UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Metabolic engineering of industrial yeast strains to minimize the production of ethyl carbamate in grape.. Dahabieh, Matthew Solomon 2008-04-30

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
24-ubc_2008_fall_dahabieh_matthew.pdf [ 1.9MB ]
Metadata
JSON: 24-1.0066389.json
JSON-LD: 24-1.0066389-ld.json
RDF/XML (Pretty): 24-1.0066389-rdf.xml
RDF/JSON: 24-1.0066389-rdf.json
Turtle: 24-1.0066389-turtle.txt
N-Triples: 24-1.0066389-rdf-ntriples.txt
Original Record: 24-1.0066389-source.json
Full Text
24-1.0066389-fulltext.txt
Citation
24-1.0066389.ris

Full Text

METABOLIC ENGINEERING OF INDUSTRIAL YEAST STRAINS TO MINIMIZE THE PRODUCTION OF ETHYL CARBAMATE IN GRAPE AND SAKE WINE  by  MATTHEW SOLOMON DAHABIEH B.Sc. Hon., The University of British Columbia, 2006   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE FACULTY OF GRADUTATE STUDIES (Genetics)     THE UNIVERISTY OF BRITISH COLUMBIA (Vancouver)  April 2008 ©Matthew Solomon Dahabieh, 2008 ii  ABSTRACT  During alcoholic fermentation Saccharomyces cerevisiae metabolizes L‐arginine to ornithine and urea. S. cerevisiae can metabolize urea through the action of urea amidolyase, encoded by the DUR1,2 gene; however, DUR1,2 is subject to nitrogen catabolite repression (NCR) in the presence of high quality nitrogen sources during fermentation. Being cytotoxic at high concentrations, urea is exported into wine where it spontaneously reacts with ethanol, and forms the carcinogen ethyl carbamate (EC).  Urea degrading yeast strains were created by integrating a linear cassette containing the DUR1,2 gene under the control of the S. cerevisiae PGK1 promoter and terminator signals into the URA3 locus of the Sake yeast strains K7 and K9. The ‘self‐cloned’ strains K7EC‐ and K9EC‐ produced Sake wine with 68% less EC. The Sake strains K7EC‐ and K9EC‐ did not efficiently reduce EC in Chardonnay wine due to the evolutionary adaptation of said strains to the unique nutrients of rice mash; therefore, the functionality of  engineered  yeasts  must  be  tested  in  their  niche  environments  as  to  correctly  characterize  new strains.  S. cerevisiae possesses an NCR controlled high affinity urea permease (DUR3). Urea importing yeast strains were created by integrating a linear cassette containing the DUR3 gene under the control of the PGK1 promoter and terminator signals into the TRP1 locus of the yeast strains K7 (Sake) and 522 (wine). In Chardonnay wine, the urea importing strains K7D3 and 522D3 reduced EC by 7% and 81%, respectively; reduction by these strains was equal to reduction by the urea degrading strains K7EC‐ and 522EC‐.  In  Sake  wine,  the  urea  degrading  strains  K7EC‐  and  522EC‐  reduced  EC  by  87%  and  84% respectively, while the urea importing strains K7D3 and 522D3 were significantly less capable of reducing EC (15% and 12% respectively). In Chardonnay and Sake wine, engineered strains that constitutively co‐expressed DUR1,2 and DUR3 did not reduce EC more effectively than strains in which either gene was expressed solely. Uptake of 14C‐urea under non‐inducing conditions was enhanced in urea importing strains; parental strains failed to incorporate any 14C‐urea thus confirming the functionality of the urea permease derived from the integrated DUR3 cassette. iii  TABLE OF CONTENTS ABSTRACT ...................................................................................................................................................... ii TABLE OF CONTENTS .................................................................................................................................... iii LIST OF TABLES .............................................................................................................................................. x LIST OF FIGURES .......................................................................................................................................... xii LIST OF ABBREVIATIONS .............................................................................................................................. xv ACKNOWLEDGEMENTS .............................................................................................................................. xix 1 INTRODUCTION ......................................................................................................................................... 1 1.1 Saccharomyces cerevisiae ............................................................................................................ 1 1.2 Yeast strains from nature vs. laboratory yeasts ........................................................................... 3 1.3 S. cerevisiae and industry: Wine yeasts ....................................................................................... 5 1.4 Winemaking and Sake brewing .................................................................................................... 6 1.5 Aspergillus oryzae and its role in Sake brewing ......................................................................... 10 1.6 Yeast nitrogen metabolism during alcoholic fermentation ....................................................... 11 1.7 Nitrogen metabolism and Nitrogen Catabolite Repression (NCR) in S. cerevisiae .................... 12 1.8 Urea and ethyl carbamate (EC) .................................................................................................. 16 1.9 The EC problem .......................................................................................................................... 17 1.9.1 The EC problem: History ............................................................................................... 17 1.9.2 The EC problem: Surveys of EC in alcoholic beverages ................................................ 18 1.9.3 The EC problem: Current methods of lowering EC ....................................................... 19 1.9.3.1 Agricultural methods ....................................................................................... 19 1.9.3.2 Additives (acid urease) .................................................................................... 20 1.9.3.3 Additives (DAP) ................................................................................................ 20 iv  1.9.3.4 Genetic engineering (urease expression) ........................................................ 20 1.9.3.5 Genetic engineering (CAR1) ............................................................................. 20 1.9.3.6 Genetic engineering (DUR1,2) ......................................................................... 21 1.9.4 Alternative methods for EC reduction .......................................................................... 22 1.10 Introduction to DUR3: Role in the cell (urea transport, polyamines, boron) .......................... 23 1.11 Proposed Research ................................................................................................................... 25 1.11.1 Significance of Research ............................................................................................. 25 1.11.2 Hypotheses ................................................................................................................. 25 1.11.2.1  The  metabolically  engineered  Sake  yeast  strains  K7EC‐  and  K9EC‐  should reduce EC efficiently during Sake brewing trials. ........................................... 25 1.11.2.2 Constitutive co‐expression of DUR1,2 and DUR3 in metabolically engineered yeasts should result in synergistic EC reduction. ............................................ 26 1.11.3 Main objectives ........................................................................................................... 26 2 MATERIALS AND METHODS ..................................................................................................................... 27 2.1 Strains, plasmids and genetic cassettes ..................................................................................... 27 2.2 Culture conditions ...................................................................................................................... 28 2.3 Genetic construction of the urea degrading yeasts K7EC‐ and K9EC‐ ........................................... 29 2.3.1 Co‐transformation of the DUR1,2 cassette and pUT332 .............................................. 29 2.3.2 Screening of transformants for the integrated DUR1,2 cassette ................................. 29 2.3.3 Genetic characterization ............................................................................................... 30 2.3.3.1 Southern blot analyses .................................................................................... 30 2.3.3.2 Sequence analysis ............................................................................................ 30 v  2.3.3.3 Analysis of DUR1,2 gene expression by qRT‐PCR ............................................ 31 2.3.3.4 Global gene expression analysis ...................................................................... 32 2.3.4 Phenotypic characterization ......................................................................................... 33 2.3.4.1 Analysis of fermentation rate in Chardonnay must ........................................ 33 2.3.4.2 Analysis of fermentation rate in Sake mash .................................................... 33 2.3.4.3 Analysis of glucose/fructose utilization and ethanol production .................... 34 2.3.5 Functionality analyses ................................................................................................... 35 2.3.5.1 Reduction of EC in Chardonnay wine .............................................................. 35 2.3.5.2 Reduction of EC in Sake wine .......................................................................... 35 2.3.5.3 Quantification of EC in wine by solid phase microextraction and GC/MS ...... 35 2.4 Genetic construction of the urea importing yeasts K7D3, K7EC‐D3, 522D3, and 522EC‐D3 ............... 36 2.4.1 Construction of the DUR3 linear cassette ..................................................................... 36 2.4.1.1 Construction of pHVX2D3 ................................................................................ 36 2.4.1.2 Construction of pHVXKD3 ................................................................................ 37 2.4.1.3 Construction of pUCTRP1 ................................................................................ 38 2.4.1.4 Construction of pUCMD .................................................................................. 39 2.4.2 Sequence analysis of the DUR3 cassette in pUCMD ..................................................... 40 2.4.3  Transformation  of  the  linear  DUR3  cassette  into  S.  cerevisiae  and  selection  of transformants .............................................................................................................. 43 2.4.3.1 Confirmation of integration via colony PCR .................................................... 43 2.4.4 Genetic characterization ............................................................................................... 43 vi  2.4.4.1 Southern blot analyses .................................................................................... 43 2.4.4.2 Analysis of gene expression by northern blotting ........................................... 44 2.4.4.3 Analysis of DUR3 gene expression by qRT‐PCR ............................................... 44 2.4.4.4 Global gene expression analysis ...................................................................... 45 2.4.5 Analysis of urea uptake using 14C‐urea ......................................................................... 45 2.4.6 Phenotypic characterization ......................................................................................... 45 2.4.6.1 Analysis of fermentation rate in Chardonnay must ........................................ 45 2.4.6.2 Analysis of fermentation rate in Sake mash .................................................... 45 2.4.6.3 Analysis for ethanol content  ........................................................................... 45 2.4.7 Functionality of metabolically enhanced yeasts ........................................................... 46 2.4.7.1 Reduction of EC in Chardonnay wine .............................................................. 46 2.4.7.2 Reduction of EC in Sake wine .......................................................................... 46 2.5 Statistical analyses........................................................................................................... 46 3 RESULTS ................................................................................................................................................... 47 3.1 Constitutive expression of DUR1,2 in Sake yeast strains K7 and K9 .......................................... 47 3.1.1 Integration of the linear DUR1,2 cassette into the genomes of Sake yeast strains K7 and K9 .......................................................................................................................... 47 3.1.2 Genetic characterization of K7EC‐ and K9EC‐ ................................................................... 47 3.1.2.1 Correct integration of the DUR1,2 linear cassette into the genomes of K7EC‐ and K9EC‐ .......................................................................................................... 47 3.1.2.2  Sake  strains  K7EC‐  and  K9EC‐  do  not  contain  the  bla  and  Tn5ble  antibiotic resistance markers .......................................................................................... 50 vii  3.1.2.3 Sequence of the DUR1,2 cassette integrated into the genomes of K7EC‐ and K9EC‐ ................................................................................................................. 51 3.1.2.4 Confirmation of constitutive expression of DUR1,2 in K7EC‐ and K9EC‐ by qRT‐PCR .................................................................................................................. 52 3.1.2.5 Effect of the integrated DUR1,2 cassette on the transcriptomes of K7EC‐ and K9EC‐ ................................................................................................................. 53 3.1.3 Phenotypic characterization of K7EC‐ and K9EC‐ ............................................................. 54 3.1.3.1 Fermentation rate of K7EC‐ and K9EC‐ in Chardonnay must .............................. 54 3.1.3.2 Fermentation rate of K7EC‐ and K9EC‐ in Sake mash .......................................... 55 3.1.3.3 Utilization of glucose and fructose and production of ethanol by K7EC‐ and K9EC‐ in Sake wine ............................................................................................ 56 3.1.4 Constitutive expression of DUR1,2 in Sake yeast strains K7EC‐ and K9EC‐ reduces EC in Chardonnay wine by approximately 30% .................................................................... 57 3.1.5 Constitutive expression of DUR1,2 in Sake yeast strains K7EC‐ and K9EC‐ reduces EC in Sake wine by approximately 68% ................................................................................ 58 3.2 Constitutive expression of DUR3 in the Sake yeast strain K7 and the wine yeast strain 522 .... 59 3.2.1 Sequence of pUCMD ..................................................................................................... 59 3.2.2 Integration of the linear DUR3 cassette into the genomes of yeast strains K7, K7EC‐, K9, and K9EC‐ ....................................................................................................................... 63 3.2.3 Genetic characterization of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 ....................................... 63 3.2.3.1 Correct integration of the DUR3 cassette into the genomes of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 .......................................................................................... 63 3.2.3.2  Confirmation  of  constitutive  expression  of  DUR3  in  K7D3  and  K7EC‐D3  by northern blotting ............................................................................................ 66 viii  3.2.3.3 Quantification of constitutive DUR3 expression in K7D3 and K7EC‐D3 by qRT‐PCR ........................................................................................................................ 67 3.2.3.4 Effect of the integrated DUR3 cassette on the transcriptome of K7D3 ............ 68 3.2.4 Recombinant strains K7D3 and K7EC‐D3 exhibit highly enhanced urea uptake ability in conditions of strong NCR ............................................................................................. 69 3.2.5 Recombinant strains K7D3 and K7EC‐D3 exhibit highly enhanced urea uptake ability in conditions of NCR de‐repression ................................................................................. 72 3.2.6 Phenotypic characterization of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 ................................. 75 3.2.6.1 Fermentation rate of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Chardonnay wine ... 75 3.2.6.2 Ethanol production by K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Chardonnay wine . 77 3.2.6.3 Fermentation rate of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Sake wine ............... 77 3.2.6.4 Ethanol production by K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Sake wine ............. 79 3.2.7  Constitutive  expression  of  DUR3  in  yeast  strains  K7D3  and  522D3  reduces  EC  in Chardonnay wine by 24.97% and 81.38%, respectively .............................................. 79 3.2.8 Constitutive expression of DUR3 in yeast strains K7D3 and 522D3 reduces EC in Sake wine by 18.40% and 10.45%, respectively .................................................................. 80 4 DISCUSSION ............................................................................................................................................. 82 4.1 Constitutive expression of the DUR1,2 cassette reduces EC production in wine and Sake ...... 82 4.2 Integration of the DUR1,2 cassette into the genomes of Sake yeast strains K7 and K9 yielded the functional urea degrading Sake yeasts K7EC‐ and K9EC‐ ......................................................... 83 4.2.1 Genetic characterization of K7EC‐ and K9EC‐ ................................................................... 83 4.2.2 The Sake yeasts K7EC‐ and K9EC‐ conduct efficient alcoholic fermentations .................. 85 4.2.3 The Sake yeasts K7EC‐ and K9EC‐ reduce EC poorly in Chardonnay wine, yet efficiently in Sake wine ..................................................................................................................... 85 ix  4.3  Constitutive  expression  of  the  urea  permease,  DUR3,  in  yeast  cells  is  a  viable  alternative method to reduce EC in fermented alcoholic beverages ........................................................... 89 4.3.1 Construction of a linear PGK1p‐DUR3‐PGK1t‐kanMX cassette for integration into the TRP1 locus of wine and Sake yeasts ............................................................................ 89 4.3.2  Integration  of  the  DUR3  cassette  into  the  genomes  of  K7,  K7EC‐ ,  522,  and  522EC‐ yielded the functional urea transporting yeasts K7D3, K7EC‐D3, 522D3,  and 522EC‐D3 ..... 91 4.3.2.1 Integration of the DUR3 cassette into the genomes of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 results in constitutive expression of DUR3 ........................................ 92 4.3.2.2 The integrated DUR3 cassette results in enhanced urea uptake .................... 93 4.3.2.3 The metabolically engineered yeasts K7D3, K7EC‐D3, 522D3, and 522EC‐D3 ferment at similar rates and produce similar amounts of ethanol in Chardonnay and Sake wine ........................................................................................................ 94 4.3.2.4  Variability  of  metabolically  engineered  yeasts  to effectively  reduce  EC  in Chardonnay wine and in Sake wine ................................................................ 95 4.3.2.5 The  metabolically engineered  yeasts K7EC‐D3 and 522EC‐D3 do not reduce EC more effectively than K7EC‐ and 522EC‐ or K7D3 and 522D3 in either Chardonnay or Sake wine .................................................................................................... 98 5 CONCLUSIONS ....................................................................................................................................... 101 5.1 Future Directions ...................................................................................................................... 103 REFERENCES ............................................................................................................................................. 104  x  LIST OF TABLES Table 1.   Ranking of various yeast nitrogen sources according to NCR repression strength ............... 13 Table 2.   Maximum potential ethyl carbamate detected by GC/MS in 20 wines from six countries .. 19 Table 3.   Strains  used  in  the  genetic  construction  and  characterization  of  DUR3  expressing  yeast strains. .................................................................................................................................... 27 Table 4.   Plasmids used in the genetic construction and characterization of DUR3 expressing yeast strains ..................................................................................................................................... 28 Table 5.   Genetic cassettes used in the genetic construction and characterization of DUR3 expressing yeast strains ........................................................................................................................... 28 Table 6.   Oligonucleotide primers used in sequencing of the integrated DUR1,2 cassette ................. 31 Table 7.   Oligonucleotide primers used in sequencing of DUR3 cassette in pUCMD .......................... 41 Table 8.   Discrepancies between the integrated DUR1,2 cassette of K9EC‐ and published sequences  51 Table 9.   Detailed description of the DNA sequences that comprise the DUR1,2 cassettes ............... 51 Table 10  Effect of the integrated DUR1,2 cassette in the genome of K7 on global gene expression patterns in S. cerevisiae K7EC‐ (≥ 4‐fold change) ..................................................................... 53 Table 11.   Utilization of glucose and fructose and production of ethanol in Sake wine by parental yeast strains (K7 and K9), their metabolically engineered counterparts (K7EC‐ and K9EC‐) .............. 57 Table 12.   Reduction of EC by functionally enhanced yeast strains K7EC‐ and K9EC‐ during wine making ... ............................................................................................................................................... 58 Table 13.   Reduction of EC by functionally enhanced yeast K7EC‐ and K9EC‐ strains during Sake brewing .. ............................................................................................................................................... 59 Table 14.   Discrepancies between the DUR3 cassette in pUCMD and published sequences ................ 60 Table 15.   Detailed description of the DNA sequences that comprise the DUR3 cassette .................... 60 xi  Table 16.   Recombinant yeast strains created by integration of the DUR3 cassette into the TRP1 locus ............................................................................................................................................... 63 Table 17.  Effect of the integrated DUR3 cassette in the genome of K7 on global gene expression patterns in S. cerevisiae K7D3 (≥ 4‐fold change) ..................................................................... 69 Table 18.  Ethanol produced by Sake yeast strains (K7, K7EC‐, K7D3, and K7EC‐D3) and wine yeast strains (522, 522EC‐, 522D3, and 522EC‐D3) in Chardonnay wine ........................................................... 77 Table 19.   Ethanol produced by Sake yeast strains (K7, K7EC‐, K7D3, and K7EC‐D3) and wine yeast strains (522, 522EC‐, 522D3, and 522EC‐D3) in Sake wine....................................................................... 79 Table 20.   Reduction of EC by functionally enhanced yeast strains during wine making ...................... 80 Table 21.   Reduction of EC reduction by functionally enhanced yeast strains during Sake making ...... 81  xii  LIST OF FIGURES Figure 1.   Chemical basis of anaerobic fermentation .............................................................................. 5 Figure 2.   Simplified diagram of the Embden‐Meyerhof pathway .......................................................... 6 Figure 3.   Processes involved in red and white winemaking ................................................................... 8 Figure 4.   Contrasting processes in wine and Sake making ................................................................... 10 Figure 5.   Overview of urea metabolism in S. cerevisiae ....................................................................... 11 Figure 6.   Model of reciprocal regulation of GATA factor gene expression and GATA factor regulation of NCR‐sensitive gene expression .......................................................................................... 14 Figure 7.   Permeases  and  degradative  enzymes  needed  to  utilize  poor  nitrogen  sources  are transcriptionally silenced during growth in abundant high quality nitrogen sources ........... 14 Figure 8.   Model of the regulatory pathway by which rapamycin and nitrogen starvation induce NCR regulated gene expression ..................................................................................................... 16 Figure 9.   Synthesis reaction and bioactivation pathway of ethyl carbamate ...................................... 17 Figure 10.   Schematic representation of cloning strategy for creation of pHVX2D3 .............................. 37 Figure 11.   Schematic representation of cloning strategy for creation of pHVXKD3 .............................. 38 Figure 12.   Schematic representation of cloning strategy for creation of pUCTRP1 ............................... 38 Figure 13.   Schematic representation of cloning strategy for creation of pUCMD ................................. 40 Figure 14.   Schematic representation of pUCMD .................................................................................... 42 Figure 15.   Schematic representation of the linear DUR1,2 cassette ...................................................... 47 Figure 16.   Integration of the DUR1,2 cassette into the URA3 locus of K7EC‐ and K9EC‐ was confirmed by Southern blot analyses using a DUR1,2 probe ....................................................................... 48  xiii  Figure 17.   Disruption of the URA3 locus by integration of the DUR1,2 cassette in K7EC‐ and K9EC‐  was confirmed by Southern blot analyses using a URA3 probe ................................................... 49 Figure 18.   The  genetically  engineered  strains  K7EC‐  and  K9EC‐  do  not  contain  the  bla  and  Tn5ble antibiotic resistance markers ................................................................................................. 50 Figure 19.   A  schematic  representation  of  new  ORFs  of  more  than  100  codons  generated  during construction of the DUR1,2 cassette ..................................................................................... 52 Figure 20.   Gene expression analysis (qRT‐PCR) of K7, K7EC‐, K9, and K9EC‐ indicates functionality of the DUR1,2 cassette and constitutive expression of DUR1,2 in non‐inducing (NCR) conditions ..... ............................................................................................................................................... 53 Figure 21.   Fermentation  profiles  (weight  loss)  of  parental  and  DUR1,2  engineered  Sake  strains  in Chardonnay wine ................................................................................................................... 