 2003). Similarly, numerous studies have shown that phospho-mimic mutations, whereby the phospho-site residues are mutated into glutamate (E) can recapitulate a phenotype caused by the phosphorylation (Maciejewski et al. 1995) (Nichols and Matthews 2002) (Morrison et al. 2003). This mutation is believed to mimic the addition of a phosphate group to the side-chain of a phosphorylatable residue, as it confers a negative charge the amino-acid side chain, similarly to the effects of phosphorylation of serine or threonine. Threonine 37 was, therefore, mutated into both alanine (T37A) and glutamate (T37E). It was believed that the T37A mutation would mimic the nonphosphorylated state, exhibiting Cdk8p stabilization and reduced rate of filamentation in SLAD media. The T37E mutation, on the other hand, was hypothesized to mimic the phosphorylated state of the kinase, thus resulting in destabilization and increased rate of filamentation in SLAD media. When the T37A CDK8 mutant was expressed in wild-type yeast expressing endogenous CDK8 or in a cdk8/cdk8 null strain, filamentation was abolished (Figure 3.9). This implies that phosphorylation on T37 is required in order to induce filament formation. Additionally, when T37E CDK8 was expressed, in the  62  Results and Discussion cdk8/cdk8 null strain, cells became hyper-filamentous, similar to the phenotype exhibited by cells lacking cdk8 (Figure 3.9). This suggests that the T37E mutation either abolishes kinase activity or targets Cdk8p for degradation. However, T37E CDK8 expressed in a wild-type strain expressing endogenous CDK8 did not display the hyper-filamentous phenotype demonstrated in the cdk8/cdk8 null background. This is likely due to the fact that endogenous Cdk8p is still active and responsive to nitrogen signaling. Additionally, this implies that the T37A mutant, since it inhibits filamentous growth even wild-type cells, the mutation is dominant to the wild-type. T37A Cdk8p must not, therefore, be subject to the same regulation as wild-type Cdk8p in response to nitrogen limitation.  63  Results and Discussion  Figure 3.9 T37A Cdk8p mutants are hypofilamentous and T37E Cdk8p mutants are hyperfilamentous. Yeast strains L5366 (wild-type) and YCN60 (cdk8/cdk8) were transformed with PSG1 (2µ CDK8), PPL09 (2µ T37A CDK8) and PPL012 (2µ T37E CDK8). Transformed yeast were streaked for single colonies on SLAD plates, incubated at 30°C and inspected for filament growth after 5 days.  64  Results and Discussion 3.7 Tpk2p specifically phosphorylates Cdk8p at position Thr37 To determine if Tpk2p was capable of directly phosphorylating T37 of Cdk8p, I produced a wild-type and T37A mutant CDK8 proteins using rabbit reticulocyte lysate-based in vitro transcription and translation for use as substrates in in vitro kinase reactions with Tpk2p purified from yeast. Wild-type and T37A CDK8 were expressed using this system and purified via Ni-NTA chromatography. Purified wild-type and T37A Cdk8p were utilized as substrate for an in vitro kinase assay (Figure 3.10). Based on this figure, Tpk2p directly phosphorylates wild-type Cdk8p (Figure 3.10, lanes 2 and 3), but not T37A Cdk8p, suggesting that phosphorylation is specific to the T37 phospho-site (Figure 3.10, lane 1). Both wild-type and T37A Cdk8p were present in the kinase reaction, as is evidenced by Figure 3.12c. Further specificity is confirmed by the fact that Tpk2p fails to phosphorylate Ste12p (lane 7). The possibility of Cdk8p autophosphorylation was eliminated by the inclusion of D290A Cdk8p (Figure 3.10, lane 3). This mutant of CDK8 contains a mutation on the catalytic domain and is, therefore, dead in terms of kinase activity; thus any kinase activity must be due to the presence of Tpk2p in the reaction mixture. Tpk2p functions as an internal control, as this kinase has been found capable of autophosphorylation (Ptacek et al. 2005).  65  Results and Discussion  1  2  3  4  5  6  7  Figure 3.10 Tpk2p phosphorylates Cdk8p in vitro specifically on Thr37. Recombinant Cdk8p (wild-type Cdk8p, T37A Cdk8p and D290A Cdk8p) and Ste12p (wild-type) were purified from the rabbit reticulocytes with Ni-NTA agarose. Approximately 200 ng of purified substrate was incubated with 3 µl of purified Tpk2 and 10µCi #32 ATP for 30 minutes at 30°C and loaded on to SDSPAGE gel. Dried gel was exposed to Biomax (Kodak) film for 48 hours. D290A Cdk8p is kinase-dead. Western-blot of the substrates are shown in Figure 3.12c.  66  Results and Discussion 3.8 Phosphorylation of Cdk8p on Thr37 by Tpk2p results in its degradation Given the strong genetic and in vitro biochemical evidence to corroborate the idea that Tpk2p-dependent phosphorylation on Thr37 of Cdk8p causes degradation, it was expected that, in vivo, the non-phosphorylated T37A Cdk8p mutant would be stabilized under conditions of limiting nitrogen, whereas the phospho-mimic T37E Cdk8p mutant was expected to have a more rapid turnover than its wild-type counterpart. According to Figure 3.11 (lane 4), the non-phosphorylated T37A Cdk8p mutant was, as expected, stabilized despite nitrogen depravation. Even after growth for 4 hours in SLAD media, the T37A mutant appears resistant to nitrogen depletion. This data provides strong support for the model proposed thus far; clearly, lack of phosphorylation