UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Targeted therapies in mantle cell lymphoma Tucker, Catherine Amanda 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_spring_tucker_catherine_amanda.pdf [ 10.23MB ]
Metadata
JSON: 24-1.0066427.json
JSON-LD: 24-1.0066427-ld.json
RDF/XML (Pretty): 24-1.0066427-rdf.xml
RDF/JSON: 24-1.0066427-rdf.json
Turtle: 24-1.0066427-turtle.txt
N-Triples: 24-1.0066427-rdf-ntriples.txt
Original Record: 24-1.0066427-source.json
Full Text
24-1.0066427-fulltext.txt
Citation
24-1.0066427.ris

Full Text

TARGETED THERAPIES IN MANTLE CELL LYMPHOMA  by  Catherine Amanda Tucker  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (PATHOLOGY AND LABORATORY MEDICINE)  THE UNIVERSITY OF BRITISH COLUMBIA  January 2008  © Catherine Amanda Tucker, 2008  ABSTRACT  Mantle cell lymphoma (MCL) is characterized by the presence of the t(11 ;14)(g13 ;g32) translocation which results in cyclin Dl over-expression . MCL is one of the most difficult lymphoproliferative disorders to manage with a median survival rate of 43 months from diagnosis . The poor prognosis associated with MCL is due in large part to its late classification as a separate clinical entity leading to a dearth in available pre-clinical models . The specific objectives of the research described in this thesis were (1) to establish MCL preclinical models of disease and (2) to evaluate deregulated cell signaling pathways in MCL that can impact treatment response . Pre-clinical models of MCL were established from pre-existing cell lines containing the t(11 ;14)(g13 ;g32). These cell lines were previously misclassified because they were developed prior to the classification of MCL as a distinct lymphoma subtype . With the establishment of MCL models, deregulated cell signaling pathways in MCL and response to different treatment strategies were investigated . These included an investigation of the cell signaling pathways activated in bcl-2 over-expressing MCL cells that were treated with oblimersen; a molecular gene silencing strategy that effectively suppresses bcl-2 in vitro and in vivo . Silencing bcl-2 provided insight into which pathways were influenced by bcl-2 over-expression in MCL . More specifically loss of cyclin D1, NF-KB, p53, bax and p27 were observed following bcl-2 silencing . Additional studies investigated how abnormal expression of CD40/CD40L and Fas/FasL along with bcl-2 family members contributes to B cell clonal expansion and influences Rituximab-mediated cell death in MCL models . Rituximab is a chimeric monoclonal antibody targeted against B cells and  ii  both Rituximab-sensitive and insensitive MCL models were defined . An abnormally high expression of bcl-2, bcl-x L, mcl-1, CD40/CD40L and Fas were observed in all MCL cells, as well as high levels of soluble FasL, capable of blocking Fas-mediated apoptosis. These deregulated pathways were associated with response to Rituximab treatment in a sensitive MCL model . These studies demonstrated some of the key pathways associated with treatment response in MCL, and the establishment of well characterized MCL models enables us to continue to explore new treatment strategies currently being studied in other lymphomas .  iu  TABLE OF CONTENTS ABSTRACT TABLE OF CONTENTS  iv  LIST OF TABLES  viii  LIST OF FIGURES  ix  LIST OF ABBREVIATIONS  xi  ACKNOWLEDGEMENTS DEDICATION  xviii  CO-AUTHORSHIP STATEMENT  xix  CHAPTER 1 : INTRODUCTION 1 .1 Mantle cell lymphoma : The clinical problem  1  1 .2 Background  2  1 .3 Classification of Mantle cell lymphoma  4  1 .4 Molecular lesions in Mantle cell lymphoma  4  1 .5 Critical role of cyclin D1 in cell cycle progression  5  1 .6 Role of cyclin D1 in malignant transformation  8  1 .7 Overview of apoptosis  9  1 .8 Proliferation and apoptosis in Mantle cell lymphoma  14  1 .9 The normal progression of B cell differentiation  15  1 .10 Regulation of B cell clonal expansion in the Germinal Center  20  1 .11 Need for new targeted therapies  23  1 .12 Antisense oligonucleotides  24  iv    1 .12 .1 Non-specific sequence effects of antisense oligonucleotides 1 .12 .2 Immunologic effects of antisense oligonucleotides 1 .13 RNA interference 1 .14 Rituximab and clinical response to Rituximab 1 .14.1 CD20 1 .14 .2 Cell signaling mediated by Rituximab binding to CD20 1 .14 .3 Rituximab induced complement activation and antibody dependent cell cytotoxicity 1 .14 .4 Mechanisms of resistance to Rituximab 1 .14 .5 Conclusions for Rituximab  27 28 30 33 36 40  1 .15 THESIS OBJECTIVES AND HYPOTHESIS  56  46 54 55  CHAPTER 2 : MATERIALS AND METHODS 2 .1 Cell lines and culture  58  2.2 Reagents  59  2.3 Cytogenetic analysis 2.3 .1 Detection oft(11 ;14)(g13;g32) and t(8 ;14) translocations 2 .3 .2 Detection of EBV by Fluorescence in Situ Hybridization 2 .3 .3 Detection of p16 and p53 deletions by Fluorescence in Situ  H ybridization  59 59 60 61  2 .4 Flow cytometry and data analysis 2.4 .1 Immunophenotypic analysis by flow cytometry 2 .4 .2 Staining for cell surface markers  62 62 62  2.5 Bcl-2 silencing in vitro : cell transfections/imaging  63  2 .6 Western blotting studies  64  2 .7 Immunoprecipitation studies  66  2 .8 RNA isolation and PCR techniques 2.8 .1 Detection of cyclin D1 mRNA isoforms by quantitative real time PCR 2.8 .2 Detection of bcl-2, bax, bcl-xL and mcl- i by quantitative real time PCR 2 .9 Sequencing of TP53 exons 5, 6, 7, and 8 2.9 .1 DNA extraction 2.9 .2 PCR and DNA sequencing  66 66  2 .10 Immunohistochemistry 2 .10 .1 Staining for Ki67, caspase 3 and Fas ligand 2.10 .2 Vasculature and FasL immunostaining  69 69 70  v  67 68 68 68  2 .10.2 .1 Image acquisition  71  2 .11 Animal studies 2.11 .1 Xenograft models 2 .11 .2 Treatment doses and schedules  71 71 72  2 .12 Statistical analysis  72  CHAPTER 3: FOUR HUMAN t(11 ;14)(g13;g32)-CONTAINING CELL LINES HAVING CLASSIC AND VARIANT FEATURES OF MANTLE CELL LYMPHOMA  3 .1  Introduction and rationale  74  3.2  Results 3 .2.1 In vitro growth characteristics 3 .2.2 Immunophenotypic, cytogenetic and EBV analysis 3 .2 .3 Expression of cyclin D1 protein and analysis of mRNA isoforms 3 .2 .4 Determination of the presence of p16, p18 and p53 3.2 .5 Growth in Rag-2M mice  76 76 77 86 88 88  3 .3  Discussion  90  CHAPTER 4 : SILENCING BCL-2 IN MODELS OF MANTLE CELL LYMPHOMA CORRELATES WITH A LOSS IN CYCLIN Dla EXPRESSION BUT NOT CYCLIN Dlb AND IS ASSOCIATED WITH DECREASES IN NFkappaB, p53, BAX AND p27 LEVELS  4.1 Introduction and rationale  94  4.2 Results and discussion 96 4 .2 .1 MCL cell lines exhibit a greater bcl-2 over-expression than a cell line containing the bcl-2 translocation t(8 ;14 ;18) 96 4.2 .2 Z-138 cells were more sensitive to bcl-2 downregulation in vitro than JVM-2 cells 98 4.2 .3 Oblimersen treatment in Z-138 xenografts and JVM-2 xenografts engenders tumor growth delays and correlates to reduced proliferation and an increase in apoptosis 101 4 .2 .4 Silencing bcl-2 in Z-138 xenografts led to downregulation of p53 expression and immunoprecipitation studies show that bcl-2 co-precipitates phospho-mdm-2 106 4.2 .5 Silencing bcl-2 in Z-138 xenografts engenders a decrease in NF-KB and phospho-NF-KB, p27 and cyclin Dl a 108 4 .2 .6 Bcl-2 over-expression leading to maintenance of cyclin Dl a  vi    expression may occur through p38 MAPK mediated signaling pathways  112  CHAPTER 5 : ABNORMAL EXPRESSION OF SOLUBLE FAS AND MEMBRANE BOUND FAS LIGAND IN MANTLE CELL LYMPHOMA: POTENTIAL FOR RESISTANCE TO FAS MEDIATED CELL DEATH AND IMMUNE EVASION  5 .1 Introduction and rationale  116  5 .2 Results 5 .2 .1 Over-expression of anti-apoptotic bcl-2 family members 5.2.2 Complete tumor regressions following treatment with Rituximab occurs in Z-138 xenografts but not in JVM-2 xenografts 5.2.3 Treatment with Rituximab leads to a reduction in tumor cell proliferation and induction of apoptosis, accompanied by decreases in expression of bcl-2, bcl-x L and mcl-1 5 .2 .4 Rituximab treatment is associated with loss of CD20 expression in Z-13 8 xenografts 5 .2 .5 High levels of Fas are expressed in MCL cell lines 5.2 .6 CD40/CD40L expression in MCL cell lines and treatment of the Z-138 Rituximab sensitive xenografts is associated with downregulation of CD40/CD40L 5.2.7 High levels of soluble FasL are expressed in MCL cells 5.2.8 FasL is expressed on endothelial cells of blood vessels  120 120  127 130 132  5.3 Discussion  132  122  122 125 127  CHAPTER 6 : DISCUSSION AND CONCLUSIONS 6 .1 Discussion  139  6 .2 Conclusions  142  REFERENCES  143  APPENDICES Appendix A Animal Care Certificate Appendix B Biohazard Approval Certificate Appendix C Submissions  174 174 175 176  vii  LIST OF TABLES  Table 3 .1 Immunophenotype of cell lines as analyzed by flow cytometry  78  Table 3 .2 Cell line karyotypes  83  Table 3 .3 Molecular profiles and EBV analysis of cell lines and cyclin D1-negative (DoHH2) and positive (TC32) controls  85    LIST OF FIGURES  Figure 1 .1  Cell cycle control  6  Figure 1 .2 Overview of the intrinsic and extrinsic apoptotic pathways  11  Figure 1 .3 The bcl-2 family of proteins  13  Figure 1 .4 Stages of B-cell differentiation  16  Figure 1 .5 Determination of life and death in the Germinal Center by the expression of Fas/FasL and CD40/CD40L  21  Figure 1 .6 Antisense mediated uptake and mechanism of action  26  Figure 1 .7 The RNA interference pathway  31  Figure 1 .8 Model of the human CD20 protein  37  Figure 1 .9 CD20 promoter  39  Figure 1 .10 Signaling events and modes of resistance associated with Rituximab treatment  42  Figure 1 .11 Rituximab can induce the classical pathway of complement activation  47  Figure 1 .12 Different types of Fc receptors on various effector cells  51  Figure 1 .13 The mechanism of action of ADCC mediated by NK cells  52  Figure 3 .1 Cytogenetic analysis of Z-138  79  Figure 3 .2 Cytogenetic analysis of HBL-2  80  Figure 3 .3 Cytogenetic analysis of JVM-2  81  Figure 3 .4 Cytogenetic analysis of NCEB-1  82  Figure 3 .5 FISH analysis for EBV  84  Figure 3 .6 Cyclin Dl expression in cell lines  87  ix  Figure 3 .7 Growth curves for different cell lines  89  Figure 4.1 Bcl-2 expression in MCL cell lines  97  Figure 4 .2 Bcl-2 silencing in vitro in Z-138 cells and JVM-2 cells  100  Figure 4 .3 Z-138 and JVM-2 xenografts exhibit a significant tumor growth delay following treatment with oblimersen  102  Figure 4 .4 Oblimersen treatment in Z-138 xenografts leads to a dose dependent downregulation of bcl-2 as well as an associated upregulation in caspase 9 and downregulation of bax in vivo and in vitro  105  Figure 4 .5 Oblimersen treatment in Z-138 xenografts leads to loss of expression of NF-03 and its phosphorylated form, p27 and cyclin D 1 a  109  Figure 4 .6 Proposed model of altered cell signaling events following bcl-2 silencing in an in vivo model of MCL  115  Figure 5 .1 Expression of bcl-xL and mcl-1 in MCL cell lines and in vivo efficacy studies of Z-138 and JVM-2 xenografts treated with Rituximab  121  Figure 5 .2 Tumor regressions in Z-138 xenografts are associated with a marked decrease in proliferation and induction of apoptosis as well as initial downregulation of bcl-2, bcl-x L , mcl-1 and IL-10  124  Figure 5 .3 Rituximab treatment in Z-138 xenografts is associated with a decrease in expression of CD20 and no significant change in expression of Fas  126  Figure 5 .4 CD40 expression is greater in JVM-2 cells compared to Z-138 cells and CD40/CD40L is downregulated following treatment with Rituximab in Z-138 xenografts 129 Figure 5 .5 A high expression of sFaL is observed in MCL cell lines and mFasL is expressed on endothelial cells lining blood vessels of Z-138 tumors  x  131    LIST OF ABBREVIATIONS  ADCC  Antibody-dependent cell-mediated cytotoxicity  AGO  Argonaute  AIDS  Acquired immune deficiency disorder  AKT  v-akt murine thymoma viral oncogene  AP-1  Activator protein 1  ARL  AIDS-related lymphoma  ASCT  Autologous stem cell transplant  ASO  Antisense oligonucleotide  ATP  Adenosine triphosphate  BAC  Bacterial artificial chromosome  Bak  Bcl-2 homologous antagonist/killer  Bax  Bcl-2 associated X protein  Bcl-2  B-cell CLL/lymphoma 2  Bcl-6  B-cell CLL/lymphoma 6  BCR  B-cell receptor  Bid  BH3 interacting domain death agonist  Bp  Base pair  BSA  Bovine serum albumin  BSAP  B-cell specific activator protein  CaM-KII  Calcium/calmodulin-dependent kinase II  CDC  Complement dependent cytotoxicity  CDK  Cyclin-dependent kinase  CD40L  CD40ligand  cDNA  Complementary DNA  c-FLIP  Cellular FLICE-inhibitory protein  CHOP  Cyclophosphamide, doxorubicin, vincristine, prednisone  CKII  Casein kinase II  CLL  Chronic lymphocytic leukemia  CO2 dioxide 	Carbon  xi    Cy5  Cyanine 5  DAPI  4', 6-diamidino-2-phenylindole  DISC  Death inducing signaling complex  DLBCL  Diffuse large B-cell lymphoma  DNA  Deoxyribonucleic acid  DNAse  Deoxyribonuclease  dsRNA  Double stranded RNA  dUTP  2'-Deoxyuridine 5'-Triphosphate  EBNA2  Epstein Barr virus nuclear antigen 2  EBV  Epstein Barr virus  EDTA  Diaminoethanetetraacetic acid  EGFR  Epidermal growth factor receptor  EPICS  Experimental physics and industrial control system  ERK  Extracellular signal regulated kinase  ESP  Eclipse screensaver project  ETS  v-ets erythroblastosis virus E26 oncogene  FADD  Fas associated death domain protein  FAM  6-carboxyfluorescein  FasL  Fas ligand  Fc  Fragment crystallizable region  FDA  Food and drug administration  FDC  Follicular dendritic cell  FISH  Fluorescence in situ hybridization  FITC  Fluorescein isothiocyanate  FL  Follicular lymphoma  GC  Germinal center  GSK3 (3  Glycogen synthase kinase 3p  HDT  High dose therapy  Her  Herceptin  Her-2  ERBB2 (v-erb-b2 erythroblastic leukemia viral oncogene homolog 2)  xii    HIV  Human immunodeficiency virus  HRP  Horseradish peroxidase  IFN  Interferon  Ig  Immunoglobulin  IGH  Immunoglobulin heavy chain  IgV  Immunoglobulin variable region  IL  Interleukin  Ip  Immunoprecipitation  ISCN  International system for human cytogenetic nomenclature  ITAM  Immunoreceptor-tyrosine-based-activation-motif  JNK  Jun N-terminal kinase  Kb  Kilobase  KDa  Kilodalton  Lck  Leukocyte-specific tyrosine kinase  LDEV  Lactose dehydrogenase-elevating virus  LMP-1  Latent membrane protein 1  Lyn  Yamaguchi sarcoma viral (v-yes-1) oncogene homolog  MAC  Membrane attack complex  MALT  Mucosa-associated lymphoid tissue  MAPK  Mitogen activated protein kinase  MCL  Mantle cell lymphoma  Mcl-1  Myeloid cell leukemia sequence 1  Mcm-2  Minichromosome maintenance complex component 2  Mdm-2  Mouse double minute 2  mFasL  Membrane bound Fas ligand  MFI  Mean fluorescence intensity  mFISH  Multi-color fluorescence in situ hybridization  MHC  Major histocompatibility complex  MMO  Mismatch polarity control oligonucleotide    mRNA  Messenger ribonucleic acid  MYC  v-myc myelocytomatosis viral oncogene homolog  NF-KB  Nuclear factor kappa B  NHL  Non-Hodgkin's lymphoma  NIK  Nuclear factor KB (NF-KB) inducing kinase  NK  Natural killer cell  Non-ARL  Non-AIDS related lymphoma  OBL  Oblimersen  PARP  Poly (ADP-ribose) polymerase  PBGD  Porphobilinogen deaminase  PBS  Phosphate buffered saline  PBSB  Phosphate buffered saline and 0 .1% bovine serum albumin  PE  Phycoerytherin  PECAM  Platelet endothelial cell adhesion molecule  PFS  Progression free survival  Phospho  Phosphorylated  PI  Propidium iodide  PKB  Protein kinase B (Akt)  PKC  Protein kinase C  PLCy  Phospholipase C gamma  Rafl  V-raf murine leukemia viral oncogene homolog 1  Rag-2M  Recombination activating gene 2  Ras  Neuroblastoma Ras viral oncogene homolog  Rb  Retinoblastoma protein  REAL  Revised European American lymphoma classification  RISC  RNA inducing silencing complex  RKIP  Rafl kinase inhibitor protein  RNA  Ribonucleic acid  RNAi  RNA interference  RNAse  Ribonuclease  RNPase  Ribonucleoproteinase  xiv    RPMI  Roswell park memorial institute medium  RPO  Reverse polarity sense control oligonucleotide  RT-PCR  Reverse-transcriptase polymerase chain reaction  Rtx  Rituximab  SDS  Sodium dodecyl sulfate  SDS-PAGE  Sodium dodecyl sulfate polyacrylamide gel electrophoresis  Ser  Serine  sFasL  Soluble Fas ligand  siRNA  Short interfering RNA  sIg  Surface immunoglobulin  SPSS  Statistical package for the social sciences  SRC  v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog  SSC  Sodium chloride-sodium citrate buffer  ssRNA  Single stranded RNA  STAT-3  Signal transducer and activator of transcription 3  TAMRA  6-carboxy-tetramethyl-rhodamine  Thl  T helper cell 1  Thr  Threonine  TLR  Toll like receptor  TMA  Tissue microarray  TNF  Tumor necrosis factor  TNFR  Tumor necrosis factor receptor  TRADD  TNFRSFIA-associated via death domain  TRAIL  TNF-related apoptosis ligand  TRITC  Tetramethyl rhodamine iso-thiocyanate  Tyr  Tyrosine  UTR  Untranslated region  VEGF  Vascular endothelial growth factor  WHO  World health organization  XIAP  X-linked inhibitor of apoptosis protein  YY1  Ying Yang 1  xv  ACKNOWLEDGEMENTS  There are many people who have helped me get through the trials and tribulations that accompany the graduate program and without their continued support this thesis would not be in existence today . To the animal technicians, thank you for taking the time to show me all the techniques needed to do the animal work contained in this thesis . To Hong, thank you for your continued support and your laughter both in the animal facility and the tissue culture facility . I would also like to extend my gratitude to both the current and past students and others in my lab who have provided me with a great deal of support over the years, and who are too numerous to mention. To Ghania and Anita thank you for your friendship and continued support over the years . I would also like to thank Dr. Micheal Williams for inspiring a true sense of integrity in me and introducing me to Mantle cell lymphoma . Your continued friendship and our discussions over the years have been invaluable to me. To Dr . Randy Gascoyne, for helping me through some of the harder portions of this PhD and for being willing to come to my aid whenever I needed you . I would also like to extend a huge thank you to Dr . Brad Hoffman and Alastair Kyle, my collaboraters who have helped me a great deal over the years and whose continued support and scientific discussions have been invaluable to me . I would also like to thank my committee members at this time, Dr . Pelech, Dr. Duronio, Dr . Hoodless and Dr . Fyfe whom have been excellent in providing me with feedback and also being available, sometimes on very short notice, to come to meetings or edit this thesis . To Dr . David Walker, for all the great discussions and friendship, thank you for being such a great advisor . To Dr.  xvi  James Goldie, my mentor, thank you for the stimulating conversations and your inspiration. To Dr. Marcel Bally and Dr . Richard Klasa my supervisors, I am not sure I have enough space to thank you both properly. Thank you for your confidence in me, thank you for believing in me, thank you for everything . Without you both I surely wouldn't have come this far. To Marcel Bally, words can't describe what we've been through together. Thank you for teaching me how to write and how to edit . Thank you for caring so much about your students and pushing us when needed . Lastly I would like to thank my family whose support have been phenomenal over the years and especially to my mother (and company) .  xvii  DEDICATION  This thesis is dedicated to those whose lives have been touched by cancer over the course of the years that it took me to complete this dissertation:  To Jake's family, to Richard's family, to Rocky and Sarah's family, to Cliff, to Lesley and lastly to my Opa .  xviii  CO-AUTHORSHIP STATEMENT  This thesis was written in its entirety by me (Catherine Tucker) . The papers submitted as detailed in appendix C have all been written in full by me . In addition the execution, design and data analysis of the content contained in this thesis were carried out in full by me . Co-authors of the papers submitted in appendix C contributed by editing the manuscripts as well as teaching and providing feedback on experiments performed.  xix  CHAPTER 1 INTRODUCTION  1.1 Mantle cell lymphoma : The clinical problem The clinical course of Mantle cell lymphoma (MCL) is aggressive and conventional chemotherapy treatment regimens are proving to be of little value in terms of increasing long-term survival rates . Local (BC Cancer Agency, British Columbia) experience confirms worldwide statistics showing that despite initial chemotherapyresponsiveness, the outcome is consistently and depressingly bad with a median overall survival of 43 months from diagnosis (Argatoff et al ., 1997). More significantly, regardless of therapy, no plateau is seen on the survival curve . Lacking the slow evolution of indolent lymphomas (follicular lymphoma) and the curability of more aggressive entities (large B cell lymphoma) means that MCL poses a clinical management challenge . Currently, there is no consensus as to what constitutes appropriate treatment at any stage of the disease . Even high dose chemotherapy protocols with purged autologous stem cell rescue have yet to demonstrate any curative potential and most patients are not candidates for aggressive chemotherapy/stem cell transplantation protocols due to age and comorbid disease (Andersen et al ., 1997; Freedman et al., 1998) . Therefore, there remains a substantial need for improvement in the therapeutic approach of MCL and the primary aim for this research was to develop preclinical models of MCL that could then be used to better understand treatment resistance.  1  1.2 Background A malignancy of B-lymphocytes, MCL accounts for 3 to 10% of all nonHodgkin's lymphomas (NHLs) (Swerdlow et al ., 2001) . Although MCL is only a small subset of NHL, there has been a significant rise in the incidence of NHL over the last four decades, a rise that is so significant that some epidemiologists have referred to it as an epidemic of NHL . The incident rate for NHL was increasing at a rate of approximately 3-4% per year in the 1970s and 1980s (Muller et al ., 2005) . Incidence rates stabilized in the 1990s, nevertheless still with an annual rise of 1-2% (Muller et al., 2005) . Similar increases in NHL incidence have been noted in international cancer registries in addition to well-defined population-based registries (reviewed in Muller et al .,  2005) . In Canada, 6,800 new cases of NHL were estimated for 2007 (Statistics  Canada, 2007) with over 63,190 estimated new cases in the United States (Jemal et al ., Cancer Statistics 2007). As may be expected the increased incidence of NHL is also associated with increased mortality and NHL is now the 5 th leading cause of cancer death (Muller et al ., 2005) . This rise in incidence can partly be attributed to the aging U .S . population, the AIDS pandemic, changes in NHL classification, modern diagnostic tools and infectious, environmental and occupational risk factors (reviewed in Muller et al., 2005) . However, even when factors such as accuracy and completeness of diagnosis, the effect of human immunodeficiency virus, and occupational exposures are considered, the reason for most of the increase in NHL incidence remains unexplained . Many investigators have postulated that a ubiquitous environmental or toxic exposure is responsible (Muller et al., 2005) and thus the incidence of NHL will probably continue to rise . We can anticipate  2  that the incidence rate of MCL will also increase, yet as a patient subpopulation, clinicians and pathologists understand that once prognostically identified there is no standard therapy available to effect improved long-term survival. Three different histologic patterns (mantle zone, nodular, and diffuse) (Lardelli et al.,  1990 ; Banks et al ., 1992) and three different cytological variants (classical, blastic  and pleomorphic) have been described (Zucca et al ., 1994 ; Swerdlow et al., 1996 ; Ott et al .,  1998) . The blastoid variant is reported in some studies to be more aggressive  (Swerdlow and Williams, 2002) . MCL is generally a tumor of older adults, with a marked male predominance (75%) (Argatoff et al., 1997 ; Armitage and Weisenburger, 1998) . Patients present with generalized disease, and have a poor prognosis . The majority (70%) of patients are in stage IV at diagnosis ; with metastasis in sites including lymph nodes, spleen, Waldeyer's ring, bone marrow (greater than 60%), peripheral blood (up to 50%), and other extranodal sites, especially the gastrointestinal tract (lymphomatous polyposis) (Argatoff et al ., 1997; Samaha et al., 1998 ; Cohen et al., 1998; Campo et al., 1999) . The median overall survival for patients with Mantle cell lymphoma is 3 years, with no plateau in the curve, and failure-free survival after initial treatment is around 1 year (Argatoff et al., 1997; Samaha et al ., 1998). It is one of the poorest prognostic subtypes of NHL (Hiddemann et al ., 1998 ; Callea et al ., 1998; Samaha et al ., 1998), and is not curable with any standard therapies (Zucca et al., 1995; Meusers et al ., 1997 ; Oinonen et al ., 1998) .  3  1 .3 Classification of Mantle cell lymphoma Mantle cell lymphoma was only recognized as a separate clinical entity in 1992 (Banks et al., 1992) . Previously it was classified under a variety of entities such as centrocytic cell lymphoma, mantle zone lymphoma and intermediately differentiated lymphocytic lymphoma (Decaudin, 2002) . Only in 1994 and in 1999 did the REAL and the WHO classification systems recommend that Mantle cell lymphoma be recognized as a distint clinical entity and be distinguished based on a series of morphologic, immunophenotypic and cytogenetic features (Harris et al ., 1994 ; Harris et al., 1999) . As such preclinical models of MCL were practically non-existent and the ones in existence were not available for widespread use, which contributed to the lack of understanding of MCL pathogenesis and the poor treatment outcomes associated with this disease . The research presented in this thesis describes the development of some of the very first characterized preclinical MCL models (see Chapter 3).  1 .4 Molecular lesions in Mantle cell lymphoma Virtually all MCL contain the t(11 ;14)(g13 ;g32) translocation involving the cyclin D1 gene, and show over-expression of both cyclin D1 mRNA and protein levels (de Boer et al ., 1995a; Swerdlow and Williams, 2002) . The translocation juxtaposes IGH sequences at 14g32 to a region variously termed BCL1/PRAD1 at 11g13, on the derivative chromosome 11 (Tsujimoto et al., 1984; Motokura et al ., 1991) . Detailed molecular analysis identified BCL 1 to be a gene coding for the G1 cyclin, cyclin D1, which is an important regulator of the G1/S transition of the cell cycle (Withers et al., 1991 ; Schuuring et al., 1992). T(11 ;14) translocations in MCL are invariably into or near  4  a JH segment, which implicates an error in VDJ recombination (Stamatopoulos et al ., 1999; Swerdlow and Williams, 2002) . The immunophenotype (strong surface IgM, CDS+, CD 10-, CD23-, cyclin D 1+ and B cell markers+, such as CD 19+, CD20+) is remarkably constant (Decaudin, 2002). Deregulation of cell proliferation is one of the hallmarks of malignant neoplasias and tumor cells have typically acquired damage to genes that directly regulate their cell cycles . Oncogenic processes exert their greatest effect by targeting particular regulators of G1 phase progression . Studies have shown abnormalities in expression of other genes in MCL associated with cell cycle, including loss of function mutations of the cyclin dependent kinase (cdk) inhibitors p16 and p18 (Dreyling et al ., 1997; Williams et al ., 1997; Pinyol et al ., 1998) . These mutations have been associated with blastoid transformation, extranodal dissemination, and short survival in MCL (Swerdlow and Williams, 2002) . A decreased expression of p27, another cdk inhibitor, has been shown in the majority of cases for MCL (Quintanilla-Martinez et al ., 1998) . However, recently, the same group that observed loss of p27 expression in MCL have now discovered that p27 is highly sequestered by cyclin D1 in MCL, and this causes a lack of recognition of p27 (Quintanilla-Martinez et al ., 2003), which will be further discussed in Chapter 4 of this thesis.  1 .5 Critical role of cyclin D1 in cell cycle progression Since loss of cell cycle control may contribute to tumor formation, it is interesting that cyclin D1 has been found to be over-expressed in a wide variety of human cancers including esophageal, breast, and head/neck carcinomas (Withers et al., 1991 ; Seto et al.,  5  1992; Diehl, 2002). Cyclin Dl expression is activated in certain head/neck, esophageal, breast, and hepatocellular carcinomas as a result of chromosomal amplification at the 11q13 region (Berenson et al., 1989 ; Jiang et al., 1993 ; Nishida et al., 1994) . Cyclin D1 is also over-expressed in some parathyroid adenomas by a chromosomal inversion, resulting in the control of cyclin D1 expression by the parathyroid hormone gene promoter (Motokura et al ., 1991) . A schematic illustration of the cell cycle is depicted in Figure 1 .1.  Figure 1.1. Cell cycle control . The signaling pathway from mitogens through Ras activates expression of cyclin D1 . Cyclin D1 mediated phosphorylation of the retinoblastoma protein (Rb) leads to release of the transcription factor E2F . This plays an important role in controlling the restriction point observed during the growth phase transition from Go to S phase of the cell cycle . Expression of cyclin dependent kinase inhibitors, such as p16 and p 18, has been shown to be deregulated in MCL (Swerdlow and Williams, 2002) .  6  Cyclin D1 was first identified as a delayed immediate gene induced by mitogenic stimulation . Its promoter contains mitogen responsive Ets and AP-1 binding sites (Albanese et al., 1995) . The tandem occurrence of Ets and AP-1 sites has been shown to respond to Ras signaling (Albanese et al., 1995). In fact, Ras has been reported as a potent inducer of cyclin D1 expression (Winston et al ., 1996 ; Villalonga et al ., 2000). Once induced, cyclin D1 forms complexes with cyclin dependent kinase (cdk) 4 or 6 (reviewed in Hunter and Pines, 1994) . Cyclin association is required for cdk activity (Sherr, 1996) . Cyclin D1-associated kinases play an essential role in governing the G1/S transition (Sherr, 1994) . Cyclin D1 also titrates the inhibitors of other cdks, by physical association, resulting in their activation to further facilitate G1/S transition or their inactivation in the case of p27 to prevent cell cycle inhibition (Koff et al., 1992; Sherr and Roberts, 1999) . The role of cyclin D1 in p27 sequestration/inactivation in MCL will be further discussed in Chapter 4 of this thesis . Because of its responsiveness to mitogens and its requirement during cell cycle progression, cyclin D1 is a pivotal molecule connecting the mitogenic signaling system to the cell cycle control machinery. Cyclin Dl-associated cdks play a vital role in phosphorylating the retinoblastoma protein (Rb) (Hunter and Pines, 1994) . Rb is a well-established in vivo substrate of cyclin D1/CDK complexes (Xiao et al., 1996) . Underphosphorylated forms of Rb bind the E2F/DP transcription factor complexes, and repress their transcriptional activity by recruiting repressor molecules, such as histone deacetylase and/or nucleosome remodeling complex to the proximity of the promoter regions containing the E2F/DP binding motif (Grana et al., 1998). E2F/DP binding sites have been identified in promoters of many genes whose products are essential for G1/S transition (cyclin E or A)  7  or DNA synthesis (dihydrofolate reductase, DNA polymerase alpha, cdc 6, etc) (reviewed in Grana et al ., 1998) . Therefore, when Rb is underphosphorylated, the expression of these genes required for S phase is suppressed . Upon phosphorylation by cyclin D l /CDK complexes, E2F/DP complexes are released from Rb and activate target genes (Weintraub et al ., 1995 ; Xiao et al., 1996). Once E2F/DP target genes are expressed, growth factors are no longer required for entry into the S phase of the cell cycle. In this way, the signaling pathway from mitogens through Ras and cyclin D1 to Rb is believed to play an important role in controlling the restriction point observed during the growth phase transition from the Go to the S phase of the cell cycle (Matsushime et al ., 1991).  1.6 Role of cyclin D1 in malignant transformation The role cyclin D1 plays in malignant transformation in general and MCL lymphomagenesis specifically has been controversial . Early studies showed that retroviral-mediated transfer of the cyclin D1 gene into rat fibroblasts results in overexpression of the cyclin D1 protein, shortening of the G1 phase of the cell cycle and gives transfected cells the potential to form tumors in nude mice (Jiang et al., 1993). In addition constitutive over-expression of cyclin D1 in transgenic mice resulted in a malignant predisposition namely, mammary hyperplasia and carcinoma (Wang et al ., 1994). These early studies suggested that cyclin D1 has the potential to cause malignant transformation . However, transgenic murine models with enforced B-cell cyclin D1 expression in the context of immunoglobulin heavy chain enhancer and promoter elements do not show lymphoma development unless crossed with transgenic murine  8  strains with active MYC or RAS (Lovec et al., 1994; Bodrug et al., 1994) . These observations indicated that although cyclin D1 over-expression is necessary for the MCL phenotype, its over-expression may not be sufficient to generate malignant transformation . Gladden et al . (2006) recently demonstrated in lymphoma models that cyclin D1 oncogenicity was manifested via retention of cyclin Dl in the nucleus . These investigators developed a cyclin D1 nuclear export deficient mutant and showed that these transgenic mice were predisposed to B-cell lymphoma . Given the proliferative potential of the cyclin D1 nuclear export deficient mutants, they expected to see a hyperproliferative disorder or early tumorigenesis . However, this was shown to be countered by an increase in cell death . Importantly, onset of lymphoma in these models correlated with perturbations in p53/mdm-2/p 19Arf expression and over-expression of bcl-2 (Gladden et al ., 2006) . This indicates that cyclin D1 over-expression can act as an oncogene but also acts in conjunction with other cell signaling molecules to induce lymphomagenesis . The role of cyclin D1 in MCL is further discussed and analyzed in Chapter 4.  1.7 Overview of apoptosis Normally cells are under a tight regulation of cell expansion and coincident cell death. Cancerous cells, however, have lost this function and an irregular expansion of a cell population is associated with aberrant cell signaling pathways involved in the control of both proliferation and apoptosis. The importance of these processes was highlighted by the investigations of Gladden et al . (2006) described above. The processes governing apoptosis are important in MCL . The main biological features  9  associated with apoptosis include the release of cytochrome c from mitochondria and subsequent activation of the caspase cascade (reviewed in Thornberry and Lazebnik, 1998) . Two main cell signaling pathways involved in the control of apoptosis have been described; the extrinsic and intrinsic apoptotic pathways (see Figure 1 .2). The extrinsic apoptotic pathway is initiated through the binding of ligands FasL, Trail and tumor necrosis factor (TNF) to their respective trimerized receptors, CD95/Fas/Apol, DR4/5 and TNFR1 (Krammer, 2000; Locksley et al ., 2001 ; Wang and El-Deiry, 2003) (Figure 1 .2) . Two pathways activated by the death receptors have been identified and are defined as type I and type II pathways (Scaffidi et al., 1998; Hua et al ., 2005) . Once initiated, effector molecules such as Fas associated death domain (FADD) and TRADD are recruited to form a death inducing signaling complex (DISC), which leads to recruitment/activation of caspase 8 (reviewed in Borner, 2003 ; Wang and ElDeiry, 2003) . Activation of the DISC can be inhibited by recruitment of the cellular FLICE inhibitory protein (c-FLIP), instead of caspase 8, preventing cell death (van Eijk et al.,  2001 ; Wang and El-Deiry, 2003) . Activated caspase 8 can either induce the type I  pathway by directly activating the caspase cascade or induce the type II pathway by initiating cleavage of Bid, generating a p15 fragment that translocates to the mitochondrion and induces cytochrome c release leading to the activation of the caspase cascade and apoptosis (Green, 2000) .  10    FasL TNF  •~~ DR4/5 ♦? s TNFR1 ♦!e l► sssssssss•s• ► lofsssspss~~~ : sssi ? ssss 1 W•ssssssssss~ *• ssss sssss ;: sss~ vsss I A~  1  ~FADD~  FADDit.,  TRADD  caspase 8 Bid  bcl-2, bax, mcl-1, bak  I caspase 3  mitochondrion  0  o p 0 0  cytochrome c  pro-caspase9  caspase 9  apoptosome  Figure 1 .2. Overview of the intrinsic and extrinsic apoptotic pathways . The extrinsic apoptotic pathway relies on death receptors to mediate assembly and activation of a death inducing signaling complex (DISC) leading to the recruitment/activation of caspase 8 . Activation of caspase 8 can then either directly activate caspase 3 leading to apoptosis or activate Bid to induce cytochrome c release from the mitochondrion leading to apoptosis . The intrinsic pathway relies on the expression of the bcl-2 family of proteins which can be either pro or anti-apoptotic . The balance of these proteins located at the mitochondrial membrane will eventually determine if apoptosis will occur . Once apoptosis is initiated cytochrome c is released from pores in the mitochondrial membrane and induces a cascade of events leading to caspase 3 activation and induction of cell death. Adapted in part from Lambert et al . (2003); Wang and El-Deiry, (2003) ; Borner, (2003), Hua et al . (2005). 