55 Figure 22.   Fermentation profiles (weight loss) of parental and DUR1,2 engineered Sake strains in Sake wine........................................................................................................................................ 56 Figure 23.   DNA  sequence  alignment  of  S288C  and  pUCMD  revealed  nine  discrepancies  along  the length of DUR3 cassette ........................................................................................................ 62 Figure 24.   A  schematic  representation  of  new  ORFs  of  more  than  100  codons  generated  during construction of the DUR3 cassette ........................................................................................ 62 Figure 25.   Schematic representation of the linear DUR3 cassette ......................................................... 63 Figure 26.   Integration of the DUR3 cassette into the TRP1 locus of 522D3, 522EC‐D3, K7D3, and K7EC‐D3 was confirmed by Southern blot analysis using DUR3 and TRP1 probes ..................................... 64 Figure 27.   Schematic  representation  of  the  signals  expected  during  Southern  blot  analysis  of recombinant yeasts containing the recombinant DUR3 cassette integrated into the TRP1 locus ....................................................................................................................................... 65  xiv  Figure 28.   Alignment of the DNA sequences of S288C, 522, and K7 confirmed the presence of a mutant EcoR1 site in the DUR3 coding region of K7. ......................................................................... 66 Figure 29.   Constitutive expression of DUR3 (2208 bp) was confirmed by northern blot analysis of K7, K7EC‐, K7D3, K7EC‐D3 ................................................................................................................... 67 Figure 30.   Analyses of gene expression (qRT‐PCR) of K7, K7EC‐, K7D3, and K7EC‐D3 confirmed functionality of the DUR3 cassette and constitutive expression of DUR1,2 and DUR3 in non‐inducing (NCR) conditions .................................................................................................................... 68 Figure 31.   Uptake of 14C‐urea by K7, K7EC‐, K7D3 and K7EC‐D3 under conditions of NCR ........................... 71 Figure 32.   Uptake of 14C‐urea by K7 and K7EC‐ under conditions of NCR ................................................ 72 Figure 33.  Uptake of 14C‐urea by K7, K7EC‐, K7D3 and K7EC‐D3 under conditions of NCR de‐repression .... 73 Figure 34.  Uptake of 14C‐urea by K7 and K7EC‐ under conditions of NCR de‐repression ......................... 74 Figure 35.   Fermentation profiles (weight loss) of (a) Sake yeast strains K7, K7EC‐, K7D3, and K7EC‐D3 and (b) wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 in Chardonnay wine. ......................... 76 Figure 36.   Fermentation profiles (weight loss) of (a) Sake yeast strains K7, K7EC‐, K7D3, and K7EC‐D3 and (b) wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 in Sake wine. ..................................... 78 Figure 37.   Schematic  representation  of  inducible  DUR1,2  expression  during  Chardonnay  and  Sake wine fermentation by a urea importing yeast strain ............................................................. 97  xv  LIST OF ABBREVIATIONS µg  Microgram µM  Micromolar aa  Amino acid Abs  Absorbance ANOVA  Analysis of variance BC  British Columbia  bp  Base pair cDNA  Complementary deoxyribonucleic acid Ci  Curie cm   Centimetre cM  Centimorgan Corp.   Corporation cRNA  Ribonucleic acid derived from cDNA DAP  Diammonium phosphate DNA  Deoxyribonucleic acid DTT  Dithiothreitol EC  Ethyl carbamate EDTA  Ethylenediamine tetraacetic acid ER  Endoplasmic reticulum EtOH  Ethanol FDA  Food and Drug Administration g  Gram GC  Gas chromatograph GC/MS  Gas chromatograph coupled mass spectrometry GM  Genetically modified GMO  Genetically modified organism GO  Gene ontology GRAS  Generally regarded as safe HPLC  High pressure liquid chromatography kb  Kilo base pair xvi  kg  Kilogram L  Litre LB  Luria‐Bertani medium LC  Liquid chromatograph log  Logarithm LSD  Least significant difference m  Metre M  Molarity m/v  Mass per volume mCi  Millicurie mg  Milligram min  Minute mL  Millilitre MLF  Malolactic fermentation mM  Millimolar mRNA  Messenger RNA MS  Mass spectrometry NAPS  Nucleic Acid Protein Service Unit at The University of British Columbia NCR  Nitrogen catabolite repression system of S. cerevisiae ng  Nanogram nM  Nanomolar nt  Nucleotide °C  Degree Celsius OD  Optical density O/N  Overnight ORF  Open reading frame PB  Protein body PCR  Polymerase Chain Reaction PDM  Prise de Mousse pH  Potential of Hydrogen ppb  Parts per billion xvii  ppm  Parts per million qPCR  Quantitative PCR qRT‐PCR   Quantitative Reverse Transcriptase PCR RFLP  Restriction fragment length polymorphism RNA  Ribonucleic acid ROX  Passive reference dye used in qPCR rpm  Revolutions per minute RQ  Relative quantification rRNA  Ribosomal RNA RSD  Relative standard deviation RT‐PCR  Reverse Transcriptase PCR s  Second SAP  Shrimp Alkaline Phosphatase STDEV  Standard deviation SGD  Saccharomyces Genome Database (www.yeastgenome.org) SLR  Signal log ratio (log base = 2) TBE  Buffer consisting of Tris base, boric acid, EDTA, and water TE  Buffer consisting of Tris base, EDTA, and water tRNA  Transfer RNA TRP  Tryptophan UAS  Upstream activation sequence UASNTR  Upstream activation sequence – nitrogen regulated UIS  Upstream induction sequence UK   United Kingdom  URA  Uracil URS  Upstream repression sequence USA   United States of America  v  Volt v/v  Volume per volume w/o  Without YAN  Yeast assimilable nitrogen  xviii  YEG  Medium consisting of yeast extract and dextrose YNB  Yeast Nitrogen Base YPD  Medium consisting of yeast extract, peptone, and dextrose xix  ACKNOWLEDGEMENTS  It is with great pleasure that I thank the many people who contributed to this research and to my development as a scientist. The road that scientists walk is fraught with self‐doubt and frustration; however, the people mentioned herein have been pivotal in helping me to complete my journey.  I  would  like  to  sincerely  thank  Dr.  Hennie  J.J.  van  Vuuren,  my  research  supervisor,  for  his support, guidance, invaluable insight, financial assistance, and help in writing this thesis. Working with Dr. van Vuuren at the UBC Wine Research Centre has allowed me to nurture my passion for scientific research while developing an appreciation for the partnership between hypothesis‐driven science and business. For the opportunities presented to me and the people I have met through Dr. van Vuuren, I am exceptionally grateful.  I would like to thank the members of my supervisory committee, Dr. Ivan Sadowski and Dr. John Smit for their advice, criticism, and diverse perspectives on this project. Working with Drs. Sadowski and Smit was an invaluable experience and I am ever thankful of their willingness to accommodate a very tight completion timeline.  I would like to thank Dr. John I. Husnik, a former PhD student in the van Vuuren lab, for his patience,  care,  and  guidance.  John  was  an  indispensable  aide  for  resolving  problems,  clarifying procedures, and sounding ideas during my early development as a scientist. He has continued to be generous with his time and assistance despite living and working halfway across the country, and for this I am thankful.  I would like to thank my past and present Wine Research Centre colleagues, especially Calvin Adams, Dr. Zongli Luo, and Lina Madilao for their warm friendship and valuable scientific collaboration. My special thanks are in order for Lina who completed all of the GC/MS analysis in this study. To the members of the Food, Nutrition and Health administration office, Donna Bradley, Tram Nguyen, and Patrick Leung, I offer my thanks for their help in ordering and logistics. I would also like to thank Dr. Hugh Brock and Monica of the Genetics Graduate program (GGP) for their respective assistance during my time in the program. Additionally, I would like to thank my fellow GGP student and friend, Kevin Eade. Kevin’s friendship and coffee break companionship was much appreciated.  xx  I am extremely appreciative of those who funded this research and/or a portion of my studies: National  Sciences  and  Engineering  Research  Council  of  Canada,  First  Venture  Technology  Corp. (Vancouver, B.C.) and the Canadian Vintners Association.  Finally, and most importantly, I thank my parents, Elizabeth H. and Joseph Dahabieh. They bore me, raised me, supported me, taught me, and loved me. Without them I would not be the person I am today.1  1  INTRODUCTION  1.1  Saccharomyces cerevisiae  In the early 20th century intensive genetic research began on the budding yeast Saccharomyces cerevisiae  and, ever since,  scientists have championed yeast as the “Escherichia  coli of eukaryotes” (Miklos and Rubin 1996). S. cerevisiae combines the ease of use and brute force genetics of bacteria with the sophistication and elegance of higher eukaryotes, thus making it an ideal organism to study processes fundamental to all eukaryotic cells. Such processes, many of which are conserved from yeast to  humans,  include  complex  cell  cycle  control,  eukaryotic  meiotic  recombination,  mitochondrial respiration, and cell fusion events (Griffiths, et al. 2005).  S. cerevisiae is a unicellular eukaryotic fungus which is ubiquitous to wineries worldwide (Perez‐Ortin,  Garcia‐Martinez  and  Alberola  2002).  While  it  is  assumed  that  its  natural  environment  is  the winery itself, S. cerevisiae can also be found naturally in rotting grapes and fruits, and in addition, there may  be  some  yet  undiscovered  natural  habitat  of  budding  yeast  (Perez‐Ortin,  Garcia‐Martinez  and Alberola 2002). S. cerevisiae feeds on the sugars and nutrients of crushed and rotting fruit and, when conditions are optimal, reproduce approximately every 90 minutes (Herskowitz 1988). Approximately 10 microns in diameter, yeast reproduce asexually by mitotic budding; however, they can also undergo sexual reproduction when haploid cells (created by meiotic division) of opposite mating type fuse, thus yielding a stable diploid cell (Herskowitz 1988). The yeast mating types (MATa and MATalpha) can be likened to the male and female genders.  Wild isolates of S. cerevisiae also possess the ability to switch mating types such that a haploid population  of  one  mating  type  can  mate  with  itself  and  achieve  diploidy  (Herskowitz  1988).  The mechanism of mating type switching involves the HO endonuclease and has been well characterized (Nasmyth 1993). Yeasts with this ability are known as homothallic and, from a Darwinian point of view, achieving diploidy is desirable. Having two copies of every gene makes an organism genetically more stable,  being  able  to  tolerate  loss  of  function  “recessive”  mutations  more  readily  than  a  haploid equivalent (Greig and Travisano 2003). However, the haploid state can confer certain advantages on the yeast cell; a second copy of every gene buffers deleterious mutations, but it also buffers advantageous 2  mutations. Thus, a diploid organism may, under certain circumstances, ‘evolve’ or ‘adapt’ to changes in the environment more slowly than its haploid counterpart (Greig and Travisano 2003). Nevertheless, as of present, S. cerevisiae has evolved into an organism which seems to function and prosper in a life cycle stuck between its haploid prokaryotic predecessors and its diploid eukaryotic successors.  Like most bacteria and other microorganisms, yeast replicate rapidly and can be easily cultivated in the laboratory. They grown well in liquid culture and on solid media, and can be manipulated via standard microbiological techniques (Ausubel, et al. 2005). In addition to other common techniques, yeast cells are remarkably amenable to chemical or UV mutagenesis, genetic selection, recombinant DNA methods, rescue cloning, complementation, and high efficiency transformation (Griffiths, et al. 2005).  However,  the  real  value  of  S.  cerevisiae  lies  in  the  fact  that  yeasts  incorporate  all  of  these advantages into a eukaryotic background. Thus, fundamental eukaryotic processes can be dissected on a molecular level when such analysis would be exceedingly difficult or impossible in higher eukaryotes.  The full sequence of the S. cerevisiae genome was published in 1996 (Goffeau, et al. 1996) and this has made S. cerevisiae even more powerful as a model organism. S. cerevisiae was in fact the first eukaryotic organism to be completely sequenced and subsequent analysis has revealed that the genome of the common laboratory strain S288C is approximately 12 Mb in size and consists of 16 independently assorting chromosomes (Goffeau, et al. 1996). It contains approximately 6000 genes, ~1000 of which are essential for growth on rich media (Maftahi, Gaillardin and Nicaud 1998), and ~25% of which have human  homologues  (Griffiths,  et  al.  2005).  The  remaining  5000  non‐essential  genes  have  been systemically  knocked  out  in  the  ‘Saccharomyces  Genome  Deletion  project’  resulting  in  a  knock‐out collection (Maftahi, Gaillardin and Nicaud 1998) that allows for streamlined reverse genetic analysis. In addition to the set of 5000 knockouts available, the remaining 1000 essential genes can be investigated through  the  use  of  readily  available  temperature  sensitive  (TS)  conditional  alleles  (Dohmen  and Varshavsky 2005). Finally, both expression and tiling DNA microarrays exist for various yeast strains allowing complex global analysis of the yeast genome, transcriptome and proteome (Dunn, Levine and Sherlock 2005; Hauser, et al. 2001; Perez‐Ortin, Garcia‐Martinez and Alberola 2002; Rossignol, et al. 2003; Shobayashi, et al. 2007; Wu, et al. 2006).   3  Of  the  6000  yeast  genes,  the  Saccharomyces  Genome  Database  (SGD  – http://www.yeastgenome.org) lists known functions or GO (Gene ontology) annotations for about 5000 genes.  The  remaining  1000  yeast  genes  remain  uncharacterized  despite  70  years of  yeast  genetics. While some speculate that many of these 1000 genes (uncharacterized ORFs) may not actually code for functional protein, the general consensus is that they are indeed functional (Pena‐Castillo and Hughes 2007). Upon in silico analysis, many of the 1000 uncharacterized genes contain putative protein domains which suggest some sort of metabolic function (Pena‐Castillo and Hughes 2007). Furthermore, a large proportion of the 1000 uncharacterized genes are homologues to genes found solely in other species of fungi  (Pena‐Castillo  and  Hughes  2007).  Thus,  these  genes  may  be  important  in  aspects  of  fungal metabolism/physiology, and thus do not assay well under standard laboratory conditions. In fact, a growing  consensus  amongst  yeast  biologists  is  that  these  1000  dubious  genes  will  never  become characterized  until  more  focus  is  placed  on  S.  cerevisiae  outside  the  laboratory  (Pena‐Castillo  and Hughes 2007). This requires doing away with traditional laboratory screens and looking at culturing S. cerevisiae  under  natural  conditions,  most  notably  fermentative  conditions.  Under  conditions  of fermentation,  yeast  cells  are  subjected  to  profoundly  different  stresses  than  under  laboratory conditions.  These  stresses  include,  but  are  not  limited  to,  osmotic  stress,  ethanol  stress,  nutrient limitation, oxidative stress, and temperature stress. If some of the 1000 uncharacterized genes are vital to these types of stress responses, their functions will only be revealed when yeast cells are cultured under conditions that create such stresses. For example, a recent study of the yeast transcriptome during  wine  fermentation  identified  a  previously  uncharacterized  fermentation  stress  response containing approximately 223 genes, many of which are part of the 1000 remaining uncharacterized yeast genes (Marks, et al. 2008).  1.2  Yeast strains from nature vs. laboratory yeasts  The majority of laboratory strains are descendents of isolates from nature, such as the common laboratory strain S288C, which is a descendent of a yeast strain isolated from a rotten fig in California in 1938  (Perez‐Ortin,  Garcia‐Martinez  and  Alberola  2002).  However,  today’s  laboratory  strains  are significantly different, both genetically and physiologically, from their wild type parents. Given the 90 minute generation time of S. cerevisiae, it is not difficult to imagine that over 70 years of growth on rich laboratory media, a wild strain could evolve such that it no longer requires much of the genetic diversity 4  and robustness needed to deal with constantly changing environmental conditions (Dunn, Levine and Sherlock 2005). Without environmental pressures to maintain robust pathways needed for growth in nature (e.g. sporulation, pseudohyphal growth), natural isolates could quickly become homogenized into  the  less  vigorous  laboratory  strains  we  see  today.  As  such,  many  laboratory  strains  exhibit dramatically different transcriptional profiles from wild yeasts and also differ in their ability to conduct robust  and  efficient  alcoholic  fermentations  of  high  sugar  grape  musts  (Hauser,  et  al.  2001). Additionally,  in  order  to  maintain  stable  haploid  populations,  the  HO  locus  of  various  S.  cerevisiae laboratory  strains  has  been  purposely  disrupted  (Nasmyth  1993).  Other  important  differences  in laboratory yeast strains include the addition of various auxotrophic markers which can be used to select transformants.  These  auxotrophic  markers  often  map  to  defects  in  amino  acid  or  nucleotide biosynthetic pathways; common markers include URA3, TRP1, LEU2, ADE2, etc. (Ausubel, et al. 1995; Dohmen and Varshavsky 2005).  In nature, many distinct strains of S. cerevisiae have been isolated from various environments worldwide (Dunn, Levine and Sherlock 2005). Environments can vary widely in terms of nutrient (carbon, nitrogen, and minerals) availability, temperature, osmolarity, etc. Thus, while fundamentally similar, each of these strains has adapted, but not yet undergone speciation, in response to various niches in the environment. These adaptations manifest themselves as differences in growth rate, fermentation rate, ethanol production, and various resistances when different strains are grown in identical media (Dunn, Levine and Sherlock 2005; Hauser, et al. 2001).   Despite differences between wild type strains from nature, they tend to share some common distinguishing genetic characteristics when comparing them to laboratory strains. As stated previously, most  laboratory  strains  exist  as  stable  populations  of  haploids;  however,  most  wild  strains  are homothallic and diploid, polyploid, or aneuploid (Bond, et al. 2004; Dunn, Levine and Sherlock 2005; Hauser, et al. 2001; Hughes, et al. 2000; Perez‐Ortin, Garcia‐Martinez and Alberola 2002). Compared to laboratory  strains,  wild  type  strains  also  differ  in  chromosome  length,  contain  large  scale  (~50  kb) deletions or insertions, contain many more transposons (Ty elements), differ in sporulation rate (0‐75%) and spore viability (0‐98%), exhibit variable pseudohyphal growth, and are largely heterozygous (Perez‐Ortin, Garcia‐Martinez and Alberola 2002). 5  1.3  S. cerevisiae and industry: Wine yeasts  The interaction between Homo sapiens and S. cerevisiae dates back almost 8000 years (Perez‐Ortin, Garcia‐Martinez and Alberola 2002; Vine, Harkness and Linton 2002). It was first reported by ancient Egyptian civilization that crushed grapes would ‘ferment spontaneously’ and that the resultant wine contained ‘magical and anesthetic properties’ (Vine, Harkness and Linton 2002). Since that time, humans have been selectively breeding the then unknown microorganism, S. cerevisiae, for desirable characteristics such as tolerance to high sugar stress, robust fermentation, ethanol tolerance, and good flavour production (Hauser, et al. 2001).   As an art form, winemaking flourished in the ancient Mediterranean and was quickly adopted anywhere where the climate was suitable for viticulture (Goode 2005; Vine, Harkness and Linton 2002). As a science, however, winemaking was not understood until 1863; Louis Pasteur was the first to isolate S. cerevisiae and show that it was responsible for the production of ethyl alcohol (ethanol) and carbon dioxide from simple sugars (glucose) (Figures 1 and 2) (Perez‐Ortin, Garcia‐Martinez and Alberola 2002; Vine, Harkness and Linton 2002).   Sugar (glucose or fructose) → Ethanol + Carbon dioxide + ATP  C6H12O6 + 2Pi + 2ADP → 2CH3CH2OH + 2CO2 + 2 ATP (energy released:118 kJ/mol)  Figure 1. Chemical basis of anaerobic fermentation. Under anaerobic conditions S. cerevisiae creates energy (ATP) for biomass by converting sugar into ethanol and carbon dioxide.   6  Glucose Glycolysis2 ADP 2 ATP 2 NAD+ 2 NADH 2 Ethanol 2 Acetylaldehyde 2 Pyruvate 2 CO2CH3CH2OH CH3(CO)H CH3(CO)COOH  Today, no other microorganism is as important to human diet and the global economy as S. cerevisiae (Goode 2005; Vine, Harkness and Linton 2002). Fermentation by yeast is vital to winemaking, brewing, baking, and the distillation of spirits. Furthermore, in the face of global warming, S. cerevisiae may soon play a vital role in the paradigm shift from fossil fuel dependency to the use of bio‐ethanol as a fuel source (Farrell, et al. 2006).  1.4  Winemaking and Sake brewing  Although it may be a seemingly simple process, winemaking (enology) and thus wine itself is incredibly complex. Recent estimates suggest that wine contains approximately 1000 volatile flavor and aroma compounds (Goode 2005). Furthermore, of the 1000 compounds, an estimated 400 are produced by S. cerevisiae itself (Goode 2005). In its most fundamental form winemaking can be described as, “the product of fermenting [with S.  cerevisiae] and processing grape juice or must” (Vine, Harkness and Linton 2002).  Figure  2.  Simplified  diagram  of  the  Embden‐Meyerhof  pathway.  In  the  presence  of  oxygen, pyruvate enters the mitochondrial Krebs cycle and then undergoes oxidative phosphorylation to create  maximal  ATP.  Under  anaerobic  conditions,  yeast  shunt  pyruvate  through  alcoholic fermentation in order to create energy from sugar and restore the intracellular pool of NAD+ that is depleted through glycolysis.  7   While human beings have been actively fermenting grapes and other fruits for thousands of years, the fundamental process has changed very little. The steps involved in modern grape winemaking are outlined in Figure 3 (Vine, Harkness and Linton 2002). 8  Harvest of ripe grapes (manual or machine) De‐stemming and crushing of berriesTreatment with pectolytic enzymes to  aid in clarification and juice extractionWhite or Red? Pressing of must to remove  skins and stems Inoculation of must with commercial starter S. cerevisiae culture (~150 available strains) or allow natural flora yeasts to ferment (Klockera, Hanseniaspora, Candida,  Metschnikowia, Pichia)Fermentation at 12‐18ºC  without mixing Fermentation at 18‐30ºC with mixing MLF? Malolactic fermentation (MLF) for deacidification of malate to lactate. Requires addition of lactic acid bacteria (Oenococcus oeni)  or functionally enhanced S. cerevisiae strain ML01 capable of MLF  during alcoholic fermentation (Husnik, et al. 2006)  Anti‐microbial treatment with sulfur dioxide (SO2) Clarification by racking, fining, centrifuging, and/or filtering Oak?Maturation in stainless steel(most white wines) Maturation in oak barrels  (most red wines and some Chardonnays) Blending (if desired)and bottling White Red No Yes YesNo                               Figure 3. Processes involved in red and white winemaking. 9  In contrast to grape wine, Sake wine is produced from the fermentation of milled rice grains by S. cerevisiae. Sake is native to Japan but has steadily been gaining popularity around the world. Sake is characterized by a translucent hue, mild fruity bouquet, relatively high natural alcohol content (15‐20% v/v), and is served either hot or cold (Shobayashi, et al. 2007). As is the case with wine yeasts, many different  Sake  yeast  strains  exist  and  certain  strains  have  become  popular  for  particular  sensory characteristics that they impart to the final product. Some strains produce Sake wine which is rich in fruitiness  and  has  high  acidity,  while  others  produce  wine  which  is  milder  and  more  aromatic  in bouquet. Sake strains K7 and K9 are amongst the most popular and widely used yeasts in the industry (Kodama  1993;  Wu,  et  al.  2006).  The  process  of  alcoholic  fermentation  is  fundamental  to  both winemaking and Sake brewing and yeast cells are subjected to substantial temperature, acid, hypoxic and ethanol stresses during both wine making and Sake brewing (Kodama 1993; Rossignol, et al. 2003; Wu,  et  al.  2006).  However,  one  of  the  most  profound  differences  is  the  level  of  osmotic  stress experienced by yeast cells during wine making. High ethanol levels produced during Sake fermentations also exert significant ethanol stress on yeast cells.   Typical grape juice is a complex mixture high in carbohydrates, rich in assimilable nitrogen, and high in vitamin/mineral content (Ingledew, Magnus and Patterson 1987; Rossignol, et al. 2003). On average,  grape  must  contains  approximately  20%  w/v  sugar  (200  g/L)  in  the  form  of  a  mixture  of sucrose,  glucose  and  fructose  (Rossignol,  et  al.  2003).  Consequently,  at  the  start  of  grape  must fermentation yeast cells are subject to substantial osmotic stress. Although yeast possess a cell wall composed of crosslinked  1,3‐  and 1,6‐glucans  that  protects  them against osmotic forces, growth in grape must induces several other metabolic methods of coping with said stress (Westfall, Ballon and Thorner 2004). The primary method of dealing with osmotic stress is induction of the high osmolarity growth (HOG) pathway (Reviewed in Westfall, Ballon and Thorner 2004; Han, et al. 1994). This pathway, which  is  highly  conserved  between  most  eukaryotic  cells,  is  responsible  for  the  production  of intracellular small molecules which help offset the osmotic pressure difference. The principle molecules produced  in  S.  cerevisiae  are  glycerol  (1,2,3‐propanetriol)  and  trehalose  (α1,1  glucose  disaccharide) (Westfall, Ballon and Thorner 2004). Both molecules are produced after the induction of biosynthetic genes  by  the  MAP  kinase  mediated  HOG  pathway,  which  occurs  within  minutes  of  osmotic  stress (Westfall, Ballon and Thorner 2004). In contrast to the high osmolarity of typical grape must, Sake rice 10  mash contains much less initial free sugar as the majority of carbon is tied up in the form of insoluble starch (Kodama 1993; Shobayashi, et al. 2007; Wu, et al. 2006).   1.5  Aspergillus oryzae and its role in Sake brewing  Since S.  cerevisiae does not possess the necessary amylases needed to convert starch (β1,4 glucose polymer) to glucose, yeast cells are not able to consume starch as a sole carbon source (Kodama 1993;  Shobayashi,  et  al.  2007;  Wu,  et  al.  2006).  As  a  result,  steamed  rice  must  be  pre‐treated  in preparation for alcoholic fermentation (Figure 4). Sake brewers have long used the fungus Aspergillus oryzae as a source of amylases (Kodama 1993; Shobayashi, et al. 2007; Wu, et al. 2006).   At the start of fermentation steamed rice is mixed with rice that has been inoculated with A. oryzae, traditionally referred to as ‘koji’. Koji rice is rich in free glucose as well as amylases that are free to act on the starch of freshly steamed rice. As a result of the presence of koji, glucose is fed into the fermentation  mixture  at  a  controlled  rate  (amylase  limited)  which  substantially  lowers  the  osmotic stress experienced by yeast cells (Kodama 1993; Shobayashi, et al. 2007; Wu, et al. 2006). This decrease in osmotic stress allows more energy to be devoted to biomass and thus enables Sake fermentations to reach higher titres and higher alcohol concentrations (Shobayashi, et al. 2007; Takagi, et al. 2005; Wu, et al. 2006). Consequently, Sake wine contains the highest concentration of ethanol of any non‐distilled alcoholic beverage (Kodama 1993).  