on Thr37 abolishes the capacity of Cdk8p to destabilize or to interact with cellular machinery capable of cleaving the kinase. On the other hand, the phospho-mutant T37E demonstrates a more rapid turnover rate than wild-type Cdk8p (Figure 3.11, lane 2 vs. lane 6). In fact, the stability of the T37E Cdk8p mutant is compromised even in rich media, as detectable levels are reduced, despite the presence of ammonia and other nitrogen-rich compounds (Figure 3.11, lane 5). This data heavily implicates the Thr37 site as a trigger for destabilization and suggests that phosphorylation on Thr37 is necessary and sufficient to target Cdk8p for degradation via an undetermined mechanism. The model for phosphorylation-dependent destabilization of Cdk8p has been gaining consistency with the genetic and biochemical evidence presented in earlier sections of the thesis, especially with the barely detectable levels of T37E Cdk8p protein present in yeast expressing the mutant (Figure 3.11). The reduced levels of the phospho-mimic mutant T37E Cdk8p suggest that phosphorylation leads to destabilization and/or truncation of the kinase via an unknown mechanism. The DNA template utilized to generate the T37E mutant was sequenced and no pre-mature stop codons were detected in this mutant. 67  Results and Discussion  1  2  3  4  5  6  Figure 3.11 T37A Cdk8p is stabilized in SLAD media and T37E Cdk8p is destabilized in rich and SLAD media. Haploid yeast strain YCN45 (cdk2) was transformed with PPL016 (fcy1::CDK8), PPL017 (fcy1::T37A CDK8) or PPL018 (fcy1::T37E CDK8) and was grown in SD –URA media, switched to SLAD media (T=0 hrs) and harvested following 4 hours. Cdk8p stability was measured by western blotting whole cell extracts of lysed cells with !-FLAG antibodies  68  Results and Discussion  1  2  3  Figure 3.12 Phospho-mimic mutant T37E CDK8 destabilizes and targets Cdk8p for truncation. (a) In vitro translated CDK8 (wild-type, T37A and T37E) were labeled with S35; (b) crude in vitro translated products were purified from the rabbit reticulocyte mix using Ni-NTA agarose; (c) purified proteins were subject to western blotting with !-FLAG; (d) schematic representation of in vitro translated CDK8; Thr37 is the N-terminal phosphorylation site.  69  Results and Discussion When the different mutants of Cdk8p were expressed in the in vitro reticulocyte translation system, wild-type and T37A CDK8 produced full-length Cdk8p (Figure 3.12a, lanes 1 and 2). However, expression of the T37E CDK8 mutant yields a fragment of reduced size (Figure 3.12a, lane 3), similarly to what was observed by Susan Goto in her previous work when the truncated Cdk8p product appeared after 4 hours growth in SLAD media. At this point, it was hypothesized that phosphorylation on T37 targeted Cdk8p for degradation via ubiquitination and, subsequently, proteasome truncation. This was considered a very plausible possibility, as rabbit reticulocyte systems are also utilized to study protein degradation events, due to the heavy presence of proteasomes and other degradation machinery in the lysates (Carlson et al. 2005). To test this hypothesis, a known inhibitor of the proteasome, MG132, was added to the rabbit reticulocyte lysate prior to the start of the in vitro translation reaction in a gradient fashion at concentrations up to 100 µM, which corresponds to a ten-fold increase relative to the standard concentration utilized. Disappointingly, addition of the proteasome inhibitor MG132 failed to restore full-length Cdk8p synthesis (data not shown). Similarly, to investigate the possibility of a protease-mediated truncation, a protease inhibitor cocktail was added in a gradient fashion and this also failed to eliminate synthesis of the truncated fragment (data not shown). Given the lack of positive evidence to suggest protease or proteasome mediated truncation of phosphorylated Cdk8p in vitro, a model for auto-cleavage gains consistency. Protein auto-cleavage, while not a common process in S. cerevisae, has been documented in a wide range of organisms, with the most notorious example in yeast being the auto-cleavage of the enzyme separase (Holland et al. 2007).  70  Results and Discussion 3.9 Over-expression of CDK8 reverses the tpk3 null phenotype According to (Pan and Heitman 1999), Tpk3p functions as a general inhibitor of filamentous growth as is evidenced by the hyperfilamentous phenotype of a tpk3/tpk3 null strain (Figure 3.13). The mechanism of action of Tpk3p has not been elucidated up to this point. The question that arises, therefore, is whether Cdk8p and Tpk3p are part of the same or parallel signaling pathways. To address this issue, yeast of a tpk3/tpk3 background was transformed with a plasmid over expressing CDK8. According to Figure 3.13, over expression of CDK8 in a tpk3/tpk3 strain causes a decrease in the rate of filamentation. Although preliminary, this data provides evidence that these two kinases function in parallel to repress filamentation via distinct DNA-binding factors. It is known that Cdk8p exerts its effects via regulation of the transcriptional activator Ste12p, thus it is likely that Tpk3p exerts its effect on a different transcriptional activator. PHD1 is a transcriptional activator of filamentous response and given the lack of knowledge of the regulatory control of this factor, Tpk3p may be involved in its regulation.  