UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

G/C tracts and genome instability in Caenorhabditis elegans Zhao, Yang 2008-12-31

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
24-ubc_2008_fall_zhao_yang.pdf [ 4.18MB ]
Metadata
JSON: 24-1.0066448.json
JSON-LD: 24-1.0066448-ld.json
RDF/XML (Pretty): 24-1.0066448-rdf.xml
RDF/JSON: 24-1.0066448-rdf.json
Turtle: 24-1.0066448-turtle.txt
N-Triples: 24-1.0066448-rdf-ntriples.txt
Original Record: 24-1.0066448-source.json
Full Text
24-1.0066448-fulltext.txt
Citation
24-1.0066448.ris

Full Text

    G/C tracts and genome instability in Caenorhabditis elegans  by  Yang Zhao  MSc., Ocean University of China, 2003 BSc., Ocean University of China, 2000      A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Genetics)     The University of British Columbia (Vancouver)    June 2008  ? Yang Zhao, 2008 ABSTRACT  The integrity of the genome is critical to organisms and it is affected by many factors. Radiation, for example, poses a serious threat to genome stability of human beings. While physical monitors for radiation hazard are present, the biological consequences of long term exposure to radiation are not well understood. With the opportunity as part of the International Caenorhabditis elegans Experiment-1 flight project, several approaches using C. elegans  were taken to measure mutational changes that occurred during the spaceflight. Among these methods, the eT1 balancer system was demonstrated to be well-suited as an integrating biological dosimeter for spaceflight. The dog-1 gene in C. elegans is required to prevent mutations at poly-G/poly-C tracts, and previous work has described that in the absence of DOG-1, small deletions initiate within these tracts, most likely as a consequence of improperly repaired replication blocks. The eT1 balancer system was adapted to investigate the broad mutational spectrum of dog-1 mutants. Using this system, I was able to determine a forward mutation rate of approximately 1 x 10-3, 10 fold higher than spontaneous. Both small deletions as reported previously and unreported large chromosome rearrangements were observed, and most of mutations analyzed are associated with G/C tracts. Thus, I propose that following dog-1-induced replication blocks, repair leads to a wide range of mutational events and chromosomal instabilities, similar to those seen in human cancers.  The existence of the G/C tracts in C. elegans creates a fortuitous but perplexing problem. They are hotspots for genome instability and need enzymatic protection. In the genome of C. elegans, approximately 400 G/C tracts exist and are distributed along every chromosome in a non-random pattern. G/C tracts are also over-represented in another Caenorhabditis  species,  C. briggsae. However, the positions and distribution differ from those in C. elegans. Furthermore, in C. elegans, analysis of SAGE data showed that the position of the G/C tracts correlated with the level of gene expression. Although being a threat to genome stability, the genomic distribution of G/C tracts in C. elegans and their effect on regional transcription levels suggest a role for G/C tracts in chromatin structure.   iiTABLE OF CONTENTS  Abstract..................................................................................................................................... ii Table of contents...................................................................................................................... iii List of tables........................................................................................................................... viii List of figures........................................................................................................................... ix List of abbreviations ................................................................................................................ xi Acknowledgements................................................................................................................ xiii Dedications ............................................................................................................................ xiv Co-Authorship statement .........................................................................................................xv  CHAPTER 1: Introduction 1.1 Causes of genome instability ...............................................................................................2   1.1.1 DNA sequence elements.......................................................................................2  1.1.2 Mutagens...............................................................................................................6   1.1.3 Error-prone DNA repair........................................................................................8 1.2 Molecular machinery maintaining genome stability............................................................8   1.2.1 Replication machinery ..........................................................................................9   1.2.2 DNA repair pathways .........................................................................................10     1.2.2.1 DNA damage tolerance (DDT)............................................................10     1.2.2.2 Double strand break (DSB) repair .......................................................12     1.2.2.3 Interstrand cross-link (ICL) repair.......................................................16     1.2.2.4 Excision repair and mismatch repair....................................................17 1.3 C. elegans as a model for genome instability studies........................................................17   1.3.1 A good model for studying DNA repair components.........................................19   1.3.2 A good model for studying mutational effects by space radiation .....................21 1.4 DOG-1 is a DNA repair component ..................................................................................22 1.5 G/C tracts ...........................................................................................................................24   1.5.1 G-rich DNA forms secondary structures ............................................................24   1.5.2 G4 DNA and chromosomal pairing....................................................................25   iii  1.5.3 G4 DNA and gene expression.............................................................................26 1.6 Thesis objectives................................................................................................................27 CHAPTER 1 References..........................................................................................................33   CHAPTER 2: Mutational analysis of C. elegans in space 2.1 Introduction........................................................................................................................42 2.2 Materials and methods.......................................................................................................43   2.2.1 Strains and culture conditions.............................................................................43   2.2.2 Experimental protocol.........................................................................................44   2.2.3 Mutational effects on the CC1 strain ..................................................................44     2.2.3.1 Integrity of poly-G/poly-C tracts in the genome..................................44     2.2.3.2 Occurrence of mutations in unc-22......................................................45   2.2.4 Mutational effects on the eT1 system (BC2200) ................................................45     2.2.4.1 Screening for mutations.......................................................................45     2.2.4.2 Mapping and complementation............................................................46     2.2.4.3 Developmental blocking stage.............................................................48   2.2.4.4 Chromosomal rearrangements: unc-36(+) duplications ......................48   2.2.5 Refining the eT1 balancer system.......................................................................49     2.2.5.1 Identification of the eT1 breakpoint.....................................................49     2.2.5.2 Single Nucleotide Polymorphism (SNP) deficiency mapping.............50 2.3 Results................................................................................................................................51   2.3.1 Mutational effects on wild-type strain CC1........................................................51     2.3.1.1 G/C tracts are stable when DOG-1 is present......................................51   2.3.1.2 Mutations in unc-22.............................................................................51   2.3.2 Capturing mutational events with the eT1(III;V) balancer system.....................52   2.3.2.1 Mutation rate........................................................................................52     2.3.2.2 Mapping and characterization of lethal mutations...............................53   2.3.2.3 Characterization of isolated chromosome rearrangements..................54   2.3.3 Refining the eT1 system......................................................................................55     2.3.3.1 Physical breakpoints of eT1.................................................................55   iv  2.3.3.2 Physical extension of the  eT1 balanced deficiencies...........................57 2.4 Discussion..........................................................................................................................58   2.4.1 A biological dosimeter for space radiation.........................................................58  2.4.2 eT1 balancer system as an integrating biological dosimeter for studying mutational effects................................................................................................59   2.4.3 Future directions of the biological dosimeter for space radiation.......................62 CHAPTER 2 References..........................................................................................................74   CHAPTER 3: Spectrum of mutational events in the absence of DOG-1 3.1 Introduction........................................................................................................................76 3.2 Materials and methods.......................................................................................................77   3.2.1 Strains and culture conditions.............................................................................77   3.2.2 Isolating mutational events in dog-1...................................................................77   3.2.2.1 Screening for lethal mutations using  eT1 as a balancer.......................77     3.2.2.2 Screening for lethal mutations in the absence of a balancer using visible markers.....................................................................................78   3.2.3 Characterizing mutational events in dog-1 .........................................................79   3.2.3.1 Chromosomal mapping........................................................................79     3.2.3.2 Single Nucleotide Polymorphism (SNP) mapping ..............................79     3.2.3.3 Array Comparative Genomic Hybridization (aCGH) analysis............80     3.2.3.4 Mapping to regions on LGV (Left)......................................................81     3.2.3.5 Correlation of the lethal phenotype with small G/C tract deletions.....81     3.2.3.6 Developmental blocking stage.............................................................82   3.2.4 Chromosomal rearrangements: unc-36(+) duplications .....................................82     3.2.4.1 Genotyping using PCR ........................................................................82   3.2.4.2 DAPI staining.......................................................................................83   3.2.5 Measuring meiotic recombination ......................................................................83 3.3 Results................................................................................................................................84   3.3.1 Forward lethal mutation rate...............................................................................84   3.3.2 Chromosome mapping and the development arrest of the lethal mutations.......85   v 3.3.3 SNP mapping......................................................................................................85  3.3.4 aCGH analysis....................................................................................................86   3.3.5 Mapping and characterization of the lethal mutations with small deletions.......88   3.3.6 Characterization of unc-36(+) duplications ........................................................89  3.3.7 Some dog-1 progeny arrest as embryos..............................................................90 3.4 Discussion..........................................................................................................................91  3.4.1 dog-1 is a mutator ...............................................................................................91   3.4.2 Most of the studied dog-1 induced lethal mutations involve chromosome instability.............................................................................................................92  3.4.3 dog-1 generates a wide range of mutational events............................................93   3.4.4 Formation of the chromosomal rearrangements .................................................95   3.4.5 Insight into the function of the repair pathway involved in Fanconi anemia .....96 CHAPTER 3 References........................................................................................................107   CHAPTER 4: Poly-G/poly-C tracts in the genomes of Caenorhabditis 4.1 Introduction......................................................................................................................110 4.2 Materials and methods.....................................................................................................111   4.2.1 Data collection and computational analysis......................................................111   4.2.2 Nematode strains...............................................................................................111   4.2.3 CBG19723 cloning and microinjection ............................................................112   4.2.4 Measurement of G/C tract deletion frequency..................................................112   4.2.5 Verification of G/C tracts in Hawaiian strain ...................................................113   4.2.6 RNA interference on C. briggsae .....................................................................114   4.2.7 Measuring meiotic recombination ....................................................................115   4.2.8 Construction of promoter::gfp and microinjection...........................................115 4.3 Results..............................................................................................................................117   4.3.1 G/C tracts are over-represented in the C. elegans genome...............................117   4.3.2 G/C tracts are conserved in C. elegans Hawaiian (CB4856) isolate ................117   4.3.3 G/C tracts are also over-represented in Caenorhabditis briggsae....................118   vi  4.3.4 Disrupting the function of the C. briggsae dog-1 ortholog, CBG19723, causes genome instability.............................................................................................119   4.3.5 CBG19723 rescued the G/C tract deletion phenotype of the dog-1 mutant in C. elegans .............................................................................................................120   4.3.6 G/C tracts are distributed non-randomly on C. elegans chromosomes ............121   4.3.7 G/C tracts are distributed uniformly in C. briggsae genome............................121   4.3.8 Meiotic recombination tests in the G/C tracts depleted strain..........................122   4.3.9 G/C tracts mostly occur between genes or in introns .......................................124   4.3.10 Most intragenic G/C tracts containing genes are poorly characterized ..........126   4.3.11 G/C tracts are associated with the levels of regional gene expression ...........126   4.3.12 Influence of G/C tract deletion on single gene expression .............................128 4.4 Discussion........................................................................................................................130   4.4.1 Do G/C tracts in the Caenorhabditis genomes contribute to fitness, or are they just remnants of biased mutagenesis?...............................................................130  4.4.2 Does C. briggsae have a different genomic configuration from C. elegans?...132   4.4.3 The X chromosome...........................................................................................132   4.4.4 G/C tracts and chromosome pairing .................................................................133   4.4.5 G/C tracts and gene expression.........................................................................136 CHAPTER 4 References........................................................................................................152   CHAPTER 5 General discussions 5.1 eT1 balancer system and studies on genome stability .....................................................156 5.2 G/C tracts and genome stability.......................................................................................158 5.3 dog-1, G-rich DNA and Fanconi anemia studies.............................................................160 5.4 Future directions  .............................................................................................................161 CHAPTER 5 References........................................................................................................164     viiLIST OF TABLES Table 2.1 G/C tract deletions on chromosome V left..............................................................64 Table 2.2 Lethal mutant isolates from the spaceflight and control samples ...........................66 Table 2.3 Mapping and development blockage stages of lethal mutations.............................67 Table 2.4 Single Nucleotide Polymorphism (SNP) mapping of the eT1 balanced deficiencies ...............................................................................................................68  Table 3.1 Single Nucleotide Polymorphism (SNP) primers ...................................................98 Table 3.2 Lethal mutant isolates from dog-1(gk10)/ dog-1(gk10) strains...............................99 Table 3.3 Mapping and development blockage stages of lethal mutations on LGV ............100 Table 3.4 SNP mapping of lethal mutations on LGV ...........................................................101 Table 3.5 Meiotic recombination frequency between Dpy-11 and the lethal mutations ......102  Table 4.1: Genomic location of G/C tracts in C. elegans .....................................................138 Table 4.2: Conserved G/C tracts in C. briggsae and C. elegans...........................................139 Table 4.3: Recombination frequency of heterozygous G/C tract deletions strain ................140 Table 4.4: Recombination frequency of heterozygous G/C tract ZC404 deletion strain......141 Table 4.5: Positions of G/C tracts in C. elegans ...................................................................142 Table 4.6: KOG classification of intragenic G/C tracts bearing genes.................................143 Table 4.7: Average SAGE tags of genes associated with nearby G/C tracts........................144   viiiLIST OF FIGURES  Figure 1.1 Strategies involved in the replication fork blockage response...............................28 Figure 1.2 Homologous recombination repair pathways in DSB repair.................................29 Figure 1.3 Punnett square showing progeny genotypes and phenotypes that result from selfing eT1 heterozygote marked by visibles................................................30 Figure 1.4 Proposed model for the occurrence of small deletions induced by the absence of DOG-1..................................................................................................31 Figure 1.5 Model proposed by Youds et al for repair pathways functioning downstream of replication blockages in dog-1 mutants ........................................32  Figure 2.1 G/C tracts located on the left arm of chromosome V............................................69 Figure 2.2 Genetic map of eT1 balanced region LGIII (right) and LGV (left).......................70 Figure 2.3 Working flow of the inverse PCR used to characterize the eT1 breakpoint on LGIII .................................................................................................................71 Figure 2.4 (a) DAPI staining of diakinesis-stage chromosomes of unc-36(+) duplications............................................................................................................72 Figure 2.4 (b) Schematic map of the location and extent of the unc-36(+) duplications........72 Figure 2.5 (a) Schematic representation of the wild-type organization of LGIII and LGV and eT1(III;V) reciprocal translocation.........................................................73 Figure 2.5 (b) eT1 chromosomes can be detected by PCR.....................................................73  Figure 3.1 Physical map of eT1 balanced region on LGV (left)...........................................103 Figure 3.2 a) aCGH detection of the large deletions on chromosome V and duplication on chromosome X.............................................................................104 Figure 3.2 b) Breakpoints of the deletion on chromosome V left and the duplication on chromosome X................................................................................................104 Figure 3.3 Small G/C tract deletions involved in h2137 and h2140.....................................105 Figure 3.4 DAPI staining of diakinesis-stage chromosomes of unc-36(+) duplications ......106  Figure 4.1 Length distribution of G/C tracts in C. elegans genome .....................................145   ixFigure 4.2 Predicted gene model of C. briggsae dog-1 CBG19723 (release cb25.agp8) and the corrected model after mRNA analysis  ...................................................146 Figure 4.3 Distribution of G/C tracts in every mega-base pair block on each chromosome of C. elegans ..................................................................................147 Figure 4.4 Distribution of G/C tracts along each chromosome of C. elegans and C. briggsae ...............................................................................................................148 Figure 4.5 Distribution of G/C tracts along each chromosome of C. briggsae based on genome assembly CB3....................................................................................149 Figure 4.6 G/C tract deletions on the genetic map of LGV .................................................150 Figure 4.7 GFP expression pattern driven by pha-4pE3-G::gfp in N2 worms does not alter significantly from the control  .....................................................................151  Figure 5.1 Different chromosome rearrangements caused by double strand breaks (DSBs)..................................................................................................................163    xLIST OF ABBREVIATIONS   aCGH array Comparative Genomic Hybridization ATLD  Ataxia Telangiectasia-like disorder AT   Ataxia Telangiectasia ATM   Ataxia Telangiectasia Mutated ATR   Ataxia Telangiectasia Related BER  Base excision repair BIR Break-induced replication BLAST   Basic Local Alignment Search Tool BLM   BLooM syndrome protein BRIP1   BRCA1-Interacting Protein CeMM  C. elegans maintenance media CFS  Common fragile sites CI Confidence interval DAPI   4'-6-DiAmidino-2-PhenylIndole DDT  DNA damage tolerance DNA-PKcs   DNA-Protein Kinase catalytic subunit DOG-1   C. elegans Deletions of Guanine DPY   C. elegans Dumpy DSB  Double strand break EMSA  Electrophoretic mobility shift assay EMS Ethylmethane sulfonate EST  Expressed sequence tag FA   Fanconi Anemia G4 DNA  G Quadruplex G/C tracts  Poly-G/poly-C tracts, or homopolymeric (G/C) runs GFP   Green Fluorescent Protein GG-NER   Global Genome Nucleotide Excision Repair HJ   Holliday Junction HIM   High Incidence of Males HP Homopolymeric nucleotides HR   Homologous Recombination HRR   Homologous Recombination Repair ICE-First  Caenorhabditis elegans Experiment First Flight ICL Interstrand Cross-Link IPTG   IsoPropyl-beta-D-ThioGalactopyranoside ISS  International Space Station KOG Conserved Orthologous Groups LET  Linear energy transfer LG Linkage group LIG4   Ligase 4 LINE  Long interspersed nuclear elements LOH  Loss of heterozygosity LTR  Long terminal repeat   xiMCM Minichromosome maintenance MIN Microsatellite Instability MLH   MutL Homolog MSH   MutS Homolog MMR Mismatch Repair MRE   Meiotic REcombination homolog MRN   MRE11/RAD50/NBS1 complex NAHR Non-allelic homologous recombination NBS Nijmegen Breakage syndrome NER   Nucleotide Excision Repair NGM   Nematode Growth Media NHEJ   Non-Homologous End-Joining PBS   Phosphate Buffered Saline PCNA   Proliferating Cell Nuclear Antigen PCR   Polymerase Chain Reaction PRR Post-replication repair PVL   C. elegans Protruding VuLva RAD-51   RADiation sensitivity abnormal RFC   Replication Factor C RFS Rare fragile sites RNAi   RNA interference RP-A   Replication Protein A RPM   Revolutions Per Minute SAGE Serial Analysis of Gene Expression SINE  Short interspersed nuclear elements SDSA   Synthesis Dependent Strand Annealing SNP  Single Nucleotide Polymorphism SSA Single-strand annealing ssDNA   single stranded DNA STE  C. elegans steriles TC-NER   Transcription Coupled Nucleotide Excision Repair TE Transposable elements TFIIH   Transcription Factor II H TLS   Trans-Lesion Synthesis TMP   TriMethylPsoralen TNR Trinucleotide repeats TTD   TrichoThiDystrophy UNC   C. elegans UNCoordinated UTR  Un-translated region  VAB  C. elegans variable abnormal WRN   WeRNer syndrome protein XP   Xeroderma Pigmentosum XRCC   X-ray Repair Cross-Complementing   xiiACKNOWLEDGEMENTS  The work in this thesis could not be accomplished without the help of many people; it is time to say thanks to those who have contributed to my experience during the last five years. Of course I would like to thank my supervisor Ann Rose for providing me the opportunity and her guidance and support throughout the past five years. I also wish to thank Nigel O?Neil particularly for sharing his knowledge and ideas and for his mentorship during the past few years. I would like to thank my supervisory committee, Carolyn Brown, Don Moerman, and Dipankar Sen for their guidance and thoughtful comments. I would also like to acknowledge David Baillie, Donald Riddle and their laboratories for sharing research resources. Thanks also to collaborators in the space project. Many thanks to the members from the Rose lab, past and present, especially to Berdjis Bahrami and Shir Hazir for pouring all those plates. Most importantly, I wish to thank my family. To my wife Jie Pan, who has accompanied me through the most difficult times of this work. To my parents, for their unconditional love, encouragement and support. I feel I owe them everything, to them I dedicate this thesis.   xiiiDEDICATIONS    to my parents, my wife, and my daughter   xiv  xvCO-AUTHORSHIP STATEMENT   The research described in chapters 2 has been published in the article ?Yang Zhao, Kenneth Lai, Iris Cheung, Jillian Youds, Maja Tarailo, Sanja Tarailo and Ann Rose. A mutational analysis of Caenorhabditis elegans in space?. I performed most of the mutation screening and all the following molecular genetic studies and drafted the manuscript. KL, JY, MT, and ST assisted the initial screening and helped to draft the manuscript. The research conducted by IC was reported in the article but was not included in this thesis. AR conceived of the study, and participated in its design and coordination and helped to draft the manuscript.   The research described in chapter 4 has been published in the article ?Yang Zhao, Nigel J O'Neil and Ann M Rose. Poly-G/poly-C tracts in the genomes of Caenorhabditis?. I carried out the molecular genetic studies, genomic data collection and analysis and drafted the manuscript. NO participated in the design of the study and helped to draft the manuscript. AR conceived of the study, and participated in its design and coordination and helped to draft the manuscript. CHAPTER 1: Introduction Organisms need to preserve the information content of the genetic material for both the health of the individual and successful reproduction of the species. The stability of the genome is affected by both external and internal factors. A number of mechanisms have evolved to maintain genomic integrity. Steps in replication, repair and the meiotic/mitotic processes all contribute to ensure genome integrity (Hassold and Hunt 2001; Aguilera and Gomez-Gonzalez 2008). In general, genome instability is usually associated with pathological disorders (Hoeijmakers 2001; Myung et al. 2001; Vinson and Hales 2002; Woodruff and Thompson 2003; Andressoo et al. 2006; Mirkin 2006). Much of our knowledge about the factors affecting genome instability comes from studies on model organisms, from prokaryotic bacteria to eukaryotes such as yeast, worms, and mice. The nematode Caenorhabditis elegans is a valuable animal model to study the mechanisms involved in genome instability because while C. elegans has most of the repair processes of higher eukaryotes it can be manipulated with the ease of a micro-organism.  In this thesis, I investigated several aspects of genomic instability in the nematode, C. elegans. The research aims at understanding the causes and the consequences in three separate but related projects: 1) characterization of mutational effects by space radiation; 2) investigation of the mutational spectrum of the dog-1 mutator phenotype; and 3) characterization of G/C tracts, hotspots for genome instability, in the genomes of C. elegans. The following sections describe the general background for the research described in this thesis.     11.1 Causes of genome instability Genome instability encompasses a range of genetic alterations from point mutations to chromosome rearrangements. There are many factors affecting the integrity of the genome, from both exogenous and endogenous sources. Exogenous genotoxic stress such as chemicals and radiation and endogenous factors such as specific sites and elements within the DNA that can form secondary structure, proteins bound to DNA and even the process of DNA repair can result in DNA damage and genome instability.   1.1.1 DNA sequence elements DNA fragile sites as well as various repetitive elements are sources of genome instability. Fragile sites are DNA sequences that are prone to form gaps and breaks following partial inhibition of DNA synthesis (Sutherland 1977). They are often associated with trinucleotide repeats (TNRs) of the type CGG?CCG, CAG?CTG, GAA?TTC and GCN?NGC and are frequently associated with hotspots for translocations, duplication, insertion and other rearrangements (Durkin and Glover 2007). Fragile sites are generally categorized into two main classes based on their population frequency and pattern of inheritance. Rare fragile sites, also known as dynamic mutations, account for less than 5% of the cases and arise as a consequence of DNA-repeat expansion (Aguilera and Gomez-Gonzalez 2008). Rare fragile sites segregate in a Mendelian manner and are associated with genetic diseases, such as fragile X mental retardation syndrome, Friedrich?s ataxia, Huntington disease, myotonic dystrophy or several spinocerebellar ataxias (reviewed by Durkin and Glover 2007). Common fragile sites (CFS) account for more than 95% of all known fragile sites and represent a component of normal chromosome structure and are not the result of nucleotide   2repeat expansion mutations. However, common fragile sites have been associated with genome instability in cancer cells and with activation of the DNA damage response to stalled replication. In cultured cells, CFSs are hotspots for metaphase chromosome gaps and breaks and induced chromosome rearrangements. Although CFSs are not involved in the most common recurrent translocations in cancer and leukemia, numerous studies have now shown that CFSs are sites of frequent deletions/insertion and other chromosome rearrangements in tumor cells (Yunis and Soreng 1984; Durkin and Glover 2007).  Many studies have shown the mutation rate of repetitive elements such as microsatellites and minisatellites to be several orders of magnitude higher than random DNA sequence (Ellegren 2000). Based on their sensitivity to replication stress (Durkin and Glover 2007), it was proposed that impairment of replication leading to DNA breaks or gaps is responsible for the fragile-site instability (Glover et al. 1984), this is also supported by the observation that the stability of mammalian fragile sites depends on the Mec1 and other S-phase checkpoints (Casper et al. 2002). In yeast, Rrm3 helicase, which is required for replication progression through obstacles, was found responsible for fragile site instability. Moreover, replication is stalled at CCG and CAG?CTG repeats found in mammalian fragile sites, supporting the idea that fragile sites are linked to replication impairment through DNA secondary structures that lead to double strand breaks (DSBs) (Pelletier et al. 2003; Schwartz et al. 2005; Admire et al. 2006). In addition to the formation of DSBs, replication blockage may also be responsible for polymerase slippage at repetitive elements, which leads to the changes in tract length (Kang et al. 1995a). Additionally, ectopic recombination is also believed to cause such mutations (Smith 1976).    