11  The intrinsic apoptotic pathway largely involves members of the bcl-2 family of proteins (see Figure 1 .3) . As outlined elsewhere in this thesis (Chapter 4) a large amount of information can be learned about the role of bcl-2 expression in MCL through the use of treatment strategies that inhibit its expression . Permeabilization of the mitochondrial membrane through the formation of permeability transition pores can be caused by proapoptotic proteins (bax, bak, bid) (Tsujimoto, 2002) or second messengers (calcium, ceramide derivatives and reactive oxygen species) (Zoratti and Szabo, 1995) . The release of cytochrome c can be countered by anti-apoptotic proteins (bcl-2, mcl-1) (Tsujimoto, 2003) . In this manner, the ratio of pro and anti-apoptotic members of the bcl-2 family of proteins can determine the apoptotic status of the cell (Adams and Cory, 1998 ; Borner, 2003) . Release of cytochrome c into the cytosol leads to oligomerization of apafl and recruitment/activation of caspase 9 leading to the formation of a complex called an apoptosome (Thornberry and Lazebnik, 1998) . Once activated, the apoptosome induces the activation of downstream caspases, including caspase 3 . Active caspase 3 leads to cleavage of caspase substrates such as, poly (ADP-ribose) polymerase (PARP), which plays a critical role in DNA repair and interacts with many DNA replication/repair factors, eventually leading to induction of caspase-dependent cell death (Thornberry and Lazebnik, 1998) .  12  BcI-2 Bcl-xl BcI-w Mcl-i Al Diva  Bax Bak Mtd (bok) BcI-rambo  Bik Bad Bid Bim Hrk (DP5) Noxa Blk Bnip3 Bnip3L Puma p193 Bmf Bcl-G  Figure 1 .3 . The bcl-2 family of proteins . These proteins largely make up the intrinsic pathway of apoptosis and the balance of both pro and anti-apoptotic proteins at the mitochondrial membrane determines if apoptosis will occur. In addition many of the anti-apoptotic proteins such as bcl-2, bcl-x L and mcl-1 have been shown to be overexpressed in lymphomas and are responsible in part for inducing chemoresistance to a multitude of therapeutic agents (Reed et al ., 1994 ; Gottardi et al ., 1996 ; Zhou et al., 1997 ; Khoury et al ., 2003) . Adapted from Tsujimoto et al. (2003).  13  1.8 Proliferation and apoptosis in Mantle cell lymphoma Mantle cell lymphoma cells have been shown to be arrested in the G1 phase of the cell cycle (Obermann et al., 2005). Typically normal mantle zone cells are composed of resting quiescent naive B cells or terminally differentiated plasma cells that exhibit downregulation of cell cycle genes such as Ki67, Mcm2 and geminin (Obermann et al ., 2005) . Ki67 is an antigen that is strictly associated with cell proliferation . Thus, Ki67 expression can be used as a proliferative index, as it is expressed at all stages of the cell cycle (Gerdes et al ., 1984; Endl and Gerdes, 2000 ; Brown and Gaffer, 2002) and it has been shown to be an important predictor of survival in MCL (Katzenberger et al., 2006). During cell proliferation the initiation of chromosome replication relies on the proper assembly of pre-replicative complexes at replication origins during late mitosis and early G1 phase (reviewed in Obermann et al ., 2005). Mcm2 is a protein that binds to prereplicative complexes rendering chromatin competent for DNA replication during the S phase of the cell cycle (Blow and Hodgson, 2002) . Geminin is a protein that is responsible for hindering the activity of replication origins needed for the proper assembly of chromosomes during the S, G2 and M phase of the cell cycle (McGarry and Kirschner, 1998) . In MCL, a low proportion of cells were found to express Ki67 and geminin, which indicated that these cells failed to progress through S/G2/M phases of the cell cycle, although they had a high expression of Mcm2 which indicated that the lymphoma cells had the potential to progress through the cell cycle (Obermann et al ., 2005) . It is possible that MCL cells undergo periodic cell expansion and therefore a low proliferation index, which may protect the cells from cytotoxic insults such as those  14  caused by chemotherapeutic agents aimed largely at killing proliferating cells . By still retaining the ability to progress rapidly through the cell cycle (high Mcm2 levels) MCL cells that procure additional genetic abnormalities, such as those affecting apoptosis may then progress to a more aggressive highly proliferative state such as those seen in the blastoid variant (Swerdlow and Williams, 2002 ; Obermann et al ., 2005) . Evidence for this comes from studies showing that MCL has a low apoptotic rate (Hermann et al ., 1997; Khoury et al., 2003). One gene microarray study indicated a skew towards altered expression of anti-apoptotic genes versus cell proliferation genes (Hofmann et al ., 2001). Furthermore, apoptosis does not increase in parallel with proliferation nor does it vary with cytological grade in MCL, indicating that in MCL apoptosis and proliferation are uncoupled (Khoury et al ., 2003).  1 .9 The normal progression of B cell differentiation To understand the deregulation of cell processes involved in cell proliferation and apoptosis in MCL it is useful to understand how MCL arises . MCL is classified as a mature B-cell neoplasm. Mature B-cell neoplasms comprise around 85% of all nonHodgkin's lymphomas. The most frequently occurring are follicular lymphoma (FL) and large B-cell lymphoma (LBCL) which account for around 50% of all mature B-cell neoplasms (Harris, 2001) . Mature B-cell neoplasms tend to arise from a clonal expansion of B cells at various stages of B-cell differentiation . The stages of B cell differentiation are summarized in Figure 1 .4.  15    precursor B-lymphoblast CD19+,CD10+  Bone Marrow  0  (Acute lymphoblastic leukemia) naive B cell CD23+,CD20+ CDS+, slgM/D+  0  Primary Follicle Marrow Blood Lymph node Paracortex Lymph node Medulla  (Chronic lymphocytic and small lymphocytic leukemia)  B-immunoblast clgM+,CD20+  plasmacytoid lymphocyte clgM+,CD20+  (Large B cell lymphoma)  (Lymphoplasmacytic lymphoma)  plasma cell IgG/A+, CD20-  (plasmacytoma myeloma)  Bone Marrow  GERMINAL CENTER  Figure 1 .4. Stages of B-cell differentiation. Lymphomas arise from B cells at different stages of development and have been named accordingly . In some lymphomas the B-cell stage of development is less clear and has been shown to have a heterogeneous origin. Adapted from Harris (2001), In : World Health Organization classification of tumors. Pathology and genetics of tumours of haematopoietic and lymphoid tissues p122-123.  16  In part, these neoplasms have been identified and named after the stage of B-cell differentiation in which they arise as differences in cell morphology, and immunophenotypes allow them to be readily distinguished according to their postulated cell of origin (Harris, 2001) . However, classification of these diseases does not solely rely on their normal counterpart as lymphoproliferative disorders such as Hairy cell leukemia have no clear correspondence to a normal B-cell differentiation stage and chronic lymphocytic leukemia (CLL) appears to arise from a heterogeneous origin (Harris, 2001). Distinct differentiation steps leading to B cell maturation are characterized by the specific structure of the B cell receptor (BCR) which is composed of two identical heavychain and two identical light-chain immunoglobulin (Ig) polypeptides (Kuppers, 2005). There are five functional classes of immunoglobulin (IgM, IgD, IgG, IgA and IgE) (Janeway and Travers, 1997) . The journey of the maturation of a B cell begins within the bone marrow where a precursor B lymphoblast gives rise to a naive B cell after successfully undergoing rearrangement of their Ig heavy- and light-chain genes to produce a functional BCR (termed VDJ gene rearrangement) (Kipps, 1989) . B cell precursors that fail to produce a functional BCR undergo apoptosis while cells that express a functional BCR leave the bone marrow and differentiate into naive B cells (Kuppers, 2005) . These small resting naive lymphocytes circulate in the blood and within the lymphoid system in primary lymphoid follicles and follicle mantle zones until they encounter antigens (Kipps, 1989 ; Inghirami et al ., 1991). They express surface immunoglobulin (slg) such as IgM+ IgD+ and are usually positive for the cell surface  17  antigen CDS+ (Kipps, 1989) . Mantle cell lymphoma and B cell chronic lymphocytic leukemia (B-CLL) are positive for CD5 (Hummel et al., 1994 ; Du et al ., 1997) . Once a circulating naive B-cell encounters antigen it undergoes a blast transformation and migrates to the primary follicle forming a germinal center (Liu et al ., 1991 ; MacLennan, 1994) . It is within the germinal center where B cell immunoglobulin genes are modified by somatic mutation and class switch recombination which leads to the heterogeneity of antibody expressing B-cells which now exhibit differences in affinity for their respective antigens and allows for intraclonal diversity to arise from only a few progenitors (French et al.,  1989 ; Jacob et al ., 1991) . Germinal center B cells can only survive and undergo  clonal expansion if the somatic mutations in the variable region genes of the heavy- and light- chains of immunoglobulin result in expression of a BCR which exhibits an increased affinity for a cognate ligand . Autoreactive B cells that exhibit a weak affinity for antigen binding undergo apoptosis . Only high affinity binding B cells hence progress to the development of a mature plasma secreting cell . As the distinct stages of B cell differentiation are characterized by the structure of the BCR and expression patterns of surface antigens, analysis of these features were used to determine the origin of B-cell lymphomas (Kuppers, 2005). Germinal center (GC) blast cells are termed centroblasts . Centroblasts mostly lack surface Ig with some cells expressing IgM or IgG, IgA and express the cell markers CD 10+ and bcl-6+ (MacLennan et al ., 1990 ; Pittaluga et al ., 1996) . The bcl-6 gene is often targeted by the hypermutation machinery (somatice hypermutation and class switch recombination) in normal B cells and since these processes occur in the germinal center, bcl-6 expression has been used as an indicator for lymphoma cells that may have  18  originated in the germinal center (Kuppers, 2005) . Centroblasts (GC B cells) are large proliferating cells which have lost expression of the anti-apoptotic protein bcl-2 and thus are susceptible to apoptotic stimuli (Nunez et al., 1990 ; Hockenbery et al., 1991). Tumors which resemble centroblasts are large B-cell lymphomas and Burkitt's lymphoma which often have mutated Ig genes and express bcl-6 (Harris, 2001). Centroblasts eventually mature into centrocytes in the germinal center . Depending on the affinity of their antibody receptors to antigens, centrocytes will either undergo apoptosis or re-express bcl-2 to inhibit apoptosis (MacLennan, 1994) . Follicular lymphoma is a tumor that arises in the germinal center and is predominantly composed of centrocytes, which are considered resting cells ; thus follicular lymphoma has an indolent progression (Harris, 2001) . Follicular lymphoma cells fail to undergo apoptosis due to the t(14 ;18) translocation and associated over-expression of bcl-2. The interaction of centrocytes with follicular dendritic cells (FDC) and T cells leads to downregulation of bcl-6 expression (Cattoretti et al., 1995 ; Pittaluga et al ., 1996) and consequently differentiation into either memory B cells or plasma cells (MacLennan, 1994; Liu et al ., 1991). Memory B cells reside in the follicle marginal zones while plasma cells migrate to the bone marrow . Memory B cells are surface IgM+, IgD-, CD5-, CD10- and express pan B-cell markers such as CD20+ while plasma cells lack expression of slg and pan B-cell markers but express IgG+, IgA+ in the cytoplasm and CD79a+ and CD138+ on the cell surface (Harris, 2001) . Lymphomas that arise in the post germinal center B cells include marginal zone lymphomas (of MALT, splenic and nodal types) and plasma cell myeloma (Harris, 2001).  19  In summary, MCL is postulated to arise from peripheral B-cells of the inner mantle zone . MCL rarely demonstrates a true follicular growth pattern and most commonly a diffuse or vaguely nodular mantle zone growth pattern is observed . Some follicular dendritic cells have been shown to be present . Morphologically MCL cells most closely resemble centrocytes (Swerdlow et al., 2001) . MCL cells express intense surface IgM, IgD+ and are typically CDS+, CD 10-, bcl-6-, bcl-2+, and either CD23 negative or weakly positive, FMC-7+ and CD43+ (Swerdlow et al ., 2001 ; Swerdlow and Williams, 2002).  1 .10 Regulation of B cell clonal expansion in the Germinal Center MCL cells, as mentioned above, most closely resemble centrocytes which rely heavily on mechanisms of cell proliferation and apoptosis (Swerdlow et al ., 2001) . However, normal B-cell differentiation also relies on the regulation of either clonal expansion of high affinity antigen presenting B cells or cell death of undesirable low affinity antigen presenting or autoreactive B cells . In this regard, a tight regulation in cell cycle checkpoint genes needs to be observed in normal B cells . More specifically a crucial role for signaling through the CD40/CD40L and Fas/FasL pathways has been shown in the control of cell survival and cell death, respectively, in germinal center B cells (GuzmanRojas et al ., 2002) (see Figure 1 .5).  20    B cell  T cell =  B cell death  low affinity, autoreactive  B cell  T cell B cell survival  High affinity  B cell CD4I, CD40L (CD154)  abnormal, cancerous cell  autonomous  Figure 1 .5 . Determination of life and death in the Germinal Center by the expression of Fas/FasL and CD40/CD40L . Although typically CD40L is located only on T cells, it is now evident that a small subset of normal B cells and malignant B cells can express CD40L (CD 154) and this can lead to autonomous B cell growth (Clodi et al ., 1998a; Grammer et al ., 1999) (discussed in Chapter 5).  21  The interaction of CD40 with its ligand promotes B cell survival and proliferation but also concomitantly inhibits apoptotic signals (Spriggs et al ., 1992). Interestingly, although CD40 ligand (CD4OL/CD154) is predominantly expressed on T cells which then activate B cells expressing CD40 receptors, it has been shown that CD40L is coexpressed on malignant germinal center (GC) B cells and subsets of normal B lymphocytes in an autonomous fashion (Clodi et al., 1998a; Grammer et al ., 1999). Fas expression and coincident binding of its ligand leads to cell death of GC B cells (Nagata and Golstein, 1995) . Expression of c-Flip, as described earlier, can abrogate cell death signals induced by the Fas/FasL signaling pathways (van Eijk et al., 2001) and its expression is stabilized via CD40 signaling (Guzman-Rojas et al ., 2002) . GC B cells express high levels of Fas and have a preformed death inducing signaling complex (DISC) indicating they are primed to die (van Eijk et al., 2001) . In addition, they produce little to no bcl-2 protein but express bax and p53, which are both involved in apoptotic cell signaling pathways (Martinez-Valdez et al., 1996). Alterations in these cell signaling pathways can lead to malignant transformation and the survival of abnormal, autoreactive, low affinity antigen binding B cells. In Mantle cell lymphoma over-expression of bcl-2 occurs in the majority of cases (Tracey et al ., 2005) . Over-expression of bcl-2 can counteract the apoptotic response leading to clonal expansion of B cells and interestingly it can do this without a concomitant increase in cell proliferation (McDonnell et al ., 1989). Furthermore, bcl-2 has been shown to block the mitochondrial branch of Fas-induced apoptotic signaling (Scaffidi et al ., 1998; Hua et al., 2005) . The balance of CD40 and Fas expression in conjunction with their ligands is important for B cell selection, maturation and  22  homeostasis . In MCL, CD40 expression was shown to be abnormally high while Fas expression was either low or absent (Clodi et al ., 1998b) . In addition, exogenous expression of FasL had no effect on MCL cells, while exogenous addition of CD40L increased survival and rescued MCL cells from cell death (Clodi et al ., 1998b) . In Chapter 5 the abnormal expression of CD40/CD40L and Fas/FasL expression in MCL is further explored.  1 .11 Need for new targeted therapies The propensity for MCL cells to exhibit a low apoptotic rate coupled with a low proliferation rate is alarming as most chemotherapeutics are aimed at targeting proliferating cells . As indicated earlier, periodic cell expansion may have evolved in MCL cells to escape apoptotic signals . Thus targeting cell signaling pathways involved in the uncoupling of apoptosis and proliferation seen in MCL may be an important precursor to sensitizing cells to various cytotoxic insults. Antisense oligonucleotides (ASO) and short interfering RNA (siRNA) technology are potentially powerful tools for the generation of specific protein knockouts . The potential for rapid, rational drug design is vast as an ASO or an siRNA can be generated to target any gene product as long as the nucleic acid sequence of that gene is known. This has become a highly attainable goal with the completion of the human genome project . Furthermore, advances in technologies such as gene and protein microarrays have led to an increase in the acquisition of information available on aberrant cell signaling pathways in different malignant subtypes and thus the need to understand and modulate these pathways is growing . Both ASO and siRNA hold great promise as  23  therapeutic tools and are conceptually elegant strategies to overcome aberrant gene expression. However, many barriers have emerged in their applications as therapeutics and these are discussed below.  1 .12 Antisense oligonucleotides Antisense oligonucleotides (ASOs) are short unmodified or chemically modified single stranded sequences of DNA or RNA typically 18-25 nucleotides in length. Appropriately selected ASOs can act specifically to abrogate expression of a deleterious gene product. Through specific Watson-Crick base pairing ASOs function to block transfer of the genetic template by interfering with protein translation hence reducing the amount of functional protein available to the cell and ultimately leading to abrogation of its cellular activity (Helene and Toulme, 1990 ; Dias and Stein, 2002). Paterson et al . (1977) were the first to describe an antisense mediated inhibition of gene expression in Rous Sarcoma virus . One year later Zamecknik and Stephenson (1978) received the Lasker prize for showing inhibition of Rous Sarcoma virus replication and cell transformation in vitro using antisense oligonucleotides . It was not, however, until much later that Whitesell et al . (1991) demonstrated one of the first in vivo  activities of an antisense oligonucleotide against N-myc expression . Currently there  are over ten different sequences of antisense oligonucleotides being tested in ongoing clinical trials (Verreault et al ., 2006) and a phosphorothioate antisense to treat cytomegalovirus-induced retinitis in AIDS patients has been approved by the U .S . FDA (Orr, 2001).  24  Phosphodiester oligonucleotides were among the first ASOs to be synthesized, although their use as antisense reagents was limited due to an increase in susceptibility to nuclease degradation (Maier et al ., 1995) . To reduce nuclease sensitivity, modifications to the oligonucleotide backbone were made by replacing the non-bridging oxygen atoms at each phosphorous in the oligodeoxynucleotide chain by various substituent groups. The nature of activity of antisense oligonucleotides became more apparent from the substitution of these compounds . For instance, substitutions leading to an uncharged ASO (i .e. addition of a methyl group) greatly reduced its activity for the following reasons . Both uncharged and charged oligonucleotides cannot passively diffuse across the cell membrane as the energy barrier is too great and the large polar nature of oligonucleotides prevents passive diffusion (Akhtar et al., 1991 ; Lebedeva and Stein, 2001) . In vitro, ASOs need to be delivered with a carrier (i .e. cationic liposomes) to be therapeutically active (Monia et al., 1996 ; Jansen et al ., 1998) . However, in vivo, ASOs can be delivered in free form (Cotter et al ., 1994 ; Hijiya et al ., 1994) and are taken up by the cell by receptor-mediated endocytosis at low concentrations and predominantly by pinocytosis or fluid phase endocytosis at higher concentrations (Loke et al., 1989; Beltinger et al ., 1995) (see Figure 1 .6). Adsorption to the cell surface depends predominantly on charge, thus the ability of uncharged oligonucleotides to be taken up by the cell is greatly reduced (Lebedeva and Stein, 2001).  25  Pinocytosis: high concentration  Receptor mediated Endocytosis: low concentration . t  S  l•i••Ni!!1li~~R~!!1tl  • i  l~  e  ,, •,,,,,,, 0 0 .0 .0,,E,,l  lM •0004 . 0000 . ~0  Figure 1 .6. Antisense mediated uptake and mechanism of action . At low concentrations charged antisense oligonucleotides are taken up by the cell by receptor mediated endocytosis . At higher concentrations, charged antisense oligonucleotides are taken up by pinocytosis . Eliminating the charge on antisense molecules largely decreases uptake by the cell . One of the most effective mechanisms of action for antisense molecules has been shown to be the activation of RNase H (Lebedeva and Stein, 2001). RNase H recognizes antisense bound to its target mRNA and subsequently cleaves this complex leading to silencing of the target protein (Crooke, 1998).  26  Secondly, uncharged ASOs cannot activate RNase H . RNase H is a ubiquitous nuclear enzyme that recognizes DNA-RNA duplexes, cleaving its product and thus preventing protein translation and synthesis (Crooke, 1998) (see Figure 1 .6). Although other ASOs have been designed to inhibit protein translation via other methods, (i .e. inhibition of ribosome activity) these ASOs have been shown to be less active than ASO modifications that trigger activation of RNase H (Lebedeva and Stein, 2001) . For the above reasons, the development of phosphorothioate chemistry in which a non-bridging oxygen has been replaced with a sulphur atom in each internucleotide linkage revolutionized the antisense field, because of its increased resistance to nuclease degradation and its retention of charge allowing for proper adsorption to the cell surfaces of diverse cell types and hence triggering RNase H activity (Zamecnik and Stephenson, 1978; Agrawal et al., 1988; Lebedeva and Stein, 2001) . Because of these properties, phosphorothioate oligodeoxinucleotides have been shown to have the broadest range of activity in preclinical and clinical studies (Lebedeva and Stein, 2001) . In addition, phosphorothioated ASOs along with 2'-O- substituted oligoribonucleotides have led to mixed backbone oligonucleotides that have an increased nuclease resistance, higher binding affinity to target mRNA, reduced polyanionic and immunostimulatory activities and allow for less frequent dosing and oral delivery (reviewed in Agrawal and Kandimalla, 2004).  1.12.1 Non-specific sequence effects of antisense oligonucleotides Phosphorothioate oligodeoxinucleotides can be designed to be highly specific biologically active molecules but they have also been shown to exhibit non-specific  27  effects that can mediate therapeutic activity . Some of these non-specific effects are due to formation of quadruple-stranded tetraplexes and other high-order structures with oligonucleotides containing four contiguous guanosine residues (Wang and Patel, 1993). These complexes are highly biologically active charged molecules but may not act in an antisense mediated fashion (Lebedeva and Stein, 2001) . This problem can be avoided by selecting ASOs that lack G-quartets . Non-specific cleavage events mediated by RNase H can also occur as RNase H is an enzyme that does not require a complete complimentary Watson-Crick base pairing to occur to elicit its effects . Thus some non-specific effects have been due to cleaved products of similar sequence, as exemplified by different isoforms of protein kinase C (PKC) (reviewed in Lebedeva and Stein, 2001). The possibility of oligonucleotide binding to intracellular proteins, an effect that has led to the development of therapeutic aptamers capable of binding their targets with high affinity (Missailidis and Perkins, 2007), increases with the presence of internucleoside charge in oligonucleotides . Phosphorothioate oligodeoxynucleotides, for example, have an intrinsic ability to bind to heparin-binding proteins . Some examples include vascular endothelial growth factor (VEGF) and its receptors (Guvakova et al., 1995 ; Fennewald and Rando, 1995), the epidermal growth factor receptor erb family (EGFR) (Rockwell et al ., 1997) and some isoforms of PKC (Stein et al., 1993), all of which have been shown to be deregulated in cancer.  1 .12 .2 Immunologic effects of antisense oligonucleotides Arguably one of the most significant off target effects is the ability of antisense oligonucleotides containing CpG motifs to elicit immune responses by inducing the  28  release of cytokines, activating natural killer cells and macrophages and stimulating B cells (Krieg et al ., 1995 ; Ballas et al ., 1996; Roberts et al . ., 2005 ; Ballas, 2007) . CpG dinucleotides, present in bacterial, viral and plasmid or synthetic double or single stranded oligonucleotides, can also induce an immune response through activation of Toll like receptor 9 (TLR9) (Diebold et al ., 2004). Furthermore, CpG motifs can preferentially activate a Thl immune response which leads to the release of cytokines IL12 and IFNy, and have been explored for treatment of cancer, infectious diseases, asthma, allergies and as adjuvants with vaccines and antigens (Agrawal and Kandimalla, 2004). The immunostimulatory activity of CpG containing oligonucleotides has been shown to be dependent in part on the accessibility of the 5' end of the sequence, especially for TLR9 activation . Addition of large ligands at this end minimizes immunostimulatory activity of ASOs (Hemmi et al ., 2000) and as expected, short oligonucleotides attached through their 3' ends (3'-3'-linkage) to contain two 5'ends are significantly more potent as immunostimulatory agents (Kandimalla et al., 2002; Klinman, 2004) . CpG dinucleotides that are located closer to the 5' ends are more active than those close to the 3' end (Yu et al., 2002 ; Klinman, 2004). Second generation antisense oligonucleotides have been designed to contain modified CpG motifs without affecting mRNA hybridization while maintaining antisense activity and associated RNase H activation (Agrawal and Kandimalla, 2004) . Although ASOs are known to cause off target effects, these events can be monitored through the stringent use of control oligonucleotides that either have a scrambled nucleotide sequence or mimic properties observed in the ASO used such as CpG motifs, thus enabling the factors associated with non-specific events to be determined (Lebedeva and Stein, 2001).  29  Furthermore, some off target events may be fortuitous as CpG motifs leading to induction of the immune system have been shown to aid in the elimination of cancerous cells (Lebedeva and Stein, 2001) . In this thesis an antisense targeting bcl-2 has been used as a therapeutic tool for treating MCL models (see Chapter 4).  1 .13 RNA interference Most organisms have evolved systems to identify and protect against foreign genetic material, (i .e . bacteria express DNA endonucleases that can degrade DNA which exhibit non-self methylation patterns) (Tock and Dryden, 2005) . Higher order organisms have also evolved systems to protect against invading lower order organisms that express foreign genetic material . Not surprisingly, an ancient defense mechanism against invading nucleic acids termed RNA interference (RNAi) has been found to be present in cells of virtually every multicellular organism including yeast, fungi, plants and animals (Schlee et al., 2006) . The RNA interference pathway is a nucleic-acid based mechanism of defense against viruses, transgenes, transposons and mRNAs that are over-produced (Tang, 2005) . The RNAi machinery is activated in response to double stranded RNA (dsRNA) leading to sequence specific degradation of homologous target mRNA (see Figure 1 .7).  30    passenger strand  degraded  RISC  3' mRNA  3' 5'  mRNA degradation Gene Silencing  Figure 1 .7. The RNA interference pathway . Organisms have developed methods of eliminating foreign genetic material such as double stranded RNA (dsRNA) produced by viruses . Double stranded RNA is recognized by the cell and cleaved by DICER which creates 3' overhangs . This asymmetry is largely what determines which strand is loaded into the RNA inducing silencing complex (RISC) and which strand is degraded. Preferential loading of the antisense strand greatly improves binding in the RISC to its target mRNA. Once bound, RISC induces cleavage of the mRNA and hence gene silencing is achieved . Adapted from Yeung et al . (2005).  31  When double stranded RNA (dsRNA) appears in the cell, it is recognized and cleaved into short dsRNA called short interfering RNA (siRNA) by Dicer, a multidomain enzyme of the RNAse III family of dsRNA specific ribonucleases (Ketting et al., 2001; Devi, 2006) . The siRNAs produced are 21-23 mer duplexes each with two nucleotide 3' overhang end structures characteristic of the staggered cut of RNase III enzymes (Devi, 2006). The 3' two-nucleotide overhang structure has been identified as a critical determinant in targeting and maintaining small RNAs in the RNA interference pathway. Dicer is predominantly a cytoplasmic enzyme composed of a dsRNA binding motif and two RNAse III domains which include the DexH/DEAH box family of ATP dependent helicases and the Paz domains (Bernstein et al ., 2001). The action of RNA helicases is two fold; first to unwind dsRNAs as only single stranded RNA (ssRNA) can bind to its target mRNA, and secondly to act as ribonucleoproteinases (RNPases) by remodeling the interactions between RNA and proteins, which is important as multiple re-organizations of ribonucleoprotein particles take place in the RNAi pathway (Schwer, 2001 ; Murchison and Hannon, 2004) . The other RNAse III domain, Paz, is unique to Dicer and the Argonaute (Ago) family of proteins and provides specificity for single stranded 3'RNA ends, including the two nucleotide 3 'overhang structure characteristic of RNAse III processing (Carmell et al., 2002 ; Murchison and Hannon, 2004). Following cleavage by Dicer, siRNA must be released and incorporated into a multiprotein RNA inducing silencing complex (RISC), whose function can vary from mRNA cleavage to translational suppression (Murchison and Hannon, 2004) . The components of RISC include members of the PAZ-PIWI domain Argonaute family of proteins, siRNA, complementary mRNA and accessory factors (Murchison and Harmon,  32  2004) . The PAZ-PIWI domain of the Argonaute proteins is thought to bring specificity to RISC . Paz domains can directly engage siRNAs (Song et al., 2003) while PIWI domains can interact directly with and inhibit the RNAse III/dsRNA binding domain of Dicer, inducing the release of siRNA and consequently the transfer of siRNA from Dicer to RISC (Tahbaz et al., 2004 ; Doi et al ., 2003) . Once the siRNA is transferred, RISC then mediates sequence specific binding of one single strand of the siRNA to its complementary target mRNA (Nykanen et al ., 2001 ; Martinez et al., 2002) . It has been reported that the antisense strand of siRNA is more responsible for target recognition and silencing (Zamore et al ., 2000) . The target mRNA is then cleaved at a single site in the center of the duplex region, 10 nucleotides from the 5' end of the siRNA and destroyed thus enabling gene-specific silencing (Elbashir et al., 2001) . Once incorporated into a RISC complex, an siRNA can direct multiple rounds of target cleavage as RISC is a multiple-turnover enzyme (Hutvagner and Zamore, 2002 ; Murchison and Hannon, 2004). As indicated, synthetic double stranded 21 by siRNAs can be used as a more potent alternative to ASOs . They can also be transfected into mammalian cell lines, producing sequence dependent gene silencing of homologous target mRNAs . In this thesis, siRNA against bcl-2 was used as an alternative to the ASO genasense (see Chapter 4).  1 .14 Rituximab and clinical response to Rituximab Rituximab was the first monoclonal antibody to be approved for treatment of indolent NHL's (Smith, 2003 ; Avivi et al ., 2003) and its use as a therapeutic against MCL is described in Chapter 5 of this thesis . In the 1970s, combination chemotherapy greatly improved the outcome in aggressive NHL but was only curative in < 50% of  33  patients . In indolent lymphomas response rates and progression free survival (PFS) were improved albeit to a lesser extent than aggressive NHLs and it remains incurable . The addition of Rituximab to CHOP (cyclophosphamide, doxorubicin, vincristine, prednisone) in the treatment of diffuse large B-cell lymphoma (DLBCL) has shown the first survival advantage over CHOP alone in more than 20 years (Coiffier, 2002). Treatment with Rituximab alone led to a response rate of >50% in relapsed follicular lymphoma (FL) with responses lasting a median of one year (McLaughlin et al., 1998). In Mantle cell lymphoma treatment with Rituximab alone led to response rates of only 22%-35% and these were of short duration (Coiffier et al., 1998 ; Foran et al., 2000; Ghielmini et al ., 2000) . Combining Rituximab with various treatment regimens greatly enhances the response rate and overall survival in patients with indolent lymphoma (Czuczman et al ., 2001 ; Hainsworth et al ., 2002), but in Mantle cell lymphoma, although the combination of Rituximab with other chemotherapy regimens enhances the response rate, the overall survival and progression free survival are still not improved (Freedman et al., 1998 ;  Meusers and Hense, 1999 ; Howard et al ., 2002).  High dose therapy (HDT) and autologous stem cell transplant (ASCT) combined with chemotherapy and Rituximab have shown some improvement in progression free survival and overall survival in younger patients with MCL (Mangel et al., 2002; Thieblemont and Coiffier, 2007) but this approach is not feasible in older patients and patients that present with comorbid disease . Toxicities related to Rituximab treatment are minimal and are generally related to the first infusion of Rituximab and include, fever and chills . Patients at higher risk for complications after Rituximab treatment include higher tumor burden leading to an increased risk of tumor lysis syndrome or previous  34  pulmonary or coronary problems . Rituximab related toxicities do not significantly add to the toxicities related to chemotherapy (Coiffier et al., 2002) and hence has been widely applied in the clinic . CD20 is expressed on both normal and malignant B cells and Rituximab causes significant loss of both normal and malignant B cells for up to six months post treatment . However, loss of B cells does not show a significantly lowered IgG, and infections as a result of B cell loss are not significantly increased (Hainsworth et al .,  2003). Rituximab is a chimeric (human-mouse) monoclonal antibody containing the  human IgGl and  K  constant regions targeted against the B cell marker CD20 (Reff et al .,  1994; Smith, 2003) . Non Hodgkin's lymphomas (NHLs) are malignancies of lymphocytes and 80-90% of NHLs express the B cell marker CD20 (Smith, 2003). CD20 was chosen as a target for antibody therapies as it is expressed at high levels, it is not downregulated after antibody binding, and it is not shed or secreted into circulation which could cause an antibody to bind solely to circulating CD20 (Reff et al ., 1994; Tedder and Engel, 1994) . The exact function of CD20 is still unknown as CD20 knockout mice were shown to have normal B cells (O'keefe et al ., 1998). Nevertheless, CD20 is thought to be involved in B cell activation, proliferation and differentiation (Golay et al ., 1985 ; Tedder et al., 1985). Early studies have suggested that CD20 may act as a calcium channel (Bubien et al ., 1993 ; Kanzaki et al ., 1995) . The mechanisms of action of Rituximab are still currently being delineated but include complement dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC) and induction of direct signaling pathways that lead to either cell cycle arrest or apoptosis (reviewed in Smith, 2003) .  35  1 .14.1 CD20 CD20 was first identified over 20 years ago and was one of the first B-cell markers to be isolated (Stashenko et al., 1980). CD20 is first expressed at the pre-B cell stage during B cell development (Reff et al ., 1994). Mature B cells and germinal center B cells express CD20 and B cell activation results in an additional increase in CD20 expression (Valentine et al., 1987 ; Kehrl et al., 1994) . Most cycling cells express CD20 (Valentine et al ., 1987). Once B cells have differentiated into plasma cells, CD20 expression is downregulated (Banchereau and Rousset, 1992) . The CD20 gene is located on human chromosome 11g12-13 and is in close proximity to the chromosomal translocation t(11 ;14)(g13 ;g32) found in MCL (Tedder et al., 1989). It has been suggested that alterations in expression of the CD20 gene may occur after the t(11 ;14) translocation (Tedder et al ., 1989; Jazirehi and Bonavida, 2005) . CD20 mRNA is transcribed from a single copy gene and is 16 kb long, consisting of eight exons (Tedder et al.,  1988a) . Two mRNA isoforms consisting of a more predominant form of 2 .6 kb  and a less predominant form of 3 .3 kb have been described as products of an alternative splicing mechanism (Einfeld et al ., 1988 ; Tedder et al ., 1988a). Cloning of the CD20 gene revealed that CD20 is an integral membrane protein consisting of four transmembrane domains and a forty-four amino acid extracellular loop (Einfeld et al., 1988 ; Tedder et al ., 1988a and 1988b) containing a disulfide bond important for Rituximab binding (Ernst et al., 2005 ; Du et al., 2007) . A model of human CD20 is provided in Figure 1 .8 .  