Figure 4. Contrasting processes in wine and Sake making. During winemaking, a saccharification step prior to alcoholic fermentation is unnecessary as the carbon source in grape must is mostly glucose and fructose. During Sake brewing, saccharification must precede alcoholic fermentation as S. cerevisiae cannot consume starch as a carbon source.  11  1.6  Yeast nitrogen metabolism during alcoholic fermentation  In order to build significant biomass and then conduct an efficient alcoholic fermentation, yeast cells require significant amounts of nitrogen.  Free nitrogen, in the form of ammonia, is used in many anabolic pathways, while peptides and free amino acids are either used in cellular processes directly, or are broken down to ammonia, glutamate, and glutamine via catabolic pathways (Cooper 2002; Hofman‐Bang 1999). The principle nitrogen source present in grape must is arginine, of which the metabolism leads directly to the formation of intracellular urea (Figure 5) (Monteiro and Bisson 1991). Urea forms from the arginase (CAR1‐ EC 3.5.3.1) dependent breakdown of arginine to ornithine and urea (Cooper 1982). At high concentrations, urea is a toxic and poor nitrogen source for S. cerevisiae, and is therefore exported to the surrounding medium (Hofman‐Bang 1999). S. cerevisiae possesses the ability to degrade urea via urea amidolyase (DUR1,2 ‐ EC 3.5.1.54) (Genbauffe and Cooper 1991); however, in the presence of higher quality nitrogen sources, DUR1,2 expression is repressed while expression of the urea exporter (DUR4) is not (Whitney, Cooper and Magasanik 1973). Consequently, as long as yeast cells are not starved for nitrogen, which forces them to degrade urea, they will preferentially export urea to the Figure 5 Overview of urea metabolism in S. cerevisiae. Arginine is imported into the cell either by the Arginine  specific  transporter  CAN1  or  by  the  general  amino  acid  permease  GAP1.  Following  import arginine is degraded to ornithine and urea by arginase, the product of the CAR1 gene. Urea can either be exported by DUR4 or degraded to ammonia and carbon dioxide by DUR1,2. Cells can also reabsorb urea through the importer DUR3. Adapted from Coulon, et al. (2006).  12  extracellular environment. If, in the later stages of fermentation, yeast become starved for nitrogen, urea can be reabsorbed (DUR3  ‐ TC 2.A.21.6) (Cooper and Sumrada 1975; ElBerry, et al. 1993) and metabolized; however, finished wines made from grape varietals with high assimilable nitrogen tend to possess significant residual urea (Ough, Crowell and Gutlove 1988; Ough, Crowell and Mooney 1988; Ough, et al. 1990; Ough, et al. 1991).   1.7 Nitrogen metabolism and Nitrogen Catabolite Repression (NCR) in S. cerevisiae  The ability to discriminate between various nutrient sources is an important and evolutionarily conserved theme in biology. Prokaryotes and eukaryotes alike exhibit exquisite regulatory control over their  metabolic  pathways  in  order  to  exist  in  the  most  energetically  efficient  way  possible.  Such regulatory systems are often referred to as ‘catabolite repression’ systems because they repress genes necessary to metabolize a particular nutrient source in the presence of a more favored one (Griffiths, et al. 2005). Catabolite repression systems occur for both various carbon (Bruckner and Titgemeyer 2002; Gancedo  1992)  and  nitrogen  sources  (Cooper  2002;  Hofman‐Bang  1999;  Salmon  and  Barre  1998). Particularly well characterized examples of carbon catabolite repression systems include the lactose (lac) operon in E. coli (Griffiths, et al. 2005) as well as the galactose (GAL) genes in S. cerevisiae (Lohr, Venkov  and  Zlatanova  1995).  In  terms  of  nitrogen  catabolite  repression  both  prokaryotes  and eukaryotes  utilize  a  more  global  repression  system  that  encompasses  many  different  catabolic pathways.  Yeast nitrogen utilization is centered on the usage of both glutamate and glutamine (Hofman‐Bang 1999). From glutamate and glutamine, wild type S. cerevisiae can synthesize any other amino acid necessary  and  thus,  glutamate  and  glutamine,  along  with  ammonia,  are  the  nitrogen  sources  most preferred by yeast (Hofman‐Bang 1999).  Due to its diverse repertoire of nitrogen catabolic pathways, S. cerevisiae can grow solely on a wide  range  of  nitrogenous  compounds  (e.g.  common  and  uncommon  amino  acids,  urea,  GABA, allophanate, allantoin), as each of these may be converted in to glutamate, glutamine, and ammonia (Hofman‐Bang 1999). However, because each non‐optimal nitrogenous compound varies in terms of ease of import and degradation, the various nitrogen sources can be ranked in terms of quality or 13  preference (Hofman‐Bang 1999). Furthermore, since it is advantageous to utilize higher quality sources preferentially, and because yeast posses a catabolite repression system for nitrogen sources, the various compounds can also be ranked in terms of NCR strength (Hofman‐Bang 1999). A few common yeast nitrogen sources are shown in Table 1.  Table 1. Ranking of various yeast nitrogen sources according to NCR repression strength. Low repression strength indicates a poor nitrogen source. Adapted from Hofman‐Bang (1999).  NCR repression under growth in listed media (Low to High) Nitrogen Source 1  Proline 2  GABA 3  Urea 4  Glutamate 5  Ammonium 6  Asparagine/Glutamine   The global nitrogen catabolite repression system of S. cerevisiae has been well studied but is far from being understood in absolute detail (Reviewed in Cooper 2002; Hofman‐Bang 1999). At its core, the NCR system of S. cerevisiae makes use of four known regulatory transcription factors (GLN3, GAT1, DAL80, and DEH1) to control the expression of all NCR sensitive genes (Cooper 2002; Hofman‐Bang 1999). Two of the factors, GLN3 and GAT1, are positive regulators (activators), while the other two factors, DAL80 and DEH1, are negative regulators (repressors) (Cooper 2002; Hofman‐Bang 1999). The complex interaction of all four transcription factors, as well as various inducers and repressors, at NCR sensitive promoters allows for highly regulated nitrogen catabolite gene expression (Figures 6 and 7).  14    Figure 6. Model of reciprocal regulation of GATA factor gene expression and GATA factor regulation of NCR‐sensitive gene expression. Dashed lines indicate weak association/regulation. Adapted from Cooper (2002).   Figure  7.  Permeases  and  degradative  enzymes  needed  to  utilize  poor  nitrogen  sources  are transcriptionally  silenced  during  growth  in  abundant  high  quality  nitrogen  sources.  Adapted  from Cooper (2002).  15  The four NCR transcription factors are referred to as GATA factors because they all exert their effect  though  the  DNA  consensus  sequence  5’‐GATAA‐3’.  Each  factor  binds  DNA  at  the  GATA  site through a conserved zinc finger binding domain and each factor is homologous to many other zinc finger proteins found in higher eukaryotes, including mammals (Bysani, Daugherty and Cooper 1991; Cooper 2002; Cox, et al. 2000; Cox, et al. 2004; Hofman‐Bang 1999; van Vuuren, et al. 1991).  The four NCR GATA factors are controlled by the upstream negative regulator URE2, which is in turn regulated by the TOR pathway (Target of Rapamycin) (Cooper 2002; Hofman‐Bang 1999). The TOR pathway, which is conserved throughout most eukaryotic organisms, acts a master regulatory sensor and signal transduction cascade that assesses and responds, with highly pleiotropic effects, to general cell health, nutrient availability, and growth (Cooper 2002; Dann and Thomas 2006; De Virgilio and Loewith 2006). The TOR pathway  acts primarily through two kinases, TOR1 and TOR2, and regulates fundamental cell functions such as the cell cycle, cell division, protein synthesis, etc. (Cooper 2002; Dann and Thomas 2006; De Virgilio and Loewith 2006).  In terms of controlling NCR, the exact mechanism linking the GATA transcription factors, URE2 and TOR1/2 has yet to be fully worked out. Despite confusion and conflicting data, researchers do agree on the following relationships (Cooper 2002; Hofman‐Bang 1999):  a. GLN3p localization correlates highly with active transcription of NCR regulated genes b. NCR regulated genes are largely activated when GLN3p is nuclear c. URE2p complexes with GLN3p and the complex localizes to the cytoplasm d. Inhibition of TOR1/2p correlates highly with decreased GLN3p phosphorylation,  which in turn correlates with GLN3p being nuclear and NCR regulated genes being expressed  The most commonly accepted model of TOR1/2 control on NCR is depicted in Figure 8. In this model TOR1/2 keep NCR genes repressed by inhibiting a phosphatase which is necessary for GLN3p dephosphorylation and nuclear import.  16    Figure  8. Model of the regulatory pathway by which rapamycin and nitrogen starvation induce NCR regulated gene expression. Adapted from Cooper (2002).    1.8  Urea and ethyl carbamate (EC)  The excretion of non‐metabolized urea into wine is the major factor involved in formation of the compound ethyl carbamate (EC) (Monteiro and Bisson 1991).  Under ambient conditions (wine storage), ethanol  reacts  with  carbamyl  compounds  present  in  fermented  beverages  to  form  EC  (Ingledew, Magnus and Patterson 1987; Kodama, et al. 1994; Ough, Crowell and Gutlove 1988) in a time and temperature dependent manner (Figure 9). Potentially reactive carbamyl compounds include citrulline and carbamyl phosphate, which result from arginine and nucleotide metabolism, as well as urea (Ough, Crowell and Gutlove 1988).  17    1.9  The EC problem  1.9.1  The EC problem: History  During the early part of the 20th century, ethyl carbamate was often administered to humans as an anesthetic during surgeries. High incidence of lung cancer in surgical patients was the first evidence supporting EC’s role as a toxic compound (Nettleship, Henshaw and Meyer 1943). Elucidation of the compound’s bioactivation pathway and further studies into its carcinogenicity (Ashby 1991; Guengerich and Kim 1991; Leithauser, et al. 1990) fueled interest of both EC’s prevalence and mechanism of action. Studies would soon show that vinyl carbamate epoxides, which are highly reactive oxidative degradation products of EC, interact with free nucleotides as well as RNA and DNA and induce mutations in both through mismatch pairing and direct damage (Dahl, Miller and Miller 1978; Leithauser, et al. 1990; Park, et al. 1993; Schlatter and Lutz 1990; Zimmerli and Schlatter 1991). Further supporting EC’s role in cancer is the evidence that EC significantly increases the rates of liver, lung, and harderian gland cancers in male and female mice. Moreover, incidence of mammary and ovarian as well as skin and forestomach cancers was substantially increased in female and male mice, respectively (National Institutes of Health National Toxicology Program 2004).   Figure 9. Synthesis reaction and bioactivation pathway of ethyl carbamate. a) The synthesis of EC in wines results from the spontaneous reaction of ethanol and urea. b) The epoxide degradation product  of  EC  binds  DNA,  causing  damage  and  resulting  in  increased  rates  of  cancers  in  test animals.     Vinyl Carbamate Epoxide Vinyl CarbamateEthyl Carbamate a) b) 18  Known  to  be  a  naturally  occurring  byproduct  of  fermentation,  EC  was  soon  shown  to  be ubiquitous to nearly all wine and spirits albeit in vastly different quantities (Canas, et al. 1989; Ingledew, Magnus and Patterson 1987; Ough 1976a; Ough 1976b; Schlatter and Lutz 1990; Zimmerli and Schlatter 1991). As a result of studies showing that most wines and spirits contain high levels of EC, during the mid 1980’s Canada set a legal limit of 30 µg/L on the allowable EC content in wines; the US set a voluntary limit of 15 µg/L. Long term toxicology studies eventually gave rise to the 1997 action manual on the prevention of EC in wine published by the FDA in conjunction with the Department of Viticulture and Enology at the University of California Davis (http://vm.cfsan.fda.gov/~frf/ecaction.html) (Butzke and Bisson 1998).       Exposure to EC, which may be significantly increased by the regular consumption of alcoholic beverages  (Zimmerli  and  Schlatter  1991),  may  be  a  significant  factor  involved  in  human  cellular mutagenesis and resultant tumorigenesis. As a result, winemakers have been actively reducing EC levels in  wines  both  by  agricultural  practices  and,  more  recently,  molecular  biological  means  (Butzke  and  Bisson 1998).  1.9.2  The EC problem: Surveys of EC in alcoholic beverages  Despite  the  government  imposed  limits  on  EC  levels,  table  wines,  Sake  and  other  alcoholic beverages currently available to consumers contain far more EC than was previously suggested.   In order to assess the scope of the EC problem, numerous stuides have assayed EC levels in various foods and beverages. The EC content of 20 randomly chosen wines from six wine producing countries (five whites – Riesling, Pinot Gris, and Chenin Blanc; 15 reds – Pinot Noir, Cabernet Sauvignon, Shiraz, Zinfandel, and Nebbiolo) is summarized in Table 2 (Reproduced from Coulon, et al. (2006)). As the data indicates, of the 20 wines, 14 exceeded the Canadian EC legal limit (30 µg/L) and 17 exceeded the US voluntary limit (15 µg/L) (Coulon, et al. 2006).   19   Table 2. Maximum potential ethyl carbamate detected by GC/MS in 20 wines from six countries. Wines were heated at 70°C for 48 hours prior to analysis. Adapted from Coulon et al. (2006). Wine Concentration EC (µg/L) Area 1 Area 2 Area 3 Mean peak area SD RSDa (%) 1 11.83 4274 4542 4185 4334 186 4.29 2 9.12 3649 3586 3887 3707 159 4.28 3 14.63 5043 4959 4948 4983 52 1.04 4 38.64 10262 10112 11269 10548 629 5.97 5 57.57 14342 15833 14632 14936 791 5.29 6 66.15 16610 16734 17430 16925 442 2.61 7 59.52 15890 15015 15260 15388 451 2.93 8 46.39 11208 13611 12213 12344 1207 9.78 9 55.41 13865 14820 14618 14434 503 3.49 10 24.36 7012 6808 7895 7238 578 7.98 11 44.76 11650 12576 11677 11968 527 4.40 12 41.32 11186 10952 11368 11169 209 1.87 13 27.5 7664 8366 7868 7966 361 4.53 14 38.22 10375 10471 10508 10451 69 0.66 15 57.68 14069 14839 15974 14961 958 6.41 16 33.82 9034 9428 9832 9431 399 4.23 17 51.99 14146 12880 13899 13642 671 4.92 18 18.61 5734 5935 6047 5905 159 2.69 19 34.99 9396 9295 10417 9703 621 6.40 20 36.57 9635 9756 10811 10067 647 6.43  a – Relative standard deviation  In addition to the goal of reducing EC in table wines, Sake wine has some of the highest EC contents amongst fermented beverages, thus making the reduction of EC in Sake an intensely relevant and important pursuit. Typical Sake wines have anywhere from 100‐250 µg/L EC (Canas, et al. 1989) due to a pasteurization process that all Sakes undergo prior to bottling.  1.9.3  The EC problem: Current methods of lowering EC  Current strategies for EC reduction generally fall into three categories: agricultural practices, the use of wine additives, and genetic engineering of yeasts.  1.9.3.1  Agricultural  methods. The yeast assimilable nitrogen  (YAN) and, more specifically, arginine content of the fermentation substrate directly influences the amount of EC present in the final product (Butzke and Bisson 1998). Thus, a reasonable approach to controlling EC levels is to limit arginine levels 20  in grape must and rice mash. It is possible to regulate the type and amount of nitrogen in fertilizers in order to minimize urea production. Furthermore, management of legume ground cover foliage and nitrogen fixing bacteria can keep juice arginine content below 1000 mg/L, however additional methods are needed to further reduce EC levels in wines (Butzke and Bisson 1998).   1.9.3.2  Additives (acid urease). Alternative methodologies for EC reduction include the use of post‐ or peri‐fermentation additives (Ough and Trioli 1988). These additives, which are most often lyophilized preparations of urease from Lactobacillus fermentum, degrade urea in the wine before it has a chance to form EC; however, urease additives yield variable results due to pH and ethanol sensitivity (Kodama, et al. 1994) which, can significantly lengthen wine processing time due to necessary enzyme incubation. The enzyme is also expensive for winemakers to use.  1.9.3.3  Additives  (DAP).  Supplementation  of  grape  musts  with  nitrogen  is  a  common  winemaking practice.  In  musts  with  low  assimilable  nitrogen,  supplementation  is  crucial  for  preventing  stuck  or sluggish  fermentations  and  subsequent  spoilage.  Given  the  obvious  inappropriateness  of supplementation with urea or arginine, the industry makes use of the cheap and efficient supplement diammonium phosphate (DAP); DAP is a source of free ammonia and, as a highly favorable nitrogen source,  has  been  shown  to  downregulate  CAR1  during  alcoholic  fermentation  (Marks,  et  al.  2003). Lessening the cell’s dependence on arginine as a nitrogen source could prove to be a useful method for lowering EC content in wines.  1.9.3.4  Genetic engineering (urease expression). Another possible method for EC control in wine is the engineering  of  yeast  strains  which  express  bacterial  or  fungal  ureases  (Ough  and  Trioli  1988).  This approach, whether  integrated or plasmid borne,  would allow yeast to directly degrade urea during fermentation, and eliminates the need for urease additives post‐fermentation. However, because S. cerevisiae does not possess such an enzyme, a urease expressing strain would be classified as transgenic thus resulting in difficulty obtaining regulatory approval for use. Furthermore, transgenic organisms carry a strong negative connotation in today’s society thus making their universal acceptance unlikely.  1.9.3.5  Genetic  engineering  (CAR1).  More central to this work is the  genetic  engineering of yeast strains which are disrupted at the CAR1 locus (Kitamoto, et al. 1991). By disrupting CAR1, arginase will no longer be available to degrade arginine to urea thus preventing the formation of EC in wine. While 21  this method does work in the laboratory (Kitamoto, et al. 1991; Yoshiuchi, Watanabe and Nishimura 2000), it has not been widely adopted in practice because arginine is one of the major nitrogen sources for S. cerevisiae (Ingledew, Magnus and Patterson 1987; Rossignol, et al. 2003). Moreover, usage of Δcar1 strains is difficult due to the diploid nature of all industrial wine and Sake yeasts, and because of the  high  risk  of  contamination  from  wild  type  CAR1/CAR1  yeasts;  however,  the  problem  of contamination has been dealt with in the case of Sake yeast by engineering Δcar1 with killer character (Yoshiuchi, Watanabe and Nishimura 2000). It should be noted that CAR1 knockouts have only been attempted in Sake yeast since it is generally regarded that yeast’s inability to metabolize arginine would, in most cases, lead to stuck fermentations and possible spoilage. An antisense mediated method for the knockdown of CAR1 has been successful in reducing Arginase activity in laboratory yeasts (Park, Shin and Woo 2001); however, this methodology has yet to be examined in industrial yeasts.  1.9.3.6  Genetic  engineering  (DUR1,2). Yeast possess the ability to degrade urea via DUR1,2 which encodes a bi‐functional adenosine tri‐phosphate (ATP) and biotin dependent enzyme (urea amidolyase) that degrades urea to two molecules each of CO2 and NH3 in a two step reaction (Genbauffe and Cooper 1986; Genbauffe and Cooper 1991; Whitney and Cooper 1972; Whitney and Cooper 1973; Whitney, Cooper and Magasanik 1973). Urea is first carboxylated using ATP and biotin to form allophanate, after which allophanate is hydrolyzed to form CO2 and NH3.   Since DUR1,2 is subject to regulation by NCR, and because regulatory mechanisms exist which allow for production of wines with high residual urea content, it is reasonable to expect that constitutive expression of DUR1,2 should result in substantially lowered EC levels. Indeed, our group has explored this approach, and such yeasts are capable of producing wines which contain up to 89% less EC (Coulon, et al. 2006). More specifically, when the DUR1,2 ORF was placed under the control of the yeast PGK1 promoter and terminator signals and a single copy was integrated into the URA3 locus of the industrial strain UC Davis 522, Chardonnay wine created by the metabolically engineered strain (522EC‐) contained 89.1% less EC (Coulon, et al. 2006). Analysis of the genotype, phenotype and transcriptome of 522EC‐ suggested  that  the  metabolically  engineered  strain  was  substantially  equivalent  to  its  parent,  thus making it suitable for commercialization (Coulon, et al. 2006). Furthermore, since the urea degrading strain (522EC‐) contains no foreign DNA sequences, it is not classified as transgenic and thus has been 22  given FDA GRAS approval which should make it much more readily accepted by industry and consumers (Coulon, et al. 2006).  1.9.4  Alternative methods for EC reduction  Realistically, there are only four genes that can be manipulated to reduce EC in wine: urea production (CAR1), urea degradation (DUR1,2), urea export (DUR4), and urea import (DUR3).   Based on the literature and published data, we understand the effects of manipulating CAR1 and DUR1,2 expression (Coulon, et al. 2006; Yoshiuchi, Watanabe and Nishimura 2000), and while CAR1 mutants produce almost no EC, CAR1 is not a practical industrial target for EC reduction due to problems with stuck fermentations. Thus, manipulation of DUR4 and DUR3 remain as potential targets to reduce EC in wine and Sake.  One option would be to knockout the urea exporter DUR4, thus disabling the yeast’s ability to export urea into the wine. Although this sounds like an attractive option, this strategy would likely cause serious problems for winemakers. Urea is a toxic byproduct of arginine metabolism and yeast cells need to export urea in order to stay healthy. By knocking out DUR4, urea will accumulate in the cell and lead to an adverse physiological state resulting in stuck fermentations. The fact that existing recombinant DUR1,2 yeasts produce any EC at all (Coulon, et al. 2006) suggests that under typical winemaking conditions more urea is produced than DUR1,2p, from a constitutively expressed copy of DUR1,2, can degrade.   Given the potential problems associated with DUR4 knockouts, we focused our attention on the urea permease, DUR3. Constitutive expression of DUR3 should result in yeasts which will act like urea sponges;  not  only  will  these  yeasts  reabsorb  urea  that  they  excreted  as  a  byproduct  of  arginine metabolism,  but  they  should  also  absorb  a  significant  amount  of  urea  that  is  naturally  present  in fermentation substrate. By combining DUR1,2 constitutive expression with that of DUR3, it should be possible to create recombinant yeasts which can conduct efficient and substantially equivalent alcoholic fermentations with the production of little or no EC.    23  1.10  Introduction to DUR3: Role in the cell (urea transport, polyamines, boron)  During the early 1970’s it was known that yeast cells were capable of metabolizing urea as a sole nitrogen source (Cooper and Sumrada 1975); however, there was no detailed knowledge of how it was brought into the cell. Studies using 14C‐urea revealed that entry of urea into the cell is bimodal (Cooper and Sumrada 1975; Sumrada, Gorski and Cooper 1976). A facilitated diffusion system brings urea into the cell in an energy independent fashion when urea is present at concentrations greater than 0.5 mM. More interestingly however, is the presence of an energy (ATP) dependent active transport system (Km = 14 μM) which functions at low concentrations of urea and is sensitive to nitrogen catabolite repression (Cooper and Sumrada 1975; Sumrada, Gorski and Cooper 1976).  First purified and characterized in 1993, the DUR3 (Degradation of URea) ORF encodes a 735 aa integral membrane protein which contains 15 predicted transmembrane domains (ElBerry, et al. 1993). The protein, which localizes to the plasma membrane, utilizes ATP to transport urea into the cell at low extracellular concentrations. There is some evidence to suggest that the physiological functioning state of the urea transporter is a multimeric complex, however this has not been confirmed (ElBerry, et al. 1993).  Expression of DUR3 is regulated in a  manner highly similar to other genes in the  urea  and allantoin degradative pathways (ElBerry, et al. 1993). Being subject to NCR, the DUR3 promoter contains two  sets  of  tandem  GATAA  consensus  sequences;  however,  while  the  promoter  contains  efficient GATAA transcription factor binding sites (UASNTR), high level expression is strongly dependent on two upstream induction sequences (UIS) (Hofman‐Bang 1999). During growth on proline media (no NCR), little  DUR3  (and  DUR1,2)  mRNA  can  be  detected  by  northern  blotting  without  the  presence  of  a gratuitous inducer (oxalurate, an allophanate analogue) (Hofman‐Bang 1999).  The activating transcription factors DAL81 and DAL82 act through the UIS sequences contained in the DUR3 promoter. The consensus sequence, 5’ (G/C) AAA (A/T) NTGCG (T/C) T (T/G/C) (T/G/C) 3’, for DAL81 and DAL82 binding is shared between other allophanate induced genes (CAR2, DAL2, DAL4, DUR1,2 and DUR3 (Hofman‐Bang 1999).   24  During times of strong NCR, DUR3 is actively repressed by the negative GATAA transcription factor DAL80, and deletion of DAL80 results in expression of DUR3 even in the absence of an inducer (Hofman‐Bang 1999). Conversely, during NCR de‐repression, DUR3 is actively transcribed, if an inducer is present, through the actions of the positive GATAA transcription factor GLN3 (Hofman‐Bang 1999).  In addition to the obvious role in urea uptake, DUR3 has been shown to be involved in other important cellular processes. DUR3 has been shown to be an important regulator of intracellular boron concentration  (Nozawa,  et  al.  2006).  Cells  lacking  DUR3  show  decreased  intracellular  boron concentration; thus, DUR3 appears to function as an active transporter of boron into the cell (Nozawa, et al. 2006). Although evidence suggests DUR3 plays a role in boron transport and regulation, a clear physiological role for DUR3 in terms of boron utilization has yet to be defined.   The  other  important  role  of  DUR3  is  in  the  uptake  of  polyamines  (Uemura,  Kashiwagi  and Igarashi 2007). Polyamines, such as putrescine, spermidine, and spermine, are highly regulated peptides essential  for  cell  growth  and  proliferation  (Uemura,  Kashiwagi  and  Igarashi  2007).  Their  function  is ubiquitous  to  both  pro‐  and  eukaryotes.  Like  E.  coli,  S.  cerevisiae  possesses  general  polyamine transporters  (TPO1‐4,  UGA4,  TPO5,  GAP1),  as  well  as  polyamine  specific  transporters  (AGP2). Interestingly, DUR3 has been shown to specifically uptake polyamines concurrently with urea (Uemura, Kashiwagi and Igarashi 2007). As urea is a very poor nitrogen source, and does not normally occur in significant  quantities  outside  the  cell,  the  main  physiological  role  of  DUR3  may  well  be  polyamine uptake; in fact, DUR3 mRNA is repressed in the presence of large quantities of polyamines (Uemura, Kashiwagi and Igarashi 2007).  Most interesting is the apparent post‐translational regulation of DUR3 polyamine uptake by the serine/threonine kinase PTK2 (Uemura, Kashiwagi and Igarashi 2007). PTK2 seems to positively regulate DUR3 polyamine uptake via the phosphorylation of cytoplasmic residues Thr‐250, Ser‐251, and Thr‐684 (Uemura,  Kashiwagi  and  Igarashi  2007).  Although  DUR3  polyamine  activity  and  subsequent  PTK2 regulation has been preliminarily investigated in the laboratory yeast YPH499 (Uemura, Kashiwagi and Igarashi 2007), there are no known studies which have investigated the role of DUR3 mediated urea or polyamine uptake during alcoholic fermentation. However, it is known that different strains of wine 25  yeast react differentially in terms of fermentation rate and biomass production in response to varying polyamine concentrations (Uemura, Kashiwagi and Igarashi 2007).   