3The instability of TNRs seems to be associated with their capability to adopt unusual secondary structures such as hairpins or triplexes (Wells 1996; Moore et al. 1999). Other repetitive DNA sequences can also form various secondary structures in vitro, such as Z-DNA, hairpins, cruciforms, triplexes, and quadruplexes. Secondary structures are not strictly limited to DNA repeats, for example, G-rich DNA can form G-quadruplexes. Secondary structures formed by DNA repeats pose a serious threat to the genome stability, because they can block DNA replication (Baran et al. 1991; Kang et al. 1995b; Usdin and Woodford 1995; Samadashwily et al. 1997).  Homopolymeric nucleotides (HPs) in forms of (A/T)n or (G/C)n are one of the most abundant microsatellite repeat types. Both types of HPs can form higher structures, but they have different structural characteristics. The crystal structure of a DNA sequence containing a homopolymeric run of A/T possesses non-Watson-Crick hydrogen bonding, which causes a rigid structure (Nelson et al. 1987). G/C HPs can form secondary structures such as DNA triplexes and G-quadruplexes. A higher mutation rate in G/C HPs than A/T HPs has been observed in both yeast and worms (Gragg et al. 2002; Denver et al. 2004), which could also be the case in other organisms, resulting in higher abundance of A/T HPs than G/C HPs (Dechering et al. 1998; Toth et al. 2000). However, the longer G/C HPs are apparently overrepresented in the genome of C. elegans, which is suggestive of the possibility that long G/C HPs have a biological function.   In addition to the tandem repeats described above, there is another class of repetitive elements called interspersed repeats. As the name suggests interspersed repeats can be present at different locations throughout the genome. Three major types of interspersed repeats exist in the eukaryotic genomes: transposable elements, segmental duplications and   4pseudogenes (reviewed by Tang 2007). Transposable elements (TEs), also called transposons or mobile genetic elements fall into three categories: (1) long terminal repeat (LTR) retrotransposons, also called retrovirus-like elements; (2) non-LTR retrotransposons, including long interspersed nuclear elements (LINEs) and short interspersed nuclear elements (SINEs); and (3) DNA transposons. Each class of repeats consists of both autonomous and non-autonomous elements. Autonomous elements are intact elements that include the full set of proteins (enzymes) required to transpose their genetic material from one region to another. Whereas, non-autonomous elements contain only partial sequence of the element and rely on another active intact element to transpose (Tang 2007). TEs are considered as agents of genome instability because of their mobility. The potentially negative consequences of this instability are perhaps best illustrated by the many human genetic diseases that are attributable to TE-mediated rearrangements (reviewed by Deininger and Batzer 1999; Hedges and Deininger 2007). Compared to TEs, segmental duplications and pseudogenes account for a minority of interspersed repeats but represent an important feature of mammalian evolution. Numerous paralogous genes in mammals are created through segmental duplications and have developed new biological functions (Johnson et al. 2001). The homologous sequences in all interspersed repeats may cause misalignment during recombination (non-allelic homologous recombination, NAHR) and facilitate genomic alterations ranging from deletions and duplications to large-scale chromosomal rearrangements.       51.1.2 Mutagens Mutations arise not only from errors in replication and repair pathways, but also from damage to the DNA, which could be caused by mutagens from the environment or in the cell. For example, even under normal physiological conditions, DNA is subject to spontaneous hydrolytic damage which can result in deamination of cytosine into uracil, depurination of guanine into apurinic deoxyribose, and deamination of 5-methylcytosine into thymine (Watson et al. 2008).  DNA is vulnerable to damage from many kinds of chemical agents. Mutations can be caused by 1) base analogs; 2) intercalating agents; 3) alkylating agents; 4) oxidizing agents and 5) inter/intrastrand crosslinkers. Most of the mutations caused by first three types of agents are small single base pair changes or small deletions, for example, ethylmethane sulfonate (EMS) is an alkylating chemical that has been widely used in mutagenesis screens to generate point mutations. Whereas, oxidizing agents such as formaldehyde and inter/intrastrand crosslinkers such as cisplatin can result in larger chromosomal rearrangements. Although mutagenic chemicals can cause damage to DNA, they are used as an approach to kill tumours. For example, DNA interstrand cross-link forming compounds are one of the most important classes of chemotherapeutic agents (McHugh et al. 2001).   Radiation, including UV light, X-rays, ? -rays, and ionizing particles can result in DNA mutation. UV light with a wavelength of 260nm is strongly absorbed by the bases, causing the photochemical fusion of two adjacent pyrimidines on the same strand termed as thymine dimer. The fused bases are incapable of base pairing and can cause replication blockage, which could lead to genome instability ranging from micro-deletion to rearrangements (Watson et al. 2008). X-ray, ? -rays and other heavy ionizing particles are more hazardous   6because they attack the DNA backbone directly and can cause double strand breaks, resulting in a high proportion of chromosomal rearrangements. Studies on C. elegans  have shown that ? -rays induced larger deficiencies than UV light or formaldehyde mutagenesis (Rosenbluth et al. 1985; Johnsen and Baillie 1988). Alternatively, radiation can also indirectly damage DNA by generating reactive oxidizing agents in the cell. Ionizing radiation is used to kill rapidly proliferating cells in cancer therapy, in a manner similar to ICL-generating chemotherapeutics described above.  One challenge is being able to identify and quantify mutagenic environments for both chemical and radiation based mutagens. An excellent example of such an environment is encountered during human space exploration. Human activities in outer-space have expanded tremendously since the last century. The number of people and the length of time spent in space are increasing. Various factors in space, especially radiation, could induce mutations. Unlike on earth, where UV light is the major mutagenic threat, high linear energy transfer (LET) charged particles are an important mutagenic component of space radiation (Hartman et al. 2001). Little is known about the biological effects of long-term exposure to radiation in space, and it is thus extremely important to understand the biological effects of space radiation on human beings. While a physical or chemical detector can measure the dosage of radiation, it cannot determine the biological effects of any specific dosage, for example, 1mRd a day for 100 days vs. 100mRd in a single day. Furthermore, existing detectors are not able to record any currently unrecognizable hazardous events. For this, biological or animal assays are needed and a biological dosimeter will help us to measure and characterize these effects. The advantage of using a biological system is that it can provide information about the real biological effects that is not reflected by physical detectors.    7 1.1.3 Error-prone DNA repair Finally, another source of genetic mutation is the repair pathways themselves. Many DNA repair mechanisms can cause genome instability as a by-product of DNA repair. Microsatellite Instability (MIN) including base substitutions, micro-insertions and micro-deletions, is associated with replication errors and error-prone translesion synthesis. Instability leading to rearrangements refers to events that involve changes in the genetic linkage of two DNA fragments. Increases in DSBs and DSB induced repair pathways, mainly HR? mediated events and end-joining between non-homologous DNA fragments, can result in chromosomal rearrangements such as translocations, duplications, inversions or deletions. The detailed mechanisms and machineries of these DNA repair pathways will be described in the following sections.  1.2 Molecular machinery maintaining genome stability Responding to DNA damage, numerous genes in many different but overlapping pathways contribute to the maintenance of genome stability. While the machinery of the DNA replication pathway ensures precise duplication of the genetic information, components in DNA damage repair pathways as well as checkpoint pathways are functioning together to make sure the genetic information is intact and transmitted faithfully. Mutations in many of these genes become mutators, as disruption in their functions leads to genome instability in the genome. The following sections briefly describe the major mechanisms and components in the pathways that maintain the genome stability    81.2.1 Replication machinery Although the primary function of the replication machinery is genome replication, their proper function prevents abnormal DNA synthesis and the formation of replication intermediates that could lead to genome instability. Many different components are involved in the DNA replication process. In eukaryotes, the heterohexameric mini-chromosome maintenance (MCM) helicase complex unwinds the DNA duplex to allow access for the DNA polymerase ?  primase that synthesizes RNA primers to initiate the DNA synthesis. The result of the unwinding is the production of single-stranded (ss)DNA, which is protected and stabilized by an ssDNA-binding protein known as replication protein-A (RP-A). This protein can also help to unwind the DNA, either on its own or through its interactions with DNA helicases and DNA polymerase. DNA synthesis is catalyzed by the polymerases ?  and ?. This polymerase switch is mediated by the replication processivity clamp (PCNA) that is loaded by the replication factor C complex (RFC) and stabilizes DNA polymerases. After complete DNA synthesis and endonucleolytic processing, the Okazaki fragments on lagging strand are joined by DNA ligase I, and topological constraints are then released by DNA topoisomerase I.  Mutations in components of the replication process have been shown to cause genome instability (reviewed by Shevelev and Hubscher 2002; Aguilera and Gomez-Gonzalez 2008). These mutations can result in DNA replication stress, normally defined as inefficient DNA replication that causes DNA replication forks to progress slowly or stall. This DNA replication stress leads to genome instability, in part because of the DNA structures formed at the replication fork. Replication forks contain unwound, highly recombinogenic single-stranded template DNA; and, single-strand lesions within unwound DNA strands at   9replication forks can result in double-strand breaks (DSBs), which are also highly recombinogenic. Two main pathways exist to repair double strand breaks: homologous recombination (HR) repair and non-homologous endjoining (NHEJ). Classic genetic studies in E. coli and S. cerevisiae have shown that mutations in DNA ligase I, DNA polymerase I (?  in S. cerevisiae), DNA polymerase III (?  in S. cerevisiae), Replication factor A, DNA thymidylate kinase or DNA adenosine methylase strongly increases the levels of spontaneous chromosomal exchanges, most likely through the HR repair process (Marinus and Konrad 1976; Zieg et al. 1978; Hartwell and Smith 1985; Aguilera and Klein 1988). Similarly, a hyper-recombination phenotype is observed in cells defective for replication-related components, such as the Rad27 Flap endonuclease, which is involved in the removal of RNA primers from Okazaki fragments, and the nucleosome assembly factors Cac1 and Asf1 that are required during replication (Gangloff et al. 1994; Tishkoff et al. 1997; Myung et al. 2003; Prado et al. 2004).  1.2.2 DNA repair pathways 1.2.2.1 DNA damage tolerance (DDT) The genome is particularly sensitive to lesions encountered during DNA replication. Cells have to maintain and complete DNA synthesis or risk replication fork collapse, which often results in double-strand breaks (DSBs) and causes genome instability and/or cell death. To ensure continuation of DNA synthesis in the presence of damage, organisms have evolved DNA damage tolerance (DDT) mechanisms to survive replication-blocking lesions. DDT was originally termed DNA post-replication repair (PRR) due to observations of transient shortened nascent DNA structures following S phase in response to DNA damage (Rupp and   10Howard-Flanders 1968; West et al. 1981). Because the DNA damage remains in the template strand, the DDT or PRR pathway is a lesion bypass pathway, or a damage avoidance pathway. There are several means to bypass replication fork blocking lesions, including both error-free and error-prone sub-pathways (Figure 1.1). The error-free bypass is achieved by using the newly synthesized sister chromatid as a template. Two possible models, namely replication fork regression and template switching, have been proposed (Broomfield et al. 2001) (Figure 1.1). Fork regression involves the unwinding of the two newly synthesized DNA from the parental strands and annealing of the two nascent strands to produce a characteristic chicken-foot structure (Flores et al. 2001; Robu et al. 2001; Grompone et al. 2004), and the longer nascent strand could act as a template for the other nascent strand to replicate past damage that is present on the parental strand. Yeast Rad5, which is a DNA helicase, was found to be necessary for replication fork regression (Blastyak et al. 2007). The alternate pathway, template switching, involves homologous sister chromatid invasion/cohesion and DNA synthesis using the lesion-free nascent strand as a template. In both proposed models, the newly formed Holliday Junction-like structure needs to be resolved. Resolution can be achieved by unwinding by helicases (Constantinou et al. 2000; Karow et al. 2000) or cleavage by structure-specific endonucleases such as Mus81 (Whitby et al. 2003).  Some types of damage can be bypassed by error-prone translesion synthesis (TLS) that is regulated by Rad6-Rad18 (Broomfield et al. 2001). Error-prone TLS can occur by the regular replicative polymerases or specialized, error-prone polymerases. While errors caused by replicative polymerases can be simple incorrect base-pairing and/or lack of proofreading, the TLS polymerases have active sites with open structures that allow the accommodation of   11altered bases, which cause these polymerases to be error-prone (Lehmann 2006). All TLS polymerases except one (i.e., Pol? ) are Y-family polymerases that lack a 3'-5' proofreading exonuclease activity and contain relatively non-restrictive active sites (reviewed by Lehmann et al. 2007; Yang and Woodgate 2007). The different polymerases act on different types of lesions (Lehmann et al. 2007).  Replication blocks pose a threat to the genome stability and the health of organisms, and DDT pathways provide mechanisms to survive replication-blocking lesions. Previous studies have clearly demonstrated the significance of DDT in maintaining genomic stability. In yeast cells defective for error-free DDT, spontaneous mutation rates are elevated by 30-fold (Andersen et al. 2008). Furthermore, mutations of many key factors in DDT, such as rad5, rad6, rad18, result in  sensitivity to DNA damage agents, mutator phenotypes, and increased illegitimate recombination/gene conversion (Jones et al. 1988; Johnson et al. 1992; Prakash et al. 1993; Liefshitz et al. 1998; Smith et al. 2004). So although DDT can result in the accumulation of mutations, the alternative of having unresolved replication fork blocks is far more deleterious.  1.2.2.2 Double strand break (DSB) repair DNA double-strand breaks are critical lesions that can result in cell death or a wide variety of genetic alterations including deletions, loss of heterozygosity (LOH), translocations, and chromosome loss. DSBs can occur as a result of endogenous sources including reactive oxygen species generated during cellular metabolism, collapsed replication forks (Figure 1.1), and nucleases, and exogenous sources including ionizing radiation and chemicals that directly or indirectly damage DNA (Scott and Pandita 2006). Furthermore,   12DSBs are intentionally created during physiological processes such as meiosis and immunoglobulin class switching (Keeney and Neale 2006; Chaudhuri et al. 2007). DSBs are mainly repaired by non-homologous end-joining (NHEJ) and homologous recombination (HR), and defects in these pathways cause genome instability and promote tumorigenesis. The homologous recombination repair (HRR) pathway functions to repair DSBs using a homologous sequence as a template. HRR comprises a series of related sub-pathways that use DNA strand invasion and template-directed DNA repair synthesis with high-fidelity (Figure 1.2). In addition to the classical model involving the formation of a double Holliday Junction and subsequent resolution (dissolving), genetic and molecular studies have proposed two further variations of the HR pathway in the Synthesis Dependent Strand Annealing (SDSA) (Nassif et al. 1994) and Break-Induced Replication (BIR) (Malkova et al. 1996; Mosig 1998). In all models, HRR initiates with the generation of single-stranded 3? DNA overhangs, which normally involves the Mre11-Rad50-Nbs1 (MRN, in human) complex. The RAD51 recombinase assembles onto the single-stranded DNA end and coordinates the invasion of the 3'-end on the template duplex DNA to initiate the repair (reviewed by Li and Heyer 2008). Many factors have been identified that regulate this complex process (Schild et al. 2000; Masson et al. 2001; Sugawara et al. 2003; Lisby et al. 2004; Esashi et al. 2005; Yonetani et al. 2005; Davies and Pellegrini 2007; Esashi et al. 2007). DNA strand invasion generates a structure called a D-loop intermediate, where the 3'-end of the invading strand primes DNA synthesis off the template duplex DNA. The classic HR sub-pathway proceeds by engaging the second end of the DSB, by either second end capture through DNA annealing or a second invasion event coordinated by Rad52 (Sugiyama et al. 2006), resulting in an intermediate structure termed as double Holliday junction (dHJ). This structure could   13be either dissolved into non-crossover products by helicases or resolved by a structure-specific endonuclease into crossover/non-crossover products. In SDSA, the D-loop is dissolved after some DNA synthesis and the invading strand disengages from the template duplex and reanneals with the second end of the DSB using the newly synthesised 3? end, always forming non-crossover products. In BIR, the invading strand is postulated to establish a replication fork to copy the entire distal arm of the template chromosome, and the second DSB end is never engaged and the genetic information of that fragment is lost.  In addition to DSB repair, HR also functions in single strand gap repair as a means of damage tolerance. These gaps could be repaired by the error-prone TLS polymerases (described above), but template-switching followed by HR repair using the uninterrupted strand as a template can also bypass the lesions (Figure 1.1)(Aguilera and Gomez-Gonzalez 2008; Li and Heyer 2008).  Another primary mechanism of eukaryotic cells? DSB repair is non-homologous end-joining (NHEJ). In NHEJ, blunt DNA ends or ends with small complementary overhangs are ligated together. In mammalian cells NHEJ proceeds in a stepwise manner beginning with limited end-processing by the MRN complex and perhaps other factors, end-binding by Ku70/Ku80 heterodimer, and recruitment of the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) (reviewed by Shrivastav et al. 2008). Once bound to broken ends, DNA-PK is activated and it phosphorylates itself and other targets including RPA, WRN, and Artemis (Burma et al. 2006; Shrivastav et al. 2008). In the final step, DNA ligase IV activated by DNA-PK, with its binding partners XRCC4 and XLF, seals the break (Burma et al. 2006; Shrivastav et al. 2008).    14DSBs repair pathways efficiently protect the genome, and mutations of components in these pathways result in genome instability ranging from microsatellite instability to gross chromosomal rearrangements. Several DSB repair deficiencies in humans are characterized by specific genome instability phenotypes such as cancer predisposition, immunodeficiency and/or developmental defects. Ataxia Telangiectasia-like disorder (ATLD) and Nijmegen Breakage syndrome (NBS) are caused by mutations in the MRE11 and NBS1 components of the MRN, which functions in the early detection and ending process of the break (Matsuura et al. 1998; Taylor et al. 2004). Mutations in BRCA2 also cause the cancer susceptibility syndrome Fanconi Anemia (Wang 2007). Severe Combined Immunodeficiency with Sensitivity to Ionizing Radiation (RS-SCID) and LIG4 syndrome, which both are characterized by immunodeficiency, cellular radiosensitivity, and/or cancer predisposition, are caused by mutation in Artemis and Ligase 4 that are involved in non-homologous end-joining pathway (Scott and Pandita 2006).  Similar to DDT pathways, DSBs repair pathways maintain genome stability but they also contribute to genome instability with risks of large- and small-scale genome rearrangement caused by recombination. Single strand annealing (SSA) causes interstitial deletions. NHEJ repairs breaks but is error prone as it does not use a template for repair and it is associated with gross chromosomal rearrangements that result from the joining of non-homologous DNA ends (Varga and Aplan 2005; Zhang and Rowley 2006). Even re-joining of broken ends by NHEJ can result in mutations at junctions, as a result of imprecise joining, which causes small deletions and insertions. HR is a more accurate mechanism for DSB repair because broken ends are repaired using homologous sequences from sister chromatids or homologous chromosomes as a template for repair. However, HR is prone to errors, most of   15which result from using non-allelic homologous regions of DNA as a repair template. Such HR errors cause chromosomal rearrangements.  1.2.2.3 Interstrand cross-link (ICL) repair  DNA interstrand cross-links (ICLs) are extremely deleterious lesions that covalently tether both duplex DNA strands and block both replication and transcription (Figure 1.1). Genetic and biochemical studies in yeast have found that genes involved in nucleotide excision repair (NER), homologous recombination (HR), and translesion synthesis (TLS) are all required for the repair of DNA cross-links (reviewed by Lehoczky et al. 2007). The Fanconi Anemia pathway is critical for ICL repair in higher eukaryotes. Fanconi Anemia (FA) is a rare cancer susceptibility syndrome associated with various congenital abnormalities, including skeletal malformations, renal abnormalities and hematological problems (Levitus et al. 2006; Wang 2007). At least 13 complementation groups are involved in the FA pathway, including A, B, C, D1/BRCA2, D2, E, F, G, I, J/BRIP1, L, M and N/PALB2, and a different gene is defective in each complementation group (reviewed by Taniguchi and D'Andrea 2006; Wang 2007).  A replication fork stalled by an ICL activates Ataxia Telangiectasia and Rad3-related protein (ATR) and the downstream checkpoint kinase 1 (CHK1), which activate the FA core  complex (composed of FA proteins A, B, C, E, F, G and L and the FA-associated protein FAAP100) and FA ID complex (FANCD2 and FANCI) by phosphorylation. The core complex monoubiquitylates the ID complex (reviewed by Wang 2007), which is central to this pathway because it causes ID complex to be recruited to the site of the DNA cross-link, where it interacts with DNA repair proteins including BRCA1, FANCD1/BRCA2 and the   16MRE11/RAD50/NBS1 (MRN) complex (Gurtan and D'Andrea 2006), leading to the postulation that the FA pathway, particularly the ID complex, coordinates multiple downstream repair pathways including HRR, TLS, and NER (reviewed by Mirchandani and D'Andrea 2006).  While the function of the FA core complex is becoming clearer, the components of the pathway and mechanism acting downstream of the ID complex are not well known. This group consists of three proteins: FANCD1/BRCA2, FANCJ/ BRIP1 and FANCN. Current evidence suggests that the BRCA2?FANCN complex participates in homologous recombination repair of DNA damage (Wang 2007), while the DNA-repair pathway that is mediated by the FANCJ-associated complex largely remains unknown.   1.2.2.4 Excision repair and Mismatch repair Two other repair pathways contribute to the maintenance of genome stability. The DNA mismatch repair (MMR) pathway repairs mismatches that escape proofreading during replication, acting as the main mechanism in repair of substitutions and insertion-deletions. Excision repair is a process capable of excising a variety of types of DNA damage, leaving gaps in the DNA duplex that are "repaired" by DNA synthesis. Excision repair is also involved in ICL downstream repair and RF blockage restore.   1.3 C. elegans as a model for genome instability studies Much of our knowledge about genome instability comes from studies on model organisms from prokaryotic bacteria to eukaryotes like yeast, worms and mice. Prevention of genome instability is very complex, and studies in easily manipulated model organisms can   17provide valuable information relevant to human genomic instability.  C. elegans is one of the well-established model organisms. It is maintained on agar culture plates and fed bacteria. The nematode takes only three days to develop from egg to fertile adult. It is a self-fertilizing hermaphrodite which produces approximately 300 progeny from a single individual. There are two sexes in C. elegans, males and hermaphrodites, making genetic manipulation possible. C. elegans is a metazoan with a number of tissue types, including nervous system, muscle, intestine and gonad. There is a large community of C. elegans researchers taking various approaches to understand the biology of this organism and there are numerous resources available to aid in research. Many experimental methods for working with C. elegans have already been established. There are many mutants available from the Caenorhabditis Genetics Centre, and a powerful approach for studying loss of gene function technology using RNA interference (RNAi) has been developed (Fire 1999). In addition, the targeted deletion of specific genes has been undertaken by the C. elegans Reverse Genetics Consortium (a collaboration of the Barstead laboratory in the USA and the Moerman laboratory in Canada) (http://www.celeganskoconsortium.omrf.org). The genetic interactions in the nematode can be easily assayed by making double mutants or combining mutant alleles and RNAi. In addition there are numerous rearrangements, duplications and deletion strains generated by the Genetic Toolkit Project.  Access to these and other resources such as the cosmid/fosmid transgenic rescue project database and single nucleotide polymorphisms (SNP) database can be obtained from Wormbase (Wormbase).      181.3.1 C. elegans is a good model for studying DNA repair components The genome of C. elegans has been completely sequenced and sequence information of several related species such as C. briggsae for comparative genomics are available (CelegansSequencingConsortium 1998; Stein et al. 2003). From analysis of the genome it is clear that C. elegans has a large number of DNA repair genes that function in highly conserved pathways, that is, the protein sequences are conserved with both yeast and higher organisms, including human (O'Neil and Rose 2006). Many DNA repair pathways including mismatch repair, excision repair, DNA damage tolerance (DDT), DSB repair, interstrand cross-link (ICL) repair and checkpoints exist in C. elegans. These features make C. elegans a very good model to study DNA repair.  Characterizing mutational events is an important aspect of studying the loss of function mutator phenotypes of DNA repair components. Many mutational events result in recessive lethal mutations. Genetic strains carrying non-conditional recessive lethal mutations cannot be maintained as homozygotes, and heterozygous mutations can be lost easily through segregation unless there is a means to identify the heterozygotes that carry them. In many cases, common visible markers linked to the mutations were used to ease all phases of analysis. A drawback of this method is that it is not easily adapted for the isolation of large numbers of mutational events over large genetic regions, thus it is not suitable when full range mutational spectrum of a mutagen is analyzed. In C. elegans, a more sophisticated approach that makes use of heterozygous chromosomal rearrangements has been widely adapted for use as genetic balancers. There are two types of balancing rearrangements: (1) those that reduce or eliminate recombination between a mutant-bearing chromosome and a homologue carrying a wild-type allele of the locus, and (2) those that provide an extra-  19chromosomal or integrated wild-type allele that complements a homozygous lethal mutation (reviewed by Edgley et al. 2006).  One of the balancing rearrangements that has been widely used is the reciprocal translocation eT1(III, V), which is viable and exhibits an Unc-36 phenotype as a homozygote (Rosenbluth and Baillie 1981). In eT1, the left portion of LGV is translocated to the left portion of LGIII, and the right portion of LGIII is translocated to the right portion of V (Figure 1.3). Meiotic recombination is suppressed along the length of the translocated portion of each chromosome, from unc-36 to the right end of LGIII, and from the breakpoint on eT1(V) to the left end of LGV. Recombination is not suppressed in the regions that segregate from their normal homologues. When used as a balancer, the non-translocation chromosomes are marked with visible mutations in the recombination-suppressed region. In this way, heterozygotes (which have a wild-type phenotype) can be distinguished from non-eT1 homozygotes (which have the visible phenotypes). Self progeny of eT1 heterozygotes are wild-type heterozygotes; eT1 homozygotes (which have an Unc-36 phenotype); visible mutations marked homozygotes; and a large percentage of aneuploid progeny (10/16) that arrest development as embryos or early larvae (Figure 1.3) (Adames et al. 1998). If a strain carries a recessive lethal mutation in the recombination-suppressed region of either normal homologue, the animals homozygous for the non-eT1 chromosome will be inviable, resulting in the absence of animals with visible phenotypes. In this way, the lethal mutation could be maintained in the heterozygotes and easily identified in the screen. The balancer system is not only useful for lethal mutations; non-lethal mutations in the balanced regions will also be maintained in the heterozygous eT1 and can be analyzed in detail.    201.3.2 C. elegans is a good model for studying mutational effects by space radiation As mentioned previously in this chapter, radiation poses a very practical threat to the genome stability of human beings. C. elegans is a good animal model to analyze the mutational effects by radiation. C. elegans has been used extensively to study the phenotypic consequences of exposure to radiation such as UV light, X-rays and ? -rays (Sigurdson et al. 1984; Rosenbluth et al. 1985; Stewart et al. 1991). Rosenbluth and colleagues originally established the eT1 balancer system and used it to genetically analyze the mutational effects in C. elegans by X-irradiation and ? -irradiation (Rosenbluth et al. 1983; Rosenbluth et al. 1985). Using this system, along with other detection methods such as chromosome non-disjunction and unc-22 mutagenesis, Nelson and colleagues carried out further investigations on the mutational effects of C. elegans under different types of radiation such as high and low linear energy transfer (LET) ionizing radiation (Nelson et al. 1989; Nelson et al. 1992). A major safety concern of human activities in outer-space is the exposure to harmful radiation in the environment. Features of C. elegans, such as small size, simplicity of maintenance, and variety of research resources,  have made it a model system for space biology studies (reviewed by Johnson and Nelson 1991; Zhao et al. 2005). Self fertilization is especially useful for maintaining animals over multiple generations as needed to study the effects of sustained space missions. C. elegans has been previously sent into space and it has been shown that it can reproduce and develop normally during the spaceflight (Nelson et al. 1994a). Analysis on dormant worms exposed to natural space radiation during the same flight revealed an elevated mutation rate compared to ground controls (Nelson et al. 1994b). More recent studies by Hartman and colleagues compared mutations in a single C. elegans gene induced by accelerated iron particles and low earth orbit space radiation, indicating that high   21LET charged particles are an important mutagenic component of space radiation (Hartman et al. 2001). While previous studies have focused on the immediate effects of natural space radiation (single generation), it is important to understand the effects of long term exposure to space radiation inside of the space vessels. Ultimately it would be desirable to use an easily maintained living system as a dosimeter that can be used to measure the biological effects of exposure over long periods of time. Taking advantage of the axenic C. elegans Maintenance Medium (CeMM), which can be used to maintain growth of worms for several months without intervention (Szewczyk et al. 2003), the mutational effects on C. elegans by long term exposure to space radiation can be analyzed and the potential of C. elegans as an integrating biological dosimeter for space radiation can be examined.  1.4 DOG-1 is a DNA repair component In C. elegans, the DOG-1 protein has been shown to play a role in maintaining genome stability (Cheung et al. 2002). The dog-1 mutant strain has a unique mutator phenotype: unidirectional deletions initiated at (G/C)n homopolymeric nucleotide sites (poly-G/poly-C tracts or G/C tracts) were observed in the dog-1 mutant strain. Examination of a number of other G/C-tracts in the genome revealed that approximately half of the G/C-tracts greater than 18 nucleotides in length had deletions in the absence of DOG-1 (Cheung et al. 2002). The G/C-tract deletions observed in dog-1 mutants were typically a few hundred base pairs long, and initiated in the 3? end of the G tract, extending upstream for various distances. Given the capability of G/C tracts to form secondary structures (see below), it was proposed that the helicase like DOG-1 might be involved in unwinding DNA secondary structures that occur in G/C tracts during lagging strand replication (Figure 1.4)(Cheung et al. 2002).    