71  Results and Discussion  Figure 3.13 TPK3 and CDK8 exert their effects on filamentation via opposing parallel pathways. Yeast strain XPY6a/! (tpk3/tpk3) was transformed with PRS316 (empty vector control with complementing prototrophic markers); PSG1 (2µ CDK8); and PJP018 (2µ KIN28). Transformed yeast were streaked for single colonies on SLAD plates, incubated days at 30°C and inspected for filament growth after 5 days.  72  Results and Discussion 3.10 Human CDK8 complements a cdk8 null phenotype and is sensitive to nitrogen signaling It is a well-established notion that there exists a high-degree of homology between S.cerevisiae and humans. Statistical studies suggest that approximately 34% of human genes have homologous counterparts in yeast (Botstein et al. 1997). The authors also mention that the value presented is a large underestimate, as genes of uncharacterized function in both humans and S. cerevisiae were not included in this statistical analysis. Given the presence of Cdk8p in the human mediator complex and in NOTCH signaling (Fryer et al. 2004) in humans, a high-degree of homology and retention of function was expected for human CDK8 expressed in yeast. According to Figure 3.14a, human CDK8 complements a cdk8/cdk8 null phenotype, thus suggesting homology between the two kinases. The question to address at this moment was whether human Cdk8p was also responsive to nitrogen limitation. Given the fact that there was mild filament formation, it was expected that human Cdk8p was responsive to nitrogen signaling, as the contrary scenario would result in a hypofilamenting phenotype. As demonstrated in Figure 3.14b, there is loss of human Cdk8p in conditions of limiting nitrogen, further corroborating the notion that function is retained between the two organisms. However, this result opens a new range of questions regarding the complete role of Cdk8p in humans. To date, human Cdk8p has received little attention from the scientific community and if the general characteristics of this kinase determined from S. cerevisiae are retained in humans, CDK8 might have a central role in coordinating stress-related responses in humans.  73  Results and Discussion  (a)  (b)  Figure 3.14 Human CDK8 is homologous to S. cerevisiae CDK8 and displays sensitivity to nitrogen depletion. (a) yeast strains L5366 (wild-type) and YCN60 (cdk8/cdk8) were transformed with PRS316 (empty vector control with complementing prototrophic markers) and PPL05 (2µ hCDK8). Transformed yeast were streaked for single colonies on SLAD plates, incubated days at 30°C and inspected for filament growth after 5 days. (b) Haploid yeast strain YCN45 (cdk8) was transformed with PPL05 (2µ hCDK8) and grown in SD –URA media, switched to SLAD media (T=0 hrs) and harvested at the indicated time point. hCdk8p stability was measured by western blotting whole cell extracts of lysed cells with !-HA antibodies.  74  Conclusions and Perspectives CHAPTER 4 – CONCLUSIONS AND PERSPECTIVES Regardless of the exact mechanism that mediates destabilization of Cdk8p in response to limiting nitrogen conditions, my results indicate a novel signaling pathway in S. cerevisiae for regulation of filamentous growth. Based on previous studies, a complete signaling cascade can now be described that leads to the activation of Ste12p-dependent filamentous responsive genes. It is known that the membrane-bound ammonium permease, Mep2p, is involved in sensing ammonium levels and relaying this to the small, membrane-bound GTP-binding protein, Ras2p (Lorenz and Heitman 1998). Activated Ras2p, further relays the signal by directly stimulating the adenylate cyclase Cyr1p (Lai et al. 1993), an event that leads to the increase of intracellular cAMP levels cAMP is a major secondary messenger controlling filamentous response, as is evidenced by the fact that exogenous cAMP causes pde/pde null yeast to filament. cAMP interacts with Bcy1, the regulatory subunit of Tpk2p, and triggers dissociation of the two proteins, liberating free, active Tpk2p (Toda et al. 1987). Finally, as here indicated, active Tpk2p phosphorylates Cdk8p at position Thr37, a modification that targets Cdk8p for truncation via an undetermined mechanism. Ultimately, loss of Cdk8p results in the stabilization of the transcriptional activator Ste12p, thus activating the expression of filamentous responsive genes (Nelson et al. 2003). A schematic representation of this complete signaling pathway is depicted in Figure 4.1. While the relation between Tpk2p and Cdk8p has become elucidated, the overall picture of the regulation of filamentous growth still has many questions to address. The complexity in regulation of the filamentous response highlights the importance of maintaining this response under tight transcriptional regulation.  75  Conclusions and Perspectives  Figure 4.1 Schematic representation of the destabilization of Cdk8p by phosphorylation by Tpk2p. Nitrogen signaling occurs via the cAMP-dependent pathway, resulting in the activation of Tpk2p, a nuclear kinase, which phosphorylates Cdk8p at Thr37. This event is believed to contribute to the destabilization of Cdk8p and, consequently, stabilization of Ste12p. Stabilized Ste12p enhances the expression of FRE-dependent filamentous genes.  