36  Figure 1 .8. Model of the human CD20 protein . CD20 protein has four transmembrane domains and a 44 amino acid extracellular loop containing a disulphide bond which is critical for Rituximab binding to CD20 . The intracellular portion of CD20 is highly phosphorylated upon mitogen stimulation . The serine/threonine phosphorylation sites for cell signaling proteins, protein kinase C (PKC), calcium/calmodulin-dependent protein kinase II (CaM-KII) and casein kinase II (CKII) are indicated . Adapted from Riley and Sliwkowski (2000) and Ernst et al ., (2005).  37  B lymphocytes express three CD20 protein isoforms (33, 35, 37 KDa) (Oettgen et al .,  1983) resulting from multiple phosphorylation of serine and threonine residues  located in the cytoplasmic domain of the CD20 protein . This implies that CD20 is highly regulated by phosphorylation (Tedder et al., 1988a and 1988c) . The 33 KDa protein is the predominant isoform (75-80%) while the 35 KDa protein represents only 20-25% of total CD20 (Einfeld et al ., 1988 ; Tedder and Schlossman, 1988) . In vitro kinase assays have shown that CD20 can be phosphorylated by the protein-serine/threonine kinases, protein kinase C (PKC), calcium/calmodulin-dependent kinase II (CaM-KII) and casein kinase II (CKII) (see Figure 1 .8) (Tedder et al.,1 988a ; Valentine et al., 1989 and 1993; Genot et al., 1993) and CD20 becomes highly phosphorylated in B cells upon mitogen stimulation (Riley and Sliwkowski, 2000) . CD20 is also found to be highly phosphorylated in activated/proliferating B cells, malignant B cells and B cell lines (Valentine et al ., 1987; Tedder et al ., 1988a and 1994) while in non-proliferating B cells CD20 is not phosphorylated (Tedder and Schlossman, 1988) . Crosslinking cell surface CD20 by antibody or phorbol esters results in enhanced phosphorylation (Tedder and Schlossman, 1988) . So far no natural ligand has been identified for CD20 (Johnson and Glennie, 2001). The mechanisms controlling CD20 expression are poorly understood. Transcription factors associated with the CD20 promoter include oct-1, oct-2 and PU .1/Pip (reviewed in Riley and Sliwkowski, 2000) . PU.1/Pip belongs to the Ets family of transcription factors and is specifically expressed in B cells, macrophages and myeloid cells (Klemsz et al., 1990 ; Hromas et al ., 1993). Both PU .1 and Pip bind co-operatively  38  to the CD20 promoter illustrated in Figure 1 .9, and disruption of the PU .1/Pip binding site leads to inactivation of the CD20 promoter (Himmelmann et al ., 1997).  Figure 1 .9. CD20 promoter . The known functional elements in the CD20 promoter include the BAT box, a PU .1/Pip binding site and an E box . The BAT box binds the transcriptional factors oct 1 and oct 2 and is important in the high constitutive expression of CD20 in mature B cells/induction of CD20 expression in pre-B cells (Rieckmann et al., 1991 ; Thevenin et al., 1993). The E-box interacts with basic helix-loop-helix zipper proteins and enhances promoter activity (Riley and Sliwkowski, 2000) . The composite Pu.1/Pip binding site is essential for CD20 promoter activity and binds the Ets transcription factors PU .1 and Pip co-operatively (Himmelmann et al ., 1997). This site likely accounts for both lineage and stage specific expression of CD20 . The other sites include a NF-y binding site, whose function within the CD20 promoter needs to be defined and a site for the B-cell specific activator protein (BSAP) which is important for the transcriptional regulation of numerous genes (Kehrl et al ., 1994). Adapted from Riley and Sliwkowski (2000) .  39  This would indicate that PU .1/Pip is an important site for CD20 promoter activity. Bryostatin-1, a PKC modulator, was able to induce the increased expression of both CD20 mRNA and protein (Wojciechowski et al, 2005) . Enhanced expression of CD20 was due to an increase in CD20 transcriptional activity as opposed to an increase in mRNA stability. The CD20 promoter can bind transcription factors belonging to the Ets family (Riley and Sliwkowski, 2000) and several members of this family are activated in an extracellular signal regulated kinase (ERK) dependent fashion . As such, Wojciechowski et al . (2005) determined that bryostatin-1 enhanced expression of CD20 was mediated by MEK1/ERK1/2 activated Ets transcription. CD20 is capable of homo-oligomerizing at the cell surface and has been shown to be in close proximity to the immune receptors MHC class I and class II proteins and other unrelated tetraspan molecules such as CD53, CD81, and CD82 (Szollosi et al ., 1996). CD20 co-precipitates with MHC class II but not MHC class I (Leveille et al., 1999). Furthermore, CD20 can associate with Src family kinases such as Lyn, Fyn and Lck (Deans et al ., 1993 and 1995), and these interactions have been implicated in the cell signaling events associated with CD20 crosslinking (discussed below). In addition, the structure of CD20 implies that it may form an ion channel and accumulating evidence indicates that CD20 is directly involved in the regulation of transmembrane calcium conductance leading to mediation of cell signaling events (discussed below).  1.14 .2 Cell signaling mediated by Rituximab binding to CD20 Compared to other immunoreceptors, CD20 lacks an Immunoreceptor-Tyrosinebased-Activation-Motif (ITAM) sequence in its cytoplasmic tail (Tedder et al ., 1988a  40  and 1988c) . CD20 has been localized in small microdomains in the plasma membrane termed lipid rafts (Deans et al ., 1998 ; Janas et al ., 2005) . Cell lines transfected with CD20 show an increase in calcium conductance across the cell membrane (Bubien et al., 1993 ; Li et al ., 2003) and antisense molecules targeted against CD20 result in a significant decrease in calcium conductance (Deans et al ., 2002 ; Li et al ., 2003). Furthermore, truncation of the CD20 cytoplasmic domain (A 219-225) can abolish CD20 lipid raft association and this in turn, significantly decreases calcium flux (Li et al ., 2003) . Upon crosslinking CD20 with Rituximab, CD20 localization to lipid rafts is observed (Deans et al., 1998 ; Janas et al., 2005). Lipid rafts serve as membrane signaling domains that are implicated in the organization of many signaling proteins (Dykstra et al ., 2003 ; Mayor and Rao, 2004) . CD20 clustering activates members of the Src family of tyrosine kinases, Lyn, Fyn and Lck, which leads to phosphorylation of phospholipase C gamma (PLCy) and induction of calcium fluxes that ultimately culminates in caspase 3 activation and induction of apoptosis (Hofmeister et al., 2000; Shan et al., 2000 ; Unruh et al ., 2005) . The various signaling events associated with Rituximab binding to CD20 are illustrated in Figure 1 .10.  41    3 lack of effector cells 1 circulating CD20 Rituximab  2  lipid  complement inhibitors 4 loss of CD20  rafts  src kinases) A  AZB  PLC-y  p38 MAPK  Ae'  IP3 DAG Ca+ flux JNK ERK  Ii  Erk1/2  NFKB  FAS  IL-10  1  caspase 8  Stat3 PKC  apoptosis apoptosis Bcl-2 Bcl-xl others (Mcl-1)  Bcl-2 Bcl-xl others (Mcl-1) Chemoresista  Chemosensitive  Figure 1 .10. Signaling events and modes of resistance associated with Rituximab treatment . (A) CD20 crosslinking via Rituximab binding induces translocation into lipid rafts/association with Src kinases leading to induction of calcium fluxes and apoptosis . (B) In some systems Rituximab can downregulate bcl-2 expression leading to chemosensitivity via blockade of the p38 MAPK/IL-10/STAT3 pathway . (C) In other systems, Rituximab can downregulate bcl-x L via modulation of RKIP1 which blocks both the NF-KB and ERK 1/2 pathways which also leads to chemosensitivity . (D) Rituximab can also induce apoptosis in some systems via the extrinsic apoptotic pathway by altering the level of Fas expression . Proposed modes of resistance to Rituximab include : (1) binding to circulating CD20, thus reducing the amount of Rituximab available ; (2) the expression of complement inhibitors ; (3) inability or lack of effector cells able to reach tumor cells ; (4) loss of CD20 expression on surface of cells ; and (5) altered cell signaling pathways . Adapted from Jazirehi and Bonavida (2005) and Smith (2003).  42  Chelators against both intracellular and extracellular calcium lead to abrogation of the apoptotic response seen in these studies (Hofmeister et al ., 2000 ; Shan et al., 1998). It is worth noting that crosslinking CD20 with various antibodies, including Rituximab, leads to enhanced levels of CD20 redistribution into lipid rafts and an enhanced apoptotic response (Shan et al ., 1998; Janas et al., 2005 ; Unruh et al ., 2005 ; Chiu et al., 2007). Numerous studies, mostly in vitro, are trying to further decipher the cell signaling pathways triggered after treatment with Rituximab . In freshly cultured chronic lymphocytic leukemia cells from patients Pedersen et al . (2002) reported marked differences between cell signaling cascades triggered by treatment with Rituximab alone or upon treatment with Rituximab hypercrosslinked with a secondary antibody. Hypercrosslinking Rituximab led to the activation/phosphorylation of all three mitogenactivated kinase (MAPK) families, JNK, ERK1/2 and p38 MAPK . Inhibition of p38 MAPK with a kinase inhibitor led to a significant decrease in apoptosis . However, treatment with Rituximab alone led to only a weak phosphorylation of JNK and ERK1/2 but had little impact on p38 MAPK phosphorylation and triggered apoptosis to a lesser extent (Pedersen et al., 2002). Bonavida's group, in particular, has focused heavily on the cell signaling pathways triggered by Rituximab in vitro and have predominantly found that while crosslinking Rituximab with a secondary antibody leads to a stronger induction of apoptosis, treatment of Rituximab alone leads to alteration of different cell signaling pathways leading to a reduction in the apoptotic threshold of a cell, thus sensitizing the cell to various cytotoxic drugs (reviewed in Jazirehi and Bonavida, 2005) . In particular, Bonavida's group has shown that Rituximab sensitizes cells to chemotherapeutics via  43  alterations in the expression of cell signaling pathways leading to downregulation of the anti-apoptotic proteins bcl-2 and bcl-x L (see Figure 1 .10). In AIDS related lymphoma (ARL) cell lines, downregulation of bcl-2 occurs after Rituximab inhibits the activity of the p38 MAPK signaling pathway which leads to inhibition of the cytokine IL-10/IL-10 receptor/regulatory loop . The inhibition of the IL10/IL-10 receptor/regulatory loop leads to downregulation of STAT-3 activity and thus bcl-2 expression culminating in chemosensitization of the cells to various cytotoxics (reviewed in Jaziheri and Bonavida, 2005). In non-AIDS related lymphoma (non-ARL) cell lines, Rituximab treatment did not lead to downregulation of bcl-2 or IL-10 (Alas et al.,  2001) but bcl-x L levels were downregulated via inhibition of the NF-KB pathway and  the ERK1/2 pathway. Rituximab mediates its effects on both of these pathways by upregulating the Rafl kinase inhibitor protein (RKIP) . RKIP physically associates with Rafl to block the ERK 1/2 pathway leading to a decrease in AP-1 transcriptional activity resulting in downregulation of bcl-xL (Alas et al ., 2001). RKIP also physically associates with nuclear factor KB (NF-KB) inducing kinase (NIK) and thus inhibits the NF-KB transcriptional activity also leading to bcl-xL downmodulation and sensitivity to druginduced apoptosis (reviewed in Jazirehi and Bonavida, 2005) . Recently Bonavida's group has also shown that downregulation of bcl-x L may occur through Rituximabinduced inhibition of the Akt/PKB signaling pathway (Suzuki et al., 2007). These results show that Rituximab can induce different cell signaling events in different cell types. In addition to the alteration of members of the bcl-2 family of proteins, Rituximab treatment leads to alterations in the extrinsic apoptotic pathway by altering levels of Fas and inducing caspase 8 activity . Bonavida's group showed that this occurred after  44  Rituximab inhibited the expression of the transcriptional repressor Ying Yang 1 (YY1), which negatively regulates Fas expression (Vega et al., 2005a and 2005b). Downregulation of YY1 by Rituximab is a direct result of Rituximab's ability to inhibit both the NF-KB and p38 MAPK signaling pathways . Stel et al. (2007) recently showed that Rituximab sensitizes lymphoma B cells to Fas-induced apoptosis in a caspase-8 dependent manner. c-Flip over-expression (a negative regulator of the death receptor pathways) led to a decrease in Rituximab induced apoptosis . Furthermore, CD20 crosslinking was associated with Fas-associated death domain protein (FADD) and caspase 8 assembly into the DISC and Rituximab induced both CD20 and Fas translocation into raft-like domains (Stel et al ., 2007) . In response to Rituximab, Fas, FADD and caspase 8 were all found together with CD20 in raft fractions (Stel et al., 2007) . These studies indicate that Rituximab can induce apoptosis via both the intrinsic and extrinsic apoptotic machinery but this may depend on the model system being analyzed as some studies have not shown Rituximab-induced activation of Fas-mediated cell death (Byrd et al., 2002) . Thus, depending on the cell type and crosslinking of Rituximab, the anti-CD20 antibody can have very different effects on cell signaling pathways. Unfortunately, few studies have analyzed the cell signaling pathways triggered by Rituximab in vivo . Byrd et al . (2002) showed that Rituximab infusion in patients with chronic lymphocytic leukemia (CLL) led to induction of caspase 9, caspase 3 and poly(ADP-ribose) polymerase (PARP) cleavage . In addition, both the inhibitor of apoptosis protein XIAP and the anti-apoptotic bcl-2 family member, mcl-1, were significantly downregulated in these patients . This could explain, in part, how Rituximab  45    sensitizes CLL cells to chemotherapy in vivo (Byrd et al ., 2002) . This was the first report providing evidence that Rituximab induces apoptosis in vivo in humans . However, it is not known if crosslinking can occur in vivo and it has been suggested that cells carrying the Fc receptors could induce crosslinking on B cells (Shan et al ., 1998 ; Hofmeister et al .,  2000 ; Unruh et al ., 2005). In vitro crosslinking has been shown to be mediated by Fc  receptor bearing cells and may be difficult to detect in vivo (Shan et al ., 1998) . Clearly, more studies are needed to determine the cell signaling pathways triggered by Rituximab in vivo  in order to determine what modes of resistance exist when treating CD20 positive,  but Rituximab insensitive diseases such as MCL . This is addressed in Chapter 5.  1.14.3  Rituximab induced complement activation and antibody dependent cell  cytotoxicity As suggested above Rituximab binding to CD20 can promote apoptosis ; however, changes in intracellular signaling are not the only means by which Rituximab exerts therapeutic effects . The Fc portion of the monoclonal antibody Rituximab can induce complement activation leading to cell lysis (Smith, 2003) . Complement dependent cytotoxicity (CDC) is a series of reactions, illustrated in Figure 1 .11, which leads to cleavage of a cascade of proteins . These can be deposited on the cell membrane to mediate cell death by attracting macrophages and/or other effector molecules capable of recognizing the deposited proteins . Alternatively the deposited proteins can lyse the cell by creating pores in the cell membrane (Janeway and Travers, 1997).  46    Classical pathway Antigen : antibody complex  C1 C4 C2  (Cl is a complex of Clq,C1 r,C1s)  C3 convertase  Terminal complement components C5b C6 C7 C8 C9  C4a* C3a, C5a  Peptide mediators of inflammation, phagocyte recruitment  Binds to complement receptors on phagocytes  Membrane-attack complex, lysis of cells  Opsonization of pathogens Removal of immune complexes  Figure 1 .11 . Rituximab can induce the classical pathway of complement activation. Once initiated C l q binds to the cell membrane leading to a cascade of cleavage events leading ultimately to the generation of C3 convertase . C3 convertase then generates cleavage products C3a and C3b that are deposited on the cell surface to either attract mediators of inflammation or results in opsonization . Alternatively the terminal complement components can form the membrane attack complex leading to direct lysis of the cell . Adapted from Janeway and Travers (1997) . In: Immunobiology, the immune system in health and disease p 8 :34  47  The classical pathway of the complement system is activated by antibody binding to antigen . Once bound a protein called C l q binds to the antibody . The C l q binding site is located within the CH2 domain of the IgGl chain of Rituximab and mutation within the CH2 domain results in impaired CDC or ADCC activity (Idusogie et al ., 2000). Binding of C 1 q to an antibody leads to a series of cleavage events culminating in the production of a protease called a C3 convertase (C4b2a) (Janeway and Travers, 1997). C3 convertase can generate two main effector molecules ; C3a, a small peptide which mediates the induction/recruitment of inflammatory cells and C3b, an opsonin that binds covalently to the cell surface of pathogens leading to induction of opsonization (reviewed in Janeway and Travers, 1997 and Paul, 2003) . Furthermore, C3 convertase leading to activation of C3b is important for the engagement of the terminal components of the complement system . This process is initiated by the cleavage of C5 by C5 convertases which initiates the late events of complement activation in which a membrane attack complex (MAC) is formed creating pores in the cell membrane leading to cell death (Paul, 2003). Rituximab has been shown to induce complement mediated cell cytotoxicity both in vitro vivo al.,  (Golay et al., 2000 and 2001 ; Kennedy et al ., 2003 ; Manches et al ., 2003) and in  (van der Kolk et al ., 2001 ; Cragg et al ., 2003 ; DiGaetano et al ., 2003 ; Kennedy et  2004 ; Golay et al ., 2006) . CDC activation both in vitro and in vivo has been shown  to depend upon the capacity of the therapeutic antibody to translocate CD20 into lipid rafts (Cragg et al ., 2003 ; Cragg and Glennie, 2004) . CD20 expression levels have also been implicated in the efficacy of Rituximab to induce CDC activation in some studies (Golay et al ., 2001 ; Bellosillo et al ., 2001). Recently, van Meerten et al . (2006)  48  determined the dependency of CD20 expression on CDC activity by using CD20 expression as the only variable . They found that a minimum number of CD20 molecules were necessary for CDC induction and that enforced CD20 expression leads to an increase in CDC susceptibility . The above studies indicate that CD20 expression levels can influence CDC susceptibility . However, it is clear that CD20 expression levels are not the only biological influences associated with CDC sensitivity and may vary depending on the system analyzed. Other factors include the expression of the regulatory proteins of CDC which may protect malignant cells from complement mediated destruction (Kennedy et al ., 2003). Some of the common CDC inhibitory proteins include CD35, CD46, CD55 and CD59 (Charles and Foerster, 1999 ; Gorter and Meri, 1999 ; Gelderman et al ., 2004). Multiple studies have shown that expression of the complement inhibitory proteins augments resistance to Rituximab treatment in a variety of B lymphoma cell lines and primary cells (Golay et al ., 2000 ; Treon et al ., 2001 ; Cardarelli et al., 2002 ; Manches et al ., 2003; Takei et al. 2006) and blockade of these inhibitory proteins enhanced Rituximabmediated CDC (Harjunpaa et al ., 2000 ; Golay et al ., 2000 and 2001 ; Treon et al., 2001). In addition, CD59, which blocks the last steps of complement activation, was identified on Rituximab bound cells and was associated with Rituximab resistance in patients (Treon et al., 2001) . On the other hand, Weng and Levy (2001) showed that expression of complement inhibitors CD46, CD55 and CD59 in tumor cells does not predict clinical outcome after Rituximab treatment in follicular non-Hodgkin's lymphoma . The discrepancies amongst these studies may reflect differences in cell types and disease subsets . Regardless of the influences of CD20 expression and complement inhibitor  49  proteins on the activity of CDC, it is clear that CDC occurs in patients (Smith, 2003). CDC protein fragments have been detected in patient samples and CDC has been associated with most of the infusional toxicities associated with Rituximab treatment (Kennedy et al., 2004 ; van der Kolk et al., 2001). Complement activation leads to the deposition of C3b and its breakdown products termed C3b(i), ultimately leading to opsonization and in the formation of the membrane attack complex (MAC) and cell lysis . Rituximab induces the rapid deposition of C3b(i) (Kennedy et al., 2003 ; Golay et al., 2001) . Interestingly, Kennedy et al. (2003) showed that the in vivo molecular form of Rituximab may be covalently bound to C3b(i) molecules . A covalent complex of Rituximab and C3b(i) could interact with effector cells containing both Fc and complement receptors, such as monocytes, macrophages and/or neutrophils potentially leading to cell killing via antibody-dependent-cellular cytotoxicity (ADCC). ADCC is induced after anti-CD20 Rituximab coats lymphoma B cells and these antibody-coated target cells are killed by effector cells that express Fc receptors that recognize the Fc region of the bound antibody (Smith, 2003) . Effector cells expressing different Fcy receptors are described in Figure 1 .12. Some receptors such as FcyRI and FcyRIII are activating receptors while others, such as FcyRIIB located on B lymphocytes, are inhibitory receptors (Janeway and Travers, 1997) . Natural killer (NK) cells that express the Fc receptor FcyRIII have been shown to mediate most ADCC (Figure 1 .13) (Janeway and Travers, 1997) . Although the precise contributions of the various effector cells to ADCC in patients treated with Rituximab needs to be determined, a recent role  50    for both NK cells and neutrophils has been identified in a non-Hodgkin's lymphoma mouse model (Hernandez-Ilizaliturri et al., 2003).  Receptor  FcyRl (CD64) a 74kDa  Structure  FcyRIIA (CD32)  _  0 IgG1  a 50—70kDa -  -  , or —  -  -  I  y or  IgG1  IgG1  Order of affinity  1) IgG1 2) IgG3=IgG4 3) IgG2  1) IgG1 2) IgG3=IgG4 3) IgG2  1) IgG1 2) IgG3=IgG4 3) IgG2  Cell type  Macrophages Neutrophils Eosinophils  Macrophages Neutrophils Eosinophils Platelets  Macrophages Neutrophils Eosinophils Platelets Langerhans' cells  Effect of ligation  Uptake  Uptake Granule release (eosinophils)  Uptake Granule release (eosinophils)  1) IgG1 2) IgG3=IgG4 3) IgG2  B cells  Inhibition of stimulation -no uptake  FccRl  a 45kDa  U  [3 33kDa y 9kDa  U  C  ?-like domain  IgG1  FcyRIIIA (CD16)  FcyRllB1  a 40kDa  y  Binding  FcyRIIB2  IgG1  i IgE  IgG1=IgG3  NK cells Eosinophils macrophages Neutrophils Langerhans' cells  Mast cells Eosinophils Basophils  Induction of killing (NK cells)  Secretion of granules  Figure 1.12. Different types of Fc receptors on various effector cells . The Fc receptors on effector cells, especially NK cells induce ADCC after binding to the Fc portion of Rituximab . Alterations in the expression of the FcyRIIB 1 inhibitor receptor and the activation receptors FcyRIIA and FcyRIIIA greatly alters the level of activity of Rituximab . Furthermore, gene polymorphisms in both FcyRIIA and FcyRIIIA have been correlated with clinical response to Rituximab (Cartron et al., 2002; Weng and Levy, 2003) . Adapted from Janeway and Travers (1997) . In: Immunobiology, the immune system in health and disease p 8:25  51    Panel B  Panel A  Panel C  Panel D  FcyRlll as  .a  •~  NK cell  activate NK cell  * 0%6 0  •• • • •  • — •i  C  g0:  0  4A1  Figure 1 .13. The mechanism of action of ADCC mediated by NK cells . (Panel A) Antibody binds antigen on the surface of target cells . (Panel B) Fc receptors on NK cells recognize bound antibody . (Panel C) Crosslinking of Fc receptors signals the NK cell to kill the target cell. (Panel D) Target cell dies by apoptosis and/or membrane damage. Adapted from Janeway and Travers (1997) . In: Immunobiology, the immune system in health and disease p 8 :29  52  The importance of ADCC as an in vivo mechanism of therapy following treatment with Rituximab or other antibodies has been shown after the alteration of both the levels of inhibitory and activating Fc receptors . FcyRIIB (inhibitory receptor) knockout mice were shown to have much more ADCC and were hypersensitive to antibody-mediated tumor suppression (Clynes et al ., 2000) . While mice that were deficient in both activating receptors, FcyRI and FcyRIIIA, and antibodies engineered to disrupt Fc binding to those receptors were unable to arrest tumor growth  in vivo  (Clynes et al .,  2000) . This would indicate that the balance of both activating and inhibitory Fc receptors is important in mediating control of tumor growth after antibody treatment. Genetic polymorphisms for both FcyRIIA and FcyRIIIA have been described (Koene et al ., 1997 ; Wu et al., 1997) and both these polymorphisms have been linked to clinical outcome in patients . The FcyRIIIA receptor has a genetic polymorphism at residue 158 in which either valine (V) or phenylalanine (F) is present . The presence of valine at residue 158 has been linked to a stronger binding to IgGI than phenylalanine which shows a weaker binding (Koene et al., 1997) . Furthermore, Rituximab treatment of follicular lymphoma patients carrying the homozygous FcyRIIIA V/V receptor resulted in higher response rates and molecular remissions of the bcl-2 translocation than patients carrying either the FcyRIIIA V/F or F/F receptors (Cartron et al., 2002 ; Weng and Levy, 2003) . Recently, Hatjiharissi et al. (2007) studied individuals expressing the different gene polymorphisms for FcyRIII and found that individuals expressing at least one valine at FcyRIIIA-158 might, in part, have better clinical outcomes due to increased expression of FcyRIIIA, Rituximab binding and Rituximab-mediated ADCC . On the  53  other hand, genetic polymorphisms of FcyRIIIA were not shown to be a determinant in clinical outcome in B-CLL (Farag et al ., 2004) indicating differences amongst NHL patient subpopulations . Different therapeutic modalities can vastly alter the availability of certain effector cells and some patients are already immune compromised . Thus the role and extent of ADCC activation may largely rely on the number and ability of effector cells to reach the target cells and may account for some of the variability seen after treatment with Rituximab (Golay et al ., 2006).  1.14.4 Mechanisms of resistance to Rituximab The lower response rates to Rituximab in MCL patients as well as chronic lymphocytic leukemia (CLL) patients as compared to follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL) is unclear . Resistance mechanisms have been related to a decrease in effector cells in immune compromised individuals to induce ADCC or an increase in complement inhibitors that would alter the efficacy of CDC mediated cell killing (see Figure 1 .10). In addition, alterations in apoptotic pathways have been suggested (Jazirehi and Bonavida, 2005) . Another interesting mechanism of resistance that has been suggested is loss of CD20 expression after treatment with Rituximab (Jilani et al., 2003) . Loss of CD20 expression was speculated to be due to shedding or internalization of CD20 (Jilani et al ., 2003) . However, Beum et al . 2004 demonstrated that the in vitro modulation of CD20 reported by Jilani et al . 2003 was likely due to deposition of the complement product C3b following Rituximab binding leading to stripping of a CD20-Rituximab-C3b complex (further discussed below) . CLL cells have the lowest level of CD20 molecules (8,000 per cell) while other lymphomas  54  have shown over 100,000 per cell (Nguyen et al., 1999) and this may explain why CLL patients have a poor response to Rituximab . Recently, Beum et al. (2006) have showed that CD20 loss following Rituximab treatment is mediated by shaving/loss of the Rituximab bound CD20 molecules by monocytes . This shaving reaction was shown in CLL patients and once CD20 levels were below a certain threshold, Rituximab was subsequently inefficient at reducing the levels of B cells . Thus they showed that low dose Rituximab administered to CLL patients may be more efficient at increasing responses to Rituximab treatment (Williams et al ., 2006) . However, loss of CD20 cannot fully explain the resistance of Rituximab seen in all lymphoma subsets, as both follilcular lymphoma and MCL have high levels of CD20 but MCL patients have a significantly poorer response rate to Rituximab compared to follicular lymphoma . Probably a combination of resistance factors influence different disease subsets underlying a growing need to explore these mechanisms in each type of lymphoma in both in vivo  in vitro  and  models.  1 .14.5 Conclusions for Rituximab It is apparent that the mechanisms of action and resistance to Rituximab varies amongst the different subsets of lymphoma and ongoing studies trying to differentiate which mechanisms of action are more important in mediating B cell death such as CDC, ADCC and alteration of cell signaling events leading to apoptosis have been inconclusive . One study has showed that CDC and ADCC complement each other so as when one is impaired the other is activated (Van Meerten et al., 2006) . This would lead to the hypothesis that all three mechanisms of action of cell mediated death by Rituximab  55  may be important but one mechanism may predominate over the other depending on the immune effector cells available to the tumor site and the specific cell signaling pathways that are deregulated in these cells. Ghielmini et al. (2005) recently showed that the response rate to Rituximab in MCL is not dependent on the presence of lymphocytes and on Fcy receptor genotype, while event free survival in MCL is dependent on these factors . They hypothesized that the mechanism of action of Rituximab may change during treatment in MCL . During the early phase of Rituximab treatment, a cytotoxic cell-independent mechanism may occur, while during the later phase a cytotoxic cell-dependent mechanism may take over . This may explain some of the discrepancies seen between in vitro studies as to what mechanism of action of Rituximab is the most predominant in mediating Rituximab effects and needs to be further elucidated (discussed in Chapter 5).  1 .15 THESIS OBJECTIVES AND HYPOTHESIS Mantle cell lymphoma was only described as a separate clinical entity in the mid to late 1990s . The apparent lack of in vitro and in vivo models for MCL greatly necessitated the establishment of new models, in which to gain a better understanding of the lack of sensitivity seen in MCL to different treatment strategies . Consequently, the research contained in this thesis was designed to establish new models of MCL and to evaluate the cell signaling pathways deregulated in MCL and their consequences on targeted therapeutic approaches . The following three specific objectives were designed to test the overall hypothesis that identification of underlying key deregulated cell  56  signaling pathways in MCL and targeted therapies aimed at these pathways will result in enhanced therapeutic activity  Specific objective 1 : To Specific objective 2 :  establish pre-clinical in vitro and in vivo models of MCL.  To investigate the cell signaling pathways activated in bcl-2 over-  expressing MCL cells that were treated with oblimersen : a molecular gene silencing strategy that effectively suppresses bcl-2 expression in vitro and in vivo. Specific objective 3 : To  investigate how abnormal expression of CD40/CD40L and  Fas/FasL along with bcl-2 family members contributes to B cell clonal expansion in MCL and influences Rituximab-mediated cell death in MCL models.  The experiments designed to test these specific objectives and the results that were obtained are presented herein. The summarizing discussion follows which outlines the overall conclusions derived from these studies and highlights areas of particular interest for potential future research .  57  CHAPTER 2 MATERIALS AND METHODS 2 .1 Cell lines and culture Four human lymphoid cell lines with the t(11 ;14)(q 13 ;g32) translocation were studied that were previously established by others : NCEB-1 (Saltman et al., 1988), JVM2 (Melo et al., 1988), HBL-2 (Abe et al ., 1988) and Z-138 (Estrov et al ., 1998) . Granta 519, a well-characterized MCL cell line, was also used in certain studies as a means of comparing selected features (Jadayel et al ., 1997) . The human osteosarcoma cell line TC32 with CCND1 (cyclin Dl) gene amplification was used as a cyclin D1 positive control and bcl-2 negative control (Dunn et al ., 1994) . The human lymphoma cell line DoHH2, which carries the complex translocation t(8 ;14;18) with resultant overexpression of both c-myc and bcl-2, was utilized as a cyclin Dl-negative control and bcl2 positive control (Klasa et al., 2000) . The T cell line Jurkat was used as a positive control for Fas and CD40L expression and as a negative control for CD40 expression. Cell lines were cultured in RPMI 1640 (Stem Cell Technologies, Inc ., Vancouver, BC, Canada), supplemented with 10% fetal bovine serum (Cansera, Rexdale, ON, Canada), 2mM L-glutamine (Stem Cell Technologies, Inc .), penicillin (10,000 units/ml ; Stem Cell Technologies Inc .) and streptomycin (10 mg/ml ; Stem Cell Technologies, Inc .) . Cells were maintained at 37°C and 5% CO 2 in a humidified atmosphere . Cell counting was performed by a haemacytometer and cell viability was assayed by trypan blue staining.  58  2.2  Reagents Oblimersen (Genasense TM, G3139) is an 18 mer phosphorothioate oligonucleotide  with a sequence complimentary to the first six codons of the human bcl-2 open reading frame: (sequence, 5'-tct ccc agc gtg cgc cat-3') . G3622 (sequence, 5'-tac cgc gtg cga ccc tct-3') is the reverse polarity sense control (RPO) of G3139, whereas G4126 (sequence, 5'-tct ccc agc atg tgc cat-3') has a two-base mismatch (MMO) to G3139 . Both antisense controls are phosphorothioated, linear, single-stranded 18 mer oligonucleotides . All of the oligonucleotides were kindly provided by Genta Inc . (Berkeley Heights, NJ, USA). Bcl-2 SMARTpool siRNA was purchased from Dharmacon (Chicago, IL, USA). Rituximab (Rituxan, IDEC-C2B8) (a chimeric monoclonal antibody against CD20) and Herceptin (a monoclonal antibody against Her-2) were kindly provided by the British Columbia Cancer Agency Pharmacy (Vancouver, BC, Canada).  2.3 Cytogenetic analysis 2.3.1 Detection of t(11;14)(q13 ;q32) and t(8;14) translocations Chromosome analysis was performed using standard 24 hour culture and harvest procedures. Giemsa stain was used for G-banding of metaphases . The karyotypes are described according to the international system for human cytogenetic nomenclature (ISCN) (1995) . Locus-specific fluorescence in situ hybridization (FISH) analysis was undertaken with an IGH/CCND1 dual color, dual translocation probe, IGH/MYC, CEP 8 dual fusion translocation probe and the LSI MYC dual color, break apart probe (Vysis Inc., Downer's Grove, IL, USA) used according to manufacturer protocols as described elsewhere (Lestou et al., 2003 ; Gascoyne et al ., 2003). In this probe cocktail the CCND1  59  probe for chromosome band 11q13 is labeled with spectrum orange and the IGH probe for chromosome band 14q32 is labeled with spectrum green . DAPI II was used as counter stain . A total of 200 interphase nuclei were scored manually for the presence of IGH-CCND1 fusion signals . The cut-off value for confirmation of the presence of a translocation was established as >5% of interphase nuclei showing two or more fused signals, based on prior assessment of this probe on five reactive lymph node specimens. Available metaphases were also examined to confirm the localization of the fusion signals to the respective derivative chromosomes . Multi-color karyotype analysis (mFISH) was performed with the Metasystems 24 color FISH cocktail using DAPI III as counter stain, according to manufacturer protocols (Metasystems GmbH, Germany) . A minimum of five metaphases were examined per cell line . Established criteria were utilized for evaluating mFISH metaphases to avoid chromosomal misclassifications due to fluorescence blending (Leenman  2004). Image capture for FISH and mFISH  et al .,  was performed with a Zeiss Axioplan 2 microscope powered by a 100-watt mercury bulb and equipped with the appropriate filters (DAPI, FITC, Spectrum Orange, TRITC, Cy5, DEAC) and the Metasystems ISIS imaging software programs . A JAI M300 camera was used to capture the fluorescence images.  2.3.2 Detection of EBV by Fluorescence  In Situ  Hybridization  EBV FISH analysis utilized slides treated with DNase-free RNase . Ten to twenty microliters of the hybridization mixture containing the biotinylated EBV-BamHIW fragment (Enzo Life Sciences, Farmingdale, NY, USA) was applied to each slide. Denaturation was performed at 80°C for 10-12 minutes on a heating plate and  60  renaturation was carried out overnight at 37°C . Post-hybridization washing steps and immunocytochemical detection of the labeled probes were performed as described elsewhere (Leenman et al., 2004).  2.3 .3 Detection of p16 and p53 deletions by Fluorescence In Situ Hybridization Chromosome preparations were pre-treated in 2 x SSC for 30 min at 75°C, followed by denaturation for 1 min in 0 .07 N NaOH . Probes were denatured separately and applied on dehydrated dried slides . Hybridization was performed for 16-18 hours at 37°C . Post hybridization washes consisted of 0 .4 x SSC/0.3% NP-40 for 2 min at 72°C and 2 x SSC for 2 min at room temperature . The following BACs from RP11 library were used as locus specific FISH probes : 149I2 containing the p16 gene (9p2l .3), 644E22 (9p13 .2 – internal control for p16) and 89D11 containing the p53 gene . CEP 17 (D1721) probe (Vysis, Downers Grove, IL, USA) was used as an internal control for p53 hybridization . Direct labeling of BAC DNA with Spectrum Red dUTP or Spectrum Green dUTP (Vysis, Inc . Downers Grove, IL, USA) was performed by Nick Translation Kit (Vysis, Inc . Downers Grove, IL, USA) according to manufacturer protocols . A minimum of 10 clonal metaphases and 200 interphase nuclei were scored in all cases. Image capture for FISH was performed with a Zeiss Axioplan2 microscope equipped with the appropriated filters (DAPI, FITC and TRITC) and the Metasystems ISIS imaging software programs .  