22DOG-1 is the C. elegans ortholog of human FANCJ (also known as BRIP1 or BACH1) (Youds et al. 2007). FANCJ encodes a human DEAH class DNA helicase and the FANCJ protein binds to the breast cancer BRCA1 protein (Cantor et al. 2001; Cantor et al. 2004). In addition to the DNA binding and helicase activities observed in vitro, FANCJ has also been shown to be able to resolve certain three dimensional structures that arise during DNA replication in vitro (Howlett et al. 2002; Cantor et al. 2004; Gupta et al. 2005). Overall, although in vitro evidence suggests a biological function for FANCJ in maintaining genome stability, the exact in vivo biological role of FANCJ remains unclear. The functional similarity between DOG-1 and FANCJ makes C. elegans a genetically amenable model for the study of the function of FANCJ. As described previously, secondary structures formed by G-rich DNA could cause replication folk blockage, which can be repaired or bypassed by many different repair strategies, leading to various outcomes (Figure 1.1). A recent study by Youds et al. demonstrated involvement of the HR and TLS pathways in the prevention of small G/C tract deletions in the dog-1 mutant (Youds et al. 2006). However, it was still unclear how the dog-1 induced small deletions were created and repaired (Figure 1.5). More importantly, it was not clear if the dog-1 induced mutations are confined to small deletions and if the mutations are always associated with G/C tracts. The identification and characterization of the mutations induced by the absence of dog-1 in the previous studies has been based on PCR assay (Cheung et al. 2002; Youds et al. 2006). This type of analysis can only detect mutations that are confined by specific primers thus miss unexpected mutation events. To better understand the role of DOG-1 in maintaining genome stability, it was thus necessary to characterize the full range of mutational spectrum induced by the absence of DOG-1.    23 1.5 G/C tracts Given the role of DOG-1 in protecting G/C tracts from deletion, it is possible that these DNA elements may have a biological function. Potential involvement of these elements in different biological processes has been proposed previously based on their capacity to form specific G-rich secondary structures.    1.5.1 G-rich DNA forms secondary structures Guanine-rich DNA is especially prone to form structures in vitro (Sen and Gilbert 1988; Sen and Gilbert 1992). Guanine-rich DNA can form triplexes or tetraplexs. G-tetraplexs (G-quadruplexes or G4 DNA) are stable structures with the four DNA strands in parallel or anti-parallel orientation, resulting in different conformations (reviewed by Gilbert and Feigon 1999; Simonsson 2001). G4 DNA structures are stabilized by G-quartets, planar arrays of four hydrogen-bonded guanines (Gellert et al. 1962).  The secondary structures formed by G-rich DNA might create blockages and cause replication fork stalling or collapse, resulting in genome instability (Woodford et al. 1994; Arthanari and Bolton 2001). Responses to replication fork blockages involve many previously described repair pathways and could result in various products (Figure 1.1). Genome stability at sites of G4 DNA may be maintained by  human RecQ helicases BLM, WRN and yeast Sgs1p helicase, which prevent the formation of secondary structures by G-rich DNA (Sun et al. 1998; Fry and Loeb 1999; Sun et al. 1999; Huber et al. 2006). These RecQ class helicases can unwind G4 DNA in vitro and have been shown to function to maintain genome stability.   24If G4 DNA is potentially a problem for replication and a DNA instability hotspot, why has it been maintained? In the mammal genome, G-rich chromosomal domains include four classes of repetitive regions?telomeres, rDNA, immunoglobulin heavy chain switch regions, and G-rich minisatellites. DNA sequences from these four regions were found to readily form G4 DNA in vitro (Wong et al. 1987; Sen and Gilbert 1988; Arakawa et al. 1993; Hanakahi et al. 1999; Parkinson et al. 2002; Neidle and Parkinson 2003; Maizels 2006). The ability to form G4 DNA in vitro of certain G-rich sequences has led to considerable interest in the possibility that G4 DNA might form in vivo and have specific functions. Recently, in vivo G4 DNA was observed as a G-loop formation induced by intracellular transcription of G-rich DNAs (Duquette et al. 2004). These results suggest that G rich DNA sequence and the secondary structures it forms play certain biological functions in vivo. This hypothesis was further supported by the bioinformatic observation that specific gene functions are correlated with the potential of forming G4 DNA (Eddy and Maizels 2006).   1.5.2 G4 DNA and chromosomal pairing It has been proposed that the special G-pairing structures play a role in DNA pairing and recombination. Sen and Gilbert proposed that the G-rich telomeres and internal chromosomal motifs in homologue chromosomes participated in recognition during meiotic prophase, based on their observation of G-rich motifs in DNA forming parallel four-stranded G-quadruplex (Sen and Gilbert 1988). G-G paired structures in G-rich immunoglobulin switch region were also proposed to play a role in the immunoglobulin class switch recombination (Williams and Maizels 1991; Dempsey et al. 1999; Hanakahi et al. 1999). The G-rich non-template strand of the switch regions (both donor and acceptor) could form G4 DNA during   25transcription, facilitating recombination between these two regions (Dempsey et al. 1999). Recently, transcription coupled G4 DNA formation was observed in vivo with the G-rich DNA in the mammalian immunoglobulin switch region (Duquette et al. 2004), further supporting the hypothesis described above. Moreover, the mismatch repair protein MutS?  binds G4 DNA and promotes synapsis and recombination in the mammalian immunoglobulin switch regions (Larson et al. 2005).  Defects in G4 DNA processing may affect aspects of meiosis. Liu et al. characterized the yeast gene KEM1 (also named SEP1/DST2/XRN1/RAR5) that encodes a nuclease specific for G4 DNA (Liu et al. 1993; Liu and Gilbert 1994). Homozygous deletions of the KEM1 gene in yeast block meiosis at the pachytene stage, which is consistent with the hypothesis that G4 DNA may be involved in homologous chromosome pairing during meiosis. G4 DNA was also found to be unwound by the coding product of yeast sgs1 gene; mutation of Sgs1p results in defective chromosome segregation, and increased mitotic and illegitimate recombination (Watt et al. 1995; Sun et al. 1999). Another yeast meiotic synapsis protein Hop1 can promote the formation of G4 DNA and the synapsis of double-stranded DNA helices through the generation of G4 DNA (Muniyappa et al. 2000; Anuradha and Muniyappa 2004; Anuradha et al. 2005). All these research results suggest a possible role for this structure in meiotic synapsis and recombination.  1.5.3 G4 DNA and gene expression One possible functional role of G4 DNA is gene regulation of transcription. An excellent example of G4 DNA regulating gene expression comes from studies of the effect of a G-quadruplex in the promoter region of human c-myc oncogene. The c-myc oncogene is one of   26the most commonly malfunctioning genes in human cancers.  Several small molecules such as the cationic porphyrin TMPyP4 and telomestatin were found to be able to stabilize the G-quadruplex in c-myc, and therefore to inhibit the c-myc gene expression (Siddiqui-Jain et al. 2002; Lemarteleur et al. 2004; Seenisamy et al. 2004).  1.6 Thesis objectives The goals of the work documented in this thesis were as follows: 1)  characterize the mutational effects on C. elegans by space radiation and develop an integrated biological dosimeter for radiation damage; 2)  Investigate the mutational spectrum of the dog-1 mutator phenotype; 3)  Characterize the G/C tracts in the genomes of C. elegans and C. briggsae and explore the possible biological function of these genome instability hotspots.  27 Figure 1.1 Strategies involved in the replication fork blockage response. A. For many RFBs (on either strand or involving both strands), the main response is to maintain the integrity of the RF and its replisome components until the barrier is removed, and replication can resume (a); some impenetrable blockage will result in complete RF collapse and formation of DSB, and therefore need HR-dependent restart (b). B. Lesions on leading-strand caused blockage can be resolved in several ways. Collapse of the RF will result in DSB and HR repair and restart (b). Uncoupled leading-strand and lagging-strand synthesis can trigger the bypass of the lesion through template switching, which can be completed either by fork regression that anneals leading and lagging nascent strands, whilst re-annealing parental DNA strands (c) or by the invasion of 3? end of leading nascent strand into the paired lagging strands (d); if replication of the nonlesion-containing strand has proceeded past the site of the lesion, it provides a lesion-free template.  Once bypass has been achieved it is thought that the RF is reset. Fork regression leads to the formation of a Holliday junction and can be resolved into DSB for a RF restart via HR pathway (b). In some cases DNA lesion is simply skipped by the replisome, which leaves behind a lesion-containing single-strand gap in the DNA that will be repaired with the help of HR post-replication repair (e). Blockage can also be bypassed through the error-prone translesion synthesis (f). C. Lesions on lagging-strand often leave lesion-containing single-strand gaps between two Okazaki fragments and can be repaired by either TLS (g) and HR-dependent bypass (h, i). Figure adapted from (Osman and Whitby 2007; Li and Heyer 2008).   28DSBSS? 3? overhang? generation?Strand? invasion? and? D? loop? formationdHJSDSA BIR HR? (NCO) HR? (CO)  Figure 1.2 Homologous recombination repair pathways in DSB repair. All pathways initiate with the process and generation of single-stranded 3? DNA overhangs followed by the single-stranded 3? end invasion of the template duplex DNA and formation of the D-loop intermediate. In the SDSA pathway (left), the D-loop is dissolved after some DNA synthesis and the invading strand disengages from the template duplex and reanneals with the second end of the DSB using the newly synthesised 3? end, always forming non-crossover products. In BIR (middle), the invading strand is postulated to establish a replication fork to copy the entire distal arm of the template chromosome, and the second DSB end is never engaged and the genetic information of that fragment is lost. In the classic HR pathway (right), with the  engagement of the second end of the DSB, an intermediate structure termed as double Holliday junction (dHJ) will be generated, which could be either dissolved into non-crossover (NCO) products or resolved crossover (CO) products.   29self   Figure 1.3 Punnett square showing progeny genotypes and phenotypes that result from selfing eT1 heterozygote marked by visibles. The normal LGIII is shown as a black bar, and the normal LGV is shown as a red bar; vertical lines indicate the visible markers. All wild-type progeny are heterozygous for the translocation chromosomes and the normal chromosomes. Unc-36 progeny are eT1 homozygotes, and the homozygotes with visible markers will show the visible(s)? phenotype. Aneuploid progeny (arrested with no adult phenotype) account for 10/16ths of the total. Figure adapted from (Adames et al. 1998).   30  deletionG tract Figure 1.4 Proposed model for the occurrence of small deletions induced by the absence of DOG-1. Single-stranded G tracts as a template for lagging-strand DNA synthesis are postulated to form secondary structures, which are believed to be substrates of DOG-1. Failure to resolve the secondary structures results in deletions (normally 100-500bp long) by an unknown mechanism. Figure adapted from (Cheung et al. 2002).    31  Figure 1.5 Model proposed by Youds et al for repair pathways functioning downstream of replication blockages in dog-1 mutants. G-rich DNA can form secondary structures when the DNA is single stranded during DNA synthesis. Normally, these structures are unwound by DOG-1. In the absence of DOG-1, repair of the stalled replication fork is required. Homologous recombination repair and trans-lesion synthesis have been shown to prevent the small G/C tract deletions (Youds et al. 2006). Unknown mutagenic repair process was believed to generate G/C tract deletions during the blockage repair. Figure adapted from (Youds et al. 2006).      32CHAPTER 1 References Adames, K.A., Gawne, J., Wicky, C., Muller, F., and Rose, A.M. 1998. Mapping a telomere using the translocation eT1(III;V) in Caenorhabditis elegans. Genetics 150(3): 1059-1066. Admire, A., Shanks, L., Danzl, N., Wang, M., Weier, U., Stevens, W., Hunt, E., and Weinert, T. 2006. Cycles of chromosome instability are associated with a fragile site and are increased by defects in DNA replication and checkpoint controls in yeast. Genes Dev 20(2): 159-173. Aguilera, A. and Gomez-Gonzalez, B. 2008. Genome instability: a mechanistic view of its causes and consequences. Nat Rev Genet. Aguilera, A. and Klein, H.L. 1988. Genetic control of intrachromosomal recombination in Saccharomyces cerevisiae. I. Isolation and genetic characterization of hyper-recombination mutations. Genetics 119(4): 779-790. Andersen, P.L., Xu, F., and Xiao, W. 2008. Eukaryotic DNA damage tolerance and translesion synthesis through covalent modifications of PCNA. Cell Res 18(1): 162-173. Andressoo, J.O., Hoeijmakers, J.H., and Mitchell, J.R. 2006. Nucleotide excision repair disorders and the balance between cancer and aging. Cell Cycle 5(24): 2886-2888. Anuradha, S. and Muniyappa, K. 2004. Meiosis-specific yeast Hop1 protein promotes synapsis of double-stranded DNA helices via the formation of guanine quartets. Nucleic Acids Res 32(8): 2378-2385. Anuradha, S., Tripathi, P., Mahajan, K., and Muniyappa, K. 2005. Meiosis-specific yeast Hop1 protein promotes pairing of double-stranded DNA helices via G/C isochores. Biochem Biophys Res Commun 336(3): 934-941. Arakawa, H., Iwasato, T., Hayashida, H., Shimizu, A., Honjo, T., and Yamagishi, H. 1993. The complete murine immunoglobulin class switch region of the alpha heavy chain gene-hierarchic repetitive structure and recombination breakpoints. J Biol Chem 268(7): 4651-4655. Arthanari, H. and Bolton, P.H. 2001. Functional and dysfunctional roles of quadruplex DNA in cells. Chem Biol 8(3): 221-230. Baran, N., Lapidot, A., and Manor, H. 1991. Formation of DNA triplexes accounts for arrests of DNA synthesis at d(TC)n and d(GA)n tracts. Proc Natl Acad Sci U S A 88(2): 507-511. Blastyak, A., Pinter, L., Unk, I., Prakash, L., Prakash, S., and Haracska, L. 2007. Yeast Rad5 protein required for postreplication repair has a DNA helicase activity specific for replication fork regression. Mol Cell 28(1): 167-175. Broomfield, S., Hryciw, T., and Xiao, W. 2001. DNA postreplication repair and mutagenesis in Saccharomyces cerevisiae. Mutat Res 486(3): 167-184. Burma, S., Chen, B.P., and Chen, D.J. 2006. Role of non-homologous end joining (NHEJ) in maintaining genomic integrity. DNA Repair (Amst) 5(9-10): 1042-1048. Cantor, S., Drapkin, R., Zhang, F., Lin, Y., Han, J., Pamidi, S., and Livingston, D.M. 2004. The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Proc Natl Acad Sci U S A 101(8): 2357-2362. Cantor, S.B., Bell, D.W., Ganesan, S., Kass, E.M., Drapkin, R., Grossman, S., Wahrer, D.C., Sgroi, D.C., Lane, W.S., Haber, D.A., and Livingston, D.M. 2001. BACH1, a novel   33helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell 105(1): 149-160. Casper, A.M., Nghiem, P., Arlt, M.F., and Glover, T.W. 2002. ATR regulates fragile site stability. Cell 111(6): 779-789. CelegansSequencingConsortium. 1998. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282(5396): 2012-2018. Chaudhuri, J., Basu, U., Zarrin, A., Yan, C., Franco, S., Perlot, T., Vuong, B., Wang, J., Phan, R.T., Datta, A., Manis, J., and Alt, F.W. 2007. Evolution of the immunoglobulin heavy chain class switch recombination mechanism. Adv Immunol 94: 157-214. Cheung, I., Schertzer, M., Rose, A., and Lansdorp, P.M. 2002. Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich DNA. Nat Genet 31(4): 405-409. Constantinou, A., Tarsounas, M., Karow, J.K., Brosh, R.M., Bohr, V.A., Hickson, I.D., and West, S.C. 2000. Werner's syndrome protein (WRN) migrates Holliday junctions and co-localizes with RPA upon replication arrest. EMBO Rep 1(1): 80-84. Davies, O.R. and Pellegrini, L. 2007. Interaction with the BRCA2 C terminus protects RAD51-DNA filaments from disassembly by BRC repeats. Nat Struct Mol Biol 14(6): 475-483. Dechering, K.J., Cuelenaere, K., Konings, R.N., and Leunissen, J.A. 1998. Distinct frequency-distributions of homopolymeric DNA tracts in different genomes. Nucleic Acids Res 26(17): 4056-4062. Deininger, P.L. and Batzer, M.A. 1999. Alu repeats and human disease. Mol Genet Metab 67(3): 183-193. Dempsey, L.A., Sun, H., Hanakahi, L.A., and Maizels, N. 1999. G4 DNA binding by LR1 and its subunits, nucleolin and hnRNP D, A role for G-G pairing in immunoglobulin switch recombination. J Biol Chem 274(2): 1066-1071. Denver, D.R., Morris, K., Kewalramani, A., Harris, K.E., Chow, A., Estes, S., Lynch, M., and Thomas, W.K. 2004. Abundance, distribution, and mutation rates of homopolymeric nucleotide runs in the genome of Caenorhabditis elegans. J Mol Evol 58(5): 584-595. Duquette, M.L., Handa, P., Vincent, J.A., Taylor, A.F., and Maizels, N. 2004. Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA. Genes Dev 18(13): 1618-1629. Durkin, S.G. and Glover, T.W. 2007. Chromosome fragile sites. Annu Rev Genet 41: 169-192. Eddy, J. and Maizels, N. 2006. Gene function correlates with potential for G4 DNA formation in the human genome. Nucleic Acids Res 34(14): 3887-3896. Edgley, M.L., Baillie, D.L., Riddle, D.L., and Rose, A.M. 2006. Genetic balancers WormBook, ed The C elegans Research Community WormBook, doi/10.1895/wormbook.1.89.1, http://www.wormbook.org. . Ellegren, H. 2000. Heterogeneous mutation processes in human microsatellite DNA sequences. Nat Genet 24(4): 400-402. Esashi, F., Christ, N., Gannon, J., Liu, Y., Hunt, T., Jasin, M., and West, S.C. 2005. CDK-dependent phosphorylation of BRCA2 as a regulatory mechanism for recombinational repair. Nature 434(7033): 598-604.   34Esashi, F., Galkin, V.E., Yu, X., Egelman, E.H., and West, S.C. 2007. Stabilization of RAD51 nucleoprotein filaments by the C-terminal region of BRCA2. Nat Struct Mol Biol 14(6): 468-474. Fire, A. 1999. RNA-triggered gene silencing. Trends Genet 15(9): 358-363. Flores, M.J., Bierne, H., Ehrlich, S.D., and Michel, B. 2001. Impairment of lagging strand synthesis triggers the formation of a RuvABC substrate at replication forks. Embo J 20(3): 619-629. Fry, M. and Loeb, L.A. 1999. Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. J Biol Chem 274(18): 12797-12802. Gangloff, S., McDonald, J.P., Bendixen, C., Arthur, L., and Rothstein, R. 1994. The yeast type I topoisomerase Top3 interacts with Sgs1, a DNA helicase homolog: a potential eukaryotic reverse gyrase. Mol Cell Biol 14(12): 8391-8398. Gellert, M., Lipsett, M.N., and Davies, D.R. 1962. Helix formation by guanylic acid. Proc Natl Acad Sci U S A 48: 2013-2018. Gilbert, D.E. and Feigon, J. 1999. Multistranded DNA structures. Curr Opin Struct Biol 9(3): 305-314. Glover, T.W., Berger, C., Coyle, J., and Echo, B. 1984. DNA polymerase alpha inhibition by aphidicolin induces gaps and breaks at common fragile sites in human chromosomes. Hum Genet 67(2): 136-142. Gragg, H., Harfe, B.D., and Jinks-Robertson, S. 2002. Base composition of mononucleotide runs affects DNA polymerase slippage and removal of frameshift intermediates by mismatch repair in Saccharomyces cerevisiae. Mol Cell Biol 22(24): 8756-8762. Grompone, G., Ehrlich, D., and Michel, B. 2004. Cells defective for replication restart undergo replication fork reversal. EMBO Rep 5(6): 607-612. Gupta, R., Sharma, S., Sommers, J.A., Jin, Z., Cantor, S.B., and Brosh, R.M., Jr. 2005. Analysis of the DNA substrate specificity of the human BACH1 helicase associated with breast cancer. J Biol Chem 280(27): 25450-25460. Gurtan, A.M. and D'Andrea, A.D. 2006. Dedicated to the core: understanding the Fanconi anemia complex. DNA Repair (Amst) 5(9-10): 1119-1125. Hanakahi, L.A., Sun, H., and Maizels, N. 1999. High affinity interactions of nucleolin with G-G-paired rDNA. J Biol Chem 274(22): 15908-15912. Hartman, P.S., Hlavacek, A., Wilde, H., Lewicki, D., Schubert, W., Kern, R.G., Kazarians, G.A., Benton, E.V., Benton, E.R., and Nelson, G.A. 2001. A comparison of mutations induced by accelerated iron particles versus those induced by low earth orbit space radiation in the FEM-3 gene of Caenorhabditis elegans. Mutat Res 474(1-2): 47-55. Hartwell, L.H. and Smith, D. 1985. Altered fidelity of mitotic chromosome transmission in cell cycle mutants of S. cerevisiae. Genetics 110(3): 381-395. Hassold, T. and Hunt, P. 2001. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet 2(4): 280-291. Hedges, D.J. and Deininger, P.L. 2007. Inviting instability: Transposable elements, double-strand breaks, and the maintenance of genome integrity. Mutat Res 616(1-2): 46-59. Hoeijmakers, J.H. 2001. Genome maintenance mechanisms for preventing cancer. Nature 411(6835): 366-374.   35Howlett, N.G., Taniguchi, T., Olson, S., Cox, B., Waisfisz, Q., De Die-Smulders, C., Persky, N., Grompe, M., Joenje, H., Pals, G., Ikeda, H., Fox, E.A., and D'Andrea, A.D. 2002. Biallelic inactivation of BRCA2 in Fanconi anemia. Science 297(5581): 606-609. Huber, M.D., Duquette, M.L., Shiels, J.C., and Maizels, N. 2006. A conserved G4 DNA binding domain in RecQ family helicases. J Mol Biol 358(4): 1071-1080. Johnsen, R.C. and Baillie, D.L. 1988. Formaldehyde mutagenesis of the eT1 balanced region in Caenorhabditis elegans: dose-response curve and the analysis of mutational events. Mutat Res 201(1): 137-147. Johnson, M.E., Viggiano, L., Bailey, J.A., Abdul-Rauf, M., Goodwin, G., Rocchi, M., and Eichler, E.E. 2001. Positive selection of a gene family during the emergence of humans and African apes. Nature 413(6855): 514-519. Johnson, R.E., Henderson, S.T., Petes, T.D., Prakash, S., Bankmann, M., and Prakash, L. 1992. Saccharomyces cerevisiae RAD5-encoded DNA repair protein contains DNA helicase and zinc-binding sequence motifs and affects the stability of simple repetitive sequences in the genome. Mol Cell Biol 12(9): 3807-3818. Johnson, T.E. and Nelson, G.A. 1991. Caenorhabditis elegans: a model system for space biology studies. Exp Gerontol 26(2-3): 299-309. Jones, J.S., Weber, S., and Prakash, L. 1988. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence. Nucleic Acids Res 16(14B): 7119-7131. Kang, S., Jaworski, A., Ohshima, K., and Wells, R.D. 1995a. Expansion and deletion of CTG repeats from human disease genes are determined by the direction of replication in E. coli. Nat Genet 10(2): 213-218. Kang, S., Ohshima, K., Shimizu, M., Amirhaeri, S., and Wells, R.D. 1995b. Pausing of DNA synthesis in vitro at specific loci in CTG and CGG triplet repeats from human hereditary disease genes. J Biol Chem 270(45): 27014-27021. Karow, J.K., Constantinou, A., Li, J.L., West, S.C., and Hickson, I.D. 2000. The Bloom's syndrome gene product promotes branch migration of holliday junctions. Proc Natl Acad Sci U S A 97(12): 6504-6508. Keeney, S. and Neale, M.J. 2006. Initiation of meiotic recombination by formation of DNA double-strand breaks: mechanism and regulation. Biochem Soc Trans 34(Pt 4): 523-525. Larson, E.D., Duquette, M.L., Cummings, W.J., Streiff, R.J., and Maizels, N. 2005. MutSalpha binds to and promotes synapsis of transcriptionally activated immunoglobulin switch regions. Curr Biol 15(5): 470-474. Lehmann, A.R. 2006. Translesion synthesis in mammalian cells. Exp Cell Res 312(14): 2673-2676. Lehmann, A.R., Niimi, A., Ogi, T., Brown, S., Sabbioneda, S., Wing, J.F., Kannouche, P.L., and Green, C.M. 2007. Translesion synthesis: Y-family polymerases and the polymerase switch. DNA Repair (Amst) 6(7): 891-899. Lehoczky, P., McHugh, P.J., and Chovanec, M. 2007. DNA interstrand cross-link repair in Saccharomyces cerevisiae. FEMS Microbiol Rev 31(2): 109-133. Lemarteleur, T., Gomez, D., Paterski, R., Mandine, E., Mailliet, P., and Riou, J.F. 2004. Stabilization of the c-myc gene promoter quadruplex by specific ligands' inhibitors of telomerase. Biochem Biophys Res Commun 323(3): 802-808.   36Levitus, M., Joenje, H., and de Winter, J.P. 2006. The Fanconi anemia pathway of genomic maintenance. Cell Oncol 28(1-2): 3-29. Li, X. and Heyer, W.D. 2008. Homologous recombination in DNA repair and DNA damage tolerance. Cell Res 18(1): 99-113. Liefshitz, B., Steinlauf, R., Friedl, A., Eckardt-Schupp, F., and Kupiec, M. 1998. Genetic interactions between mutants of the 'error-prone' repair group of Saccharomyces cerevisiae and their effect on recombination and mutagenesis. Mutat Res 407(2): 135-145. Lisby, M., Barlow, J.H., Burgess, R.C., and Rothstein, R. 2004. Choreography of the DNA damage response: spatiotemporal relationships among checkpoint and repair proteins. Cell 118(6): 699-713. Liu, Z., Frantz, J.D., Gilbert, W., and Tye, B.K. 1993. Identification and characterization of a nuclease activity specific for G4 tetrastranded DNA. Proc Natl Acad Sci U S A 90(8): 3157-3161. Liu, Z. and Gilbert, W. 1994. The yeast KEM1 gene encodes a nuclease specific for G4 tetraplex DNA: implication of in vivo functions for this novel DNA structure. Cell 77(7): 1083-1092. Maizels, N. 2006. Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nat Struct Mol Biol 13(12): 1055-1059. Malkova, A., Ivanov, E.L., and Haber, J.E. 1996. Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc Natl Acad Sci U S A 93(14): 7131-7136. Marinus, M.G. and Konrad, E.B. 1976. Hyper-recombination in dam mutants of Escherichia coli K-12. Mol Gen Genet 149(3): 273-277. Masson, J.Y., Tarsounas, M.C., Stasiak, A.Z., Stasiak, A., Shah, R., McIlwraith, M.J., Benson, F.E., and West, S.C. 2001. Identification and purification of two distinct complexes containing the five RAD51 paralogs. Genes Dev 15(24): 3296-3307. Matsuura, S., Tauchi, H., Nakamura, A., Kondo, N., Sakamoto, S., Endo, S., Smeets, D., Solder, B., Belohradsky, B.H., Der Kaloustian, V.M., Oshimura, M., Isomura, M., Nakamura, Y., and Komatsu, K. 1998. Positional cloning of the gene for Nijmegen breakage syndrome. Nat Genet 19(2): 179-181. McHugh, P.J., Spanswick, V.J., and Hartley, J.A. 2001. Repair of DNA interstrand crosslinks: molecular mechanisms and clinical relevance. Lancet Oncol 2(8): 483-490. Mirchandani, K.D. and D'Andrea, A.D. 2006. The Fanconi anemia/BRCA pathway: a coordinator of cross-link repair. Exp Cell Res 312(14): 2647-2653. Mirkin, S.M. 2006. DNA structures, repeat expansions and human hereditary disorders. Curr Opin Struct Biol 16(3): 351-358. Moore, H., Greenwell, P.W., Liu, C.P., Arnheim, N., and Petes, T.D. 1999. Triplet repeats form secondary structures that escape DNA repair in yeast. Proc Natl Acad Sci U S A 96(4): 1504-1509. Mosig, G. 1998. Recombination and recombination-dependent DNA replication in bacteriophage T4. Annu Rev Genet 32: 379-413. Muniyappa, K., Anuradha, S., and Byers, B. 2000. Yeast meiosis-specific protein Hop1 binds to G4 DNA and promotes its formation. Mol Cell Biol 20(4): 1361-1369.   37Myung, K., Datta, A., and Kolodner, R.D. 2001. Suppression of spontaneous chromosomal rearrangements by S phase checkpoint functions in Saccharomyces cerevisiae. Cell 104(3): 397-408. Myung, K., Pennaneach, V., Kats, E.S., and Kolodner, R.D. 2003. Saccharomyces cerevisiae chromatin-assembly factors that act during DNA replication function in the maintenance of genome stability. Proc Natl Acad Sci U S A 100(11): 6640-6645. Nassif, N., Penney, J., Pal, S., Engels, W.R., and Gloor, G.B. 1994. Efficient copying of nonhomologous sequences from ectopic sites via P-element-induced gap repair. Mol Cell Biol 14(3): 1613-1625. Neidle, S. and Parkinson, G.N. 2003. The structure of telomeric DNA. Curr Opin Struct Biol 13(3): 275-283. Nelson, G.A., Schubert, W.W., Kazarians, G.A., and Richards, G.F. 1994a. Development and chromosome mechanics in nematodes: results from IML-1. Adv Space Res 14(8): 209-214. Nelson, G.A., Schubert, W.W., Kazarians, G.A., Richards, G.F., Benton, E.V., Benton, E.R., and Henke, R. 1994b. Radiation effects in nematodes: results from IML-1 experiments. Adv Space Res 14(10): 87-91. Nelson, G.A., Schubert, W.W., and Marshall, T.M. 1992. Radiobiological studies with the nematode Caenorhabditis elegans. Genetic and developmental effects of high LET radiation. Int J Rad Appl Instrum D 20(1): 227-232. Nelson, G.A., Schubert, W.W., Marshall, T.M., Benton, E.R., and Benton, E.V. 1989. Radiation effects in Caenorhabditis elegans, mutagenesis by high and low LET ionizing radiation. Mutat Res 212(2): 181-192. Nelson, H.C., Finch, J.T., Luisi, B.F., and Klug, A. 1987. The structure of an oligo(dA).oligo(dT) tract and its biological implications. Nature 330(6145): 221-226. O'Neil, N.J. and Rose, A.M. 2006. DNA repair. WormBook, ed The C elegans Research Community WormBook, doi/10.1895/wormbook.1.54.1, http://www.wormbook.org. Osman, F. and Whitby, M.C. 2007. Exploring the roles of Mus81-Eme1/Mms4 at perturbed replication forks. DNA Repair (Amst) 6(7): 1004-1017. Parkinson, G.N., Lee, M.P., and Neidle, S. 2002. Crystal structure of parallel quadruplexes from human telomeric DNA. Nature 417(6891): 876-880. Pelletier, R., Krasilnikova, M.M., Samadashwily, G.M., Lahue, R., and Mirkin, S.M. 2003. Replication and expansion of trinucleotide repeats in yeast. Mol Cell Biol 23(4): 1349-1357. Prado, F., Cortes-Ledesma, F., and Aguilera, A. 2004. The absence of the yeast chromatin assembly factor Asf1 increases genomic instability and sister chromatid exchange. EMBO Rep 5(5): 497-502. Prakash, S., Sung, P., and Prakash, L. 1993. DNA repair genes and proteins of Saccharomyces cerevisiae. Annu Rev Genet 27: 33-70. Robu, M.E., Inman, R.B., and Cox, M.M. 2001. RecA protein promotes the regression of stalled replication forks in vitro. Proc Natl Acad Sci U S A 98(15): 8211-8218. Rosenbluth, R.E. and Baillie, D.L. 1981. The genetic analysis of a reciprocal translocation, eT1(III; V), in Caenorhabditis elegans. Genetics 99(3-4): 415-428.   38Rosenbluth, R.E., Cuddeford, C., and Baillie, D.L. 1983. Mutagenesis in Caenorhabditis elegans. I. A rapid eukaryotic mutagen test system using the reciprocal translocation, eT1(III,V). Mutat Res 110(1): 39-48. -. 1985. Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 r of gamma-radiation. Genetics 109(3): 493-511. Rupp, W.D. and Howard-Flanders, P. 1968. Discontinuities in the DNA synthesized in an excision-defective strain of Escherichia coli following ultraviolet irradiation. J Mol Biol 31(2): 291-304. Samadashwily, G.M., Raca, G., and Mirkin, S.M. 1997. Trinucleotide repeats affect DNA replication in vivo. Nat Genet 17(3): 298-304. Schild, D., Lio, Y.C., Collins, D.W., Tsomondo, T., and Chen, D.J. 2000. Evidence for simultaneous protein interactions between human Rad51 paralogs. J Biol Chem 275(22): 16443-16449. Schwartz, M., Zlotorynski, E., Goldberg, M., Ozeri, E., Rahat, A., le Sage, C., Chen, B.P., Chen, D.J., Agami, R., and Kerem, B. 2005. Homologous recombination and nonhomologous end-joining repair pathways regulate fragile site stability. Genes Dev 19(22): 2715-2726. Scott, S.P. and Pandita, T.K. 2006. The cellular control of DNA double-strand breaks. J Cell Biochem 99(6): 1463-1475. Seenisamy, J., Rezler, E.M., Powell, T.J., Tye, D., Gokhale, V., Joshi, C.S., Siddiqui-Jain, A., and Hurley, L.H. 2004. The dynamic character of the G-quadruplex element in the c-MYC promoter and modification by TMPyP4. J Am Chem Soc 126(28): 8702-8709. Sen, D. and Gilbert, W. 1988. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 334(6180): 364-366. -. 1992. Novel DNA superstructures formed by telomere-like oligomers. Biochemistry 31(1): 65-70. Shevelev, I.V. and Hubscher, U. 2002. The 3' 5' exonucleases. Nat Rev Mol Cell Biol 3(5): 364-376. Shrivastav, M., De Haro, L.P., and Nickoloff, J.A. 2008. Regulation of DNA double-strand break repair pathway choice. Cell Res 18(1): 134-147. Siddiqui-Jain, A., Grand, C.L., Bearss, D.J., and Hurley, L.H. 2002. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc Natl Acad Sci U S A 99(18): 11593-11598. Sigurdson, D.C., Spanier, G.J., and Herman, R.K. 1984. Caenorhabditis elegans deficiency mapping. Genetics 108(2): 331-345. Simonsson, T. 2001. G-quadruplex DNA structures--variations on a theme. Biol Chem 382(4): 621-628. Smith, G.P. 1976. Evolution of repeated DNA sequences by unequal crossover. Science 191(4227): 528-535. Smith, S., Hwang, J.Y., Banerjee, S., Majeed, A., Gupta, A., and Myung, K. 2004. Mutator genes for suppression of gross chromosomal rearrangements identified by a genome-wide screening in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 101(24): 9039-9044. Stein, L.D., Bao, Z., Blasiar, D., Blumenthal, T., Brent, M.R., Chen, N., Chinwalla, A., Clarke, L., Clee, C., Coghlan, A., Coulson, A., D'Eustachio, P., Fitch, D.H., Fulton, L.A., Fulton, R.E., Griffiths-Jones, S., Harris, T.W., Hillier, L.W., Kamath, R.,   39Kuwabara, P.E., Mardis, E.R., Marra, M.A., Miner, T.L., Minx, P., Mullikin, J.C., Plumb, R.W., Rogers, J., Schein, J.E., Sohrmann, M., Spieth, J., Stajich, J.E., Wei, C., Willey, D., Wilson, R.K., Durbin, R., and Waterston, R.H. 2003. The genome sequence of Caenorhabditis briggsae: a platform for comparative genomics. PLoS Biol 1(2): E45. Stewart, H.I., Rosenbluth, R.E., and Baillie, D.L. 1991. Most ultraviolet irradiation induced mutations in the nematode Caenorhabditis elegans are chromosomal rearrangements. Mutat Res 249(1): 37-54. Sugawara, N., Wang, X., and Haber, J.E. 2003. In vivo roles of Rad52, Rad54, and Rad55 proteins in Rad51-mediated recombination. Mol Cell 12(1): 209-219. Sugiyama, T., Kantake, N., Wu, Y., and Kowalczykowski, S.C. 2006. Rad52-mediated DNA annealing after Rad51-mediated DNA strand exchange promotes second ssDNA capture. Embo J 25(23): 5539-5548. Sun, H., Bennett, R.J., and Maizels, N. 1999. The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. Nucleic Acids Res 27(9): 1978-1984. Sun, H., Karow, J.K., Hickson, I.D., and Maizels, N. 1998. The Bloom's syndrome helicase unwinds G4 DNA. J Biol Chem 273(42): 27587-27592. Sutherland, G.R. 1977. Fragile sites on human chromosomes: demonstration of their dependence on the type of tissue culture medium. Science 197(4300): 265-266. Szewczyk, N.J., Kozak, E., and Conley, C.A. 2003. Chemically defined medium and Caenorhabditis elegans. BMC Biotechnol 3: 19. Tang, H. 2007. Genome assembly, rearrangement, and repeats. Chem Rev 107(8): 3391-3406. Taniguchi, T. and D'Andrea, A.D. 2006. Molecular pathogenesis of Fanconi anemia: recent progress. Blood 107(11): 4223-4233. Taylor, A.M., Groom, A., and Byrd, P.J. 2004. Ataxia-telangiectasia-like disorder (ATLD)-its clinical presentation and molecular basis. DNA Repair (Amst) 3(8-9): 1219-1225. Tishkoff, D.X., Filosi, N., Gaida, G.M., and Kolodner, R.D. 1997. A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88(2): 253-263. Toth, G., Gaspari, Z., and Jurka, J. 2000. Microsatellites in different eukaryotic genomes: survey and analysis. Genome Res 10(7): 967-981. Usdin, K. and Woodford, K.J. 1995. CGG repeats associated with DNA instability and chromosome fragility form structures that block DNA synthesis in vitro. Nucleic Acids Res 23(20): 4202-4209. Varga, T. and Aplan, P.D. 2005. Chromosomal aberrations induced by double strand DNA breaks. DNA Repair (Amst) 4(9): 1038-1046. Vinson, R.K. and Hales, B.F. 2002. DNA repair during organogenesis. Mutat Res 509(1-2): 79-91. Wang, W. 2007. Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins. Nat Rev Genet 8(10): 735-748. Watson, J.D., Baker, T.A., Bell, S.P., Gann, A., Levine, M., and Losick, R. 2008. Molecular Biology of The Gene. Cold Spring Harbor Laboratory Press Sixth Edition. Watt, P.M., Louis, E.J., Borts, R.H., and Hickson, I.D. 1995. Sgs1: a eukaryotic homolog of E. coli RecQ that interacts with topoisomerase II in vivo and is required for faithful chromosome segregation. Cell 81(2): 253-260.   40  41Wells, R.D. 1996. Molecular basis of genetic instability of triplet repeats. J Biol Chem 271(6): 2875-2878. West, S.C., Cassuto, E., and Howard-Flanders, P. 1981. Mechanism of E. coli RecA protein directed strand exchanges in post-replication repair of DNA. Nature 294(5842): 659-662. Whitby, M.C., Osman, F., and Dixon, J. 2003. Cleavage of model replication forks by fission yeast Mus81-Eme1 and budding yeast Mus81-Mms4. J Biol Chem 278(9): 6928-6935. Williams, M. and Maizels, N. 1991. LR1, a lipopolysaccharide-responsive factor with binding sites in the immunoglobulin switch regions and heavy-chain enhancer. Genes Dev 5(12A): 2353-2361. Wong, Z., Wilson, V., Patel, I., Povey, S., and Jeffreys, A.J. 1987. Characterization of a panel of highly variable minisatellites cloned from human DNA. Ann Hum Genet 51(Pt 4): 269-288. Woodford, K.J., Howell, R.M., and Usdin, K. 1994. A novel K(+)-dependent DNA synthesis arrest site in a commonly occurring sequence motif in eukaryotes. J Biol Chem 269(43): 27029-27035. Woodruff, R.C. and Thompson, J.N., Jr. 2003. The role of somatic and germline mutations in aging and a mutation interaction model of aging. J Anti Aging Med 6(1): 29-39. Wormbase. [http://www.wormbase.org/]. Yang, W. and Woodgate, R. 2007. What a difference a decade makes: insights into translesion DNA synthesis. Proc Natl Acad Sci U S A 104(40): 15591-15598. Yonetani, Y., Hochegger, H., Sonoda, E., Shinya, S., Yoshikawa, H., Takeda, S., and Yamazoe, M. 2005. Differential and collaborative actions of Rad51 paralog proteins in cellular response to DNA damage. Nucleic Acids Res 33(14): 4544-4552. Youds, J.L., Barber, L.J., Ward, J.D., Collis, S.J., O'Neil, N.J., Boulton, S.J., and Rose, A.M. 2007. DOG-1 is the Caenorhabditis elegans BRIP1/FANCJ homologue and functions in interstrand cross-link repair. Mol Cell Biol. Youds, J.L., O'Neil, N.J., and Rose, A.M. 2006. Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173(2): 697-708. Yunis, J.J. and Soreng, A.L. 1984. Constitutive fragile sites and cancer. Science 226(4679): 1199-1204. Zhang, Y. and Rowley, J.D. 2006. Chromatin structural elements and chromosomal translocations in leukemia. DNA Repair (Amst) 5(9-10): 1282-1297. Zhao, Y., Johnsen, R., Baillie, D., and Rose, A. 2005. Worms in space? A model biological dosimeter. Gravit Space Biol Bull 18(2): 11-16. Zieg, J., Maples, V.F., and Kushner, S.R. 1978. Recombinant levels of Escherichia coli K-12 mutants deficient in various replication, recombination, or repair genes. J Bacteriol 134(3): 958-966.   CHAPTER 21: Mutational analysis of C. elegans in space  2.1 Introduction C. elegans is an excellent model for the studies of DNA damage and repair (reviewed by O'Neil and Rose 2006). To better understand the nature of genome instability and mutation rates associated with radiation during spaceflight, an analysis on the mutational spectrum was necessary. Taking advantage of the opportunity of being part of the International Caenorhabditis elegans Experiment First Flight (ICE-First) project, we have analyzed the mutational effects of a brief spaceflight on the International Space Station. Several different kinds of mutational analysis systems for radiation damage have been tested to establish an effective mutational analysis system for spaceflight. An ideal mutational analysis system will be sensitive to relatively low dosages of damage, efficiently reflect the biological effects, and be amenable to detailed studies. The assays described in this chapter focused on examining the capability of these mutational analysis systems in capturing, maintaining, and recovering mutation events and investigation the potential of C. elegans as an integrating mutational biological dosimeter to examine mutational effects in the space environment.    1 A version of this chapter has been published. Zhao, Y., Lai, K., Cheung, I., Youds, J., Tarailo, M., Tarailo, S., and Rose, A. 2006. A mutational analysis of Caenorhabditis elegans in space. Mutat Res 601(1-2): 19-29   422.2 Materials and methods 2.2.1 Strains and culture conditions: Two strains were used in the spaceflight: CC1 (wild-type) obtained from C. Conley, NASA, Ames CA, USA (Szewczyk et al. 2003) and BC2200 (dpy-18(e364)/eT1(III); unc-46(e177)/eT1(V)) kindly provided by D. L. Baillie, Simon Fraser University, Burnaby BC, Canada (Rosenbluth et al. 1983). During the mission, both strains were cultured in the liquid C. elegans maintenance media (CeMM) media as described by Szewczyk et al. (Szewczyk et al. 2003). Strains carrying the following deficiencies and mutations were obtained from the D. L. Baillie laboratory at Simon Fraser University: sDf53, sDf38, sDf39, sDf32, sDf74, sDf33, sDf52, sDf45, sDf40, sDf34, sDf42, sDf28, sDf50, sDf27, sDf20, sDf35, sDf47, sDf29, sDf110, let-332(s234), let-339(s1444), let-343(s1025), let-346(s1619), let-404(s119), let-425(s385), let-438(s2114), let-442(s1416), let-468(s1533), let-335(s1439), let-405(s116), let-406(s514), let-411(s1595), let-423(s818), let-449(s1343), let-474(s1577), let-480(s1607), let-408(s827), let-413(s128), let-414(s114), let-424(s384), let-436(sl403), let-445(s1419), let-456(s1479), let-412(s1598), and let-464(s1504). CB4856, nDf32, nDf40, and eDf2 were from the Caenorhabditis Genetics Center at the University of Minnesota, Minneapolis, Minnesota. dog-1(gk10) was made available by the C. elegans Gene Knockout Consortium, Vancouver BC. All mutations denoted with the h prefix arose in the A. M. Rose laboratory.  In the laboratory, worms grown on NGM plates were cultured as described in (Brenner 1974).     432.2.2 Experimental protocol Both strains were divided into three samples (spaceflight, ground control and laboratory control) and loaded into 2.5ml culture bags ((Szewczyk et al. 2003) and personal communication). Spaceflight worms were cultured in an incubator for the space experiment and flown from April 19 to 30, 2004, with a total mission time of 11 days. The ground control was maintained at the Universit? Paul Sabatier in Toulouse, France in a temperature controlled Thermocase. Samples were maintained at 20?C for the duration of the experiment, except the spaceflight samples were cultured at 12?C for 5 days at Baikonur before the launch. Animals were maintained in the liquid CeMM media until return to the University of British Columbia in Vancouver. During post-flight analysis, the worms were transferred to NGM plates.  2.2.3 Mutational effects on the CC1 strain 2.2.3.1 Integrity of poly-G/poly-C tracts in the genome  PCR was used to measure deletions of G/C tracts in the genome. DNA of individual fourth larval stage (L4) or young adult worms was prepared by lysis with Proteinase K. The integrity of G/C-tracts was examined by the length of the amplified DNA using primers flanking the G/C-tracts. Conditions for the PCR were as described by Cheung et al.(Cheung et al. 2002). PCR products were run on 1% agarose gels, stained with SYBR Green, and photographed by the BioRad GelDoc 2000 imager. In total, 37 G/C tract sites in the spaceflight samples and 24 G/C tract sites in the ground control samples were examined.   44Primers used in the assay were listed in Table 2.1. Most of these G/C tract sites are on the left arm of LGV (Figure 2.1).  2.2.3.2 Occurrence of mutations in unc-22 Mutations in the unc-22 gene, either homozygous or heterozygous, have a twitcher phenotype in a 1% solution of nicotine, while wild-type worms in this solution become rigid (Moerman and Baillie 1979). 1000 worms from the spaceflight and 500 from the ground control were individually placed on NGM plates. Three days later the F1 progeny were treated with 1% nicotine solution and after 2-5 minutes screened for the presence of twitching worms.   2.2.4 Mutational effects on the eT1 system (BC2200) 2.2.4.1 Screening for mutations Lethal screening methods as described by Rosenbluth et al. (Rosenbluth et al. 1983) were used: single L4 phenotypically wild-type looking dpy-18/eT1; unc-46/eT1 worms from the spaceflight, ground control and laboratory control samples were placed on individual NGM plates. The progeny of these worms were screened for the absence of normal-appearing gravid Dpy-Unc worms. The absence of mature Dpy-Uncs indicated the presence of a lethal mutation linked to either dpy-18 or unc-46 within the eT1 balanced region. To identify mutations resulting in sterility or maternal-effect lethality, Dpy-Unc animals obtained from previous screening were plated and the F2 generation was examined. From   45each plate containing a putative mutation, an eT1 heterozygote was picked to establish a strain.  2.2.4.2 Mapping and complementation Mapping: The lethal-bearing strains were crossed to N2 males and L4 F1 hermaphrodites from each strain were individually plated for progeny tests. All the F2 progeny for non-Unc-36 bearing F1 animals (n>2) were scored (Note: eT1 homozygotes have an Unc-36 phenotype). The lethal mutation was assigned to LGIII (right) if the number of fertile F2 Dpy-18 progeny was significantly less than one third of the number of wild-types or to LGV (Left) if the Unc-46 to wild-type ratio was significantly less than one third.  Complementation: Each lethal strain isolated was tested for complementation with other lethal strains isolated on the same chromosome arm as appropriate (see below). Recovery of fertile F1 Dpy-Uncs indicated complementation between the two parental strains. Strains that failed to complement each other were classified into the same complementation group. Mapping to regions on LGIII and LGV: LGV (left) has been divided into zones by a set of chromosomal rearrangement breakpoints, mostly deficiencies (Rosenbluth et al. 1988). These deficiencies uncover the entire eT1 balanced region except for the zone between sDf30 and sDf35 (Figure 2.2). All of the deficiencies were balanced over eT1 and were in strains that also contain dpy-18, and all of the strains except sDf35 carry unc-46. Males containing lethal mutations generated during the spaceflight on LGV (Left) [dpy-18/eTl(III);     46let unc-46/eTl(V)] were crossed to the set of deficiencies. Absence of fertile Dpy-Unc (Dpy-18 for sDf-35) progeny indicated failure to complement. Once a lethal had been mapped to a zone, it was complementation tested against representative alleles of all known lethals in that zone (Johnsen and Baillie 1991). Similarly, three eT1 balanced deficiency strains (sDf110, nDf40, eDf2) that cover most of the eT1 balanced LGIII (right) area were used to complementation test the lethals on chromosome III. These deficiency strains all carry dpy-18 (eDf2 deletes dpy-18) and the absence of fertile Dpy-18 progeny, or Dpy-18 Unc-46 progeny in the case of sDf110, indicated failure to complement.  Single Nucleotide Polymorphism (SNP) mapping: The Hawaiian strain CB4856 is an isolate showing a uniformly high density of polymorphisms compared with the reference Bristol N2 strain (Wicks et al. 2001). In order to generate heterozygous F1 worms for SNP mapping, CB4856 males were mated to the lethal strains. F1 progeny were then transferred to individual plates and allowed to self fertilize. For those lethals mapped to chromosome V, Unc-46 F2 worms were selected from crosses; for those lethals mapping to chromosome III Dpy-18 F2 worms were selected from crosses. A crossover between unc-46 or dpy-18 and the mutation generated viable F2 Unc or Dpy worms. These Unc and Dpy worms were then individually plated. Their progeny were lysed and tested using the snip-SNP mapping approach described by (Wicks et al. 2001). The primers and conditions of PCR and restriction enzyme digestion were as described by Wicks et al. (Wicks et al. 2001).     472.2.4.3 Developmental blocking stage Developmental blocking stages were observed at 20?C. Worms with recessive lethal mutations were mated to either dpy-18/+ or unc-46/+ males depending on where the mutation was located. Dpy or Unc L4 F1 worms (n>2) were grown on plates for 12 hours and the number of eggs (F2) were counted. The next day the F2 animals were scored for the presence of unhatched eggs (putative embryonic lethal mutations). On the fourth day the plates were observed and scored for the absence of adult Dpys or Uncs (putative larval lethal mutations); and on the seventh day these worms were progeny-tested for the adult sterility.  2.2.4.4 Chromosomal rearrangements: unc-36(+) duplications Genetic test: Several strains isolated from the screening process never segregated Dpy-18 or Unc-46 in either the mapping or complementation experiments, and the wild-type hermaphrodites of these strains segregated only wild-type and Unc-36 worms. Genetic analytical methods described by Rosenbluth et al. (Rosenbluth et al. 1985) were used to test if these were duplications carrying a wild-type copy of unc-36. These strains were crossed to m eTI/++ or m unc-36/++ males (?m? represents a visible mutant allele that is tightly linked to unc-36 or eT1 breakpoint). If a significantly high ratio of Unc-36 worms were segregated in the M-Unc-36 double F2 bearing progeny from the self-fertilizing wild-type F1 hermaphrodites, it indicates the presence of an unc-36(+) duplication in the strain (genotype:   48unc-36(+); eT1/eT1). The absence of M single F2 individuals among the progeny of self-fertilizing wild-type F1 hermaphrodites indicates that the duplication carries m(+). DAPI staining: Whole worms stained with DAPI and chromosomes in diakinesis were examined for extra-chromosomal segments of an unc-36(+) duplication. One day old synchronized adults were washed with M9 buffer and stained with 150nM DAPI in ethanol for 90 minutes at room temperature. DAPI was removed by washing with M9 buffer. Animals were destained overnight in M9 buffer at 4 ?C. Destained animals were mounted on agarose pads and viewed with the Zeiss Axioscope fluorescent microscope with 40X objective.  2.2.5 Refining the eT1 balancer system 2.2.5.1 Identification of the eT1 breakpoint Inverse PCR was used to identify the physical breakpoints of eT1 (Figure 2.3). DNA of individual L4 eT1 homozygous worms was prepared by QIAGEN Tissue Kit. The eT1 breakpoint within the unc-36 gene on LGIII was first mapped by PCR, and then identified by inverse PCR. Inverse PCR was carried out as described in Ochman et al. (Ochman et al. 1988). 1ug DNA was digested for 3 hours by HaeIII. Digested DNA was then allowed to self-ligate by T4 ligase for 12 hours to form circular DNA molecules. A second enzymatic digestion by BsmI was then conducted, creating linear DNA molecules to favor the following PCR reaction. PCR primers (5?-gtgctcgccacttatgtctc-3? and 5?- cgattatttggtccagatttcta-3?) were designed based on the position of BsmI so that they were   49complementary to the sequence of each end of the linear DNA after the second digestion. The PCR product was then submitted to the Nucleic Acid and Protein Services (NAPS) at UBC for sequencing and the results were compared using WormBase (Wormbase).   2.2.5.2 Single Nucleotide Polymorphism (SNP) deficiency mapping  The Hawaiian strain CB4856 was mated to the lethal strains in order to generate heterozygous F1 worms. F1 progeny were then transferred to individual plates and allowed to self fertilize. Plates with the absence of Unc-36 were selected (non-eT1 chromosomes heterozygous for Hawaiian chromosomes) and the parental hermaphrodites (Hawaiian/Bristol heterozygote) were lysed and tested using snip-SNP PCR (Wicks et al. 2001). The absence of an amplified N2 band at a certain SNP site indicated deletion of this site in the deficiency strain. The extent of the deletion in the lethal mutations was determined by testing a series of SNPs on LGV (Left). The primers and conditions of PCR and restriction enzyme digestion were as described by Wicks et al. (Wicks et al. 2001)  502.3 Results 2.3.1 Mutational effects on wild-type strain CC1 2.3.1.1 G/C tracts are stable when DOG-1 is present G/C tracts are prone to forming secondary structures and have been shown to be sites of genome instability in dog-1 mutant worms: in the absence of DOG-1, small deletions associated with G/C tracts were observed (Cheung et al. 2002). To investigate the effect of spaceflight on this type of genome instability, the integrity of G/C tracts was examined using PCR. 37 sites of G/C tracts were tested in the spaceflight samples and no deletions were observed (Table 2.1). Although deletions have been observed in many of these sites in dog-1 mutant animals, there was no deletion found in N2 worms (Table 2.1). Ground control worms have also been tested on part of these sites (24 out of 37) and revealed no deletion as well. Thus, G/C tracts seem to be stable when DOG-1 is present.  2.3.1.2 Mutations in unc-22 The length of unc-22, approximately 20kb of coding sequence, makes it a large target for mutagenesis. The different behaviours of the wild-type and unc-22 mutant animals in a 1% solution of nicotine provide an easy method to screen a large number of animals for mutations in this gene (Moerman and Baillie 1979). 1000 worms from the spaceflight and 500 from the ground control were individually plated and allowed to self-fertilize. Their progeny (3X105 F1 animals from the spaceflight and 1.5X105 F1 animals from the control, respectively) were treated with a 1% nicotine solution to observe twitching and thus   51estimate the mutation frequency. No twitching worms were observed, indicating that neither homozygous nor heterozygous unc-22 mutations were present.  2.3.2 Capturing mutational events with the eT1(III;V) balancer system The eT1 balancer system was previously used to measure the frequency of mutation for commonly used mutagenesis methods in C. elegans (Rosenbluth et al. 1983; Rosenbluth et al. 1985; Nelson et al. 1989). Meiotic crossing-over in the balanced regions is suppressed in heterozygous eT1, making it useful for the capture and maintenance of mutations in C. elegans. A typical eT1 balancer system (eT1 heterozygote with visible markers, for example, BC2200 (dpy-18(e364)/eT1(III); unc-46(e177)/eT1(V)) used in this study) can be used to recover mutations in the crossover-suppressed regions (~6Mbp on LGIII and ~9Mbp on LGV). To simplify the screening assay, only lethal mutations were screened for: recessive lethal mutations in either the LGIII or LGV balanced region can be detected by the absence of Dpy-Unc F2 animals. The spontaneous mutation frequency of worms on NGM has been previously shown to be approximately 0.06% (Rosenbluth et al. 1983).   2.3.2.1 Mutation frequency In total, 2314 worms from the spaceflight, 2061 from the ground control and 3000 from the laboratory control were set up individually for the lethal screening; 13, 11 and 3 lethal strains were isolated from these samples, respectively. Another 1000 laboratory control worms cultured on NGM plates were also set up and yielded 3 lethal isolates.   52Complementation tests between the isolates divided them into 17 complementation groups (Table 2.2). The mutation rates over the eT1 balanced region (around 40 m.u.) for these samples are indicated in Table 2.2. Based on the calculated Poisson variable confidence intervals (Crow and Gardner 1959), there were no statistically significant differences between the samples.   2.3.2.2 Mapping and characterization of lethal mutations After the lethal mutations were mapped to either LGIII or LGV, they were complementation tested using deficiencies uncovering different regions. Failure to complement indicated the lethal mutation was located in the region deleted by the deficiency; hence, the lethals could be to different zones on LGIII (right) or LGV (left) (Figure 2.2, Table 2.3). After a lethal was mapped to a zone, representative alleles of known essential genes in the zone were complementation tested with the lethal mutation. h2154 and h2157 were found to be alleles of let-344 and let-343, respectively. h2155 and h2158 are deletions, as they failed to complement more than one known lethal, and they were thus re-named hDf36 and hDf37.  Some lethals complemented all of the deficiencies used in this study. They were assigned to the regions between deficiencies with the aid of SNP mapping data and recombination data. h2159 was assigned in the region to the left of sDf110 as its genetic distance from dpy-18 is 8.10mu (95% CI 7.94~8.26) and SNP data located it to the left of the cosmid K11D9. Similarly, h2156 was assigned to the region between sDf20 and sDf35.   53h2164 contains a Dpy mutation and therefore was difficult to map precisely. Three lethals isolated from NGM control samples were mapped to a chromosome, but no further investigation was conducted. The developmental blockage stages of the lethal mutations were determined and are listed in Table 2.3. Four lethal strains could not be mapped to either LGIII or LGV as they segregated neither Dpy-18 nor Unc-46; they were proven to be duplications that contain a wild-type duplication of unc-36. A description of these duplications follows below.  2.3.2.3 Characterization of isolated chromosome rearrangements  h2162, h2163, h2166 and h2167 segregated neither Dpy-18 nor Unc-46 in either the mapping or complementation experiments. Progeny from wild-type hermaphrodites of these strains always included Unc-36 animals but not in the expected ratio for an eT1 heterozygote. As Rosenbluth et al. (Rosenbluth et al. 1985) described, the hermaphrodites were either (1) heterozygous eT1 with unmarked homologues that carried a recessive lethal mutation or (2) homozygous eT1 carrying a homozygous lethal unc-36(+) duplication derived from the normal LGIII chromosome. Wild-type hermaphrodites from each strain were crossed to unc-36(e251) sma-2(e502)/++ males; the progeny of wild-type Fl worms that carried the closely linked unc-36 sma-2 mutations were scored and the frequencies of Unc-36 were examined. From an unc-36 sma-2 +/+ + let F1 the frequency was expected to be 0.007, whereas from an unc-36 sma-21/eT1(III); +/eT1(V); Dp[unc-36(+)] F1 it would be   54approximately 0.28 (not precisely predictable if it is a free duplication). The actual observed Unc-36 frequencies among the F2s from h2162, h2163, h2166 and h2167 were 0.32, 0.06, 0.44 and 0.03, respectively, suggesting that these strains carried an unc-36(+) duplication (all P<0.005). These strains were therefore respectively renamed hDp137, hDp138, hDp139 and hDp140. DAPI staining of diakinesis chromosomes in the germline of the wild-type hermaphrodites of these strains showed more than the wild-type 6 bivalent chromosomes, which indicated extra DNA fragments or chromosomes (Figure 2.4a). These cytogenetic results confirmed the hypothesis that these strains have duplications and that the duplications are free duplications. Several other visible mutations on LGIII linked to unc-36(e251) were also used to map the breakpoints of these duplications. hDp137 was found to uncover the region from dpy-17 to unc-32 since the crossing progeny including linked M-Unc-36 double mutant (where m was the gene tested in the region from dpy-17 to unc-32) always excluded M single mutant (Figure 2.4b). No wild-type hermaphrodites were recovered from hDp140 strain after several generations, possibly because the strain lost the duplication.  2.3.3 Refining the eT1 system 2.3.3.1 Physical breakpoints of eT1 To identify the eT1 chromosomes in the genome using detection techniques like PCR, it was necessary to know the physical breakpoints of the translocations. Based on the knowledge that eT1 interrupts unc-36, a 7kb long gene on LGIII, PCR was used to narrow   55the breakpoint on LGIII down to a 450bp region. Restriction enzymes and PCR primers for inverse PCR were chosen and designed based on the known sequence in the 450bp region. Using inverse PCR, the unknown sequence flanking the breakpoint was able to be amplified by the primers complementary to known DNA sequences (Figure 2.3). Examination of the inverse PCR sequences revealed that the eT1 breakpoint on LGIII is in the second intron of unc-36. The left arm of LGIII was translocated to the region of LGV contained in cosmid H14N18, placing the eT1 breakpoint on LGV in the region between rol-3 and unc-42 (Figure 2.5a). This result agreed with the genetic prediction by Rosenbluth and Baillie (Rosenbluth and Baillie 1981). The breakpoint on eT1(V) (LGIII left and LGV left) results in no loss or duplication of DNA sequence, while the breakpoint on eT1(III) contains a 35 bp duplication. 20-bp sequences of either side of the eT1 breakpoints are as follows: eT1(V): aataatttttgaaacaaaaa?GTTTATCATCTCAAGACGTG; eT1(III): GAGCCAATCACTTACTGGTTAGTAATGATTCCAAATATGAGCCAATCACTTACTGGTTAGTAATGATTCCAAA-cttgattccaaatatgacat (lower case: LGIII; upper case: LGV; italics: 35-bp duplication). Taking advantage of the molecularly defined breakpoints of eT1, PCR primers spanning the breakpoints were designed to facilitate the detection of the eT1 chromosomes (Figure 2.5b) (for sequences see methods). The following primers were used to confirm the presence of the eT1 chromosome: (1) 5?-gtgctcgccacttatgtctc-3?; (2) 5?-ggcaaaaactgagtaacctatatt-3?; and (3) 5?-gtaatcgtttggatgggtgc-3? ((1) and (2) were used to detect wild-type LGIII; (1) and (3) were used to detect eT1(V)).     562.3.3.2 Physical extents of the eT1 balanced deficiencies LGV (left) has been divided into zones by a set of chromosomal rearrangement breakpoints, mostly deficiencies (Rosenbluth et al. 1988). Many of these deficiencies were balanced by eT1 and were often used to map new mutations captured by the eT1 system. However, it is hard to map a mutation precisely using these deficiencies because their physical breakpoints were unknown. To facilitate the mutation characterization after a mutational screen with eT1 system, several eT1 balanced deficiencies were studied for the extent of deletion. Strains carrying sDf74, sDf39, sDf32, sDf50, sDf27, sDf34, sDf53, sDf38, and sDf33 were chosen for Single Nucleotide Polymorphism (SNP) deficiency mapping. The physical extents of these deficiencies were thus defined by the SNP sites and the results were listed in Table 2.4.     572.4 Discussion 2.4.1 A biological dosimeter for space radiation  Tools for measuring the biological consequences of prolonged exposure to cosmic radiation are important for manned spaceflight. While a physical or chemical detector can measure the dosage of radiation, it cannot determine the biological effects of any specific dosage, for example, 1mRd a day for 100 days vs. 100mRd in a single day. Furthermore, existing detectors are not able to record any unrecognizable hazardous events. For this, biological or animal assays are needed. A biological dosimeter will help us to measure and characterize these effects, not only for spaceflight, but also for other hazardous environments on earth. To be able to work in space vessels, the biological dosimeter has to be small, easy to maintain, and self-sufficient enough to endure a long-term mission. Meanwhile, the dosimeter system has to be sensitive to relatively low dosages of radiation, efficiently reflect the biological effects of radiation, and be amenable to detailed studies after the space mission. C. elegans satisfies all of these criteria. The DNA damage response, including most of the known DNA repair pathways, are highly conserved between C. elegans and humans (reviewed by O'Neil and Rose 2006). Therefore, information gained from C. elegans is functionally relevant to human beings. Using C. elegans as a dosimeter is thus very useful to understand the biological effects of space environment on humans.        582.4.2 eT1 balancer system as an integrating biological dosimeter for studying mutational effects Several approaches were taken to examine the mutational effects of the spaceflight in this study. First, no G/C tract deletions, such as those observed in the dog-1 mutant, were detected in this study. This could be due to the fact that G/C tracts do not delete frequently when DOG-1 is present and that the space environment itself has little effect on the stability of G/C tracts. Worms were reported to survive well in the defined liquid CeMM used in the study, but there are various morphological changes and delayed development process observed in worms in this media (Szewczyk et al. 2006). Four unc-36(+) duplications were isolated from the ground and laboratory controls, which were cultured in CeMM during the experiment. No similar chromosome rearrangements were isolated from the NGM laboratory control. Although the numbers are small and not statistically significant, there might be some effect of the liquid media on worms as it is very uncommon to recover chromosome rearrangements from worms on NGM. Nutritional limitation in this liquid media may induce certain biological stress responses. No G/C tract deletions were observed in worms cultured in the liquid media, from spaceflight or ground control samples, indicating that the G/C tracts seem to be stable when DOG-1 is present. Therefore, G/C tract deletion testing on wild-type worms is not an informative assay for spontaneous or low frequency mutational events. Using strains carrying dog-1 mutant in the study might be able to yield informative results (Cheung et al. 2002), but the reduced viability of dog-1 mutant animals would hamper their use as a dosimeter. In any event, however, CeMM?s potential   59mutagenicity did not differentially affect the results since the same media was used in both spaceflight and control experiments and the background was measured. The forward mutation frequency for unc-22 was examined but did not recover any unc-22 mutants from this assay, from either the spaceflight or control samples. The spontaneous forward mutation frequency at the unc-22 locus is about 7Xl0-7 (Moerman and Waterston 1984; Nelson et al. 1994). It is thus not surprising that no unc-22 mutants were seen in this study, especially considering that, based on the lethal mutation rates observed in the eT1 experiment, the mutation frequency in spaceflight was not significantly different from the control. To isolate unc-22 mutations and estimate the mutation frequency by this system, a much larger number of worms need to be screened (around 5000 hermaphrodites or 1.5 million F1 animals are needed for 1 spontaneous mutant (Nelson et al. 1994)) reflecting the low efficiency of the system. Most importantly, unless the unc-22 mutants were protected from competition with wild-type animals in the population over a long period of time, for which the dosimeter was designed, mutational events could be lost.  The eT1 balancer system was developed to measure the frequency of mutation for commonly used mutagenesis methods (Rosenbluth et al. 1983; Rosenbluth et al. 1985; Nelson et al. 1989). It has also been used to capture mutations caused by exposure to space radiation (Nelson et al. 1994). In the study by Nelson et al., dormant dauer worms were exposed to space radiation in a specially designed cabinet on the spacecraft where radiation shielding was minimal. Based on the number of lethals recovered they concluded that the mutation frequency was 8-fold higher in the spaceflight samples when compared to the   60control samples. In this experiment, worms were incubated within the space station as it is more interesting to study the mutational effects in the human-living environment. In this way, mutations in worms actively growing inside of the space station environment were analyzed. As this study was carried out in the well-shielded human-living environment, the mutation frequency is expected to be lower than the study of Nelson (Nelson et al. 1994), but more comparable to the environment in which astronauts reside. Taking advantage of the liquid CeMM media, mutation rates were examined in experimental populations with all developmental stages instead of dormant worms. The living, reproducing populations not only facilitates long-term experiments but also could provide comprehensive information about the environment.  Unlike the unc-22 screen, mutational events in the eT1 balancer system would not be lost through recombination because crossing-over is suppressed in the balanced regions. Any spontaneous mutations captured by the eT1 system will be maintained in the population without being lost through competition. In this study it has been shown that the mutations captured by eT1 can be recovered and analyzed by genetic and molecular methods when the samples are returned to earth. This is the first study to capture and analyze mutational events genetically in a self-maintained population over multiple generations in space. It has been shown the advantages of using the eT1 balancer system for measuring the effects of long-term exposure to a radiation environment that will be encountered by manned spaceflights.    