76  Conclusions and Perspectives  Figure 4.2 Integration of the pathways that regulate filamentous response. Schematic representation of the MAPK, cAMP-dependent Flo8p/Sfl1p, and Cdk8p-dependent pathways exerting their effects on the expression of the hallmark filamentation gene, FLO11. Expression of FLO11 is dependent on the activity of various transcription factors, with Ste12p/Tec1p, Sfl1p and Flo8p being of utmost importance.  77  Conclusions and Perspectives Our understanding of the regulation of filamentous growth is further complicated by the fact that while the MAPK pathway is required for filamentous growth, nitrogen signaling is not transmitted through this signaling cascade. Instead, we propose that the MAPK pathway is important because it is required to ensure basal level de-repression of Ste12p, Figure 4.2. Even without pheromone stimulation, there is basal signaling via the MAPK pathway due to spontaneous dissociation of the !" subunits from the G-protein coupled receptor (Siekhaus and Drubin 2003). This basal signaling likely allows for constitutive basal derepression of Ste12p by relieving the inhibitory effects of the Dig1/2 and Kss1 proteins. The leaky GCPR, thus, prevents the repression and sequestering of a small pool of Ste12p on the PRE. It is this pool of free, un-repressed Ste12p that is sensitive to the effects of Cdk8p. The proposed model is in agreement with the evidence linking the MAPK to filamentous growth. Genetic evidence demonstrates that strains lacking the major MAPK cascade signal transducers, such as Ste2 or Ste11, do not filament. The reason is likely due to the fact that the basal level of signaling is incapable of reaching its downstream effectors in cells that lack members of the pathway, specifically Ste12p and Tec1p. Therefore, Ste12p (and Tec1p indirectly) is under constant repression by Dig1p/Dig2p and Kss1p, eliminating the formation of a small pool of free, activated Ste12p. Additionally, northern blotting data from our lab has demonstrated that TEC1 expression is highly dependent upon Ste12p and the basal constitutive MAPK pheromone response signaling. The requirement of the MAPK pathway in activation of the filamentous responses is, therefore, a mere artifact of the shared requirement for Ste12p with the pheromone response. In fact, previous work done in our lab showed that Cdk8p is degraded in nitrogen limiting conditions even in a ste7/ste7 diploid strain, thus indicating that the MAPK pathway is independent from cAMP-dependent signaling (Daisy Liu, Unpublished). Another factor that appears to have a pronounced effect on filamentation is Snf1p. Two-hybrid systems and co-immunoprecipitation experiments have 78  Conclusions and Perspectives demonstrated a physical interaction between Snf1p and Cdk8p (Kuchin et al. 2000), although the exact nature and extent of this interaction have not yet been elucidated in detail. One possibility is that Snf1p is an upstream regulator of Cdk8p. Yeast that lack snf1 are hypo-filamenting, whereas over-expression of SNF1 yields a hyper-filamentous phenotype (Kuchin et al. 2002). Conversely, a strain that lacks cdk8 exhibits hyper-filamentation (Figure 3.1), while CDK8 overexpression yields a hypo-filamenting phenotype (Figure 3.2). Based on this genetic evidence, it is plausible that Snf1p is directly phosphorylating Cdk8p and that this event leads to the destabilization of Cdk8p, similarly to the role of Tpk2p presented herein. Thus, Snf1p would function as an inhibitor of Cdk8p and additional pathways involved in glucose and nitrogen sensing would converge on Cdk8p, rendering this kinase as a very versatile and crucial general stress sensor in S. cerevisiae.  79  Future Directions CHAPTER 5 - FUTURE DIRECTIONS While the regulation of the filamentous response is a heavily studied and characterized event, many questions still remain unanswered. The previous work performed by Susan Goto (unpublished), demonstrating truncation of Cdk8p in response to nitrogen limitation is an area that requires further investigation. Given the fact that the truncated product forms a product of consistent size, it will prove important to determine the site and mechanism of cleavage. Another issue to address is whether the truncated kinase has any activity that is required for the induction of the filamentous response. Purification and characterization of this lower-molecular weight species is, therefore, of utmost importance. As discussed in chapter 4, the relation between Snf1p and Cdk8p is very vague. The evidence to suggest interaction between Snf1p and Cdk8p is sufficient to warrant the investigation on the possibility that Snf1p is directly phosphorylating Cdk8p and that this event leads to the destabilization of Cdk8p, similarly to the role of Tpk2p presented herein. Characterization of the role of Cdk8p in human cells is also of great importance. Cdk8p is a very versatile and crucial general stress sensor in S. cerevisiae; thus, to study if its yeast characteristics are retained in humans, it could prove useful in the creation of therapeutics. For instance, Cdk8p in humans may be sensitive hypoxic conditions. Given the fact that the interior of cancerous tumors are often hypoxic, due to the lack of angiogenesis and high O2 consumption by expedited growth, Cdk8p may be involved in regulating a response that would allows cells starved for O2 to forage for nutrients in adjacent areas, thus providing a model for metastasis.  