As with polyamine uptake, the DUR3 mediated uptake of boron seems to be post‐translationally regulated. Although cells lacking DUR3 exhibit lower boron concentrations, the converse situation is not true i.e. cells overexpressing DUR3 do not show significant increases in boron concentration (Nozawa, et al. 2006). Taken together, the cases of polyamine and boron uptake provide good evidence for the existence of a DUR3 regulatory protein, presumably PTK2.  1.11  Proposed Research 1.11.1  Significance of Research  Given the obvious governmental health concern regarding the EC content of wines, it seems logical to pursue the goal of producing wines that contain no EC. Until recently with the advent of constitutive  DUR1,2  expression  (Coulon,  et  al.  2006),  existing  methods  of  EC  reduction  were cumbersome, ineffective, expensive, and/or impractical.   The development of non‐transgenic yeast strains which are capable of producing little or no EC during an efficient and substantially equivalent alcoholic fermentation would be of direct benefit to industry and consumers alike. As such, the research described herein is both an application of existing technology to a novel target, as well as a proof of concept exploration of one possible new method for EC reduction.  1.11.2  Hypotheses  1.11.2.1  The metabolically engineered Sake yeast strains K7EC‐ and K9EC‐ should reduce EC efficiently during Sake brewing trials. Given the substantially different environment of Sake mash, it is reasonable that the EC reduction of functionally enhanced Sake yeasts will be highly superior when fermenting rice mash  rather  than  grape  must.  Sake  yeasts  have  evolved  to  function  optimally  in  the  nutrient composition of rice mash and in the presence of ‘koji’, thus the efficiency of the DUR1,2 cassette should also function optimally. Such a result should reveal the true EC reduction potential of our recombinant 26  yeasts  and  would  affirm  our  belief  that  each  specific  yeast  strain  must  be  tested  in  its  native environment in order to yield the most accurate results. 1.11.2.2  Constitutive co‐expression of DUR1,2 and DUR3 in metabolically engineered yeasts should result in synergistic EC reduction. DUR1,2/DUR3 yeasts should produce substantially less EC than both DUR1,2 and parental yeasts due to their ability to absorb native urea in grape musts and to reabsorb excreted  urea.  Moreover,  these  yeasts  should  behave  like  their  parental  counterparts  in  all  other aspects of fermentation i.e. growth rate, ethanol production, CO2 production, kinetics, etc. Obtaining these results will affirm our belief that the problem with current DUR1,2 clones is their ability to export metabolic urea before it can be completely degraded. Additionally DUR1,2 yeasts cannot be used to degrade any urea natively present in the must/mash while DUR1,2/DUR3 yeasts could.  1.11.3  Main objectives  The main objectives of this study are to:  1. Constitutively express DUR1,2 in the Sake yeast strains K7 and K9, characterize the resultant engineered  strains,  and  evaluate  the  effect  of  constitutive  DUR1,2  expression  on  EC production in Chardonnay wine   2. Characterize the EC reduction potential of Sake yeast clones K7EC‐ and K9EC‐ during small scale Sake fermentation 3. Construct a genetic cassette capable of maintaining constitutive expression of a functional DUR3 urea permease in wine and Sake yeasts 4. Constitutively express DUR3 both on its own and concurrently with DUR1,2 during wine and Sake making in order to assess the effect on EC reduction 5. Characterize the role of DUR3, and its interplay with DUR1,2, in yeast urea metabolism and EC production during alcoholic fermentation.   27  2  MATERIALS AND METHODS  2.1 Strains, plasmids and genetic cassettes    The strains, plasmids, and genetic cassettes used in the construction and characterization of DUR1,2 and/or DUR3 expressing yeast strains are listed in Tables 3, 4, and 5, respectively.  Table 3. Strains used in the genetic construction and characterization of DUR3 expressing yeast strains. Strain  Description  Reference E. coli Subcloning Efficiency™ DH5α™ Competent Cells F‐ φ80lacZΔM15 Δ(lacZYA‐argF)U169 recA1 endA1 hsdR17(rk‐, mk+) phoA supE44 thi‐1 gyrA96 relA1 λ‐ Invitrogen S. cerevisiae K7  Industrial Sake yeast strain Kyokai No. 701 (K7)  Brewing Society of Japan S. cerevisiae K9  Industrial Sake yeast strain Kyokai No. 901 (K9)  Brewing Society of Japan S. cerevisiae 522   Industrial wine yeast strain   UC Davis S. cerevisiae K7EC‐  Sake yeast strain K7 containing the DUR1,2 cassette (Coulon, et al. 2006) integrated at the URA3 locus This study S. cerevisiae K9EC‐  Sake yeast strain K9 containing the DUR1,2 cassette integrated at the URA3 locus This study S. cerevisiae 522EC‐  Wine yeast strain 522 containing the DUR1,2 cassette integrated at the URA3 locus (Coulon, et al. 2006) S. cerevisiae K7D3  Sake yeast strain K7 containing the DUR3 cassette integrated at the TRP1 locus This study S. cerevisiae 522D3  Wine yeast strain 522 containing the DUR3 cassette integrated at the TRP1 locus This study S. cerevisiae K7EC‐D3  Sake yeast strain K7 containing the DUR1,2 cassette integrated at the URA3 locus and the DUR3 cassette integrated at the TRP1 locus This study S. cerevisiae 522EC‐D3  Wine yeast strain 522 containing the DUR1,2 cassette integrated at the URA3 locus and the DUR3 cassette integrated at the TRP1 locus This study A. oryzae ‘Koji‐Kin’  Industrial preparation of ‘koji’ grade A. oryzae   Vision Brewing http://www.visionbrewing.com       28  Table  4.  Plasmids  used  in  the  genetic  construction  and  characterization  of  DUR3  expressing  yeast strains. Plasmid  Description  Reference pUT332∆ura3  E. coli/S. cerevisiae episomal shuttle vector containing the Tn5ble (phleomycin) dominant marker. (Gatignol 1987) pUC18  High copy number E. coli plasmid that contains AmpR, ori, and an MCS located within a lacZ coding sequence thus facilitating cloning via blue/white X‐Gal selection. (Yanisch‐Perron, Vieira and Messing 1985) pUG6  High copy number E. coli plasmid that contains AmpR, kanMXR, and ori. (Guldener, et al. 1996) pHVX2  A YEplac181 based S. cerevisiae expression vector in which gene expression is driven from the constitutive PGK1 promoter and terminator signals (Volschenk, et al. 1997) pUCTRP1  pUC18 to which the TRP1 coding region was inserted into the BamH1 site at the MCS This study pHVX2D3  pHVX2 to which the DUR3 coding region was inserted between the PGKp and PGKt via the Xho1 cloning site This study pHVXKD3  pHVX2D3 to which a kanMX resistance marker (from pUG6) was inserted into the Sal1 site of pHVX2D3 This study pUCMD  pUCTRP1 based plasmid into which the DUR3 expression cassette (5’‐PGKp‐DUR3‐PGKt‐kanMX‐3’) was PCR blunt end cloned into the middle of TRP1 via the EcoRV site  This study   Table 5. Genetic cassettes used in the genetic construction and characterization of DUR3 expressing yeast strains. Cassette  Description  Reference DUR1,2  Linear expression cassette containing 5’‐URA3‐PGKp‐DUR1,2‐PGKt‐URA3‐3’ (Coulon, et al. 2006) DUR3  Linear expression cassette containing 5’‐TRP1‐PGKp‐DUR3‐PGKt‐kanMX‐TRP1‐3’ This study   2.2  Culture conditions  E.  coli DH5α cells were  used for molecular  cloning and propagation of plasmids; cells  were cultured  according  to  standard  methods  (Ausubel,  et  al.  1995).  Unless  otherwise  indicated,  all  S. cerevisiae strains were cultured aerobically with shaking at 30°C in either liquid YPD medium (Difco, Becton Dickinson and Co., USA), or on YPD + 2% (w/v) agar (Difco, Becton Dickinson and Co., USA) 29  plates. YPD plates supplemented with 300 µg/mL G418 (Sigma, USA) were used to select for positive S. cerevisiae transformants containing the DUR3 expression cassette.  2.3  Genetic construction of the urea degrading yeasts K7EC‐ and K9EC‐  2.3.1  Co‐transformation of the DUR1,2 cassette and pUT332  S. cerevisiae strains K7 and K9 were co‐transformed with the 9191 bp DUR1,2 cassette (Table 5) and pUT332∆ura3 (Gatignol 1987) combined at a 10:1 (DUR1,2 cassette:pUT332) molar ratio. Yeast strains  were  transformed  using  the  lithium  acetate/polyethylene  glycol/ssDNA  method  (Gietz  and Woods 2002). Following transformation, cells were left to recover in YEG at 30°C for 2 hours before plating  on  YEG  plates  supplemented  with  100  µg/mL  phleomycin  (Invitrogen,  USA).  Plates  were incubated at 30°C until colonies appeared.  2.3.2  Screening of transformants for the integrated DUR1,2 cassette  Colony PCR (Ward 1992) was used as described to detect the presence of the linear DUR1,2 cassette integrated into the yeast genome at the URA3 locus. Zymolyase 100 U/mL (Seikagaku Corp., Japan)  was  used  to  lyse  the  cells  (30  µl  zymolyase  solution).  Primers  InDURURA  (5’‐ TGGTGATATGGTTGATTCTGGTGACATA ‐3’)  and  OutURAb  (5’‐  TTCCAGCCCATATCCAACTTCCAATTTA ‐3’) were used to generate an approximately 1500 bp fragment from the 3’ end of the cassette. The primers are specific for the inside and outside of the integrated cassette in order to detect integration and correct orientation. The yeasts 522 and 522EC‐ were used as negative and positive controls, respectively. PCR was performed with iProofTM High Fidelity DNA polymerase (BioRad, USA) using suggested reagent concentrations and 1 µl of Zymolyase treated cell suspension as a template. The PCR program was as follows: 1. Initial denaturation – 3 min at 98°C. 2. Denaturation – 10 sec at 98°C. 3. Annealing – 30 sec at 58.5°C. 4. Extension – 45 sec at 72°C. 5. Cycle to step 2, 30 times. 6. Final extension – 10 min at 72°C.  Colony PCR reactions were visualized on 0.8% agarose gels stained with SYBR™ Safe (Invitrogen, USA).  After identification of positive transformants, engineered strains were cultured for ~10 generations on non‐selective media (YPD) in order to ensure loss of the co‐transforming plasmid.   30  2.3.3  Genetic characterization  2.3.3.1  Southern  blot  analyses.  Southern  blotting  was  used  to  confirm  integration  of  the  DUR1,2 cassette into the URA3 locus. Genomic DNA from engineered strains K7EC‐ and K9EC‐ as well as their respective parent strains was digested with BglII (Roche, Germany) (Ausubel, et al. 1995), and separated on  a  0.8%  agarose  gel.  Following  gel  preparation,  transfer  and  fixing  to  a  positively  charged  Nylon membrane  (Roche  Diagnostics,  Germany)  (Ausubel,  et  al.  1995),  the  blots  were  probed  with  PCR generated fragments specific for DUR1,2 and URA3. The AlkPhosTM Direct Nucleic Acid Labeling and CDP‐Star Detection system was used as recommended for probe detection (Amersham Biosciences, England).  The 736 bp DUR1,2 probe was generated by PCR using genomic DNA from S. cerevisiae strain 522 as a template and the primers DUR1,2probe5 (5’‐TTAGACTGCGTCTCCATCTTTG‐3’) and DUR1,2F (5’‐TGCTGGCTTTACTGAAGAAGAG‐3’). The 927 bp URA3 probe was generated by PCR using 522 genomic DNA  and  the  primers  3’URA3  (5'‐TGGGAAGCATATTTGAGAAGATG‐3')  and  OutURAb  (5’‐ TTCCAGCCCATATCCAACTTCCAATTTA ‐3’).  2.3.3.2  Sequence analysis. Genomic DNA isolated from strains K7EC‐ and K9EC‐ was used to amplify two separate fragments which together encompassed the entire ~10 kb linear ura3‐PGK1p‐DUR1,2‐PGK1t‐ura3  cassette.  Primers  5’OUTURA3Cas  (5'‐AACTAATGAGATGGAATCGGTAG‐3')  and  DUR12rev1  (5’‐TCCTGGAATGCTGTGATGG‐3’) amplified a 7900 bp fragment on the 5’ end of the cassette, while primers PGK1forDUR  (5’‐TGGTTTAGTTTAGTAGAACCTCGTGAAACTTAC‐3’)  and  OutURAb  (5’‐ TTCCAGCCCATATCCAACTTCCAATTTA ‐3’) amplified a 7100 bp fragment on the 3’ end of the cassette.   Sequencing was performed by the Nucleic Acid Protein Service Unit (NAPS) at The University of British Columbia using an Applied Biosystems PRISM 377 sequencer and Applied Biosystems BigDye v3.1 sequencing chemistry. Primers and template were supplied to NAPS in the concentrations specified by their sample submission requirements. The entire integrated DUR1,2 cassette was sequenced via 19 different sequencing reads (Table 6) and later assembled in silico using Accelrys DS Gene v1.1 software. The assembled sequences were aligned against previously published sequences and those of DUR1,2, URA3, PGK1p, and PGK1t obtained from SGD. If any discrepancies were found, the specific read which gave rise to the discrepancy was repeated in order to identify bona fide mutations.  31   Table 6.  Oligonucleotide primers used in sequencing of the integrated DUR1,2 cassette.  Primer  Primer Name  Sequence (5’�3’) P1  5'OUTURA3Cas  5'‐AACTAATGAGATGGAATCGGTAG‐3' P2  5'URA3Flank  5'‐AGTATTCTTAACCCAACTGCACAGA‐3' P3  5'PGK1pro1  5'‐ACAAAATCTTCTTGACAAACGTCACAA3' P4  5'PGK1pro2  5'‐AATTGATGTTACCCTCATAAAGCACGT‐3' P5  PGK1forDUR  5'‐TGGTTTAGTTTAGTAGAACCTCGTGAAACTTAC‐3' P6  DUR12G  5'‐TACCAGAACCTGCTGTATCAG‐3' P7  DUR12rev6  5'‐TCATCCGCAACTTGTTGCATAG‐3' P8  DUR12F  5'‐TGCTGGCTTTACTGAAGAAGAG‐3' P9  DUR12rev5  5'‐TCGGAATAAACTGCAACTGATC‐3' P10  DUR12E  5'‐ACCTCTGATAATATCTCCCGAAG‐3' P11  DUR12D  5'‐TTTTGGCCAATGTTGGATCATATTC‐3' P12  DUR12rev3  5'‐TGTCAACTTGCCAATGGATAAAGTAG‐3' P13  DUR12C  5'‐TTGTAATGAACCTTCCACTTCTC‐3' P14  DUR12B  5'‐ACACATGCCAAAGTCTTCGAG3' P15  DUR12A  5'‐ATTTCCAAAAACGCCCAGAATAC‐3' P16  DUR12for3end  5'‐TCATCAAGAATACTTGAGATGGATC‐3' P17  InDURURA  5’‐TGGTGATATGGTTGATTCTGGTGACATA‐3’ P18  3'URA3  5'‐TGGGAAGCATATTTGAGAAGATG‐3' P19  OutURAb  5’‐TTCCAGCCCATATCCAACTTCCAATTTA‐3’   2.3.3.3  Analysis of DUR1,2 gene expression by qRT‐PCR. Single colonies of parental strains as well as engineered strains from freshly streaked YPD plates were inoculated into 5 mL YPD and grown overnight at 30°C on a rotary wheel. Cells were subcultured into 50 mL YPD (final OD600 = 0.05) and again grown overnight at 30°C in a water shaker bath (180 rpm). Cells were harvested by centrifugation (5000 rpm, 4°C, 5 min) and washed once with 50 mL sterile water. Cell pellets were resuspended in 5 mL sterile water and OD600 measured. Cell suspensions were used to inoculate sterile 250 mL Schott bottles filled with 200 mL filter sterilized (0.22 µm, Millipore, USA) Calona Chardonnay juice to a final OD600 = 0.1. Bottles were aseptically sealed with vapour locks (sterilized with 70% v/v ethanol) filled with sterile water. Sealed bottles were incubated at 20°C for 24 hours.  Total RNA from 24 hour fermentations was extracted using the hot phenol method (Ausubel, et al. 1995); RNA was cleaned up post extraction using a total RNeasy Midi Kit (Qiagen), and quantified on a Pharmacia Ultrospec 3000 UV/Vis spectrophotometer. Clean total RNA (1 µg) was used for cDNA synthesis (iScriptTM, BioRad, USA) according to the manufacturer’s instructions.  iTAQ™ SYBR® Green 32  Supermix with ROX (BioRad, USA) was used in conjunction with an Applied Biosystems 7500 Real Time PCR machine in order to determine the relative levels of gene expression in the strains studied. Real time  primers  for  both  DUR1,2  and  ACT1  were  automatically  optimized  and  designed  using  Applied Biosystem’s Primer ExpressTM v2.0 software. The DUR1,2 amplification product was amplified using the primers  DUR12RTfwd  (5’‐CTCTGGTCCAATGGACGCATA ‐3’)  DUR12RTrev  (5’‐GATGGATGGACCAGTCAACGTT‐3’).  ACT1  was  amplified  using  the  primers  act1forward  (5’‐GTTTCCATCCAAGCCGTTTTG‐3’) and act1reverse (5’‐GCGTAAATTGGAACGACGTGAG‐3’). For each strain, DUR1,2 and ACT1 expression was analyzed six times and results were averaged. RQ data were analyzed using the Applied Biosystems RQ Study software v1.2.2.  2.3.3.4  Global gene expression analysis. Total RNA from strains K7 and K7EC‐ was extracted after 24 hours of fermentation (Section 2.3.3.3), via the hot phenol method (Ausubel, et al. 1995), quantified on a NanoDrop ND‐1000 spectrophotometer and visualized on a 0.8% agarose gel. A ‘GeneChip® One‐Cycle Target Labeling and Control’ kit (Affymetrix, USA) was used according to manufacturer’s instructions for synthesis and clean up of cDNA and for synthesis, cleanup and fragmentation of biotinylated cRNA from 10 µg of high quality total RNA. Microarray analyses were done in duplicate, each with independently grown cell cultures.  Four oligonucleotide yeast genome arrays, two per strain, (YGS98; Affymetrix, USA) were used for  hybridization  of  fragmented  labelled  cRNA.  Preparation  of  hybridization  solution,  hybridization, washing,  staining,  and  scanning  of  the  microarrays  were  performed  as  per  the  manufacturer’s instructions (Eukaryotic Array Gene Chip Expression Analysis and Technical Manual; Affymetrix, USA). The EukGE‐WS2v4 fluidics protocol of Affymetrix MASv5.0 software was used for array staining and washing  procedures  while  arrays  were  scanned  using  a  G2500A  GeneArray  Scanner  (Agilent Technologies, USA).  Data  were  analyzed  with  MASv5.0  and  DMT  software  (Affymetrix,  USA)  running  on  default settings  (Affymetrix  Statistical  Algorithm  Reference  Guide).  Statistically  significant  and  reproducible results were obtained by only including genes which responded similarly in all four cross comparisons and with change p‐values of ≤0.005 (increasers) or ≥0.995 (decreasers). Reported fold change values are derived from the average (n=4) of the Signal Log (base 2) Ratio (SLR). Array annotations were linked to 33  their  gene  ontology  (GO)  annotations  using  the  ‘gene_association.sgd.tab’  table (http://www.yeastgenome.org/gene_list.shtml).  2.3.4  Phenotypic characterization  2.3.4.1  Analysis of fermentation rate in Chardonnay must. Single colonies of parental strains (K7 and K9) as well as appropriate engineered strains from freshly streaked YPD plates, were inoculated into 5 mL YPD and grown overnight at 30°C on  a rotary wheel. Cells were subcultured into 50 mL YPD (final OD600 = 0.05) and again grown overnight at 30°C in a water shaker bath (180 rpm). Cells were harvested by centrifugation (5000 rpm, 4°C, 5 min) and washed once with 50 mL sterile water. Cell pellets were resuspended in 5 mL sterile water and OD600 measured. Cell suspensions were used to inoculate sterile 250 mL Schott bottles filled with 200 mL unfiltered Chardonnay juice obtained from Calona Vineyards, Kelowna, BC, Canada to a final OD600 = 0.1. Bottles were aseptically sealed with sterilized (70% v/v ethanol) vapour locks filled with sterile water. Sealed bottles were incubated at 20°C, and weighed daily to monitor CO2 production. Data were plotted in Excel to generate fermentation profiles.   2.3.4.2  Analysis of fermentation rate in Sake mash. Koji rice was prepared in 400 g batches from short grain Japanese Kokoho Rose (Safeway, Canada). Rice was rinsed with tap water at room temperature until  the  water  ran  clear;  the  rice  was  subsequently  soaked  for  1.5  hours  at  room  temperature  in enough water to cover the rice. The rice was then drained in a kitchen sieve for 20 min. The rice in the sieve was then placed over a pot of boiling water and covered with a bamboo steamer lid. The sieve was arranged in such a way that the rice was not in direct contact with boiling water. After steaming until soft and slightly transparent, the cooked rice was placed in a stainless steel bowl and cooled to ~30°C. Upon  reaching  30°C,  the  cooled  rice  was  inoculated  with  1.5  g  of  koji  seeds  (Vision  Brewing, Washington, USA) mixed with 1 teaspoon of all purpose white flour. The rice was mixed well, covered with a piece of moist Whatman No. 3 paper, and the bowl was sealed with plastic film. The covered bowl was incubated, with occasional mixing, at 30°C for 48 hours, or until the rice grains were covered with fine white fibres and the entire mixture had a cheese‐like aroma. The koji was then transferred to sterile 500 mL centrifuge bottles and stored at ‐30°C until use.  Single colonies of parental strains (K7 and K9) as well as appropriate engineered strains from freshly streaked YPD plates,  were inoculated into 5mL YPD and grown overnight at 30°C on a rotary 34  wheel. Cells were subcultured into 50 mL YPD (final OD600 = 0.05) and again grown overnight at 30°C in a water shaker bath (180 rpm). Cells were harvested by centrifugation (5000 rpm, 4°C, 5 min) and washed once with 50 mL sterile water. Cell pellets were resuspended in 5 mL sterile water and OD600 measured.   The cell suspension was used to inoculate (final OD600 = 0.1) sterile 250 mL Schott bottles filled with 13 g ‘koji’ rice, 48 g freshly steamed rice (steamed as per ‘koji’ preparation above), and 100 mL of water  containing  0.125  g/L  citric  acid.  Bottles  were  aseptically  sealed  with  sterilized  (70%  ethanol) vapour locks filled with sterile water. Sealed  bottles were incubated at 18°C, and weighed daily  to monitor CO2 production. Data were plotted in Excel to generate fermentation profiles.  2.3.4.3  Analysis of glucose/fructose utilization and ethanol production. Following fermentation, 1 mL of fresh unheated Sake was transferred to a sterile 1.5 mL microcentrifuge tube and centrifuged for 10 min at max speed (13K RPM) to pellet cells and any particulate. Supernatant (500 μL) was transferred to a new autosampler screw cap vial (Agilent, USA).  A 20% (v/v) EtOH standard was made from 100% EtOH (Sigma, USA) mixed with sterile MilliQ water (Millipore, USA), and 1 mL of the standard was transferred to new autosampler screw cap vial. A standard curve corresponding to 4, 8, 12, 16, and 20% (v/v) EtOH was plotted after duplicate injections of 2, 4, 6, 8, and 10 µL of the 20% standard as outlined below.  A 3 g/L glucose/fructose standard was made from D‐Glucose (Fisher Scientific, USA) and D‐Fructose  (Fisher  Scientific,  USA)  mixed  with  sterile  MilliQ  water  (Millipore,  USA),  and  1  mL  of  the standard was transferred to new autosampler screw cap vial. A standard curve corresponding to 0.6, 1.2, 1.8, 2.4, and 3.0 g/L glucose/fructose was plotted after duplicate injections of 2, 4, 6, 8, and 10 µL of the 20% standard as outlined below.   Samples were analyzed on an Agilent 1100 series liquid chromatograph running Chemstation Rev A.09.03 [1417] software (Agilent Technologies, USA). The LC was fitted with a Supelcogel C‐610H main column [column temperature: 50°C, 30 cm x 7.8 mm ID] (Supelco, USA) that was protected by a Supelguard C‐610H [5cm x 4.6 mm ID] (Supelco, USA) guard column. A 10 μL sample was run isocratically with 0.1% (v/v) H3PO4/H20 buffer at a flow rate of 0.75 mL/min. Ethanol was eluted from the column at 35  ~19 min, fructose was eluted at ~8 min and glucose was eluted at ~9.5 min, and all compounds were detected by a refractive index detector running in positive mode. The concentration of each compound was determined automatically by Chemstation software as based on the standard curves.   2.3.5 Functionality analyses  2.3.5.1 Reduction of EC in Chardonnay wine. Chardonnay wine was produced with K7, K7EC‐, K9, and K9EC‐ as in Section 2.3.4.1. At the end of fermentation, cells were removed by centrifugation (5000 rpm, 4°C, 5 min), and ~ 50 mL of wine was decanted into sterile 50 mL Schott bottles. Bottles were incubated in a 70°C water bath for exactly 48 hours to maximize EC production, and then stored at 4°C until GC/MS analysis (Section 2.3.5.3).  2.3.5.2 Reduction of EC in Sake wine. Sake wine was produced with K7, K7EC‐, K9, and K9EC‐ as in Section 2.3.4.2. At the end of fermentation, cells and rice were removed by centrifugation (5000 rpm, 4°C, 5 min), and ~ 50 mL of wine was decanted into sterile 50 mL Schott bottles. Bottles were incubated in a 70°C water bath for exactly 48 hours to maximize EC production, and then stored at 4°C until GC/MS analysis (Section 2.3.5.3).  2.3.5.3  Quantification of EC in wine by solid phase microextraction and GC/MS. A 10 mL sample of heated (70°C ‐ 48 hours) wine was pipetted into a 20 mL sample vial, to which a magnetic stirring bar and 3 g of NaCl were added. The vial was capped with a PTFE/silicone septum, placed on a stirrer at 22°C, and allowed to equilibrate, while stirring, for 15 min. A Solid Phase Microextraction (SPME) fibre [65 µm Carbowax/Divinylbenzene (CW/DVB)] was conditioned at 250°C for 30 min before use. After sample equilibration, the fibre was inserted into the head space. After 30 min, the fibre was removed from the sample vial and inserted into the injection port for 15 min. A blank run was performed before each sample run. Quantification was done as follows: an ethyl carbamate (Sigma‐Aldrich) standard stock solution (0.1 mg/mL) was prepared in distilled H20 containing 12% (v/v) ethanol and 1 mM tartaric acid at pH 3.1. Calibration standards were prepared with ethyl carbamate concentrations of 5, 10, 20, 40, 90 µg/L. The standard solutions were stored in the refrigerator at 4°C.  Ethyl carbamate in wine was quantified using an Agilent 6890N GC interfaced to a 5973N Mass Selective Detector. A 60 m x 0.25 mm ID, 0.25 µm thickness DBWAX fused silica open tubular column 36  (J&W  Scientific, Folsom, CA, USA) was employed.  The  carrier gas was ultra high  purity  helium at  a constant  flow  of  36  cm/s.  The  injector  and  transfer  line  temperature  was  set  at  250°C.  The  oven temperature was initially set at 70°C for 2 min then raised to 180°C at 8°C /min and held for 3 min. The temperature was then programmed to increase by 20°C /min to 220°C where it was held for 15 min. The total run time was 35.75 min. The injection mode was splitless for 5 min (purge flow: 5 mL/min, purge time:  5  min).  The  MS  was  operated  in  Selected  Ion  Monitoring  (SIM)  mode  with  electron  impact ionization; MS quad temperature 150°C and MS source temperature 230°C. The solvent delay was 8 min. Specific ions 44, 62, 74, 89 were monitored with a dwell time of 100 msec. Mass 62 was used for quantification  against  the  mass  spectrum  of  the  authentic  ethyl  carbamate  standard.  Wines  were analyzed by three separate injections and the data were averaged.   2.4  Genetic construction of the urea importing yeasts K7D3, K7EC‐D3, 522D3, and 522EC‐D3  2.4.1  Construction of the DUR3 linear cassette  In order to express DUR3 constitutively, a cassette similar to the DUR1,2 cassette previously made  by  our  group  (Coulon,  et  al.  2006)  was  constructed.  All  cloning  steps  and  reactions,  unless otherwise  stated,  were  performed  according  to  standard  molecular  biology  standards  methods (Ausubel, et al. 1995). All PCR reactions, unless otherwise indicated, were performed using iProofTM High Fidelity DNA polymerase (BioRad, USA) as per the manufacturer’s instructions.  2.4.1.1  Construction of pHVX2D3. In order to place DUR3 under the control of the constitutive PGK1 promoter and terminator signals, the DUR3 ORF was cloned into pHVX2 (Volschenk, et al. 1997) (Figure 10). The DUR3 ORF was amplified from 522 genomic DNA using the following primers which contained Xho1 restriction enzyme sites built into their 5’ ends:  1. DUR3forXho1 (5’‐AAAACTCGAGATGGGAGAATTTAAACCTCCGCTAC‐3’)  2. DUR3revXho1 (5’‐AAAACTCGAGCTAAATTATTTCATCAACTTGTCCGAAATGTG‐3’).  Following PCR, 0.8% agarose gel visualization, and PCR cleanup (Qiagen, USA – PCR Purification Kit), both the PCR product (insert) and pHVX2 (vector) were digested with Xho1 (Roche, Germany). After the digested vector was treated with SAP (Fermentas, USA) to prevent re‐circularization, the insert and linearized‐SAP treated vector were ligated overnight at 22°C (T4 DNA Ligase – Fermentas, USA); the 37  ligation  mixture  (5 μL)  was  used  to  transform  DH5α™  competent  cells  (Invitrogen,  USA)  that  were subsequently  grown  on  100  µg/mL  Ampicillin  (Fisher,  USA)  supplemented  LB  (Difco,  USA)  plates. Plasmids from a random selection of transformant colonies were harvested (Qiagen, USA – QIAprep Spin Miniprep kit) and digested by EcoR1 (Roche, Germany); PCR, using inside‐outside primers, was done to identify plasmids with the desired insert.   Figure 10. Schematic representation of cloning strategy for creation of pHVX2D3. The DUR3 ORF was PCR amplified from 522 genomic DNA and ligated into the Xho1 site of pHVX2.   