61The system is now more useful since the molecular breakpoints of eT1 was characterized, making it possible to use PCR to detect the presence of eT1 chromosomes. The extensions of the eT1 balanced deficiencies on LGV were also established to facilitate the mapping of mutations captured by eT1.  Of all the methods examined, the eT1 balancer system was the most sensitive at detecting, capturing, maintaining, and recovering the mutation events. This study demonstrates that the C. elegans eT1 balancer system is very useful as an integrating biological dosimeter for studying mutational effects not only in space but also under other DNA damage agents. Using a similar assay, mutational spectrum of different DNA damage agents could be determined and the isolated mutational events could be analyzed in detail, which would provide insights into the nature of the damage and the repair pathway responding to the damage.  2.4.3 Future directions of the biological dosimeter for space radiation No significant difference in the average mutation frequency was observed between the spaceflight and the control samples suggesting that the 11-day spaceflight did not result in significant change in the mutation frequency of the worms (estimated radioactive dosage was 10-12 mRad per day, DiPalermo (ESA), personal communication). An 11-day spaceflight to the International Space Station (ISS) might not be long enough to cause significant effects, but many astronauts have spent considerably longer time in the space environment and probably will stay even longer in the future. Moreover, the situation   62changes greatly if the spaceships fly out of the magnetosphere, which protects the ISS, to more distant locations. In addition, the radiation exposure would be much higher if there were solar flare activities. Having a system like eT1 that can detect mutational effects will be necessary to analyze the biological effects of exposure to the space environment, and knowledge obtained from the analysis will aid the design of future manned spaceflight.  Multiple-generation growth of worms using a balancer in a closed media could result in accumulation of mutations in the population. Keeping the number of generations to a minimum will reduce the background caused by the mutation accumulation. Shortening the pre-flight preparation time, using lower culture temperature and slower developing strains are recommended for short flights. In the case of long term flights (such as a mission to Mars), experimental modifications to the detection system will be needed. In some cases, a genetically modified eT1 balancer system with for example, an extended generation time, could be used. However, development of a monitoring system that does not rely on return of the samples would be most useful. For example, a signalling system using GFP reporters coupled with radiation response genes, in which the signals could be transmitted back to earth would be very valuable.       63Table 2.1 G/C tract deletions on chromosome V left  Cosmid  Primers  dog-1  N2 Spaceflight CC1 1 T22H9  cccaacaactcgtatgccatc - - -   cgcgggaatatctaaattgtcta    2 F31F4  gcaagaacagcgagccacaa  -  -  -   ctccgcttccagtctcacat    3 Y50D4C  aaagcctgaaacacggatagga  -  -  -   cgttacagtgagaaacccgag    4 Y50D4A  gggttgctgtagtcggagaa  -  -  -   gtatattacgcttgcactttgc    5 Y75B7AL  tttcccgtcaccatcaccgc + - -   cttcagccagcttaatgtatcg    6 R12A1  tcaaattgtgagccggaaacg  -  -  -   gcgggagaagtgacgcatag    7 F53E2  ttggatgcccatcggctcaaa  -  -  -   acttgctctgcccgaaatacc    8 F52F10  ccccttattgcgggacgaatc  -  -  -   agctccttgcatgacgctctg    9 Y46H3D  caaagcactgtcgcatgttcc  -  -  -   tctctcgctcacctgcatcg    10 T06A1  aattggatgctcgtttgtttgtc  -  -  -   gcgcctctgatatttacaactc    11 F59A7  tcatctgattatggtcgatttgc - - -   atccactttcccttgagtttgc    12 F53E10  gtctcatttcggcttgatctatg  -  -  -   aaaagtctgcgtctcatctccc    13 C44C3  atttcgttcacatgggcaagaag  -  -  -   ggatctgtgaactaggcatagc    14 F59D6  tctgacgggcaaattccacata  +  -  -   atgctctttaacggcgcacac    15 C50H11  gagaattatggaaaattggg  -  -  -   ttcctgacaggctgtaaaa    16 C50H11  cactaccattaccgccctttat - - -   tttagcagccgacagtttagag    17 Y73C8B  acaggttatacattctgccacg + - -   gtctcccgatagccctccat    18 K08D9  ttgcgggaagtgtttagaggg  +  -  -   agatgatctggacacgaccga       64Table 2.1 G/C tract deletions on chromosome V left  ?+? indicates detected G/C tract deletions via PCR, while ?-? indicates no deletions observed.19 H10D18  cacttactgcgttggacacc  -  -  -    acggcagtctttatggttcg       20 C17E7  gattaaatcggaaatcccagag  -  -  -    gtagcgtcccaacaacaagag       21 Y45G5AM  atacagacagaacaccgattgc  -  -  -    gagaatattgttggctgcctga       22 T28F12  cgctactccaccttcaacaac - - -    cggttgtatgtcaatcttgtcc       23 T28F12  ttttggtgggtatttgaggct  +  -  -    aaggactactgacggctatg       24 T28F12  tcggagtctaagaagaagaagg  -  -  -    ttgaaacgcggttattgattagc       25 F54D11  cctgtgatgttgcgacttacc  -  -  -    cacagacccaaatccacattca       26 C37H5  gagactgctgttgttacttcg  -  -  -    ttcagagcgtaggatgtggc       27 Y49G5B  tcgtttgccgcccacctatg  -  -  -    ccatttggaacacggaacagaa       28 B0238  tgggaagaaatctccatca  -  -  -    aattccagctaactgcaaaa       29 F26F12  tattcgtcagggacaaacaacc  -  -  -    acgagatagagcaccagacag       30 T05H4  gccatttccctttgtttcttcg  -  -  -    caatctaatctggttcggtggt       31 ZC404  ttaagtccgcctcctctgtcc  -  -  -    cttcatttcaagcctttcaaccg       32 M03A1  cgacgaaaaatgcagaatttggc  +  -  -    aggtgtgtgtgcatacctccg       33 R144  catatggattggcatgtgaagca  +  -  -    tcaactttgacagcatttatccga       34  F07C6  cacgcttatcatttcaaatgtac  +  -  -    cgagcacaagtggcacatcgg       35 K09H9  cagtacctttccaaaggcgca  +  -  -    ggcgtctcgcatcgattcctc       36 C04C11  atcgattgacaaaggtgaaggag  -  -  -    cagttcacacaatgcgacttgc       37 F38A6  ggctagttgtataaccgtctgg  +  -  -    ttagacttattagtgagaacaggg         65Table 2.2 Lethal mutant isolates from the spaceflight and control samples    No. of F1?s tested No. of Culture BagsIsolates Complementation Group Mutation Frequency % (95% CI) Flight 2314 6 13 3 0.13 (0.035-0.35)  Ground Control 2061 6 11 8 0.39 (0.15-0.72) Lab Control 3000 6 3 3 0.1 (0.027-0.27) Lab NGM Control  1000 N/A 3 3 0.3 (0.08-0.8)     66 Table 2.3 Mapping and development blockage stages of lethal mutations   Lethals Isolates of complementation group Chromosome Locus Lethality Final name Flight        n=2314 h2159 11 III  Larval h2159  h2161 1 III  Maternal effect lethal h2161  h2164 1 III  Embryonic h2164 Ground Ctrl       n=2061 h2154 1 V let-344 Embryonic h2154  h2155 1 V Deletion Larval hDf36  h2156 1 V New lethal Larval h2156  h2157 4 V let-343 Larval h2157  h2158 1 V Deletion Embryonic hDf37  h2160 1 III  Larval h2160  h2162 1  Duplication  hDp137  h2163 1  Duplication  hDp138 Lab Ctrl       n=4000 h2165 1 III  Embryonic h2165  h2166 1  Duplication  hDp139  h2167 1  Duplication  hDp140  h2169 1 V   h2169  h2170 1 V   h2170  h2171 1 III   h2171    67 68Table 2.4 Single Nucleotide Polymorphism (SNP) mapping of the eT1 balanced deficiencies   Defs Y38C9B T01G6 H24K24 R09A1 T21H3 F52F10 F36H9 Y40B10A F36F12 R05D8 C44C3 C50H11 F35F10 C02A12 H10D18 B0213 T28F12 C13D9                    sDf74 - - - - - + + + + + + + + + + + + +                    sDf39 - - + + + + + + + + + + + + + + + +                    sDf32 - - - - - + + + + + + + + + + + + +                    sDf50 + + + + + + + + - - - - - - - - + +                    sDf27 + + + + + + + + + - - - - - - - - +                    sDf34 + - - - - - - - - - - - - + + + + +                    sDf53 - + + + + + + + + + + + + + + + + +                    sDf38 - + + + + + + + + + + + + + + + + +                    sDf33 - - - - - - + + + + + + + + + + + + ?+? means DNA is present on the specific SNP site in the deficiency, while ?-? indicates deletion of DNA on the site.  Figure 2.1 G/C tracts located on the left arm of chromosome V. The physical positions of G/C tracts are shown by sequential numbers in red below the line, and the genes on LGV were above the line.  69   70    Figure 2.2 Genetic map of eT1 balanced region LGIII (right) and LGV (left). Lethal mutations isolated in this study were shown above the lines of chromosome III and V. Known deficiencies and lethals were placed below the lines, while the SNP marker positions were marked above the lines. Position of the known deficiencies and lethals were described in Rosenbluth et al.[10], and Johnsen and Baillie[11].   3?5? 3?5?Known unknown3?5? 3?5?HaeIII site HaeIII siteRestriction? enzyme? and? primer? designHaeIII digestion? and? self? circularizationHaeIII siteBsmIsiteBsmI digestion? and? PCR  Figure 2.3 Working flow of the inverse PCR used to characterize the eT1 breakpoint on LGIII 71  (a)  (b)  Figure 2.4 (a) DAPI staining of diakinesis-stage chromosomes of unc-36(+) duplications. Six bivalents should be observed in the diakinesis-stage oocytes in the wild type worm germline; while more than six bivalents indicate the presence of extra-chromosomes or chromosome fragments. Arrows indicate the putative chromosome fragments with unc-36(+) duplications. (b) Schematic map of the location and extent of the unc-36(+) duplications. While hDp137 covers a region at least from dpy-17 to unc-32, hDp138 and hDp139 are confined to the region between sma-3 and sma-2.    72  (a)   (b)  Figure 2.5 (a) Schematic representation of the wild-type organization of LGIII and LGV and eT1(III;V) reciprocal translocation. Black and gray lines represent the chromosomal arms of LGIII and LGV, respectively. The relative positions and directions of genes near the breakpoints are indicated. (b) eT1 chromosomes can be detected by PCR.     73Chapter 2 References  Brenner, S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1): 71-94. Cheung, I., Schertzer, M., Rose, A., and Lansdorp, P.M. 2002. Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich DNA. Nat Genet 31(4): 405-409. Crow, E.L. and Gardner, R.S. 1959. Confidence Intervals for the expectation of a posson variable. Biometrika 46(3/4): 441-453. Johnsen, R.C. and Baillie, D.L. 1991. Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129(3): 735-752. Moerman, D.G. and Baillie, D.L. 1979. Genetic organization in Caenorhabditis elegans: fine-structure analysis of the unc-22 gene. Genetics 91(1): 95-103. Moerman, D.G. and Waterston, R.H. 1984. Spontaneous unstable unc-22 IV mutations in C. elegans var. Bergerac. Genetics 108(4): 859-877. Nelson, G.A., Schubert, W.W., Kazarians, G.A., Richards, G.F., Benton, E.V., Benton, E.R., and Henke, R. 1994. Radiation effects in nematodes: results from IML-1 experiments. Adv Space Res 14(10): 87-91. Nelson, G.A., Schubert, W.W., Marshall, T.M., Benton, E.R., and Benton, E.V. 1989. Radiation effects in Caenorhabditis elegans, mutagenesis by high and low LET ionizing radiation. Mutat Res 212(2): 181-192. O'Neil, N.J. and Rose, A.M. 2006. DNA repair. WormBook, ed The C elegans Research Community WormBook, doi/10.1895/wormbook.1.54.1, http://www.wormbook.org. Ochman, H., Gerber, A.S., and Hartl, D.L. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120(3): 621-623. Rosenbluth, R.E. and Baillie, D.L. 1981. The genetic analysis of a reciprocal translocation, eT1(III; V), in Caenorhabditis elegans. Genetics 99(3-4): 415-428. Rosenbluth, R.E., Cuddeford, C., and Baillie, D.L. 1983. Mutagenesis in Caenorhabditis elegans. I. A rapid eukaryotic mutagen test system using the reciprocal translocation, eT1(III,V). Mutat Res 110(1): 39-48. -. 1985. Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 r of gamma-radiation. Genetics 109(3): 493-511. Rosenbluth, R.E., Rogalski, T.M., Johnsen, R.C., Addison, L.M., and Baillie, D.L. 1988. Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V (left). Genet Res 52: 105-118.   74  75Szewczyk, N.J., Kozak, E., and Conley, C.A. 2003. Chemically defined medium and Caenorhabditis elegans. BMC Biotechnol 3: 19. Szewczyk, N.J., Udranszky, I.A., Kozak, E., Sunga, J., Kim, S.K., Jacobson, L.A., and Conley, C.A. 2006. Delayed development and lifespan extension as features of metabolic lifestyle alteration in C. elegans under dietary restriction. J Exp Biol 209(Pt 20): 4129-4139. Wicks, S.R., Yeh, R.T., Gish, W.R., Waterston, R.H., and Plasterk, R.H. 2001. Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat Genet 28(2): 160-164. Wormbase. [http://www.wormbase.org/].  CHAPTER 31: Spectrum of mutational events in the absence of DOG-1  3.1 Introduction The Caenorhabditis elegans gene dog-1 is required to maintain genomic stability (Cheung et al. 2002) and encodes an ortholog of the Fanconia Anemia pathway component J (Youds et al. 2007). Using a PCR-based assay, deletions initiating in poly-G/poly-C tracts (G/C tracts) and extending for several hundred base pairs have been observed (Cheung et al. 2002). It was thus proposed that DOG-1 resolves secondary structures during DNA replication, and that in its absence replication blocks occur resulting in mutational alterations in the DNA (Cheung et al. 2002). Similarly, in human cells, FANCJ, which has DNA binding and helicase activities, has been shown to resolve certain three dimensional structures that arise during DNA replication in vitro (Howlett et al. 2002; Cantor et al. 2004; Gupta et al. 2005). However, the PCR based assay used to detect G/C tract deletions may not reflect the global spectrum of genome instability caused by the disruption of DOG-1 in C. elegans. To understand more fully the range of mutational events that occur in the absence of DOG-1, I have used the well-established eT1 balancer system (see chapter 2) to capture and characterize lethal mutations. Because of the functional similarity between DOG-1 and FANCJ, examination of DOG-1 function in C. elegans may provide insight into the function of the repair pathway involved in FA.     1 A version of this chapter will be submitted for publication. Zhao, Y., O'Neil, N.J., Tarailo, M., and Rose, A.M. Spectrum of mutational events in the absence of DOG-1.   763.2 Materials and methods 3.2.1 Strains and culture conditions:   The following strains were used in this analysis: N2 Bristol strain (wild-type), CB4856 Hawaiian strain , VC13 dog-1(gk10), CB224 dpy-11(e224), BC251 dpy-11(e224) unc-42(e270), BC70 eT1, CB644 unc-62(e644), BC2507 (dpy-18(e364)/eT1(III); unc-60(e677) emb-29(s819) dpy-11(e224)/eT1(V)), BC3538 (dpy-18(e364)/eT1(III); sDf27 unc-46(e177)/let-500(s2165) eT1(V)), BC3438 (dpy-18(e364)/eT1(III); sDf28 unc-46(e177)/let-500(s2165) eT1(V)), BC3402 (dpy-18(e364)/eT1(III); sDf32  unc-46(e177)/let-500(s2165) eT1(V)), BC3545 (dpy-18(e364)/eT1(III); sDf35 dpy-11(e224)/let-500(s2165) eT1(V)), BC3461 (dpy-18(e364)/eT1(III); sDf53 unc-46(e177)/let-500(s2165) eT1(V)), BC1993 (dpy-18(e364)/eT1(III); nDf32/eT1(V)). Many strains were kindly provided by D. L. Baillie, Simon Fraser University, Burnaby BC, Canada and the Caenorhabditis Genetics Center at the University of Minnesota, Minneapolis, Minnesota, USA. VC13 dog-1(gk10) was made available by the C. elegans Gene Knockout Consortium, Vancouver BC. The All mutations denoted with the h prefix arose in the A. M. Rose laboratory. All strains were maintained as previously described (Brenner 1974).   3.2.2 Isolating mutational events in dog-1 3.2.2.1 Screening for lethal mutations using eT1 as a balancer As described in chapter 2, the eT1 balancer system has been shown to be capable of capturing, maintaining and recovering various kinds of mutations from a variety of mutagenic conditions. I constructed the strain KR3964 (dog-1(gk10)/dog-1(gk10); +/eT1(III); dpy-11(e224) unc-42(e270)/eT1(V)) to screen for lethal mutations arising in the absence of   77DOG-1, using the approach described in the chapter 2. Single L4 wild-type looking heterozygotes (dog-1(gk10)/dog-1(gk10); +/eT1(III);  dpy-11(e224) unc-42(e270)/eT1(V)) were placed on individual NGM plates. The progeny of these worms were screened for the absence of gravid Dpy-Unc worms. The absence of mature Dpy-Uncs indicated the presence of a lethal mutation within the eT1 balanced region on LGIII or LGV. From each plate containing a putative mutation, an eT1 heterozygote was picked to establish a strain. To prevent the accumulation of mutations in the mutator background, dog-1(gk10) was routinely crossed to N2 before the KR3964 was made. Lethal mutations isolated from the screen were outcrossed to remove dog-1(gk10) before the strains were established.  3.2.2.2 Screening for lethal mutations in the absence of a balancer using visible markers  In order to compare the dog-1 forward mutation frequency with or without crossing-over occurring, the strain dog-1(gk10)/dog-1(gk10); unc-46(e177) + +/+ dpy-11(e224) unc-42(e270) was constructed. Single L4 wild-type looking dog-1(gk10)/dog-1(gk10); unc-46(e177) + +/+ dpy-11(e224) unc-42(e270) worms were placed on individual NGM plates. The progeny of these worms were screened for the presence of Unc-46 but absence of Dpy-11-Unc-42. Heterozygous worms with such a phenotypic segregation pattern indicate the presence of a lethal mutation on the dpy-11 unc-42 marked chromosome. eT1 was then crossed to these heterozygotes to balance the lethal mutations on the left part of LGV. An eT1 heterozygote was picked to establish a strain. The genotype of the new strain (+/eT1(III); let-* dpy-11(e224) unc-42(e270)/eT1(V)) was confirmed by segregation and by   78complementation to dpy-11(e224) unc-42(e270). Confirmed lethal mutations were outcrossed to remove dog-1(gk10) before the strains were established.   3.2.3 Characterizing mutational events in dog-1 3.2.3.1 Chromosomal mapping The lethal-bearing strains from both screens were crossed to N2 males and L4 F1 hermaphrodites from each strain were individually plated for progeny tests. The F2 progeny of non-Unc-36 bearing F1 animals (n>2) were scored (Note: eT1 homozygotes have an Unc-36 phenotype). The lethal mutation was assigned to LGIII (right) if the number of fertile F2 Dpy-Unc progeny was approximately one third of the number of wild-types; if the Dpy-Unc to wild-type ratio was significantly less than one third, the lethal was then assigned to LGV (Left). The segregation also indicated the genetic map distance between a LGV lethal mutation and dpy-11. Lethal mutations on LGV (Left) were chosen for further investigation.  3.2.3.2 Single Nucleotide Polymorphism (SNP) mapping  The Hawaiian strain CB4856, which is a wild-type isolate that has a uniformly high density of single nucleotide polymorphisms compared with the reference Bristol N2 strain (Wicks et al. 2001), was mated to the lethal strains. The F1 heterozygotes were transferred to individual plates and allowed to self-fertilize. Plates with no eT1[Unc-36] progeny were selected (that is, the parent has lethal-bearing chromosomes with the Hawaiian chromosomes). The parental Hawaiian/Bristol heterozygous hermaphrodites from these plates were lysed and amplified by PCR using primers designed to detect the SNP sites by restriction enzymes (snip-SNP PCR) (Wicks et al. 2001). The absence of amplified N2 band   79at a certain SNP site indicated deletion of this site in the lethal-bearing chromosome. The extent of the deletion in the lethal mutations was determined by testing a series of contiguous SNPs. Primers, PCR conditions and restriction enzyme digestion were described by Wicks et al. (Wicks et al. 2001) (Table 3.1).   3.2.3.3 Array Comparative Genomic Hybridization (aCGH) analysis DNA samples of lethal mutations were prepared for CGH (Comparative Genomic Hybridization) Microarray analysis. Genomic DNA was isolated from mixed stage worms grown on 4 large NGM plates. Worms were digested with protinase K followed by RNase and phenol/chloroform extraction. DNA samples were tested for purity and diluted to a concentration of 250ng/ml prior to sending to Nimblegen Systems Inc. for the CGH microarray analysis. For the experiments in this study a C. elegans whole genome tiled CGH array was used.  This chip, produced by Nimblegen Systems Inc., is based on the Wormbase CE2, WS120 build and consists of 385,000 45-85mer probes spaced at a median separation of 137bp across the entire genome designed by S. Flibotte, Genome Science Centre, Vancouver, BC. Sample QC, fluorescent dye labelling, array hybridisation and Data analysis are performed by Nimblegen Systems Inc. Test strains were labelled with Cy3 and hybridised to the array using Cy5 labelled N2 DNA as a reference. The array data were returned in both raw and processed formats. Formatted data were viewed and manipulated with Signalmap browser software.      803.2.3.4 Mapping to regions on LGV (Left) If no deletion was detected by SNP analysis, the lethal mutation was assumed to be small, affecting one or few genes. In these cases, known deficiencies were used to map the lethal mutations. LGV (left) has been divided into zones by a set of chromosomal rearrangement breakpoints, mostly deficiencies (Rosenbluth et al. 1988). These deficiencies uncover most of the eT1 balanced region. In chapter 2, I have described the use of SNP markers to determine their molecular positions along the chromosome. The absence of viable let-x/Df heterozygous worms indicated failure to complement. Lethal mutations that mapped within the same zones were tested for complementation with each other. Strains that failed to complement were classified into a single complementation group.   3.2.3.5 Correlation of the lethal phenotype with small G/C tract deletions Once a lethal had been mapped to a zone, it was complementation tested against representative alleles of known lethals in the zone (Johnsen and Baillie 1991). Failure to complement indicated that the mutation affects a known lethal. Deletions associated with G/C-tracts were identified using PCR method as follows. DNA of individual fourth larval stage (L4) or young adult worms was prepared by lysis with Proteinase K. The integrity of the G-tract was examined by the length of the amplified DNA using primers flanking the G-tracts. Conditions for the PCR were described by Cheung et al.(Cheung et al. 2002). PCR products were run on 1% agarose gels, stained with SYBR Green, and photographed by the BioRad GelDoc 2000 imager. PCR product was then submitted to Nucleic Acid and Protein Services (NAPS) at UBC for sequencing.    813.2.3.6 Developmental blocking stage The developmental blocking stages were noted at 20?C. Worms with lethal mutations balanced by eT1 were mated to dpy-11 unc-42/++ males. Unfertilized Dpy Unc L4 F1 progeny (n>2) were grown on plates for 12 hours and the number of eggs (F2) laid were counted. The next day the F2 animals were scored for the presence of unhatched eggs (arrested embryos). On the fourth day the plates were scored for arrested larvae; and on the seventh day for lack of fertile adults.  3.2.4 Chromosomal rearrangements: unc-36(+) duplications 3.2.4.1 Genotyping using PCR Two strains isolated from the screen segregated no Dpy-Unc in either the mapping or complementation experiments, and the progeny from wild-type hermaphrodites of these strains always contained Unc-36?s. Based on previous studies (Rosenbluth et al. 1985; Zhao et al. 2006), this segregation pattern indicate that these strains might be homozygous eT1 carrying a wild-type copy of unc-36, which leads to wild-type phenotype. Taking advantage of the molecular indentification of the eT1 breakpoints on LGIII and LGV (Chapter 2), following primers were used to follow the eT1 chromosome: (1) 5?-GTAATCGTTTGGATGGGTGC-3?, (2)5?-TCCGTAGATGACAAAACAGTTG-3?, and (3) 5?-GTGCTCGCCACTTATGTCTC-3?. (1) and (2) were used to detect wild-type LGV; (1) and (3) were used to detect eT1(V). If the wild-type looking worms were homozygous for eT1, no wild-type LGV amplification band would be observed. If the wild-type looking worms were eT1 heterozygotes, then both wild-type LGV and eT1(V) bands would be seen.     823.2.4.2 DAPI staining Whole worms were stained with DAPI and chromosomes in diakinesis were examined for extra-chromosomal segments, indicating an unc-36(+) duplication. One day old synchronized adults were washed with M9 buffer and stained with 150nM DAPI in ethanol for 90 minutes at room temperature. DAPI was removed by washing with M9 buffer. Animals were destained overnight in M9 buffer at 4 ?C. Destained animals were mounted on agarose pads and viewed with the Zeiss Axioscope fluorescent microscope with 40X objective.  3.2.5 Measuring meiotic recombination The frequency of meiotic recombination was measured in the interval between dpy-11 and let-x on LGV. Individual animals of genotype +/eT1(III); let-x unc-42 dpy-11/eT1(V) were crossed to N2. Wild-type looking F1 hermaphrodites were plated individually and those that segregated no Unc-36 F2 progeny were transferred daily for four days. In each of the broods, the number of wild-types, Dpy-Unc, Dpys and Uncs were scored. Recombination frequency (p) was calculated using the equation: p=1-(1-2(R/T))2 Where: R=numbers of recombinants=2(largest recombinant class) T=total progeny=4/3(number of wild-types + 1 recombinant class) The map distance was calculated as px100. Confidence intervals for each recombination frequency were calculated using the statistics of Crow and Gardner (1959).    833.3 Results 3.3.1 Forward lethal mutation frequency Prior to this study, the characterization of the mutations generated in the absence of DOG-1 were largely based on PCR analysis using primers flanking the G/C tracts (Cheung et al. 2002; Youds et al. 2006). The analysis only detects deletions in the length of the sequence amplified. However, this approach may not detect the complete range of mutations induced by the absence of DOG-1. In order to investigate the full mutational spectrum, the eT1 balancer system was used. An eT1 heterozygote with visible markers, +/eT1(III); dpy-11(e224) unc-42(e270)/eT1(V) was constructed for the analysis. In this way, the frequency and nature of mutations can be compared to those recovered after treatment with known mutagens such as ethylmethane sulfonate (EMS) and radiation (Rosenbluth et al. 1983; Rosenbluth et al. 1985; Nelson et al. 1989; Zhao et al. 2006). Because of the pseudo-linkage of translocated regions on LGIII and LGV, absence of Dpy Unc F2 animals indicates the presence of a lethal mutation in these crossing-over suppressed regions. The molecular identification of the eT1 breakpoints previously defined this region of 6Mbp on LGIII and 9Mbp on LGV (Zhao et al. 2006). The spontaneous lethal mutation frequency for the eT1 balanced region is approximately 0.06% (Rosenbluth et al. 1983). eT1 balancer system (strain KR3964) was thus used to measure and capture lethal mutations arisen in dog-1 background. From 3385 L4 worms that were set up individually for the lethal screen, thirty lethal strains were isolated from these samples, giving a mutation frequency just under 1% (Table 3.2). Homologous recombination has been shown to be involved in the repair of G/C tract deletions in dog-1 background (Youds et al. 2006), it was questioned whether the elevated   84mutation frequency observed in KR3964 worms was also caused or affected by the depletion of homologous recombination in the balanced area in eT1 heterozygous worms. As a control, a non-eT1 system was established to screen lethal mutations in dog-1 mutant worms. From 1195 worms with the genotype of dog-1(gk10)/dog-1(gk10); unc-46(e177) + +/+ dpy-11(e224) unc-42(e270), two lethal mutations were isolated and subsequently balanced by eT1 to maintain them. In this case, only lethal mutations on LGV would be recovered and thus the mutation frequency 0.17% is not significantly different from that observed in the eT1 balancer system (9 mutations from 3385 worms 0.27%; t-test, P>0.05) (Table 3.2).  3.3.2 Chromosome mapping and the development arrest of the lethal mutations  From the 30 lethal mutations recovered by the eT1 balancer system, 19 of them were mapped to LGIII and 9 were mapped to LGV. Two strains could not be mapped to either chromosome. These two strains and the 9 strains with mutations on LGV were selected for detailed investigation.  The developmental arrest stages of these LGV lethal mutations were determined and are described in Table 3.3. A large number of strains arrested as embryos were observed. Considering that only few G/C tracts bearing genes are known to be essential genes (Zhao et al. 2007), it seems likely that many of the lethal mutations affect more than one gene unlike what has been published previously (Cheung et al. 2002).   3.3.3 SNP mapping Many lethals arrested at the embryonic stage, indicating the possible disruption of multiple genes of the mutation. SNP mapping was used to test if these lethal mutations   85involved large deletions and to establish the physical extent of the deletions. Heterozygotes for Hawaiian chromosomes with lethal mutation bearing chromosomes were analyzed. The absence of Bristol band indicated deletion of the SNP site. Of the 11 lethal mutations on LGV, five were found to have deletions involving more than two SNP sites (Figure 3.1, Table 3.4), indicating that they are large deficiencies. Based on the SNP data, h2141 and h2172 contained deletions of approximately 1Mbp, h2179 deleted 1.5Mbp and h2173 deleted 4.5Mbp approximately of LGV sequence. The h2148 mutation is more complicated and has two large deletions separated by intact sites (Figure 3.1, Table 3.4). The strain containing h2189 segregates arrested embryos but it deletes only one SNP site located in cosmid C02A12. However, no G/C tract is located nearby the SNP site and in the 20kb upstream and downstream regions of this SNP site there are no obvious genes causing embryonic lethality when disrupted. Thus h2189 might also be a large deletion involving more than a single essential gene (with the involvement of G/C tract or not). Another possibility would be that a secondary mutation not detected by SNP mapping is the reason for the lethal phenotype, which is unlikely as the genetic distance mapping result indicated that the lethal mutation is located close to the C02A12 SNP site (Table 3.5).  3.3.4 aCGH analysis In order to investigate the molecular nature of the large deletions and to see whether or not they were associated with G/C tracts, array Comparative Genomic Analysis (aCGH) was used to determine the physical breakpoints of these deletions. aCGH is an emerging technology for high resolution mapping of chromosomal copy number changes at a genome wide scale through the comparison of the DNA ratio between two samples and it has been   86successfully applied in genetic studies on C. elegans (Jones et al. 2007; Maydan et al. 2007). Two large deletions were analyzed using aCGH with the eT1 heterozygote as reference sample. h2141 and h2172 were chosen for aCGH analysis. Surprisingly, aCGH data showed that these lethal mutations not only have large deletions on LGV, but also have large duplications of other chromosomes. h2141 has a deletion of approximate 1Mbp on the left end of LGV and a duplication of 300kb on right end of LGX (Figure 3.2a), and h2172 has a deletion at about same size on LGV and a duplication of 3.5 Mbp on the left end of LGIV.  Because the rearrangements in both strains delete the end of the LGV, and presumably the telomeres as well, it seems reasonable to propose that the duplications in these strains are actually half translocations. To test this hypothesis, a PCR assay using the primer set (5?-GCCCAGGAAGTTTTGAGTTG-3? on LGV and 5?-GACCGAGGACAACTCTAACACC-3? on LGX) was done and a fragment of 328kb long was amplified in h2141. The duplicated LGX right end was connected to the breakpoint of the 981kb LGV deletion, forming a V-X translocation chromosome. The breakpoint of the LGV deletion is in a 24mer G/C tract, while the LGX breakpoint is in a G-rich region (sequence GTTCGGGACGGGGGGGGGGGGG) that is not the typical G/C tract described by (Cheung et al. 2002) (Figure 3.2b). The configuration of h2172 could not be confirmed by PCR and sequencing possibly due to the complicated rearrangement (insertions for example) and the length of the region. However, the chromosomal regions where the breakpoints are located contain multiple G/C tracts. It is reasonable to believe that h2172 has a IV-V half translocation similar to h2141.    87 3.3.5 Mapping and characterization of the lethal mutations with small deletions Five lethal mutations did not delete any of the tested SNP site on LGV and were classified as putative small deletions. Two of them, h2137 and h2140 were chosen for more detailed investigation. They were complementation tested using deficiencies of several regions on LGV (Johnsen and Baillie 1991). Failure to complement indicated the lethal was located in the region deleted by the deficiency. h2137 failed to complement sDf27 and nDf32 but complement sDf28, sDf32, sDf35 and sDf53; h2140 failed to complement sDf28 and complemented the rest of the deficiencies. After a lethal was mapped to a zone, representative alleles of known essential genes in the zone were complementation tested with the lethal mutation. In this way, h2137 failed to complement unc-62 and h2140 failed to complement emb-29. h2144, h2177, h2186 were not molecularly identified and they were positioned on the map based on their genetic map distance from Dpy-11 (Figure 3.1). unc-62 encodes a Meis-class homeodomain protein and has an allele s472 with a lethal phenotype. It was thus questioned if G/C tract deletions caused the disruption of the function of unc-62 gene. There are two G/C tracts in the unc-62 gene, one in the first intron and the other one in the fifth intron (Figure 3.3a). A PCR assay as described by Cheung et al. (Cheung et al. 2002) was applied to see if deletions of these two G/C tracts occurred in h2137. Using the primer set (5?-TTTTGGTGGGTATTTGAGGCT-3? and 5?- CACCGACAAAAAGCGTAATCTG-3?), a 1.1kb deletion of the G/C tract in the fifth intron was observed. Sequencing results showed that the deletion starts from the first cytosine (C) of the G/C tract and extends downstream, taking out the sixth exon of unc-62 (Figure 3.3a).    88emb-29 has not been molecularly identified. G/C tract PCR assay was thus used to test the integrity of G/C tracts in the area. Using the primer set (5?-TGAGTTGACTTCGGCTTCACGG-3? and 5?