80  References REFERENCES Ahn, S. H., A. Acurio, et al. (1999). "Regulation of G2/M progression by the STE mitogen-activated protein kinase pathway in budding yeast filamentous growth." Mol Biol Cell 10(10): 3301-16. Andrews, B. and V. Measday (1998). "The cyclin family of budding yeast: abundant use of a good idea." Trends Genet 14(2): 66-72. Bardwell, L., J. G. Cook, et al. (1998). "Repression of yeast Ste12 transcription factor by direct binding of unphosphorylated Kss1 MAPK and its regulation by the Ste7 MEK." Genes Dev 12(18): 2887-98. Bender, A. and G. F. Sprague, Jr. (1986). "Yeast peptide pheromones, a-factor and alpha-factor, activate a common response mechanism in their target cells." Cell 47(6): 929-37. Berry, L. D. and K. L. Gould (1996). "Regulation of Cdc2 activity by phosphorylation at T14/Y15." Prog Cell Cycle Res 2: 99-105. Bhattacharya, S., L. Chen, et al. (1995). "Ras membrane targeting is essential for glucose signaling but not for viability in yeast." Proc Natl Acad Sci U S A 92(7): 2984-8. Bjorklund, S. and C. M. Gustafsson (2005). "The yeast Mediator complex and its regulation." Trends Biochem Sci 30(5): 240-4. Blackwood, E. M. and J. T. Kadonaga (1998). "Going the distance: a current view of enhancer action." Science 281(5373): 60-3. Botstein, D., S. A. Chervitz, et al. (1997). "Yeast as a model organism." Science 277(5330): 1259-60. Broek, D., N. Samiy, et al. (1985). "Differential activation of yeast adenylate cyclase by wild-type and mutant RAS proteins." Cell 41(3): 763-9. Caldwell, G. A., F. Naider, et al. (1995). "Fungal lipopeptide mating pheromones: a model system for the study of protein prenylation." Microbiol Rev 59(3): 406-22. Cali, B. M., T. C. Doyle, et al. (1998). "Multiple functions for actin during filamentous growth of Saccharomyces cerevisiae." Mol Biol Cell 9(7): 1873-89. Cannon, J. F. and K. Tatchell (1987). "Characterization of Saccharomyces cerevisiae genes encoding subunits of cyclic AMP-dependent protein kinase." Mol Cell Biol 7(8): 2653-63. Carlson, E., N. Bays, et al. (2005). "Reticulocyte lysate as a model system to study endoplasmic reticulum membrane protein degradation." Methods Mol Biol 301: 185-205.  81  References Carlson, M., B. C. Osmond, et al. (1984). "A suppressor of SNF1 mutations causes constitutive high-level invertase synthesis in yeast." Genetics 107(1): 19-32. Carrozza, M. J., L. Florens, et al. (2005). "Stable incorporation of sequence specific repressors Ash1 and Ume6 into the Rpd3L complex." Biochim Biophys Acta 1731(2): 77-87; discussion 75-6. Chandarlapaty, S. and B. Errede (1998). "Ash1, a daughter cell-specific protein, is required for pseudohyphal growth of Saccharomyces cerevisiae." Mol Cell Biol 18(5): 2884-91. Chang, Y. W., S. C. Howard, et al. (2001). "The rye mutants identify a role for Ssn/Srb proteins of the RNA polymerase II holoenzyme during stationary phase entry in Saccharomyces cerevisiae." Genetics 157(1): 17-26. Chi, Y., M. J. Huddleston, et al. (2001). "Negative regulation of Gcn4 and Msn2 transcription factors by Srb10 cyclin-dependent kinase." Genes Dev 15(9): 1078-92. Choder, M. and R. A. Young (1993). "A portion of RNA polymerase II molecules has a component essential for stress responses and stress survival." Mol Cell Biol 13(11): 6984-91. Chou, S., S. Lane, et al. (2006). "Regulation of mating and filamentation genes by two distinct Ste12 complexes in Saccharomyces cerevisiae." Mol Cell Biol 26(13): 4794-805. Colombo, S., P. Ma, et al. (1998). "Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced cAMP signalling in the yeast Saccharomyces cerevisiae." Embo J 17(12): 3326-41. Conlan, R. S. and D. Tzamarias (2001). "Sfl1 functions via the co-repressor Ssn6-Tup1 and the cAMP-dependent protein kinase Tpk2." J Mol Biol 309(5): 1007-15. Cook, J. G., L. Bardwell, et al. (1996). "Two novel targets of the MAP kinase Kss1 are negative regulators of invasive growth in the yeast Saccharomyces cerevisiae." Genes Dev 10(22): 2831-48. Cooper, K. F., M. J. Mallory, et al. (1997). "Stress and developmental regulation of the yeast C-type cyclin Ume3p (Srb11p/Ssn8p)." Embo J 16(15): 466575. D'Souza, C. A. and J. Heitman (2001). "Conserved cAMP signaling cascades regulate fungal development and virulence." FEMS Microbiol Rev 25(3): 349-64. Deschenes, R. J. and J. R. Broach (1987). "Fatty acylation is important but not essential for Saccharomyces cerevisiae RAS function." Mol Cell Biol 7(7): 2344-51. Dickinson, J. R. (1996). "'Fusel' alcohols induce hyphal-like extensions and pseudohyphal formation in yeasts." Microbiology 142 ( Pt 6): 1391-7. 