2.4.1.2  Construction of pHVXKD3. A kanMX marker was obtained from pUG6 (Guldener, et al. 1996) via double digestion with Xho1 and Sal1 (Fermentas, USA). Following digestion, the 1500 bp kanMX band was gel purified (Qiagen, USA – Gel Extraction Kit) and ligated into the Sal1 site of linearized‐SAP treated pHVX2D3. The ligation mixture (5 μL) was used to transform DH5α™ competent cells which were grown on  LB‐Ampicillin  (100  µg/mL).  Recombinant  plasmids  (Figure  11)  were  identified  by  HindIII  (Roche, Germany) digestion of plasmids isolated from 24 randomly chosen colonies.  38   Figure 11. Schematic representation of cloning strategy for creation of pHVXKD3. The kanMX marker was obtained from Xho1/Sal1 digestion of pUG6 and ligated into the Sal1 site of pHVXKD3.  2.4.1.3 Construction of pUCTRP1. The TRP1 coding region was PCR amplified from 522 genomic DNA using TRP1 specific primers, each containing BamH1 (bold) and then Apa1 (underline) sites at their 5’ ends: BamH1Apa1TRP1ORFfwd (5’‐AAAAAAGGATCCAAAAAAGGGCCCATGTCTGTTATTAATTTCACAGG‐3’); BamH1Apa1TRP1ORFrev (5’‐AAAAAAGGATCCAAAAAAGGGCCCCTATTTCTTAGCATTTTTGACG‐3’).   Following amplification, cleanup, and quantification, the ~750 bp fragment was ligated into the BamH1 (Roche, Germany) site of linearized‐SAP treated pUC18 (Figure 12). Recombinant plasmids were identified primarily through blue/white screening (growth on LB‐Ampicillin supplemented with 50 μg/mL Xgal) and subsequently confirmed through HindIII/EcoR1 digestion.   Figure 12. Schematic representation of cloning strategy for creation of pUCTRP1. The TRP1 ORF was PCR amplified from 522 genomic DNA and ligated into the BamH1 site of pUC18.  39  2.4.1.4  Construction of pUCMD. The PGK1p‐DUR3‐PGK1t‐kanMX cassette located within pHVXKD3 was amplified from pHVXKD3 plasmid DNA using cassette specific primers: 1. pHVXKfwdlong (5’‐ CTGGCACG ACAGGTTTCCCGACTGGAAAGCGGGCAGTGAG‐3’); pHVXKrevlong (5’‐ CTGGCGAAAGGGGGATGTGCTGCAA GGCGATTAAGTTGGG‐3’). Following amplification, cleanup, and quantification, the ~6500 bp blunt end PCR generated fragment was treated with polynucleotide kinase (New England Biolabs, USA) in order to facilitate ligation (O/N at 22°C) into the blunt EcoRV (Fermentas, USA) site of linearized‐SAP treated pUCTRP1.  Recombinant plasmids (Figure 13) were initially identified using E‐lyse analysis (Eckhardt 1978) and later confirmed via Apa1 (Stratagene, USA) /Sal1 digestion. Briefly, E‐lyse efficiently screens large numbers of colonies for the presence of plasmid DNA by lysing the colonies within the wells of an agarose gel, followed by electrophoresis (Eckhardt 1978). More specifically, after patching onto selective media, small aliquots of colonies were suspended in 5 µL TBE buffer and then mixed with 10 µL SRL buffer  (25%  v/v  sucrose,  50  µg/mL  RNaseA,  1  mg/mL  lysozyme).  After  mixing  by  pipetting,  cell suspensions were loaded into the wells of a 0.2% (w/v) SDS ‐ 0.8% (w/v) agarose gel. After the cell suspension in the wells had become clear indicating cell lysis (~ 30 min), the DNA was electrophoresed at 20 V for 45 min, then at 80 V for 45 min. Finally the gel was stained as required with SYBR™ Safe (Invitrogen, USA).  40   Figure 13. Schematic representation of cloning strategy for creation of pUCMD. The linear PGK1p‐DUR3‐PGK1t‐kanMX construction was PCR amplified from pHVXKD3 and blunt end cloned into the EcoRV site of pUCTRP1 to yield pUCMD.   2.4.2  Sequence analysis of the DUR3 cassette in pUCMD  Plasmid pUCMD (Figure 14) was isolated from E. coli (Qiagen, USA – QIAprep Spin Miniprep kit) and used directly as a sequencing template. Sequencing was performed by the Nucleic Acid Protein Service  Unit  (NAPS)  at  The  University  of  British  Columbia  using  an  Applied  Biosystems  PRISM  377 sequencer  and  Applied  Biosystems  BigDye  v3.1  sequencing  chemistry.  Primers  and  template  were supplied to NAPS in the concentrations specified by their sample submission requirements. The entire DUR3 cassette, beginning from the 5’ TRP1 flanking sequence and ending with the 3’ TRP1 flanking sequence, was sequenced via 16 different sequencing reads (Table 6) and later assembled in silico using Accelrys DS Gene v1.1 software. The assembled sequences were aligned against previously published sequences and those of DUR3, TRP1, PGK1p, and PGK1t obtained from SGD. If any discrepancies were found, the specific read which gave rise to the discrepancy was repeated in order to identify bona fide mutations.  41   Table 7. Oligonucleotide primers used in sequencing of DUR3 cassette in pUCMD.  Primer  Primer Name  Sequence (5’�3’) P1  BamH1TRP1Apa1Fwd  5’‐AAAAAAGGATCCAAAAAAGGGCCCATGTCTGTTATTAATTTCACAGG‐3’ P2  pHVXKlongfwd  5’‐CTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAG‐3’ P3  pHVXKfwd  5’‐CTGGCACGACAGGTTTCCCGACTGG‐3’ P4  pDUR3tfwd  5’‐TTTCCGCGGAGCTTTCTAACTGATCTATCC‐3’ P5  DUR3Xho1fwd  5’‐AAAACTCGAGATGGGAGAATTTAAACCTCCGCTAC‐3’ P6  DUR3Xho1rev  5’‐AAAACTCGAGCTAAATTATTTCATCAACTTGTCCGAAATGTG‐3’ P7  pDUR3trev  5’‐TTTCCGCGGTGCGGTGTGAAATACC‐3’ P8  kanMXORFrev  5’‐TTAGAAAAACTCACTGAGCATCAAATGAAACTGC‐3’ P9  kanMXORFfwd  5’‐ATGGGTAAGGAAAAGACTCACGTTTCGAGG‐3’ P10  pHVXKlongrev  5’‐CTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGG‐3’ P11  BamH1TRP1Apa1rev  5’‐AAAAAAGGATCCAAAAAAGGGCCCCTATTTCTTAGCATTTTTGACG‐3’ P12  DUR3RTfwd  5’‐GATCGGCCATGGTTGCTACTT‐3’ P13  RevPGKtPst1  5’‐TTTTCTGCAGAAGCTTTAACGAACGCAGAATT‐3’ P14  PGKpro1  5'‐ACAAAATCTTCTTGACAAACGTCACAA3' P15  PGKpro2  5'‐AATTGATGTTACCCTCATAAAGCACGT‐3' P16  PGKforDUR  5'‐TGGTTTAGTTTAGTAGAACCTCGTGAAACTTAC‐3' 42  Figure 14. Schematic representation of pUCMD. The DUR3 linear cassette stretches between Apa1 sites encompassing 5’1/2TRP1‐PGK1p‐DUR3‐PGK1t‐kanMXp‐kanMX‐kanMXt‐3’1/2TRP1.   5’ ½ TRP1 PGK1 Promoter PGK1 Terminator DUR3 kanMX Promoter kanMX Terminator kanMX 3’ ½ TRP1 AmpR rep (pMB1) pUCMD (9221bp)  43  2.4.3  Transformation of the linear DUR3 cassette into S. cerevisiae and selection of transformants  The 6536 bp DUR3 cassette was cut from pUCMD using Apa1 (Stratagene, USA) (Ausubel, et al. 1995) and visualized on a 0.8% agarose gel. From the gel, the expected 6536 bp band was resolved and extracted  (Qiagen,  USA  –  Gel  extraction  kit).  After  extraction,  clean  up,  and  quantification  using  a Nanodrop  ND‐1000  spectrophotometer  (Nanodrop,  USA),  250  ng  of  linear  cassette  was  used  to transform  S.  cerevisiae  strains  K7,  K7EC‐,  522,  and  522EC‐.  Yeast  strains  were  transformed  using  the lithium acetate/polyethylene glycol/ssDNA method (Gietz and Woods 2002). Following transformation, cells were left to recover in YPD at 30°C for 2 hours before plating on to YPD plates supplemented with 300 µg/mL G418 (Sigma, USA). Plates were incubated at 30°C until colonies appeared.   2.4.3.1  Confirmation of integration via colony PCR. Colony PCR was used as previously described to detect the presence of the linear DUR3 cassette integrated into the yeast genome at the TRP1 locus (Ward 1992). Zymolyase 100 U/mL (Seikagaku Corp., Japan) was used to lyse the cells (30 µl zymolyase solution).  Primers  kanMXORFfwd  (5’‐ATGGGTAAGGAAAAGACTCACGTTTCGAGG‐3’)  and  kanMXORFrev (5’‐TTAGAAAAACTCATCGAGCATCAAATGAAACTGC‐3’) were used to generate an 809 bp fragment from the 3’ end of the cassette. 522 genomic DNA was used as a negative control and pUCMD as a positive control. PCR was performed with iProofTM High Fidelity DNA polymerase (BioRad, USA) using suggested reagent concentrations and 1 µl of Zymolyase treated cell supernatant as template. The PCR program was as follows: 1. Initial denaturation – 3 min at 98°C. 2. Denaturation – 10 sec at 98°C. 3. Annealing – 20 sec at 62.4°C. 4. Extension – 30 sec at 72°C. 5. Cycle to step 2, 30 times. 6. Final extension – 10 min at 72°C.  Colony PCR reactions were visualized on 0.8% agarose gels stained with SYBR™ Safe (Invitrogen, USA).   2.4.4  Genetic characterization  2.4.4.1  Southern blot analyses. Southern blotting was used to confirm integration of the DUR3 cassette into the TRP1 locus. Genomic DNA from engineered strains K7EC‐, K7D3, K7EC‐D3, 522D3, and 522EC‐D3, as well as their respective parent strains, was digested with EcoRI (Roche, Germany) (Ausubel, et al. 1995), and  separated  on  a  0.8%  agarose  gel.  Following  gel  preparation,  transfer  and  fixing  to  a  positively charged Nylon membrane (Roche Diagnostics, Germany) (Ausubel, et al. 1995), the blots were probed with PCR generated fragments specific for DUR3 and TRP1. The AlkPhosTM Direct Nucleic Acid Labeling   44  and CDP‐Star Detection system was used as recommended for probe detection (Amersham Biosciences, England).  The 661 bp DUR3 probe was generated using genomic DNA from S. cerevisiae strain 522 as a template  and  the  primers  DUR3probefwd  (5’‐  CAGCAGAAGAATTCACCACCGCCGGTAGATC‐3’)  and DUR3proberev  (5’‐  CAATCAGGTTAATAATTAATAAAATACCAGCGG‐3’).  The  461  bp  TRP1  probe  was generated  using  genomic  DNA  from  522  as  a  template  and  the  primers  TRP1probefwd  (5’‐ TTAATTTCACAGGTAGTTCTGGTCCATTGG‐3’) and TRP1proberev (5’‐ CAATCCAAAAGTTCACCTGTCCCACCT GCTTCTG‐3’).   2.4.4.2  Analysis of gene expression by northern blotting.  Fermentations with K7, K7EC‐ K7D3, and K7EC‐D3 in filter sterilized Calona Chardonnay must were conducted as in Section 2.3.3.3. After 24 hours, cells were harvested by centrifugation (5000 rpm, 4°C, 4 min), snap frozen in liquid nitrogen (3 min), and stored at ‐80°C until RNA extraction. Total RNA was extracted using a hot phenol method (Ausubel, et al. 1995), quantified on a NanoDrop ND‐1000 spectrophotometer and visualized on a 0.8% agarose gel.  Northern blot analysis was performed as described (Ausubel, et al. 1995). Briefly, 30 μg total RNA  was  separated  on  a  1%  agarose‐formaldehyde  denaturing  gel  and  transferred  to  a  positively charged  Nylon  membrane  (Roche  Diagnostics,  Germany).  Blots  were  probed  with  PCR  generated fragments specific for DUR3 and the loading control HHF1. The AlkPhosTM Direct Nucleic Acid Labeling and CDP‐Star Detection system was used as recommended for probe detection (Amersham Biosciences, England).   The 661 bp DUR3 probe used for northern blotting was the same as the probe used for Southern blotting (Section 2.4.4.1). The ~500 bp HHF1 probe was supplied by another member of our lab (Coulon, et al. 2006).  2.4.4.3  Analysis of DUR3 gene expression by qRT‐PCR. Gene expression analysis of K7, K7EC‐ K7D3, and K7EC‐D3 was  performed  as  described  in  Section  2.3.3.3  using  total  RNA  from  24  hour  fermentations (Section 2.4.4.2). The DUR3 real time PCR product was generated using the primers DUR3RTfwd (5’‐GATCGGCCATGGTTGCTACTT‐3’) and DUR3RTrev (5’‐GCGATAGTGTTCATCCCGGTT‐3’).    45  2.4.4.4  Global gene expression analysis. Following 24 hour fermentations (Section 2.4.4.2), total RNA from strains K7 and K7D3 was used for transcriptome analysis as described in Section 2.3.3.4.  2.4.5  Analysis of urea uptake using 14C‐urea  In order to assess the effect of DUR3 constitutive expression on urea uptake activity, a 14C‐urea uptake assay was performed as previously described (Cooper and Sumrada 1975). Briefly, appropriate strains were grown (30°C – 180 RPM) in minimal media (1.7 g/L YNB w/o amino acids w/o ammonium sulfate, 20 g/L glucose, 1 g/L ammonium sulfate or 1 g/L L‐proline) to approximately 1x107 cells/mL. An 11 mL sample of cell culture was transferred to a 250 mL Erlenmeyer flask containing 80 μL of 36.6 mM 14C‐urea (Sigma, USA – 6.8 mCi/mmol). Cells were then cultured (30°C – 180 RPM) for 20 min and 1 mL samples were taken every 2 min. The 1 mL samples were applied to 0.22 μm nylon filters (Millipore, USA) and washed with 25 mL aliquots of cold minimal media to which 10 mM urea (Fisher, USA) had been added. Filters were placed in scintillation vials, filled with scintillation fluid (Fisher, USA) and left overnight to equilibrate. Samples were then counted in a recently calibrated Beckman LS6000IC liquid scintillation counter using the counter’s factory ‘14C quench’ mode. DPM values were then converted into nano‐mole urea transported (Cooper and Sumrada 1975) and plotted against time in Excel.  2.4.6  Phenotypic characterization  2.4.6.1  Analysis  of  fermentation  rate  in  Chardonnay  must.  Fermentations  of  unfiltered  Calona Chardonnay  must  with  K7,  K7EC‐,  K7D3,  K7EC‐D3,  522,  522EC‐,  522D3,  and  522EC‐D3  were  performed  as described in Section 2.3.4.1.  2.4.6.2  Analysis of fermentation rate in Sake mash. Fermentations of Sake rice mash with K7, K7EC‐, K7D3, K7EC‐D3, 522, 522EC‐, 522D3, and 522EC‐D3 were performed as described in Section 2.3.4.2.  2.4.6.3  Analysis for ethanol content. Ethanol production by K7, K7EC‐, K7D3, K7EC‐D3, 522, 522EC‐, 522D3, and 522EC‐D3 in Chardonnay and Sake wine was quantified as described in Section 2.3.4.3.      46  2.4.7  Functionality of metabolically enhanced yeasts  2.4.7.1  Reduction of EC in Chardonnay wine. Chardonnay wine was produced with K7, K7EC‐, K7D3, K7EC‐D3, 522, 522EC‐, 522D3, and 522EC‐D3 as described in 2.3.4.1. Quantification of EC reduction was performed as described in Section 2.3.5.1.  2.4.7.2  Reduction of EC in Sake wine. Sake wine was produced with K7, K7EC‐, K7D3, K7EC‐D3, 522, 522EC‐, 522D3, and 522EC‐D3 as described in 2.3.4.2. Quantification of EC reduction was performed as described in Section 2.3.5.2.  2.5 Statistical analyses  Two  factor  ANOVA  analyses  were  used  to  evaluate  the  variations  in  glucose,  fructose,  and ethanol measured in Chardonnay and Sake wine produced by parental and engineered yeast strains. Fisher’s LSD (Least Significant Difference) test was used after ANOVA to determine which means were statistically  significant  (p<0.05).  All  statistical  calculations  were  performed  in  Excel  2007  (Microsoft, USA).           47  URA3  PGKp  URA3 PGKt DUR1,2 Srf1 ½ site  Srf1 ½ site 3  RESULTS  3.1  Constitutive expression of DUR1,2 in Sake yeast strains K7 and K9  3.1.1  Integration of the linear DUR1,2 cassette into the genomes of Sake yeast strains K7 and K9  In order to constitutively express DUR1,2, the Sake yeast strains K7 and K9 were transformed with the linear DUR1,2 cassette (Figure 15). After colony PCR screening of approximately 1500 yeast transformants for the integration of the DUR1,2 cassette, two metabolically engineered strains, K7EC‐ and K9EC‐, were obtained. The designation ‘EC‐‘ denotes integration of the linear DUR1,2 cassette into the URA3 locus.   3.1.2  Genetic characterization of K7EC‐ and K9EC‐  3.1.2.1  Correct integration of the DUR1,2 linear cassette into the genomes of K7EC‐ and K9EC‐. In order to confirm the correct integration of the DUR1,2 cassette, a Southern blot was performed using PCR generated DUR1,2 and URA3 probes and the BglII digested genomic DNA of K7EC‐ and K9EC‐.    When probed with DUR1,2, two signals were detected for K7EC‐ and K9EC‐ corresponding to 5.0 kb and 9.0 kb DNA fragments, and one signal was detected for K7 and K9 corresponding to a 5.0 kb DNA fragment (Figure 16a). The 5.0 kb fragment matches the expected fragment size for the native DUR1,2 locus while the 9.0 kb fragment matches the expected fragment size for the presence of the DUR1,2 cassette integrated into the URA3 locus (Figure 16b).   Figure 15. Schematic representation of the linear DUR1,2 cassette.    48  Probing with URA3 gave rise to two signals for K7EC‐ and K9EC‐, corresponding to 3.8 kb and 4.4 kb DNA fragments, and one signal for K7 and K9 corresponding to a 4.4 kb fragment (Figure 17a). The 3.8 kb  fragment  matches  the  expected  fragment  size  for  the  recombinant  URA3  locus,  and  the  4.4  kb fragment matches the expected fragment size for a non‐disrupted URA3 locus (Figure 17b).     Figure  16.  Integration  of  the  DUR1,2  cassette  into  the  URA3  locus  of  K7EC‐  and  K9EC‐was confirmed  by  Southern  blot  analyses  using  a  DUR1,2  probe  (a).  All  faint  bands  that  do  not correspond to a size in the schematic representation were deemed to be non‐specific. For each sample, the agarose gel is shown on the left while the exposed film is on the right. b) Schematic representation  of  the  signals  expected  during  Southern  blot  analyses  (DUR1,2  probe)  of recombinant yeasts containing the recombinant DUR1,2 cassette integrated into the URA3 locus. The DUR1,2 probe is illustrated with blue hatched lines (b).  BglII DUR1,2PGK1p PGK1tura3ura3 BglII 9085 bpDUR1,2BglII 5084 bpBglII a) b)   49        Figure 17. Disruption of the URA3 locus by integration of the DUR1,2 cassette in K7EC‐ and K9EC‐ was confirmed by Southern blot analyses using a URA3 probe (a). All faint bands that do not correspond to a size in the schematic representation were deemed to be non‐specific. For each sample, the agarose gel is shown on the left while the exposed film is on the right. b) Schematic representation  of  the  signals  expected  during  Southern  blot  analysis  (URA3  probe)  of recombinant  yeasts  containing  the  recombinant  DUR1,2  cassette  integrated  into  the  URA3 locus. The URA3 probe is illustrated with green hatched lines (b). BglIIDUR1,2PGK1p PGK1tura3ura3 BglII 3757 bpURA3BglII 4455 bpBglIIa) b)   50  3.1.2.2  Sake strains K7EC‐ and K9EC‐ do not contain the bla and Tn5ble antibiotic resistance markers. After transformation, K7EC‐ and K9EC‐ were successively sub‐cultured on a non‐selective medium in order to eliminate pUT332, whose only purpose was to facilitate early screening for transformants. A Southern blot using probes specific for bla (Ampicillin resistance) and Tn5ble (Phleomycin resistance) revealed that these genes were absent from K7EC‐ and K9EC‐ , as well as the parental strains K7 and K9 (Figure 18).   Figure 18. The genetically engineered strains K7EC‐ and K9EC‐ do not contain the bla and Tn5ble antibiotic resistance markers. The plasmid pUT332 was used as a positive control for both bla and Tn5ble. For each sample, the agarose gel is shown on the left while the exposed film is on the right.   51  3.1.2.3  Sequence of the DUR1,2 cassette integrated into the genomes of K7EC‐ and K9EC‐. To verify the sequence of the DUR1,2 cassette integrated into the URA3 locus, single strand DNA sequencing of the cassette in K7EC‐ and K9EC‐ was completed. In silico sequence assembly and subsequent analysis revealed one nucleotide in the cassette sequence of K9EC‐ that did not match the previously reported recombinant DUR1,2 sequences and/or SGD’s S288C DUR1,2 sequence (Table 8). The C to T switch (theoretical to sequenced data) at nucleotide position 821 is located within the 5’URA3 flanking region of the cassette and is likely due to a genetic polymorphism between the Sake strain K9 and the laboratory strain S288C. Comparison of the recombinant DUR1,2 ORF sequence in K7EC‐ and K9EC‐ and that of SGD revealed no nucleotide  changes  or  amino  acid  substitutions.  A  detailed  description  of  the  DNA  sequences  that comprise the DUR1,2 cassette is given in Table 9.  Table 8. Discrepancies between the integrated DUR1,2 cassette of K9EC‐ and published sequences.  Nucleotide position Description 821  Difference in the 5’ region of the URA3 open reading frame of K9EC‐C�T   Table 9. Detailed description of the DNA sequences that comprise the DUR1,2 cassette. Nucleotide position Description 1‐4  5’ SRF1 ½ site 5‐950  URA3 sequence 5‐508  5’ non coding sequence 509‐950  5’ part of URA3 ORF 951‐2445  PGK1 promoter 2446‐7953  DUR1,2 ORF 7954‐8235  PGK1 terminator 8236‐9187  URA3 sequence 8236‐8640  3’ part of URA3 ORF 8641‐9187  3’ non coding sequence 9188‐9191  3’ SRF1 ½ site  In silico analysis of the integrated DUR1,2 cassette revealed that two new ORFs were created during  construction  of  the  DUR1,2  cassette;  these  ORFs  were  composed  entirely  of  S.  cerevisiae sequences (Figure 19). Novel ORF1 (447 bp) is located at nucleotide position 509‐955 while novel ORF2 (792 bp) is located at position 767‐1558.   52    3.1.2.4  Confirmation of constitutive expression of DUR1,2 in K7EC‐ and K9EC‐ by qRT‐PCR. Total RNA from  yeast  cells  in  24  hour  fermentations  of  Chardonnay  must  was  used  to  confirm  and  quantify constitutive expression of DUR1,2 in K7EC‐ and K9EC‐. Integration of the DUR1,2 cassette in K7EC‐ and K9EC‐ up regulated DUR1,2 expression by 9.13‐fold and 12.77‐fold, respectively, compared to the parental strains K7 and K9 (Figure 20). Expression of DUR1,2 in K7EC‐ and K9EC‐ was detected in non‐inducing (NCR) conditions  indicating  that  the  PGK1  promoter  and  terminator  signals  are  effective  at  overcoming repression by NCR during fermentation.  Figure 19. A schematic representation of new ORFs of more than 100 codons generated during construction of the DUR1,2 cassette. Two new ORFs, entirely composed of S. cerevisiae sequences, were created.   Novel ORF2(792 bp) Novel ORF1 (447 bp) 5’ URA3  PGK1p  DUR1,25’ SRF1 ½ site PGK1t  3’ URA3  53  1.009.131.0012.77024681012141618K7 K7EC-K9 K9EC-StrainRelative quantification (fold)Relative quantification (fold) Figure 20. Gene expression analysis (qRT‐PCR) of K7, K7EC‐, K9, and K9EC‐ indicates functionality of the DUR1,2 cassette and constitutive expression of DUR1,2 in non‐inducing (NCR) conditions. Total RNA was extracted  from  yeast  cells  harvested  after  24  hour  fermentation  (20°C)  in  filter  sterilized  Calona Chardonnay  must  that  was  inoculated  to  a  final  OD600  =  0.1.  Total  RNA  was  subsequently  reverse transcribed, and the resultant cDNA was amplified in the presence of SYBR green dye. DUR1,2 gene expression was standardized to ACT1 expression and data for strains K7EC‐ and K9EC‐ were calibrated to their respective parental strain K7 and K9. Fermentations were conducted in triplicate and the data averaged; error bars represent 95% confidence intervals.    3.1.2.5  Effect of the integrated DUR1,2 cassette on the transcriptomes of K7EC‐ and K9EC‐. Total RNA from yeast cells in 24 hour fermentations of Chardonnay must was used analyze the impact of the integrated DUR1,2 cassette on global gene expression in K7EC‐. Reported changes in gene expression were cut off at a minimum 4‐fold change in expression (SLRAvg ≥ 2 or SLRAvg ≤ ‐2) to ensure elimination of experimental noise inherent in microarray analysis; this cut‐off is supported by the previously published statistical examination of a wine yeast’s transcriptome during fermentation (Marks, et al. 2008).  Integration of the DUR1,2 cassette into the URA3 locus of K7EC‐ had a minimal effect on the yeast’s transcriptome. DUR1,2 was upregulated by 6.35‐fold in K7EC‐; URA3 was downregulated by 2.35‐  54  fold but was not included in Table 10 as it fell below the 4‐fold cut off. Besides DUR1,2, two genes were upregulated greater than 4‐fold in K7EC‐ (Table 10); seven genes were downregulated more than 4‐fold in K7EC‐.  No  metabolic  pathways  were  affected  by  the  presence  of  the  integrated  DUR1,2  cassette; however,  integration  of  the  DUR1,2  cassette  downregulated  three  unrelated  genes  involved  in meiosis/sporulation (RME1, SSP1, SDS3) indicating a possible negative effect on sporulation efficiency (Table 10).    Table  10.  Effect of the integrated DUR1,2 cassette in the genome of K7 on global gene expression patterns in S. cerevisiae K7EC‐ (≥ 4‐fold change). Reported changes are relative to the parental strain K7. Total RNA from K7 and K7EC‐, harvested at 24 hours into fermentation of filter sterilized Chardonnay must, were used for hybridization to microarray. Fermentations were conducted in duplicate and the data were averaged (p≤0.005).   Genes expressed at higher levels in K7EC- Fold Change Gene Symbol Biological Process 6.60 RTG1 Transcription factor (bHLH) involved in interorganelle communication 6.35 DUR1,2 Urea amidolyase  4.23 HAC1 bZIP (basic-leucine zipper) protein involved in unfolded protein response Genes expressed at lower levels in K7EC- Fold Change Gene Symbol Biological Process -5.64 RME1 Zinc finger protein involved in control of meiosis -4.97 SEO1 Permease involved in methionine transport -4.67 MF(Alpha)1 Mating factor alpha -4.64 SSP1 Protein involved in the control of meiotic nuclear divisions and spore formation -4.21 SDS3 Protein involved in deactylase complex and transcriptional silencing during sporulation -4.16 CBP1 Protein required for Cytochrome B mRNA stability or 5’  processing -4.12 RUD3 Protein involved in organization of Golgi  3.1.3  Phenotypic characterization of K7EC‐ and K9EC‐  3.1.3.1  Fermentation rate of K7EC‐ and K9EC‐ in Chardonnay must. Fermentation profiles of the parental and metabolically engineered Sake yeasts are shown in Figures 21a,b. As is common in grape must, fermentations were robust and rapid (~400 hours). The fermentation profiles shown in Figures 21a,b indicate substantial equivalence amongst the parent and engineered strains as far as fermentation rate is concerned.    55   0.002.004.006.008.0010.0012.0014.0016.0018.000 100 200 300 400 500Time (Hours)Weight loss (g)K7K7EC‐ 0.002.004.006.008.0010.0012.0014.0016.0018.000 100 200 300 400 500Time (Hours)Weight loss (g)K9K9EC‐ Figure  21.  Fermentation  profiles  (weight  loss)  of  parental  and  DUR1,2  engineered  Sake  strains  in Chardonnay wine. Chardonnay wine was produced by inoculating Sake yeast strains (a) K7 and K7EC‐ and (b)  K9  and  K9EC‐ into  unfiltered  Calona  Chardonnay  must  (final  OD600  =  0.1).  Fermentations  were incubated to completion (~400 hours) at 20°C. Fermentations were conducted in triplicate and the data were averaged; error bars indicate one standard deviation.   3.1.3.2  Fermentation rate of K7EC‐ and K9EC‐ in Sake mash. Fermentation profiles of the parental and metabolically engineered Sake yeasts are shown in Figures 22a,b. In contrast to the fermentations of a) b)   56  Chardonnay must in Section 3.1.3.1, Sake fermentations were less robust, and slower (~600 hours to completion). The fermentation profiles shown in Figures 22a,b indicate substantial equivalence amongst the parent and engineered strains as far as fermentation rate is concerned. 0.002.004.006.008.0010.0012.0014.0016.0018.0020.000 100 200 300 400 500 600Time (Hours)Weight loss (g)K7K7EC‐ 0.002.004.006.008.0010.0012.0014.0016.0018.0020.000 100 200 300 400 500 600Time (Hours)Weight loss (g)K9K9EC‐ Figure 22. Fermentation profiles (weight loss) of parental and DUR1,2 engineered Sake strains in Sake wine. Sake wine was produced by inoculation (final OD600 = 0.1) of Sake yeast strains (a) K7 and K7EC‐ and (b) K9 and K9EC‐ into white rice (Kokako Rose) and koji mash (Vision Brewing). Fermentations were incubated to completion (~600 hours) at 18°C. Fermentations were conducted in triplicate and data averaged; error bars indicate one standard deviation.  3.1.3.3  Utilization of glucose and fructose and production of ethanol by K7EC‐ and K9EC‐ in Sake wine. The effect of the DUR1,2 cassette on glucose and fructose utilization as well as ethanol production in a) b)   57  strains K7EC‐ and K9EC‐ was investigated. Glucose, fructose and ethanol were quantified by LC analysis at the end of fermentation. Compared to their respective parental strains, K7EC‐ and K9EC‐ produced Sake wine with substantially equivalent amounts of residual glucose, residual fructose and ethanol (Table 11).  Table 11. Utilization of glucose and fructose and production of ethanol in Sake wine by parental yeast strains  (K7  and  K9),  their  metabolically  engineered  counterparts  (K7EC‐  and  K9EC‐).  Sake  wine  was produced by inoculation of Sake yeast strains, K7, K7EC‐, K9 and K9EC‐ in white rice (Kokako Rose) and koji mash (Vision Brewing). Fermentations (Figures 22a,b) were incubated to completion (~600 hours) at 18°C. Glucose and fructose (g/L) and ethanol (v/v) were quantified at the end of fermentation. Data were analyzed for statistical significance (p≤0.05) using two factor ANOVA analysis.                    3.1.4  Constitutive expression of DUR1,2 in Sake yeast strains K7EC‐ and K9EC‐ reduces EC in Chardonnay wine by approximately 30%   In order to assess the effect of the DUR1,2 cassette on EC reduction in Chardonnay wine, K7EC‐ and K9EC‐ were used to ferment Chardonnay must, and EC content was measured in the resultant wine.   