- GGGGCAGCATACAAAACTTGACAC-3?), a 453bp G/C tract deletion was found in a predicted gene Y46H3D.4 (Figure 3.3b). Interestingly, this deletion includes but does not initiate from the G/C tract. The deletion is confined to the first intron based on current Wormbase gene prediction. However, SAGE tags have been assigned to this intron and there is sequence conservation between C. elegans and C. briggsae in the first intron (Wormbase). It is thus possible that an un-annotated exon or regulatory elements occur in the deleted sequence of Y46H3D.4 and this gene is emb-29.  3.3.6 Characterization of unc-36(+) duplications Two of the lethal strains segregated no Dpy Uncs in either the chromosome mapping or complementation experiments. Progeny from wild-type hermaphrodites of these strains always included Unc-36 animals but not at the expected ratio for an eT1 heterozygote. Previous studies with eT1 balancer system as described in chapter 2 have shown this segregation pattern is indicative of a homozygous eT1 with an unc-36(+) duplication derived from the normal LGIII chromosome (Rosenbluth et al. 1985; Zhao et al. 2006). The genotypes of these two strains were tested by PCR. No wild-type LGV band was observed from either of the two strains in the PCR assay indicating that these wild-type looking worms are homozygous eT1. An unc-36(+) duplication derived from the normal LGIII was proposed to be responsible for the wild-type phenotype. DAPI staining of diakinesis chromosomes in the germline of the wild-type hermaphrodites of these strains showed more than the wild-type 6 bivalent chromosomes, which indicated extra DNA fragments or chromosomes   89(Figure 3.4). The cytogenetic results confirmed the hypothesis that these strains have duplications and that the duplications are free duplications. These strains were thus renamed hDp142 and hDp143.   3.3.7 Some dog-1 progeny arrest as embryos    The high proportion of large chromosome rearrangements observed in the lethal mutations studied (8/13) lead us to question whether the absence of dog-1 was responsible for the severe problems in the mutant worms. dog-1 mutant animals have been reported to have fairly low overall embryonic lethality (Youds et al. 2006). The conclusion was based on the total number of dead embryos observed from the total progeny of dog-1 mutants. If the chromosome instabilities as observed in this study are happening frequently in the dog-1 mutants, it is thus expected that worms with this kind of problems would have more severe embryonic lethality than others, as observed in worms with deficiencies or translocations. An analysis of embryonic arrest was done on dog-1 mutants. The progeny of 105 L4 dog-1(gk10)/dog-1(gk10) worms were examined. In agreement with the results reported by Youds et al. (Youds et al. 2006), the overall frequency of embryonic lethality is fairly low (date not shown). In fact, most worms have only a few dead embryos. However, some worms (7 out of 105) had more than 10% embryonic lethality (up to 56% for one case), an indication of lethality due to chromosomal rearrangements. This result supports the hypothesis that large chromosomal rearrangements are happening in dog-1 mutant animals.           903.4 Discussion 3.4.1 dog-1(-) is a mutator Previously, dog-1 mutant strains were found to contain deletions of G/C tracts that result in a range of mutant phenotypes including variable abnormal (Vab), high incidence of males (Him), steriles (Ste) and other visible mutants such as dumpy (Dpy) (Cheung et al. 2002; Youds et al. 2006). Using primers flanking the G/C tracts, PCR amplification revealed deletions of variable length, all originating in the G/C tracts. The small G/C tract deletion phenotype in the absence of DOG-1 has indicated that disruption of dog-1 causes genome instability. However, isolating spontaneous mutations from the strain in this way did not provide an accurate estimate of the forward mutation frequency. Furthermore, it was difficult to estimate the mutational frequency based on the PCR assay because of the characteristics of PCR method itself: any single deletion occurred within one nucleus can be detected and multiple deletion events within one animal can not be distinguished and somatic deletions could not be easily distinguished from heritable deletions.     In order to gain an estimate of how effective a mutator dog-1 was, we used an established and well characterized balancer system to isolate lethal mutations. Compared to the spontaneous lethal mutational frequency (0.06%) in wild-type worms (Rosenbluth et al. 1983), the mutational frequency over the eT1 balanced regions in dog-1 mutants was more than 10 fold higher (Table 3.2). The frequency of recovery of lethals using eT1 provided information that could be compared to other widely used mutagens. The dog-1 mutation frequency (0.89%) is comparable to 3mM EMS or 500R ? ?radiation treatment (Rosenbluth et al. 1983). The forward mutational frequency described here clearly showed that dog-1 is an effective mutator.   91It was previously shown that the small G/C tract deletion on the site in vab-1 can be partially prevented by homologous recombination machinery components such as HIM-6, BARD1, RAD51, and XPF, since knock down of these components led to more severe deletion phenotype (Youds et al. 2006). eT1 balancer system relies on meiotic recombination suppression to maintain mutations. It is thus reasonable to question if the eT1 balancer system itself can affect the lethal mutational frequency in dog-1 mutants. However, the non-eT1 system under dog-1 background using the same visible markers revealed comparable mutational frequency to that in eT1 balancer system. This observation demonstrated that meiotic recombination did not significantly affect the creation of lethal mutational events in dog-1. It was the first time the overall mutational frequency of dog-1 mutants could be established using the eT1 balancer system. On the other hand, PCR based analysis can only detect mutations that are confined by specific primers thus miss unpredicted mutation events. The analysis described in this chapter however has shown that dog-1 can cause a wide range of mutations in addition to the small G/C tract deletions.  3.4.2 Most of the studied dog-1(-) induced lethal mutations involve chromosome instability Most predicted DOG-1 targets, G/C tracts, are in intergenic regions. Even for those intragenic G/C tracts, most associated genes seem not have essential functions (Zhao et al. 2007). Small G/C tract deletions of hundreds of base pairs were unlikely to be responsible for the high lethal mutation frequency observed in dog-1 mutants.    92As shown by SNP mapping in this chapter, most of the studied lethal mutations on LGV involved deletion of large DNA segments including multiple genes. Some mutations have lost millions of base pairs DNA on the chromosome V. More detailed aCGH analysis revealed that two of these large deletions actually have duplicated DNA segments. Subsequent PCR assay on one of them (h2141) has proven that the duplicated DNA segment on LGX was fused to the truncated LGV to form a V-X translocation. This is possibly the situation for all of the deletions extending to the left end of LGV (h2141, h2148, h2172, h2173, h2179), replacement of the LGV telomere with duplicated non-homologous chromosome ends. Free duplications observed in the screen were another indication of chromosome instability in dog-1 mutants. They clearly demonstrated the presence of chromosomal fragmentation.  Large deficiencies on LGV have been previously shown to cause severe suppression of meiotic recombination between themselves and Unc-46 (Rosenbluth et al. 1990). This suppression phenotype has also been observed in the dog-1 induced large deletions (Table 3.5). h2189, also classified as ?large deletion?, did not exhibit significant meiotic recombination suppression. It is possible that this deletion is not long enough to affect the meiotic recombination.  3.4.3 dog-1 generates a wide range of mutational events  For the small deletions with identified breakpoints (h2137 and h2140) and large deletions (h2141 and h2172), all the breakpoints are either within the G/C tracts or immediately adjacent to G/C tracts. Consistent to the original findings of small G/C tract   93deletions in the absence of DOG-1, G/C tracts are apparently vulnerable sites for genome stability. It is believed that in the absence of dog-1, G/C tracts or the secondary structures they might form can cause ?trouble spots? in the genome. Presently, dog-1 is the only gene found to be responsible for the retention of G/C tracts (Youds et al. 2006; Youds et al. 2007). Other than those lethal mutations isolated in this study, many small G/C tract deletions have been observed and isolated. PCR analysis has been very efficient at identifying small deletions of G/C tracts using flanking primers. However, when we attempted to identify the physical basis for the spontaneous mutants isolated, not all could be accounted for by G/C tract deletion. In addition to the G/C tract associated mutations, non-G/C tract associated mutations were also observed based on the data revealed by aCGH. Both deletions and duplications were found in a region without obvious G-rich DNA. In a screen for mdf-1 suppressor using dog-1 as a mutator, duplication and deletion of non-G-rich DNA were also observed (Tarailo, personal communication). Similarly, other spontaneous mutants that were recovered could not be accounted for by G/C tract deletion.  For example, an allele of dpy-5 was recovered from a dog-1 strain, sequenced and shown to be a single nucleotide mutation in the exon.  Although not proven to be the result of dog-1 loss of function, it appears that not all mutants recovered result from G-tract deletion. It is thus obvious that mutation events occurring in the absence of DOG-1 are not confined to G/C tracts, although the majority of them are associated with G/C tracts. Using the eT1 balancer to isolate lethal mutations, we hoped to gain a fuller understanding of the nature of mutations occurring in dog-1. In all, we observed five small deletions (two confirmed by PCR), six large deletions (detectable by SNP mapping) and two   94duplications (detectable by DAPI). Two of the apparent deletions are actually translocations with associated large deletions and duplications.   3.4.4 Formation of the chromosomal rearrangements  An interesting question regarding the chromosomal rearrangements observed in this study is how they were formed. It was proposed that dog-1 may be necessary to unwind the secondary structures formed at guanine rich DNA during the lagging strand DNA synthesis thus in the absence of DOG-1 small deletions could be formed (Cheung et al. 2002). As described in Chapter 1, the DNA replication folk stalls could be a possible cause for the chromosomal rearrangements. Double strand breaks induced by the stalled replication can be repaired by many different pathways. DSB repair mechanisms such as single-strand annealing (SSA), break-induced replication (BIR), and Non- homologous end joining (NHEJ) can lead to error-prone repair of DNA, resulting chromosomal rearrangements such as long deletion, non-reciprocal translocation, and duplication. In the absence of DOG-1, G/C tracts formed secondary structures that block the replication process; DNA repair pathways following the DSBs thus caused the observed chromosomal rearrangements. Another explanation would be ectopic recombination coordinated by G/C tracts. The ability of G/C tracts or G-rich DNA to interact with each other with non-Watson-Crick base pairing makes them candidate for chromosomal pairing components (Sen and Gilbert 1988; Zhao et al. 2007). Especially when the DOG-1 is absent, G/C tracts are free to form secondary structures, becoming possible chromosome alignment sites. Recombination between heterologous chromosomes in the process of DNA repair could thus produce a half translocation as observed in this study.   95 3.4.5 Insight into the function of the repair pathway involved in Fanconi anemia  Fanconi anemia is a cancer susceptibility syndrome characterized by hypersensitivity to agents that cause DNA interstrand cross-links (ICL) (reviewed by Taniguchi and D'Andrea 2006), indicating a role for the FA proteins in repair of cross-links. Patients with Fanconi Anemia in subgroup J have mutations in FANCJ (also known as BRIP1 or BACH1) (Bridge et al. 2005; Levitus et al. 2005; Levran et al. 2005; Litman et al. 2005) and mutations in FANCJ have been identified in some cases of breast cancer (Cantor et al. 2001; Seal et al. 2006). FANCJ encodes a human DEAH class DNA helicase and the FANCJ protein binds to the breast cancer BRCA1 protein (Cantor et al. 2001; Cantor et al. 2004). In addition to the DNA binding and helicase activities observed in vitro, FANCJ has also been shown to be able to resolve certain three dimensional structures that arise during DNA replication in vitro (Howlett et al. 2002; Cantor et al. 2004; Gupta et al. 2005). Overall, although plenty of in vitro evidence suggests the biological function of FANCJ in maintaining genome stability, the exact in vivo biological role of FANCJ remains unclear.  C. elegans is a useful model for FA pathway studies as the fundamental components of the FA pathway are believed to be conserved in C. elegans, including FANCD1/BRCA2, FANCD2, FANCJ, FANCL, and FANCM (Dequen et al. 2005; Collis et al. 2006; Patel and Joenje 2007; Youds et al. 2007). dog-1 encodes an ortholog of FANCJ (Youds et al. 2007). The mutational spectrum demonstrated in this study thus provided valuable insight into the function of the repair pathway in FA. Chromosomal instabilities such as large deletions, duplications and translocations found in dog-1 mutants are hallmark of tumors (Hassold and Hunt 2001; Bharadwaj and Yu 2004). The mutational analysis described here and   96characterization of the range of chromosomal instabilities resulting from the absence of the C. elegans FANCJ ortholog have provided insights into the roles of human FANCJ and the cancer progression in Fanconi anemia.    97Table 3.1 Single Nucleotide Polymorphism (SNP) primers No.  SNP location (Cosmid)  Primers 1  Y38C9B  Y38C9BL  CCGCACTTCCTTCAGAAATG     Y38C9BR  TGTAGGGCGAGTAACCAAGC 2  T01G6  T01G6L  TATTGCTATGGGGATTCCCG     T01G6R  ACCGCCGACTGAATTATCTG 3  H24K24  H24K24L  GATGGGTTTTCCGCCAAATAC     H24K24R  GCTTGGAAAAGGTTCGAAAAG 4  R09A1  R09A1L  CTCTGAAAGGAATTTGATCGG     R09A1R  TGCTGGAGCTCAATGTGTG 5  T21H3  T21H3L  TTCAGGCTTTCAAGGAGAGG     T21H3R  ACGGAACGAGAATGATGGC 6  F52F10  F52F10L  CTACCCATCGGAAATCCGTTAG     F52F10R  GCGTTTTTGTCATCAACGC 7  F36H9  F36H9L  CGGAAAATTGCGACTGTC     F36H9R  ATTAGGACTGCTTGGCTTCC 8  Y40B10A  Y40B10AL TCGTGATGGGAGCATAGCTG     Y40B10AR TTTCGCCAATGATCAGTTCG 9  F36F12  F36F12L  TCGTTGATGTTCGAGTGTCTTC     F36F12R  TTCACCAGCTTAACCTCCTCTC 10  R05D8  R05D8L  ATGGATTGCCATTGCATTTCC     R05D8R  AATTAGACACACTTCCATGTGG 11  C44C3  C44C3L  TGAACGACTTATCAGAGAGTGG     C44C3R  AATTCTCGGAGCAAAAGTGG 12  C50H11  C50H11L  TTTCGGAGCATCCGTAAGC     C50H11R  CGCTGTATTGTACTGGAGGTGC 13  F35F10  F35F10L  TTGCTGATAGGGACTGTTCC     F35F10R  CAAGCAAGTGAGAATCTCGG 14  C02A12  C02A12L  GCTTACAGTTCTGTGAGCTGTC     C02A12R  TTCTACTACCGTTTCACAATGG 15  H10D18  H10D18L  AATCGCTACTTCCGATAACTTC     H10D18R  ATTGATCCCATGATCTCGG 16  B0213  B0213L  AGCTTTTGCGAGCGATTCTC     B0213R  GTGGAGAAGCTCAGAAAAGAGC 17  T28F12  T28F12L  GGTGTAGAGAGCTCACTCAGC     T28F12R  TTGGATAGGCCTAGCAGAGC 18  C13D9  C13D9L  TTCGCAGTTCACTCTTGTGCTC     C13D9R  GGCCAAATTCTCCGTTTCAC 19  C52A10  C52A10L  TCTTGTGCCTTCCATCCAAG     C52A10R  ATGGTCTCAGTTTACCAGGAAG   98Table 3.2 Lethal mutant isolates from dog-1(gk10)/ dog-1(gk10) strains.      No. of F1?s tested Isolates  Mutation Frequency % (95% CI) On LGIII  19  0.56 (0.33-0.86) On LGV  9  0.27 (0.13-0.50) Duplication 2  0.06 (0.01-0.20) eT1 balancer screen  3385 Total 30 0.89 (0.60-1.23) Non-eT1 screen  1195  On LGV  2  0.17 (0.03-0.56)    99  100Table 3.3 Mapping and development blockage stages of lethal mutations on LGV    Lethals  Lethality Molecular nature h2137  Embryonic  unc-62 allele  (small deletion)  h2140  Larval  emb-29 allele (putative small deletion) h2141  Embryonic  Large deletion with V-X half translocation  h2144  Embryonic  Putative small deletion h2148  Embryonic Large deletion h2177  Embryonic  Putative small deletion h2179  Embryonic Large deletion h2186  Larval  Putative small deletion eT1 balancer screen n=3385 h2189  Embryonic Large deletion       h2172  Embryonic  Large deletion with IV-V half translocation Non-eT1 screen n=1195  h2173  Embryonic Large deletion  Table 3.4 SNP mapping of lethal mutations on LGV   SNP Site 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 h2137                             +++    h2140        + + + + + + + +     h2141 - - - + + + + + + + + + + +      h2144 + + + + + + + + + + + + + + + + + + + h2148 - - - - - - - + + + + - - - - - + + + h2172 - - - + + + + + + + + + + + + + + + + h2173 - - - - - - - - - - - - - - - - + + + h2177 + + + + + + + + + + + + + + + + + + + h2179 - - - - - + + + + + + + + + + + + + + h2186 + + + + + + + + + + + + + + + + + + + h2189 + + + + + + + + + + + + + - + + + + + SNP sites on LGV left were numbered from 1 to 19 according to the supplementary table 1; ?+? for any site means the presence of N2 DNA on this specific SNP site in the tested strain, while ?-? means the absence of N2 DNA on this site, which indicates a deletion.    101Table 3.5 Meiotic recombination frequency between Dpy-11 and the lethal mutations  Lethals  Expected genetic position  Observed genetic position (95% CI) h2137  -5.25  -6.23 (-4.65~-8.20) h2140  -18.19  -17.95 (-15.00~-21.16) h2141  -19.85  -6.56 (-4.54~-8.38) h2148  -7.43  0 h2172  -19.85  0 h2179  -19.84  -3.05 (-0.54~-10.10) h2189  -10.57  -9.12 (-6.00~-12.84)    102Figure 3.1 Physical map of eT1 balanced region on LGV (left). Lethal mutations isolated in this study were marked onto the mapped region. SNP sites were marked on the chromosome using number from 1 to 19, the corresponding physical location and PCR primers are listed in Table 3.1. Large deficiencies that delete at least one SNP site were shown below the chromosome. While solid lines indicate the presence of DNA, uncertain regions were shown as dot lines. The tranlocated arms of h2141 and h2172 revealed by CGH were shown in grey. (Putative) small deletions were marked on top of the chromosome based on their genetic mapping data except h2137, which has been cloned as an allele of unc-62.   103 104Figure 3.3 Small G/C tract deletions involved in h2137 and h2140. a) h2137 has a 1.1kb deletion that takes out the sixth exon of unc-62; b) h2140 has a 453bp deletion in the first intron of gene Y46H3D.4. Arrows indicate the position of G/C tracts.   105Figure 3.4 DAPI staining of diakinesis-stage chromosomes of unc-36(+) duplications. Six bivalents should be observed in the diakinesis-stage oocytes in the wild type worm germline; while more than six bivalents indicate the presence of extra-chromosomes or chromosome fragments. Arrows indicate the putative chromosome fragments with unc-36(+) duplications.   106CHAPTER 3 References  Bharadwaj, R. and Yu, H. 2004. The spindle checkpoint, aneuploidy, and cancer. Oncogene 23(11): 2016-2027. Brenner, S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1): 71-94. Bridge, W.L., Vandenberg, C.J., Franklin, R.J., and Hiom, K. 2005. The BRIP1 helicase functions independently of BRCA1 in the Fanconi anemia pathway for DNA crosslink repair. Nat Genet 37(9): 953-957. Cantor, S., Drapkin, R., Zhang, F., Lin, Y., Han, J., Pamidi, S., and Livingston, D.M. 2004. The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Proc Natl Acad Sci U S A 101(8): 2357-2362. Cantor, S.B., Bell, D.W., Ganesan, S., Kass, E.M., Drapkin, R., Grossman, S., Wahrer, D.C., Sgroi, D.C., Lane, W.S., Haber, D.A., and Livingston, D.M. 2001. BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell 105(1): 149-160. Cheung, I., Schertzer, M., Rose, A., and Lansdorp, P.M. 2002. Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich DNA. Nat Genet 31(4): 405-409. Collis, S.J., Barber, L.J., Ward, J.D., Martin, J.S., and Boulton, S.J. 2006. C. elegans FANCD2 responds to replication stress and functions in interstrand cross-link repair. DNA Repair (Amst) 5(11): 1398-1406. Dequen, F., St-Laurent, J.F., Gagnon, S.N., Carreau, M., and Desnoyers, S. 2005. The Caenorhabditis elegans FancD2 ortholog is required for survival following DNA damage. Comp Biochem Physiol B Biochem Mol Biol 141(4): 453-460. Gupta, R., Sharma, S., Sommers, J.A., Jin, Z., Cantor, S.B., and Brosh, R.M., Jr. 2005. Analysis of the DNA substrate specificity of the human BACH1 helicase associated with breast cancer. J Biol Chem 280(27): 25450-25460. Hassold, T. and Hunt, P. 2001. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet 2(4): 280-291. Howlett, N.G., Taniguchi, T., Olson, S., Cox, B., Waisfisz, Q., De Die-Smulders, C., Persky, N., Grompe, M., Joenje, H., Pals, G., Ikeda, H., Fox, E.A., and D'Andrea, A.D. 2002. Biallelic inactivation of BRCA2 in Fanconi anemia. Science 297(5581): 606-609. Johnsen, R.C. and Baillie, D.L. 1991. Genetic analysis of a major segment [LGV(left)] of the genome of Caenorhabditis elegans. Genetics 129(3): 735-752. Jones, M.R., Maydan, J.S., Flibotte, S., Moerman, D.G., and Baillie, D.L. 2007. Oligonucleotide Array Comparative Genomic Hybridization (oaCGH) based   107characterization of genetic deficiencies as an aid to gene mapping in Caenorhabditis elegans. BMC Genomics 8(1): 402. Levitus, M., Waisfisz, Q., Godthelp, B.C., de Vries, Y., Hussain, S., Wiegant, W.W., Elghalbzouri-Maghrani, E., Steltenpool, J., Rooimans, M.A., Pals, G., Arwert, F., Mathew, C.G., Zdzienicka, M.Z., Hiom, K., De Winter, J.P., and Joenje, H. 2005. The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. Nat Genet 37(9): 934-935. Levran, O., Attwooll, C., Henry, R.T., Milton, K.L., Neveling, K., Rio, P., Batish, S.D., Kalb, R., Velleuer, E., Barral, S., Ott, J., Petrini, J., Schindler, D., Hanenberg, H., and Auerbach, A.D. 2005. The BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia. Nat Genet 37(9): 931-933. Litman, R., Peng, M., Jin, Z., Zhang, F., Zhang, J., Powell, S., Andreassen, P.R., and Cantor, S.B. 2005. BACH1 is critical for homologous recombination and appears to be the Fanconi anemia gene product FANCJ. Cancer Cell 8(3): 255-265. Maydan, J.S., Flibotte, S., Edgley, M.L., Lau, J., Selzer, R.R., Richmond, T.A., Pofahl, N.J., Thomas, J.H., and Moerman, D.G. 2007. Efficient high-resolution deletion discovery in Caenorhabditis elegans by array comparative genomic hybridization. Genome Res 17(3): 337-347. Nelson, G.A., Schubert, W.W., Marshall, T.M., Benton, E.R., and Benton, E.V. 1989. Radiation effects in Caenorhabditis elegans, mutagenesis by high and low LET ionizing radiation. Mutat Res 212(2): 181-192. Patel, K.J. and Joenje, H. 2007. Fanconi anemia and DNA replication repair. DNA Repair (Amst) 6(7): 885-890. Rosenbluth, R.E., Cuddeford, C., and Baillie, D.L. 1983. Mutagenesis in Caenorhabditis elegans. I. A rapid eukaryotic mutagen test system using the reciprocal translocation, eT1(III,V). Mutat Res 110(1): 39-48. -. 1985. Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 r of gamma-radiation. Genetics 109(3): 493-511. Rosenbluth, R.E., Johnsen, R.C., and Baillie, D.L. 1990. Pairing for recombination in LGV of Caenorhabditis elegans: a model based on recombination in deficiency heterozygotes. Genetics 124(3): 615-625. Rosenbluth, R.E., Rogalski, T.M., Johnsen, R.C., Addison, L.M., and Baillie, D.L. 1988. Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V (left). Genet Res 52: 105-118. Seal, S., Thompson, D., Renwick, A., Elliott, A., Kelly, P., Barfoot, R., Chagtai, T., Jayatilake, H., Ahmed, M., Spanova, K., North, B., McGuffog, L., Evans, D.G., Eccles, D., Easton, D.F., Stratton, M.R., and Rahman, N. 2006. Truncating mutations   108  109in the Fanconi anemia J gene BRIP1 are low-penetrance breast cancer susceptibility alleles. Nat Genet 38(11): 1239-1241. Sen, D. and Gilbert, W. 1988. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 334(6180): 364-366. Taniguchi, T. and D'Andrea, A.D. 2006. Molecular pathogenesis of Fanconi anemia: recent progress. Blood 107(11): 4223-4233. Wicks, S.R., Yeh, R.T., Gish, W.R., Waterston, R.H., and Plasterk, R.H. 2001. Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat Genet 28(2): 160-164. Wormbase. [http://www.wormbase.org/]. Youds, J.L., Barber, L.J., Ward, J.D., Collis, S.J., O'Neil, N.J., Boulton, S.J., and Rose, A.M. 2007. DOG-1 is the Caenorhabditis elegans BRIP1/FANCJ homologue and functions in interstrand cross-link repair. Mol Cell Biol. Youds, J.L., O'Neil, N.J., and Rose, A.M. 2006. Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173(2): 697-708. Zhao, Y., Lai, K., Cheung, I., Youds, J., Tarailo, M., Tarailo, S., and Rose, A. 2006. A mutational analysis of Caenorhabditis elegans in space. Mutat Res 601(1-2): 19-29. Zhao, Y., O'Neil, N.J., and Rose, A.M. 2007. Poly-G/poly-C tracts in the genomes of Caenorhabditis. BMC Genomics 8(1): 403.   CHAPTER 41: Poly-G/poly-C tracts in the genomes of Caenorhabditis  4.1 Introduction Studies reported previously (Cheung et al. 2002; Youds et al. 2006) and results described in Chapter 3 have clearly shown that retention of the poly-G/poly-C DNA elements is dependent on enzymatic activity of DOG-1, a protein with similarity to the human FANCJ helicase. Disruption of DOG-1 results in a variety of genome instabilities detrimental to the organism. The probability of one stretch of 18 guanines occurring by chance in the 100Mb AT-rich C. elegans genome (GC content 36%) (CelegansSequencingConsortium 1998) is approximately 1/6 to the 18th power or 1 in 100 trillion. However, in the Caenorhabditis elegans genome there are approximately 400 such homopolymeric poly-G/poly-C tracts (G/C tracts). Thus, these tracts are greatly over-represented in the genome. Based on the observations that G/C tracts are over-represented in the C. elegans genome and protected by enzymatic activity, it seems unlikely that the occurrence and maintenance of G/C tracts are by chance. Non-protein encoding DNA such as guanine-rich DNA performs a variety of important biological functions (reviewed by Bird et al. 2006) that are poorly understood. These G-rich DNA elements all have stretches of consecutive guanines and have the capacity to form secondary structures, which have been proposed to have multiple biological functions in vivo (Maizels 2006). The aim of the analyses described in this chapter was to characterize the frequency and distribution of G/C tracts in C. elegans genome and explore possible biological roles.  1 A version of this chapter has been published. Zhao, Y., O'Neil, N.J. and Rose, A.M. (2007) Poly-G/poly-C tracts in the genomes of Caenorhabditis. BMC Genomics, 8, 403   1104.2 Materials and methods 4.2.1 Data collection and computational analysis G/C tracts data including the length, orientation, and position as well as the other related genomic information in the C. elegans and C. briggsae genome, were obtained from the online database Wormbase (C. elegans release WS165, C. briggsae release CB25) (Wormbase). SAGE data were obtained from the Genome BC C. elegans Gene Expression Consortium (McKay et al. 2003).   4.2.2 Nematode strains The strains used include: N2 Bristol strain (wild-type), CB4856 Hawaiian strain (wild-type), VC13 dog-1 (gk10), and AF16 C. briggsae strain. Strains denoted with the h prefix arose in the A.M. Rose laboratory. All strains were maintained as previously described (Brenner 1974).  Strain KR4125 was originally isolated from a dog-1 mutant strain and was found to carry 3 homozygous G/C tract deletions. The extension of the deletions was established by PCR using following primers: 5?-ttttggtgggtatttgaggct-3? and 5?-aaggactactgacggctatg-3?for G/C tract in T28F12; 5?- tgggaagaaatctccatca-3?and 5?- aattccagctaactgcaaaa-3? for G/C tract in B0238; 5?- ttaagtccgcctcctctgtcc-3?and 5?- cttcatttcaagcctttcaaccg-3?for G/C tract in ZC404. The strain has been out-crossed to wild-type N2 worms for several times after dog-1 mutation was removed.      1114.2.3 CBG19723 cloning and microinjection The full-length genomic DNA with the 194bp promoter region of CBG19723, which is the C. briggsae ortholog of dog-1, was amplified using Phusion High-Fidelity Polymerase (Finnzymes) using primers 5?-atactcgagcgaaaattccagaaaatttggc-3? and 5?-ataactagtcatgcgtcctcctgctccttctt-3?. The PCR fragment was cut and then ligated into the Xho1 and Spe1 sites of pBluescriptII/KS(+) vector. This plasmid, pYZ1 (12ng/ul) and the pRF4 rol-6(su1006) (60ng/ul) marker plasmid were microinjected into the germ lines of N2 adults to generate the transgenic array hEx264. dog-1(gk10)/dog-1(gk10); hEx264 strain was then made by crossing the hEx264 to dog-1(gk10) male animals. Successful transgenic dog-1(gk10) animals were tested for rescue of dog-1 mutant phenotype using the deletion frequency of the G/C tract in gene vab-1 (YOUDS et al. 2006).  A full-length CBG19723 cDNA was isolated by the Invitrogen SuperScript II Reverse Transcriptase from total RNA from mixed-stage C. briggsae cultures. The RT-PCR product was inserted into the pGEM-T vector (Promega) and then verified by sequencing (Nucleic Acid and Protein Services, NAPS, UBC).    4.2.4 Measurement of G/C tract deletion frequency L4 stage animals of the genotype of interest were picked to fresh OP50 plates 24hr before DNA preparation. DNA of individual worms was prepared with lysis buffer (10mm Tris-HCl, 50mm KCl, 2.5mm MgCl2, 0.45%NP40, 0.45% Tween20, 0.01% gelatin, 100mg/ml ProteinaseK) and incubated at -70?C for 10 min, at 60?C for 1 hr, and then at 95?C for 15 min.  G/C tract deletion within the vab-1 gene on chromosome II were detected by PCR as previously described (YOUDS et al. 2006):  The G/C tract and flanking DNA were amplified   112in each animal by PCR using a set of nested primers. External primer sequences were 5?-cgattccaacaattggtaaatacc-3? and 5?- aatatttgctaaacctattgttgcc-3?.The external PCR program was 94?C for 4 min followed by 34 cycles of 94?C for 30 sec, 58?C for 30 sec, and 72?C for 1 min 30 sec, and a final elongation step of 72?C for 10 min. One microliter of DNA from the external reaction was used as the template for a second internal PCR. Internal primer sequences were 5?- cgacgaaaaatgcagaatttggc-3? and 5?-aggtgtgtgtgcatacctccg-3?. The internal PCR program was the same as the external program, except primers were annealed at 62?C and the extension time was 1 min. PCR products were run on 1% agarose gels and stained with SYBR Green (Molecular Probes) for nucleic acid visualization. Gels were imaged using a Gel Doc 2000 (Bio-Rad, Hercules, CA).  Other G/C tract amplification and deletion tests in this report used similar protocol but nested primers were not used.   4.2.5 Verification of G/C tracts in Hawaiian strain  Six randomly selected G/C tract sites (one on each chromosome) of Hawaiian strain CB4856 were analyzed by DNA sequencing on the PCR products amplified using primers flanking the G/C tracts: K09H9 (LGI, primers: 5?-ctcgaacggaaatgtcaatatgg-3? and 5?-ctgcgttactttgactatcagag-3?), M03A1 (LGII, primers: 5?-cgacgaaaaatgcagaatttggc-3? and 5?-aggtgtgtgtgcatacctccg-3?), R144 (LGIII, primers: 5?-catatggattggcatgtgaagca-3? and 5?-tcaactttgacagcatttatccga-3?), F07C6 (LGIV, primers: 5?-cacgcttatcatttcaaatgtac-3? and 5?-cgagcacaagtggcacatcgg-3?), T22H9 (LGV, primers: 5?-cccaacaactcgtatgccatc-3? and 5?-cgcgggaatatctaaattgtcta -3?), and Y9C12A (LGX, primers: 5?-cttgaagagaattccgaatgaaac-3?   113and 5?-ctcattgccaaactcctccac-3?). DNA preparation and PCR protocol were same as described above.   4.2.6 RNA interference on C. briggsae Single colonies of Escherichia coli (HT115) containing the C.elegans F33H2.1 (dog-1) RNA interference (RNAi) constructs were grown at 37?C overnight in LB medium with 50 mg/ml ampicillin and 12.5 mg/ml tetracycline. Sixty microliters of the culture was spotted on to NGM plates containing 50 mg/ml ampicillin, 12.5 mg/ml tetracycline, and 0.5 mM IPTG and allowed to grow overnight (~16 hours). The next day, L4 stage C.briggsae animals were placed on the RNAi plates. For the genomic instability assay, L4 worms of F2 or F3 RNAi treated C. briggsae animals were individually setup on fresh RNAi plates for 12h. Then they were transferred to new plates and the number of eggs (F1) laid were counted. The next day the F1 animals were scored for the presence of unhatched eggs and on the forth day the total number of living adult F1s was noted to confirm the embryonic lethality ratio of the line. Occurrence of males was also noted for each line. For the G/C tract deletion tests, F2 progeny from the RNAi plates were picked to fresh plates at the L4 stage and were lysed 24 hr later for G/C tract PCR. C .briggsae G/C tracts tested included: cb25.fpc0071 (primers: 5?-gattggctgtcacctggatt-3? and 5?-tatctcggttcctgtcaaagata-3?); cb25.fpc4033 (primers: 5?-gatagacttggcatcttttggc-3? and 5?-aagttttggagaagtggcaga-3?); cb25.fpc0829 (primers: 5?-ctattcggctggctacattg-3? and 5?-tttgaggtacagggacagttatg-3?); cb25.fpc0066 (primers: 5?-aaacttgctcagtgtttggtga-3? and 5?-  114gagatgaaaagaggattgggtg-3?); and cb25.fpc0011 (primers: 5?-aaactgatgaagccgaggtg-3? and 5?-caaggtctacgaggtctacgatg-3?).  4.2.7 Measuring meiotic recombination The frequency of meiotic recombination was measured in the interval between dpy-11 and unc-x on LGV. Individual animals of genotype dpy-11 unc-x/+ + and dpy-11 unc-x/Dfx were plated and transferred daily for four days. In each of the broods, the number of wild-types, Dpy-Unc, Dpys and Uncs were scored. Recombination frequency (p) was calculated using the equation: p=1-(1-2(R/T))2 Where: R=numbers of recombinants=2(largest recombinant class) T=total progeny=4/3(number of wild-types + 1 recombinant class) The map distance was calculated as px100. Confidence intervals for each recombination frequency were calculated using the statistics of Crow and Gardner (1959).  4.2.8 Construction of promoter::gfp and microinjection  DNA from the promoter up to the third intron of pha-4 gene (5kb) was amplified by PCR using the primer 5?-caacgagagggcatgctgtgaac-3? and 5?-cgggatcctgatatggttggtagtttaacg-3? and inserted in to the pPD95.67 gfp vector (made available by Andrew Fire lab) using SphI and BamHI sites to form the pYZ2 ( pha-4pE3::gfp). To obtain the G/C tract depleted sequence, primers 5?-caacgagagggcatgctgtgaac-3? and 5?- ttcctcgtcgacgtcggataaata-3? were used to amplify the sequence before the G/C tract in the second intron and the sequence after was amplified by primer 5?