61  2.4 Flow cytometry and data analysis 2.4 .1 Immunophenotypic analysis by flow cytometry Single cell suspensions were prepared by scraping the fresh tissue with a scalpel blade into a bath containing RPMI solution followed by centrifugation and a cell count to enumerate the number of viable cells that could be analyzed by flow cytometry . A direct antibody labeling technique was employed using mouse monoclonal antibodies to CD3, 4, 5, 7, 8, 10, 11c, 19, 20, 23, 38, 45 and FMC 7 (Becton Dickinson, San Jose, CA, USA), and goat polyclonal antibody (for kappa and lambda) labeled with either PE, FITC or Cy5 . All events were recorded on an FC500 flow cytometer and the analysis was restricted to a gated population of abnormal cells as defined by light scatter and antigenic profile.  2.4 .2 Staining for cell surface markers Tumor samples were harvested and placed in 5 ml of room temperature RPMI media. Subsequently, tumors were placed on a 5µM filter and were disaggregated using a plunger of a 5 ml syringe . Cells from culture were harvested and washed with PBSB (PBS + 0 .1 % BSA) . Cell counts for both tumor and cell culture samples were obtained by trypan blue staining . Approximately 1 x 10 6 cells from either tumor samples or cell culture were distributed into separate eppendorf tubes and centrifuged at 7K for 20s at 4°C . Cells were resuspended in 100 µ1 PBSB + 20% human serum and incubated on ice for 10 minutes . Cells were then stained for the following cell surface markers, CD 19, CD20, CD40, CD 154, and Fas (BD Biosciences, Franklin Lakes, NJ, USA) and incubated on ice for 45 minutes . Cells were washed 2x with 1 ml cold PBSB and  62  resuspended in 400 µ1 PBSB or 400 µ1 PBSB + PI to discriminate between viable and dead cells (final concentration of PI is 0 .5 ug/ml) . Samples were filtered (0 .2 µM) and transferred to flow cytometry tubes . Samples were analyzed using an EPICS Elite ESP flow cytometer (Beckman-Coulter, Miami, FL, USA) equipped with an Enterprise 621 laser (Coherent, Santa Clara, CA, USA) . The levels of expression of each surface marker were evaluated according to CD 19/CD20 positive B cells and PI negative viable populations.  2 .5 Bcl-2 silencing in vitro: cell transfections/imaging Z-138 and JVM-2 were transfected with oblimersen (Obl), RPO or MMO (Ctr) or bcl-2 siRNA by using the Amaxa Nucleofector (Amaxa Inc ., Gaithersburg, MD, USA) according to the manufacturer's protocol . Briefly, 3 x 10 6 cells were suspended into Amaxa nucleofection solution T (Z-138) or solution R (JVM-2) with 50-300 pMol bcl-2 siRNA (SMARTpool, Dharmacon, Chicago, IL, USA) or 100-600nM oblimersen (Genta Inc, Berkeley Heights, NJ, USA) . The A32 Amaxa nucleofection program was used for Z-138 and the A23 Amaxa nucleofection program was used for JVM-2 . Cells transfected with FITC labeled oblimersen (Becton Dickinson, San Jose, CA, USA) were evaluated for transfection efficiency by flow cytometry and by confocal microscopy (CI, Nikon, Japan equipped with inverted microscope Eclipse TE2000E and plan APO 60.0x/1 .45/0 .13 oil immersion objective) . Images were cropped and magnified with imaging system software Clsi version EZ-CI 3 .0 (Nikon, Japan) . Samples were analyzed using an EPICS Elite ESP flow cytometer (Beckman-Coulter, Miami, FL, USA) equipped with an Enterprise 621 laser (Coherent, Santa Clara, CA, USA) . Bcl-2 and bax  63  protein expression was analyzed by Western blotting . Approximately 3 x 10 6 of nucleofected cells were incubated for 48 hours before protein extraction . Approximately 25 µg protein per sample were separated on 12% SDS-acrylamide gel and electroblotted onto Protran nitrocellulose membranes (Whatman Inc ., Florham Park, NJ, USA). Membranes were blocked with Odyssey blocking buffer (Licor Biosciences, Lincoln, Nebraska, USA) for 1 hour at room temperature . For two-color detection, primary antibodies of mouse anti-human bcl-2 and rabbit anti-human bax (DAKO, Glostrup, Denmark) were incubated in Odyssey blocking buffer in dilutions of 1 :1000 and 1 :500, respectively . Alexa 680 conjugated goat anti-rabbit (Molecular Probes, Carlsbad, CA, USA) and IRDye 800 conjugated goat anti-mouse (Rockland Immunochemicals, Gilbertsville, PA, USA) secondary antibodies in dilutions of 1 :15,000 in blocking buffer were incubated for 30 minutes . Bands were detected with Licor Odyssey Infrared imaging system (Licor Biosciences, Lincoln, Nebraska, USA) and Odyssey Software 1 .2.  2 .6 Western Blotting Studies Western blotting analysis was performed using standard techniques . Briefly, 5-10 x 10 6 exponentially growing cells were washed in PBS or tumor tissues were snap frozen at -70°C, subsequently disaggregated and sonicated in cold lysis buffer (150 mM NaCl, 1% Nonidet P-40, 0 .5% sodium deoxycholate, 0 .1% SDS, 2 .5 mM EDTA, and 0 .1% mM sodium azide) containing protease inhibitors (complete mini protease inhibitor cocktail tablets, Roche, Mannheim, Germany) . Protein concentrations in the obtained lysates were determined by a BCA protein assay kit (BioRad, Hercules, CA, USA). Approximately 10-50 µg of protein for each sample were separated using 12%  64  polyacrylamide gels by electrophoresis and electroblotted onto Immobilon membranes (Millipore, Billerica, MA, USA) . The following antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) : anti-p18 (118 .2), anti-p16 (50 .1), antiCD20, anti-CD40, and anti-CD 154 . From Dako (Carpinteria, CA, USA) the following antibodies were purchased : anti-cyclin D1 (DCS-6), anti-bcl-2 (124), and anti-bax . The remaining antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA) : anti-p27, anti-NF-KB p65, anti-phospho-NF-KB p65-Ser-536, anti-cleaved caspase 3, anti-cleaved caspase 9, anti-p53 (7F5), and anti-cFLIP . The antibody cyclin D2 (G132-43) was purchased from BD Biosciences Pharmingen (San Diego, CA, USA). These antibodies were used at dilutions of 1 :100 or 1 :1000 for anti-bcl-2 and were subsequently incubated either for one hour at room temperature or overnight at 4°C in PBS containing 1% casein and 0 .02% Tween-20 . Anti-tubulin (Covance, Richmond, CA, USA) and anti-beta actin (Sigma, Saint Louis, MO, USA) at dilutions of 1 :100 and 1 :10,000 respectively, were used to assess protein loading . After extensive washing an anti-mouse, an anti-goat or an anti-rabbit IgG HRP (Promega, Madison, WI, USA) incubation at room temperature was performed for 30 minutes . Bands were detected using enhanced chemiluminescence reagent from Amersham (Baie D'Urfe, Quebec, Canada) . Membranes were exposed to Kodak X-Omat Kodak film (Mandel Scientific, Guelph, ON, Canada) . Band intensity was measured by densitometry . It should be noted that the cyclin D1 antibody clone DCS-6 can detect both cyclin DI a and cyclin D lb proteins (Hosokawa et al ., 1999 ; Gladden et al ., 2006).  65  2.7  Immunoprecipitation studies Protein A-Sepharose beads were purchased from Amersham Biosciences  (Piscataway, NJ, USA), and equilibrated by repeated washes with 500  !Al  of buffer D [30  mM Hepes (pH 7 .6), 60 mM KC1, 15 mM NaCl, 1 mM EDTA, 0 .5% Triton X-100] with protease and protein phosphatase inhibitor cocktails (Calbiochem, San Diego, CA, USA). The following antibodies were used : anti-cyclin D1 (DCS-6) (Dako and Cell Signaling Technology) and anti-bcl-2 (Dako, Carpinteria, CA, USA), anti-p38 MAPK, antiphospho p38 MAPK (Thr-180/Tyr-182) (3D7), anti-phospho-GSK-3a/(3 (Ser-21/9), and anti-phospho-mdm-2 (Ser-166) (Cell Signaling Technology, Danvers, MA, USA) . Five to ten microliters of each antibody were added to 100 µl-200 µL of the cell lysates or tumor lysates and incubated overnight or for one hour at 4°C . Fifty microliters of equilibrated protein A-Sepharase slurry were then added to each reaction and incubated at 37°C for one hour . Several washes were performed with buffer D and the pellets were collected and analyzed by SDS-PAGE (see Western blotting) . All immunoprecipitations were carried out at 37°C.  2.8 RNA isolation and PCR techniques 2.8 .1 Detection of cyclin D1 mRNA isoforms by quantitative real-time PCR To measure cyclin D1 mRNA expression by real-time quantitative RT-PCR, total RNA was prepared using the RNeasy® protocol with DNase I digestion (Qiagen, Valencia, CA, USA) and diluted to approximately 5 ng/µ1 . Five microliters of the diluted RNA were used for each RT-PCR reaction using TagManTM reagents and analyzed on an Applied Biosystems Thermal Cycler (Applied Biosystems, Foster City, CA, USA) . All  66    samples were run in triplicate in at least two independent experiments with a probe for the (32-microglobulin gene as a reference . Primers and Taqman probes for both (32microglobulin and the coding region of cyclin D1 have been described previously (Bijwaard  et al.,  2001) . The TaqMan probe for the 3'UTR was  5'TGCTGTGTGOOCCGGTCACCTA with forward primer 5'TCTCAATGA AGCCAGCTCACA and reverse primer 5'CTTTTGGTTCGGCAGCTTG . All probes were FAM labeled and purchased from Synthegen (Synthegen, Houston, TX, USA).  2.8.2  Detection of bcl-2, bax, bcl-xL , mcl-1 and IL-10 by quantitative real-time  PCR Total RNA from cell lines and tissues was isolated using Trizol reagent according to the manufacturer's protocols (Invitrogen, Carlsbad, CA, USA) . Triplicate cDNA were synthesized using 1 µg of total RNA with Superscript III (Invitrogen) . Bcl-2, bax, mcl-1, bcl-x L, IL-10 and porphobilinogen deaminase (PBGD) primers and probes were purchased from Applied Biosystems (Foster City, CA, USA) . Probes used included : bcl2 (5'-ctgaaccggcacctgcacacctg-3'), bax (5'-tcagaaaacatgtcagctgccactcgg-3'), mcl-1 (5'tcaagtgtttagccacaaaggcaccaaaag-3'), bcl-xL (5'-cctggccctttcggctctcgg-3'), IL-10 (5'acaagagcaaggccgtggagca-3'), PBGD (5'-catctttgggctgttttcttccgcc-3') . All probes were labeled with the following fluorescent markers, either VIC or FAM at the 5'end and TAMRA at the 3'end . For PCR reactions 1µl of cDNA was incubated with 2x Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 12 .5 pmol bcl-2/bax/bclxL/mcl-l/IL-10 primers, 15 .0 pmol PBGD primer, and 10 pmol of bcl-2/bax/bcl-x L/mcl1/IL-10 and PBGD taqman probes to a final volume of 251 .tl. Analysis of mRNA  67  expression was carried out using the ABI Prism 7500 Sequence detection system . All samples were done in triplicate.  2.9 Sequencing of TP53 exons 5, 6, 7, and 8 2.9 .1 DNA extraction Z-138 cells were digested at 55°C overnight with 40 mg of proteinase K in 400 µl digestion buffer (10 mM Tris pH 8 .0, 1 mM EDTA pH 8 .0, 0 .5% SDS, 50 mM NaCl). The proteinase K enzyme was then heat inactivated by incubating at 85°C for 20 minutes. RNA was removed by digestion with RNase A at 37°C for 60 minutes, at a final concentration of 100 µg/ml . Four hundred microliters of buffer saturated phenol/chloroform were added, and mixed thoroughly . Tubes were centrifuged at 13,000 g for 5 minutes to separate organic and aqueous phases . The aqueous phase was removed, and 40 µl 3 M sodium acetate were added, followed by mixing . One thousand microliters of 100% EtOH were added, and DNA was precipitated at -20°C for 30 minutes . Tubes were centrifuged at 13,000 g for 20 minutes, and liquid was removed leaving the DNA pellet . Seven hundred and fifty microliters of 70% EtOH were added and the tubes were briefly vortexed . Tubes were centrifuged briefly, and the EtOH was removed . Pellets were air dried, and then resuspended in H 2O.  2.9.2 PCR and DNA sequencing Exon specific PCR was performed using primers that amplify exons 5, 6, 7, and 8 of TP53 (exon 5 : TGTTCACTTGTGCCCTGACT and CAGCCCTGTCGTCTCTCCAG, exon 6 : GCCTCTGATTCCTCACTGAT and TTAACCCCTCCTCCCAGAGA, exon7:  68  ACGGGCCTCATCTTGGGCCT and TGTGCAGGGTGGCAAGTGGC, exon 8: TAAATGGGACAGGTAGGACC and TCCACCGCTTCTTGTCCTGC-3') (Sakai and Tsuchida, 1992) . Twenty-five microliter reactions were prepared using 2 .5 p.1 10X Buffer (Promega, Madison, WI, USA), 1 .0 – 1 .5 mM MgC1 2 (Promega), 10 mM each dNTP (Invitrogen, Carlsbad, CA, USA), 50 ng genomic DNA, and 5 U Taq polymerase (Promega) . PCR products were then extracted from a 1 .5% agarose gel using the Qiaquick gel extraction kit (Qiagen, Valencia, CA, USA) . Direct sequencing was performed by the Nucleic Acid Protein Service Unit in the Michael Smith Laboratories at the University of British Columbia . Exon sequences generated were compared against consensus exon sequences from the genome browser at the University of California Santa Cruz Genome Browser (http ://genome .ucsc .edu).  2 .10 Immunohistochemistry 2.10 .1 Staining for Ki67, caspase 3 and Fas ligand Formalin fixed tumor samples were prepared for sectioning . For staining purposes, anti-human Ki67 was obtained from Dako (Carpinteria, CA, USA) and used at a dilution of 1 :100 . Anti-cleaved caspase 3 was obtained from Cell Signaling Technology Inc . (Danvers, MA, USA) and anti-FasL (N-20) was obtained from Santa Cruz biotechnology (Santa Cruz, CA, USA) and used at a dilution of 1 :100. Methods for Ki67 staining have been described elsewhere (Kurita et al ., 2005) and cleaved caspase-3 and FasL were stained similarly . In brief, sections to be used for Ki67, cleaved caspase-3 and FasL staining were rehydrated and heated in 10 mM citrate buffer for 30 minutes. Subsequently, these sections were incubated with primary antibodies at 4°C overnight  69  followed by the addition of biotinylated secondary antibodies against mouse and and rabbit IgGs (Vector Laboratories Inc ., Burlingame, CA, USA) . Immunoreactivity was visualized with Vectastain Elite ABC Kit (Vector Laboratories Inc ., Burlingame, CA, USA) and diaminobenzidine (Sigma Chemical Co ., St. Louis, MO, USA) as the chromagen. The microscope Leica DM L (20x/0 .50 HCD PL Fluotar) was used and images were acquired with a Regita 1300i CCD camera (Qlmaging Inc .) and imaging software Openlab 5 .0.1 (Improvision Inc .).  2.10.2 Vasculature and Fas ligand immunostaining Cryosections, 10 µm thick, were fixed in acetone-methanol for 10 minutes at room temperature and immunostained simultaneously for vasculature and FasL using ratanti-PECAM/CD3 1 (BD Pharmingen, San Diego, CA, USA) and rabbit-anti-FasL (Santa Cruz biotechnology, Santa Cruz, CA, USA). Primary antibodies were detected using fluorescent labelled anti-rat Alexa-350 and anti-rabbit Alexa-546 secondary antibodies (Invitrogen, Burlington, ON, Canada) . Work was carried out in PBS containing 2% goat serum (Sigma Chemical, Oakville, ON, Canada) and 0 .1% Triton X-100 (Kodak, Rochester, NY, USA) . To rule out possible cross reactivity of the secondary antibodies, additional slides which were not stained with the primary antibodies were stained with the secondary antibodies . All samples were negative for cross reactivity but did show appropriate positive staining.  70  2.10 .2.1 Image acquisition The imaging system consisted of a robotic fluorescence microscope (Zeiss Imager Z1, Oberkochen, Germany), a cooled, monochrome CCD camera (Retiga 4000R, QImaging, Vancouver, BC, Canada), a motorized slide loader and x-y stage (Ludl Electronic Products, Hawthorne, NY, USA) and customized NIH-ImageJ software (public domain program developed at the U .S. National Institutes of Health, available at (htt p ://rsb .info.nih.~ov/ij/)) running on a G5 Macintosh computer (Apple, Cupertino, CA, USA) . The system allowed for tiling of adjacent microscope fields of view . Using this system, images of entire tumor cryosections up to 1 cm 2 were captured at a resolution of 0 .75 .im/pixel.  2.11 Animal studies 2.11 .1 Xenograft models Male Rag-2M mice with transgenic knock-out of the Rag-2 gene were obtained from the breeding colony at the British Columbia Cancer Agency at age 6-9 weeks . The mice, which lack B and T lymphocytes, were maintained in a pathogen-free environment. Approximately 5 x 10 6  exponentially growing cultured cells were injected  subcutaneously with Matrigel (volume of 100µi) (Collaborative Biomedical Products Inc, Chicago, IL, USA) or without Matrigel (volume of 50u1) (Collaborative Biomedical Products Inc .), intraperitoneally, or intravenously via tail vein . Animals were assessed for the time course of illness and for signs of tumor growth, and were sacrificed for progressing tumor mass > 1 cm 3, paralysis, ascites, scruffy coat, loss of >10% body weight and lethargy or for survival beyond 120 days . As specified within the individual  71  study protocols, tumor specimens were harvested as required and divided into two portions . One was snap frozen at -70°C (and used for western blot analysis) and the other was placed in buffered formalin or tissue preservative (OCT compound, Sakura Finetek, Torrance, CA, USA) and snap frozen on dry ice (and subsequently prepared for immunohistochemistry, see above).  2.11.2 Treatment doses and schedules The effects of treatment with either oblimersen (Obl) or Rituximab (Rtx) were investigated . Controls included treatment with saline, Herceptin and RPO or MMO . All drugs were administered intraperitoneally (ip) . Groups of six mice were injected ip with: oblimersen (2 .5, 5 and 12 .5 mg/kg) for 14 treatments every day (QD) excluding weekends or Rituximab (1, 2 .5, 5, 10 mg/kg) for 5 treatments every other day (QOD). All treatments began when tumors were palpable (0 .5 x 0 .5 x 0.5 mm), usually day 16-20 or when tumors reached 200 mg . All data are expressed as the average tumor volume (cm3) per group as a function of time . A statistical comparison between each treatment arm was analyzed as described below . All animal studies were completed in accordance with the current guidelines of the Canadian Council of Animal Care and with the approval of the University of British Columbia Animal Care Committee.  2.12 Statistical analysis In vivo efficacy data was analyzed using SPSS 13 .0 (SPSS Inc, Chicago, IL). The time taken for subcutaneous tumors to reach a size of 0 .4 cm3 was analyzed using Kaplan-Meier curves for survival analysis . This analysis allows modeling to the time  72  event data (ie : time to reach 0 .4 cm) in the presence of censored cases (ie : animals who never reached this end-point because of, for example, tumor ulceration) . Treatment and control groups were compared using a log-rank test . JVM-2 xenografts rarely reached a tumor volume of 0 .4 cm3 due to the kinetics of growth of this tumor and for this reason time to reach a tumor volume of 0 .1 cm 3 was evaluated . Results for quantitative real time PCR are from triplicate samples and are presented as mean ± the standard deviation. Statistically significant differences between samples were analyzed using two-tailed Student's t-tests for unpaired samples . A p-value of <0 .05 was considered significant.  73  CHAPTER 3 FOUR HUMAN T(11 ;14)(g13 ;g32)-CONTAINING CELL LINES HAVING CLASSIC AND VARIANT FEATURES OF MANTLE CELL LYMPHOMA  3.1 Introduction and rationale MCL is largely diagnosed by the presence of the t(11 ;14)(g13 ;g32) translocation, cyclin D1 over-expression and a characteristic immunophenotype (CDS+, CD20+, CD23-, CD10-) . Due to the late recognition of MCL as a distinct clinical and pathological entity there has been a lack of well-characterized MCL cell lines available for research purposes . The best-characterized cell line in the literature is Granta 519 and it is the most widely used by investigators (Jadayel et al ., 1997). Recent work has identified a number of new MCL cell lines (Mino, UPN-1 and -2) (Lai et al ., 2002; M'kacher et al ., 2003) and further characterized others (Granta 519, Jeko-1, SP-53) (Amin et al ., 2003 ; Rudolph et al ., 2004) . A comprehensive review of the MCL cell lines in existence, the extent of their characterization and the need to further characterize and classify existing cell lines is given elsewhere (Drexler et al., 2002) and in the introduction to this thesis. Many cell lines containing the t(11 ;14)(g13 ;g32) translocation were established before the classification of MCL such as NCEB-1 (Saltman et al., 1988), JVM-2 (Melo et al .,  1988), and HBL-2 (Abe et al ., 1988). In a number of cases this required  transformation with EBV (Saltman et al ., 1988; Melo et al ., 1988) and in others large numbers of cell lines were screened noting that those with the t(11 ;14)(g13 ;g32)  74  translocation were more readily established and grew at faster rates in vitro (Melo et al., 1988), while others containing the t(11 ;14)(q13;q32) translocation were noted as having higher rates of tumorgenicity in murine models (Abe et al ., 1988) . The exact mechanisms underlying this tumorgenicity are still unclear . Virtually all MCL overexpress cyclin D1 (CCND1) as a result of the t(11 ;14)(g13 ;g32) translocation (Swerdlow and Williams, 2002 ; Au et al., 2002) . Cyclin D1 facilitates progression of the cell cycle through its interaction with cyclin-dependent kinases (cdks) by phosphorylating and inactivating the retinoblastoma protein (RB) (Au et al., 2002 ; Hunter and Pines, 1994). The extent of the role cyclin D1 plays in malignant transformation in general and MCL lymphomagenesis specifically has been controversial . Transgenic murine models with enforced B-cell cyclin D1 have not shown lymphoma development (Lovec et al ., 1994) unless crossed with MYC or RAS transgenic strains (Bodrug et al ., 1994). These observations indicate that although cyclin D1 over-expression is critical to the MCL phenotype, it is insufficient on its own to generate malignant transformation . Nuclear retention of cyclin D1 has now clearly been shown to induce malignant transformation and this is discussed further in Chapter 5. In an attempt to reconcile which genes are important in the pathogenesis of MCL Rosenwald et al. (2003) used gene expression profiling to establish a molecular diagnosis of MCL and to identify predictors of outcome from patient biopsy samples . A few interesting observations arose from this study ; one was that differences in cyclin D1 mRNA abundance synergizes with INK4a/ARF locus deletions, which encodes tumor suppressors p16 and p14, to dictate tumor proliferation rate and survival . Another was that it is possible to develop a proliferation gene signature, omitting cyclin D1, to predict  75  outcomes, indicating that other genes are important to the clinical course of MCL. Lastly, they identified a subset of cyclin D1 negative MCL that was otherwise indistinguishable from cyclin Dl-positive MCL. The objectives in this Chapter of the thesis were foremost to further characterize pre-existing cell lines containing the t(11 ;14)(g13;g32) translocation that were ambiguous as to their classification . Furthermore, although the existence of different cyclin Dl mRNA isoforms has been known for quite some time to our knowledge very few publications in the recent literature address this phenomenon and in light of the recent observation that differences in cyclin D1 mRNA isoforms can correlate with survival, it is of interest to further investigate this in MCL models . The results of the characterization of the cell lines, Z-138, HBL-2, NCEB-1 and JVM-2 revealed that this group of cell lines represents both classic and variant features of MCL and can form the basis of a useful investigative platform to study this disease in more detail.  3.2 Results  3.2 .1  In vitro growth characteristics The cells lines HBL-2 and Z-138 had similar growth and morphological  characteristics and grew as single cell suspensions of small rounded cells . Doubling times of 24-48 h were observed for these cell lines which is consistent with previously reported doubling times as HBL-2 was found to have a doubling time of 36 h (Abe et al., 1988) and Z-138 had a doubling time of 18-24 h (Estrov et al ., 1998) . By contrast, NCEB-1 and JVM-2 grew as single cells and as larger clusters in suspension and exhibited slower growth rates in vitro . JVM-2 was previously found to have a doubling  76  time of 60-72 h (Saltman et al., 1988) and NCEB- 1 was found to have a doubling time of 72-96 h (Saltman et al ., 1988) . However, it was observed that typically JVM-2 exhibited the slowest doubling times of 72-96 h, while NCEB-1 had a slightly faster doubling time of 60-72 h.  3.2 .2 Immunophenotypic, cytogenetic, and EBV analysis Table 3 .1 summarizes the expression of surface markers in the four cell lines, as analyzed by flow cytometry . Each of the four cell lines expressed immunoglobulin lambda light chains and the B cell markers CD 19 and CD20 . All were FMC7 positive. JVM-2 and NCEB-1 co-expressed CDS, CD11c and CD23, whereas Z-138 and HBL-2 were negative for these markers . All the cell lines carried the t(11 ;14)(q13;q32) translocation by FISH analysis (Figures 3 .1-3 .4) . In addition, the HBL-2 cell line showed tandem repeats of the IGH/BCL1 fusion on the derivative chromosome 14, demonstrating amplification of the fusion product, as previously described (Figure 3 .2) (Taniwaki et al., 1995) . Z-138 additionally carries the c-myc translocation t(8 ;14) as described thoroughly elsewhere (Estrov et al ., 1998 ; Guikema et al., 2005) (Figure 3 .1). The NCEB-1 cell line was near-tetraploid, while the other cell lines were diploid or hyperdiploid ; multiple numerical and structural anomalies were present in each of the cell lines by standard cytogenetic and mFISH analysis (Table 3 .2 and Figures 3 .1-3 .4). The presence of EBV in the cell lines was determined by FISH analysis (Table 3 .3, Figure 3 .5) . JVM-2 and NCEB-1 cell lines were positive for EBV . JVM-2 showed both episomal and chromosomally-integrated EBV copies, while NCEB-1 showed only episomal EBV copies . Z-138 and HBL-2 cell lines were EBV-negative.  77    	+  Table 3.1 Immunophenotype of cell lines as analyzed by flow cytometry  Phenotypic Marker FMC7 CD5 CD 10 CD 11 c CD23 CD45 + + + + + + + + + +  Mantle cell line CD 19 CD20 + + JVM-2 + NCEB-1 + Z-138  +  +  HBL-2  Wk  +  a,  +  Wk, weak expression; positive (+)/negative (-)  78  -  _  _  _  _  +  _  +    (A)  (B)  Figure 3.1. Cytogenetic analysis of Z-138 . (A) Detection of the t(11 ;14)(g13 ;g32) translocation by FISH . Arrows show IGH/CCND1 fusion signal . (B) Detection of chromosomal abnormalities by mFISH in the Z-138 cell line . A minimum of 5 metaphases were examined per cell line . Arrows indicate t(l 1 ;14) translocation.  79    (A)  (B )  Figure 3 .2. Cytogenetic analysis of HBL-2 . (A) Detection of the t(11 ;14)(q13 ;q32) translocation by FISH . Arrows show IGH/CCND1 fusion signal . (B) Detection of chromosomal abnormalities by mFISH in the HBL-2 cell line . A minimum of 5 metaphases were examined per cell line . Arrows indicate t(l 1 ;14) translocation.  80    (A)  (B)  Figure 3 .3. Cytogenetic analysis of JVM-2 . (A) Detection of the t(11 ;14)(g13 ;g32) translocation by FISH . Arrows show IGH/CCND1 fusion signal . (B) Detection of chromosomal abnormalities by mFISH in the JVM-2 cell line . A minimum of 5 metaphases were examined per cell line . Arrows indicate t(11 ;14) translocation.  81    (A)  (B)  Figure 3 .4 . Cytogenetic analysis of NCEB-1 . (A) Detection of the t(11 ;14)(g13 ;g32) translocation by FISH . Arrows show IGH/CCND1 fusion signal . (B) Detection of chromosomal abnormalities by mFISH in the NCEB-1 cell line . A minimum of 5 metaphases were examined per cell line. Arrows indicate t(11 ;14) translocation.  82    Table 3.2 Cell line karyotypes Cell lines JVM-2  Karyotype 46,XX,t(4;13)(g2?5 ;q1?4),der(8)t(3 ;8)(?gl0 ;pl0),t(11 ;14)(g13 ;g32) (by MFISH)  NCEB- 1  81,X,del(X)(?q),Y,-Y,-2,-4,der(5)t(5 ;12)(p 1 ?5 ;?)x2,-6,+8,+8, -9,der(9)t(9 ;13)(q3? ;q?)x2,der(10)t(10 ;15)(g2?2;q?)x2, t(11 ;14)(q3 ;q32)x2,-12,der(12)t(12 ;18)(p1 ;?q)x2,-13, der(13)t(12 ;13)(? ;?),-15,15,-17,+del(18)(q?)x3,-20,-21 (by MFISH)  Z- 138  50,XY,+ 1 ,der( 1 ; 15)(q 10 ;p 10),del(5)(p 15),+7,der(9)t(9 ; 1 8)(p23 ;?q21), der( 11)t(11 ;14)(q 13 ;q32),+12,+13,der(14)t(8 ;14)(g24 ;g32), der(14)del( 1 1)(q 14g25)t(11 ;14)(q 13 ;g32),der(17)t(17 ;17)(p 12 ;821), der( 1 8)?ins( 1 8 ;18)(p 11 ;g21 q22),+?inv(18)(?p 11 .3g23) (by G-Band and MFISH)  HBL-2  50,XY,der( 1 )t( 1 ; 16)(?q ;?),der( 1 ;4)(?q;q),der( 1 )( 1 ; 1 1 : 15)(? ;?;?), der(3)(8;3; 15)(? ;? ;?),der(4 ; 18)(?q ;?q),+7,der(8)t(8 ; 16)(p?;?), der(9)t(3 ;9)(? ;p2),der(9)(9 ;22)(q 1 ;q 1),der(9)t(9 ; 18)(ql ;?),del(9)(p 1), der( 1 1)t(8 ;11)(? ;q?21),t( 1 1 ;14)(q13 ;g32),der(13)t(13 ;18)(q? 1 ;?), der( 14)t(14 ;15)(q?3 ;q?),der(15)t(3 ;15)(? ;q?)x2, der( 17)t(11 ;17)(? ;q?2),dup(18)(?q 11g23),-22 (by MFISH)  83    (A) Z-138  (B) HBL-2  (C) JVM-2  (D) NCEB-1  Figure 3 .5. FISH analysis for EBV . (A) Z-138 (B) HBL-2 (C) JVM-2 and (D) NCEB-1 . Both Z-138 and HBL-2 are negative for EBV while JVM-2 and NCEB-1 are positive for EBV (indicated by the arrows).  84    Table 3 .3 Molecular profiles and EBV analysis of cell lines and cyclin D1 negative (DoHH2) and positive (TC32) controls  Karyotype  Western Blotting Analysis  cell t(11 ;14) Ploidy Cyclin 	pMantle l8 line 	D 2 D1 a JVM-2 + 2n wk NCEB-1 + 4n + + Z-138 +++ 2n HBL-2 +d 2n ++ NHL' line t(8 ;14 ;18) _ DoHH2 Osteosrcf cyclin Dl TC32 ++  Cyclin  pl6 a  a  Gene copy #  EBV Analysis  p53 b  FISH Epi c 6-11 20-28 0 0  loss  a + -  + +  -  -  -  + +  No Heter No Heter  p16 b loss  No Heter Heter Heter  amplification  aWestern blotting analysis . wk=weak expression ; +, positive expression ; ++, strong expression; +++, very strong expression ; -, no detectable expression. bGene copy number by locus-specific FISH. Heter= heterozygous deletion, No= no deleted copies 'Approximate number of EBV copies per cell, episomal versus chromosomally integrated dExtra copy of IGH signal in all nuclei some metaphases show IGH/BCLI tandem repeats consistent with amplification ; +, t(11 ;14) (q 13 ;g32) translocation present 'Non-Hodgkin's lymphoma cell line, cyclin D1 -negative control fOsteosarcoma cell line, cyclin D1 positive -control  85  FISH Chrom ' 2 0 0 0  3.2.3 Expression of cyclin D1 protein and analysis of mRNA isoforms The amount of cyclin D1 protein expression was determined by Western blotting analysis . Despite the presence of a t(11 ;14) translocation in all the cell lines studied, considerable variation in the abundance of cyclin D1 protein expression was shown in Figure 3 .6A. Z-138 and HBL-2 cells expressed levels of cyclin D1 comparable to, or greater than, the TC32 cell line (positive control) while NCEB-1 and JVM-2 had a considerably lower expression of cyclin D1 protein. MCLs have been reported to express various cyclin D1 mRNA isoforms that differ in the sequence of the 3' end of the coding region and in the length and structure of the 3'UTR (Rimokh et al ., 1994 ; de Boer et al ., 1995b) . Isoforms that have a shortened 3'UTR tend to be expressed at higher levels than those with a full length 3'UTR and are associated with higher expression of tumor proliferation and inferior survival (Rosenwald et al .,  2003). To test whether the MCL cell lines reflect this pathogenic mechanism  quantitative RT-PCR was used to measure the expression of total cyclin D1 mRNA with a probe in the coding region. A second probe adjacent to the polyadenylation signal of full length mRNA was used to determine the presence of the terminal 3'UTR (Figure 3 .6B). It was found that the two cell lines with the highest cyclinD 1 mRNA levels, Z138 and HBL-2, expressed a greater amount of the truncated 3'UTR isoform, with the exception of HBL-2 which expressed high levels of both mRNA isoforms, while NCEB1 and JVM-2 expressed low levels of both mRNA isoforms . Furthermore, JVM-2, which was found to have the lowest expression of cyclin D1 protein and the lowest expression of both cyclin D1 mRNA isoforms (Figure 3 .6), was the only cell line to express cyclin D2 (Table 3 .3) .  86    T  F  T  T  1  (  i  DoHH2 TC32 Granta JVM-2 NCEB1 Z-138 HBL-2  cycin D1 . .r tubulin -+  36  (A) 4 .0 3 .5  2  N  3 .0  coding  tEE1  3'UTR  2 .5  0  U  2 .0  0 1 .5 1 .0 0 .5 (B)  0.0 Granta  JVM-2  NCEB1  Z-138  HBL-2  Figure 3 .6. Cyclin D1 expression in cell lines . (A) Western blotting analysis of cyclin D1 protein expression . DoHH2 was used as a negative control and TC32 was used as a positive control for cyclin D1 expression . (B) Quantitative RT- PCR analysis of cyclin Dl (CCND1) mRNA expression . The total cyclin Dl mRNA was measured using a probe against the coding region and to determine the presence of the terminal 3'UTR a second probe adjacent to the polyadenylation signal of full length mRNA was used. Values are the mean ± standard deviation of three replicates . Note: representative sample shown for Western blotting analysis . 87  3.2.4 Determination of the presence of p16, p18 and p53 HBL-2 and Z-138 showed no expression of p16 at the protein level (Table 3 .3) and therefore, it was decided to determine if these cell lines were deleted for p16 by FISH analysis (data summarized in Table 3 .3) . JVM-2 was the only cell line to retain both copies of p16 based on locus-specific FISH analysis, while both Z-138 and HBL-2 showed heterozygous deletion for p16 . NCEB-1, a near-tetraploid cell line, had a total of 3 copies of p16, indicating heterozygous loss, but it nevertheless still retained p16 protein expression . An evaluation for deletions of p53 was also completed for all the cell lines (Table 3 .3) . JVM-2 and Z-138 retained both copies of p53, while HBL-2 revealed a heterozygous deletion of p53 . Similarly, NCEB-1 showed three signals, indicating the loss of one copy of p53. 3.2.5 Growth in Rag-2M mice All cell lines showed subcutaneous growth in Rag-2M mice (Figure 3 .7) . Growth was enhanced by injection with Matrigel, with the exception of HBL-2, which showed equally rapid growth with or without Matrigel as most injected sites showed growth by days 25-30 . In the cell lines other than HBL-2 growth in the absence of Matrigel was delayed beyond day 50 or not observed . Animals injected with Matrigel were tested for lactose dehydrogenase-elevating virus (LDEV) . These animals were negative for LDEV, but it cannot be certain that the Matrigel used at the time was LDEV free . JVM-2 and NCEB-1 had a slower growth pattern of about 40-50 days compared to Z-138 and HBL-2 (Figure 3 .7). A shorter survival time was observed for animals injected subcutaneously with HBL-2 (27 days) and Z-138 (31 days), while longer survival times were observed for both JVM-2 (50 days) and NCEB-1 (47 days) . IP or i.v injection of HBL-2 led to  88    tumor growth and dissemination with a somewhat slower time course of about 45-50 days . Parenteral injection of Z-138 did not generate any systemic disease . The i .v. injection of JVM-2 and NCEB-1 led to the establishment of cohesive deposition of systemic MCL after 60-90 days . Parenteral injection of the HBL-2, NCEB-1 and JVM-2 cell lines showed tropism for extranodal sites, although the number of animals tested was small.  1 .2 1 .0 -  0.2 0 .0 15  20  25  30  35  40  45  50  Day  Figure 3.7. Growth curves for different cell lines . Rag-2M mice were injected with 5 x 10 6 cells subcutaneously with each cell line HBL-2 ( n), Z138 (o), NCEB-1 (A), JVM2 (.) . Mice were terminated for progressing subcutaneous tumor mass >1 cm 3 , paralysis, ascites, scruffy coat and lethargy, loss of body weight >10%, or for survival beyond 90 days . Values are mean ± standard deviation of six measurements.  89  3.3 Discussion Although a number of B-cell lymphoma cell lines that harbor the t(11 ;14)(g13 ;g32) abnormality exist, very few have been documented and characterized as MCL cell lines in the literature (Jeon et al., 1998 ; Drexler et al ., 2002) . Many of the cell lines such as NCEB-1 (Saltman et al., 1988), JVM-2 (Melo et al., 1988) and HBL-2 (Abe et al ., 1988) were established before MCL was widely accepted as a separate clinical entity . The cell line Z-138 was initially described as acute lymphoblastic leukemia, derived from a patient with previous chronic lymphocytic leukemia and was characterized in part by the presence of t(11 ;14)(g13 ;g32) translocation and overexpression of cyclin D1 (Estrov et al., 1998). The data presented in this thesis indicate that, in retrospect, Z-138 is in fact a MCL cell line derived from a blastoid transformation of MCL, originally misclassified as CLL . All four of the previously established cell lines examined in this study exhibited the hallmark t(11 ;14)(q13 ;q32) . The typical immunophenotype of MCL consists of combined CD20 and CD5 positivity, with CD10 and CD23 negativity, although anomalous cases have been reported (Decaudin, 2002). EBV-positive cell lines, JVM-2 and NCEB-1, were CD5 and CD23 positive while the EBV-negative cell lines, HBL-2 and Z-138, were CD5 and CD23 negative . This was not entirely surprising as EBV transformed cell lines have been reported to have differential expression of CD5 (Saltman et al ., 1988; Ott et al ., 1997). All of the cell lines examined had high but variable expression of cyclin D1 . The cell lines that were the highest expressers of cyclin D1 protein, Z-138 and HBL-2 had a greater amount of the truncated cyclin D1 mRNA isoform, with the exception of HBL-2, which had high amounts of both mRNA isoforms . HBL-2 was the only cell line shown to have an amplification of the IGH/BCL-1 fusion product and this may explain why high  90  levels of both cyclin D1 mRNA transcripts were present in this cell line . Furthermore, Z138, and HBL-2 had increased proliferation rates  in vitro  and  in vivo .  