Glucose   K7  K7EC‐  p*K9  K9EC‐  p* Replicate 1  0.059  0.056  ‐‐  0.057  0.102  ‐‐ Replicate 2  0.066  0.056  ‐‐  0.114  0.103  ‐‐ Replicate 3  0.059  0.051  ‐‐  0.072  0.090  ‐‐ Residual glucose average (n=3)  0.06  0.05  ns 0.08  0.10  ns STDEV  0.00  0.00  ‐‐  0.03  0.01  ‐‐      Fructose   K7  K7EC‐  p*K9  K9EC‐  p* Replicate 1  0.736  0.733  ‐‐  0.333  0.242  ‐‐ Replicate 2  0.841  0.752  ‐‐  0.271  0.361  ‐‐ Replicate 3  0.374  0.665  ‐‐  0.338  0.303  ‐‐ Residual fructose average (n=3) 0.65  0.72  ns 0.31  0.30  ns STDEV  0.25  0.05  ‐‐  0.04  0.06  ‐‐      Ethanol   K7  K7EC‐  p*K9  K9EC‐  p* Replicate 1  12.23  12.49  ‐‐  12.71  13.22  ‐‐ Replicate 2  12.27  12.64  ‐‐  13.59  12.71  ‐‐ Replicate 3  11.95  11.93  ‐‐  13.05  12.17  ‐‐ Ethanol average (n=3)  12.15  12.35 ns 13.12  12.70  ns STDEV  0.17  0.37  ‐‐  0.44  0.53  ‐‐ * si, ns: significant at p≤0.05, or non‐significant   58  Fermentation profiles of the parental and metabolically engineered Sake yeasts are shown in Figures 21a,b.  In contrast to the usually high amounts of EC found in Sake wine, during laboratory scale wine fermentations the parental Sake strains K7 and K9 produced relatively low amounts of EC, 64.87 and 56.16  ppm,  respectively  (Table  12);  the  engineered  strains  K7EC‐ and  K9EC‐  reduced  by  EC  in  the Chardonnay wine by 29.88% and 0%, respectively.  Table 12. Reduction of EC by functionally enhanced yeast strains K7EC‐ and K9EC‐ during wine making. The concentration of EC (µg/L) in Chardonnay wine produced by Sake yeast strains K7, K7EC‐, K9, and K9EC‐ was quantified by GC/MS. Strains were inoculated (final OD600 = 0.1) into unfiltered Calona Chardonnay must and fermentations were incubated to completion (~350 hours) at 20°C. Fermentation profiles are given in Figure 21.  Yeast strain  K7  K7EC‐  K9  K9EC‐ Replicate 1  69.05  46.3  56.13  55.18 Replicate 2  63.62  42.94  ‐‐  ‐‐ Replicate 3  61.93  47.21  ‐‐  ‐‐ Average (n=3)  64.87  45.48  56.16  55.18 STDEV  3.72  2.25  ‐‐  ‐‐ RSD (%)  5.73  4.94  ‐‐  ‐‐ Reduction (%)  ‐‐  29.88  ‐‐  ~0   3.1.5  Constitutive expression of DUR1,2 in Sake yeast strains K7EC‐ and K9EC‐ reduces EC in Sake wine by approximately 68%   To assess the effect of the DUR1,2 cassette on EC reduction in Sake wine, K7EC‐ and K9EC‐ were used to ferment Sake rice mash (rice and koji), and EC content was measured in the resultant Sake wine. Fermentation profiles of the parental and metabolically engineered Sake yeasts are shown in Figures 22a,b.   During laboratory scale Sake wine fermentations the parental Sake strains K7 and K9 produced significantly more EC (211.19 and 344.16 ppm, respectively ‐ Table 13) than during wine fermentations (Table 12). In Sake wine, the engineered strains K7EC‐ and K9EC‐ reduced by EC by 67.54% and 68.33%, respectively (Table 13), making K7EC‐ and K9EC‐ much more effective at EC reduction in Sake wine than in   59  Chardonnay wine. Given the substantial difference in EC production and reduction by identical strains, it seems imperative that yeast strains be evaluated in their native environment to accurately assess the efficacy of the DUR1,2 cassette.  Table 13. Reduction of EC by functionally enhanced yeast strains K7EC‐ and K9EC‐ during Sake brewing. The concentration of EC (µg/L) in Sake wine, produced by inoculation (final OD600 = 0.1) of Sake yeast strains  K7,  K7EC‐,  K9,  and  K9EC‐  into  white  rice  (Kokako  Rose)  and  koji  mash  (Vision  Brewing),  was quantified  by  GC/MS.  Fermentations  were  incubated  to  completion  (~600  hours)  at  18°C  and fermentation profiles are given in Figure 22.         3.2  Constitutive expression of DUR3 in the Sake yeast strain K7 and the wine yeast strain 522   3.2.1  Sequence of pUCMD  A multicopy episomal plasmid containing the DUR3 ORF inserted between the PGK1 promoter and terminator signals flanked by TRP1 sequences was constructed; kanMX served as a selective marker in  pUCMD  (Figure  14).  Single  strand  sequencing  revealed  this  plasmid  contained  the  desired  DNA fragments in the correct order and orientation. Furthermore, in  silico assembly of the DUR3 coding region in pUCMD revealed that the DUR3 ORF was identical in amino acid sequence and length to that published on SGD.  Aligning the sequence data of the DUR3 cassette with the expected sequence revealed nine single nucleotide changes along the length of the cassette (Table 14), which are highlighted in a DNA sequence  alignment  between  of  S288C  and  pUCMD  (Figure  23).  A  detailed  description  of  the  DNA sequences that comprise the DUR3 cassette is given in Table 15.   Yeast strain  K7  K7EC‐  K9  K9EC‐ Replicate 1  224.11  72.5  241.73  108.92 Replicate 2  198.7  79.28  265.01  105.96 Replicate 3  210.75  53.85  525.74  112.15 Average (n=3)  211.19  68.54  344.16  109.01 STDEV  12.71  13.17  157.68  3.10 RSD (%)  6.02  19.22  45.82  2.84 Reduction (%)  ‐‐  67.54  ‐‐  68.33   60  Table 14. Discrepancies between the DUR3 cassette in pUCMD and published sequences. Nucleotide mismatches are designated as ‘X� Y’, meaning that the predicted nucleotide ‘X’ has been sequenced as ‘Y’. The DNA alignment of S288C and pUCMD is given in Figure 23.  Nucleotide position Region of cassette  Description 928  PGK1 promoter  C�T  999  PGK1 promoter  C�T 1230  PGK1 promoter  C�T 1491  PGK1 promoter  C�T 1494  PGK1 promoter  G�A 3524  DUR3 ORF  G�C: Silent 3821  DUR3 ORF  T�C: Silent 3970  DUR3 ORF  G�A: Silent 4160  DUR3 ORF  A�C: Silent  Table 15.  Detailed description of the DNA sequences that comprise the DUR3 cassette.  Nucleotide position Description 1‐6  5’ Apa1 restriction site 7‐291  5’ TRP1 sequence 292‐475  pHVXKD3 vector sequence from cloning strategy 476‐1976  PGK1 promoter 1977‐4184  DUR3 ORF 4185‐4467  PGK1 terminator 4468‐4535  pHVXKD3 vector sequence from cloning strategy 4536‐4933  kanMX promoter 4934‐5743  kanMX ORF 5744‐5992  kanMX terminator 5993‐6120  pHVXKD3 vector sequence from cloning strategy 6121‐6510  3’ TRP1 sequence 6511‐6516  3’ Apa1 restriction site                 61  Alignment of DNA sequences: S288C and pUCMD  Upper line: S288C, from 1 to 6515 Lower line: pUCMD, from 1 to 6515  Data identity= 99%  901   TAGCATACAATTAAAACATGGCGGGCACGTATCATTGCCCTTATCTTGTGCAGTTAGACG       ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| 901   TAGCATACAATTAAAACATGGCGGGCATGTATCATTGCCCTTATCTTGTGCAGTTAGACG  961   CGAATTTTTCGAAGAAGTACCTTCAAAGAATGGGGTCTCATCTTGTTTTGCAAGTACCAC       |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| 961   CGAATTTTTCGAAGAAGTACCTTCAAAGAATGGGGTCTTATCTTGTTTTGCAAGTACCAC              ------------------------------------------------------------       ---------------CONTINUATION OF PGK1 PROMOTER----------------       ------------------------------------------------------------  1201  TCAAGACGCACAGATATTATAACATCTGCACAATAGGCATTTGCAAGAATTACTCGTGAG       |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| 1201  TCAAGACGCACAGATATTATAACATCTGCATAATAGGCATTTGCAAGAATTACTCGTGAG        ------------------------------------------------------------       ---------------CONTINUATION OF PGK1 PROMOTER----------------       ------------------------------------------------------------  1441  CCGTCGCTCGTGATTTGTTTGCAAAAAGAACAAAACTGAAAAAACCCAGACACGCTCGAC       |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| 1441  CCGTCGCTCGTGATTTGTTTGCAAAAAGAACAAAACTGAAAAAACCCAGATACACTCGAC  1501  TTCCTGTCTTCCTATTGATTGCAGCTTCCAATTTCGTCACACAACAAGGTCCTAGCGACG       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1501  TTCCTGTCTTCCTATTGATTGCAGCTTCCAATTTCGTCACACAACAAGGTCCTAGCGACG              ------------------------------------------------------------       ----CONTINUATION OF PGK1 PROMOTER AND START OF DUR3 ORF-----       ------------------------------------------------------------  3481  CTTTGCTATCACCAGCCATTTTTATTCCTATTTTAACGTATGTGTTTAAGCCACAAAATT       ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| 3481  CTTTGCTATCACCAGCCATTTTTATTCCTATTTTAACGTATGTCTTTAAGCCACAAAATT        ------------------------------------------------------------       ---------------CONTINUATION OF DUR3 ORF---------------------       ------------------------------------------------------------  3781  TACAAAATGAATTAGACGAAGAACAAAGAGAACTAGCACGTGGTTTAAAAATTGCATACT       |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| 3781  TACAAAATGAATTAGACGAAGAACAAAGAGAACTAGCACGCGGTTTAAAAATTGCATACT  3841  TCCTATGTGTTTTTTTCGCTTTGGCATTTTTGGTAGTTTGGCCCATGCCCATGTATGGTT       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 3841  TCCTATGTGTTTTTTTCGCTTTGGCATTTTTGGTAGTTTGGCCCATGCCCATGTATGGTT  3901  CCAAATATATCTTCAGTAAAAAATTCTTTACCGGTTGGGTTGTTGTGATGATCATCTGGC       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 3901  CCAAATATATCTTCAGTAAAAAATTCTTTACCGGTTGGGTTGTTGTGATGATCATCTGGC  3961  TTTTTTTCAGTGCGTTTGCCGTTTGTATTTATCCACTCTGGGAAGGTAGGCATGGTATAT   62        ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| 3961  TTTTTTTCAGTGCATTTGCCGTTTGTATTTATCCACTCTGGGAAGGTAGGCATGGTATAT  4021  ATACCACTTTGCGAGGCCTTTACTGGGATCTATCTGGTCAAACTTATAAATTAAGGGAAT       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 4021  ATACCACTTTGCGAGGCCTTTACTGGGATCTATCTGGTCAAACTTATAAATTAAGGGAAT  4081  GGCAAAATTCGAACCCACAAGATCTGCATGTAGTAACAAGCCAAATTAGTGCGAGAGCAC       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 4081  GGCAAAATTCGAACCCACAAGATCTGCATGTAGTAACAAGCCAAATTAGTGCGAGAGCAC  4141  ATAGACAATCATCACATTTCGGACAAGTTGATGAAATAATTTAGCTCGAGGATTGAATTG       |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| 4141  ATAGACAATCATCACATTTCGGCCAAGTTGATGAAATAATTTAGCTCGAGGATTGAATTG  4201  AATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAATA       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 4201  AATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAATA  Figure 23.  DNA sequence alignment of S288C and pUCMD revealed nine discrepancies along the length of DUR3 cassette. The sequence obtained from S288C is shown in the upper line and the sequence of the DUR3 cassette in pUCMD is shown in the lower line. Only a partial sequence of the DUR3 cassette is displayed.  The  PGK1  promoter  is  shown  in  green,  the  DUR3  ORF  is  shown  in  black,  and  the  PGK1 terminator is shown in blue. Nucleotide mismatches are highlighted in bold and red, and are underlined. In the DUR3 ORF, mismatches are oriented within their respective codons  by underlining; the stop codon is italicized.    In silico analysis of the integrated DUR3 cassette revealed that two new ORFs were created during construction of the DUR3 cassette; these ORFs were composed of a mixture of S.  cerevisiae sequence and pHVXK vector sequence (Figure 24). Novel ORF1 (324 bp) is located at nucleotide position 7‐330 while novel ORF2 (621 bp) is located at position 463‐1083. Figure  24.  A  schematic  representation  of  new  ORFs  of  more  than  100  codons  generated  during construction of the DUR3 cassette. Two new ORFs, composed of a mixture of S. cerevisiae sequence and pHVXK vector sequence, were created. Novel ORF2 (621 bp) Novel ORF1 (324 bp) 5’ TRP1  PGK1p  kanMX  3’ TRP1PGK1tDUR3 kanMXp  kanMXt5’ Apa1 site  3’ Apa1 site  63  3.2.2  Integration of the linear DUR3 cassette into the genomes of yeast strains K7, K7EC‐, K9, and K9EC‐ To constitutively express DUR3, the linear DUR3 cassette (Figure 25) was transformed into Sake yeast strains K7 and K7EC‐, and the wine strains 522 and 522EC‐. Following positive selection on a G418 medium and sub‐culturing, the eight strains listed in Table 16 were obtained.  Table 16. Recombinant yeast strains created by integration of the DUR3 cassette into the TRP1 locus. The  designation  ‘EC‐‘  corresponds  to  integration  of  the  DUR1,2  cassette  while  ‘D3’  corresponds  to integration of the DUR3 cassette. ‘EC‐D3’ designates integration of both cassettes.  Genetic modification Parent strain K7  522 Wild type  K7  522 DUR1,2  K7EC‐  522EC‐ DUR3  K7D3  522D3 DUR1,2/DUR3  K7EC‐D3  522EC‐D3  3.2.3  Genetic characterization of K7D3, K7EC‐D3, 522D3, and 522EC‐D3  3.2.3.1  Correct integration of the DUR3 cassette into the genomes of K7D3, K7EC‐D3, 522D3, and 522EC‐D3. A Southern blot, using EcoR1 digested genomic DNA and PCR created DUR3 and TRP1 probes (Figure 26), was performed on each of the recombinant yeast strains to assess proper integration of the DUR3 cassette into the genome. The DUR3 and TRP1 probes are schematically represented in Figures 27a,b.    In each of the recombinant yeast strains, two signals corresponding to 2.4 kb and 4.7 kb, were detected when probed for DUR3 (Figure 26). The 2.4 kb fragment matches the expected fragment size for the native DUR3 locus while the 4.7 kb fragment matches the expected size for the recombinant TRP1‐PGK1p‐DUR3‐PGK1t‐kanMX‐TRP1  locus.  In  strains  that  did  not  carry  the  recombinant  DUR3 cassette, only the 2.4 kb signal was detected.  Figure 25. Schematic representation of the linear DUR3 cassette.  TRP1  PGKp  kanMX  TRP1 PGKt DUR3 Apa1 site  Apa1 site   64   When probed for TRP1, three signals, corresponding to 1.5 kb, 3.0 kb and 4.7 kb, were detected in  each  of  the  strains  containing  the  recombinant  DUR3  cassette  (Figure  26).  The  1.5  kb  fragment matches  the  expected  fragment  size  for  a  non‐disrupted  TRP1  locus,  while  the  3.0  kb  and  4.7  kb fragments are in accordance with the presence of the recombinant DUR3 cassette integrated into the TRP1 locus.   Unexpectedly, when any of the K7 derived strains, except for K7EC‐D3, were probed for DUR3, a novel signal was detected at ~3.5 kb (Figure 26). This fragment corresponds to the disappearance of the 2.4 kb band that represents the native DUR3 locus. This result was confirmed by sequencing to be caused by a restriction fragment length polymorphism (RFLP) between 522 and K7. The DUR3 locus in K7 is mutated such that it no longer contains the EcoR1 site within the coding region (Figure 28) and, as a Figure 26. Integration of the DUR3 cassette into the TRP1 locus of 522D3, 522EC‐D3, K7D3, and K7EC‐D3 was confirmed  by  Southern  blot  analysis using  DUR3  and  TRP1  probes.  Approximately  1  µg  of  EcoR1 digested genomic DNA from 522 (lane #1), 522D3 (lane #2), 522EC‐D3 (lane #3), K7 (lane #4), K7EC‐ (lane #5), K7D3 (lane #6), and K7EC‐D3 (lane #7) was probed with either DUR3 or TRP1. In lane #5 less DNA was accidentally loaded thus accounting for the faint band pattern. All faint bands that did not correspond to a size in the schematic representation were deemed to be non‐specific binding.  4680 bp DUR3 probe TRP1 probe 1452 bp 3088 bp 4680 bp 2444 bp ~ 3500 bp 1    2    3     4    5    6  7 1   2   3    4    5    6    7   65  EcoR1 a) DUR3 PGK1p trp1 trp1 PGK1t DUR3 EcoR1 2444 bp EcoR1 EcoR1 4680 bp  EcoR1 3088 bp EcoR1 DUR3 PGK1p trp1 trp1 PGK1t TRP1 EcoR1 1452 bp EcoR1 EcoR1 4680 bp  b) result, the native DUR3 locus in K7 produced a larger signal (~3500 bp). By integrating a copy of DUR3 derived from 522, which contains the internal EcoR1 site, a recombinant locus was created which gives rise to the same band pattern seen in 522. Although this RFLP should have been observed in K7EC‐D3 it was not and therefore warrants further investigation.         Figure  27.  Schematic  representation  of  the  signals  expected  during  Southern  blot  analysis  of recombinant  yeasts  containing  the  recombinant  DUR3  cassette  integrated  into  the  TRP1  locus. Expected signals during  Southern  blotting with  the DUR3 probe (drawn in green)  (a). Expected signals during Southern blotting with the TRP1 probe (drawn in red) (b).    66  Alignment of DNA sequences: S288C, 522, K7 (1‐240 bp DUR3)   S288C      ATGGGAGAATTTAAACCTCCGCTACCTCAAGGCGCTGGGT     40 522        ......................cAtCcaggGGCGCTGGGa     18 K7         ............cAACaaaCcCcctactcAGGCGCTGGGT     28  S288C      ACGCTATTGTATTGGGCCTAGGGGCCGTATTTGCAGGAAT     80 522        .CGCTATTGTATTGGGCCTAGGGGCCGTATTTGCAGGAAT     57 K7         .CGCTATTGTATTGGGCCTAGGGGCCGTATTTGCAGGAAT     67  S288C      GATGGTTTTGACCACTTATTTACTGAAACGTTATCAAAAG    120 522        GATGGTTTTGACCACTTATTTACTGAAACGTTATCAAAAG     97 K7         GATGGTTTTGACCACTTATTTACTGAAACGTTATCAAAAG    107  S288C      GAAATCATCACAGCAGAAGAATTCACCACCGCCGGTAGAT    160 522        GAAATCATCACAGCAGAAGAATTCACCACCGCCGGTAGAT    137 K7         GAAATCATCACAGCAGAAGAATTtACCACCGCCGGcAGAT    147  S288C      CTGTAAAAACCGGCTTAGTGGCTGCAGCCGTGGTTTCTAG    200 522        CTGTAAAAACCGGCTTAGTGGCTGCAGCCGTGGTTTCTAG    177 K7         CTGTAAAAACCGGCTTAGTGGCTGCcGCCGTGGTTTCTAG    187  S288C      TTGGATCTGGTGTTCTACATTGTTAACGTCGTCAACAAAG    240 522        TTGGATCTGGTGTTCTACATTGTTAACGTCGTCAACAAAG    217 K7         TTGGATCTGGTGTTCTACATTGTTAACGTCGTCAACAAAG    227  Figure 28. Alignment of the DNA sequences of S288C, 522, and K7 confirmed the presence of a mutant EcoR1 site in the DUR3 coding region of K7. Only a partial sequence of DUR3 is displayed. The EcoR1 site in question is displayed in red; other mismatches revealed by sequencing are highlighted in blue.   3.2.3.2  Confirmation of constitutive expression of DUR3 in K7D3 and K7EC‐D3 by northern blotting. In order  to  assess  the  constitutive  expression  of  DUR3  from  the  DUR3  cassette  in  K7D3  and  K7EC‐D3,  a northern blot was performed using PCR generated probes for HHF1 (Histone H4) and DUR3 on freshly harvested total RNA from K7, K7EC‐, K7D3, and K7EC‐D3. Identical signals matching the predicted transcript size for HHF1 (312 bp) were observed in all of the strains tested (Figure 29), indicating an abundance of un‐degraded mRNA in the samples. Signals, which matched the predicted transcript size (2208 bp) for DUR3, were observed in strains K7D3 and K7EC‐D3 when probed for DUR3 (Figure 29), thus confirming constitutive  expression  of  DUR3  in  non‐inducing  conditions  as  a  result  of  integration  of  the  DUR3 cassette. No DUR3 signal was detected in K7 or K7EC‐ confirming that DUR3 mRNA is absent during fermentation due to repression by NCR.    67                3.2.3.3  Quantification of constitutive DUR3 expression in K7D3 and K7EC‐D3 by qRT‐PCR. Expression of DUR3 and DUR1,2 was verified and quantified by qRT‐PCR analysis of cDNA reverse transcribed from the total RNA of K7, K7EC‐, K7D3, and K7EC‐D3.  Analyses were performed on the same RNA samples as in Section 3.2.3.2.  The PGK1 promoter and terminator signals resulted in high level expression, under non‐inducing (NCR) conditions, of both the DUR1,2 and DUR3 genes in the integrated cassettes (Figure 30); DUR1,2 was upregulated 11.8‐fold in K7EC‐ while DUR3 was upregulated 22.1‐fold in K7D3. High level expression of both DUR1,2 and DUR3 (17.3‐fold and 11.5‐fold, respectively) was sustained in K7EC‐D3, when both DUR1,2 and DUR3 were integrated into the genome.    In strains in which only one cassette (DUR1,2 or DUR3) was integrated, constitutive expression of that gene induced expression of the other (Figure 30). Constitutive expression of DUR1,2 in K7EC‐ Figure 29. Constitutive expression of DUR3 (2208 bp) was confirmed by northern blot analysis of K7, K7EC‐, K7D3, K7EC‐D3. Total RNA (30 µg) was harvested from 24 hour fermentations of Calona Chardonnay must inoculated to a final OD600 = 0.1, separated on a 1% agarose‐formaldehyde gel and probed for both the loading control HHF1 and DUR3.  K7 K7EC‐ K7D3 K7EC‐D3 K7 K7EC‐ K7D3 K7EC‐D3 DUR3HHF1312bp 2208bp   68  induced expression of DUR3 by 3.78‐fold. Likewise, constitutive expression of DUR3 in K7D3 induced expression of DUR1,2 by 3.61‐fold.  1.009.263.6111.821.003.7814.197.10024681012141618K7 K7EC-K7D3K7EC-D3StrainRelative quantification (fold)DUR1,2DUR3Relative quantification (fold) Figure 30. Analyses of gene expression (qRT‐PCR) of K7, K7EC‐, K7D3, and K7EC‐D3 confirmed functionality of the DUR3 cassette and constitutive expression of DUR1,2 and DUR3 in non‐inducing (NCR) conditions. Total RNA was extracted from cells harvested after 24 hour fermentation (20°C) in filter sterilized Calona Chardonnay  must  that  was  inoculated  to  a  final  OD600  =  0.1.  Total  RNA  was  subsequently  reverse transcribed, and the resultant cDNA was amplified in the presence of SYBR green dye. DUR1,2 and DUR3 gene expression was standardized to ACT1 expression and data for K7EC‐, K7D3, K7EC‐D3 was calibrated to the parental strain K7. Fermentations were conducted in triplicate and the data averaged; error bars represent 95% confidence intervals.   3.2.3.4  Effect of the integrated DUR3 cassette on the transcriptome of K7D3. Total RNA from yeast cells isolated from 24 hour fermentations in Chardonnay must was used analyze the impact of the integrated DUR3 cassette on global gene expression in K7D3. Reported changes in gene expression were cut off at a minimum 4‐fold change in expression (SLRAvg ≥ 2 or SLRAvg ≤ ‐2) to ensure elimination of experimental noise inherent in microarray analysis; this cut‐off is supported by the previously published statistical examination of a wine yeast’s transcriptome during fermentation (Marks, et al. 2008).     69  Integration of the DUR3 cassette into the TRP1 locus of K7D3 had a minimal effect on the yeast’s transcriptome. DUR3 was upregulated by 36.95‐fold in K7D3; TRP1 was downregulated by 1.25‐fold but was  not  included  in  Table  17  as  it  fell  below  the  4‐fold  cut  off.  Besides  DUR3,  three  genes  were upregulated  greater  than  4‐fold  in  K7D3  (Table  17);  one  gene  (HAC1)  was  common  to  both  of  the engineered strains K7EC‐ and K7D3 (Tables 10 and 17). Four genes were downregulated more than 4‐fold in K7D3. Despite falling below the 4‐fold cut off, one gene (RUD3) was included in Table 17 because it was common to the list of genes downregulated in both K7EC‐ and K7D3 (Tables 10 and 17) and because it is very close to the 4‐fold cut off. No metabolic pathways were affected by the presence of the integrated DUR3  cassette;  however,  integration  of  the  DUR3  cassette  upregulated  one  gene  (FIG1)  and downregulated  one  gene  (TID3)  involved  in  meiosis/sporulation  indicating  a  possible  effect  on meiosis/sporulation efficiency (Table 17).    Table 17. Effect of the integrated DUR3 cassette in the genome of K7 on global gene expression patterns in S. cerevisiae K7D3 (≥ 4‐fold change). Reported changes are relative to the parental strain K7. Total RNA from K7 and K7D3, harvested at 24 hours into fermentation of filter sterilized Chardonnay must, were used for hybridization to microarrays. Fermentations were conducted in duplicate and the data were averaged (p≤0.005).   Genes expressed at higher levels in K7D3 Fold Change Gene Symbol Biological Process 36.95 DUR3 Urea permease 5.67 HAC1 bZIP (basic-leucine zipper) protein involved in unfolded protein response 4.93 BRN1 Protein required for chromosome condensation 4.24 FIG1 Integral membrane protein required for efficient mating and low affinity Ca2+ transport Genes expressed at lower levels in K7D3 Fold Change Gene Symbol Biological Process -8.18 TID3 Meiotic protein required for synapsis and meiotic recombination; interaction partner with DMC1p -7.31 SNT309 Splicing factor protein -5.98 TOA1 Transcription factor IIA, large chain -3.98 RUD3 Protein involved in organization of Golgi  3.2.4  Recombinant strains K7D3 and K7EC‐D3 exhibit highly enhanced urea uptake ability in conditions of strong NCR  Radiolabelled 14C‐urea uptake assays were performed to confirm constitutive urea uptake as a result of integration of the DUR3 cassette.   70  The parental Sake strain K7, and the recombinant yeast K7EC‐ containing the DUR1,2 cassette integrated into the URA3 locus, failed to incorporate any significant amount of radiolabelled urea in a minimal medium containing 1% (w/v) ammonium sulphate (Figure 31). This is likely due to the NCR of the DUR genes in the presence of the preferred nitrogen source (ammonium sulphate). In contrast, K7D3 and K7EC‐D3 were highly efficient at urea uptake (Figure 31), confirming that integration of the DUR3 cassette results in the production of a functional protein that localizes to the yeast plasma membrane, and that control of DUR3 by the PGK1 promoter and terminator signals is capable of overcoming native repression by NCR.  A significant difference in the urea uptake rates of K7D3 and K7EC‐D3 was observed (Figure 31), despite integration of identical DUR3 cassettes in both strains. The observed difference in urea uptake between K7D3 and K7EC‐D3 can be explained by the need for urea degradation (DUR1,2p) after its import by the cell. While DUR1,2 must be induced and then synthesized in K7D3, DUR1,2p is constitutively expressed in K7EC‐D3 leading to rapid degradation of urea to which might mask an increased uptake; the radiolabel would be quickly lost as 14CO2.    71   Figure  31.  Uptake of 14C‐urea by K7, K7EC‐, K7D3 and K7EC‐D3 under conditions of NCR.  Strains were cultured (final OD600 = 1) in a 1% (w/v) ammonium sulphate minimal medium prior to exposure to 0.27 mM 14C‐urea (6.8 mCi/mmol). Assays were conducted in triplicate and the data averaged; error bars represent one standard deviation.   When compared to either K7D3 or K7EC‐D3, both K7 and K7EC‐ exhibited relatively poor urea uptake under the conditions tested (Figure 31). In order to differentiate between K7 and K7EC‐, Figure 31 was modified by significantly reducing the scale of the Y‐axis; the maximum value of the Y‐axis was reduced from 7.0 nmole (Figure 31) to 0.1 nmole (Figure 32). K7 was capable of accumulating significantly more urea than K7EC‐ (Figure 32), probably due to the constitutive expression of DUR1,2 in K7EC‐; 14C‐urea might be actively degraded as it is imported into the cell thus giving the illusion that transport is less efficient. This phenomenon was also observed when the abilities of K7D3 and K7EC‐D3 to transport urea into the cell were compared (Figure 31).    72    Figure 32. Uptake of 14C‐urea by K7 and K7EC‐ under conditions of NCR. Strains were cultured (final OD600 = 1) in a 1% (w/v) ammonium sulphate minimal medium prior to exposure to 0.27 mM 14C urea (6.8 mCi/mmol).  Assays  were  conducted  in  triplicate  and  the  data  averaged;  error  bars  represent  one standard deviation.   3.2.5  Recombinant strains K7D3 and K7EC‐D3 exhibit highly enhanced urea uptake ability in conditions of NCR de‐repression  Radiolabelled 14C‐urea  uptake  assays  were  performed  in  order  to  assess  the  ability  of engineered  strains  containing  the  integrated  DUR3  cassette  to  uptake  urea  under  non‐repressive conditions.    73  Both  the  parental  Sake  strain  K7,  and  the  recombinant  yeast  K7EC‐  containing  the  DUR1,2 cassette integrated into the URA3 locus, did not incorporate any significant amount of 14C‐urea in a minimal medium containing 1% (w/v) L‐proline (Figure 33). This result, which parallels the inability of K7 and K7EC‐ to incorporate 14C‐urea in an ammonium sulphate minimal medium (Figure 31), is likely due to the slow induction and membrane trafficking of functional DUR3p. In contrast, K7D3 and K7EC‐D3 were highly efficient at urea uptake (Figure 33), confirming that integration of the DUR3 cassette results in the production  of  a  functional  protein,  and  that  transcription  of  DUR3  from  the  PGK1  promoter  and terminator signals is strong regardless of NCR state.     Figure  33.  Uptake  of 14C‐urea  by  K7,  K7EC‐,  K7D3  and  K7EC‐D3 under  conditions  of  NCR  de‐repression. Strains were cultured (final OD600 = 1) in a 1% (w/v) L‐proline minimal medium prior to exposure to 0.27 mM 14C urea (6.8 mCi/mmol). Assays were conducted in triplicate and the data averaged; error bars represent one standard deviation.   74  When compared to either K7D3 or K7EC‐D3, both K7 and K7EC‐ exhibited relatively poor urea uptake under conditions of NCR de‐repression (Figure 33), K7 was capable of accumulating significantly more urea than K7EC‐ (Figure 34). To differentiate between K7 and K7EC‐, Figure 33 was modified by reducing the scale of the Y‐axis; the maximum value of the Y‐axis was reduced from 7.0 nmole (Figure 33) to 0.1 nmole (Figure 34). K7 was capable of accumulating significantly more urea than K7EC‐ (Figure 34); 14C‐urea might be actively degraded as it is imported into K7EC‐ where DUR1,2 is constitutively expressed, thus masking the strain’s true ability to import urea.   