-ccaccgtcgacaaacacacacacaacc-3? and 5?-  115cgggatcctgatatggttggtagtttaacg-3?. The two DNA segments were ligated using the SalI site engineered in the primers and then inserted in to pPD95.67 using the same method described above to form pYZ3 (pha-4pE3-G::gfp).  These two plasmids (12ng/ul) were microinjected into the germ lines of N2 adults to form the transgenic strains. GFP expression was then studied on successful transgenic animals using the Zeiss Axioscope fluorescent microscope.  1164.3 Results 4.3.1 G/C tracts are over-represented in the C. elegans genome Although statistically no G/C tracts containing 18 or more consecutive Gs are expected in the 100Mbp C. elegans genome, 396 G/C tracts were found. They are over-represented in the C. elegans genome, especially compared to the human (200 in 3.3Bbp) and yeast (1 in 12Mbp) genomes. These G/C tracts range in size from 18 to 32 base pairs and the frequency decreases with increased length (Figure 4.1). The tracts are distributed throughout the genome along all six chromosomes.  The five autosomes have approximately 50 to 70 tracts each, while the X chromosome has more than 100 tracts. The density of G/C tracts on LGX is 6.1 per Mbps compared to 2.7 per Mbps of LGV (longest chromosome in C. elegans) (Table 4.1).  4.3.2 G/C tracts are conserved in C. elegans Hawaiian (CB4856) isolate Given that G/C tracts are unstable in the C. elegans dog-1 mutant, I investigated whether or not G/C tracts were conserved in other wild type isolates of C. elegans and if they are inherently unstable. Recent studies using array comparative genomic hybridization (aCGH) demonstrated that there is approximately 2% gene content variance between the Hawaiian (CB4856) and Bristol (N2) isolates, and that these differences are primarily deletions in the CB4856 Hawaiian strain (Maydan et al. 2007). Furthermore there are a large number of single nucleotide polymorphisms (SNPs) between the two intraspecific isolates, 10,711 for 7.3% covered sequence (Swan et al. 2002). The conservation of G/C tracts in the CB4856 Hawaiian strain was assayed by PCR and sequencing. One randomly chosen G/C tract on each chromosome was analyzed and the sequencing results showed that the presence, length   117and orientation of G/C tracts were conserved in the Hawaiian strain. This result demonstrated the preservation of the tested G/C tracts in these two wild type isolates of C. elegans.   4.3.3 G/C tracts are also over-represented in Caenorhabditis briggsae To determine if the location and orientation of G/C tracts are also conserved in closely related nematode species, I investigated the G/C tract conservation in C. briggsae, a closely related species of C. elegans. In total, 216 G/C tracts in size from 18 to 25 base pairs were found in the C. briggsae genome based on the sequence release cb25.agp8 (Wormbase; Stein et al. 2003), of which 46 G/C tracts are intragenic and 170 G/C tracts are intergenic. Although there are fewer G/C tracts in the C. briggsae sequenced genome compared to the C. elegans genome, the tracts are still over-represented as the C. briggsae genome is similar to that of C. elegans in size and GC content (Stein et al. 2003).    However, the positions of G/C tracts are not well conserved between two species. The assay on the conservation of the G/C tracts was performed using the following procedure: 1) identify the gene (for intragenic G/C tracts) or the nearest gene to a G/C tract (for intergenic G/C tracts) in C. briggsae genome; 2) identify the corresponding C. elegans ortholog; 3) screen for G/C tracts in the gene or surrounding sequence. Three intragenic G/C tracts are located within the same genes in two species: a 19bp tract in C. elegans gene vab-10 and an 18bp tract in its C. briggsae ortholog CBG15813; a 23bp tract in hmr-1 and an 18bp tract in CBG07964; and a 22bp tract in H10D18.5 with its counterpart a 20bp tract in CBG01202. However, only the tracts in vab-10 and CBG15813 could be considered conserved when the facts such as tract orientation and position specificity were taken into account (Table 4.2). For intergenic G/C tracts, 14 G/C tracts were found to be located in similar locations in C.   118elegans and C. briggsae.  However, using a strict criterion (presence, orientation, and position), only 4 G/C tracts could be classified as conserved (Table 4.2).   4.3.4 Disrupting the function of the C. briggsae dog-1 ortholog, CBG19723, causes genome instability The fact that the C. briggsae genome also possesses abundant G/C tracts proposed a question: whether these G/C tracts are also protected by a C. briggsae DOG-1 ortholog in a manner similar to C. elegans? Based on the results of amino acid reciprocal best Blast hits, there is a predicted ortholog of dog-1 in C. briggsae named CBG19723. RT-PCR showed that it was transcribed, producing a mRNA of 2892 base pairs. Sequencing of the C. briggsae dog-1 cDNA demonstrated that there was an additional exon that was not included in the predicted C. briggsae gene model (Wormbase cb25.agp8 (Wormbase; Stein et al. 2003)) (Figure 4.2). The corrected gene model showed 71% amino acid identity and 87% protein similarity with the C. elegans ortholog.  Since there were no mutant alleles available, to test if disruption of CBG19723 would cause a similar phenotype as that seen in dog-1 (Cheung et al. 2002; Youds et al. 2006), RNAi targeting C. elegans dog-1 was used to knock down function of CBG19723 in C. briggsae. Five randomly chosen G/C tract sites in C. briggsae were examined for deletion in RNAi treated animals, but no small G/C deletions were observed (25 worms each site). However, C. briggsae dog-1(RNAi) worms exhibited other phenotypes indicative of genome instability, such as elevated embryonic lethality (2.77%, 95% CI 1.88~3.86%) and an increased incidence of males (0.83%, 95% CI 0.41~1.55%), similar to that reported for dog-1 mutants (Youds et al. 2006). C. briggsae animals with visible phenotypes such as   119Uncoordinated and PVL (Protruding VuLva) were also observed on the RNAi plates. The results indicated that CBG19723 in C. briggsae might have similar functions in DNA repair pathways as its ortholog in C. elegans (Youds et al. 2006).  4.3.5 CBG19723 rescued the G/C tract deletion phenotype of the dog-1 mutant in C. elegans   Since there were no mutant alleles of CBG19723 available, to test whether the C. briggsae DOG-1 ortholog had a clear role in maintaining G/C tracts, the full length CBG19723 gene with its promoter region was introduced into the dog-1(gk10) knockout mutant to determine if the C. briggsae DOG-1 ortholog could rescue the G/C tract deletion phenotype in C. elegans. Deletions of the vab-1 G/C tract were observed in 12/101 (11.9% 95% CI: 6.62-20.1%) dog-1(gk10) animals. Deletions of the vab-1 G/C tract were observed in only 2/136 (1.47% 95% CI: 0.26-4.92%) dog-1(gk10); hEx264 transgenic animals, significantly fewer than non-transgenic animals (t-test, P<0.001). This result clearly demonstrates that the C. briggsae dog-1 ortholog CBG19723 can protect the integrity of G/C tracts in C. elegans, rescuing the G/C tract deletion phenotype of the dog-1 mutant. Therefore, CBG19723 has the potential to protect the 216 G/C tracts in C. briggsae just as DOG-1 does in C. elegans. Although the positions of most G/C tracts are not conserved, the G/C tracts are protected by the C. briggsae DOG-1 ortholog.       1204.3.6 G/C tracts are distributed non-randomly on C. elegans chromosomes Although the GC content in the C. elegans genome is similar on all the chromosomes (CelegansSequencingConsortium 1998), the G/C tracts are not distributed uniformly across the chromosomes. C. elegans autosomes can be divided into three genetically defined compartments of the left arm (L), the central gene cluster region (C), and the right arm (R) (Barnes et al. 1995). More G/C tracts are located in the chromosome arms than in the central regions (Table 4.1, Figure 4.3 and 4.4). While this pattern is fairly subtle on LGIII, it is more obvious on the other chromosomes especially on LGV where only 9% of G/C tracts are located in the central region while 91% reside on the arms of LGV (Table 4.1, Figure 4.3 and 4.4). This non-random distribution of G/C tracts on the autosomes correlates with both the meiotic cross-over distribution (Barnes et al. 1995) and negatively with gene density (CelegansSequencingConsortium 1998; Stein et al. 2003; Prachumwat et al. 2004). An enrichment of G/C tracts on the chromosome arms of the X chromosome was observed even though the X chromosome does not have a central gene cluster or a similar meiotic cross-over pattern to the autosomes. The distributions of the intragenic and intergenic G/C tracts do not differ from the overall distribution pattern with more and longer G/C tracts on the arms. Nor is there any distinct pattern with regard to the orientation of G/C tracts on either DNA strand.   4.3.7 G/C tracts are distributed uniformly in C. briggsae genome  In order to graphically demonstrate the distribution of G/C tracts in the genome, a ?Marey Map? (Chakravarti 1991) approach was used . As shown in Figure 4.4, abundant G/C tracts in a given region result in a steeper slope than areas that lack of G/C tracts. When the   121distribution of G/C tracts in C. elegans was represented in this way, the plots resulted in ?S? curves, subtle on LGIII but more obvious on the other chromosomes (Figure 4.4), indicating the abundance of G/C tracts on chromosome arms compared to the clusters. The curves on the map were similar to those on the genetic/physical Marey map reported by Barnes et al. (Barnes et al. 1995), which reflected the increased meiotic cross-over in the arm regions compared to the cross-over in the central gene clusters. Based on the knowledge that the two genomes exhibit extensive colinearity (Kent and Zahler 2000; Stein et al. 2003; Hillier et al. 2007), the genomic positions of the C. elegans orthologs of genes associated with G/C tracts in C. briggsae were used to create a predicted genomic distribution map of G/C tracts in C. briggsae. In the C. briggsae plots (Figure 4.4), G/C tracts are also dispersed across every chromosome in the C. briggsae genome. Because there are fewer G/C tracts on each chromosome, the curves plot beneath the C. elegans counterparts. The slope of the C. briggsae line illustrates that the G/C tracts are distributed evenly across the chromosomes. Both the analysis presented here (Figure 4.4) and a more recent analysis based on the chromosome-based assembly of C. briggsae genome (Wormbase CB3 (Wormbase; Hillier et al. 2007)) result in a similar pattern (Figure 4.5). Thus, although there is no specific patterning to the position or the orientation of the tracts, the number and dispersed location of them in these two species is suggestive of a biological role.   4.3.8 Meiotic recombination tests in the G/C tracts depleted strain Given the capacity of G-rich secondary DNA structures to interact with each other through non Watson-Crick base pairing, the distributed G/C tracts in C. elegans could possibly be involved in the chromosome pairing process. The distribution pattern on the   122autosomes correlates with the meiotic cross-over distribution (Barnes et al. 1995), but more G/C tracts in C. elegans were found to be located on the arms of the X chromosome even though the X chromosome does not have a meiotically defined central gene cluster. This observation and the uniform distribution of G/C tracts in C. briggsae, along with the recent report showing C. briggsae has a similar meiotic pattern as C. elegans (Hillier et al. 2007), suggests that abundant G/C tracts on the chromosome arms are not likely to facilitate meiotic recombination or to be cross-over hotspots per se. However, disruption of chromosome pairing and other processes of early meiotic stage could result in alteration of the processes downstream such as cross-over (Zetka et al. 1999; Phillips et al. 2005). It was thus questioned whether deletions of G/C tracts in C. elegans, presumably affecting chromosome pairing, could cause meiotic recombination changes that are easier to detect.  Strain KR4125 was originally isolated from a dog-1 mutant and was found to contain 3 homozygous G/C tract deletions. The deletions of G/C tracts are located in the regions defined by cosmid T28F12, B0238, and ZC404 on LGV, and the deletion lengths are 98bps, 223bps, and 169bps respectively (Figure 4.6). All deletions cover the G/C tracts but none of them affects coding areas. The strain is morphologically wild-type and has an average brood size of 271. dpy-11 unc-x double mutants on LGV were used to test if these deletions affect the recombination frequency in intervals along the whole chromosome. F2 progeny of dpy-11 unc-x/Dfx (KR4125) heterozygous F1s were scored and recombination frequencies between the two markers were calculated. Control experiments were done by crossing the doubles to N2 males. Results are listed in Table 4.3. From the results, it appears that there was no   123significant difference between the experiment and control. Deletion of these three G/C tracts did not significantly affect the recombination frequency between these markers. There is only one G/C tract (ZC404) in the region between dpy-11 and unc-68 (0.48m.u. apart), and the G/C tract in ZC404 is deleted in KR4125. It is thus informative to test if deletion of this specific G tract interrupts the recombination between dpy-11 and unc-68. dpy-11 unc-68 double mutant was crossed to KR4125 males, F2 progeny of wild-type F1s were then scored. Recombination frequency was calculated based on the number of observed recombinant Dpy non-Unc mutants, as the phenotype of unc-68 is pretty weak. While the wild-type control results in the test agreed with reported map distance between these two markers (0.48m.u.), a slight but not significant reduced recombination frequency was observed in the G/C tract deletion strain (Table 4.4). Deletion of the only G/C tract did not eliminate cross-over between the two markers, which is consistent with the hypothesis that G/C tracts are not cross-over hot spots.   4.3.9 G/C tracts mostly occur between genes or in introns  Although 27% of C. elegans genome is predicted to encode exons (CelegansSequencingConsortium 1998), only 4 out of 396 G/C tracts (1%) were in gene exons (Y48G1BM.7, F49B2.3, Y105E8A.26, and F43b10.1). Consecutive guanines or cytosines would encode strings of glycines or prolines, an unlikely sequence combination. The four genes containing G/C tract sequences are located near the ends of the chromosome arms. The predicted gene products are not currently assigned to any KOG (Conserved Orthologous Groups) category (Tatusov et al. 2003; Koonin et al. 2004) and there is no EST or SAGE data that confirms that these predicted genes are expressed, which would support   124these gene predictions. It is possible that these genes were predicted incorrectly and that the G/C tracts are not in coding regions. For the remaining 392 G/C tracts, 127 of them were found to be in non-coding regions of genes (6 in UTRs and 121 in introns), and the other 265 G/C tracts are located between genes. The average distance from an intergenic G/C tract to the nearest gene is 1.9kb. Although some of the 265 intergenic G/C tracts are located as far as nearly 10kb from the nearest gene, most intergenic G/C tracts are found to be close to genes. Most intergenic G/C tracts (197 out of 265, 74%) are found to be within 3kb of the nearest gene and almost one third of intergenic G/C tracts (85 out of 265, 32%) are within 500bp of the nearest gene. Thirteen G/C tracts were found to reside between two genes that are closer than 1kb. Interestingly, although it is known that the gene density in the central gene cluster regions on autosomes is higher than autosome arms (Barnes et al. 1995; CelegansSequencingConsortium 1998), the average distance of the intergenic G/C tracts from a gene in autosome central gene cluster regions is actually slightly larger than that on the arms (1.96kb vs. 1.83kb). The genes containing tracts vary in length, from less than 500bp to more than 50kb, with an average length of 10.6kb, much longer than the average gene size for the whole genome (2.5kb) (CelegansSequencingConsortium 1998). This was true for all chromosomal regions: autosome central, 10.0kb; autosome arm, 11.2kb; and X chromosome, 9.0kb. The location of the tracts within introns was unbiased, but not the orientation. Almost twice as many intragenic G tracts are located on non-coding strands as on coding strands (84 vs. 47). This preference might be due to catastrophic problems caused by higher structures formed by G/C tracts during the transcription on the non-coding strand. The number of intragenic G/C tracts on each chromosome is very similar. Thus, the high number of G/C tracts on the X   125chromosome is largely due to a greater number of tracts between genes on that chromosome (Table 4.5).   4.3.10 Most intragenic G/C tracts containing genes are poorly characterized Eddy and colleagues previously reported that G-rich DNA motifs with potential to form G4 DNA are highly represented in proto-oncogenes in human genome (Eddy and Maizels 2006). This result prompted us to investigate whether or not the G/C tract bearing genes in C. elegans are functionally related. Sixty-nine percent of the genes containing G/C tracts could be assigned to a KOG classification (Table 4.6). The most abundant category ?poorly characterized genes? (31 genes) combined with the number of unassigned genes (41 genes) account for more than half of the total G/C tract bearing genes, indicating that many G/C tract bearing genes are not well understood. ?Signal transduction mechanisms? and ?Transcription? are the two most abundant categories with specified functions, and contain 23 and 11 genes respectively. However, they are not statistically over-represented based on the C. elegans whole genome KOG classification (Koonin et al. 2004) (Chi-Square test, P>0.05). Overall, there is no evidence that the G/C tract bearing genes are functionally related.  4.3.11 G/C tracts are associated with the levels of regional gene expression Both introns and the flanking regions of genes are known to affect gene expression. It was thus suspected that the abundant G/C tracts in these areas are associated with the transcriptional regulation of corresponding genes. C. elegans  SAGE (Serial Analysis of Gene Expression) data (McKay et al. 2003) were used to investigate the relationship between   126the position of the G/C tract and the level of transcription. SAGE data for genes containing intragenic G/C tracts and for various distances away from a G/C tract was assembled and collated (Table 4.7). Only the specific tags assigned to genes were used. A ?specific? tag is defined as a tag that uniquely matches to a single gene or that can be resolved to a single gene by taking the lowest position match (McKay et al. 2003). Genes with a G/C tract within an intron (intragenic tracts) had on average 2.05 SAGE tags (2.21 tags if on the non-coding strand and 1.77 tags if on the coding strand). Similarly, genes within 500bp of a G/C tract had 1.92 tags. Genes 500-1500bp away from a G/C tract had on average 1.19 tags and those 1.5-3 kb had 1.50 tags. Genes further away, 3-5 kb, exhibited higher levels of gene expression. The average of 4.48 tags per gene differed significantly from the averages for genes closer to tracts (P value of t-test to intra G/C genes: 0.039; to genes within 500bp: 0.053; to genes in 500bp-1.5kb: 0.008; to genes in 1.5-3kb: 0.017). For genes 5kb away from G/C tracts the average SAGE tag number is 3.00. Thus, genes located distantly from G/C tracts have higher levels of transcription than genes close to G/C tracts, which may reflect a relationship to chromatin domains. While genes on the autosome arms in C. elegans tend to be poorly expressed (CelegansSequencingConsortium 1998), average number of SAGE tags of genes associated with G/C tracts located on autosome arms does not significantly differ from that of those in the central gene clusters (2.97 vs 2.49 respectively, t-test P>0.5). There is no significant difference in SAGE tag number whether the G tract is on the coding strand or not, and whether the G/C tract is upstream (5? end) or downstream (3? end). Spearman correlation coefficient analysis revealed correlation between the SAGE tag numbers and gene distance from a G/C tract for genes that are no more than 3kb away from a G/C tract (P<0.005). This correlation was not observed on genes further away.   127 4.3.12 Influence of G/C tract deletion on single gene expression G/C tracts are correlated with regional gene expression based on SAGE data: genes that are closer to G/C tracts have fewer SAGE tags than those farther away. This effect is similar to the suppression of human c-myc gene by its G-rich promoter (Siddiqui-Jain et al. 2002). However, there was no direct evidence showing G/C tracts are regulating individual genes in C. elegans.  There is a G/C tract with 29 consecutive Gs in the second intron of pha-4, a gene necessary for the development of pharynx and rectum. Mango?s group found that a rearrangement in the second intron can suppress the pha-4 function (Updike and Mango 2004). To test if deletion of this G/C tract would affect expression of pha-4, a transgenic GFP reporter was used. A control construct with the DNA sequence including the pha-4 promoter (1.5kb) and sequences up to the third exon (including the first two introns) fused to GFP (pYZ2, pha-4pE3::gfp) was made. The 29bp G/C tract in this construct was subsequently deleted using the PCR-stitching method and a construct without the G tract was named pYZ3 (pha-4pE3-G::gfp). Each construct was injected into N2 worms, and GFP expression patterns were examined. Worms with the pha-4pE3::gfp construct expressed GFP mainly in pharynx, intestine, and neurons in the tail (Figure 4.7). The average expression level was higher in larvae than in adults although it varied among individual animals. The removal of G/C tract in the 2nd intron sequence from the pha-4pE3::gfp construct did not cause significant changes in expression pattern. Transgenic worms with pha-4pE3-G::gfp also showed GFP signal in   128pharynx, intestine, and the tail neurons (Figure 4.7). In conclusion, there was no significant alteration in the expression pattern in the G/C-devoid transgenic strain.   1294.4 Discussion 4.4.1 Do G/C tracts in the Caenorhabditis genomes contribute to fitness, or are they just remnants of biased mutagenesis?  Both the C. elegans and C. briggsae genomes contain many more G/C tracts than expected as not even one tract greater than 18bps is expected to be found by chance in a genome of 100Mb of DNA. Meanwhile, the fact that the positions of G/C tracts in these two genomes are not well conserved indicated that new G/C tracts appeared and were maintained after they evolutionally separated from their common ancestor. Many repetitive sequences in C. elegans are believed to be associated with transposition  in some way (Smit 1996; Duret et al. 2000), however, there is no evidence that G/C tracts occurred this way. In general, G/C tracts could be maintained in the genomes in two different ways: they were selected because they contribute to the fitness for the animal or they passively accumulated due to the nonrandom mutagenesis.  The observation that most G/C tracts are located in regions under lower selective pressure favors the model that these G/C tracts accumulated by biased mutagenesis. Except for four G/C tracts, most are located in intergenic or intronic areas. Compared to the protein encoding exons, these regions are under less selective pressure and mutations in these areas would be more tolerated. This hypothesis is supported by the fact that G/C tracts are located in regions with less protein encoding DNA: G/C tract bearing genes are much longer than average and more G/C tracts are located on the gene-poor chromosomal arms. Even for those tracts in the central cluster regions, the average distance between a G/C tract and an adjacent gene is not significantly different than the distance from G/C tracts to genes on the arms. It has also been shown by the ontology study that most of the G/C tracts bearing genes are poorly   130characterized. These genes are more likely to be non-essential and thus under reduced selective pressure. However, numerous non-random and biased mutational events would be required to produce such kind of tracts. Once the tract was formed, it could be protected by the DNA repair component DOG-1. In this model, the distribution pattern of the G/C tracts in C. elegans genome reflects the events of mutagenesis being preserved in sites not under selective pressure. However, this hypothesis does not explain why C. briggsae possesses numerous G/C tracts in non-conserved positions. If G/C tracts were simply maintained once produced, one would expect to see a large number of G/C tract conserved between the nematodes, Caenorhabditis elegans and Caenorhabditis briggsae. This is not the case as there are few G/C tracts conserved between the two species. In this way, every G/C tract in both C. elegans and C. briggsae genome must have been produced after their divergence, and their common ancestor must have had few if any G/C tracts. It seems more likely that individual G/C tracts might appear and be lost but that the presence of G/C tracts distributed across the genome in some way contributes to evolutionary fitness. The idea that the G/C tracts in C. elegans are performing a biological role is supported by the fact that they are actively protected by a protein DOG-1. The G/C tracts are prone to deletion when DOG-1 function is absent (Cheung et al. 2002; Youds et al. 2006). Even in Wild Type a low level of spontaneous deletion might be expected, thus all the G/C tracts would have disappeared if they were not actively maintained in the genome. Functional analysis also showed that the C. briggsae DOG-1 ortholog can also function to protect G/C tracts from deletion. It seems unlikely that nematodes would maintain G/C tracts, which appear to produce some detrimental effects on genome stability, if they were simply the products of mutagenesis and had no biological role. Based on the bioinformatic and   131functional analyses stated previously in this chapter, it is reasonable to propose that these G/C tracts contribute in some way to the structural organization and function of the chromosomes   4.4.2 Does C. briggsae have a different genomic configuration from C. elegans?  Based on the genomic distribution map of G/C tracts in C. briggsae, the C. briggsae G/C tracts showed a uniform distribution pattern (Figure 4.4 and 4.5). The map indicated that the G/C tracts in C. briggsae are evenly distributed along all the six chromosomes, suggesting that C. briggsae might have a different genomic configuration. For example, if the G/C tracts are like other repetitive sequences, packed in the gene lacking chromosome arms in C. elegans because the low selective pressure, then the uniform distribution of G/C tracts in C. briggsae would suggest the absence of center-arm bias in its genome. On the other hand, the distribution pattern of the G/C tracts is apparently important if the G/C tracts are playing biological roles. Different distribution could suggest different chromosome pairing mechanisms and/or chromatin configuration. However, this hypothesis can not be validated without more detailed genetic information about C. briggsae is available.    4.4.3 The X chromosome    Initially it would appear that the X chromosome in C. elegans is significantly different than the autosomes with regard to G/C tracts distribution. The X chromosome contains almost twice as many G/C tracts as the autosomes whereas both inverted and tandem repetitive sequences are more frequent on the autosomes than on the X chromosome (CelegansSequencingConsortium 1998). For example, CeRep11, with 711 copies distributed   132over the autosomes, has only one copy located on the X chromosome (CelegansSequencingConsortium 1998). Although the X chromosome has many more G/C tracts than the autosomes, it has approximately the same number of intragenic G/C tracts (24/109) compared to the autosomes (Avg. 21.4 each), which means the large number of G/C tracts on the X are due to a larger number of intergenic G/C tracts (85 vs. 36 of autosomes) (Table 4.5). Furthermore, the overall gene density of the X chromosome is lower than that of the autosomes (CelegansSequencingConsortium 1998). Taken together with regard to the distribution of G/C tracts on X chromosome, it would appear that the X chromosome is organized like an autosomal arm.   4.4.4 G/C tracts and chromosome pairing The capability of G-rich secondary DNA structures to interact with each other using non Watson-Crick base pairing makes them an excellent candidate to coordinate chromosome dynamics such as pairing during meiosis. Sen and Gilbert originally proposed that G4 DNA might facilitate the pairing of homologous chromosomes without the need for testing homology at the sequence level (Sen and Gilbert 1988). There are several lines of evidence suggesting that the G/C tracts in C. elegans might have a role in meiotic chromosome pairing. Many pairing or recombination related components can interact with G-rich DNA secondary structures (Liu et al. 1995; Sun et al. 1999; Muniyappa et al. 2000; Anuradha and Muniyappa 2004; Anuradha et al. 2005; Ghosal and Muniyappa 2005). For example, the mismatch repair protein MutS?  binds G4 DNA and promotes synapsis and recombination in the mammalian immunoglobulin switch regions (Larson et al. 2005) and in yeast, the meiotic synapsis protein Hop1 can promote the formation of G4 DNA and the synapsis of double-stranded   133DNA helices through the generation of G4 DNA (Muniyappa et al. 2000; Anuradha and Muniyappa 2004; Anuradha et al. 2005). The distribution of G/C tracts across the chromosomes in the two species is compatible with a role for the tracts in chromosome alignment for pairing.   In many organisms, homolog pairing is achieved by double-stranded DNA breaks and Rad51-mediated strand invasion. Subsequent strand invasion can then align and pair homologous chromosomes before the formation of the synaptonemal complex. In C. elegans and D. melanogaster, this is not the case as alignment and synapsis occurs without the generation of DSBs (reviewed by Joyce and McKim 2007). Although the specific mechanisms that drive homologous chromosome pairing while preventing the pairing of non-homologous chromosomes are unknown, DNA domains in C. elegans chromosomes have been proposed to play key roles in homolog pairing. Genetic analysis of C. elegans chromosome rearrangements identified cis-acting regions for pairing (Rosenbluth and Baillie 1981) which occur at one ?end? of each C. elegans chromosome which were called the homolog recognition region (HRR) (McKim et al. 1988). Recent reports showed that specific C2H2 zinc-finger proteins bind to these regions and mediate the chromosome synapsis (Phillips et al. 2005; Phillips and Dernburg 2006), however, they are not essential for homolog pairing (Macqueen et al. 2005; Phillips et al. 2005). Once synapsis initiates, it is likely that sequences distributed along the chromosomes promote proper alignment. In the case of large deletions or insertions that disrupt alignment, pairing for recombination can reinitiate, thus, there must be some mechanism by which homologous chromosomes can be brought into register along the length of the chromosomes without stand invasion (Rosenbluth et al. 1990; McKim et al. 1993). Abundant G/C tracts distributed along the   134chromosomes with the ability to generate secondary G-rich structures that can pair with other G-rich structures on the homologs could function to align homologous chromosomes. The observation that yeast Hop1 protein is able to promote synapsis of double-stranded DNA helices by the formation of G4 DNA raised the possibility that Hop1 homologs in C. elegans (him-3 and the him-3 paralogs) might have similar capabilities. This speculation is supported by the fact that mutants of him-3 and him-3 paralogs htp-1, htp-2 were reported to all have chromosome pairing defects (Couteau et al. 2004; Couteau and Zetka 2005; Martinez-Perez and Villeneuve 2005; Goodyer et al. 2008). It will be interesting to investigate whether him-3 or the him-3 paralogs can interact with G/C tracts.  Although G/C tracts are very likely to be involved in chromosome pairing process, there is evidence indicating that G/C tracts are not directly correlated with the formation of the meiotic pattern in C. elegans. C. briggsae genetic mapping using SNPs showed that C. briggsae has a similar meiotic pattern as C. elegans (Hillier et al. 2007). Considering the uniform distribution pattern of G/C tracts in C. briggsae and the fact that more G/C tracts in C. elegans were found to be located on the arms of the X chromosome even though the X chromosome does not have a meiotically defined central gene cluster, it seems that there is no direct correlation between the meiotic pattern and G/C tracts. Meiotic recombination was not eliminated or significantly altered when G/C tracts between the markers were deleted, also indicating the lack of direct relationship between meiotic recombination and G/C tracts, although multiple G/C tracts in the area between these markers might function together and deletion of a few of them might not cause detectable phenotypes in recombination.     1354.4.5 G/C tracts and gene expression The distribution of the tracts in the context of the level of gene expression in C. elegans was examined. Based on SAGE analysis, there was a variation in transcription levels that correlated with distance from the G/C tract. The average number of SAGE tags associated with G/C tract flanking genes is significantly lower than the number of SAGE tags associated with genes further from G/C tracts. This effect is similar to the suppression of human c-myc gene by its G-rich promoter (Siddiqui-Jain et al. 2002). Although no evidence for direct regulation by G/C tracts on specific genes was found in C. elegans, this observation showed that there is a correlation with the presence of a G/C tract and the level of expression. If G/C tracts played important gene specific cis-regulatory functions they should be conserved in C. briggsae but few are. Meanwhile, depletion of G/C tracts in pha-4 gene did not result in apparent gene expression pattern changes based on the promoter::gfp assay. Thus, G/C tracts are unlikely to be regulating transcription in a gene specific manner. On the other hand, previous studies on regulatory elements in C. elegans muscle genes showed that regulatory elements are also highly represented in C. briggsae muscle genes but the conservation of individual sites is weak (GuhaThakurta et al. 2004). One of their interpretations was that a specific site in C. elegans could disappear over evolutionary time and reappear at a different position and retain its regulatory activity. Similarly, G/C tracts in C. elegans, although not conserved in position in C. briggsae or regulating individual gene specifically, could be affecting gene expression in a regional manner.  