It is not clear that  differential expression of cyclin D1 alone contributes to the higher proliferation rates seen in these cell lines, as other studies have shown that cyclin D1 protein levels did not correlate with the proliferative activity of MCL cells (Sanchez-Aguilera et al., 2004). However, as mentioned earlier, differences in cyclin D1 mRNA abundance have recently been shown to correlate with proliferation rate and survival in MCL along with deletions of the INK4a/Arf locus encoding tumor suppressors p16 and p14 (Rosenwald et al., 2003) . Observations provided here reflect this finding ; the cell lines Z-138 and HBL-2, which exhibited the fastest growth rates and had the shortest survival times in Rag-2M mice injected subcutaneously, had high expression of either one or both cyclin D1 isoforms and had negligible expression of p16, while NCEB-1 and JVM-2 had low expression of both mRNA isoforms, retained expression of p16, and had slower growth rates and exhibited longer survival times in Rag-2M mice. Alterations affecting cdk inhibitors p16 or p15 are seen more frequently than those affecting p18, which have been observed in human cancer only sporadically (Sanchez-Aguilera et al ., 2004 ; Iolascon et al ., 1996; Blais et al ., 1998) . However, alterations in p18 expression have been shown to be more frequent in MCL than other non-Hodgkin's lymphomas (NHLs) (Williams et al ., 1997 ; Swerdlow and Williams, 2002) . It is worth noting that, in the absence of p16 expression, HBL-2 and Z-138 retained p18 protein expression . In contrast, JVM-2 and NCEB-1 expressed p16 but lacked expression of p18 . p18 has been proposed to function as a tumor suppressor gene (Franklin et al ., 1998 ; Latres et al ., 2000) and more recently it has been shown that  91  Hodgkin's lymphoma cases featuring loss of p18 protein expression have different clinical characteristics, a poorer treatment response and have an inferior survival (Sanchez-Aguilera et al., 2004) . As loss of p18 expression occurs infrequently in most carcinomas, these models may provide an opportunity to delineate the functions of p16 and p18 in MCL pathogenesis. Classic MCL is represented by the presence of a t(11 ;14)(g13 ;g32) translocation with resultant over-expression of cyclin D1 . However, recent reports have shown that cyclinD1/t(11 ;14)(g13 ;g32) negative MCL exists (Rosenwald et al., 2003 ; Yatabe et al ., 2000), and in some cases cyclin D2 or D3 were expressed instead . Although all the cell lines examined in this study over-expressed cyclin D1 and retained the t(11 ;14)(g13 ;g32) translocation it is worth noting that JVM-2, which expressed the lowest levels of cyclin D1, was the only cell line that expressed cyclin D2 . This may be an indication that other cyclins may substitute for cyclin D1 not only in cyclin Dl/t(11 ;14)(q13 ;q32) negative cases but also in cases that express very low levels of cyclin D1 and retain the translocation . At present the mechanisms underlying this phenomenon are unclear but it is interesting to note that JVM-2 is an EBV transformed cell line and it recently has been reported that expression of cyclin D2 can be induced by EBV proteins LMP-1 and EBNA2 (Arvanitakis et al ., 1995 ; Sinclair et al., 1995). In conclusion, the recognition of classic and variant features of MCL has the potential to facilitate a better understanding of the key elements involved in the development of this disease . The identification of differential expression of cyclin D1 raises questions regarding the exact role it plays in pathogenesis and implies deregulation of other genes involved in cell cycle progression especially in cases of low to no  92  expression of cyclin D1 . Furthermore, MCL models will be useful in helping to understand the mechanisms influencing the expression of differential cyclin D1 mRNA isoforms which may have broader implications for other malignancies as differential expression of cyclin D1 mRNA isoforms was shown in a human breast cancer cell line (Lebwohl et al ., 1994). Hopefully, with a better understanding of the MCL cell lines available and with a broader distribution of these cell lines, investigators can continue to make progress in delineating the steps leading to this devastating disease and to improve treatment outcomes .  93  CHAPTER 4 SILENCING BCL-2 IN MODELS OF MANTLE CELL LYMPHOMA CORRELATES WITH LOSS IN CYCLIN Dla EXPRESSION BUT NOT CYCLIN Dlb AND IS ASSOCIATED WITH DECREASES IN NFkappaB, p53, BAX and p27 LEVELS  4.1 Introduction and rationale The lack of progress in the treatment of MCL is due in part to its late recognition as a separate clinical and pathological entity and a dearth of available cell lines and preclinical models needed to test the efficacy of new treatment strategies (Drexler et al., 2002). In recent years, more progress has been made in the establishment of well characterized cell lines leading to preclinical models of MCL (see Chapter 3)(M'Kacher et al .,  2003 ; Tucker et al ., 2006) . Thus novel treatment strategies currently studied in  other lymphomas, such as targeted therapies against bcl-2 (Chanan-Khan, 2005), can now be assessed in MCL. One of the early events in the development of MCL is thought to be the t(11 ;14)(g13;g32) translocation where the immunoglobulin heavy chain promoter is juxtaposed to the cyclin Dl gene leading to cyclin D1 over-expression (Swerdlow and Williams, 2002) . Cyclin D1 is believed to play an important role in the biology of MCL and a higher expression of cyclin D1 mRNA transcripts has been associated with an increased cell proliferation rate and is related to decreased survival (Rosenwald et al .,  94  2003). Gladden et al . (2006) demonstrated that inhibition of cyclin D1 nuclear exportation, preventing cyclin D1 degradation in the cytoplasm, leads to a constitutive nuclear expression of cyclin D1 and induces lymphomagenesis in murine models. Furthermore, in addition to nuclear retention of cyclin Dl, lymphoma onset correlated with perturbations in p53/mdm-2/p19`  expression and with bcl-2 over-expression,  indicating a role for these pathways in lymphoma development (Gladden et al ., 2006). Thus, in the context of MCL it is important to consider deregulation of expression of genes involved in cell cycle progression (e .g. cyclin D1, p27) as well as those involved in cell survival/apoptosis (e .g. bcl-2, NF-KB, p53, bax). Bcl-2 alters the activity of a variety of cell signaling proteins involved in apoptosis, proliferation, and cell survival (Ryan et al ., 1994 ; Borner, 2003 ; Jang and Surh, 2004) . The frequency of bcl-2 over-expression in MCL has been shown to be as high as 97% (Tracey et al ., 2005) . Although bcl-2 has been shown to have multiple independent functions, bcl-2 possesses no inherent enzymatic activity (Jang and Surh, 2004). The bcl-2 proto-oncogene encodes an intracellular membrane-associated protein that has been located in the mitochondrial, endoplasmic reticulum and nuclear membrane (Borner, 2003) . Its proximity to the pore structures of the nuclear membrane is an ideal location for interacting with proteins as they cross the nuclear envelope (Reed, 1997). Thus, it has been proposed that bcl-2 can act as an adaptor or docking protein sequestering molecules to the nuclear membrane. This function of bcl-2 can result in inactivation of the bound protein or may facilitate interactions with other proteins (Reed, 1997), such as proteins like Rafl that possess kinase activity capable of altering multiple cell signaling pathways (Jang and Surh, 2004).  95  The role that over-expression of bcl-2 plays in mediating resistance to apoptosis through alteration of other cell signaling pathways such as cyclin Dl/p27, p53/mdm-2 and NF-KB is largely unknown in MCL . Thus, in this Chapter the focus was on investigating the cell signaling pathways by which bcl-2 over-expressing cells mediate resistance to cell death using human MCL cell lines, Z-138 and JVM-2 . For this purpose a strategy that involved the silencing of bcl-2 with siRNA or an antisense oligonucleotide against bcl-2 (oblimersen) was used . Silencing bcl-2 in Z-138 xenografts revealed an associated dose dependent suppression of bax, a decrease in NF-KB and phospho-NF-KB and transient loss of p53 levels . Co-immunoprecipitation studies indicate that the latter observation is mediated by an association between bcl-2 and phospho-mdm-2 . Bcl-2 silencing also led to p27 downregulation and co-immunoprecipitation studies point to a role for bcl-2 in regulation of p27 localization/degradation . Bcl-2 silencing was also correlated with loss of cyclin D1 protein levels . Co-immunoprecipitation studies indicate that bcl-2 may mediate its effects on cyclin D1 via interaction with p38 MAPK as well as a previously unreported interaction between bcl-2 and cyclin D1.  4.2 Results and discussion 4.2 .1 MCL cell lines exhibit a greater bcl-2 over-expression than a cell line containing the bcl-2 translocation t(8 ;14 ;18) All of the MCL cell lines examined had levels of bcl-2 protein expression either equal to or 2-fold higher than the DoHH2 cells, which were used as the bcl-2 positive control (Figure 4 .1A) . As a baseline control, bcl-2 expression levels in TC32 cells were approximately 90% lower than those seen in the DoHH2 cells . The expression of bcl-2  96    mRNA followed a similar pattern to bcl-2 protein levels (Figure 4 .1B) which is consistent with previous studies (Shen et al ., 2004).  A  hd2 --  26  actin  B 3.5 3.0 c 2 .5 co 2 .0 ~{ r~ 1 .5 1 .0 0 .5 0 t)ohh2 TC32 Grants JVM2 NCEB1 2138 1BL2  Figure 4.1 . Bcl-2 expression in MCL cell lines . Bcl-2 expression in MCL cell lines is equivalent or 1- to 2-fold higher than the DoHH2 cell line containing the bcl-2 translocation t(8 ;14;18) and parallels its mRNA expression levels . (A) Western blotting analysis of bcl-2 expression . DoHH2 was used as a positive control and TC32 was used as a negative control for bcl-2 expression . (B) Quantitative real time PCR analysis of bcl-2 mRNA expression relative to the endogenous control porphobilinogen deaminase (PBGD) . Values are mean ± standard deviation of three replicates . Note: a representative sample is shown for Western blotting analysis.  97  It should be noted that all of the MCL cell lines tested in this study are high overexpressers of bcl-2, reflecting the clinical disease state (Tracey et al ., 2005). Z-138 (high level of bcl-2) and JVM-2 (lowest level of bcl-2) cell lines were used for comparative purposes. In addition to the 1 .8-fold higher bcl-2 expression levels, it should be noted that the Z-138 cell line exhibits an amplification of the bcl-2 gene copy number, while this amplification is absent in JVM-2 cells (de Leeuw et al., 2004).  4.2 .2 Z-138 cells were more sensitive to bcl-2 downregulation in vitro than JVM-2 cells A significant downregulation of bcl-2 mRNA was observed in Z-138 cells after treatment with oblimersen (Obl) (300 nM) (p=0.027) and siRNA (200 pMol) (p=0 .001) although there was not an associated decrease in bcl-2 protein levels (Figure 4 .2 A-D). Treatment with higher doses of oblimersen (600nM) and siRNA (300 pMol) caused a significant downregulation of bcl-2 mRNA levels (p < 0 .025) and led to an associated decrease in bcl-2 protein levels in Z-138 cells (Figure 4 .2 A-D). Notably, only mRNA was significantly downregulated in JVM-2 cells after treatment with the highest dose of siRNA (300 pMol) (p=0 .039) (Figure 4 .2 B and D). To determine whether differences in gene silencing could be attributed to the amount of oblimersen delivery to the cell lines, FITC-oblimersen was transfected into Z138 and JVM-2 cells . Subsequently, the cells were analyzed by confocal microscopy and flow cytometry . The results summarized in Figure 4 .2E indicate that FITC-oblimersen delivery to Z-138 and JVM-2 cells were comparable on the basis of confocal microscopy analysis . This result was confirmed by flow cytometry, where Z-138 (Figure 4 .2F filled triangles) and JVM-2 cells (Figure 4 .2F open triangles) transfected with FITC-  98  oblimersen exhibited comparable uptake . Although differences in the mean fluorescence of cells were noted at 30 minutes after transfection, indicating that Z-138 cells had higher levels of cell associated oblimersen, these differences were not sustained . These data would indicate that differences in bcl-2 silencing could not be attributed to differences in FITC-oblimersen transfection . In Chapter 3 it was shown that Z-138 cells proliferate more rapidly than JVM-2 cells and it is possible that a more rapid rate of bcl-2 mRNA and protein turnover may confer a greater sensitivity to treatments targeting mRNA degradation and subsequently loss of protein levels.  99    4 .50 2 .5 0 co 2 .0  3.53.0 -  c  NN 1 .5  N  x • 1 .0  w o  m  0.5 0  2.5-  1 . 11  illil . .,  2.0 1 .51 .0 0.5--  Unt Ctr 100  300 600 Z138 : Obl (nM)  1 Unt neg 50 200 300 Unt neg 50 20300 Z138 : siRNA (pMol) JVM2 : siRNA (pMol)  D  C    Z138 :siRNA (pMol) E Unt neg 50 200 3 .4 4 .4 3 .5 3 .7 1 .9   Obl (nM) Ctr (nM) Unt 100 300 600 100 300 600 8 .0 7 .7 6.6 1 .5 6.4 9 .0 4 .2 Z138)  JVM2 : siRNA (pMol) E Unt neg 50 200 5 .4 7 .5 7 .8 7 .1 8 .9  bcl2  bcl2  actin  actin  3 .6 4 .0 3 .7 3 .1 3 .0 3 .4 3.3 Z138 : siRNA (pMol) E 300 2.0 0 .49 bcl2  bcl2 actin  JVM2I  JVM2 : siRNA (pMol) E 300 0 .49 0 .78 bcI2  actin E  actin  F Z138  JVM2  U  60  Z138  u—.. 50.  cc'  8  40 30  >g JVM2  S  0 • • 20-  c  10-  • •  0  Z138 n untreated • free FITC ♦ transfected FITC JVM2 a untreated o free FITC A transfected FITC  0.5 1 .0 2 .0 3 .0 4 .0 Time (hours)  Figure 4 .2. Bcl-2 silencing in vitro in Z-138 cells and JVM-2 cells . Quantitative real time PCR analysis (A, B) and Western blotting analysis (C, D) of Z-138 and JVM-2 cells left untreated (Unt) or treated with oblimersen (Obl) (100-600 nM) or control ASO (Ctr) (100-600 nM) for 48 h or treated with bcl-2 siRNA (50-300 pMol) or a negative siRNA control (neg) for 48 h. An additional control of untreated electroporated cells, denotated as E was analyzed by Western blotting . * represents significant downregulation of bcl-2. Analysis of transfection efficiency of Z-138 and JVM-2 cells following 48 h treatment with FITC labeled oblimersen by either (E), confocal microscopy, images taken at 60x oil immersion and (F), flow cytometry as analyzed at different time points (1/2-4 h) after transfection . Z-138 : untreated cells ( n), incubation of cells with free, untransfected FITC-oblimersen (•) cells transfected with FITC-oblimersen (A) ; JVM-2 : untreated cells (q), free (o), transfected (A).  100  4.2.3 Oblimersen treatment in Z-138 xenografts and JVM-2 xenografts engenders tumor growth delays and correlates to reduced proliferation and an increase in apoptosis The in vitro results summarized above suggest that tumors established following inoculation of JVM-2 cells would be influenced to a lesser extent by the gene silencing activity of oblimersen, while Z-138 derived tumors would be sensitive . As expected, treatment with oblimersen caused a significant tumor growth delay in animals bearing Z138 tumors . This was observed after treatment with doses of 5 and 12 .5 mg/kg oblimersen (Figure 4.3A) . Using time to reach a tumor volume of 0 .4 cm3 as an endpoint defining survival, a statistical analysis of the resultant Kaplan-Meir indicated that the antitumor activity of oblimersen administered at these doses was highly significant (p<0.0005). Perhaps surprisingly, animals bearing JVM-2 tumors and treated with oblimersen appeared to exhibit a significant tumor growth delay when treated at oblimersen doses of 5 and 12 .5 mg/kg when compared to controls (Figure 4.3B).  101    Z138  JVM2  C Z138  Ki67  Caspase 3  Figure 4 .3. Z-138 and JVM-2 xenografts exhibit a significant tumor growth delay following treatment with oblimersen . Tumor growth delay in Z-138 xenografts is associated with a marked decrease in proliferation and an associated increase in apoptosis . Growth curves for (A) Z-138 and (B) JVM-2 xenografts after treatment with either saline (II), control ASO (Ctr) ( q) or oblimersen (Obl) 5 mg/kg (41) and 12 .5 mg/kg (o) . (C) Immunohistochemistry analysis for Z-138 xenografts : Ki67 and caspase 3 staining of tumor tissue at day 7 of treatment with either saline, control ASO (Ctr) or oblimersen (Obl) (12 .5 mg/kg) . Images were taken at 20x magnification.  102  There remains some controversy over the mechanism of activity driving the therapeutic effects of oblimersen in vivo (Lebedeva and Stein, 2001). As suggested by others, bcl-2 suppression may be the result of indirect effects (Castro et al ., 2006), but these indirect effects vary depending on the system analyzed and with the appropriate controls these indirect effects can be accounted for. The antisense sequence and control sequences (RPO and MMO) used in the studies summarized here all contain an immune activating CpG motif that could stimulate NK functions in the Rag-2M mice, however, only oblimersen was capable of inducing therapeutic effects . Previous studies from our laboratory indicate that the therapeutic activity of oblimersen was maintained in mice that lack NK function (Klasa et al ., 2000), and there is little doubt from our perspective that part of the therapeutic action of oblimersen is due to bcl-2 suppression . As indicated previously, an objective of this study was to determine how MCL cell lines respond under conditions where bcl-2 is suppressed . Since Z-138 exhibited sensitivity to oblimersen treatment both in vitro and in vivo, this model was chosen for subsequent studies. In Z-138 xenografts the effects of oblimersen treatment on proliferation and apoptosis was examined on day 7 after treatment initiation. As shown in Figure 4 .3C (top photomicrographs), treatment with oblimersen (12 .5 mg/kg) led to a decrease in proliferation rates as measured by a substantial decrease in Ki67 staining . An increase in apoptosis was also apparent as shown by the presence of cleaved caspase 3 when compared to tumors from animals treated with saline or control antisense sequence (Figure 4 .3C, bottom photomicrographs) . Western blotting analysis was used to assess whether oblimersen treatment of Z-138 tumor bearing mice was associated with bcl-2  103  suppression and the results (summarized in Figure 4 .4A) clearly demonstrate a dose dependent downregulation of bcl-2 . Bcl-2 protein suppression data shown in Figure 4 .4A was observed in tumors isolated 7 days after treatment was initiated . It is also important to note, as shown in Figure 4B, that the bcl-2 levels measured in tumors from mice treated with 12 .5 mg/kg doses were comparable to controls at the end of the study (day 30). Previous studies have also showed maximum downregulation of bcl-2  in vivo  between day 5 and 7 after treatment was initiated and a return to normal levels of bcl-2 expression after day 7, despite continued treatment with oblimersen (reviewed in Lebedeva and Stein, 2001). Thus, this model is an interesting one to begin to question how MCL cells are compensating in response to oblimersen engendered decreases in bcl-2 levels . For example, in MCL over-expression of bcl-2 is associated with a decrease in expression of apoptotic effectors such as caspase 9 (Hofmann et al ., 2001) . For this reason, the effect of bcl-2 silencing on caspase 9 levels was evaluated . The results summarized in Figure 4C show that bcl-2 silencing  in vivo  with a 12.5 mg/kg oblimersen dose led to a time  dependent increase in caspase 9 protein expression. Another compensating mechanism known to be associated with bcl-2 expression concerns increased expression of the pro-apoptotic protein bax (Green, 2000) . However, as shown in Figure 4 .4C, Z-138 tumors from mice treated with 12 .5 mg/kg oblimersen exhibited a time dependent decrease in bax levels. In addition, decreased bax levels were also observed when the Z-138 cells were treated  in vitro  with oblimersen (Figure 4 .4D).  The biological significance for the observed decreases in bax protein expression following bcl-2 silencing is not known ; however, this may not be a direct effect of bcl-2  104    but rather an indirect one following downregulation of other proteins . Since p53 is involved in bax transcriptional regulation (Miyashita and Reed, 1995), it is reasonable to speculate that bax downregulation may occur as a result of p53 downregulation and this possibility was addressed in the studies described below.  A  B Unt Ctr 	 2 .0	 2 .5 bcI2 actin  C  Obl and/kq 7d 5 7.5 12 .5 1 .8 1 .0	 0 .65  Obl 5 mg/kg Unt Ctr 5d 2 .1 2 .5 0.69 bcI2 =- -26 actin  -26  Obl 12 .5 mg/kg Ctr Unt 24h 5d 24h 5d 7d 30d 0 .78 0 .91 1 .1 0 .54 0 .28 . 0 .39  Obl 12 .5 mg/kg Unt 30d 2 .1 2 .5 -26 bcI2 actin  D 	 Obl (nM) Ctr (nM) Unt 100 300 600 100 300 600 0.84 1 .2 0 .84 0 .22 0 .95 1 .0 0 .61 x  -20 •ri Iklb  E  F  •0"n  dip wIA  Ctr Obl 12 .5 mq/kg Ctr Obl 5 mg/kg Unt 5d 5d 7d 30d Unt 5d 5d 0 .8 1 .1 0 .08 0.9 1 .2 0 .8 1 .1 0 .26 p53 p53 -53 -53 actin actin  IP: bcI2 IP : p-mdm2 1 . 2 . IgG 1 . 2 . I•G -26 p-mdm2 [ -90 bcI2  Figure 4 .4. Oblimersen treatment in Z-138 xenografts leads to a dose dependent downregulation of bcl-2 as well as an associated upregulation in caspase 9 and downregulation of bax in vivo and in vitro . Silencing bcl-2 in vivo also leads to a loss in p53 expression and bcl-2 co-precipitates with phosphorylated mdm-2 . Western blotting analysis of Z-138 tumors after treatment with either saline (Unt), control ASO (Ctr) or oblimersen (Obl) at doses of (5 mg/kg, 7 .5 mg/kg, 12 .5 mg/kg) for (A, B) bcl-2 levels or (C) caspase 9 and bax levels . (D) In vitro analysis of bax expression by Western blotting analysis of Z-138 cells left untreated (Unt) or treated with oblimersen (Obl) (100-600 nM) or control ASO (Ctr)(100-600 nM) for 48 h . (E) Western blotting analysis for p53 expression of Z-138 tumors after treatment with either saline, control ASO or oblimersen (5 and 12 .5 mg/kg). (G) Co-immunoprecipitation (IP) studies of bcl-2 and mdm-2. Lanes represent : 1 . IP for Z-138 tumor lysate . 2. IP for Z-138 cell lysate. Results obtained are from representative samples, however studies were completed using a minimum of 4 animals .  105  4.2.4 Silencing bcl-2 in Z-138 xenografts led to downregulation of p53 expression and immunoprecipitation studies show that bcl-2 co-precipitates phospho-mdm-2 The results summarized in Figure 4 .4E indicate that bcl-2 downregulation is associated with suppression of p53 . Suppression is observed in tumors isolated from mice treated with 5 and 12 .5 mg/kg oblimersen and the expression returns to control levels within 7 days. It is known that bcl-2 can interact directly with p53 in conjunction with c-myc to prevent p53 nuclear localization leading to abrogation of the apoptotic effects of p53 (Ryan et al ., 1994). In addition, bcl-2 and p53 complexes are important regulators of apoptosis at the mitochondrial membrane (Deng et al ., 2006) . However, the reason why bcl-2 suppression is associated with decreased expression of p53 is not clear and this phenomenon has also been observed in breast cancer (Tsutsui et al., 2006) . One possibility is that bcl-2 silencing leading to downregulation of p53 may be the result of p53 nuclear localization followed by p53 transcriptional regulation of its own inhibitor, mdm-2 . It is well-established that p53 transcriptionally activates the mdm-2 gene, and the mdm-2 protein in turn regulates p53 levels by binding to p53 which, in turn triggers proteasome-mediated degradation (Wu et al ., 1993). Another possibility that was explored in this study is that bcl-2 could have a direct effect on mdm-2 . Recently, a tissue microarray study on tumor samples obtained from MCL patients indicated that expression of bcl-2 was associated with a downregulation of mdm-2 (Tracey et al ., 2005) . Thus, interactions between bcl-2 and mdm-2 both in vitro and in vivo were assessed using co-immunoprecipitation strategies . The results, summarized in Figure 4 .4F, confirmed that bcl-2 can be co-precipitated with phosphomdm-2 . These results indicate a role for bcl-2 in the degradation/localization of p53  106  expression mediated by mdm-2, perhaps by sequestering/inactivating the active phosphorylated form of mdm-2 and preventing its translocation into the nucleus or preventing mdm-2 mediated degradation of p53 in the cytoplasm . Mdm-2 can target p53 protein for degradation in the cytoplasm but can also inhibit p53 transcriptional activity in the nucleus once mdm-2 is activated by phosphorylation at Ser-166 and Ser-186 by the protein-serine/threonine kinase Akt/PKB (Mayo et al., 2001). Although these observations would explain why bcl-2 silencing could lead to p53 downregulation the biological significance of these events still need to be elucidated. p53 over-expression is sometimes associated with TP53 mutations and TP53 mutations are correlated with a more aggressive blastoid variant in MCL (Greiner et al ., 1996; Khoury et al ., 2003). Therefore, TP53 exons 5, 6, 7, and 8 of the cell line Z-138 were sequenced and no mutations were found . The sequestration of wildtype p53 in the cytoplasm can greatly alter its effects on inducing apoptosis (Ryan et al ., 1994). Therefore, it is plausible that bcl-2 plays a role in the localization/degradation of wildtype p53 which would greatly alter its effects on apoptosis/cell survival and needs to be further elucidated . In addition, p53 has a complex interaction with different components of the NF-KB cell signaling pathways and p53 can act in conjunction with NF-KB on the cyclin D1 promoter to regulate cyclin D1 expression (Rocha et al., 2003). As such, the effects of bcl-2 silencing on these molecules were explored and are discussed below.  107  4.2.5 Silencing bcl-2 in Z-138 xenografts engenders a decrease in NF-xB and phospho-NF-kB, p27 and cyclin Dla NF-KB has been shown to be constitutively active in MCL (Pharr et al ., 2003) . In addition, studies on tissue microarray (TMA) samples in MCL indicate that NF-KB activation (as measured by IxBa phosphorylation) was significantly associated with bcl-2 expression (Tracey et al., 2005) . The Western blotting analysis from oblimersen treated Z-138 tumor bearing animals (Figure 4 .5A) shows that treatment resulted in downregulation of NF-xB-p65 and its phosphorylated form . These data could be explained by implicating a role for bcl-2 expression in maintaining the constitutive activation of NF-xB seen in MCL . Other studies, for example, have shown that bcl-2 through its BH4 domain can interact with the kinase Rafl (Wang et al ., 1996 ; Gary-Gouy et al .,  2006) . Bcl-2 interaction with this kinase can lead to downstream activation of  ERK1/2, which in turn induces degradation of IxBa (Feinman et al ., 1999 ; Jang and Surh, 2004) . This contributes to the constitutive activation of NF-03 (Feinman et al., 1999; Jang and Surh, 2004) . NF-KB is a well-established transcription factor that regulates the expression of many important genes involved in cell survival and differentiation, including the promotion of both bcl-2 (Kurland et al., 2001) and cyclin D1 expression (Guttridge et al ., 1999).  108    A  	 Obl mg/kg7d Unt Ctr 5 7.5 12 .5 6.5 5 .1 4 .2 4.9 2 .5 I-65 NFiBI I* '*^^ 1 .0 0 .7 0 .66 0 .98 0.33 p-NFxB -75 actin  C  B  Ob15mg/kg Unt Ctr 5d cyclinDl tubulin  D  I P : p27 1 . 2 . IgG  cyclinDl tubulin  Zg Obl mg/kg 7d Unt Ctr 5 7 .5 12 .5 .4 2 . : 1 .• a . :5  IP : p38 	 1 .	 2 . cyclinD1  I ` ' Iq i, bcI2 IP: bcI2 1 . 2 . I•G  cyclinDl  E -27  cyclin D1  F  Obl 12 .5 mg/kg Unt Ctr 5d 7d 30d 2.9 3 .8 0 .32 2 .2 2 .4  -41  IP : p38 1  G -26  IP: GSK3 	 .	 2 .	 IgG 1 bcl21 1-26  H  IP : p27 1 . 2 . I .G bcI2 .... -26  f  IP : bcI2 	 1 .	 2. IaG p271$ rl 1-27  IP : GSK3 IP: p38 1. 2 . IgG 1 . 2. G -51 -43 GSK3 p-p38 46  IP : cyclinDl 1 . 2 . IqG bcl2l11aw 1-26  Figure 4 .5. Oblimersen treatment in Z-138 xenografts leads to loss of expression of NF-KB and its phosphorylated form, p27 and cyclin Dla . Co-immunoprecipitation studies indicate that bcl-2 is co-precipitated with p27, p3 8 MAPK and cyclin Dl a and b, but not GSK3I3, which co-precipitates with p38 MAPK . Western blotting analysis of Z138 tumors after treatment with either saline (Unt), control ASO (Ctr) or oblimersen (Obl) at doses of (5 mg/kg, 7 .5 mg/kg, 12 .5 mg/kg) for (A) NF-KB (B) cyclin D1 a and b (Long arrow denotes cyclinD l a and short arrow denotes cyclinD 1 b protein), and (D) p27 levels . Co-immunoprecipitation (IP) studies for (C) IP p27 and cyclin D1, (E) IP p27 and bcl-2, IP bcl-2 and p2'7, (F) IP p38 MAPK and cyclin, IP p38 MAPK and bcl-2, (G) IP GSK3 and bcl-2, (H) IP GSK3 and phospho-p38 MAPK and, IP p38 MAPK and GSK3 (I) IP bcl-2 and cyclin D1, IP cyclin Dl and bcl-2 . Lanes represent: 1 . IP for Z-138 tumor lysate . 2. IP for Z-138 cell lysate . Results obtained are from representative samples, however studies were completed using a minimum of 4 animals.  109  Since the role of bcl-2 in mediating control over cyclin D1 expression in MCL has not been previously explored, the tumors obtained from mice treated with oblimersen were assessed for cyclin D1 expression as well as expression of a well known cell cycle inhibitor, p27 . It should be noted, however, that analysis of cyclin D1 expression in MCL is complex . The cyclin D1 gene is approximately 15 kb and has 5 exons . Two major cyclin D1 mRNA transcripts have been identified and termed cyclin DI a and cyclin D1 b (Hosokawa et al., 1999 ; Lu et al ., 2003). Cyclin DI a transcripts were the first to be discovered and are typically more abundant than cyclin D lb transcripts. However, cyclin Dl b transcripts appear to be more predominant when the t(11 ;14) is present (Hosokawa et al., 1999) . Cyclin D lb is an alternatively spliced cyclin D1 transcript that arises due to a gene polymorphism (AIG) at codon 241 and lacks exon 5 (Howe and Lynas, 2001) . Cyclin D lb proteins lack an important phosphorylation site (Thr-286) targeting cyclin D1 exportation from the nucleus and its subsequent degradation during the S phase of the cell cycle (Lu et al., 2003) . Results from Gladden et al .  (2006) indicate that cyclin D 1 b may be important in the early transformation events  seen in MCL, but Wiestner et al. (2007) have recently shown that cyclin DI a transcripts are important for events that lead to a more highly proliferative, aggressive MCL disease. For this reason, the effects of oblimersen treatment on the levels of cyclin Dl a and cyclin Dlb were assessed . The results indicate that following bcl-2 silencing in vivo there was a concomitant decrease in cyclin DI a protein levels (Figure 4 .5B, long arrow). Importantly, cyclin Dl b protein levels were not downregulated by oblimersen treatment (Figure 4 .5B, short arrow).  110  It is unclear at this stage if cyclin D 1 a and cyclin D1 b are under the same transcriptional regulation . In general, cyclin Dl a enters the nucleus where it accumulates and assembles with CDK4 during G1 phase of the cell cycle . This event occurs in response to Ras associated signaling pathways triggered by mitogens (Alt et al., 2000). Once in the nucleus, association with p27 can further promote the assembly/stabilization of cyclin Dl/CDK4 complexes (Sherr and Roberts, 1999) . When p27 is complexed with cyclin D1/CDK4, its inhibitory functions on other cell cycle effectors is prevented leading to their activation (Sherr and Roberts, 1999) . Interestingly, MCL was found to be atypical compared to other lymphomas as p27 expression did not have an inverse relationship with cell proliferation (Quintanilla-Martinez et al., 1998) . This latter observation is what prompted the discovery in MCL that p27 is highly sequestered by cyclin D1/CDK4 complexes due to an over abundance of cyclin D1 (QuintanillaMartinez, 2003) . Thus, it was of interest to determine if p27 was complexed with cyclin D1 in our study . As summarized in Figure 5C co-immunoprecipitations confirmed that p27 and cyclin Dl a and b were co-precipitated . Since cyclin D1 association with p27 is thought to prevent p27 degradation in MCL (Quintanilla-Martinez, 2003) it was also important to determine if bcl-2 silencing, through cyclin DI a downregulation, may mediate a decrease in p27 protein levels. To address this, Z-138 tumors from oblimersen treated animals were assessed for p27 by Western blotting analysis . The results summarized in Figure 5D show that treatment with oblimersen was associated with a dose dependent reduction in p27 levels. Other investigators, studying breast cancer, have also noted a correlation between loss of bcl-2 protein expression and loss of p27 expression (Tsutsui et al., 2006), but the data  111  presented here are the first to show that this effect on p27 may be mediated through cyclin Dla downregulation. The possibility of a direct interaction between bcl-2 and p27 was also evaluated and the co-immunoprecipitation studies shown in Figure 4 .5E demonstrate that p27 and bcl-2 co-precipitate, an interaction that has not been previously noted . This indicates the possibility that bcl-2 located near the nuclear pores could play a more direct role in p27 localization/degradation.  4.2 .6 Bcl-2 over-expression leading to maintenance of cyclin Dla expression may occur through p38 MAPK mediated signaling pathways To determine how bcl-2 influences cyclin DI a protein levels, the role of p38 MAPK was considered . Cyclin D 1 a and cyclin D 1 b differ in that cyclin D 1 b has lost exon 5, leading to a protein that cannot be phosphorylated at Thr-286, hence exported from the nucleus and degraded (Lu et al., 2003) . GSK313 has been shown to be the main protein involved in phosphorylating cyclin D1 at Thr-286 (Alt et al ., 2000) . Recently, in an MCL in vitro model, the stress-induced protein serine/threonine kinase p38 MAPK has also been shown to directly bind and phosphorylate cyclin D1 at Thr-286 leading to its degradation (Casanovas et al., 2000) . Thus, p38 MAPK acts as a dual negative regulator of cyclin D la expression as it also inhibits cyclin D1 transcription (Casanovas et al.,  2000) . Hence, p38 MAPK is acting in opposition of the Ras signaling pathways  which enhances cyclin D1 transcription and decreases cyclin D1 degradation by inducing Akt/PKB to phosphorylate GSK313 on Ser-9 rendering it inactive (Alt et al ., 2000) . As p38 MAPK plays a major role in both negatively regulating cyclin D1 mRNA and protein levels and bcl-2 has recently been shown to directly interact with p38 MAPK (Torcia et  112  al.,  2001), interactions between p38 MAPK/cyclin D1/bcl-2 were assessed using co-  immunoprecipitation methods and these data are summarized in Figure 4 .5F. An assessment of cultured Z-138 cells, as well as Z-138 tumors, clearly demonstrate that p38 MAPK and cyclin D 1 a and b can be co-precipitated . Furthermore, bcl-2 and p38 MAPK were also co-precipitated (Figure 4 .5F). These data indicate that in MCL bcl-2 may influence cyclin D 1 a expression levels through an interaction with p38 MAPK. It is also possible that bcl-2 interaction with GSK3(3 could interfere with its ability to phosphorylate Thr-286 on cyclin D1 a . To assess this possibility, coimmunoprecipitations were completed and the results (Figure 4 .5G) indicate that GSK3(3 does not co-precipitate with bcl-2 in Z-138 cells or in Z-138 tumors . We then sought to determine if bcl-2 may influence GSK30 indirectly through its interaction with p38 MAPK. Interestingly, GSK3(3 co-precipitated p38 MAPK (Figure 5H) . An interaction between bcl-2 and p38 MAPK leading to regulation of GSK3[3 may explain why oblimersen mediated bcl-2 silencing is only able to influence the expression levels of cyclin D l a and not cyclin D l b. In addition, the possibility of a direct interaction of bcl-2 and cyclin D1 (a and b forms) was not excluded . The results of these co-immunoprecipitation studies indicate that bcl-2 can co-precipitate cyclin D 1 a and b and vice versa (Figure 4 .51). Hence it is possible that bcl-2 may act directly on cyclin Dl a by preventing its exportation from the nucleus and hence its degradation . The interesting possibility that GSK3(3/cyclinDl/p38 MAPK/bcl-2 exist as a single signalosome or part of a signalosome cannot be excluded. The preliminary evidence provided here supports a role for bcl-2 in maintaining cyclin D 1 a expression. A more detailed analysis will have to be carried out to determine the  113  exact nature of these interactions and the biological outcomes associated with these interactions. In summary, although bcl-2 possesses no inherent enzymatic activity, a growing body of evidence supports a strong role for bcl-2 as a docking protein whereas bcl-2 can alter cell signaling pathways by sequestering/inactivating molecules that engender kinase activity such as Rafl and p38 MAPK or preventing proteins from crossing membranes such as the nucleus. In light of this knowledge, it is shown here for the first time that bcl2 silencing in MCL can lead to alteration of several important cell signaling pathways and these pleotropic effects have been summarized in the model presented in Figure 4 .6. Although, at present, these studies provide strong preliminary results of the cell signaling pathways affected by bcl-2 over-expression in MCL, future studies are needed to delineate the exact nature of bcl-2's interaction with these proteins and to determine the eventual biological outcomes of these events in MCL.  114     CM membrane  9 .1110. ~i~+ia~i.i.i+S •.i.i"i~.~Wee* . .'Wee'e''e'i.Wei eei*roe, oiii~iiesji  :ea *e s *  p53  constitutive activation  pax, mdm2  .'E .~"'L. .. r"'"'."  j~i1  .r  Figure 4.6. Proposed model of altered cell signaling events following bcl-2 silencing in an in vivo model of MCL . Shaded areas denote proposed interactions based on the co-immunoprecipitation studies while white areas denote previously known interactions/cell signaling pathways . (A) proposed interaction between bcl-2 and mdm-2 leading to p53 regulation (B) known interaction between bcl-2 and Rafl leading to NFKB constitutive activation (C) p27 is sequestered by cyclinDl/CDK4 in MCL (D) proposed interaction between bcl-2 and p27 potentially altering p27 localization/degradation (E) known interaction between cyclin D1 and either p38 MAPK or GSK3(3 leading to cyclinD1 phosphorylation/degradation (F) known interaction between bcl-2 and p38 MAPK which may lead to maintenance of cyclinDla expression (G) proposed interaction between p38 MAPK and GSK3(3 possibly mediated through another scaffold protein (H) proposed interaction between cyclinD 1 a and bcl-2 possibly preventing cyclinD 1 a exportation from the nucleus/degradation.  