Figure  34.  Uptake  of 14C‐urea  by  K7  and  K7EC‐ under  conditions  of  NCR  de‐repression. Strains  were cultured (final OD600 = 1) in a 1% (w/v) L‐proline minimal medium prior to exposure to 0.27 mM 14C urea (6.8 mCi/mmol). Assays were conducted in triplicate and the data averaged; error bars represent one standard deviation.    75  3.2.6  Phenotypic characterization of K7D3, K7EC‐D3, 522D3, and 522EC‐D3  3.2.6.1  Fermentation rate of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Chardonnay wine. The fermentation profiles of the parental and metabolically engineered strains are shown in Figures 35a,b. The robust fermentations were completed within 300 hours, and the fermentation rates of all but one engineered strain closely matched those of their respective parental strains, thus indicating substantial equivalence.  The engineered strain K7EC‐D3 completed the fermentation by approximately 200‐250 hours while the strains K7EC‐, and K7D3 required 300 hours to finish; the parental strain K7 also required 300 hours to complete the fermentation.     76  0.005.0010.0015.0020.0025.000 50 100 150 200 250 300 350Time (Hours)Weight loss (g)K7K7 EC‐K7 D3K7 EC‐D3 0.005.0010.0015.0020.0025.000 50 100 150 200 250 300 350Time (Hours)Weight loss (g)522522 EC‐522 D3522 EC‐D3 Figure 35. Fermentation profiles (weight loss) of (a) Sake yeast strains K7, K7EC‐, K7D3, and K7EC‐D3 and (b) wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 in Chardonnay wine. Chardonnay wine was produced from unfiltered Calona Chardonnay must inoculated to a final OD600 = 0.1 and incubated to completion (~300 hours) at 20°C. Fermentations were conducted in triplicate and data were averaged; error bars indicate one standard deviation.   b) a)   77  3.2.6.2  Ethanol production by K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Chardonnay wine. The effect of the DUR3 cassette on ethanol production in Chardonnay wine by strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3 was investigated by LC analysis at the end of fermentation. Compared to their respective parental strains, K7D3, K7EC‐D3,  522D3,  and  522EC‐D3 produced  Chardonnay  wine  with  substantially  equivalent  ethanol content (Table 18).  Table 18. Ethanol produced by Sake yeast strains (K7, K7EC‐, K7D3, and K7EC‐D3) and wine yeast strains (522, 522EC‐, 522D3, and 522EC‐D3) in Chardonnay wine. Ethanol content (%v/v) was measured by LC at the end of fermentation. Fermentation profiles are given in Figures 35a,b. Data were analyzed for statistical significance (p≤0.05) using two factor ANOVA analysis.    3.2.6.3  Fermentation rate of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Sake wine. The fermentation profiles of the  parental  and  metabolically  engineered  strains  are  shown  in  Figures  36a,b.  In  all  cases,  the fermentations proceeded at a slower rate than those in grape must; fermentations were completed within 450 hours compared to 300 hours in Chardonnay grape must (Figure 35). The fermentation rates of  engineered  strains  closely  matched  those  of  the  respective  parental  strains,  thus  indicating substantial equivalence in fermentation rate.    K7  K7EC‐  K7D3  K7EC‐D3  p* Replicate 1  12.89  12.84  12.89  12.91  ‐‐ Replicate 2  12.90  12.75  13.01  12.95  ‐‐ Replicate 3  12.96  12.97  12.97  12.89  ‐‐ Ethanol average (n=3)  12.92  12.85  12.96  12.92  ns STDEV  0.04  0.11  0.06  0.03  ‐‐         522  522EC‐  522D3  522EC‐D3  p* Replicate 1  13.65  13.71  13.74  13.54  ‐‐ Replicate 2  13.60  13.65  13.71  13.62  ‐‐ Replicate 3  13.71  13.66  13.55  13.58  ‐‐ Ethanol average (n=3)  13.65  13.67  13.67  13.58  ns STDEV  0.06  0.03  0.10  0.04  ‐‐ * si, ns: significant at p≤0.05, or non‐significant   78  0.002.004.006.008.0010.0012.000 100 200 300 400 500HoursWeight loss (g)K7K7 EC‐K7 D3K7 EC‐D30.002.004.006.008.0010.0012.000 100 200 300 400 500HoursWeight loss (g)522522 EC‐522 D3522 EC‐D3 Figure 36. Fermentation profiles (weight loss) of (a) Sake yeast strains K7, K7EC‐, K7D3, and K7EC‐D3 and (b) wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 in Sake. Sake wine was produced from white rice (Kokako  Rose)  and  koji  mash  (Vision  Brewing)  inoculated  to  a  final  OD600  =  0.1  and  incubated  to completion (~450 hours) at 18°C. Fermentations were conducted in triplicate and data were averaged; error bars indicate one standard deviation.  a) b)   79  3.2.6.4  Ethanol production by K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Sake wine. The effect of the DUR3 cassette on ethanol production in Sake wine by strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3 was investigated by LC analysis at the end of fermentation. Compared to their respective parental strains, K7D3, K7EC‐D3, 522D3, and 522EC‐D3 produced Sake wine with substantially equivalent ethanol content (Table 19).   Table 19. Ethanol produced by Sake yeast strains (K7, K7EC‐, K7D3, and K7EC‐D3) and wine yeast strains (522, 522EC‐, 522D3, and 522EC‐D3) in Sake wine. Ethanol content (% v/v) was measured by LC at the end of fermentation.  Fermentation  profiles  are  given  in  Figures  36a,b.  Data  were  analyzed  for  statistical significance (p≤0.05) using two factor ANOVA analysis.    K7  K7EC‐  K7D3  K7EC‐D3  p* Replicate 1  9.33  9.22  8.90  8.63  ‐‐ Replicate 2  9.20  8.14  9.58  8.96  ‐‐ Replicate 3  10.01  8.14  9.64  9.01  ‐‐ Ethanol average (n=3)  9.51  8.50  9.37  8.87  ns STDEV  0.44  0.62  0.41  0.21  ‐‐         522  522EC‐  522D3  522EC‐D3  p* Replicate 1  8.78  7.46  8.77  8.99  ‐‐ Replicate 2  8.80  7.81  8.99  8.86  ‐‐ Replicate 3  8.61  9.22  8.98  8.37  ‐‐ Ethanol average (n=3)  8.73  8.16  8.91  8.74  ns STDEV  0.10  0.93  0.12  0.33  ‐‐ * si, ns: significant at p≤0.05, or non‐significant   3.2.7  Constitutive expression of DUR3 in yeast strains K7D3 and 522D3 reduces EC in Chardonnay wine by 24.97% and 81.38%, respectively.  In order to assess the reduction of EC by functionally enhanced yeast strains, Chardonnay wine was made with the parental strains K7 and 522 and the recombinant strains K7EC‐, K7D3, K7EC‐D3, 522EC‐, 522D3,  and  522EC‐D3  and  the  EC  content  quantified  by  GC/MS  at  the  end  of  fermentation.  The fermentation profiles are given in Figures 35a,b.  During wine making, K7D3 and 522D3 reduced EC as efficiently as K7EC‐ and 522EC‐, respectively (Table 20). In Chardonnay wine, K7D3 reduced EC by 12.64% while K7EC‐ reduced EC by 6.85%; 522D3   80  reduced EC by 82.96% while 522EC‐ reduced EC by 81.48%. Constitutive co‐expression of DUR1,2 and DUR3 did not result in synergistic EC reduction in K7EC‐D3 or 522EC‐D3 (Table 20).  Table 20. Reduction of EC by functionally enhanced yeast strains during wine making. The concentration of EC (µg/L) in Chardonnay wine produced by Sake yeast strains K7, K7EC‐, K7D3, and K7EC‐D3 and wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 from unfiltered Calona Chardonnay must was quantified by GC/MS. Triplicate fermentations were incubated to completion (~300 hours) at 20°C and fermentation profiles are given in Figures 35a,b.  Yeast strain  K7  K7EC‐  K7D3  K7EC‐D3 Replicate 1  34.19 34.25 29.39 29.74 Replicate 2  40.31 30.98 29.98 31.29 Replicate 3  28.69 30.89 30.78 30.06 Average (n=3)  34.40 32.04 30.05 30.36 STDEV  5.81 1.91 0.70 0.82 RSD (%)  16.89 5.96 2.33 2.70 Reduction (%)  -- 6.85 12.64 11.73          Yeast strain  522  522EC‐  522D3  522EC‐D3 Replicate 1  199.3 31.32 28.76 36.63 Replicate 2  169.95 37.32 29.89 38.61 Replicate 3  177.61 32.66 34.56 31.3 Average (n=3)  182.29 33.77 31.07 35.51 STDEV  15.22 3.15 3.07 3.78 RSD (%)  8.34 9.33 9.88 10.64 Reduction (%)  -- 81.48 82.96 80.52   3.2.8  Constitutive expression of DUR3 in yeast strains K7D3 and 522D3 reduces EC in Sake wine by 18.40% and 10.45%, respectively.  To assay the EC reduction of functionally enhanced yeast strains during Sake making, Sake wine was brewed with the parental strains K7 and 522 and the recombinant strains K7EC‐, K7D3, K7EC‐D3, 522EC‐, 522D3,  and  522EC‐D3  and  the  EC  content  quantified  by  GC/MS  at  the  end  of  fermentation.    The fermentation profiles are given in Figures 36a,b.  As observed before (Section 3.1.5), engineered Sake yeast strains reduce EC more effectively when assessed by brewing Sake; the Sake yeasts K7EC‐ and K7EC‐D3 both reduced EC content by ~84%   81  (Table 21). During the wine making trial described in Section 3.2.7, K7EC‐ and K7EC‐D3 both reduced EC by only ~15% (Table 20).  In contrast to the results described in Section 3.2.7 for Chardonnay wine, constitutive expression of DUR3 did not reduce EC as effectively as constitutive expression of DUR1,2 (Tables 20 and 21). In Sake wine, K7D3 reduced EC by 14.97% while K7EC‐ reduced EC by 87.07%; 522D3 reduced EC by 11.49% while 522EC‐  reduced  EC  by  84.30%  (Table  21).  Constitutive  co‐expression  of  DUR1,2  and  DUR3  had  no synergistic  effect  on  EC  reduction  during  Sake  production  (Table  21);  there  was  no  appreciable difference  in  EC  reduction  between  the  DUR1,2  expressing  strains  and  those  which  constitutively expressed both DUR1,2 and DUR3.  Table 21. Reduction of EC by functionally enhanced yeast strains during Sake making. The concentration of EC (µg/L) in Sake wine produced by Sake yeast strains K7, K7EC‐, K7D3, and K7EC‐D3 and wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 from white rice (Kokako Rose) and koji mash (Vision Brewing) was quantified by GC/MS. Triplicate fermentations were incubated to completion (~450 hours) at 18°C and the fermentation profiles are given in Figures 36a,b.  Yeast strain  K7  K7EC‐  K7D3  K7EC‐D3 Replicate 1  109.83 13.37 93.42 15.72 Replicate 2  80.68 12.3 79.86 18.6 Replicate 3  108.26 12.96 80.77 17.79 Average (n=3)  99.59 12.88 84.68 17.37 STDEV  16.40 0.54 7.58 1.49 RSD (%)  16.47 4.19 8.95 8.58 Reduction (%)  -- 87.07 14.97 82.56          Yeast strain  522  522EC‐  522D3  522EC‐D3 Replicate 1  77.05 11.6 85.85 16.12 Replicate 2  104.01 12.17 82.17 13.07 Replicate 3  85.11 18.03 67.57 13.51 Average (n=3)  88.72 13.93 78.53 14.23 STDEV  13.84 3.56 9.67 1.65 RSD (%)  15.60 25.56 12.31 11.60 Reduction (%)  -- 84.30 11.49 83.96      82  4  DISCUSSION  4.1  Constitutive expression of the DUR1,2 cassette reduces EC production in wine and Sake  A common theme throughout the history of mankind has been the lack of effective solutions to problems until the advent of certain technologies. Such has been the case for the problem of EC in fermented foods and beverages, more specifically EC in grape and Sake wine. Since its discovery and subsequent characterization as a carcinogen in the mid 20th century (Nettleship, Henshaw and Meyer 1943), EC has been found ubiquitously in almost all wines and spirits (Canas, et al. 1989; Coulon, et al. 2006). Although the actual health implications of EC consumption by humans has yet to be definitively established, the Canadian government has imposed a legal limit (30 µg/L) and the US FDA has imposed a voluntary limit (15 µg/L) on the EC content of wines (Butzke and Bisson 1998). Furthermore, several agencies, including the National Institute of Health’s National Toxicology Programme and the University of California Davis Department of Enology and Viticulture, have published preventative action manuals for limiting the EC content of wines and spirits (Butzke and Bisson 1998).   Despite the mandatory and voluntary limits imposed on the EC content in food and beverages, its  presence  continues  to  be  a  pervasive  problem.  A  recent  survey  by  our  group  found  that  of  20 randomly chosen, commercially available wines from six wine producing countries, 14 and 17 exceeded the  Canadian  and  US  limits,  respectively  (Coulon,  et  al.  2006).  It  is  therefore  obvious  that  current methods for EC reduction in wine are largely ineffective. Methods currently suggested to reduce EC include  agricultural  practices  to  control  grape  must  arginine  content  (Butzke  and  Bisson  1998),  the addition of lyophilized acid urease preparations to wine (Kodama, et al. 1994; Ough and Trioli 1988), and, to a lesser extent, the metabolic engineering of CAR1 deficient yeast strains was exploited to limit EC in Sake (Kitamoto, et al. 1991; Park, Shin and Woo 2001; Yoshiuchi, Watanabe and Nishimura 2000).   Until  recently,  the  previously  mentioned  methods  were  the  only  methods  of  EC  reduction available to winemakers. However, in 2006 our group developed a functionally enhanced strain of the popular industrial wine yeast 522 that is capable of reducing EC levels by 89% (Coulon, et al. 2006). This result, which is a consequence of the constitutive expression of an otherwise inactive urea amidolyase (DUR1,2) gene, far exceeds any other method of EC reduction and does not lengthen production time or   83  incur any additional costs to winemakers/consumers. The metabolically enhanced 522 strain contains a constitutively expressed DUR1,2 gene, no antibiotic resistance marker genes or foreign DNA and is thus non‐transgenic and ‘self‐cloned’. This yeast has received approval from the FDA, Health Canada, and Environment Canada for commercial wine production.    4.2  Integration of the DUR1,2 cassette into the genomes of Sake yeast strains K7 and K9 yielded the functional urea degrading Sake yeasts K7EC‐ and K9EC‐  S. cerevisiae produces wine with varying amounts of residual urea, mainly due to NCR of its urea amidolyase  encoding  gene  (DUR1,2  ‐  YBR208C);  synthesis  of  the  urea  degrading  urea  amidolyase enzyme is thus prevented and urea is excreted in to the wine (Kodama, et al. 1994; Monteiro and Bisson 1991; Monteiro, Trousdale and Bisson 1989; Ough, et al. 1990; Ough, et al. 1991; Stevens and Ough 1993). The successful integration of the DUR1,2 cassette (Figure 15) (Coulon, et al. 2006) into the URA3 locus of the popular Sake yeast strains K7 and K9 yielded the urea degrading strains K7EC‐ and K9EC‐. In addition to the URA3 flanking sequences required for homologous recombination, the DUR1,2 cassette contains the S. cerevisiae DUR1,2 gene under the control of the constitutive S. cerevisiae PGK1 promoter and terminator signals.  4.2.1  Genetic characterization of K7EC‐ and K9EC‐  The targeted integration of the DUR1,2 cassette into the URA3 locus (YEL021W) was confirmed on Southern blots hybridized with both DUR1,2 and URA3 (Figures 16 and 17). These blots revealed that K7EC‐ and K9EC‐ both contain a single copy of the ~9.1 kb linear DUR1,2 cassette integrated into one of their  URA3  loci.  Genomic  hybridization  also  confirmed  that  both  the  diploid  strains  K7EC‐  and  K9EC‐ retained a non‐disrupted URA3 locus, thus maintaining their uracil prototrophy. Nutritional prototrophy is important for industrial yeasts as they are required to ferment substrates with highly variable nutrient contents.  As the DUR1,2 cassette does not contain any antibiotic resistance markers, no positive selection method was available to identify transformants that carried the integrated cassette; as a result, urea degrading yeasts were initially identified by colony PCR. Screening was completed with the assistance of   84  the  co‐transforming  plasmid  pUT332  which  contains  both  the  bla  and  Tn5ble  resistance  markers (Ampicillin  and  phleomycin,  respectively);  pUT332  was  used  in  order  to  reduce  the  number  of transformants  that  had  to  be  screened  by  colony  PCR.  By  successive  subculturing  on  non‐selective media, the plasmid was lost and this was confirmed on Southern blots hybridized with the bla and Tn5ble genes (Figure 18). Sake strains K7EC‐ and K9EC‐ are the first metabolically engineered Sake yeast strains  to  be  constructed  without  the  integration  of  antibiotic  resistance  markers  or  E.  coli  vector sequences, thus making them suitable for commercialization; these strains will be more likely to be accepted by consumers than strains containing antibiotic resistance marker genes or foreign DNA.  One  strand  of  the  integrated  DUR1,2  cassettes  in  K7EC‐  and  K9EC‐ was  sequenced.  Upon comparison to previously published sequences (Coulon, et al. 2006), a single nucleotide difference was observed in the sequence of K9EC‐ (Table 8). This single nucleotide difference was localized to the 5’ URA3 flanking region of the cassette and is likely due to a genetic polymorphism between the Sake strain K9 and the wine strain 522. No differences were observed in the DUR1,2 coding region or the PGK1 promoter and terminator signals.   Analysis of DUR1,2 expression during wine fermentation revealed that integration of the DUR1,2 cassette indeed relieves repression of DUR1,2 by NCR, as the PGK1 promoter is much stronger than the inducible/repressible, NCR sensitive DUR1,2 promoter. DUR1,2 mRNA was approximately 10‐fold more abundant in K7EC‐ and K9EC‐ than in their respective parent strains (Figure 20).  The global gene expression pattern of the engineered strain K7EC‐ as compared to the pattern of the parent strain K7 was studied at 24 hours into Chardonnay must fermentation. Besides DUR1,2 (6.35‐fold overexpression), nine genes were affected ≥ 4‐fold; thus, it is evident that integration of the DUR1,2 cassette into the genome of S. cerevisiae K7 had a minimal effect (0.15% change) on the transcription of the 5795 ORFs (4692 verified and 1103 uncharacterized, SGD, March, 2008) in the yeast cell. One gene of interest that was upregulated ≥ 4‐fold in K7EC‐ (Table 10) was HAC1 (4.23‐fold), a transcription factor involved in the unfolded protein response (Cox and Walter 1996, Mori 1996, Nikawa, et al. 1996); this response is likely needed to support the increased translation and folding of DUR1,2p constitutively expressed  from  the  strong  PGK1  promoter;  indeed,  HAC1  was  also  upregulated  (5.67‐fold)  in  the engineered strain K7D3 which contains the DUR3 gene under the control of the PGK1 promoter and   85  terminator signals (Table 17). The data also suggests that no metabolic pathways were affected by the presence of the DUR1,2 cassette integrated into K7EC‐; however, three (RME1, SSP1, SDS3) of the seven genes downregulated in K7EC‐ are involved in different aspects of meiosis/sporulation (Table 10). As sporulation can be triggered by nutrient deficiency (Malone 1990), it is reasonable that the integration of the DUR1,2 cassette, which results in constitutive utilization of urea as a nitrogen source, may cause yeast cells to alter or delay their response to nutrient limitation.  4.2.2  The Sake yeasts K7EC‐ and K9EC‐ conduct efficient alcoholic fermentations   As  measures  of  substantial  equivalence,  fermentation  rates,  glucose/fructose  utilization  and ethanol  production  was  evaluated  in  the  metabolically  engineered  strains  K7EC‐  and  K9EC‐.  Prior  to commercialization, engineered yeasts must obtain approval from regulatory agencies such as the FDA, Health  Canada,  and  Environment  Canada.  In  North  America,  approval  is  granted  on  the  basis  of substantial equivalence, which means that should a foodstuff from a genetically modified organism (GMO) be proven to be ‘as safe as’ the food produced by traditional means, then both should be treated equally (Kessler 1992). Proof of substantial equivalence and safety for a genetically engineered organism generally  requires  detailed  data  regarding  the  organism’s  genotype,  phenotype,  transcriptome, proteome, and metabolome.   In  both  Chardonnay  must  and  Sake  mash,  K7EC‐  and  K9EC‐ conducted  efficient  alcoholic fermentations (Figures 21 and 22), comparable to those of the parental strains K7 and K9; fermentations were completed in ~300 hours in Chardonnay wine and ~500‐600 hours in Sake wine. Furthermore, residual glucose and fructose in Sake wine produced with K7EC‐ and K9EC‐ (0.05, 0.010 g/L glucose and 0.72, 0.30 g/L fructose, respectively) and the parental strains K7 and K9 were comparable (0.06, 0.08 g/L glucose and 0.65, 0.31 g/L fructose, respectively). All four yeasts produced similar amounts of ethanol in Sake wine (Table 11).    4.2.3 The Sake yeasts K7EC‐ and K9EC‐ reduce EC poorly in Chardonnay wine, yet efficiently in Sake wine   The two functionally enhanced Sake yeasts K7EC‐ and K9EC‐ were evaluated for their ability to reduce EC content in both Chardonnay wine and Sake wine. In Chardonnay wine, K7EC‐ and K9EC‐ were   86  ineffective in reducing EC; K7EC‐ and K9EC‐ reduced EC by 30% and 0%, respectively (Table 12). In contrast, K7EC‐ and K9EC‐ both effectively reduced EC by 68% in Sake wine (Table 13).   During the course of Sake fermentations, yeast cells are exposed to a substantially different set of environmental conditions and stresses than those experienced during wine fermentation.  Specialized Sake yeast strains have been selected for the production of Sake wine (Shobayashi, et al. 2007) and fermentation conditions undoubtedly play a role in Sake yeast metabolism. While several environmental parameters may play a role in explaining the ineffective EC reduction of Sake strains K7EC‐ and K9EC‐ during Chardonnay wine making (Tables 12 and 13), the effect of yeast available nitrogen on native NCR controlled genes is likely the predominant factor.    The type and quantity of yeast assimilable nitrogen (YAN) in Sake mash is substantially different from grape must. Grape must of almost all varietals is usually high in free arginine and proline (Kliewer 1970). In contrast, Sake mash is rich in polypeptides that form structures known as protein bodies (PB) (Kizaki, et al. 1991).  These protein bodies, which fall into two major categories (PB‐I and PB‐II), are primarily composed of prolamins and glutelins, respectively (Hashizume, et al. 2006). During the course of the fermentation yeast draw on the pool of free amino acids which is replenished by degradation of PB by koji‐provided acid carboxypeptidases and acid proteases (Hashizume, et al. 2006; Iemura, et al. 1999a; Iemura, et al. 1999b). This controlled release process, which may limit the large scale induction of certain amino acid catabolic enzymes, functions to prevent nitrogen exhaustion (Wu, et al. 2006) and subsequent TOR mediated transcriptional reprogramming leading to the de‐repression of NCR sensitive genes (Cooper 2002; Hofman‐Bang 1999).  In contrast to the nitrogen available in Sake mash, yeasts draw on the large pool of free amino acids in grape must to create biomass during fermentation. However, at approximately 2‐4 days into the fermentation, cells stop dividing and enter a stationary growth phase in which they ferment actively. While there is new evidence to suggest that ethanol stress may play a role transitioning into stationary phase (Marks, et al. 2003; Marks, et al. 2008), the general consensus in the literature, however, is that nitrogen exhaustion is the primary reason why yeast cells enter into stationary phase (Hauser, et al. 2001; Rossignol, et al. 2003; Shobayashi, et al. 2007; Wu, et al. 2006). Nitrogen exhaustion, which is detected by the TOR pathway, is accompanied by large scale transcriptional changes leading to the de‐  87  repression of genes involved in the catabolism of poor nitrogen sources, including urea (Cooper 2002; Hofman‐Bang 1999). Interestingly, the second most abundant amino acid in grape must (Kliewer 1970), proline, is not metabolized during fermentation. Proline catabolism requires molecular oxygen and, as fermentations are anaerobic, proline cannot be utilized (Ingledew, Magnus and Sosulski 1987). Thus, after nitrogen exhaustion shifts cells into stationary phase, the high concentration of proline in the ferment likely reinforces, sustains and strengthens the transcriptional reprogramming associated with NCR de‐repression.    Of particular interest to EC reduction is the de‐repression of the NCR sensitive urea amidolyase encoding gene DUR1,2. Induction of DUR1,2 allows yeast to degrade urea in an increasingly nitrogen scarce environment. Thus, during the later stages of wine fermentation, DUR1,2 can be induced and maintained throughout the fermentation as long as yeast are starved for nitrogen. As a result, parental strains produce less EC overall since they tend to induce DUR1,2 at the middle/end of the fermentation, thereby reducing the effectiveness of functionally enhanced clones (Table 12). During Sake brewing however, no nitrogen exhaustion is experienced by yeast cells and DUR1,2, along with the other NCR sensitive genes, remains largely repressed, resulting in higher absolute EC values and an increase in the effectiveness of the metabolically enhanced yeasts containing the constitutive DUR1,2 cassette (Table 13). Data obtained from global gene expression studies during grape wine and Sake wine fermentations confirm that, during grape wine fermentation, the native DUR1,2 and DUR3 genes are both induced at the transition into stationary phase (Rossignol, et al. 2003); this is consistent with nitrogen exhaustion and subsequent transcriptional reprogramming inducing stationary phase. In Sake wine making, DUR1,2 and DUR3 are transcriptionally inactive throughout the course of fermentation (Wu, et al. 2006), which is consistent with an adequate nitrogen supply.  Another difference between grape must and rice mash concerns osmotic stress. As a result of the  continuous  saccharification  process  during  Sake  brewing,  (Figure  4),  yeasts  are  subjected  to substantially less osmotic stress during Sake fermentation than during wine fermentation where all of the sugars are present at inoculation (Takagi, et al. 2005; Wu, et al. 2006). This reduced stress during  Sake fermentations is thought to play a role in the ability of Sake yeasts to produce up to 20% (w/v) ethanol in Sake wine (Shobayashi, et al. 2007). During osmotic stress, yeast cells activate the ‘high osmolarity growth’ (HOG) pathway which allows cells to survive osmotic stress via the biosynthesis and   88  intracellular retention of small molecules such as trehalose and glycerol (Westfall, Ballon and Thorner 2004).  These  molecules  help  to  offset  the  osmotic  pressure  created  by  the  high  concentration  of extracellular sugars (often 20‐30% w/v, equimolar amounts of glucose and fructose in grape must), which  would  otherwise  crenate  the  cells.  Although  S.  cerevisiae  has  evolved  to  tolerate  substantial osmotic  stress,  induction  and  maintenance  of  tolerance  mechanisms  requires  significant  energy expenditure that could otherwise be devoted to biomass creation and other metabolic processes (Wu, et al. 2006). For Sake yeast, which has evolved in a niche of markedly reduced osmotic stress, the osmotic shock in grape must may be a factor in explaining the poor EC reduction of engineered Sake strains during wine making. Specifically, the yeast stress response tends to down‐regulate translation globally,  which  in  turn  could  decrease  the  levels  of  DUR1,2p  (Cooper  2002;  Hauser,  et  al.  2001; Rossignol, et al. 2003).   Finally, the addition of koji to Sake fermentations plays an important role in the availability of some vital auxiliary factors. One such factor is ergosterol, a cholesterol derivative compound present in yeast cell membranes that is vital for ethanol tolerance (Inoue 2000). Ethanol causes rigidity of the cell membrane  and  induces  fatal  cracks;  ergosterol,  like  cholesterol,  functions  to  decrease  the  packing density of membrane phospholipids and increase membrane fluidity, thus counteracting the effects of ethanol (Inoue 2000). Yeast cells require oxygen to synthesize ergosterol (Jahnke 1983), and during anaerobic fermentations this dependency on ergosterol may be a limiting factor on cell viability and ethanol  production.  In  fact,  wine  fermentations  are  often  oxygenated  briefly  prior  to  or  during fermentation  in  order  to  facilitate  the  production  of  ergosterol  (Rossignol,  et  al.  2003).  In  Sake fermentations however, ergosterol is supplied primarily from koji which are cultured aerobically (Wu, et al.  2006),  and  as  such  Sake  yeast  may  have  evolved  to  be  dependent  on  this  external  source  of ergosterol. In fact, Sake yeast strains were shown to induce all of the ergosterol biosynthetic genes during the course of Sake fermentation thus indicating an unexpected shortage of ergosterol despite the presence of koji derived ergosterol (Wu, et al. 2006).  