82  References Dolan, J. W., C. Kirkman, et al. (1989). "The yeast STE12 protein binds to the DNA sequence mediating pheromone induction." Proc Natl Acad Sci U S A 86(15): 5703-7. Edgington, N. P., M. J. Blacketer, et al. (1999). "Control of Saccharomyces cerevisiae filamentous growth by cyclin-dependent kinase Cdc28." Mol Cell Biol 19(2): 1369-80. Elion, E. A., J. A. Brill, et al. (1991). "FUS3 represses CLN1 and CLN2 and in concert with KSS1 promotes signal transduction." Proc Natl Acad Sci U S A 88(21): 9392-6. Estruch, F. and M. Carlson (1990). "Increased dosage of the MSN1 gene restores invertase expression in yeast mutants defective in the SNF1 protein kinase." Nucleic Acids Res 18(23): 6959-64. Fields, S. and I. Herskowitz (1985). "The yeast STE12 product is required for expression of two sets of cell-type specific genes." Cell 42(3): 923-30. Fryer, C. J., J. B. White, et al. (2004). "Mastermind recruits CycC:CDK8 to phosphorylate the Notch ICD and coordinate activation with turnover." Mol Cell 16(4): 509-20. Fujita, A., Y. Kikuchi, et al. (1989). "Domains of the SFL1 protein of yeasts are homologous to Myc oncoproteins or yeast heat-shock transcription factor." Gene 85(2): 321-8. Gagiano, M., D. van Dyk, et al. (1999). "Msn1p/Mss10p, Mss11p and Muc1p/Flo11p are part of a signal transduction pathway downstream of Mep2p regulating invasive growth and pseudohyphal differentiation in Saccharomyces cerevisiae." Mol Microbiol 31(1): 103-16. Gancedo, J. M. (2001). "Control of pseudohyphae formation in Saccharomyces cerevisiae." FEMS Microbiol Rev 25(1): 107-23. Gavrias, V., A. Andrianopoulos, et al. (1996). "Saccharomyces cerevisiae TEC1 is required for pseudohyphal growth." Mol Microbiol 19(6): 1255-63. Gietz, R. D. and R. H. Schiestl (2007). "High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method." Nat Protoc 2(1): 31-4. Gill, G. and M. Ptashne (1988). "Negative effect of the transcriptional activator GAL4." Nature 334(6184): 721-4. Gimeno, C. J. and G. R. Fink (1994). "Induction of pseudohyphal growth by overexpression of PHD1, a Saccharomyces cerevisiae gene related to transcriptional regulators of fungal development." Mol Cell Biol 14(3): 2100-12. Gimeno, C. J., P. O. Ljungdahl, et al. (1992). "Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS." Cell 68(6): 1077-90.  83  References Gnatt, A. L., P. Cramer, et al. (2001). "Structural basis of transcription: an RNA polymerase II elongation complex at 3.3 A resolution." Science 292(5523): 1876-82. Gustin, M. C., J. Albertyn, et al. (1998). "MAP kinase pathways in the yeast Saccharomyces cerevisiae." Microbiol Mol Biol Rev 62(4): 1264-300. Hampsey, M. (1998). "Molecular genetics of the RNA polymerase II general transcriptional machinery." Microbiol Mol Biol Rev 62(2): 465-503. Hansen, E. C. (1886). "Recherches sur la physiologie et la morphologie der fermentes alcooliques: VI." C. R. Trav. Lab. Carlsberg T II(Les voiles chez genre Saccharomyces): 106-147. Hedges, D., M. Proft, et al. (1995). "CAT8, a new zinc cluster-encoding gene necessary for derepression of gluconeogenic enzymes in the yeast Saccharomyces cerevisiae." Mol Cell Biol 15(4): 1915-22. Hengartner, C. J., V. E. Myer, et al. (1998). "Temporal regulation of RNA polymerase II by Srb10 and Kin28 cyclin-dependent kinases." Mol Cell 2(1): 43-53. Herskowitz, I. (1995). "MAP kinase pathways in yeast: for mating and more." Cell 80(2): 187-97. Hirst, M., M. S. Kobor, et al. (1999). "GAL4 is regulated by the RNA polymerase II holoenzyme-associated cyclin-dependent protein kinase SRB10/CDK8." Mol Cell 3(5): 673-8. Holland, A. J., F. Bottger, et al. (2007). "Protein phosphatase 2A and separase form a complex regulated by separase autocleavage." J Biol Chem 282(34): 24623-32. Holstege, F. C., E. G. Jennings, et al. (1998). "Dissecting the regulatory circuitry of a eukaryotic genome." Cell 95(5): 717-28. Hong, S. P., F. C. Leiper, et al. (2003). "Activation of yeast Snf1 and mammalian AMP-activated protein kinase by upstream kinases." Proc Natl Acad Sci U S A 100(15): 8839-43. Huang, D., H. Friesen, et al. (2007). "Pho85, a multifunctional cyclin-dependent protein kinase in budding yeast." Mol Microbiol 66(2): 303-14. Huh, W. K., J. V. Falvo, et al. (2003). "Global analysis of protein localization in budding yeast." Nature 425(6959): 686-91. Jeffrey, P. D., A. A. Russo, et al. (1995). "Mechanism of CDK activation revealed by the structure of a cyclinA-CDK2 complex." Nature 376(6538): 313-20. Kellis, M., N. Patterson, et al. (2003). "Sequencing and comparison of yeast species to identify genes and regulatory elements." Nature 423(6937): 241-54.  84  References Kim, J. H. and M. Johnston (2006). "Two glucose-sensing pathways converge on Rgt1 to regulate expression of glucose transporter genes in Saccharomyces cerevisiae." J Biol Chem 281(36): 26144-9. Kobayashi, O., H. Suda, et al. (1996). "Molecular cloning and analysis of the dominant flocculation gene FLO8 from Saccharomyces cerevisiae." Mol Gen Genet 251(6): 707-15. Kornberg, R. D. (1999). "Eukaryotic transcriptional control." Trends Cell Biol 9(12): M46-9. Kron, S. J., C. A. Styles, et al. (1994). "Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae." Mol Biol Cell 5(9): 1003-22. Kruckeberg, A. L., M. C. Walsh, et al. (1998). "How do yeast cells sense glucose?" Bioessays 20(12): 972-6. Kuchin, S., V. K. Vyas, et al. (2002). "Snf1 protein kinase and the repressors Nrg1 and Nrg2 regulate FLO11, haploid invasive growth, and diploid pseudohyphal differentiation." Mol Cell Biol 22(12): 3994-4000. Kuchin, S., P. Yeghiayan, et al. (1995). "Cyclin-dependent protein kinase and cyclin homologs SSN3 and SSN8 contribute to transcriptional control in yeast." Proc Natl Acad Sci U S A 92(9): 4006-10. Lai, C. C., M. Boguski, et