Local chromatin environment affects many biological processes involving DNA, such as replication, transcription, and recombination. Open chromatin configuration allows easier access to DNA hence the local region will be more accessible to enzymes and will have more   136active replication and/or transcription. The ability of G/C tracts to form secondary structures and to maintain the formation of single strand DNA suggested their possible role in mediating the local chromatin configuration. The correlation between G/C tracts and regional gene expression could be due to changes in the local chromatin environment, perhaps as a result of the G/C tract that affects gene transcription, or that these chromatin environments may be more conducive to the generation or maintenance of G/C tracts. This explanation is also in accordance with the proposed role of G/C tracts in chromosome pairing.     137Table 4.1: Genomic location of G/C tracts in C. elegans  Location LG  Phys. Length (Mb)  G/C tracts Density (per Mb)  Left Mid Right I  15  69  4.6  29 (42%)  11 (16%)  29 (42%) II  15  52  3.5  27 (52%)  6 (11%)  19 (37%) III  14  58  4.1  22 (38%)  14 (24%)  22 (38%) IV  17  51  3.0  32 (63%)  7 (14%)  12 (23%) V  21  57  2.7  28 (49%)  5 (9%)  24 (42%) Xa  18  109  6.1  45 (41%)  19 (18%)  45 (41%)  a: There is no gene cluster center and arm differentiation on the X chromosome(Barnes et al. 1995). In this study, the LGX was divided into three parts based on its physical length.   138Table 4.2: Conserved G/C tracts in C. briggsae and C. elegans    C. briggsae  gene  C. elegans ortholog  C. elegans chromosome Intragenic G/C tracts  CBG15813 vab-10  I  CBG01202 H10D18.5 V  CBG07964 hmr-1  I       Intergenic G/C tracts#  CBG05578 dnj-25  V   CBG07642 C18B12.2  X   CBG13811 Y65A5A.1  IV   CBG14237 ckc-1  X  CBG03680 ZK430.8 II  CBG04107 F32B5.6 I  CBG04376 F32B4.5 I  CBG06557 F59D6.6 V  CBG07688 C33A11.1 X  CBG09160* ceh-13* III  CBG15039 C09G12.1 IV  CBG15729 H10E21.2 III  CBG20844 gur-4  II  G/C tracts considered conserved between the two species under strict criterion were highlighted with bold font. # Intergenic G/C tracts were defined by closest gene in this table. *There are two G/C tracts in both CBG09160 of C.briggsae and ceh-13 of C. elegans.    139Table 4.3: Recombination frequency of heterozygous G/C tract deletions strain   WT Dpy Unc Dpy-Unc  P (95%CI) dpy-11 unc-42/Del  2202 41 18  637  2.78% (2.19~3.41) dpy-11 unc42/+  1106 20 7  303  2.7% (1.95~3.64) unc-60 dpy-11/Del  2037 249 260  488  18.7% (18.0~19.5) unc60 dpy-11 /+  1064 134 142  254  19.6% (17.0~22.3) dpy-11 unc-76/Del  2249 80 91  710  6.0% (5.14~6.94) dpy-11 unc76/+  1196 53 50  333  6.58% (5.3~7.9) unc-62 dpy-11/Del  2174 77 67  607  5.27% (4.45~6.15) unc62 dpy-11 /+  1130 40 27  301  5.25% (4.1~6.56)    140Table 4.4: Recombination frequency of heterozygous G/C tract ZC404 deletion strain  WT Dpy P (95%CI) Del 5854 10 0.26% (0.14-0.45) + 4143 11 0.40% (0.19-0.68)     141 Table 4.5: Positions of G/C tracts in C. elegans   LG Intergenic 5' UTR Intron Exon 3?UTR I 38 0 28 3 0 II 33 0 18 0 1 III 35 0 22 0 1 IV 36 1 13 0 1 V 38 0 19 0 0 X 85 0 21 1 2    142Table 4.6: KOG classification of intragenic G/C tracts bearing genes  KOG classifications  Genes  Categories  Genes36  Posttranslational modification, protein turnover, chaperones   5CELLULAR PROCESSES AND SIGNALING    Signal transduction mechanisms     23    Defense mechanisms      1    Extracellular structures      3    Cytoskeleton       415  RNA processing and modification    2INFORMATION STORAGE AND PROCESSING      Chromatin structure and dynamics    1    Translation, ribosomal structure and biogenesis   1    Transcription       11METABOLISM       9  Cell cycle control, cell division, chromosome  2    Amino acid transport and metabolism   2    Carbohydrate transport and metabolism    1    Inorganic ion transport and metabolism   3    Secondary metabolites biosynthesis, transport and catabolism  1POORLY CHARACTERIZED     31  General function prediction only    18    Function unknown      13Unassigned 41     *The G/C tract in T06A10 on LGIV was located in two overlapping genes T06A10.4 and mel-46, both genes were analyzed in this study.   143Table 4.7: Average SAGE tags of genes associated with nearby G/C tracts  Position  G/C bearing genes N=132*  <500bp N=104  0.5-1.5kb N=110  1.5-3kb N=127  3-5kb N=136  5-10kb N=179 SAGE tags  2.05  1.92 1.19 1.50 4.48 3.00 *The G/C tract in T06A10 on LGIV was located in two overlapping genes T06A10.4 and mel-46, both genes were analyzed in this study   144                    Figure 4.1 Length distribution of G/C tracts in C. elegans genome   145             Figure 4.2 Predicted gene model of C. briggsae dog-1 CBG19723 (release cb25.agp8) and the corrected model after mRNA analysis.   146                        Figure 4.3 Distribution of G/C tracts in every mega-base pair block on each chromosome of C. elegans. In each graph, X axis represents the length of the chromosome that was divided by million base pairs, while Y axis is the frequency of G/C tracts.                        Figure 4.4 Distribution of G/C tracts along each chromosome of C. elegans and C. briggsae*. X axis in each graph represents one chromosome whose length was normalized to 1 and Y axis is the number of G/C tracts. Each G/C tract from the left end to the right end of one chromosome was numbered sequentially. The diamond spots on the X axis marked the edge of the genetically defined central gene cluster (Barnes et al. 1995). * Positions of G/C tracts in C. briggsae were predicted by the method described in text.   148 149                       Figure 4.5 Distribution of G/C tracts along each chromosome of C. briggsae based on genome assembly CB3. X axis of each graph represents the physical length of each chromosome and Y axis is the ordinal number. Each G/C tract from the left end to the right end of one chromosome was numbered sequentially.  Figure 4.6 G/C tract deletions on the genetic map of LGV. Visible markers are marked on top of the chromosome and G/C tract deletions are below. Figure 4.7 GFP expression pattern driven by pha-4pE3-G::gfp in N2 worms does not alter significantly from the control. A, C, E are expression pattern of pha-4pE3::gfp; B, D, F are expression pattern of pha-4pE3-G::gfp. A and B show the expression of pha-4 in pharynx, C and D show its expression in intestine (arrows indicate the intestinal nuclei), and arrows in E and F indicate its expression in a neuron in the tail.  CHAPTER 4 References  Anuradha, S. and Muniyappa, K. 2004. Meiosis-specific yeast Hop1 protein promotes synapsis of double-stranded DNA helices via the formation of guanine quartets. Nucleic Acids Res 32(8): 2378-2385. Anuradha, S., Tripathi, P., Mahajan, K., and Muniyappa, K. 2005. Meiosis-specific yeast Hop1 protein promotes pairing of double-stranded DNA helices via G/C isochores. Biochem Biophys Res Commun 336(3): 934-941. Barnes, T.M., Kohara, Y., Coulson, A., and Hekimi, S. 1995. Meiotic recombination, noncoding DNA and genomic organization in Caenorhabditis elegans. Genetics 141(1): 159-179. Bird, C.P., Stranger, B.E., and Dermitzakis, E.T. 2006. Functional variation and evolution of non-coding DNA. Curr Opin Genet Dev 16(6): 559-564. Brenner, S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1): 71-94. CelegansSequencingConsortium. 1998. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science 282(5396): 2012-2018. Chakravarti, A. 1991. A graphical representation of genetic and physical maps: the Marey map. Genomics 11(1): 219-222. Cheung, I., Schertzer, M., Rose, A., and Lansdorp, P.M. 2002. Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich DNA. Nat Genet 31(4): 405-409. Couteau, F., Nabeshima, K., Villeneuve, A., and Zetka, M. 2004. A component of C. elegans meiotic chromosome axes at the interface of homolog alignment, synapsis, nuclear reorganization, and recombination. Curr Biol 14(7): 585-592. Couteau, F. and Zetka, M. 2005. HTP-1 coordinates synaptonemal complex assembly with homolog alignment during meiosis in C. elegans. Genes Dev 19(22): 2744-2756. Duret, L., Marais, G., and Biemont, C. 2000. Transposons but not retrotransposons are located preferentially in regions of high recombination rate in Caenorhabditis elegans. Genetics 156(4): 1661-1669. Eddy, J. and Maizels, N. 2006. Gene function correlates with potential for G4 DNA formation in the human genome. Nucleic Acids Res 34(14): 3887-3896. Ghosal, G. and Muniyappa, K. 2005. Saccharomyces cerevisiae Mre11 is a high-affinity G4 DNA-binding protein and a G-rich DNA-specific endonuclease: implications for replication of telomeric DNA. Nucleic Acids Res 33(15): 4692-4703.   152Goodyer, W., Kaitna, S., Couteau, F., Ward, J.D., Boulton, S.J., and Zetka, M. 2008. HTP-3 Links DSB Formation with Homolog Pairing and Crossing Over during C. elegans Meiosis. Dev Cell 14(2): 263-274. GuhaThakurta, D., Schriefer, L.A., Waterston, R.H., and Stormo, G.D. 2004. Novel transcription regulatory elements in Caenorhabditis elegans muscle genes. Genome Res 14(12): 2457-2468. Hillier, L.W., Miller, R.D., Baird, S.E., Chinwalla, A., Fulton, L.A., Koboldt, D.C., and Waterston, R.H. 2007. Comparison of C. elegans and C. briggsae Genome Sequences Reveals Extensive Conservation of Chromosome Organization and Synteny. PLoS Biol 5(7): e167. Joyce, E.F. and McKim, K.S. 2007. When specialized sites are important for synapsis and the distribution of crossovers. Bioessays 29(3): 217-226. Kent, W.J. and Zahler, A.M. 2000. Conservation, regulation, synteny, and introns in a large-scale C. briggsae-C. elegans genomic alignment. Genome Res 10(8): 1115-1125. Koonin, E.V., Fedorova, N.D., Jackson, J.D., Jacobs, A.R., Krylov, D.M., Makarova, K.S., Mazumder, R., Mekhedov, S.L., Nikolskaya, A.N., Rao, B.S., Rogozin, I.B., Smirnov, S., Sorokin, A.V., Sverdlov, A.V., Vasudevan, S., Wolf, Y.I., Yin, J.J., and Natale, D.A. 2004. A comprehensive evolutionary classification of proteins encoded in complete eukaryotic genomes. Genome Biol 5(2): R7. Larson, E.D., Duquette, M.L., Cummings, W.J., Streiff, R.J., and Maizels, N. 2005. MutSalpha binds to and promotes synapsis of transcriptionally activated immunoglobulin switch regions. Curr Biol 15(5): 470-474. Liu, Z., Lee, A., and Gilbert, W. 1995. Gene disruption of a G4-DNA-dependent nuclease in yeast leads to cellular senescence and telomere shortening. Proc Natl Acad Sci U S A 92(13): 6002-6006. Macqueen, A.J., Phillips, C.M., Bhalla, N., Weiser, P., Villeneuve, A.M., and Dernburg, A.F. 2005. Chromosome Sites Play Dual Roles to Establish Homologous Synapsis during Meiosis in C. elegans. Cell 123(6): 1037-1050. Maizels, N. 2006. Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nat Struct Mol Biol 13(12): 1055-1059. Martinez-Perez, E. and Villeneuve, A.M. 2005. HTP-1-dependent constraints coordinate homolog pairing and synapsis and promote chiasma formation during C. elegans meiosis. Genes Dev 19(22): 2727-2743. Maydan, J.S., Flibotte, S., Edgley, M.L., Lau, J., Selzer, R.R., Richmond, T.A., Pofahl, N.J., Thomas, J.H., and Moerman, D.G. 2007. Efficient high-resolution deletion discovery in Caenorhabditis elegans by array comparative genomic hybridization. Genome Res 17(3): 337-347.   153McKay, S.J., Johnsen, R., Khattra, J., Asano, J., Baillie, D.L., Chan, S., Dube, N., Fang, L., Goszczynski, B., Ha, E., Halfnight, E., Hollebakken, R., Huang, P., Hung, K., Jensen, V., Jones, S.J., Kai, H., Li, D., Mah, A., Marra, M., McGhee, J., Newbury, R., Pouzyrev, A., Riddle, D.L., Sonnhammer, E., Tian, H., Tu, D., Tyson, J.R., Vatcher, G., Warner, A., Wong, K., Zhao, Z., and Moerman, D.G. 2003. Gene expression profiling of cells, tissues, and developmental stages of the nematode C. elegans. Cold Spring Harb Symp Quant Biol 68: 159-169. McKim, K.S., Howell, A.M., and Rose, A.M. 1988. The effects of translocations on recombination frequency in Caenorhabditis elegans. Genetics 120(4): 987-1001. McKim, K.S., Peters, K., and Rose, A.M. 1993. Two types of sites required for meiotic chromosome pairing in Caenorhabditis elegans. Genetics 134(3): 749-768. Muniyappa, K., Anuradha, S., and Byers, B. 2000. Yeast meiosis-specific protein Hop1 binds to G4 DNA and promotes its formation. Mol Cell Biol 20(4): 1361-1369. Phillips, C.M. and Dernburg, A.F. 2006. A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans. Dev Cell 11(6): 817-829. Phillips, C.M., Wong, C., Bhalla, N., Carlton, P.M., Weiser, P., Meneely, P.M., and Dernburg, A.F. 2005. HIM-8 Binds to the X Chromosome Pairing Center and Mediates Chromosome-Specific Meiotic Synapsis. Cell 123(6): 1051-1063. Prachumwat, A., DeVincentis, L., and Palopoli, M.F. 2004. Intron size correlates positively with recombination rate in Caenorhabditis elegans. Genetics 166(3): 1585-1590. Rosenbluth, R.E. and Baillie, D.L. 1981. The genetic analysis of a reciprocal translocation, eT1(III; V), in Caenorhabditis elegans. Genetics 99(3-4): 415-428. Rosenbluth, R.E., Johnsen, R.C., and Baillie, D.L. 1990. Pairing for recombination in LGV of Caenorhabditis elegans: a model based on recombination in deficiency heterozygotes. Genetics 124(3): 615-625. Sen, D. and Gilbert, W. 1988. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 334(6180): 364-366. Siddiqui-Jain, A., Grand, C.L., Bearss, D.J., and Hurley, L.H. 2002. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc Natl Acad Sci U S A 99(18): 11593-11598. Smit, A.F. 1996. The origin of interspersed repeats in the human genome. Curr Opin Genet Dev 6(6): 743-748. Stein, L.D., Bao, Z., Blasiar, D., Blumenthal, T., Brent, M.R., Chen, N., Chinwalla, A., Clarke, L., Clee, C., Coghlan, A., Coulson, A., D'Eustachio, P., Fitch, D.H., Fulton, L.A., Fulton, R.E., Griffiths-Jones, S., Harris, T.W., Hillier, L.W., Kamath, R.,   154  155Kuwabara, P.E., Mardis, E.R., Marra, M.A., Miner, T.L., Minx, P., Mullikin, J.C., Plumb, R.W., Rogers, J., Schein, J.E., Sohrmann, M., Spieth, J., Stajich, J.E., Wei, C., Willey, D., Wilson, R.K., Durbin, R., and Waterston, R.H. 2003. The genome sequence of Caenorhabditis briggsae: a platform for comparative genomics. PLoS Biol 1(2): E45. Sun, H., Bennett, R.J., and Maizels, N. 1999. The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. Nucleic Acids Res 27(9): 1978-1984. Swan, K.A., Curtis, D.E., McKusick, K.B., Voinov, A.V., Mapa, F.A., and Cancilla, M.R. 2002. High-throughput gene mapping in Caenorhabditis elegans. Genome Res 12(7): 1100-1105. Tatusov, R.L., Fedorova, N.D., Jackson, J.D., Jacobs, A.R., Kiryutin, B., Koonin, E.V., Krylov, D.M., Mazumder, R., Mekhedov, S.L., Nikolskaya, A.N., Rao, B.S., Smirnov, S., Sverdlov, A.V., Vasudevan, S., Wolf, Y.I., Yin, J.J., and Natale, D.A. 2003. The COG database: an updated version includes eukaryotes. BMC Bioinformatics 4: 41. Updike, D.L. and Mango, S.E. 2004. Suppressors of pha-4/FoxA loss of function mutations define potential pha-4 regulators. East Coast Worm Meeting 246. Wormbase. [http://www.wormbase.org/]. Youds, J.L., O'Neil, N.J., and Rose, A.M. 2006. Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173(2): 697-708. Zetka, M.C., Kawasaki, I., Strome, S., and Muller, F. 1999. Synapsis and chiasma formation in Caenorhabditis elegans require HIM-3, a meiotic chromosome core component that functions in chromosome segregation. Genes Dev 13(17): 2258-2270.   CHAPTER 5 General discussions The integrity of the genome is essential to the health of the individual and to the reproductive success of a species. Although mutations are believed to drive evolution at the molecular level and generate genetic variation, genomic instability is usually associated with pathological disorders, and in humans it is often associated with premature ageing, birth defects, inherited diseases and development of various types of cancer (Hoeijmakers 2001; Myung et al. 2001; Vinson and Hales 2002; Woodruff and Thompson 2003; Andressoo et al. 2006; Mirkin 2006).   5.1 eT1 balancer system and studies on genome stability As described in Chapter 1, C. elegans has proven to be a useful model to investigate the mechanisms maintaining genome stability. Many methods to study components involved in the genome stability maintenance in C. elegans focus on the germline, because damaged DNA results in obvious morphological changes, either by the checkpoint arrest or apoptosis activation (Gartner et al. 2000; Ahmed et al. 2001; Gartner et al. 2004; Stergiou and Hengartner 2004). Phenotypic assays have been very successful in isolating components and elucidating the genetic pathways in DNA repair. However, the nature of genome instability caused by many external or internal damage agents is still poorly understood. In this thesis, I have demonstrated further the usefulness of the eT1 balancer system, which was established by Rosenbluth and Baiillie (Rosenbluth and Baillie 1981), for capturing mutational events for molecular and genetic characterization. In Chapter 2, the system was used to detect damage induced by low-dosage radiation in space. In Chapter 3, the system was used to demonstrate the wide range of mutational events occurring in the dog-1 mutants. The molecular nature of   156the isolated mutations has provided us with a much fuller understanding of types of chromosomal rearrangements that occur in the absence of DOG-1. A range of mutational events including point mutations, deficiencies, duplications, and translocations were isolated using eT1 to recover lethal mutations. While previous studies on DNA damage responses in C. elegans have focussed on mutation rates and apoptosis, using the eT1 balancer system I have captured specific chromosomal rearrangements to determine both the lethal mutation frequency and to investigate the nature of the mutation and in some cases even the specific breakpoints. Such a study would not be feasible without an effective genetic balancer system.   There are many genetic balancers available in C. elegans (Reviewed by Edgley et al. 2006). Many of them are chromosomal rearrangements that suppress meiotic crossing-over. The usefulness of the eT1 balancer system has been greatly improved with the molecular identification of the physical breakpoints, allowing the presence of the balancer to be detected molecularly by PCR rather than by phenotypes associated with eT1. Detailed studies on eT1 balanced regions described in this thesis as well as in the previous reports (Rosenbluth et al. 1988; Zhao et al. 2006) have also provided a well established platform for future studies.  There are, however, limitations in studying mutational spectrum using this system, especially when only lethal mutations were to be isolated. Like other screening methods, such as screening for specific visible mutations, the eT1 system for lethal mutations is not unbiased as only mutations affecting essential genes in the balanced regions or rearrangements affecting multiple genes are selected. The mutational spectrum by eT1 system is thus affected by this nature. On the other hand, as I have shown in this thesis, this   157system still provided much information about global mutational events as any additional mutations occurred with the lethal mutations in the balanced regions of eT1 can be retained.  5.2 G/C tracts and genome stability Most of the dog-1-induced mutations, both small deletions and large chromosomal rearrangements, are associated with G/C tracts in the genome. While the small G/C tract deletions are thought to be formed by error-prone DNA repair after DNA replication folk stalling (Youds et al. 2006), the large chromosomal rearrangements could be produced by repair processes following double strand breaks (DSBs), possibly also caused by the replication folk stalling at the sites of G/C tracts. Even though HR has been shown to function in the prevention of small deletions on G/C tracts (Youds et al. 2006), HR pathways could be error-prone. As described in Chapter 1, many HR repair pathways, including HRR, SDSA, BIR, and SSA, can all cause chromosomal rearrangements when illegitimate recombination occurs between non-allelic regions (Figure 5.1). The G/C tracts, which are interspersed repeated DNA elements, could also serve as substrates for ectopic recombination events, leading to large deletions and translocations. NHEJ, telomere addition and breakage-bridge fusion can also play roles in creating and maintaining the rearrangements when breaks occur at the sites of G/C tracts (Figure 5.1). In any case, G/C tracts are vulnerable sites for genome stability.  Replication stress such as replication folk stalling is normally seen as a source of genome instability. A very recent study on WRN has shown that the RecQ helicase is associated with replication fork stalls at fragile sites (Pirzio et al. 2008). This result demonstrates the need for helicases to resolve secondary structures in order for replication to proceed properly. An   158interesting possibility based on this recent finding is that replication folk stalls could be beneficial in some circumstances and form purposefully, coordinated by the helicases such as dog-1. An example might be situations where the replication speed needs to be controlled or where DSBs are helpful (in homologous recombination for example). Dispersed G/C tracts could serve such a role well. In this model, the G/C tracts, with functional helicases, maintain the genome stability by means of a regulated series of DNA breaks. To date, dog-1 is the only gene found to be responsible for the G/C tract associated genome instability. However, genome instability observed in dog-1 mutant background is not limited to G/C tracts only. G-rich DNA segments without defined G/C tract features (18 consecutive Gs, for example) and other repetitive elements without obvious G-rich DNA were found to be sources of genome instability when DOG-1 is absent. This finding indicated a role for dog-1 in other DNA repair pathways. Given that these elements are prone to cause DNA lesions, it is curious that they are over-represented in the genome. The number of G/C tracts in both C. elegans and C. briggsae is suggestive of a positive role of these DNA elements. In Chapter 4, I examined this question and found that G/C tracts correlated with regional gene expression levels, therefore, it is possible that G/C tracts could be affecting adjacent chromatin structure. The possibility of G/C tracts playing a role in chromosomal structure coupled with their ability to form secondary structures may reinforce the original hypothesis that they play a role of G/C tracts in chromosomal pairing (Sen and Gilbert 1988).        1595.3 dog-1, G-rich DNA and Fanconi anemia studies In humans, the FA pathway consists of at least 13 complementation groups (A, B, C, D1, D2, E, F, G, I, J, L, M and N) (Reviewed by Taniguchi and D'Andrea 2006; Reid et al. 2007; Wang 2007). Only 5 of these proteins, FANCD1/BRCA2, FANCD2, FANCJ/BRIP1/DOG-1, FANCL and FANCM, have identified homologs in C. elegans (Dequen et al. 2005; Collis et al. 2006; Patel and Joenje 2007; Youds et al. 2007). Although other components could have been missed due to lack of sequence similarity, the current FA protein network in C. elegans might represent a simplified FA pathway in lower organisms. While much is known about the FA core complex, the downstream components of the FA pathway are not well understood. dog-1 encodes an ortholog of FANCJ (Youds et al. 2007), study of DOG-1 and its function in genome instability could be very informative to understand the FA pathway.  The mutational spectrum of dog-1 in C. elegans described in this thesis extends our understanding of consequences of loss of function in the C. elegans ortholog. The frequency of chromosomal rearrangements observed in dog-1 mutants is suggestive of DSB-induced repair process (HR, NHEJ and/or chromosome fusion) (Figure 5.1). Substrates could include stalled replication forks, strand cross-links, or G-quadruplex structures.  Chromosomal rearrangements such as large deletions, duplications and translocations found in dog-1 mutants are a hallmark of tumour progression (Hassold and Hunt 2001; Bharadwaj and Yu 2004). This type of damage in cells has proven oncogenic potential, more than those small G/C tract deletions observed previously in the dog-1 mutant.  DNA segments in forms of G/C tracts (consecutive Gs or Cs) are not abundant in human genome. However, there are multiple sites of G-rich DNA in the genome, including at the telomeres, ribosomal DNA, certain microsatellites, and the immunoglobulin heavy chain   160switch regions (Maizels 2006). Many of them have been shown to be able to form secondary structure in vitro (Maizels 2006) and as many as  300,000 sites are predicted to have the potential to form secondary structures when DNA is single stranded during replication or transcription (Huppert and Balasubramanian 2005). These sites thus constitute a common source of genome instability when they form secondary structures and proteins that unwind these structures are needed. Based on the sequence and other functional similarity between DOG-1 and FANCJ, it is possible that FANCJ might carry out similar function in humans. In the absence of FANCJ genome instability at G-rich DNA sites is likely to occur. In fact, FA patients have been shown to have genome instability including chromatid breaks, large deletions and chromosomal rearrangements (Hinz et al. 2006; Levitus et al. 2006), similar to those in dog-1 mutants. G-rich DNA sites may thus prove informative in future clinical FA diagnostic practice.  5.4 Future directions  Several directions for further investigation come from the work described in this thesis. As the eT1 balancer system has been shown to be a qualified monitor for spaceflight radiation, longer term spaceflight experiments are being conducted to test the DNA damages caused by low dosage space radiation. High throughput post-flight investigation methods like aCGH described in Chapter 3 will assist rapid identification and characterization of detected lesions. Ideally, intervention-free monitor systems that demonstrate ongoing radiation damage would be desirable in future.  The eT1 balancer system could also be used in the mutant backgrounds of other DNA repair pathway components, as shown in this thesis, to recover and analyze the induced   161mutational events in order to reveal the information about pathway substrates and repair outcomes. HR and NHEJ are proposed to cause the chromosomal rearrangements in the absence of dog-1, to prove this hypothesis, components involved in these two pathways could thus be tested with or without dog-1 background.  Fragile G/C tracts are apparently of a source of genome instability, supposedly by forming the secondary structures. It is thus necessary to test if the G/C tracts can actually form secondary structures in vivo; and if possible, to test whether the G/C tracts or secondary structures they formed are associated with stalling replication folks. dog-1 appears to be the only gene responsible for G/C tract associated genome instability but it may have other substrates. Study of the substrates that DOG-1 can unwind/resolve would be informative in determining mechanism by which DOG-1 acts. Demonstration of the physical interaction between DOG-1 and G/C tracts would also be useful in understanding this helicase and its function in the DNA repair pathways.  Lastly, the role of G/C tracts in the genome remains elusive. My analysis of G/C tracts has uncovered a possible link between chromatin structure and the presence of G/C tracts. It will be informative to use techniques such as electrophoretic mobility shift assay (EMSA) to determine if meiotic pairing proteins such as HIM-3 or HTP-1/HTP-2/HTP-3 can bind to G/C tracts. Furthermore, it would be interesting to assay transcriptional levels in the dog-1 mutant and to test if loss of DOG-1 affects the stability of G/C tracts and transcription.    162DSBHRSSA EctopicHRR/SDSABIR NHEJ Telomere additionBreakage-bridge fusionDeletions Deletions;translocations;inversionsDeletions;translocations;duplications;inversionsDeletions;translocations;duplications;inversions;insertionsDeletions;duplicationsTranslocations Figure 5.1 Different chromosome rearrangements caused by double strand breaks (DSBs).  Illegitimate recombination between non-allelic regions in HR pathways (SDSA and the standard HRR) and other HR based sub-pathways including SSA and BIR can cause a variety of chromosome rearrangements. Two chromosome segments can be joined together without sequence homology with the NHEJ. In some case, a broken chromosome fragment can be stabilized by telomere addition. Translocation and other types of rearrangements can also be generated by breakage-bridge fusion. Figure adapted from (Aguilera and Gomez-Gonzalez 2008).   163CHAPTER 5 References Aguilera, A. and Gomez-Gonzalez, B. 2008. Genome instability: a mechanistic view of its causes and consequences. Nat Rev Genet. Ahmed, S., Alpi, A., Hengartner, M.O., and Gartner, A. 2001. C. elegans RAD-5/CLK-2 defines a new DNA damage checkpoint protein. Curr Biol 11(24): 1934-1944. Andressoo, J.O., Hoeijmakers, J.H., and Mitchell, J.R. 2006. Nucleotide excision repair disorders and the balance between cancer and aging. Cell Cycle 5(24): 2886-2888. Bharadwaj, R. and Yu, H. 2004. The spindle checkpoint, aneuploidy, and cancer. Oncogene 23(11): 2016-2027. Collis, S.J., Barber, L.J., Ward, J.D., Martin, J.S., and Boulton, S.J. 2006. C. elegans FANCD2 responds to replication stress and functions in interstrand cross-link repair. DNA Repair (Amst) 5(11): 1398-1406. Dequen, F., St-Laurent, J.F., Gagnon, S.N., Carreau, M., and Desnoyers, S. 2005. The Caenorhabditis elegans FancD2 ortholog is required for survival following DNA damage. Comp Biochem Physiol B Biochem Mol Biol 141(4): 453-460. Edgley, M.L., Baillie, D.L., Riddle, D.L., and Rose, A.M. 2006. Genetic balancers WormBook, ed The C elegans Research Community WormBook, doi/10.1895/wormbook.1.89.1, http://www.wormbook.org. . Gartner, A., MacQueen, A.J., and Villeneuve, A.M. 2004. Methods for analyzing checkpoint responses in Caenorhabditis elegans. Methods Mol Biol 280: 257-274. Gartner, A., Milstein, S., Ahmed, S., Hodgkin, J., and Hengartner, M.O. 2000. A conserved checkpoint pathway mediates DNA damage--induced apoptosis and cell cycle arrest in C. elegans. Mol Cell 5(3): 435-443. Hassold, T. and Hunt, P. 2001. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet 2(4): 280-291. Hinz, J.M., Nham, P.B., Salazar, E.P., and Thompson, L.H. 2006. The Fanconi anemia pathway limits the severity of mutagenesis. DNA Repair (Amst) 5(8): 875-884. Hoeijmakers, J.H. 2001. Genome maintenance mechanisms for preventing cancer. Nature 411(6835): 366-374. Huppert, J.L. and Balasubramanian, S. 2005. Prevalence of quadruplexes in the human genome. Nucleic Acids Res 33(9): 2908-2916. Levitus, M., Joenje, H., and de Winter, J.P. 2006. The Fanconi anemia pathway of genomic maintenance. Cell Oncol 28(1-2): 3-29.   164Maizels, N. 2006. Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nat Struct Mol Biol 13(12): 1055-1059. Mirkin, S.M. 2006. DNA structures, repeat expansions and human hereditary disorders. Curr Opin Struct Biol 16(3): 351-358. Myung, K., Datta, A., and Kolodner, R.D. 2001. Suppression of spontaneous chromosomal rearrangements by S phase checkpoint functions in Saccharomyces cerevisiae. Cell 104(3): 397-408. Patel, K.J. and Joenje, H. 2007. Fanconi anemia and DNA replication repair. DNA Repair (Amst) 6(7): 885-890. Pirzio, L.M., Pichierri, P., Bignami, M., and Franchitto, A. 2008. Werner syndrome helicase activity is essential in maintaining fragile site stability. J Cell Biol 180(2): 305-314. Reid, S., Schindler, D., Hanenberg, H., Barker, K., Hanks, S., Kalb, R., Neveling, K., Kelly, P., Seal, S., Freund, M., Wurm, M., Batish, S.D., Lach, F.P., Yetgin, S., Neitzel, H., Ariffin, H., Tischkowitz, M., Mathew, C.G., Auerbach, A.D., and Rahman, N. 2007. Biallelic mutations in PALB2 cause Fanconi anemia subtype FA-N and predispose to childhood cancer. Nat Genet 39(2): 162-164. Rosenbluth, R.E. and Baillie, D.L. 1981. The genetic analysis of a reciprocal translocation, eT1(III; V), in Caenorhabditis elegans. Genetics 99(3-4): 415-428. Rosenbluth, R.E., Rogalski, T.M., Johnsen, R.C., Addison, L.M., and Baillie, D.L. 1988. Genomic organization in Caenorhabditis elegans: deficiency mapping on linkage group V (left). Genet Res 52: 105-118. Sen, D. and Gilbert, W. 1988. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 334(6180): 364-366. Stergiou, L. and Hengartner, M.O. 2004. Death and more: DNA damage response pathways in the nematode C. elegans. Cell Death Differ 11(1): 21-28. Taniguchi, T. and D'Andrea, A.D. 2006. Molecular pathogenesis of Fanconi anemia: recent progress. Blood 107(11): 4223-4233. Vinson, R.K. and Hales, B.F. 2002. DNA repair during organogenesis. Mutat Res 509(1-2): 79-91. Wang, W. 2007. Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins. Nat Rev Genet 8(10): 735-748. Woodruff, R.C. and Thompson, J.N., Jr. 2003. The role of somatic and germline mutations in aging and a mutation interaction model of aging. J Anti Aging Med 6(1): 29-39.   165  166Youds, J.L., Barber, L.J., Ward, J.D., Collis, S.J., O'Neil, N.J., Boulton, S.J., and Rose, A.M. 2007. DOG-1 is the Caenorhabditis elegans BRIP1/FANCJ homologue and functions in interstrand cross-link repair. Mol Cell Biol. Youds, J.L., O'Neil, N.J., and Rose, A.M. 2006. Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173(2): 697-708. Zhao, Y., Lai, K., Cheung, I., Youds, J., Tarailo, M., Tarailo, S., and Rose, A. 2006. A mutational analysis of Caenorhabditis elegans in space. Mutat Res 601(1-2): 19-29.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066448/manifest

Comment

Related Items