115  CHAPTER 5 ABNORMAL EXPRESSION OF SOLUBLE AND MEMBRANE BOUND FAS LIGAND IN MANTLE CELL LYMPHOMA : POTENTIAL FOR RESISTANCE TO FAS MEDIATED CELL DEATH AND IMMUNE EVASION 5.1 Introduction and rationale As indicated in the Introduction (section 1 .10) normal B-cell differentiation relies on the regulation of either clonal expansion of high affinity antigen presenting B cells or cell death of undesirable low affinity antigen presenting or autoreactive B cells . A tight regulation in cell cycle checkpoint genes needs to be achieved to regulate this differentiation process . A crucial role for signaling through the CD40/CD40L and Fas/FasL pathways has been shown in the control of GC B cell survival and cell death, respectively (Guzman-Rojas et al ., 2002). The interaction of CD40 with its ligand promotes B cell survival and proliferation but also concomitantly inhibits apoptotic signals (Spriggs et al., 1992). Although CD40L (CD 154) is predominantly expressed on T cells which then activate B cells expressing CD40 receptors, it has been shown that CD40/CD40L is co-expressed on malignant GC B cells and subsets of normal B lymphocytes, leading to autonomous B cell survival (Clodi K et al., 1998; Grammer et al .,  1999). Further, it is now apparent that an increasing number of lymphomas exhibit a  heightened expression of CD40L (Clodi et al., 1998). As mentioned above, the interaction of Fas with its ligand leads to cell death of GC B cells (Nagata and Golstein, 1995) . FasL binding induces trimerization of Fas  116  receptors leading to recruitment of effector molecules Fas-associated death domain (FADD) protein and pro-caspase 8, which together form a death-inducing signaling complex (DISC). After the formation of the DISC, caspase 8 is activated by autoproteolytic cleavage and initiates the apoptotic cascade . GC B cells express high levels of Fas and have a preformed DISC complex that includes a trimeric form of Fas, FADD and caspase 8 (van Eijk die (Guzman-Rojas  et al.,  et al .,  2001). This indicates that GC B cells are primed to  2002) unless rescued by signals initiated by CD40-CD40L  interactions . Recruitment of the cellular FLICE inhibitory protein (c-Flip) can abrogate cell death signals induced by the Fas/FasL signaling pathway by maintaining the DISC in an inactive form (van Eijk signaling (Guzman-Rojas  et al .,  et al .,  2001) and its expression is stabilized via CD40  2002).  Interestingly, FasL is typically expressed in immune privileged tissues such as the eye and testis (Xerri  et al.,  1997). Importantly, abnormal expression of FasL on  malignant B cells can also lead to immune evasion . Malignant B cells expressing FasL can  counterattack  apoptosis (Kim  invading T cells which express Fas and are sensitive to Fas-mediated  et al.,  2004) . Further, it has been shown that circulating isoforms of  soluble FasL (sFasL) can lead to immune evasion by preventing the recognition of tumor cells by immune effector cells (Hallermalm  et al .,  2004).  Soluble FasL are either produced by cleavage of membrane bound FasL (mFasL) by metalloproteases (Kayagaki  et al .,  1995), mRNA alternative splicing (Ayroldi  et al .,  1999), or production of microvesicle associated sFasL, which is located and subsequently released from intracellular stores within the cell (Martinez-Lorenzo  et al .,  1999). Soluble  FasL can bind to membrane bound Fas but has been shown to be >1,000-fold less  117  efficient at inducing apoptosis compared with the membrane-bound trimeric FasL complex (Schneider et al ., 1998 ; Hallermalm et al ., 2004) . Soluble FasL binds to Fas receptors, blocking ligation with mFasL located on the cell surface of invading effector cells, thus shielding the cell and preventing apoptosis (Hallermalm et al., 2004). Malignant cells that co-express mFasL and sFasL can thus avoid apoptosis typically triggered by invading immune cells . In addition these factors can produce "bystander" effects preventing apoptosis of neighbouring malignant B cells that express Fas (Hallermalm et al., 2004). The balance of CD40 and Fas expression in conjunction with their ligands and soluble forms is important for B cell selection, maturation and homeostasis . However, alterations in these cell signaling pathways can lead to malignant transformation and the survival of abnormal autoreactive, low affinity antigen binding B cells . In MCL, CD40 expression is abnormally high, while Fas expression is either low or absent (Clodi et al., 1998). Exogenous expression of FasL was shown to have no effect on MCL cells while exogenous addition of CD40L increased survival and rescued MCL cells from cell death (Clodi et al., 1998b) . Over-expression of anti-apoptotic proteins, such as bcl-2, has been shown to block the mitochondrial branch of Fas-induced apoptotic signaling . Normal GC B cells express little to no bcl-2 protein (Martinez-Valdez et al., 1996), however in MCL over-expression of bcl-2 occurs in the majority of cases (Tracey et al., 2005). Over-expression of bcl-2 can counteract the apoptotic response leading to clonal expansion of B cells and, interestingly, it can do this without a concomitant increase in cell proliferation (McDonnell et al., 1989).  118  The objectives in this Chapter of the thesis were to determine if deregulated expression of CD40/CD40L and Fas/FasL expression along with bcl-2 family members influences sensitivity to Rituximab in in vivo models of MCL. In vitro studies in NHL have indicated that Rituximab can alter the expression levels of the anti-apoptotic proteins bcl-2, bcl-xL, and mcl-1 as well as Fas expression depending on the system analyzed (Jazirehi and Bonavida, 2005) . Rituximab is a chimeric monoclonal antibody against the pan-B cell marker CD20 (see section 1 .14) . The mechanisms of action of Rituximab include induction of the complement pathway (CDC), antibody dependent cell-mediated cell cytotoxicity (ADCC) and induction of both the intrinsic and extrinsic apoptotic pathways (reviewed in Jazirehi and Bonavida, 2005) . The results summarized here indicate that initial responsiveness to Rituximab treatment in vivo is associated with a marked downregulation of bcl-2, bcl-xL and mcl-1 . Expression levels of CD20 and CD40/CD40L were also downregulated following Rituximab treatment . High levels of Fas expression were observed in all MCL cells examined, accompanied by high levels of intracellular sFasL, indicating for the first time a possible mechanism of evading Fasmediated cell death in MCL cells. Staining for FasL in vivo demonstrated that FasL was expressed on endothelial cells lining tumor blood vessels, the consequences of which are being further investigated and may indicate a potential mechanism of exclusion of immune effector cells from the tumor microenvironment.  119  5.2 Results 5.2.1 Over-expression of anti-apoptotic bcl-2 family members in MCL cell lines Bcl-2 expression is highly over-expressed in MCL cell lines (see Chapter 4, Figure 4.1) and it is demonstrated here that MCL cell lines, Z-138, JVM-2, NCEB-1, HBL-2 and Granta 519, also over-express the anti-apoptotic proteins mcl-1 and bcl-x L (Figure 5 .1A and 1B) . The MCL cell lines, Z-138 and JVM-2, exhibited a 2- to 3-fold increase in expression of mcl-1 and bcl-xL compared to the other MCL cell lines and the positive control T cell line, Jurkat . These cell lines were thus used for animal studies.  120    t7 o_  I  Jurkat Z138  .  HBL2  0  Granta JVM2 NCEB1 ,  Jurkat Z138  HBL2  MCL Cell Lines C  Granta JVM2 NCEB1 MCL Cell Lines  D Z138  Z138 M E • E  ,.9 0 0.8 0 .70.6 0.5 0.4  o• E 0.3 0.2 0.1 0  Saline  Rtx (1, 2 .5, 5 mg/kg) 10 15  20 25 30 35 40 45 50 55 60 65 70  15 20 25 30 35 40 45 50 55 60 65 70 75  day  day  E JVM2  20 25 30 35 40 45 50 55 60 65 day  Figure 5 .1 . Expression of bcl-x L and mcl-1 in MCL cell lines and in vivo efficacy studies of Z-138 and JVM-2 xenografts treated with Rituximab . Expression of bcl-xL and mcl-1 is three-fold higher in JVM-2 and Z-138 cells compared to the other MCL cell lines and the positive control cell line Jurkat. (A and B) Quantitative real time PCR analysis of bcl-xL and mcl-1 expressed relative to the endogenous control porphobilinogen deaminase (PBGD) . Z-138 xenografts but not JVM-2 xenografts exhibit complete tumor regressions following treatment with Rituximab . Growth curves for (C) Z-138 xenografts after treatment with either saline (sal) (n ), Herceptin (Her) (A) or Rituximab (Rtx) 1 mg/kg (+), 2 .5 mg/kg (+), 5 mg/kg ( x) or (D) Z-138 xenografts with a higher tumor burden (200 mg) after treatment with either saline ( n ) or Rituximab 2 .5 mg/kg (A), 5 mg/kg (A), 10 mg/kg (•) and (E) JVM-2 xenografts after treatment with either saline ( n) or Rituximab 2.5 mg/kg (A), 5 mg/kg (A), 10 mg/kg (o) . Values are the mean ± standard deviation of three to six replicates.  121  5.2.2 Complete tumor regressions following treatment with Rituximab occurs in Z-138 xenografts but not in JVM-2 xenografts Considering the high over-expression of bcl-2, mcl-1 and bcl-xL, in Z-138 and JVM-2 cells it was anticipated that xenografts established from these cell lines would be resistant to Rituximab or other chemotherapies. Z-138 xenografts treated with Rituximab at doses of 1, 2 or 5 mg/kg, however, were highly sensitive to Rituximab (Figure 5 .1C). Tumor growth was completely prevented even when a single dose of Rituximab was administered to animals bearing tumors that were just detectable (Figure 5 .1C) . Z-138 xenografts were still disease free past 120 days and treatment with Herceptin, an antibody targeted against Her2 that was used as a treatment control, had no effect on tumor growth (Figure 5 .1C). This confirmed the specificity of Rituximab for its target, CD20 . The activity of Rituximab in animals with larger Z-138 tumor burdens (200 mg) was also significant (Figure 5 .1D). At Rituximab doses of 10 mg/kg, complete tumor regressions were observed in Z-138 xenografts (Figure 5 .1D). In contrast, JVM-2 xenografts appeared to be insensitive to Rituximab treatment (Figure 5 .1E). At a dose of 10 mg/kg JVM-2 tumors in Rituximab treated animals reached 200 mg in 57 days, whereas in the untreated animals 200 mg tumors were observed around 50 days (Figure 5 .1E).  5.2.3 Treatment with Rituximab leads to a reduction in tumor cell proliferation and induction of apoptosis, accompanied by decreases in expression of bcl-2, bcl-x L and mcl-1 The therapeutic activity of Rituximab in the sensitive Z-138 xenografts was accompanied by a decrease in proliferation as shown by a decrease in Ki67 staining (Figure 5 .2A) and an increase in apoptosis as shown via upregulation of caspase 9  122  expression (Figure 5 .2B). To determine if reductions in proliferation and increases in apoptosis were due to a reduction in the expression of anti-apoptotic proteins bcl-2, bclxL, and mcl-1, the expression of these proteins were evaluated in Z-138 tumors isolated from treated animals. This work focused on the Z-138 model to gain a better understanding of what changes in the tumor may be contributing to activity . As shown in Figure 5 .2 C and D, bcl-2 and bcl-x L mRNA expression levels rose as the tumor progressed in untreated animals . In control tumors there is a rapid growth during the course of this study (see Figure 5 .1D). Treatment with Rituximab prevented this increase in bcl-2 and bcl-xL mRNA expression at 48 h and 72 h relative to the untreated animals, although the mRNA levels never decreased below the initial expression levels observed at 24 h (Figure 5 .2 C and D) . This would indicate that Rituximab prevents the increase in expression of bcl-2 and bcl-x L in tumor progression . Mcl-1 mRNA expression levels did not increase during tumor progression in untreated animals, however in Rituximab treated mice there was a decrease in mcl-1 mRNA expression at 48 h (Figure 5 .2 E). Rituximab treatment has been shown to down-regulate bcl-2 via a mechanism that may involve a decrease in IL-10 levels (Alas et al ., 2001). For this reason, IL-10 levels were evaluated in Z-138 tumors from treated animals (Figure 5 .2F). As the tumor progressed IL-10 levels increased ; consistent with other reports showing an autocrine production of IL-10 in MCL cells, leading to proliferation in conjunction with CD40 engagement (Visser et al ., 2000) . Rituximab treatment prevented this increase in IL-10 expression levels at 72 h (Figure 5 .2F). At this time point IL-10 levels were almost 2fold greater in control tumors compared to treated tumors (Figure 5 .2F).  123    B Rituximab 10 mg/kg  A Ki67 Saline  Sal 0 .9  Rtx 10 mg/kg  2d 7 .5  7d 8 .1  30d 10 .0 37  Caspase 9  0.7  1 .4  1 .1  1 .4 17  actin  C  D 3 .5  12  a 10  Rtx  3  n Saline  Saline 2 .5  o o $ co  0  a  6 4  m  2  0 .5 0  0 24h  48h  24h  72h  E  a  48h  72h  F 4  4  3 .5  3 .5  3 0 O 2 .5  m  2  x 1 .5  N m  0 Rtx  T  0  0 m a  2  o  0  Rtx  n Saline  3 , 2 .5 2 . 1 .5  1 .5 1 0 .5  0 .5  0  0 24h  48h  72h  I 24h  48h  i 72h  Figure 5 .2 . Tumor regressions in Z-138 xenografts are associated with a marked decrease in proliferation and induction of apoptosis as well as initial downregulation of bcl-2, bcl-xL, mcl-1 and IL-10. (A) Immunohistochemistry analysis of Z-138 tumors after treatment with either saline or Rituximab (Rtx) (10 mg/kg) . Images were taken at 20x magnification. (B) Western blotting analysis of Z-138 tumors after treatment with either saline or Rituximab at doses of 2 .5 and 10 mg/kg for caspase 9. Quantitative real time PCR analysis for (C) bcl-2, (D) bcl-xL, (E) mcl-1 and (F) IL-10 expressed relative to the endogenous control porphobilinogen deaminase (PBGD) . *represents significant downregulation . Values represent standard deviation ± mean of three replicates.  124  5.2.4 Rituximab treatment is associated with a loss of CD20 expression in Z-138 xenografts Rituximab is targeted to the pan B cell marker CD20 and loss of CD20 expression in some systems is associated with a decreased response to Rituximab (Jilani et al ., 2003) . Expression of CD20 was high in both Z-138 and JVM-2 cell lines compared to the negative control cell line Jurkat (Figure 5 .3A and B) . The number of CD20 positive cells was comparable between Z-138 and JVM-2 cell lines (Figure 5 .3A) and the expression levels were similar when measured by Western blotting analysis (Figure 5.3B), however, flow cytometric analysis indicated that the mean fluorescence intensity (MFI) of CD20 was 2-fold higher in Z-138 cells compared to JVM-2 cells (Figure 5 .3A). Western blotting analysis indicated that CD20 in Z-138 and JVM-2 cell lines are 3- to 4fold lower than that seen in NCEB-1 and Granta 519 cell lines (Figure 5 .3B) . Rituximab treatment in Z-138 xenografts resulted in a significant loss in both the number of cells expressing CD20 and the MFI of CD20 observed in positive cells (Figure 5 .3C). Western blotting analysis corroborated these findings (Figure 5 .3B). Interestingly, the cells remaining still expressed a high level of CD20 (Figure 5 .3C). This indicates that Rituximab activity may not be lost through CD20 downregulation due to the high number of cells still expressing CD20 . It should be noted that in tumors derived from saline treated animals, >90% of the isolated cells were positive (Figure 5 .3C) . Within two days following Rituximab treatment only 72% of the cells were positive and these exhibited a mean fluorescence that was 2-fold lower (Figure 5 .3C).  125     A  B Jurkat  Z138  1 .12 x=13.10  JVM2 2 .7 0.9 2 .7 0 .8 0 .5 0 .0  90 .11 x=106 .34  99.56 x=215.71  actin  r~'1 100  10 1  102  too  103  100 10 1 102 103 104  100 10 4  1  CD20-FITC  8  99 .54 x=146 .55  86 .09 x=55 .72  Saline 24h 48h 72h 7d 0 .4 0 .4 0 .3 0 .2  99 .93 x=1985 .5  actin 10  0  10 10  C  102 103 to FAS-APC  10  24h  Rtx 10 mglkg 30d 24h 0.3 3 .2  48h 72h 7d 30d 1 .0 1 .1 1 .3 1 .2  CD20  , l 0 10 1  -33  CD20  -33   .  00x. AM.  =I . .x.' __••  I  6 10 1 102 10 3 0  72h  48h  30d  7d  CD20  100  	10  10' 102  103  10 4  100  tot  402  10J. .. to o  0 10 ' 10  CD20-FITC 8  Sal  8 8i 8,  0  82.87 x=159 .63  79 .18 x=97 .23  94 .32 x=148.73  a  FAS 0 Rtx  8 92.46 x=140 .84  83 .74 x=130.12  94 .2 x=162 .71  0  too to t  102 103 104  too  10  102  463 10 4  100  »«.. o1  10 2  t o3  104  8 8 S 0 0 0 L .. .+"  4 10 0 10 1 102 8 91 .99 x=169.65  91 .84 x=83 .26  100 10 4 102  FAS-APC  Figure 5.3 . Rituximab treatment in Z-138 xenografts is associated with a decrease in expression of CD20 and no significant change in expression of Fas . (A) Flow  cytometry analysis of Z-138 and JVM-2 cells for CD20 and Fas expression . Jurkat cells were used as a negative control for CD20 and as a positive control for Fas expression. (B) Western blotting analysis for CD20 expression in cell lines and in Z-138 xenografts following treatment with either saline (sal) or Rituximab (Rtx) (10 mg/kg) . (C) Flow cytometry analysis of Z-138 xenografts for CD20 and Fas expression following treatment with either saline or Rituximab (10 mg/kg) . The dotted line in all flow cytometry analysis represents control cells, while the solid line represents the marker of interest.  126    5.2.5 High levels of Fas are expressed in MCL cell lines Rituximab mediated upregulation of Fas and induction of caspase 8 leading to cell death in vitro has been observed previously in some model systems, but not in others (Jazirehi and Bonavida, 2005) . The influence of Rituximab treatment on Fas expression in the Rituximab sensitive model (Z-138) was determined by flow cytometry analysis of disaggregated tumors obtained from saline or Rituximab (10 mg/kg) treated mice . Both Z-138 and JVM-2 cells were positive for Fas staining (Figure 5 .3A) with >86% labeling observed . However, the MFI for Fas staining in JVM-2 cells was 1985 .5 units, compared to 55.7 units for the Z-138 cells. In the Z-138 tumors Fas levels appeared to increase slightly with tumor progression (MFI increased 20-40% by day 7) (Figure 5 .3C) and treatment with Rituximab did not significantly change the number of Fas positive cells or their expression levels (Figure 5 .3C), even though this was assessed in a Rituximab sensitive model (Z-138).  5.2.6  CD40/CD40L expression in MCL cell lines and treatment of the Z-138  Rituximab sensitive xenografts is associated with downregulation of CD40/CD40L Fas expression may not necessarily correlate with an increase in apoptosis, as other factors leading to inhibition of Fas mediated cell death can occur . In particular, assembly of the Fas signaling complex at the plasma membrane can be inhibited and disrupted by CD40 and the expression of c-FLIP (Guzman-Rojas et al ., 2002) . JVM-2 and Z-138 cells expressed high levels of both CD40 and c-FLIP expression (Figure 5.4A and B). However, the majority of CD40 expression appears to be intracellular since Western blotting analysis indicates high CD40 expression (Figure 5 .4 B) and flow  127  cytometry analysis indicates that CD40 expression is only slightly higher compared to that seen in Jurkat cells (Figure 5 .4 A). Lin-Lee et al ., (2006) have recently suggested that cytoplasmic and nuclear CD40 play key roles in B-cell growth and survival . JVM-2 cells had a 3-fold increase in CD40 expression compared to Z-138 cells but expressed similar levels of CD40L (Figure 5 .4A and B). Treatment of animals bearing Z-138 tumors caused a decrease in CD40 expression (Figure 5 .4C). This Western blotting analysis indicates a loss of CD40 expression of >80% within 3 days after treatment initiation (Figure 5 .4C). The expression of CD40's cognate ligand, CD 154, was also assessed by flow cytometry, however it was not detectable (Figure 5 .4A). Intracellular CD40L was observed in all the MCL cell lines when measured by Western blotting analysis (Figure 5.4B). Treatment with Rituximab in Z-138 xenografts caused a marked decrease in CD40L expression, compared to untreated tumors as analyzed by Western blotting analysis (Figure 5 .4C) .  128    A  Jurkat  Z138  0 .69 x=15 .62  B  JVM2  10 .96 =10 .92  ~Gt`0 J~`L C~~a~ ~~\rL'1>>,~0 °tea  17 .93 =18 .28  5.6  9.0  6.5  5 .2  2.2  0 .4 -43  CD40 	10  10`1  0  a) U  10 1  102  1 .0  103  CD40-PE 1 .03 x=6 .30  2 .46 =13 .82  10 1  102  103  104  0  10 1  102  10 3  0.9  104  00  10 1  102  103  0 .1  0 .2  0 .3  cFLIPL 104  CD40L-FITC Saline  C  24h 48h 72h 1 .5 1 .6 1 .6  Rtx 10 mg/kg  7d 1 .3  30d 1 .4  24h 48h 0 .7 0 .5  72h 7d 30d 0 .1 0.1 0 .1  CD40  -43  actin 1 .4  0 .7  0 .8  0.9  0 .9  0 .8 -39  0 .2  4 .26 =26 .91  a) 100  1 .1  CD40L  Cu  	10  1 .0  0.3  2 .5  CD40L  0 .5  0.3  0 .2  0 .7 1-39  actin 1  Figure 5 .4. CD40 expression is greater in JVM-2 cells compared to Z-138 cells and CD40/CD40L is downregulated following treatment with Rituximab in Z-138 xenografts . (A) Flow cytometry of CD40/CD40L in Z-138 and JVM-2 cells . Jurkat cells were used as a negative control for CD40 and a positive control for CD40L expression . (B, C) Western blotting analysis for CD40/CD40L/c-FLIP expression in MCL cell lines and Z-138 xenografts following treatment with either saline (Sal) or Rituximab (Rtx) (10 mg/kg) .  129  0 .3  0 .4 -58  5.2 .7 High levels of soluble FasL are expressed in MCL cells The expression of soluble FasL (sFasL) has been shown to be important in mediating Fas resistance to cell death (Hallermalm et al., 2004); thus, the expression of both sFasL and membrane bound FasL (mFasL) in MCL cell lines was determined via Western blotting analysis and immunohistochemistry . Western blotting analysis show bands of 52 KDa and 78 KDa ; bands that correlate to intracellular dimerized and trimerized sFasL respectively (Figure 5 .5A) (Tanaka et al ., 1995 ; Verbeke et al ., 1999). The 52 KDa band is clearly seen in extracts from JVM-2 cells and is absent in Z-138 cells (Figure 5 .5A) . Analysis of all the MCL cell lines indicates that the trimerized 78 KDa sFasL isoform is highly expressed and in addition, a faint band of 40 KDa appears which correlates to the expression of mFasL (Figure 5 .5A). Analysis of FasL in the Rituximab sensitive Z-138 tumors following treatment indicates that an additional band of 160 KDa appears at 48 h (Figure 5 .5B). This may represent a multimeric form of sFasL . In addition, a faint band of 26 KDa is apparent in Z-138 tumors and corresponds to cleaved sFasL from membrane bound FasL (Figure 5.5B). This would suggest that only a small portion of the sFasL produced in Z-138 cells is of the cleaved 26 KDa form . Thus, the effects of Rituximab treatment were unable to be evaluated for the 26 KDa form . The highest level of expression occurred in the trimerized 78 KDa form of sFasL and did not change after treatment with Rituximab (Figure 5 .5B).  130      Rtx 10 mg/kg 48h 72h 7d 30d    Saline 48h 72h 7d 30d  sFasL 160 sFasL trimers 78 dimers 52  	za  actin 4,  a  ti  4ry ,ci sFasL trimers 78 ,war sXMMI  nnIMUr  mFasL 40 sFasL 26  rw+r rrre r~  mFasL 40  Rtx 10 mg/kg 48h 72h 7d 30d  Saline 48h 72h 7d  30d  actin  actin C FasL on B cells  FasL tumor blood vessels  CD31  FasL  100µM  Figure 5 .5. A high expression of sFasL is observed in MCL cell lines and mFasL is expressed on endothelial cells lining blood vessels of Z-138 tumors . Western blotting analysis for FasL in (A) MCL cell lines and (B) Z-138 xenografts treated with either saline (sal) or Rituximab (Rtx) (10 mg/kg) . Immunohistochemistry of Z-138 xenografts stained for (C) FasL (top two panels) and CD3l/FasL (bottom two panels) . Images were taken at 20x and 40x magnification .  131  5.2.8 FasL is expressed on endothelial cells of blood vessels Membrane bound FasL is typically expressed on T cells and dendritic cells in the GC (Verbeke et al., 1999) . An abnormal over-expression of FasL on B cells can lead to T cell counterattack (Kim et al ., 2004). FasL expression was thus evaluated via immunohistochemistry and was found to be expressed in approximately 30% of cells (Figure 5.5C, top left panel) . These results are in aggreement with those observed by Hallermalm et al. (2004) who determined that only 20% of uveal melanoma cells stained positive for FasL . Hallermalm et al . (2004) indicated that a relatively small population of cells are sufficient to maintain the production of soluble FasL in the tumor milieu and can confer resistence to Fas-mediated apoptosis . In addition, FasL expression was found to be localized in thin strips resembling blood vessels throughout the tumor (Figure 5 .5C, top right panel) . Coincidence of the FasL signal and CD31 targeting blood vessels was confirmed by double immunofluorescence staining on frozen sections (Figure 5 .5C, two bottom panels) . FasL expression on endothelial cells is a known phenomenon in cardiac inflammation and expression of FasL on endothelial cells prevents inflammatory cells from crossing the blood vessels (Walsh and Sata, 1999) . However, to our knowledge this is the first observation of this phenomenon in a lymphoma model and may support a new mechanism of evasion for B lymphoma cells to prevent immune cells from attacking and is under current investigation.  5.3 Discussion Mantle cell lymphoma is a disease that arises from the clonal expansion of B cells and is thought to arise in the mantle zone of the follicle . MCL cells most closely  132  resemble centrocytes, which either undergo apoptosis to eliminate autoreactive, low affinity B cells or undergo B cell clonal expansion in response to high affinity B cells. As such, centrocytes are tightly regulated by the expression of the bcl-2 family of proteins and the balance of expression of CD40/CD40L and Fas/FasL . In this study our primary objective was to determine how these pathways are altered in a Rituximab sensitive MCL xenograft model (Z-138) to gain insight into mechanisms leading to Rituximab resistance such as that seen in the JVM-2 model. Mantle cell lymphoma cells over-express the anti-apoptotic proteins, bcl-2, bclxL, and mcl-1 . The data presented here indicates that initial sensitization to Rituximab treatment involves the downregulation of members of the bcl-2 family of proteins, confirming extensive studies done previously in vitro (Jazirehi and Bonavida, 2005). Studies examining the mechanisms of action of Rituximab indicate that apoptosis, CDC and ADCC all occur after treatment (Jezirehi and Bonavida, 2005) . Thus, it is not unreasonable to suggest that immediate effects of Rituximab treatment may include reduction of anti-apoptotic family members but subsequently induction of cell death mediated by complement or ADCC may predominate at later stages . These multi-modes of action are of clear benefit when considering Rituximab sensitive tumors ; where redundant modes of cell death help to ensure that if resistance to any one mechanism emerges, another mechanism is in place to maintain therapeutic effects . Perhaps most importantly, studying these different modes of action in a sensitive tumor model may provide insight into how resistance to Rituximab occurs in insensitive models (i .e. JVM2).  133  Resistance to Rituximab has been associated with over-expression of antiapoptotic proteins as well as, decreases in CD20 expression (Jilani et al ., 2003) . Loss of CD20 expression was observed following treatment with Rituximab in the Z-138 xenografts (see Figure 5 .3). Beum et al . (2006) demonstrated that loss of CD20 expression in Z-138 cells following Rituximab treatment is mediated by the loss or shaving of Rituximab bound CD20 by monocytes . In CLL cells, where CD20 expression is low (less than 8,000 molecules per cell) (Nguyen et al ., 1999), loss of CD20 via shaving by monocytes is thought to be a critical factor determining sensitivity to Rituximab treatment (Beum et al., 2006). In MCL cells CD20 expression is typically high (Figure 5.3). Loss of CD20 expression following Rituximab treatment may not be as critical in the Rituximab sensitive Z-138 xenografts as the cells remaining still expressed a high level of CD20 (Figure 5 .3C). This indicates that Rituximab activity may not be lost through CD20 downregulation due to the high number of cells still expressing CD20. Crosslinking of CD20 by Rituximab causes rapid translocation of CD20 into lipid rafts, leading to induction of apoptosis (Shan et al., 1998; Janas et al., 2005 ; Unruh et al ., 2005 ; Chiu et al., 2007). Once in the lipid rafts, the CD20 transmembrane protein can co-localize with other receptors such as the immune receptors MHC class II and CD40, although the consequences of these interactions have not yet been determined (Szollosi et al .,  1996). The MCL models used here appear to express high levels of CD40, but the  majority may not be surface associated since flow cytometric analysis of the cells suggests low levels of expression (Figure 5 .4) . Lin-lee et al., (2006) have demonstrated that human B-lymphocyte CD40 can be expressed in the cytoplasm and the nucleus and  134  have suggested that this CD40 expression can either induce cell proliferative signals or cell survival signals . It is interesting to speculate that differences in Rituximab sensitivity may be a reflection of intracellular CD40 expression where the very high levels of expression in NM-2 could be linked to its Rituximab insensitivity . The role of intracellular CD40 in Rituximab resistance has not been noted previously. Expression of CD40 is one of the most potent inducers of expression of Fas (Garrone et al., 1995 ; De Paoli et al ., 1997) . In nontumoral B cells CD40 engagement leads to upregulation of Fas and induces Fas-mediated apoptosis . In malignant B cells, including MCL cells, CD40 ligation strongly increases Fas expression, however, this is not associated with a marked increase in Fas-induced apoptosis (Plumas et al ., 1998). The MCL cell lines examined in this study had a high expression of Fas (Figure 5 .3) and JVM-2 cells which expressed the highest levels of CD40 also expressed the highest levels of Fas . In the Rituximab sensitive Z-138 xenograft model it was interesting to note that Fas expression appeared to increase as the tumor progressed (Figure 5 .3C). This increase in expression was not significantly influenced by Rituximab treatment which is surprising considering the dramatic effects that this agent was having on delaying tumor growth compared to the saline controls. Over-expression of Fas has been shown to induce cell proliferation in thyroid cancer, epithelial cancer, melanoma, myeloma cell lines and primary chronic lymphocytic leukemia B cells (reviewed in Hyer et al., 2006) and it is interesting to speculate that increased Fas expression as tumors progress may be a reflection of increases in cell proliferation rate . Mitsiades et al . (2006) demonstrated in thyroid carcinomas that cross-linking of Fas led to recruitment of c-FLIP to the DISC instead of  135  pro-caspase 8 which caused an increase in cell proliferation instead of induction of apoptosis . Therefore, it was suggested that c-FLIP may provide the molecular switch allowing Fas to promote cell proliferation/survival as opposed to apoptosis . Levels of cFLIP were high in all the MCL cell lines examined (Figure 5 .4B). Most cancerous cells have evolved mechanisms to avoid Fas-mediated cell death by either altering the levels of Fas expressed at the cell surface, by loss of function of Fas through mutations or by altered expression of the apoptotic machinery such as over-expression of the antiapoptotic proteins bcl-2 and bcl-x L, over-expression of c-FLIP or reduced expression of FADD or caspase 8 (Shin et al ., 1999; Khong and Restifo, 2002 ; Park et al ., 2005; Schmitz et al ., 2005 ; Oyarzo et al ., 2006). Another mechanism of evasion from Fas mediated cell death through the abnormal expression of sFasL has been described (Hallermalm et al ., 2004). Circulating isoforms of FasL can prevent the recognition of tumor cells by immune effector cells (Hallermalm et al ., 2004). MCL cells used in the studies summarized here express high levels of sFasL, especially the trimerized 78 KDa form (Figure 5 .5A). The soluble 78 KDa form of FasL is not expressed in normal lymph nodes (Verbeke et al., 1999). Release of sFasL from stores located in the cytoplasm can lead to autocrine binding of the cells own Fas receptors . This, in turn, can lead to prevention of Fas ligation of incoming immune effector cells bearing membrane bound FasL and inhibition of Fasmediated apoptosis (Hallermalm et al., 2004) . In other words, in the presence of sFasL, a high expression of Fas would not lead to apoptosis . Interestingly, JVM-2 cells differed from Z-138 cells by expressing a large quantity of dimerized sFasL (52 KDa) (Figure 5 .5A). It is unclear why dimerized and trimerized sFasL exists . However, the  136  engagement of Fas receptors leads to trimerization at the cell surface and germinal center cells exhibit pre-existing trimers of Fas (van Eijk et al ., 2001) ; the consequence of which may necessitate pre-existing dimers or trimers of soluble FasL to block pre-formed sets of trimerized Fas. In addition to abnormal expression of sFasL, aberrant expression of membrane FasL (mFasL) has been associated with increased tumor progression and metastasis (Kim et al ., 2004) .  Expression of FasL on tumor cells can lead to apoptosis of incoming  immune cells because activated T lymphocytes express Fas and are sensitive to Fas mediated apoptosis . In this sense, B cells abnormally expressing mFasL can counterattack  the immune system (reviewed in Kim et al ., 2004) .  However, mFasL  expression in the Rituximab sensitive Z-138 tumors, as measured by Western blotting analysis or immunohistochemistry, was low ; thus, it may be unlikely that mFasL counterattack  of immune cells is the only relevant mechanism of immune evasion in this  model. Importantly, mFasL expression may be much more relevant in the Rituximab resistant JVM-2 model and this is being explored at the moment. An unexpected finding in this study was that immunohistochemistry of Z-138 tumors showed mFasL expression on the endothelial cells lining the blood vessels of the tumor. Importantly, mFasL expression on endothelial cells has been described in atherosclerosis to prevent immune effector cells from extravasation into the surrounding tissue (Walsh and Sata, 1999) . Endothelial cells are resistant to Fas mediated apoptosis and over-express the inhibitor of Fas mediated apoptosis c-FLIP (Sata and Walsh, 1998). As such, endothelial cells lining blood vessels that over-express mFasL can counterattack invading effector cells that express the Fas receptor . The presence of mFasL on the  137  endothelial cells of blood vessels lining the tumors of Z-138 xenografts suggest that MCL in the absence of treatment, may engender changes in endothelial cells that help it evade the immune system. To our knowledge this has not been observed previously and is certainly worth further research .  138  CHAPTER 6 DISCUSSION AND CONCLUSIONS  6.1 . Discussion Mantle cell lymphoma was classified as a separate clinical entity in the mid 1990s (Banks et al ., 1992). Classification by the WHO of Mantle cell lymphoma as a separate entity only occurred in 1999 (Harris et al ., 1999) . At the time this thesis research began, practically no cell lines or animal models were in existence . Furthermore, cell lines that were starting to be characterized and appearing in the literature were very difficult to obtain. Through this work a number of different MCL models that are well characterized are now in existence . These models have now been widely distributed amongst the scientific community and a MCL cell line bank is currently being established as a result of efforts put forth by this work and others to make MCL models available to everyone. This is an exciting time for research in MCL as investigators now have the tools in place to thoroughly study mechanisms of resistance to treatment, the underlying cell signaling pathways involved in MCL pathogenesis, and new treatment strategies sorely needed for MCL. Although the median overall survival of MCL is 3 years, patients can either undergo a more aggressive progression of disease leading to a survival of only a couple of months or can undergo a slower evolution or progression, as some patients survive past 10 years (Rosenwald et al ., 2003) . This would strongly indicate that MCL, as a  139  whole is not a homogeneous patient population. In conjunction with this idea there are some cyclin Dl/t(I 1 ;14)(g13 ;g32) negative MCL that have been identified (Rosenwald et al .,  2003 ; Yatabe et al., 2000). This patient population has been shown, in some cases, to  express cyclin D2 or cyclin D3, which indicates that these cyclins may substitute for cyclin DI expression (Rosenwald et al ., 2003). The MCL models characterized in this thesis research showed both variant and typical features of MCL . The JVM-2 and NCEB-1 cell lines were very similar in that they had slower proliferation rates and a slower evolution in mouse models compared to Z-138 and HBL-2 models, which exhibited both higher proliferation rates  in vitro  and a  more aggressive time course in mouse models . Curiously, the Z-138 model was much more sensitive to treatment with Rituximab and oblimersen and ongoing studies indicate that other drugs tested  in vitro  against the Z-138 cells were also more active than in  either the JVM-2 or NCEB-1 cell lines . It is plausible that the higher proliferation rate seen in the Z-138 model leads to an increase in drug sensitivity, particularly if there is a concomitant absence in alterations negatively affecting the apoptotic pathway . On the other hand, JVM-2 and NCEB-I cells may have evolved mechanisms of slower evolution to protect against apoptotic stimuli . Additional mutations/alterations could then eventually lead to impaired apoptotic machinery leading to a more aggressive proliferative state . If these models reflect subsets of patient populations in MCL, screening of patients to determine if they follow a more aggressive lymphoma type with increased chances of curability or an indolent lymphoma type may greatly alter the therapeutic approaches used . This is consistent with the overall trend in cancer treatment  140  research, where it is argued that each patient must be treated more individually based on underlying genetic and/or molecular features. Protein microarrays (Kinexus antibody microarrays) were performed in Z-138 cells and NCEB-1 cells to determine some of the underlying differences in cell signaling pathways between these two models . Interestingly, Z-138 and NCEB-1 differed in cell signaling pathways related to B cell receptor (BCR) and CD40 signaling . Thus, future studies examining alterations of BCR or CD40 will be of value to further our understanding of the differences in these models . These models exhibit both sensitivity and insensitivity to various treatment strategies and studying them may help to identify MCL patient populations that are more amenable to different treatment modalities. It is interesting to note that JVM-2 cells, which closely resemble NCEB-1 cells, over-expressed CD40 to a greater level than Z-138 cells . The JVM-2 xenograft model was also insensitive to Rituximab treatment . As summarized in the introduction (section 1 .14), Rituximab treatment engenders translocation of CD20 into lipid rafts, leading to cell signaling events culminating in apoptosis . As CD40 and CD20 can interact and the BCR is also in close proximity to these receptors in lipid rafts, it is tempting to speculate that Rituximab binding to CD20 may alter the cell signaling activities of CD40 and BCR leading to changes in the cell such as apoptosis or increased susceptibility to chemotherapeutic agents. Future studies looking at the altered cell signaling molecules associated with CD20 following Rituximab binding would be of great value to the understanding of cell signaling events following Rituximab binding to CD20 . The CD20 receptor possesses no inherent kinase activity, indicating that other yet to be identified molecules may mediate its effects .  