al. (1993). "Influence of guanine nucleotides on complex formation between Ras and CDC25 proteins." Mol Cell Biol 13(3): 1345-52. Laloux, I., E. Dubois, et al. (1990). "TEC1, a gene involved in the activation of Ty1 and Ty1-mediated gene expression in Saccharomyces cerevisiae: cloning and molecular analysis." Mol Cell Biol 10(7): 3541-50. Lambrechts, M. G., F. F. Bauer, et al. (1996). "Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast." Proc Natl Acad Sci U S A 93(16): 8419-24. Langan, T. A., J. Gautier, et al. (1989). "Mammalian growth-associated H1 histone kinase: a homolog of cdc2+/CDC28 protein kinases controlling mitotic entry in yeast and frog cells." Mol Cell Biol 9(9): 3860-8. Lee, J. M. and A. L. Greenleaf (1991). "CTD kinase large subunit is encoded by CTK1, a gene required for normal growth of Saccharomyces cerevisiae." Gene Expr 1(2): 149-67. Lees, E. M. and E. Harlow (1993). "Sequences within the conserved cyclin box of human cyclin A are sufficient for binding to and activation of cdc2 kinase." Mol Cell Biol 13(2): 1194-201. Levin, D. E. and B. Errede (1995). "The proliferation of MAP kinase signaling pathways in yeast." Curr Opin Cell Biol 7(2): 197-202.  85  References Li, G. Y., M. Xing, et al. (2004). "A PSTAIRE CDK-like protein localizes in nuclei and cytoplasm of Physarum polycephalum and functions in the mitosis." Cell Res 14(2): 169-75. Liu, H., C. A. Styles, et al. (1993). "Elements of the yeast pheromone response pathway required for filamentous growth of diploids." Science 262(5140): 1741-4. Liu, H., C. A. Styles, et al. (1996). "Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth." Genetics 144(3): 967-78. Lo, W. S. and A. M. Dranginis (1998). "The cell surface flocculin Flo11 is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae." Mol Biol Cell 9(1): 161-71. Lo, W. S., E. I. Raitses, et al. (1997). "Development of pseudohyphae by embedded haploid and diploid yeast." Curr Genet 32(3): 197-202. Loeb, J. D., T. A. Kerentseva, et al. (1999). "Saccharomyces cerevisiae G1 cyclins are differentially involved in invasive and pseudohyphal growth independent of the filamentation mitogen-activated protein kinase pathway." Genetics 153(4): 1535-46. Long, R. M., R. H. Singer, et al. (1997). "Mating type switching in yeast controlled by asymmetric localization of ASH1 mRNA." Science 277(5324): 383-7. Lorenz, M. C. and J. Heitman (1997). "Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog." Embo J 16(23): 7008-18. Lorenz, M. C. and J. Heitman (1998). "The MEP2 ammonium permease regulates pseudohyphal differentiation in Saccharomyces cerevisiae." Embo J 17(5): 1236-47. Maciejewski, P. M., F. C. Peterson, et al. (1995). "Mutation of serine 90 to glutamic acid mimics phosphorylation of bovine prolactin." J Biol Chem 270(46): 27661-5. Madden, K. and M. Snyder (1998). "Cell polarity and morphogenesis in budding yeast." Annu Rev Microbiol 52: 687-744. Madhani, H. D. and G. R. Fink (1997). "Combinatorial control required for the specificity of yeast MAPK signaling." Science 275(5304): 1314-7. Maldonado, E., M. Hampsey, et al. (1999). "Repression: targeting the heart of the matter." Cell 99(5): 455-8. Mendenhall, M. D. and A. E. Hodge (1998). "Regulation of Cdc28 cyclindependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae." Microbiol Mol Biol Rev 62(4): 1191-243. Morrison, L. E., H. E. Hoover, et al. (2003). "Mimicking phosphorylation of alphaB-crystallin on serine-59 is necessary and sufficient to provide  86  References maximal protection of cardiac myocytes from apoptosis." Circ Res 92(2): 203-11. Murray, S., R. Udupa, et al. (2001). "Phosphorylation of the RNA polymerase II carboxy-terminal domain by the Bur1 cyclin-dependent kinase." Mol Cell Biol 21(13): 4089-96. Myer, V. E. and R. A. Young (1998). "RNA polymerase II holoenzymes and subcomplexes." J Biol Chem 273(43): 27757-60. Nasmyth, K. (1993). "Regulating the HO endonuclease in yeast." Curr Opin Genet Dev 3(2): 286-94. Nelson, C., S. Goto, et al. (2003). "Srb10/Cdk8 regulates yeast filamentous growth by phosphorylating the transcription factor Ste12." Nature 421(6919): 187-90. Nichols, N. M. and K. S. Matthews (2002). "Human p53 phosphorylation mimic, S392E, increases nonspecific DNA affinity and thermal stability." Biochemistry 41(1): 170-8. Olson, K. A., C. Nelson, et al. (2000). "Two regulators of Ste12p inhibit pheromone-responsive transcription by separate mechanisms." Mol Cell Biol 20(12): 4199-209. Orlova, M., E. Kanter, et al. (2006). "Nitrogen availability and TOR regulate the Snf1 protein kinase in Saccharomyces cerevisiae." Eukaryot Cell 5(11): 1831-7. Orphanides, G., T. Lagrange, et al. (1996). "The general transcription factors of RNA polymerase II." Genes Dev 10(21): 2657-83. Pan, X. and J. Heitman (1999). "Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae." Mol Cell Biol 19(7): 4874-87. Pan, X. and J. Heitman (2002). "Protein kinase A operates a molecular switch that governs yeast pseudohyphal differentiation." Mol Cell Biol 22(12): 3981-93. Parrini, M. C., A. Bernardi, et al. (1996). "Determinants of Ras proteins specifying the sensitivity to yeast Ira2p and human p120-GAP." Embo J 15(5): 110711. Peter, M. and I. Herskowitz (1994). "Joining the complex: cyclin-dependent kinase inhibitory proteins and the cell cycle." Cell 79(2): 181-4. Peter, M., A. M. Neiman, et al. (1996). "Functional analysis of the interaction between the small GTP binding protein Cdc42 and the Ste20 protein kinase in yeast." Embo J 15(24): 7046-59. Phatnani, H. P. and A. L. Greenleaf (2006). "Phosphorylation and functions of the RNA polymerase II CTD." Genes Dev 20(21): 2922-36.  