141  6.2 Conclusions In conclusion, research summarized in this thesis has shown that cyclin D1 mRNA isoforms can dictate proliferation rates and survival in conjunction with deletions in the p16 INK4/ARF regions in MCL models . An inverse relationship in the expression of p16 and p18 which has never been described was observed in MCL, indicating that deletion of one or the other may be sufficient to cause perturbations of the cell cycle in MCL. Some true cyclin Dl/t(11 ;14)(g13 ;g32) negative MCL exist and these cases appear to have the same expression signature profiles as cyclin D1 positive cases in MCL patients . Curiously, in the absence of cyclin D1 expression cyclin D2 or D3 expression was observed and thought to substitute for cyclin D1 . In accordance with this finding the data presented here showed that in cases where the t(11 ;14) is still present but the levels of cyclin D1 are low, cyclin D2 can also be expressed. New models of MCL were established leading to the discovery of many altered pathways in MCL, which include a role for bcl-2 in altering expression levels of NF-KB, p53, bax and p27 . From these studies novel interactions between bcl-2 and mdm-2, p27 and cyclin D1 were observed . Other altered cell signaling pathways included an increased expression in bcl-xL, mcl-1, CD40/CD40L, Fas and soluble FasL, capable of blocking Fas-mediated apoptosis . The abnormal expression of soluble FasL by MCL B cells indicates for the first time another means for MCL cells to evade the immune system. Lastly, the discovery of FasL expressed on endothelial cells lining tumor blood vessels, potentially leading to exclusion of immune effector cells, may indicate a new mechanism for immune evasion in lymphoma and is currently being investigated.  142  REFERENCES Abe M, Nozawa Y, Wakasa H, Ohno H, Fukuhara S . Characterization and comparison of two newly established Epstein-Barr virus-negative B-cell lines . Surface markers, growth characteristics, cytogenetics, and transplantability. Cancer 1988 ;61 :483-90 Adams JM, Cory S . The Bcl-2 protein family : arbiters of cell survival . Science 1998;281 :1322-6 Agrawal S, Goodchild J, Civeira MP, Thornton AH, Sarin PS, Zamecnik PC. Oligodeoxynucleoside phosphoramidates and phosphorothioates as inhibitors of human immunodeficiency virus . Proc Natl Acad Sci USA 1988 ;85 :7079-83 Agrawal S, Kandimalla ER . Role of Toll-like receptors in antisense and siRNA . Nat Biotechnol 2004 ;22:1533-7 Akhtar S, Basu S, Wickstrom E, Juliano RL . Interactions of antisense DNA oligonucleotide analogs with phospholipid membranes (liposomes) . Nucleic Acids Res 1991 ;19 :5551-9 Alas S, Emmanouilides C, Bonavida B . Inhibition of interleukin 10 by Rituximab results in down-regulation of bcl-2 and sensitization of B-cell non-Hodgkin's lymphoma to apoptosis . Clin Cancer Res 2001 ;7 :709-23 Albanese C, Johnson J, Watanabe G, Eklund N, Vu D, Arnold A, Pestell RG. Transforming p21 `as mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions . J Biol Chem 1995 ;270:23589-97 Alt JR, Cleveland JL, Hannink M, Diehl JA. Phosphorylation-dependent regulation of cyclin D1 nuclear export and cyclin Dl-dependent cellular transformation . Genes Dev 2000 ;14 :3102-14 Amin HM, McDonnell TJ, Medeiros LJ, Rassidakis GZ, Leventaki V, O'Connor SL, Keating MJ, Lai R . Characterization of 4 mantle cell lymphoma cell lines . Arch Pathol Lab Med 2003 ;127 :424-31 Andersen NS, Donovan JW, Borus JS, Poor CM, Neuberg D, Aster JC, Nadler LM, Freedman AS, Gribben JG. Failure of immunologic purging in mantle cell lymphoma assessed by polymerase chain reaction detection of minimal residual disease. Blood 1997;90 :4212-21 Argatoff LH, Connors JM, Klasa RJ, Horsman DE, Gascoyne RD . Mantle cell lymphoma : a clinicopathologic study of 80 cases . Blood 1997;89 :2067-78  143  Armitage JO, Weisenburger DD . New approach to classifying non-Hodgkin's lymphomas : clinical features of the major histologic subtypes . Non-Hodgkin's Lymphoma Classification Project . J Clin Oncol 1998 ;16 :2780-95 Arvanitakis L, Yaseen N, Sharma S . Latent membrane protein-1 induces cyclin D2 expression, pRb hyperphosphorylation, and loss of TGF-beta 1-mediated growth inhibition in EBV-positive B cells . J Immunol 1995 ;155 :1047-56 Au WY, Gascoyne RD, Viswanatha DS, Connors JM, Klasa RJ, Horsman DE. Cytogenetic analysis in mantle cell lymphoma : a review of 214 cases . Leuk Lymphoma 2002;43 :783-91 Avivi I, Robinson S, Goldstone A . Clinical use of Rituximab in haematological malignancies. Br J Cancer 2003 ;89:1389-94 Ayroldi E, D'Adamio F, Zollo 0, Agostini M, Moraca R, Cannarile L, Migliorati G, Delfino DV, Riccardi C . Cloning and expression of a short Fas ligand : A new alternatively spliced product of the mouse Fas ligand gene . Blood 1999 ;94 :3456-67 Ballas ZK, Rasmussen WL, Krieg AM . Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA . J Immunol 1996;157 :1840-5 Ballas ZK . Modulation of NK cell activity by CpG oligodeoxynucleotides . Immunol Res 2007 ;39 :15-21 Banchereau J, Rousset F . Human B lymphocytes : phenotype, proliferation, and differentiation . Adv Immunol 1992 ;52:125-262 Banks PM, Chan J, Cleary ML, Delsol G, De Wolf-Peeters C, Gatter K, Grogan TM, Harris NL, Isaacson PG, Jaffe ES, Mason D, Pileri S, Ralfikiaer E, Stein H, Warnke RA. Mantle cell lymphoma. A proposal for unification of morphologic, immunologic, and molecular data . Am J Surg Pathol 1992 ;16 :637-40 Bellosillo B, Villamor N, Lopez-Guillermo A, Marce S, Esteve J, Campo E, Colomer D, Montserrat E . Complement-mediated cell death induced by Rituximab in B-cell lymphoproliferative disorders is mediated in vitro by a caspase-independent mechanism involving the generation of reactive oxygen species . Blood 2001 ;98:2771-7 Beltinger C, Saragovi HU, Smith RM, LeSauteur L, Shah N, DeDionisio L, Christensen L, Raible A, Jarrett L, Gewirtz AM . Binding, uptake, and intracellular trafficking of phosphorothioate-modified oligodeoxynucleotides . J Clin Invest 1995 ;95 :1814-23 Berenson JR, Yang J, Mickel RA . Frequent amplification of the bcl-1 locus in head and neck squamous cell carcinomas . Oncogene 1989 ;4 :1111-6  144  Bernstein E, Caudy AA, Hammond SM, Hannon GJ . Role for a bidentate ribonuclease in the initiation step of RNA interference . Nature 2001 ;409:363-6 Beum PV, Kennedy AD, Li Y, Pawluczkowycz AW, Williams ME, Taylor RP. Complement activation and C3b deposition on rituximab-opsonized cells substantially blocks binding of phycoerythrin-labeled anti-mouse IgG probes to rituximab . J Immunol Methods 2004 ;294:37-42 Beum PV, Kennedy AD, Williams ME, Lindorfer MA, Taylor RP . The shaving reaction: rituximab/CD20 complexes are removed from mantle cell lymphoma and chronic lymphocytic leukemia cells by THP-1 monocytes. J Immunol 2006 ;176 :2600-9 Bijwaard KE, Aguilera NS, Monczak Y, Trudel M, Taubenberger JK, Lichy JH. Quantitative real-time reverse transcription-PCR assay for cyclin D1 expression : utility in the diagnosis of mantle cell lymphoma . Clin Chem 2001 ;47:195-201 Blais A, Labrie Y, Pouliot F, Lachance Y, Labrie C . Structure of the gene encoding the human cyclin-dependent kinase inhibitor p18 and mutational analysis in breast cancer. Biochem Biophys Res Commun 1998 ;247:146-53 Blow JJ, Hodgson B . Replication licensing-defining the proliferative state? Trends Cell Biol 2002 ;12 :72-8 Bodrug SE, Warner BJ, Bath ML, Lindeman GJ, Harris AW, Adams JM . Cyclin D1 transgene impedes lymphocyte maturation and collaborates in lymphomagenesis with the myc gene. EMBO J 1994 ;13 :13 :2124-30 Borner C . The bcl-2 protein family : sensors and checkpoints for life-or-death decisions. Mol Immunol 2003 ;39 :615-47 Brown DC, Gatter KC . Ki67 protein : the immaculate deception? Histopathology 2002 ;40 :2-11 Bubien JK, Zhou LJ, Bell PD, Frizzell RA, Tedder TF . Transfection of the CD20 cell surface molecule into ectopic cell types generates a Ca t+ conductance found constitutively in B lymphocytes . J Cell Biol 1993 ;121 :1121-32 Byrd JC, Kitada S, Flinn IW, Aron JL, Pearson M, Lucas D, Reed JC . The mechanism of tumor cell clearance by rituximab in vivo in patients with B-cell chronic leukemia: evidence of caspace activation and apoptosis induction . Blood 2002 ;99:1038-43 Callea V, Clo V, Morabito F, Baldini L, Stelitano C, Narni F, Avanzini P, Brugiatelli M, Silingardi V. Retrospective analysis of mantle cell lymphoma : experience of the "Gruppo Italiano per lo Studio dei Linfomi (GISL) . Haematologica 1998 ;83 :993-7 Campo E, Raffeld M, Jaffe ES . Mantle-cell lymphoma . Semin Hematol 1999 ;36:115-27  145  Cardarelli PM, Quinn M, Buckman D, Fang Y, Colcher D, King DJ, Bebbington C, Yarranton G. Binding to CD20 by anti-B1 antibody or F(ab')(2) is sufficient for induction of apoptosis in B-cell lines . Cancer Immunol Immunother 2002 ;51 :15-24 Carmell MA, Xuan Z, Zhang MQ, Hannon GJ . The Argonaute family : tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes Dev 2002;16 :2733-42 Cartron G, Dacheux L, Salles G, Solal-Celigny P, Bardos P, Colombat P, Watier H. Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor FcgammaRllla gene . Blood 2002 ;99:754-8 Casanovas 0, Miro F, Estanyol JM, Itarte E, Agell N, Bachs O . Osmotic stress regulates the stability of cyclin D1 in a p38 sapk2-dependent manner. J Biol Chem 2000;275:350917 Castro JE, Prada CE, Aguillon RA, Kitada S, Fukuda T, Motta M, Wu C, Dicker F, Sun G, Wang JY, Carson DA, Reed JC, Kipps TJ . Thymidine-phosphorothioate oligonucleotides induce activation and apoptosis of CLL cells independently of CpG motifs or bcl-2 gene interference . Leukemia 2006 ;20:680-8 Cattoretti G, Chang CC, Cechova K, Zhang J, Ye BH, Falini B, Louie DC, Offit K, Chaganti RS, Dalla-Favera R. Bcl-6 protein is expressed in germinal-center B cells. Blood 1995 ;86:45-53 Chanan-Khan A . Bcl-2 antisense therapy in B-cell malignancies . Blood Rev 2005 ;19 :213-21 Charles J, Foerster PAJ . Chapter 44 . In: Richard LG, John F, John L, Frixos P, John G, George MR, editors. Wintrobe's Clinical Hematology, Vol 1 . Baltimore, USA: Williams and Wilkins ;1999 . p.1191-1209. Chiu GN, Edwards LA, Kapanen AI, Malinen MM, Dragowska WH, Warburton C, Chikh GG, Fang KY, Tan S, Sy J, Tucker C, Waterhouse DN, Klasa R, Bally MB. Modulation of cancer cell survival pathways using multivalent liposomal therapeutic antibody constructs . Mol Cancer Ther 2007 ;6 :844-55 Clodi K, Asgary Z, Zhao S, Kliche KO, Cabanillas F, Andreeff M, Younes A. Coexpression of CD40 and CD40 ligand in B cell lymphoma cells . Br J Haematol 1998a;103 :270-5 Clodi K, Snell V, Zhao S, Cabanillas F, Andreeff M, Younes A . Unbalanced expression of Fas and CD40 in mantle cell lymphoma. Br J Haematol 1998b;103 :217-9  146  Clynes RA, Towers TL, Presta LG, Ravetch JV . Inhibitory Fc receptors modulate cytoxicity against tumor targets . Nat Med 2000 ;6 :443-6  in vivo  Cohen PL, Kurtin PJ, Donovan KA, Hanson CA. Bone marrow and peripheral blood involvement in mantle cell lymphoma . Br J Haematol 1998 ;101 :302-10 Coiffier B, Haioun C, Ketterer N, Engert A, Tilly H, Ma D, Johnson P, Lister A, FeuringBuske M, Radford JA, Capdeville R, Diehl V, Reyes F . Rituximab (anti-CD20 monoclonal antibody for the treatment of patients with relapsing or refractory aggressive lymphoma : a multicenter phase II study . Blood 1998;92 :1927-32 Coiffier B, Lepage E, Briere J, Herbrecht R, Tilly H, Bouabdallah R, Morel P, Van Den Neste E, Salles G, Gaulard P, Reyes F, Lederlin P, Gisselbrecht C . CHOP chemotherapy plus rituximab compared with CHOP alone in elderly patients with diffuse large-B-cell lymphoma . N Engl J Med 2002;346:235-42 Coiffier B. Rituximab in combination with CHOP improves survival in elderly patients with aggressive non-Hodgkin's lymphoma . Semin Oncol 2002;29:18-22 Cotter FE, Johnson P, Hall P, Pocock C, al Mandi N, Cowell JK, Morgan G . Antisense oligonucleotides suppress B-cell lymphoma growth in a SCID-hu mouse model. Oncogene 1994 ;9:3049-55 Cragg MS, Morgan SM, Chan HT, Morgan BP, Filatov AV, Johnson PW, French RR, Glennie MJ . Complement-mediated lysis by anti-CD20 mAb correlates with segregation into lipid rafts. Blood 2003 ;101 :1045-52 Cragg MS, Glennie M . Antibody specificity controls anti-CD20 reagents . Blood 2004;103 :2738-43  in vivo  effector mechanisms of  Crooke ST. Molecular mechanisms of antisense drugs : RNase H . Antisense Nucleic Acid Drug Dev 1998 ;8 :133-4 Czuczman MS, Grillo-Lopez AJ, McLaughlin P, White CA, Saleh M, Gordon L, LoBuglio AF, Rosenberg J, Alkuzweny B, Maloney D . Clearing of cells bearing the bcl2 [t(14 ;18)] translocation from blood and marrow of patients treated with rituximab alone or in combination with CHOP chemotherapy . Ann Oncol 2001 ;12:109-14 Deans JP, Schieven GL, Shu GL, Valentine MA, Gilliland LA, Aruffo A, Clark EA, Ledbetter JA . Association of tyrosine and serine kinases with the B cell surface antigen CD20 . Induction via CD20 of tyrosine phosphorylation and activation of phospholipase C-gamma 1 and phospholipase C-gamma 2 . J Immunol 1993 ;151 :4494-504 Deans JP, Kali L, Ledbetter JA, Schieven GL, Bolen JB, Johnson P . Association of 75/80-KDa phosphoproteins and the tyrosine kinases Lyn, Fyn, and Lck with the B cell  147  molecule CD20 . Evidence against involvement of the cytoplasmic regions of CD20 . J Biol Chem 1995 ;270 :22632-8 Deans JP, Robbins SM, Polyak MJ, Savage JA . Rapid redistribution of CD20 to a low density detergent-insoluble membrane compartment. J Biol Chem 1998 ;273 :344-8 Deans JP, Li H, Polyak MJ . CD20-mediated apoptosis : signalling through lipid rafts. Immunology 2002;107 :176-82 de Boer CJ, Schuuring E, Dreef E, Peters G, Bartek J, Kluin PM, van Krieken JH . Cyclin D1 protein analysis in the diagnosis of mantle cell lymphoma . Blood 1995a;86 :2715-23 de Boer CJ, van Krieken JH, Kluin-Nelemans HC, Kluin PM, Schuuring E . Cyclin D1 messenger RNA overexpression as a marker for mantle cell lymphoma . Oncogene 1995b ;10:1833-40 Decaudin D . Mantle cell lymphoma : a biological and therapeutic paradigm . Leuk Lymphoma 2002 ;43 :773-81 de Leeuw RJ, Davies JJ, Rosenwald A, Bebb G, Gascoyne RD, Dyer MJ, Staudt LM, Martinez-Climent JA, Lam WL . Comprehensive whole genome array CGH profiling of mantle cell lymphoma model genomes . Hum Mol Genet 2004 ;13 :1827-37 Deng X, Gao F, Flagg T, Anderson J, May WS . Bcl-2's flexible loop domain regulates p53 binding and survival . Mol Cell Biol 2006 ;26:4421-34 De Paoli P, Cozzi M, Tedeschi R, Gloghini A, Cilia AM, van Kooten C, Gaidano G, Carbone A . High CD40 membrane expression in AIDS-related lymphoma B cell lines is associated with the CD45RA+, CD45RO+, CD95+ phenotype and high levels of its soluble form in culture supernatants . Cytometry 1997 ;30:33-8 Devi GR . siRNA-based approaches in cancer therapy . Cancer Gene Ther 2006 ;13 :81929 Dias N, Stein CA . Antisense oligonucleotides : basic concepts and mechanisms. Mol Cancer Ther 2002 ;1 :347-55 Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C . Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA . Science 2004;303 :152931 Diehl JA . Cycling to cancer with cyclin D1 . Cancer Biol Ther 2002;1 :226-31 Di Gaetano N, Cittera E, Nota R, Vecchi A, Grieco V, Scanziani E, Botto M, Introna M, Golay J . Complement activation determines the therapeutic activity of rituximab in vivo. J Immunol 2003 ;171 :1581-7  148  Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K . Short-interfering-RNAmediated gene silencing in mammalian cells requires Dicer and eIF2C translation intiation factors. Curr Biol 2003 ;13 :41-6 Drexler HG, MacLeod RA . Malignant hematopoietic cell lines : in vitro models for the study of mantle cell lymphoma . Leuk Res 2002 ;26:781-7 Dreyling MH, Bullinger L, Ott G, Stilgenbauer S, Muller-Hermelink HK, Bentz M, Hiddemann W, Dohner H. Alterations of the cyclin Dl/p16-pRB pathway in mantle cell lymphoma . Cancer Res 1997 ;57 :4608-14 Du J, Wang H, Zhong C, Peng B, Zhang M, Li B, Huo S, Guo Y, Ding J . Structural basis for recognition of CD20 by therapeutic antibody rituximab . J Biol Chem 2007;282:15073-80 Du MQ, Diss TC, Xu CF, Wotherspoon AC, Isaacson PG, Pan LX . Ongoing immunoglobulin gene mutations in mantle cell lymphomas . Br J Haematol 1997 ;96:124-31 Dunn T, Praissman L, Hagag N, Viola MV . ERG gene is translocated in an Ewing's sarcoma cell line . Cancer Genet Cytogenet 1994 ;76:19-22 Dykstra M, Cherukuri A, Sohn HW, Tzeng SJ, Pierce SK . Location is everything : lipid rafts and immune cell signaling . Annu Rev Immunol 2003 ;21 :457-81 Einfeld DA, Brown JP, Valentine MA, Clark EA, Ledbetter JA . Molecular cloning of the human B cell CD20 receptor predicts a hydrophobic protein with multiple transmembrane domains. EMBO J 1988 ;7 :711-7 Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T . Duplexes of 21nucleotide RNAs mediate RNA interference in cultured mammalian cells . Nature 2001 ;411 :494-8 Endl E, Gerdes J . The Ki-67 protein : fascinating forms and an unknown function . Exp Cell Res 2000 ;257 :231-7 Ernst JA, Li H, Kim HS, Nakamura GR, Yansura DG, Vandlen RL . Isolation and characterization of the B-cell marker CD20 . Biochemistry 2005 ;44 :15150-8 Estrov Z, Talpaz M, Ku S, Harris D, Van Q, Beran M, Hirsch-Ginsberg C, Huh Y, Yee G, Kurzrock R . Z-138: a new mature B-cell acute lymphoblastic leukemia cell line from a patient with transformed chronic lymphocytic leukemia . Leuk Res 1998 ;22 :341-53  149  Farag SS, Flinn IW, Modali R, Lehman TA, Young D, Byrd JC . Fc gamma RIIIa and Fc gamma RIIa polymorphisms do not predict response to rituximab in B-cell chronic lymphocytic leukemia. Blood 2004 ;103 :1472-4 Feinman R, Koury J, Thames M, Barlogie B, Epstein J, Siegel DS . Role of NF-kappaB in the rescue of multiple myeloma cells from glucocorticoid-induced apoptosis by bcl-2. Blood 1999 ;93 :3044-52 Fennewald SM, Rando RF . Inhibition of high affinity basic fibroblast growth factor binding by oligonucleotides . J Biol Chem 1995;270 :21718-21 Foran JM, Cunningham D, Coiffier B, Solal-Celigny P, Reyes F, Ghielmini M, Johnson PW, Gisselbrecht C, Bradburn M, Matthews J, Lister TA . Treatment of mantle-cell lymphoma with rituximab (chimeric monoclonal anti-CD20 antibody) : analysis of factors associated with response . Ann Oncol 2000 ;11 Suppl 1 :117-21 Franklin DS, Godfrey VL, Lee H, Kovalev GI, Schoonhoven R, Chen-Kiang S, Su L, Xiong Y. CDK inhibitors p18(INK4c) and p27(Kipl) mediate two separate pathways to collaboratively suppress pituitary tumorigenesis. Genes Dev 1998;12 :2899-911 Freedman AS, Neuberg D, Gribben JG, Mauch P, Soiffer RJ, Fisher DC, Anderson KC, Andersen N, Schlossman R, Kroon M, Ritz J, Aster J, Nadler LM . High-dose chemoradiotherapy and anti-B-cell monoclonal antibody-purged autologous bone marrow transplantation in mantle-cell lymphoma : no evidence for long-term remission . J Clin Oncol 1998 ;16:13-8 French DL, Laskov R, Scharff MD . The role of somatic hypermutation in the generation of antibody diversity . Science 1989 ;244 :1152-7 Garrone P, Neidhardt EM, Garcia E, Galibert R, van Kooten C, Banchereau J . Fas ligation induces apoptosis of CD40 activated human B lymphocytes . J Exp Med 1995 ;182 :1265-73 Gary-Gouy H, Sainz-Perez A, Bismuth G, Ghadiri A, Perrino BA, Dalloul A. Cyclosporin-A inhibits ERK phosphorylation in B cells by modulating the binding of Raf protein to bcl-2 . Biochem Biophys Res Commun 2006 ;344:134-9 Gascoyne RD, Lamant L, Martin-Subero JI, Lestou VS, Harris NL, Muller-Hermelink HK, Seymour JF, Campbell LJ, Horsman DE, Auvigne I, Espinos E, Siebert R, Delsol G. ALK-positive diffuse large B-cell lymphoma is associated with Clathrin-ALK rearrangements: report of 6 cases . Blood 2003 ;102 :2568-73 Gelderman KA, Tomlinson S, Ross GD, Gorter A . Complement function in mAbmediated cancer immunotherapy . Trends Immunol 2004 ;25 :158-64  150  Genot EM, Meier KE, Licciardi KA, Ahn NG, Uittenbogaart CH, Wietzerbin J, Clark EA, Valentine MA . Phosphorylation of CD20 in cells from a hairy cell leukemia cell line. Evidence for involvement of calciumlcalmodulin-dependent protein kinase II . J Immunol 1993 ;151 :71-82 Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U, Stein H . Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody ki-67. J Immunol 1984 ;133 :1710-5 Ghielmini M, Schmitz SF, Burki K, Pichert G, Betticher DC, Stupp R, Wernli M, Lohri A, Schmitter D, Bertoni F, Cerny T . The effect of rituximab on patients with follicular and mantle-cell lymphoma . Swiss Group for Clinical Cancer Research (SAKK) . Ann Oncol 2000 ;1 1 :123-6 Ghielmini M, Rufibach K, Salles G, Leoncini-Franscini L, Leger-Falandry C, Cogliatti S, Fey M, Martinelli G, Stahel R, Lohri A, Ketterer N, Wernli M, Cerny T, Schmitz SF. Single agent rituximab in patients with follicular or mantle cell lymphoma : clinical and biological factors that are predictive of response and event-free survival as well as the effect of rituximab on the immune system : a study of the Swiss Group for Clinical Cancer Research (SAKK) . Ann Oncol 2005 ;16 :1675-82 Gladden AB, Woolery R, Aggarwal P, Wasik MA, Diehl JA . Expression of constitutively nuclear cyclin D1 in murine lymphocytes induces B-cell lymphoma. Oncogene 2006 ;25:998-1007 Golay JT, Clark EA, Beverley PC. The CD20 (Bp35) antigen is involved in activation of B cells from the Go to the G1 phase of the cell cycle . J Immunol 1985 ;135 :3795-801 Golay J, Zaffaroni L, Vaccari T, Lazzari M, Borleri GM, Bernasconi S, Tedesco F, Rambaldi A, Introna M. Biologic response of B lymphoma cells to anti-CD20 monoclonal antibody rituximab in vitro : CD55 and CD59 regulate complement-mediated cell lysis. Blood 2000 ;95 :3900-8 Golay J, Lazzari M, Facchinetti V, Bernasconi S, Borleri G, Barbui T, Rambaldi A, Introna M. CD20 levels determine the in vitro susceptibility to rituximab and complement of B-cell chronic lymphocytic leukemia : further regulation by CD55 and CD59. Blood 2001 ;98 :3383-9 Golay J, Cittera E, Di Gaetano N, Manganini M, Mosca M, Nebuloni M, van Rooijen N, Vago L, Introna M. The role of complement in the therapeutic activity of rituximab in a murine B lymphoma model homing in lymph nodes . Haematologica 2006 ;91 :176-83 Gorter A, Meri S . Immune evasion of tumor cells using membrane-bound complement regulatory proteins . Immunol Today 1999 ;20:576-82  151  Gottardi D, Alfarano A, De Leo AM, Stacchini A, Aragno M, Rigo A, Veneri D, Zanotti R, Pizzolo G, Caligaris-Cappio F . In leukaemic CD5+ B cells the expression of bcl-2 gene family is shifted toward protection from apoptosis . Br J Haematol 1996 ;94:612-8 Grammer AC, McFarland RD, Heaney J, Darnell BF, Lipsky PE . Expression, regulation and function of B cell-expressed CD154 in germinal centers . J Immunol 1999 ;163 :41509 Grana X, Garriga J, Mayol X . Role of the retinoblastoma protein family, pRB, p107 and p130 in the negative control of cell growth. Oncogene 1998 ;17:3365-83 Green DR . Apoptotic pathways : paper wraps stone blunt scissors . Cell 2000 ;102:1-4 Greiner TC, Moynihan MJ, Chan WC, Lytle DM, Pedersen A, Anderson JR, Weisenburger DD . p53 mutations in mantle cell lymphoma are associated with variant cytology and predict a poor prognosis . Blood 1996 ;87:4302-10 Guikema JE, Fenton JA, de Boer C, Kleiverda K, Brink AA, Raap AK, Estrov Z, Schuuring E, Kluin PM . Complex biallelic IGH rearrangements in IgM-expressing Z138 cell line : Involvement of downstream immunoglobulin class switch recombination. Genes Chromosomes Cancer 2005 ;42 :164-9 Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin AS Jr . NF-kappaB controls cell growth and differentiation through transcriptional regulation of cyclin D1 . Mol Cell Biol 1999 ;19:5785-99 Guvakova MA, Yakubov LA, Vlodaysky I, Tonkinson JL, Stein CA . Phosphorothioate oligodeoxynucleotides bind to basic fibroblast growth factor, inhibit its binding to cell surface receptors, and remove it from low affinity binding sites on extracellular matrix . J Biol Chem 1995 ;270 :2620-7 Guzman-Rojas L, Sims-Mourtada JC, Rangel R, Martinez-Valdez H . Life and death within germinal centres : a double-edged sword . Immunology 2002 ;107:167-75 Hainsworth JD, Litchy S, Burris HA 3 rd, Scullin DC Jr, Corso SW, Yardley DA, Morrissey L, Greco FA. Rituximab as first-line and maintenance therapy for patients with indolent non-Hodgkin's lymphoma . J Clin Oncol 2002 ;20 :4261-7 Hainsworth JD, Litchy S, Lamb MR, Rodriguez GI, Scroggin C Jr, Greco FA . First-line treatment with brief-duration chemotherapy plus rituximab in elderly patients with intermediate-grade non-Hodgkin's lymphoma : phase II trial. Clin Lymphoma 2003 ;4:3642 Hallermalm K, De Geer A, Kiessling R, Levitsky V, Levitskaya J . Autocrine secretion of Fas ligand shields tumor cells from Fas-mediated killing by cytotoxic lymphocytes. Cancer Res 2004 ;64 :6775-82  152  Harjunpaa A, Junnikkala S, Meri S. Rituximab (anti-CD20) therapy of B-cell lymphomas: direct complement killing is superior to cellular effector mechanisms. Scand J Immunol 2000;51 :634-41 Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, Delsol G, De WolfPeeters C, Falini B, Gatter KC, Grogan TM, Isaacson PG, Knowles D, Mason D, MullerHermelink HK, Pileri SA, Piris M, Ralfkiaer E, Warnke R . A revised EuropeanAmerican classification of lymphoid neoplasms : a proposal from the International Lymphoma Study Group. Blood 1994 ;84:1361-92 Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J, Lister TA, Bloomfield CD . World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues : report of the Clinical Advisory Committee meeting- Airlie House, Virginia, November 1997 . J Clin Oncol 1999 ;17 :3835-49 Harris NL . Mature B-cell neoplasms : Introduction . In: Jaffe ES, Harris NL, Stein H, Vardiman JW, editors. World Health Organization classification of tumors . Pathology and genetics of tumours of haematopoietic and lymphoid tissues . Lyon, France: IARC Press ; 2001 . p119-124 Hatjiharissi E, Xu L, Santos DD, Hunter ZR, Ciccarelli BT, Verselis S, Modica M, Cao Y, Manning RJ, Leleu X, Dimmock EA, Kortsaris A, Mitsiades C, Anderson KC, Fox EA, Treon SP . Increased natural killer cell expression of CD16, and augmented binding and ADCC activity to rituximab among individuals expressing the Fc{gamma}RIIIA-158 V/V and V/F polymorphism . Blood 2007 ;110 :2561-4 Helene C, Toulme JJ. Specific regulation of gene expression by antisense, sense and antigene nucleic acids. Biochim Biophys Acta 1990 ;1049 :99-125 Hemmi H, Takeuchi 0, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S . A Toll-like receptor recognizes bacterial DNA . Nature 2000;408 :740-5 Hermann M, Scholman HJ, Marafioti T, Stein H, Shriever F . Differential expression of apoptosis, bcl-x and c-myc in normal and malignant lymphoid tissues. Eur J Haematol 1997;59 :20-30 Hernandez-Ilizaliturri FJ, Jupudy V, Otsberg J, Oflazoglu E, Huberman A, Repasky E, Czuczman MS . Neutrophils contribute to the biological antitumor activity of rituximab in a non-Hodgkin's lymphoma severe combined immunodeficiency mouse model . Clin Can Res 2003 ;9 :5866-73 Hiddemarm W, Unterhalt M, Herrmann R, Woltjen HH, Kreuser ED, Trumper L, ReussBorst M, Terhardt-Kasten E, Busch M, Neubauer A, Kaiser U, Hanrath RD, Middeke H, Helm G, Freund M, Stein H, Tiemann M, Parwaresch R . Mantle-cell lymphomas have  153  more widespread disease and a slower response to chemotherapy compared with folliclecenter lymphomas : results of a prospective comparative analysis of the German LowGrade Lymphoma Study Group . J Clin Oncol 1998 ;16 :1922-30 Hijiya N, Zhang J, Ratajczak MZ, Kant JA, DeRiel K, Herlyn M, Zon G, Gewirtz AM. Biologic and therapeutic significance of MYB expression in human melanoma . Proc Natl Acad Sci USA 1994 ;91 :4499-503 Himmelmann A, Riva A, Wilson GL, Lucas BP, Thevenin C, Kehrl JH . PU .1/Pip and basic helix loop helix zipper transcription factors interact with binding sites in the CD20 promoter to help confer lineage- and stage-specific expression of CD20 in B lymphocytes . Blood 1997 ;90:3984-95 Hockenbery DM, Zutter M, Hickey W, Nahm M, Korsmeyer SJ . Bcl-2 protein is topographically restricted in tissues characterized by apoptotic cell death . Proc Natl Acad Sci USA 1991 ;88 :6961-5 Hofmann WK, de Vos S, Tsukasaki K, Wachsman W, Pinkus GS, Said JW, Koeffler HP. Altered apoptosis pathways in mantle cell lymphoma detected by oligonucleotide microarray. Blood 2001 ;98 :787-94 Hofmeister JK, Cooney D, Coggeshall KM . Clustered CD20 induced apoptosis : srcfamily kinase, the proximal regulator of tyrosine phosphorylation, calcium influx and caspase 3-dependent apoptosis . Blood Cells Mol Dis 2000;26 :133-43 Hosokawa Y, Joh T, Maeda Y, Arnold A, Seto M . Cyclin D1/PRAD1/BCL-1 alternative transcript [B] protein product in B-lymphoid malignancies with t(11 ;14)(g13 ;g32) translocation . Int J Cancer 1999 ;81 :616-19 Howard OM, Gribben JG, Neuberg DS, Grossbard M, Poor C, Janicek MJ, Shipp MA. Rituximab and CHOP induction therapy for newly diagnosed mantle-cell lymphoma: molecular complete responses are not predictive of progression-free survival . J Clin Oncol 2002 ;20:1288-94 Howe D, Lynas C . The cyclin D1 alternative transcripts [a] and [b] are expressed in normal and malignant lymphocytes and their relative levels are influenced by the polymorphism at codon 241 . Haematologica 2001 ;86 :563-9 Hromas R, Orazi A, Neiman RS, Maki R, Van Beveran C, Moore J, Klemsz M. Hematopoietic lineage- and stage-restricted expression of the ETS oncogene family member PU .1 . Blood 1993 ;82:2998-3004 Hua F, Cornejo MG, Cardone MH, Stokes CL, Lauffenburger DA . Effects of bcl-2 levels on Fas signaling-induced caspase-3 activation : molecular genetic tests of computational model predictions . J Immunol 2005 ;175 :985-95  154  Hummel M, Tamaru J, Kalvelage B, Stein H . Mantle cell (previously centrocytic) lymphomas express VH genes with no or very little somatic mutations like the physiologic cells of the follicle mantle . Blood 1994 ;84:403-7 Hunter T, Pines J . Cyclins and cancer. II. Cyclin D and CDK inhibitors come of age. Cell 1994 ;79:573-82 Hutvagner G, Zamore PD . A microRNA in a multiple-turnover RNAi enzyme complex. Science 2002 ;297 :2056-60 Hyer ML, Samuel T, Reed JC . The FLIP-side of Fas signaling . Clin Cancer Res 2006;12 :5929-31 Idusogie EE, Presta LG, Gazzano-Santoro H, Totpal K, Wong PY, Ultsch M, Meng YG, Mulkerrin MG . Mapping of the Cl q binding site on rituxan, a chimeric antibody with a human IgGl Fc. J Immunol 2000 ;164:4178-84 Inghirami G, Foitl DR, Sabichi A, Zhu BY, Knowles DM . Autoantibody-associated cross-reactive idiotype-bearing human B lymphocytes : distribution and characterization, including Ig VH gene and CD5 antigen expression . Blood 1991 ;78 :1503-15 Iolascon A, Faienza MF, Coppola B, della Ragione F, Schettini F, Biondi A. Homozygous deletions of cyclin-dependent kinase inhibitor genes, p16(INK4A) and p18, in childhood T cell lineage acute lymphoblastic leukemias . Leukemia 1996 ;10:255-60 Jacob J, Kelsoe G, Rajewsky K, Weiss U . Intraclonal generation of antibody mutants in germinal centres . Nature 1991 ;354 :389-92 Jadayel DM, Lukas J, Nacheva E, Bartkova J, Stranks G, De Schouwer PJ, Lens D, Bartek J, Dyer MJ, Kruger AR, Catovsky D . Potential role for concurrent abnormalities of the cyclin D1, p16CDKN2 and p15CDKN2B genes in certain B cell non-Hodgkin's lymphomas. Functional studies in a cell line (Granta 519) . Leukemia 1997;11 ;64-72 Janas E, Priest R, Wilde JI, White JH, Malhotra R . Rituxan (anti-CD20 antibody)induced translocation of CD20 into lipid rafts is crucial for calcium influx and apoptosis. Clin Exp Immunol 2005 ;139:439-46 Janeway CA, Travers P . The humoral immune response (chapter 8) . In: Austin P, Lawrence E, Robertson M, Hunt E, Montier G, Richardson H, editors . Immunobiology: the immune system in health and disease . 3`d edition . New York/London, UK : Current biology Ltd ./Garland publishing Inc ; 1997. p.1-54 Jang JH, Surh YJ . Bcl-2 attenuation of oxidative cell death is associated with upregulation of gamma-glutamylcysteine ligase via constitutive NF-kappaB activation . J Biol Chem 2004 ;279 :38779-86  155  Jansen B, Schlagbauer-Wadl H, Brown BD, Bryan RN, van Elsas A, Muller M, Wolff K, Eichler H, Pehamberger H . Bcl-2 antisense therapy chemosensitizes human melanoma in SCID mice . Nat Med 1998 ;4:232-4 Jazirehi AR, Bonavida B . Cellular and molecular signal transduction pathways modulated by rituximab (rituxan, anti-CD20 mAb) in non-Hodgkin's lymphoma: implications in chemosensitization and therapeutic intervention . Oncogene 2005;24:2121-43 Jemal A, Siegel R, Ward E, Murray T, Xu J, Thun MJ . Cancer statistics, 2007 . CA Cancer J Clin 2007 ;57:43-66 Jeon HJ, Kim CW, Yoshino T, Akagi T . Establishment and characterization of a mantle cell lymphoma cell line . Br J Haematol 1998 ;102 :1323-6 Jiang W, Kahn SM, Zhou P, Zhang YJ, Cacace AM, Infante AS, Doi S, Santella RM, Weinstein IB . Overexpression of cyclin D1 in rat fibroblasts causes abnormalities in growth control, cell cycle progression and gene expression . Oncogene 1993 ;8 :3447-57 Jilani I, O'Brien S, Manshuri T, Thomas DA, Thomazy VA, Imam M, Naeem S, Verstovsek S, Kantarjian H, Giles F, Keating M, Albitar M . Transient down-modulation of CD20 by rituximab in patients with chronic lymphocytic leukemia . Blood 2003 ;102 :3514-20 Johnson PW, Glennie MJ . Rituximab: mechanisms and applications . B J Cancer 2001 ;85 :1619-23 Kandimalla ER, Bhagat L, Yu D, Cong Y, Tang J, Agrawal S . Conjugation of ligands at the 5'-end of CpG DNA affects immunostimulatory activity . Bioconjug Chem 2002;13 :966-74 Kanzaki M, Shibata H, Mogami H, Kojima I . Expression of calcium-permeable cation channel CD20 accelerates progression through the G1 phase in Balb/c 3T3 cells . J Biol Chem 1995 ;270 :13099-104 Katzenberger T, Petzoldt C, Holler S, Mader U, Kalla J, Adam P, Ott MM, MullerHermelink HK, Rosenwald A, Ott G. The Ki67 proliferation index is a quantitative indicator of clinical risk in mantle cell lymphoma . Blood 2006 ;107:3407 Kayagaki N, Kawasaki A, Ebata T, Ohmoto H, Ikeda S, Inoue S, Yoshino K, Okumura K, Yagita H. Metalloproteinase-mediated release of human Fas ligand . J Exp Med 1995;182 :1777-83 Kehrl JH, Riva A, Wilson GL, Thevenin C . Molecular mechanisms regulating CD19, CD20, and CD22 gene expression . Immunol Today 1994 ;15 :432-6  156  Kennedy AD, Solga MD, Schuman TA, Chi AW, Lindorfer MA, Sutherland WM, Foley PL, Taylor RP . An anti-C3b(i) mAb enhances complement activation, C3b(i) deposition, and killing of CD20+ cells by rituximab . Blood 2003;101 :1071-9 Kennedy AD, Beum PV, Solga MD, DiLillo DJ, Lindorfer MA, Hess CE, Densmore JJ, Williams ME, Taylor RP . Rituximab infusion promotes rapid complement depletion and acute CD20 loss in chronic lymphocytic leukemia . J Immunol 2004 ;172 :3280-8 Ketting RF, Fischer SE, Bernstein E, Sijen T, Hannon GJ, Plasterk RH . Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev 2001 ;15 :2654-9 Khong HT, Restifo NP . Natural selection of tumor variants in the generation of "tumor escape" phenotypes . Nat Immunol 2002 ;3 :999-1005 Khoury JD, Medeiros LJ, Rassidakis GZ, McDonnell TJ, Abruzzo LV, Lai R. Expression of mcl-1 in mantle cell lymphoma is associated with high-grade morphology, a high proliferative state, and p53 overexpression. J Pathol 2003 ;199:90-7. Kim R, Emi M, Tanabe K, Uchida Y, Toge T . The role of Fas ligand and transforming growth factor beta in tumor progression : molecular mechanisms and potential targets for cancer therapy. Cancer 2004 ;100:2281-91 Kipps TJ . The CD5 B cell . Adv Immunol 1989 ;47:117-85 Klasa RJ, Bally MB, Ng R, Goldie JH, Gascoyne RD, Wong FM . Eradication of human non-Hodgkin's lymphoma in SCID mice by bcl-2 antisense oligonucleotides combined with low-dose cyclophosphamide . Clin Cancer Res 2000 ;6:2492-500 Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA . The macrophage and B cell-specific transcription factor PU .I is related to the ets oncogene . Cell 1990 ;61 :11324 Klinman DM . Immunotherapeutic uses of CpG oligodeoxynucleotides . Nat Rev Immunol 2004 ;4:249-58 Koene HR, Kleijer M, Algra J, Roos D, von dem Borne AE, de Haas M . Fc gammaRII1a-158V/F polymorphism influences the binding of IgG by natural killer cell Fc gammaRllla, independently of the Fc gammaRllla-48L/R/H phenotype . Blood 1997;90 :1109-14 Koff A, Giordano A, Desai D, Yamashita K, Harper JW, Elledge S, Nishimoto T, Morgan DO, Franza BR, Roberts JM . Formation and activation of a cyclin E-cdk2 complex during the G1 phase of the human cell cycle . Science 1992;257 :1689-94 Krammer PH. CD95's deadly mission in the immune system . Nature 2000;407 :789-95  157  Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM . CpG motifs in bacterial DNA trigger direct B-cell activation . Nature 1995 ;374:546-9 Kuppers R. Mechanisms of B-cell lymphoma pathogenesis . Nature Rev 2005 ;5 :251-62 Kurita T, Medina R, Schabel AB, Young P, Gama P, Parekh TV, Brody J, Cunha GR, Osteen KG, Bruner-Tran KL, Gold LI. The activation function-1 domain of estrogen receptor alpha in uterine stromal cells is required for mouse but not human uterine epithelial response to estrogen. Differentiation 2005 ;73 :313-22 Kurland JF, Kodym R, Story MD, Spurgers KB, McDonnell TJ, Meyn RE . NF-kappaBl (p50) homodimers contribute to transcription of the bcl-2 oncogene . J Biol Chem 2001 ;276:45380-6 Lai R, McDonnell TJ, O'Connor SL, Medeiros LJ, Oudat R, Keating M, Morgan MB, Curiel TJ, Ford RJ . Establishment and characterization of a new mantle cell lymphoma cell line, Mino . Leuk Res 2002 :26:849-55 Lambert C, Landau AM, Desbarats J . Fas-beyond death : a regenerative role for Fas in the nervous system . Apoptosis 2003 ;8 :551-62 Lardelli P, Bookman MA, Sundeen J, Longo DL, Jaffe ES . Lymphocytic lymphoma of intermediate differentiation . Morphologic and immunophenotypic spectrum and clinical correlations. Am J Surg Pathol 1990 ;14 :752-63 Latres E, Malumbres M, Sotillo R, Martin J, Ortega S, Martin-Caballero J, Flores JM, Cordon-Cardo C, Barbacid M . Limited overlapping roles of p 15(INK4b) and p18(INK4c) cell cycle inhibitors in proliferation and tumorigenesis . EMBO J 2000;19:3496-506 Lebedeva I, Stein CA . Antisense oligonucleotides : promise and reality. Annu Rev Pharmacol Toxicol 2001 ;41 :403-19 Lebwohl DE, Muise-Helmericks R, Sepp-Lorenzino L, Serve S, Timaul M, Bol R, Borgen P, Rosen N . A truncated cyclin D1 gene encodes a stable mRNA in a human breast cancer cell line . Oncogene 1994 ;9:1925-9 Lee SH, Sinko PJ. siRNA--getting the message out . Eur J Pharm Sci 2006 ;27:401-10 Leenman EE, Panzer-Grumayer RE, Fischer S, Leitch HA, Horsman DE, Lion T, Gadner H, Ambros PF, Lestou VS . Rapid determination of Epstein-Barr virus latent or lytic infection in single human cells using in situ hybridization . Mod Pathol 2004 ;17:1564-72  158  Lestou VS, Gascoyne RD, Sehn L, Ludkovski 0, Chhanabhai M, Klasa RJ, Husson H, Freedman AS, Connors JM, Horsman DE . Multicolour fluorescence in situ hybridization analysis of t(14 ;18)-positive follicular lymphoma and correlation with gene expression data and clinical outcome . Br J Haematol 2003 ;122 :745-59 Leveille C, AL-Daccak R, Mourad W . CD20 is physically and functionally coupled to MHC class II and CD40 on human B cell lines . Eur J Immunol 1999 ;29 :65-74 Li H, Ayer LM, Lytton J, Deans JP . Store-operated cation entry mediated by CD20 in membrane rafts . J Biol Chem 2003 ;278 :42427-34 Lin-Lee YC, Pham LV, Tamayo AT, Fu L, Zhou HJ, Yoshimura LC, Decker GL, Ford RJ. Nuclear localization in the biology of the CD40 receptor in normal and neoplastic human B lymphocytes . J Biol Chem 2006 ;281 :18878-87 Liu YJ, Zhang J, Lane PJ, Chan EY, MacLennan IC . Sites of specific B cell activation in primary and secondary responses to T cell-depedent and T cell-independent antigens. Eur J Immunol 1991 ;21 :2951-62 Locksley RM, Killeen N, Lenardo MJ . The TNF and TNF receptor superfamilies: integrating mammalian biology . Cell 2001 ;104:487-501 Loke SL, Stein CA, Zhang XH, Mori K, Nakanishi M, Subasinghe C, Cohen JS, Neckers LM. Characterization of oligonucleotide transport into living cells . Proc Natl Acad Sci USA 1989;86 :3474-8 Lovec H, Grzeschiczek A, Kowalski MB, Moroy T . Cyclin DI/bcl-1 cooperates with myc genes in the generation of B-cell lymphoma in transgenic mice . EMBO J 1994;13 :3487-95 Lu F, Gladden AB, Diehl JA . An alternatively spliced cyclin D1 isoform, cyclin D 1 b, is a nuclear oncogene . Cancer Res 2003 ;63 :7056-61 MacLennan IC, Liu YJ, Oldfield S, Zhang J, Lane PJ . The evolution of B-cell clones. Curr Top Microbiol Immunol 1990 ;159:37-63 MacLennan IC. Germinal Centers. Annu Rev Immunol 1994 ;12 :117-39 Maier M, Bleicher K, Kalthoff H, Bayer E . Enzymatic degradation of various antisense oligonucleotides : monitoring and fragment identification by MECC and ES-MS . Biomed Pept Proteins Nucleic Acids 1995 ;1 :235-42 Manches 0, Lui G, Chaperot L, Gressin R, Molens JP, Jacob MC, Sotto JJ, Leroux D, Bensa JC, Plumas J . In vitro mechanisms of action of rituximab on primary non-Hodgkin lymphomas . Blood 2003 ;101 :949-54  159  Mangel J, Buckstein R, Imrie K, Spaner D, Crump M, Tompkins K, Reis M, PerezOrdonez B, Deodhare S, Romans R, Pennell N, Robinson JB, Hewitt K, Richardson P, Lima A, Pavlin P, Berinstein NL . Immunotherapy with rituximab following high-dose therapy and autologous stem-cell transplantation for mantle cell lymphoma . Semin Oncol 2002 ;29(1 Suppl 2) :56-69 Martinez J, Patkaniowska A, Urlaub H, Luhrmann R, Tuschl T . Single-stranded antisense siRNAs guide target RNA cleavage in RNAi . Cell 2002 ;110 :563-74 Martinez-Lorenzo MJ, Anel A, Gamen S, Monlen I, Lasierra P, Larrad L, Pineiro A, Alava MA, Naval J. Activated human T cells release bioactive Fas ligand and APO2 ligand in microvesicles . J immunol 1999 ;163:1274-81 Martinez-Valdez H, Guret C, de Bouteiller 0, Fugier I, Banchereau J, Liu YJ. Human germinal center B cells express the apoptosis-inducing genes Fas, c-myc, p53, and Bax but not the survival gene bcl-2 . J Exp Med 1996 ;183 :971-7 Matsushime fl, Roussel MF, Sherr CJ . Novel mammalian cyclins (CYL genes) expressed during G1 . Cold Spring Harb Symp Quant Biol 1991 ;56:69-74 Mayo LD, Donner DB . A phosphatidylinositol 3-kinase/Akt pathway promotes translocation of mdm2 from the cytoplasm to the nucleus . Proc Natl Acad Sci USA 2001 ;98 :11598-603 Mayor S, Rao M . Rafts: scale-dependent, active lipid organization at the cell surface. Traffic 2004 ;5 :231-40 McDonnell TJ, Deane N, Platt FM, Nunez G, Jaeger U, McKearn JP, Korsmeyer SJ. Bcl-2-immunoglobulin transgenic mice demonstrate extended B cell survival and follicular lymphoproliferation . Cell 1989 ;57:79-88. McGarry TJ, Kirschner MW . Geminin, an inhibitor of DNA replication, is degraded during mitosis . Cell 1998 ;93 :1043-53 McLaughlin P, Grillo-Lopez AJ, Link BK, Levy R, Czuczman MS, Williams ME, Heyman MR, Bence-Bruckler I, White CA, Cabanillas F, Jain V, Ho AD, Lister J, Wey K, Shen D, Dallaire BK . Rituximab chimeric anti-CD20 monoclonal antibody therapy for relapsed indolent lymphoma: half of patients respond to a four dose treatment program. J Clin Oncol 1998 ;16:2825-33 Melo JV, Foroni L, Brito-Babapulle V, Luzzatto L, Catovsky D . The establishment of cell lines from chronic B cell leukemias : evidence of leukaemic origin by karyotypic abnormalities and Ig gene rearrangement . Clin Exp Immunol 1988 ;73 :23-8 Meusers P, Hense J, Brittinger G . Mantle cell lymphoma : diagnostic criteria, clinical aspects and therapeutic problems . Leukemia 1997 ;11 Suppl 2 :560-4  160  Meusers P, Hense J . Management of mantle cell lymphoma . Ann Hematol 1999 ;78 :48594 Missailidis S, Perkins A. Update: aptamers as novel radiopharmaceuticals : their applications and future prospects in diagnosis and therapy. Cancer Biother Radiopharm 2007;22 :453-68 Mitsiades CS, Poulaki V, Fanourakis G, Sozopoulos E, McMillin D, Wen Z, Voutsinas G, Tseleni-Balafouta S, Mitsiades N . Fas signaling in thyroid carcinomas is diverted from apoptosis to proliferation . Clin Cancer Res 2006 ;12 :3705-12 Miyashita T, Reed JC . Tumor suppressor p53 is a direct transcriptional activator of the human bax gene . Cell 1995 ;80 :293-9 M'Kacher R, Farace F, Bennaceur-Griscelli A, Violot D, Clausse B, Dossou J, Valent A, Parmentier C, Ribrag V, Bosq J, Carde P, Turhan AG, Bernheim A . Blastoid mantle cell lymphoma : evidence for nonrandom cytogenetic abnormalities additional to t(l 1 ;14) and generation of a mouse model . Cancer Genet Cytogenet 2003 ;143 :32-8 Monia BP, Johnston JF, Geiger T, Muller M, Fabbro D . Antitumor activity of a phosphorothioate antisense oligodeoxynucleotide . Nat Med 1996 ;2:668-75 Motokura T, Bloom T, Kim HG, Juppner H, Ruderman JV, Kronenberg HM, Arnold A. A novel cyclin encoded by a bcl- l -linked candidate oncogene . Nature 1991 ;350:512-5 Muller AMS, Ihorst G, Mertelsmann R, Engelhardt M . Epidemiology of non-Hodgkin's lymphoma (NHL) : trends, geographic distribution, and etiology . Ann Hematol 2005;84:1-12 Murchison EP, Hannon GJ . miRNAs on the move : miRNA biogenesis and the RNAi machinery. Curr Opin Cell Biol 2004 ;16:223-9 Nagata S, Golstein P . The Fas death factor . Science 1995 ;267 :1449-56 Nguyen DT, Amess JA, Doughty H, Hendry L, Diamond LW . IDEC-C2B8 anti-CD20 (rituximab) immunotherapy in patients with low-grade non-Hodgkin's lymphoma and lymphoproliferative disorders : evaluation of response on 48 patients . Eur J Haematol 1999 ;62 :76-82 Nishida N, Fukuda Y, Komeda T, Kita R, Sando T, Furukawa M, Amenomori M, Shibagaki I, Nakao K, Ikenaga M, Ishizaki K. Amplification and overexpression of the cyclin D1 gene in aggressive human hepatocellular carcinoma . Can Res 1994 ;54:310710  161  Nunez G, London L, Hockenbery D, Alexander M, McKearn JP, Korsmeyer SJ. Deregulated Bcl-2 gene expression selectively prolongs survival of growth factordeprived hemopoietic cell lines . J Immunol 1990 ;144:3602-10 Nykanen A, Haley B, Zamore PD . ATP requirements and small interfering RNA structure in the RNA interference pathway . Cell 2001 ;107:309-21 Obermann EC, Eward KL, Dogan A, Paul EA, Loddo M, Munson P, Williams GH, Stoeber K . DNA replication licensing in peripheral B-cell lymphoma . J Pathol 2005 ;205:318-28 Oettgen HC, Bayard PJ, Van Ewijk W, Nadler LM, Terhorst CP . Further biochemical studies of the human B-cell differentiation antigens B1 and B2 . Hybridoma 1983 ;2 :1728 Oinonen R, Franssila K, Teerenhovi L, Lappalainen K, Elonen E . Mantle cell lymphoma: clinical features, treatment and prognosis of 94 patients . Eur J Cancer 1998 ;34:329-36 O'Keefe TL, Williams GT, Davies SL, Neuberger MS . Mice carrying a CD20 gene disruption. Immunogenetics 1998 ;48:125-32 Orr RM. Technology evaluation : fomivirsen, Isis Pharmaceuticals Inc/CIBA vision. Curr Opin Mol Ther 2001 ;3 :288-94 Ott G, Kalla J, Hanke A, Muller JG, Rosenwald A, Katzenberger T, Kretschmar R, Kreipe H, Muller-Hermelink HK . The cytomorphological spectrum of mantle cell lymphoma is reflected by distinct biological features . Leuk Lymphoma 1998 ;32:55-63 Ott MM, Bartkova J, Bartek J, Durr A, Fischer L, Ott G, Muller-Hermelink HK, Kreipe H. Cyclin D1 expression in mantle cell lymphoma is accompanied by donwregulation of cyclin D3 and is not related to the proliferative activity . Blood 1997 ;90:3154-9 Oyarzo MP, Medeiros LJ, Atwell C, Feretzaki M, Leventaki V, Drakos E, Amin HM, Rassidakis GZ . c-Flip confers resistance to Fas-mediated apoptosis in anaplastic largecell lymphoma. Blood 2006;107 :2544-7 Park S, Kim S, Choi J, Hur D, Lee W, Lee M, Choe J, Lee TH . TGF-13 inhibits Fasmediated apoptosis of a follicular dendritic cell line by down-regulating the expression of Fas and caspase-8 : counteracting role of TGF-(3 on TNF sensitization of Fas-mediated apoptosis. J Immunol 2005 ;174:6169-75 Paterson BM, Roberts BE, Kuff EL . Structural gene identification and mapping by DNA-mRNA hybrid-arrested cell-free translation. Proc Natl Acad Sci USA 1977;74:4370-4  162  Paul WE . The Immune system : an Introduction (chapter 1) . In: Paul WE, Merritt J, Seto J, Martin SP, editors . Fundamental Immunology . 5t" edition . Philadelphia, Lippincott Williams & Wilkins ; 2003 : pp 21-22 Pedersen IM, Buhl AM, Klausen P, Geisler CH, Jurlander J . The chimeric anti-CD20 antibody rituximab induces apoptosis in B-cell chronic lymphocytic leukemia cells through a p38 mitogen activated protein-kinase-dependent mechanism . Blood 2002;99:1314-9 Pham LV, Tamayo AT, Yoshimura LC, Lo P, Ford RJ . Inhibition of constitutive NFkappaB activation in mantle cell lymphoma B cells leads to induction of cell cycle arrest and apoptosis. J Immunol 2003 ;171 :88-95 Pinyol M, Cobo F, Bea S, Jares P, Nayach I, Fernandez PL, Montserrat E, Cardesa A, Campo E. p16(INK4a) gene inactivation by deletions, mutations, and hypermethylation is associated with transformed and aggressive variants of non-Hodgkin's lymphomas. Blood 1998 ;91 :2977-84 Pittaluga S, Ayoubi TA, Wlodarska I, Stul M, Cassiman JJ, Mecucci C, Van Den Berghe H, Van De Ven WJ, De Wolf-Peeters C. Bcl-6 expression in reactive lymphoid tissue and in B-cell non-Hodgkin's lymphomas . J Pathol 1996 ;179 :145-50 Plumas J, Jacob MC, Chaperot L, Molens JP, Sotto JJ, Bensa JC . Tumor B cells from non-Hodgkin's lymphoma are resistant to CD95 (Fas/Apo-1)-mediated apoptosis . Blood 1998 ;91 :2875-85 Quintanilla-Martinez L, Thieblemont C, Fend F, Kumar S, Pinyol M, Campo E, Jaffe ES, Raffeld M. Mantle cell lymphomas lack expression of p27kip1 a cyclin-dependent kinase inhibitor . Am J Pathol 1998 ;153 :175-82 Quintanilla-Martinez L, Davies-Hill T, Fend F, Calzada-Wack J, Sorbara L, Campo E, Jaffe ES, Raffeld M . Sequestration of p27k'pl protein by cyclin D1 in typical and blastic variants of mantle cell lymphoma (MCL) : implications for pathogenesis. Blood 2003 ;101 :3181-7 Reed JC, Kitada S, Miyashita T . Regulation of chemoresistance by the bcl-2 oncoprotein in non-Hodgkin's lymphoma and lymphocytic leukemia cell lines . Ann Oncol 1994 ;5 Suppl 1 :S61-5 Reed JC . Double identity for proteins of the Bcl-2 family . Nature 1997;387 :773-6 Reff ME, Carner K, Chambers KS, Chinn PC, Leonard JE, Raab R, Newman RA, Hanna N, Anderson DR . Depletion of B cells in vivo by a chimeric mouse human monoclonal antibody to CD20 . Blood 1994;83 :435-45  163  Rieckmann P, Wilson GL, Thevenin C, Hong JX, Kehrl JH . Analysis of cis-acting elements present in the CD20B 1 antigen promoter . J Immunol 1991 ;147:3994-9 Riley JK, Sliwkowski MX. CD20 : A gene in search of a function. Semin Oncol 2000;27(suppl 12) :17-24 Rimokh R, Berger F, Bastard C, Klein B, French M, Archimbaud E, Rouault JP, Santa Lucia B, Duret L, Vuillaume M, Coiffier B, Bryon PA, Magaud JP . Rearrangement of CCND1 (BCLI/PRAD1) 3'untranslated region in mantle-cell lymphomas and t(l 1g13)associated leukemias . Blood 1994 ;83 :3689-96 Roberts TL, Dunn JA, Terry TD, Jennings MP, Hume DA, Sweet MJ, Stacey KJ. Differences in macrophage activation by bacterial DNA and CpG-containing oligonucleotides. J Immunol 2005 ;175 :3569-76 Rocha S, Martin AM, Meek DW, Perkins ND . p53 represses cyclin D1 transcription through down regulation of bcl-3 and inducing increased association of the p52 NFkappaB subunit with histone deacetylase 1 . Mol Cell Biol 2003 ;23 :4713-27 Rockwell P, O'Connor WJ, King K, Goldstein NI, Zhang LM, Stein CA . Cell-surface perturbations of the epidermal growth factor and vascular endothelial growth factor receptors by phosphorothioate oligodeoxynucleotides . Proc Natl Acad Sci USA 1997 ;94:6523-8 Rosenwald A, Wright G, Wiestner A, Chan WC, Connors JM, Campo E, Gascoyne RD, Grogan TM, Muller-Hermelink HK, Smeland EB, Chiorazzi M, Giltnane JM, Hurt EM, Zhao H, Averett L, Henrickson S, Yang L, Powell J, Wilson WH, Jaffe ES, Simon R, Klausner RD, Montserrat E, Bosch F, Greiner TC, Weisenburger DD, Sanger WG, Dave BJ, Lynch JC, Vose J, Armitage JO, Fisher RI, Miller TP, LeBlanc M, Ott G, Kvaloy S, Holte H, Delabie J, Staudt LM . The proliferation gene expression signature is a quantitative integrator of oncogenic events that predicts survival in mantle cell lymphoma . Cancer Cell 2003 ;3 :185-97 Rudolph C, Steinemann D, Von Neuhoff N, Gadzicki D, Ripperger T, Drexler HG, Mrasek K, Liehr T, Claussen U, Emura M, Schrock E, Schlegelberger B . Molecular cytogenetic characterization of the mantle cell lymphoma cell line Granta-519 . Cancer Genet Cytogenet 2004 ;153 :144-50 Ryan JJ, Prochownik E, Gottlieb CA, Apel IJ, Merino R, Nunez G, Clarke MF . c-myc and bcl-2 modulate p53 function by altering p53 subcellular trafficking during the cell cycle. Proc Natl Acad Sci USA 1994 ;91 :5878-82 Sakai E, Tsuchida N . Most human squamous cell carcinomas in the oral cavity contain mutated p53 tumor-suppressor genes . Oncogene 1992 ;7:927-33  164  Saltman DL, Cachia PG, Dewar AE, Ross FM, Krajewski AS, Ludlam C, Steel CM. Characterization of a new non-Hodgkin's lymphoma cell line (NCEB-1) with a chromosomal (11 :14) translocation [t(11 :14)(g13;g32)] . Blood 1988 ;72:2026-30 Samaha H, Dumontet C, Ketterer N, Moullet I, Thieblemont C, Bouafia F, Callet-Bauchu E, Felman P, Berger F, Salles G, Coiffier B . Mantle cell lymphoma: a retrospective study of 121 cases . Leukemia 1998;12:1281-7 Sanchez-Aguilera A, Delgado J, Camacho FI, Sanchez-Beato M, Sanchez L, Montalban C, Fresno MF, Martin C, Piris MA, Garcia JF . Silencing of the pl8INK4c gene by promoter hypermethylation in Reed-Sternberg cells in Hodgkin lymphomas . Blood 2004;103 :2351-7 Sata M, Walsh K . Endothelial cell apoptosis induced by oxidized LDL is associated with the down-regulation of the cellular caspase inhibitor FLIP . J Biol Chem 1998 ;273 :33103-6 Scaffidi C, Fulda S, Srinivasan A, Friesen C, Li F, Tomaselli KJ, Debatin KM, Krammer PH, Peter ME. Two CD95 (APO-1/Fas) signaling pathways . EMBO J 1998 ;17:1675-87 Schlee M, Hornung V, Hartmann G . siRNA and isRNA : two edges of one sword . Mol Ther 2006 ;14:463-70 Schmitz R, Renne C, Rosenquist R, Tinguely M, Distler V, Menestrina F, Lestani M, Stankovic T, Austen B, Brauninger A, Hansmann ML, Kuppers R . Insights into the multistep transformation process of lymphomas : IgH-associated translocations and tumor suppressor gene mutations in clonally related composite Hodgkin's and non-Hodgkin's lymphomas. Leukemia 2005 ;19:1452-8 Schneider P, Holler N, Bodmer JL, Hahne M, Frei K, Fontana A, Tschopp J . Conversion of membrane-bound Fas(CD95) ligand to its soluble form is associated with downregulation of its proapoptotic activity and loss of liver toxicity . J Exp Med 1998 ;187 :1205-13 Schuuring E, Verhoeven E, Mooi WJ, Michalides RJ . Identification and cloning of two overexpressed genes, U2 1 B31 /PRAD 1 and EMS 1, within the amplified chromosome 11q13 region in human carcinomas . Oncogene 1992 ;7 :355-61 Schwer B. A new twist on RNA helicases : DExH/D box proteins as RNPases . Nat Struct Biol 2001 ;8:113-6 Seto M, Yamamoto K, Iida S, Akao Y, Utsumi KR, Kubonishi I, Miyoshi I, Ohtsuki T, Yawata Y, Namba M, Motokura T, Arnold A, Takahashi T, Ueda R . Gene rearrangement and overexpression of PRAD 1 in lymphoid malignancy with t(11 ;14)(g13 ;g32) translocation . Oncogene 1992 ;7:1401-6  165  Shan D, Ledbetter JA, Press OW. Apoptosis of malignant human B cells by ligation of CD20 with monoclonal antibodies . Blood 1998;91 :1644-52 Shan D, Ledbetter JA, Press OW . Signaling events involved in anti-CD20-induced apoptosis of malignant human B cells . Cancer Immunol Immunother 2000 ;48:673-83 Shen Y, Iqbal J, Huang JZ, Zhou G, Chan WC . Bcl-2 protein expression parallels its mRNA level in normal and malignant B cells . Blood 2004 ;104 :2936-9 Sherr CJ. Gl phase progression: cycling on cue . Cell 1994 ;79:551-5 Sherr CJ. Cancer cell cycles. Science 1996;274:1672-7 Sherr CJ, Roberts JM . CDK inhibitors: positive and negative regulators of G1-phase progression . Genes Dev 1999;13 :1501-12 Shin MS, Park WS, Kim SY, Kim HS, Kang SJ, Song KY, Park JY, Dong SM, Pi JH, Oh RR, Lee JY, Yoo NJ, Lee SH . Alterations of Fas (Apo-1/CD95) gene in cutaneous malignant melanoma . Am J Pathol 1999 ;154 :1785-91 Sinclair AJ, Palmero I, Holder A, Peters G, Farrell PJ . Expression of cyclin D2 in Epstein-Barr virus-positive Burkitt's lymphoma cell lines is related to methylation status of the gene . J Virol 1995 ;69:1292-5 Smith MR . Rituximab (monoclonal anti-CD20 antibody) : mechanisms of action and resistance. Oncogene 2003 ;22 :7359-68 Song JJ, Liu J, Tolia NH, Schneiderman J, Smith SK, Martienssen RA, Hannon GJ, Joshua-Tor L . The crystal structure of the Argonaute2 PAZ domain reveals an RNA binding motif in RNAi effector complexes . Nat Struct Biol 2003 ;10 :1026-32 Spriggs MK, Armitage RJ, Strockbine L, Clifford KN, Macduff BM, Sato TA, Maliszewski CR, Fanslow WC . Recombinant human CD40 ligand stimulates B cell proliferation and immunoglobulin E secretion . J Exp Med 1992 ;176 :1543-50 Stamatopoulos K, Kosmas C, Belessi C, Kyriazopoulos P, Papadaki T, Anagnostou D, Loukopoulos D . Molecular analysis of bcl-1/IgH junctional sequences in mantle cell lymphoma : potential mechanism of the t(11 ;14) chromosomal translocation. Br J Haematol 1999 ;105:190-7 Stashenko P, Nadler LM, Hardy R, Schlossman SF . Characterization of a human B lymphocyte-specific antigen . J Immunol 1980 ;125 :1678-85 Stein CA, Tonkinson JL, Zhang LM, Yakubov L, Gervasoni J, Taub R, Rotenberg SA. Dynamics of the internalization of phosphodiester oligonucleotides in HL60 cells. Biochemistry 1993 ;32 :4855-61  166  Stel AJ, Ten Cate B, Jacobs S, Kok JW, Spierings DC, Dondorff M, Helfrich W, KluinNelemans HC, de Leij LF, Withoff S, Kroesen BJ . Fas receptor clustering and involvement of the death receptor pathway in rituximab-mediated apoptosis with concomitant sensitization of lymphoma B cells to Fas-induced apoptosis . J Immunol 2007;178:2287-95 Suzuki E, Umezawa K, Bonavida B . Rituximab inhibits the constitutively activated PI3K-Akt pathway in B-NHL cell lines : involvement in chemosensitization to druginduced apoptosis. Oncogene 2007 ;26 :6184-93 Swerdlow SH, Zukerberg LR, Yang WI, Harris NL, Williams ME . The morphologic spectrum of non-Hodgkin's lymphomas with BCL1/cyclin D1 gene rearrangements . Am J Surg Pathol 1996 ;20 :627-40 Swerdlow SH, Berger F, Isaacson PI, Muller-Hermelink HK, Nathwani BN, Piris MA, Harris NL . Mantle cell lymphoma . In: Jaffe ES, Harris NL, Stein H, Vardiman JW, editors. World Health Organization classification of tumors . Pathology and genetics of tumours of haematopoietic and lymphoid tissues . Lyon, France: IARC Press ; 2001 . p168170 Swerdlow SH, Williams ME . From centrocytic to mantle cell lymphoma : a clinicopathologic and molecular review of 3 decades . Hum Pathol 2002 ;33 :7-20 Szollosi J, Horejsi V, Bene L, Angelisova P, Damjanovich S . Supramolecular complexes of MHC class I, MHC class II, CD20 and tetraspan molecules (CD53, CD81, and CD82) at the surface of a B cell line JY . J Immunol 1996 ;157 :2939-46 Tahbaz N, Kolb FA, Zhang H, Jaronczyk K, Filipowicz W, Hobman TC. Characterization of the interactions between mammalian PAZ PIWI domain proteins and Dicer. EMBO Rep 2004 ;5 :189-94 Takei K, Yamazaki T, Sawada U, Ishizuka H, Aizawa S . Analysis of changes in CD20, CD55, and CD59 expression on established rituximab-resistant B-lymphoma cell lines. Leuk Res 2006 ;30 :625-31 Tanaka M, Suda T, Takahashi T, Nagata S . Expression of the functional soluble form of human Fas ligand in activated lymphocytes . EMBO J 1995 ;14 :1129-35 Tang G . siRNA and miRNA : an insight into RISCS . Trends Biochem Sci 2005 ;30:10614 Taniwaki M, Nishida K, Ueda Y, Misawa S, Nagai M, Tagawa S, Yamagami T, Sugiyama H, Abe M, Fukuhara S, Kashima K. Interphase and metaphase detection of the breakpoint of 14g32 translocations in B-cell malignancies by double-color fluorescence in situ hybridization. Blood 1995 ;85 :3223-8  167  Tedder TF, Boyd AW, Freedman AS, Nadler LM, Schlossman SF . The B cell surface molecule B1 is functionally linked with B cell activation and differentiation . J Immunol 1985 ;135:973-9 Tedder TF, Streuli M, Schlossman SF, Saito H . Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes . Proc Natl Acad Sci USA 1988a;85 :208-12 Tedder TF, Klejman G, Disteche CM, Adler DA, Schlossman SF, Saito H . Cloning of a complementary DNA encoding a new mouse B lymphocyte differentiation antigen, homologous to the human B1 (CD20) antigen, and localization of the gene to chromosome 19. J Immunol 1988b ;141 :4388-94 Tedder TF, McIntyre G, Schlossman SF . Heterogeneity in the B1(CD20) cell surface molecule expressed by human B-lymphocytes. Mol Immunol 1988c ;25:1321-30 Tedder TF, Schlossman SF . Phosphorylation of the B1 (CD20) molecule by normal and malignant human B lymphocytes . J Biol Chem 1988 ;263 :10009-15 Tedder TF, Disteche CM, Louie E, Adler DA, Croce CM, Schlossman SF, Saito H . The gene that encodes the human CD20 (B 1) differentiation antigen is located on chromosome 11 near the t(11 ;14)(g13 ;g32) translocation site . J Immunol 1989 ;142;2555-9 Tedder TF, Engel P. CD20: a regulator of cell-cycle progression of B lymphocytes. Immunol Today 1994 ;15 :450-4 Thevenin C, Lucas BP, Kozlow EJ, Kehrl JH . Cell type- and stage-specific expression of the CD20/B1 antigen correlates with the activity of a diverged octamer DNA motif present in its promoter. J Biol Chem 1993 ;268:5949-56 Thieblemont C, Coiffier B . Lymphoma in older patients . J Clin Oncol 2007 ;25 :1916-23 Thornberry NA, Lazebnik Y . Caspases : enemies within . Science 1998;281 :1312-6 Tock MR, Dryden DT . The biology of restriction and anti-restriction . Curr Opin Microbiol 2005 ;8 :466-72 Torcia M, De Chiara G, Nencioni L, Ammendola S, Labardi D, Lucibello M, Rosini P, Marlier LN, Bonini P, Dello Sbarba P, Palamara AT, Zambrano N, Russo T, Garaci E, Cozzolino F. Nerve growth factor inhibits apoptosis in memory B lymphocytes via inactivation of p38 MAPK, prevention of bcl-2 phosphorylation, and cytochrome c release. J Biol Chem 2001 ;276:39027-36  168  Tracey L, Perez-Rosado A, Artiga MJ, Camacho FI, Rodriguez A, Martinez N, RuizBallesteros E, Mollejo M, Martinez B, Cuadros M, Garcia JF, Lawler M, Piris MA. Expression of the NF-kappaB targets BCL2 and BIRC5/Survivin characterizes small Bcell and aggressive B-cell lymphomas, respectively . J Pathol 2005 ;206 :123-34 Treon SP, Mitsiades C, Mitsiades N, Young G, Doss D, Schlossman R, Anderson KC. Tumor cell expression of CD59 is associated with resistance to CD20 serotherapy in patients with B-cell malignancies . J Immunother 2001 ;24 :263-71 Tsujimoto Y, Yunis J, Onorato-Showe L, Erikson J, Nowell PC, Croce CM . Molecular cloning of the chromosomal breakpoint of B-cell lymphomas and leukemias with the t(11 ;14) chromosome translocation . Science 1984;224 :1403-6 Tsujimoto Y . Bcl-2 family of proteins : life-or-death switch in mitochondria . Biosci Rep 2002 ;22:47-58 Tsujimoto Y . Cell death regulation by the bcl-2 protein family in the mitochondria . J Cell Physiol 2003 ;195 :158-67 Tsutsui S, Yasuda K, Suzuki K, Takeuchi H, Nishizaki T, Higashi H, Era S . Bcl-2 protein expression is associated with p27 and p53 protein expression and MIB- 1 counts in breast cancer . BMC Cancer 2006 ;6:187 Tucker CA, Bebb G, Klasa RJ, Chhanabhai M, Lestou V, Horsman DE, Gascoyne RD, Wiestner A, Masin D, Bally M, Williams ME . Four human t(11 ;14)(g13 ;g32)-containing cell lines having classic and variant features of Mantle Cell Lymphoma . Leuk Res 2006 ;30 :449-57 Unruh TL, Li H, Mutch CM, Shariat N, Griogoriou L, Sanyal R, Brown CB, Deans JP. Cholesterol depletion inhibits src family kinase-dependent calcium mobilization and apoptosis induced by rituximab crosslinking . Immunology 2005 ;116:223-32 Valentine MA, Cotner T, Gaur L, Torres R, Clark EA . Expression of the human B-cell surface protein CD20 : Alteration by phorbol 12-myristate 13-acetate . Proc Natl Acad Sci U S A 1987;84 :8085-9 Valentine MA, Meier KE, Rossie S, Clark EA . Phosphorylation of the CD20 phosphoprotein in resting B lymphocytes . Regulation by protein kinase C . J Biol Chem 1989;264 :11282-7 Valentine MA, Licciardi KA, Clark EA, Krebs EG, Meier KE . Insulin regulates serine/threonine phosphorylation in activated human B lymphocytes . J Immunol 1993;150:96-105  169  Van der Kolk LE, Grillo-Lopez AJ, Baars JW, Hack CE, van Oers MH . Complement activation plays a key role in the side-effects of rituximab treatment . Br J Haematol 2001 ;115 :807-11 Van Eijk M, Defrance T, Hennino A, de Groot C . Death-receptor contribution to the germinal-center reaction . Trends Immunol 2001 ;22 :677-82 Van Meerten T, van Rijn RS, Hol S, Hagenbeek A, Ebeling SB . Complement-induced cell death by rituximab depends on CD20 expression level and acts complementary to antibody-dependent cellular cytotoxicity . Clin Can Res 2006 ;12:4027-35 Vega MI, Huerta-Yepez S, Jazirehi AR, Garban H, Bonavida B . Rituximab (chimeric anti-CD20) sensitizes B-NHL cell lines to Fas-induced apoptosis . Oncogene 2005a;24:8114-27 Vega MI, Jazirehi AR, Huerta-Yepez S, Bonavida B . Rituximab-induced inhibition of YY1 and bcl-xL expression in Ramos non-Hodgkin's lymphoma cell line via inhibition of NF-kappaB activity : role of YY1 and bcl-x L in Fas resistance and chemoresistance, respectively. J of Immunol 2005b ;175 :2174-83 Verbeke CS, Wenthe U, Zentgraf H . Fas ligand expression in the germinal centre . J Pathol 1999 ;189:155-60 Verreault M, Webb MS, Ramsay EC, Bally MB . Gene silencing in the development of personalized cancer treatment : the targets, the agents and the delivery systems . Curr Gene Ther 2006 ;6 :505-33 Villalonga P, Rius E, Bachs 0, Agell N . [Lys6l]N-Ras is able to induce full activation and nuclear accumulation of Cdk4 in NIH3T3 cells . Oncogene 2000 ;19 :690-9 Visser HP, Tewis M, Willemze R, Kluin-Nelemans JC . Mantle cell lymphoma proliferates upon IL-10 in the CD40 system . Leukemia 2000 ;14:1483-9 Walsh K, Sata M . Is extravasation a Fas-regulated process? Mol Med Today 1999 ;61-7 Wang HG, Rapp UR, Reed JC . Bcl-2 targets the protein kinase Raf-1 to mitochondria. Cell 1996 ;87:629-38 Wang S, El-Deiry WS . TRAIL and apoptosis induction by TNF-family death receptors. Oncogene 2003 ;22 :8628-33 Wang TC, Cardiff RD, Zukerberg L, Lees E, Arnold A, Schmidt EV . Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice . Nature 1994 ;369:66971  170  Wang Y, Patel DJ . Solution structure of a parallel-stranded G-quadruplex DNA . J Mol Biol 1993 ;234:1171-83 Weintraub SJ, Chow KN, Luo RX, Zhang SH, He S, Dean DC . Mechanism of active transcriptional repression by the retinoblastoma protein . Nature 1995 ;375 :812-5 Weng WK, Levy R . Expression of complement inhibitors CD46, CD55 and CD59 on tumor cells does not predict clinical outcome after rituximab treatment in follicular nonHodgkin lymphoma . Blood 2001 ;98 :1352-7 Weng WK, Levy R . Two immunoglobulin G fragment C receptor polymorphisms independently predict response to rituximab in patients with follicular lymphoma . J Clin Oncol 2003 ;21 :3940-7 Whitesell L, Rosolen A, Neckers LM . In vivo modulation of N-myc expression by continuous perfusion with an antisense oligonucleotide . Antisense Res Dev 1991 ;1 :34350 Wiestner A, Tehrani M, Chiorazzi M, Wright G, Gibellini F, Nakayama K, Liu H, Rosenwald A, Muller-Hermelink HK, Ott G, Chan WC, Greiner TC, Weisenburger DD, Vose J, Armitage JO, Gascoyne RD, Connors JM, Campo E, Montserrat E, Bosch F, Smeland EB, Kvaloy S, Holte H, Delabie J, Fisher RI, Grogan TM, Miller TP, Wilson WH, Jaffe ES, Staudt LM . Point mutations and genomic deletions in cyclin Dl create stable truncated mRNAs that are associated with increased proliferation rate and shorter survival in mantle cell lymophoma . Blood 2007 ;109 :4599-606 Williams ME, Whitefield M, Swerdlow SH. Analysis of the cyclin-dependent kinase inhibitors p18 and p19 in mantle-cell lymphoma and chronic lymphocytic leukemia . Ann Oncol 1997 ;8 Supp12 : S71-3 Williams ME, Densmore JJ, Pawluczkowycz AW, Beum PV, Kennedy AD, Lindorfer MA, Hamil SH, Eggleton JC, Taylor RP . Thrice-weekly low-dose Rituximab decreases cd20loss via shaving and promotes enhanced targeting in chronic lymphocytic leukemia. J Immunol 2006 ;177:7435-43 Winston JT, Coats SR, Wang YZ, Pledger WJ . Regulation of the cell cycle machinery by oncogenic ras. Oncogene 1996 ;12:127-34 Withers DA, Harvey RC, Faust JB, Melnyk 0, Carey K, Meeker TC . Characterization of a candidate bcl-1 gene . Mol Cell Biol 1991 ;11 :4846-53 Wojciechowski W, Li H, Marshall S, Dell'Agnola C, Espinoza-Delgado I . Enhanced expression of CD20 in human tumor B cells is controlled through ERK-dependent mechanisms. J Immunol 2005 ;174:7859-68  171  Wu J, Edberg JC, Redecha PB, Bansal V, Guyre PM, Coleman K, Salmon JE, Kimberly RP. A novel polymorphism of FcgammaRllla (CD16) alters receptor function and predisposes to autoimmune disease. J Clin Invest 1997 ;100 :1059-70 Wu X, Bayle JH, Olson D, Levine AJ. The p53-mdm-2 autoregulatory feedback loop. Genes Dev 1993 ;7:1126-32 Xerri L, Devilard E, Hassoun J, Mawas C, Birg F . Fas ligand is not only expressed in immune privileged human organs but is also coexpressed with Fas in various epithelial tissues. Mol Pathol 1997 ;50 :87-91 Xiao ZX, Ginsberg D, Ewen M, Livingston DM . Regulation of the retinoblastoma protein-related p107 by GI cyclin-associated kinases . Proc Natl Acad Sci USA 1996 ;93 :4633-7 Yatabe Y, Suzuki R, Tobinai K, Matsuno Y, Ichinohasama R, Okamoto M, Yamaguchi M, Tamaru J, Uike N, Hashimoto Y, Morishima Y, Suchi T, Seto M, Nakamura S. Significnace of cyclin D1 overexpression for the diagnosis of mantle cell lymphoma : a clinicopathologic comparison of cyclin Dl-positive and cyclin D1 -negative MCL-like Bcell lymphoma. Blood 2000;95:2253-61 Yeung ML, Bennasser Y, Le SY, Jeang KT . siRNA, miRNA and HIV : promises and challenges. Cell Res 2005 ;15 :935-46 Yu D, Kandimalla ER, Bhagat L, Tang JY, Cong Y, Tang J, Agrawal S . `Immunomers'novel 3 '-3' –linked CpG oligodeoxyribonucleotides as potent immunomodulatory agents. Nucleic Acids Res 2002 ;30:4460-9 Zamecnik PC, Stephenson ML . Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide . Proc Natl Acad Sci USA 1978;75 :280-4 Zamore PD, Tuschl T, Sharp PA, Bartel DP . RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals . Cell 2000 ;101 :2533 Zhou P, Qian L, Kozopas KM, Craig RW . Mcl-1, a bcl-2 family member, delays the death of hematopoietic cells under a variety of apoptosis-inducing conditions . Blood 1997;89 :630-43 Zoratti M, Szabo I . The mitochondrial permeability transition . Biochim Biophys Acta 1995 ;1241 :139-76 Zucca E, Stein H, Coiffier B . European Lymphoma Task Force (ELTF) : Report of the workshop on mantle cell lymphoma (MCL) . Ann Oncol 1994 ;5 :507-11  172  Zucca E, Roggero E, Pinotti G, Pedrinis E, Cappella C, Venco A, Cavalli F . Patterns of survival in mantle cell lymphoma. Ann Oncol 1995 ;6:257-62  173    APPENDICES Appendix A Animal Care Certificate  The University of British Columbia  Animal Care Certificate Application Number : A05-0792 Investigator or Course Director : Marcel  B Bally  Department : Medicine, Department of Animals Approved : Start Date :  Mice Rag2M 548  May 2, 2005  Approval Date : January 23, 2006  Funding Sources: Funding Agency :  Canadian Institutes of Health Research  Funding Title:  Assessing the molecular consequences of novel therapeutic strategies directed against cyclin D1, bcl-2 and other specific targets in a new murine model of mantle cell lymphoma  Unfunded title:  N/A  The Animal Care Committee has examined and approved the use of animals for the above experimental project. This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures . Annual review is required by the CCAC and some granting agencies.  A copy of this certificate must be displayed in your animal facility  Office of Research Services and Administration 102, 6190 Agronomy Road, Vancouver, V6T 1Z3 Phone : 604-827-5111 Fax : 604-822-5093  174  Appendix B Biohazard Approval Certificate  The University of British Columbia  Biohazard Approval Certificate H05-0189  PROTOCOL NUMBER :  INVESTIGATOR OR COURSE DIRECTOR : DEPARTMENT :  Wasan, Ellen  Pathology & Laboratory Med  PROJECT OR COURSE TITLE: Development of a novel formulation of Uposomal econazole as an anticancer agent APPROVAL DATE :  06-02-23  APPROVED CONTAINMENT LEVEL : FUNDING AGENCY :  2  Canadian Institutes of Health Research  The Principal Investigator/Course Director is responsible for ensuring that all research or course work invoking biological hazards is conducted in accordance with the Health Canada, Laboratory Biosafety Guidelines, (2nd Edition 1996) . Copies of the Guidelines (1996) are available through the Biosafety Office, Department of Health, Safety and Environment, Room 50 - 2075 Wesbrook Mall, UBC, Vancouver, BC, V6T 1Z1, 822-7596, Fax: 822-6650.  R k Approval of the UBC Biohazards Committee by one of Chair, Biosafety Committee Manager, Biosafety Ethics Director, Office of Research Services  This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures . Annual review is required.  A copy of this certificate must be displayed in your facility.  Office of Research Services 102, 6190 Agronomy Road, Vancouver, V6T 1Z3 Phone: 604-627-5111 FAX : 604-622.5093  175  Appendix C Submissions  Chapter 3 — A version of this chapter has been published . Tucker CA, Bebb G, Klasa RJ, Chhanabhai M, Lestou V, Horsman DE, Gascoyne RD, Wiestner A, Masin D, Bally M, Williams ME . Four human t(11 ;14)(gl3 ;g32)-containing cell lines having classic and variant features of Mantle cell lymphoma. Leukemia Research 2006 ;30:449-457 Chapter 4- A version of this chapter has been accepted for publication pending revisions. Tucker CA, Kapanen Al, Chikh G, Hoffman BG, Kyle AH, Wilson I, Masin D, Gascoyne RD, Bally M, Klasa RJ . Silencing bcl-2 in models of Mantle cell lymphoma correlates with a loss in cyclin DI a expression but not cyclin D1 b and is associated with decreases in NFkappaB, p53, bax, and p27 levels . Molecular Cancer Therapeutics (accepted pending revisions)  Chapter 5- A version of this chapter will be submitted for publication . Tucker CA, Chikh G, Kyle AH, Hoffman BG, Kapanen Al, Minchinton Al, Gascoyne RD, Bebb G, Klasa RJ, Bally MB . Abnormal expression of soluble and membrane bound Fas ligand in Mantle cell lymphoma: potential for resistance to Fas-mediated cell death and immune evasion . (to be submitted)  176  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066427/manifest

Comment

Related Items