87  References Pines, J. (1995). "Cyclins and cyclin-dependent kinases: a biochemical view." Biochem J 308 ( Pt 3): 697-711. Ptacek, J., G. Devgan, et al. (2005). "Global analysis of protein phosphorylation in yeast." Nature 438(7068): 679-84. Ren, B., F. Robert, et al. (2000). "Genome-wide location and function of DNA binding proteins." Science 290(5500): 2306-9. Riedl, T. and J. M. Egly (2000). "Phosphorylation in transcription: the CTD and more." Gene Expr 9(1-2): 3-13. Rigaut, G., A. Shevchenko, et al. (1999). "A generic protein purification method for protein complex characterization and proteome exploration." Nat Biotechnol 17(10): 1030-2. Roberts, R. L. and G. R. Fink (1994). "Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth." Genes Dev 8(24): 2974-85. Roberts, R. L., H. U. Mosch, et al. (1997). "14-3-3 proteins are essential for RAS/MAPK cascade signaling during pseudohyphal development in S. cerevisiae." Cell 89(7): 1055-65. Robertson, L. S. and G. R. Fink (1998). "The three yeast A kinases have specific signaling functions in pseudohyphal growth." Proc Natl Acad Sci U S A 95(23): 13783-7. Rodriguez, C. R., E. J. Cho, et al. (2000). "Kin28, the TFIIH-associated carboxyterminal domain kinase, facilitates the recruitment of mRNA processing machinery to RNA polymerase II." Mol Cell Biol 20(1): 104-12. Rohde, J. R., J. Trinh, et al. (2000). "Multiple signals regulate GAL transcription in yeast." Mol Cell Biol 20(11): 3880-6. Rupp, S., E. Summers, et al. (1999). "MAP kinase and cAMP filamentation signaling pathways converge on the unusually large promoter of the yeast FLO11 gene." Embo J 18(5): 1257-69. Russo, A. A., P. D. Jeffrey, et al. (1996). "Structural basis of cyclin-dependent kinase activation by phosphorylation." Nat Struct Biol 3(8): 696-700. Sadowski, I., T. C. Su, et al. (2007). "Disintegrator vectors for single-copy yeast chromosomal integration." Yeast 24(5): 447-55. Sanz, P. (2003). "Snf1 protein kinase: a key player in the response to cellular stress in yeast." Biochem Soc Trans 31(Pt 1): 178-81. Sarkar, G. and S. S. Sommer (1990). "The "megaprimer" method of site-directed mutagenesis." Biotechniques 8(4): 404-7. Siekhaus, D. E. and D. G. Drubin (2003). "Spontaneous receptor-independent heterotrimeric G-protein signalling in an RGS mutant." Nat Cell Biol 5(3): 231-5.  88  References Song, D., J. W. Dolan, et al. (1991). "Pheromone-dependent phosphorylation of the yeast STE12 protein correlates with transcriptional activation." Genes Dev 5(5): 741-50. Song, W. and M. Carlson (1998). "Srb/mediator proteins interact functionally and physically with transcriptional repressor Sfl1." Embo J 17(19): 5757-65. Stoldt, V. R., A. Sonneborn, et al. (1997). "Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi." Embo J 16(8): 1982-91. Sutherland, C. M., S. A. Hawley, et al. (2003). "Elm1p is one of three upstream kinases for the Saccharomyces cerevisiae SNF1 complex." Curr Biol 13(15): 1299-305. Tassan, J. P., M. Jaquenoud, et al. (1995). "Identification of human cyclindependent kinase 8, a putative protein kinase partner for cyclin C." Proc Natl Acad Sci U S A 92(19): 8871-5. Thompson, C. M., A. J. Koleske, et al. (1993). "A multisubunit complex associated with the RNA polymerase II CTD and TATA-binding protein in yeast." Cell 73(7): 1361-75. Toda, T., S. Cameron, et al. (1987). "Cloning and characterization of BCY1, a locus encoding a regulatory subunit of the cyclic AMP-dependent protein kinase in Saccharomyces cerevisiae." Mol Cell Biol 7(4): 1371-7. Toda, T., S. Cameron, et al. (1987). "Three different genes in S. cerevisiae encode the catalytic subunits of the cAMP-dependent protein kinase." Cell 50(2): 277-87. Vallier, L. G. and M. Carlson (1994). "Synergistic release from glucose repression by mig1 and ssn mutations in Saccharomyces cerevisiae." Genetics 137(1): 49-54. Vincent, O., S. Kuchin, et al. (2001). "Interaction of the Srb10 kinase with Sip4, a transcriptional activator of gluconeogenic genes in Saccharomyces cerevisiae." Mol Cell Biol 21(17): 5790-6. Ward, M. P. and S. Garrett (1994). "Suppression of a yeast cyclic AMPdependent protein kinase defect by overexpression of SOK1, a yeast gene exhibiting sequence similarity to a developmentally regulated mouse gene." Mol Cell Biol 14(9): 5619-27. Ward, M. P., C. J. Gimeno, et al. (1995). "SOK2 may regulate cyclic AMPdependent protein kinase-stimulated growth and pseudohyphal development by repressing transcription." Mol Cell Biol 15(12): 6854-63. Webber, A. L., M. G. Lambrechts, et al. (1997). "MSS11, a novel yeast gene involved in the regulation of starch metabolism." Curr Genet 32(4): 260-6.  89  References Zeitlinger, J., I. Simon, et al. (2003). "Program-specific distribution of a transcription factor dependent on partner transcription factor and MAPK signaling." Cell 113(3): 395-404.  90  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066450/manifest

Comment

Related Items