Thus, when functionally enhanced Sake yeasts are used to ferment grape must which is not oxygenated, the lack of ergosterol contribution from koji may play a role in a reduction in cell health, viability and EC reduction.   Given the observed differences in the EC reduction of the functionally enhanced yeasts K7EC‐ and K9EC‐ in grape must and Sake mash, it is imperative that, in order to gather the most relevant data, the   89  functionality  of  engineered  yeasts  be  tested  in  their  niche  environments;  this  should  prevent  the identification of false negatives and will expedite commercialization of new strains.  4.3  Constitutive expression of the urea permease, DUR3, in yeast cells is a viable alternative method to reduce EC in fermented alcoholic beverages  The  most  efficient  metabolically  enhanced  wine  yeast  522EC‐,  which  contains  the  DUR1,2 cassette integrated into the URA3 locus, reduced EC by 89% in Chardonnay wine (Coulon, et al. 2006). In order  to  further  improve  EC  reduction,  we  created  yeast  strains  that  acted  as  ‘urea  sponges’, reabsorbing any urea secreted during fermentation or urea native to the must. This goal was completed through the constitutive expression of the urea permease DUR3 (YHL016C), a NCR sensitive gene native to S. cerevisiae (Cooper and Sumrada 1975; ElBerry, et al. 1993; Sumrada, Gorski and Cooper 1976). Due to the abundance of other high quality nitrogen sources during primary fermentation, there is no need for yeast cells to actively import urea, thus the urea transporter is transcriptionally silenced. Given the success of the constitutively expressed DUR1,2 cassette previously characterized by our group (Coulon, et  al.  2006),  we  chose  to  utilize  similar  methodology  in  order  to  transcriptionally  activate  and constitutively express DUR3 in wine and Sake yeasts.   4.3.1  Construction of a linear PGK1p‐DUR3‐PGK1t‐kanMX cassette for integration into the TRP1 locus of wine and Sake yeasts  Although constitutive expression of DUR3 could have been more easily achieved through an episomal plasmid expression system, creation of a linear cassette for integration into the yeast genome was a more attractive option. The main problem with a plasmid borne system is that without a positive selection pressure, such as the addition of antibiotics to the must, plasmid loss in S. cerevisiae generally occurs within 3‐5 generations (Jones, Pringle and Broach 1992) thereby reverting engineered strains to wild  type.  Coupled  with  the  nutrient  prototrophy  of  industrial  yeasts,  positive  selection  during winemaking is extremely impractical as grape must/rice mash is essentially a ‘rich’ medium for yeast growth. Furthermore, addition of antibiotics to the fermentation substrate is undesirable and negates the goal of creating ‘self‐cloned’ yeast strains. Additionally, S. cerevisiae is highly amenable to gene   90  uptake  and  integration  via  homologous  recombination  (Ausubel,  et  al.  1995;  Griffiths  et  al.,  2005), making precise manipulation, replacement, and deletion of genes in the genome possible.  In order to create a linear cassette for the constitutive expression of DUR3 (Figure 25), the DUR3 ORF was placed under the control of the S. cerevisiae PGK1 promoter and terminator signals (Figure 10). PGK1 (YCR012W) encodes 3‐phosphoglycerate kinase (EC 2.7.2.3) which is a key enzyme in the glycolytic pathway responsible for transferring the acyl phosphate from 1,3‐bisphosphoglycerate to ADP thereby creating one molecule of energy rich ATP (Blake 1981; Hitzeman 1980; Lam 1977). Being a key enzyme in the ubiquitous process of glycolysis, PGK1, while technically inducible, is constitutively expressed so long as yeast are grown in the presence of glucose (Lam 1977). During both wine and Sake fermentation glucose is abundant and cells never experience carbon exhaustion (Marks, et al. 2008; Wu, et al. 2006). Additionally, as glycolysis is essential during fermentation (Lam 1977), placing DUR3 under the control of PGK1 ensured constitutive expression throughout the course of fermentation.   As this section of the research was to be a proof of concept study only, the antibiotic resistance marker kanMX was used in order to simplify the selection of positive clones (Figure 11). A positive selection marker allowed us to distinguish DUR3 clones from untransformed cells thus eliminating the need for costly and time consuming colony PCR selection. While this approach was suitable for this study, it will be necessary to construct an antibiotic resistance free cassette similar to that of DUR1,2 when DUR3 strains are developed for commercial purposes.   In order to target the linear DUR3 expression cassette to a specific locus in the genome the PGK1p‐DUR3‐PGK1t‐kanMX cassette was flanked on either side with 300 bp of TRP1 homology and successfully integrated into the TRP1 locus (Figure 13). While homologous recombination in S. cerevisiae is  possible  in  laboratory  strains  with  as  few  as  40  nucleotides  of  flanking  homology  (Baudin  1993; Manivasakam  1995),  we  used  300  homologous  nucleotides  on  either  end  of  the  DUR3  cassette  to ensure efficient and specific integration into the TRP1 locus. Shorter regions of homology increases the likelihood that strain sequence polymorphisms will reduce integration efficiency. Efficiencies increase 30‐ to 50‐fold when flanking sequences of several hundred base pairs in length are used (Wach 1996).     91  While the DUR3 cassette could have been integrated into any locus, the TRP1 locus was chosen for  a  number  of  reasons.  Firstly,  TRP1  is  a  well  characterized  and  common  auxotrophic  marker (Hampsey 1997; Mortimer 1966; Stolz 1998). Secondly, TRP1 is closely located (1 cM) to the centromere of chromosome four (Mortimer 1966) and is thus highly stable, as genetic recombination during meiosis is proportional to a locus’ distance from the centromere (Griffiths, et al., 2005).  As a result of this genetic stability, engineered strains would be suitable for active dry yeast production and industrial use.  Prior to integration into test strains, the DUR3 cassette in the plasmid pUCMD was sequenced (single strand) to confirm its structure; analysis revealed that the plasmid contained all the desired DNA fragments in the correct order and orientation (Figure 14). Furthermore, sequencing data revealed nine single  nucleotide  changes  along  the  length  of  cassette  (Table  14  and  Figure  23);  however,  all  four mismatches in the DUR3 coding region were silent and the deduced DUR3p was identical in amino acid sequence  and  length  to  that  published  for  DUR3p  on  SGD.  Five  of  the  nine  base  pair  mismatches localized to the PGK1 promoter; four were C to T conversions. Given that the in silico sequence was assembled from single pass, single strand sequencing, the most logical explanation for the mismatches is sequencing error. This conclusion is supported by the fact that none of the identified mismatches in the PGK1  promoter  were  previously  reported  in  the  utilization  of  the  PGK1  promoter  for  constitutive expression  (Coulon,  et  al.  2006;  Husnik,  et  al.  2006;  Volschenk,  et  al.  1997).  Furthermore,  during characterization of the wine yeast ML01 (Husnik, et al. 2006), two mismatches that were found in one copy of the PGK1 promoter were absent in the other copy (Husnik, et al. 2006), indicating that the sequence of the PGK1 promoter may be prone to sequencing errors. Given that the integrated DUR3 cassette was fully functional, further sequencing of the cassette to identify bona fide mismatches was deemed non‐essential.   4.3.2  Integration of the DUR3 cassette into the genomes of K7, K7EC‐ , 522, and 522EC‐ yielded the functional urea transporting yeasts K7D3, K7EC‐D3, 522D3,  and 522EC‐D3   Like DUR1,2, DUR3 is subject to transcriptional repression by NCR during fermentation, resulting in the inability of S. cerevisiae to re‐absorb excreted urea in the presence of good nitrogen sources (ElBerry, et al. 1993; Hofman‐Bang 1999). This inability to absorb excreted urea is a contributing factor in the production of wines with high residual urea, thus leading to high EC. In order to constitutively   92  express DUR3 throughout fermentation, the DUR3 cassette (Figure 25) was integrated into the TRP1 locus of K7, K7EC‐ , 522, and 522EC‐, which yielded the functionally enhanced strains K7D3, K7EC‐D3, 522D3, and  522EC‐D3 (Table  16).  The  enhanced  strains  were  genetically,  phenotypically,  and  functionally characterized.  4.3.2.1  Integration of the DUR3 cassette into the genomes of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 results in constitutive expression of DUR3. Correct integration of the DUR3 cassette into the TRP1 locus was confirmed by Southern blots probed with both DUR3 and TRP1 fragments. S. cerevisiae strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3 were all shown to contain a single copy of the ~6.5 kb linear DUR3 cassette integrated in their TRP1 loci (Figure 26). Blotting also confirmed that the diploid strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3 retained a non‐disrupted TRP1 locus, thus maintaining their tryptophan prototrophy and wild type phenotype.  In the DUR3 cassette, expression of DUR3 is controlled by the PGK1 promoter and terminator signals.  As  was  previously  observed  (Section  4.2.1)  during  the  characterization  of  DUR1,2  cassette clones, PGK1 is a strong promoter capable of driving constitutive expression under NCR conditions. To confirm the constitutive expression of DUR3 from the integrated DUR3 cassette, a northern blot was hybridized with a DUR3 probe; blots of K7, K7EC‐, K7D3, and K7EC‐D3 total RNA revealed strong expression of DUR3 in K7D3 and K7EC‐D3 (Figure 29). RNA for the northern blot was isolated from cells 24 hours into a fermentation of Chardonnay must; at 24 hours, quality nitrogen sources are still abundant and thus NCR is still strong. Thus, under the control of the PGK1 promoter and terminator signals, DUR3 expression is high in cells containing the integrated DUR3 cassette despite non‐inducing conditions. Quantification of constitutive expression by qRT‐PCR revealed a 14‐ and 7‐fold increase in DUR3 mRNA at 24 hours into Chardonnay must fermentations in K7D3 and K7EC‐D3, respectively (Figure 30). Furthermore, high level expression of both DUR1,2 and DUR3 was maintained in K7EC‐D3 (12‐ and 7‐fold, respectively), which had both  the  DUR1,2  and  DUR3  cassettes  integrated  into  its  genome.  These  data  suggest  that  K7,  and presumably  other  strains  of  S.  cerevisiae,  is  tolerant  to  altered,  high  level  expression  of  multiple proteins. Coupled with data confirming the functionality of both DUR1,2p (Table 21) and DUR3p (Figure 31), this result validates the metabolic engineering of S. cerevisiae for polygenic traits. In strains in which only  one  cassette  (DUR1,2  or  DUR3)  was  integrated,  constitutive  expression  of  that  gene  induced expression of the other gene (Figure 30). These results indicate a certain amount of cross talk between   93  the regulatory mechanisms for DUR1,2 and DUR3. Presumably when cells are actively degrading urea instead  of  exporting  it  (constitutive  expression  of  DUR1,2),  the  urea  degradation  intermediate, allophanate, causes induction of DUR3. Allophanate is a known inducer of all DUR genes (Cooper 1982; Cooper 2002; Cooper and Sumrada 1975; ElBerry, et al. 1993; Hofman‐Bang 1999; Uemura, Kashiwagi and Igarashi 2007; Whitney and Cooper 1972; Whitney, Cooper and Magasanik 1973) and exerts its effect through an upstream induction sequence that binds the transcriptional activators DAL81 and DAL82, and through an upstream activation sequence that binds the NCR GATA factor GLN3 (Hofman‐Bang 1999). Similarly, when cells are actively importing urea (constitutive expression of DUR3), the increased  intracellular  urea  concentration  induces  DUR1,2  expression  such  that  the  intracellular concentration of urea can be lowered before it becomes toxic.   The global gene expression patterns of the metabolically engineered strain K7D3 and the parent strain  K7  were  studied  at  24  hours  into  Chardonnay  must  fermentation.  Besides  DUR3  (36.95‐fold overexpression), seven genes were affected ≥ 4‐fold; thus, it is evident that integration of the DUR3 cassette into the genome of S. cerevisiae K7 had a minimal effect (0.1% change) on the transcription of the 5795 ORFs (4692 verified and 1103 uncharacterized, SGD, March, 2008) in the yeast cell. One gene that was upregulated ≥ 4‐fold in K7D3 (Table 17) was common  to those upregulated in the DUR1,2 cassette containing engineered strain K7EC‐ (Table 10); HAC1 (5.67‐fold) encodes a transcription factor involved in the unfolded protein response and is likely needed for increased translation and folding of DUR3 constitutively expressed from the strong PGK1 promoter. The data also suggests that no metabolic pathways  were  affected  by  the  presence  of  the  DUR3  cassette  integrated  into  K7EC‐.  However, integration  of  the  DUR3  cassette  into  K7D3  appears  to  have  had  some  effect  on  the  regulation  of meiosis/sporulation, processes controlled by nutrient deficiency (Malone 1990). One gene (FIG1) was upregulated  and  one  gene  (TID3)  was  downregulated  in  K7D3  (Table  17);  both  are  involved  in meiosis/sporulation. As constitutive expression of DUR3 results in increased nitrogen availability it is reasonable that the DUR3 cassette would exert some effect on sporulation gene regulation.  4.3.2.2  The  integrated  DUR3  cassette  results  in  enhanced  urea  uptake.  In  order  to  confirm  the production of a functional urea permease encoded by the integrated DUR3 cassette, and to correlate DUR3 constitutive expression with increased urea uptake, the uptake of radiolabelled urea by K7, K7EC‐, K7D3, and K7EC‐D3 was studied. Under the conditions tested, the strains K7D3 and K7EC‐D3 were both highly   94  capable of importing 14C‐urea while K7 and K7EC‐ were unable to incorporate any appreciable amounts of 14C‐urea (Figure 31). These data indicate that integration of the DUR3 cassette is responsible for the constitutive expression of an active urea permease (DUR3p) under NCR conditions.   In  the 14C‐urea  uptake  assay,  the  strains  K7,  K7EC‐,  K7D3,  and  K7EC‐D3  were  cultured  in  an ammonium sulphate minimal medium that results in repression of all NCR sensitive genes (Cooper 1982; Hofman‐Bang 1999). In all of the strains (K7, K7EC‐, K7D3 and K7EC‐D3) transcription of DUR3 from its native promoter was repressed due the presence of ammonium sulphate; however in strains K7D3 and K7EC‐D3, DUR3 was expressed despite the presence of ammonium sulphate in the medium due to the presence of the recombinant DUR3 cassette. Given that the conditions of fermentation are largely repressive to NCR sensitive  genes,  the  efficient  uptake  of 14C‐urea  by  K7D3  and  K7EC‐D3  in  conditions  of  strong  NCR  is indicative of efficient EC reduction.  Despite integration of the same DUR3 cassette, K7D3 and K7EC‐D3 exhibited different rates of 14C‐urea uptake; K7D3 was able to incorporate approximately 3‐fold more 14C‐urea than K7EC‐D3 (Figure 31). Since there is no data or rationale to explain why K7D3 would be more efficient at urea uptake than K7EC‐D3, the  most  logical  explanation  is  that  the  constitutive  expression  of  DUR1,2  in  K7EC‐D3  masks  the accumulation of 14C‐urea. In order to counteract the influx of toxic urea, K7D3 must induce transcription of DUR1,2 and, in turn, produce functional DUR1,2p. DUR1,2 is known to be controlled at the level of transcription (Genbauffe and Cooper 1986; Genbauffe and Cooper 1991); enzyme activity correlates well with transcript abundance and the half‐life of DUR1,2 transcripts is the same in both the presence and absence of an inducer (Jacobs, Dubois and Wiame 1985). In the case of K7EC‐D3, DUR1,2 is constitutively expressed and the functional enzyme is capable of degrading urea as it is incorporated into the cell. Thus, both K7D3 and K7EC‐D3 likely incorporate urea with equivalent efficiencies, however, this conclusion was  not  confirmed  by  experimental  data.  The  same  masking  phenomenon  was  observed  when comparing the uptake of 14C‐urea by K7 and K7EC‐ (Figure 32).   4.3.2.3  The metabolically engineered yeasts K7D3, K7EC‐D3, 522D3, and 522EC‐D3 ferment at similar rates and produce similar amounts  of ethanol in Chardonnay and Sake wine. As measures of substantial equivalence, fermentation rate and ethanol production was evaluated in the metabolically engineered strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3. In both Chardonnay must and Sake mash, K7D3, K7EC‐D3, 522D3,   95  and  522EC‐D3 conducted  substantially  equivalent  alcoholic  fermentations  (Figures  35  and  36). Furthermore, the amount of ethanol produced in Chardonnay and Sake wine by K7D3, K7EC‐D3, 522D3, and 522EC‐D3 was shown to be similar (Tables 18 and 19). These results indicate that the K7D3, K7EC‐D3, 522D3, and 522EC‐D3 strains are suitable for commercialization from a fermentation standpoint.  4.3.2.4  Variability of metabolically engineered yeasts to effectively reduce EC in Chardonnay wine and in Sake wine. In order to assess the EC reduction potential of the engineered strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3, fermentations of both Chardonnay must and Sake rice mash were conducted after which the EC content of the resultant wines was quantified. Consistent with prior observations of K7EC‐ (Section 4.2.2),  EC  reduction  by  K7EC‐  in  Chardonnay  wine  was  inefficient  (6.85% ‐ Table  20)  due  to  low  EC production by the parental strain K7. As expected, production of Sake wine with K7EC‐ yielded highly efficient  EC  reduction  (87% ‐ Table  21).  Furthermore,  522EC‐  was  effective  at  reducing  EC  in  both Chardonnay wine and Sake wine (81% and 84%, respectively ‐ Tables 20 and 21).   In Chardonnay wine, K7D3 and 522D3 reduced EC as efficiently as K7EC‐ and 522EC‐, respectively (Table 20); both K7D3 and K7EC‐ reduced EC by ~10% while 522D3 and 522EC‐ both reduced EC by ~81%. The observed equivalency in EC reduction is likely a function of the need for cells to degrade urea once it is internalized,  as  urea  is  toxic  to  cells  at  high  concentrations.  Presumably,  the  3.6‐fold  induction  of DUR1,2  observed  in  K7D3 (Figure  30),  coupled  with  constitutive  urea  import,  is  responsible  for  the strain’s ability to reduce EC as efficiently as K7EC‐. Despite the lack of gene expression data, the same rationale is likely responsible for the reduction of EC in Chardonnay wine by 522D3. These data suggest that K7 and 522 are highly sensitive to changes in the expression of genes involved in urea metabolism and  that  engineering  yeasts  to  induce  large  scale  expression  changes  (greater  than  5‐fold)  may  be unnecessary. Furthermore, these data are important because they validate the application of DUR3 constitutive expression for the reduction of EC in grape wine, specifically in wine derived from musts with high endogenous urea. In such cases, EC reduction would likely be greatest in wine fermented by urea importing yeasts (DUR3 cassette) rather than urea degrading yeasts (DUR1,2 cassette).       In  Sake  wine,  K7D3 and  522D3 were  much  less  effective  in  reducing  EC  than  their  DUR1,2 counterparts K7EC‐ and 522EC‐ (Table 21). These results can be explained by the requirements for DUR1,2 expression in S. cerevisiae (Figure 37). In a system analogous to the well characterized lac operon in E.   96  coli,  NCR  in  S.  cerevisiae  functions  to  force  cells  to  metabolize  the  most  energetically  favourable nutrients. As such, expression of NCR regulated genes is highly dependent on two conditions being met: the presence of an inducer and the presence of an NCR associated transcriptional activator like GLN3. Indeed, expression of DUR1,2 was shown to be highly dependent on GLN3 under induced conditions (Cooper, et al. 1990). Likewise, DUR1,2 expression on a proline medium (no NCR – GLN3 active) was very low  without  an  inducer  present  (Cooper,  et  al.  1990).  As  discussed  previously  (Section  4.2.3), fermentations  of  grape  must  can  be  subject  to  nitrogen  exhaustion  and  thus  yeasts  may  undergo transcriptional de‐repression of NCR sensitive genes i.e. GLN3 becomes activated. During Chardonnay must fermentation K7D3 and 522D3 constitutively imported urea thus fulfilling the inducer requirement for DUR1,2 expression. Upon nitrogen limitation, transcriptional reprogramming likely activated GLN3 and, because of the constitutive presence of urea, DUR1,2 was induced enabling K7D3 and 522D3 to degrade urea and reduce EC. In contrast, fermentations of Sake rice mash are not subject to nitrogen exhaustion due to the presence of koji enzymes and rice protein bodies. Although K7D3 and 522D3 still constitutively  imported  urea  during  Sake  fermentations,  GLN3  remained  inactive  due  to  a  plentiful supply  of  good  nitrogen.  Thus,  without  satisfying  both  conditions  for  transcriptional  activation,  the native  DUR1,2  genes  remained  repressed  in  K7D3 and  522D3 and  constitutively  absorbed  urea  likely diffused back out of the cell, where it could form EC in the resultant Sake wine. Indeed, the facilitated diffusion system for urea (DUR4), which allows leakage from the cell, is energy independent, insensitive to NCR, and present in cells growing in the absence of any inducer (Cooper and Sumrada 1975).    97   Figure 37. Schematic representation of inducible DUR1,2 expression during Chardonnay and Sake wine fermentation by a urea importing yeast strain. During Chardonnay fermentation partial activation of GLN3  coupled  with  the  constitutive  presence  of  the  inducer  allows  for  expression  of  DUR1,2  and reduction of EC. Despite the constitutive presence of the inducer, constant NCR maintains repression of DUR1,2 during Sake fermentations and constitutively imported urea is allowed to leak from the cell and form EC.  While Figure 37 explains the most likely reason for the inability of K7D3 and 522D3 to reduce EC efficiently  in  Sake  wine,  there  may  be  other  minor  issues.  Firstly,  yeast  growth  in  rice  mash  may influence  the  degree  of  protein  mistargeting,  a  common  problem  for  membrane  protein  over expression. Unlike soluble proteins, which are translated and kept in the cytosol, membrane proteins must navigate the protein trafficking system which, consequently, is subject to a number of rate limiting steps (Reviewed in Wagner, et al. 2006). In eukaryotes, membrane protein production begins on the rough  endoplasmic  reticulum  (ER)  where  ribosomes  bound  to  ER  translate  proteins  which  are immediately translocated into the ER lumen (Wagner, et al. 2006). From there, proteins can begin to undergo a variety of post‐translational modifications (most commonly glycosylation) and quality control checks (Wagner, et al. 2006). Proteins leave the ER by means of COPII coated vesicles that travel along microtubules through the cis‐, mid‐ and trans‐ Golgi apparatus before being excreted into the plasma membrane via additional vesicles (Wagner, et al. 2006). Since protein trafficking machinery is limited in its  speed  and  efficiency,  and  must  be  shared  with  other  essential  membrane  proteins,  excess Minimal leakage of urea   98  overexpressed protein often backs up (Wagner, et al. 2006). Such backups are often dealt with via ubiquitin‐proteasome mediated degradation (Wagner, et al. 2006), or, as more often the case in S. cerevisiae, excess protein is diverted to the vacuole where it is either stored or degraded (Wagner, et al. 2006). Although expressed from a high copy plasmid rather than an integrated cassette, a recent study of the polyamine transport function of DUR3p reported significant amounts of over expressed DUR3p localizing  to  the  vacuole  suggesting  a  high  degree  of  degradation  (Uemura,  Kashiwagi  and  Igarashi 2007).  This  result  was  subsequently  confirmed  by  another  study  looking  at  optimizing  S.  cerevisiae membrane protein over expression (Newstead, et al. 2007). Thus, if cell growth in rice mash increases DUR3p  mistargeting  relative  to  growth  in  grape  must,  or,  more  likely,  if  cell  survival  in  Sake  wine (perhaps due to high ethanol stress and low osmotic stress) requires the expression of a greater number of membrane proteins, the amount of functional DUR3p would be diminished, thus lowering the EC reduction ability.   Finally, Sake brewing may change the primary physiological role of DUR3p. As noted previously DUR3p is primarily an active transporter of urea, however it has also been shown to be involved in boron transport (Nozawa, et al. 2006) and polyamine uptake (Uemura, Kashiwagi and Igarashi 2007). While little is known about boron’s role in fermentation, polyamines have been shown to be crucial for cell growth (Tabor and Tabor 1999); polyamine levels are elevated in actively growing cells (Monteiro and Bisson 1992). Polyamines may be especially important for growth in the substantially different nutrient environment of rice mash; thus, during Sake brewing, an increased need for polyamines, and perhaps boron, may decrease the amount of over expressed DUR3p available for urea uptake, thereby lowering EC reduction ability.  4.3.2.5  The metabolically engineered yeasts K7EC‐D3 and 522EC‐D3 do not reduce EC more effectively than  K7EC‐ and  522EC‐ or  K7D3 and  522D3 in  either  Chardonnay  or  Sake  wine. The effect of both the DUR1,2 and DUR3 cassettes on EC reduction was evaluated in Chardonnay and Sake wine. Strains K7EC‐D3 and 522EC‐D3 were not capable of producing Chardonnay or Sake wine with less EC than K7EC‐ and 522EC‐ or K7D3 and 522D3 (Tables 20 and 21). Thus, it seems that constitutive expression of both DUR1,2 and DUR3 offers no synergistic advantage over the constitutive expression of either gene alone and that, in the case of metabolic engineering of S. cerevisiae to reduce EC in wine, it is prudent to limit engineering to   99  one  gene.  Yeast  strains  constitutively  expressing  only  a  single  gene  are  logistically  and  functionally simpler, more cost effective, and can more expediently receive regulatory approval.  Data from this study suggested that in K7EC‐D3, which has both cassettes integrated, high level expression of both DUR1,2 and DUR3 was maintained (Figure 30), and that both cassettes produce functional enzymes (Figure 31). Moreover, urea degrading and urea importing yeast strains (integration of the DUR1,2 and DUR3 cassettes, respectively) each reduce EC by up to 90% (Tables 20 and 21); however, the lack of synergistic EC reduction in strains constitutively co‐expressing DUR1,2 and DUR3 suggests the presence of confounding factors which must still be investigated. One such factor may be the induction of the native copies of DUR3 in the engineered strains at or near the end of fermentation. If and when, at the end of fermentation, yeasts are subject to nitrogen exhaustion, the de‐repression of NCR may result in the expression of DUR3; if the level of DUR3 expression from the native promoter is equal or near equal to that of expression from the PGK1 promoter then it follows that integration of the DUR3 cassette should not confer any advantage in terms of urea uptake and EC reduction. To test this hypothesis, the ability for yeasts to uptake urea under conditions of NCR de‐repression was examined (Figures  33  and  34).  These 14C‐uptake  assays  were  completed  in  an  L‐proline  minimal  medium  to simulate conditions of NCR de‐repression. Proline has long been recognized as a poor quality nitrogen source  for  yeast  (Hofman‐Bang  1999;  Ingledew,  Magnus  and  Sosulski  1987).  Under  de‐repressive conditions, uptake of urea by the parental strain K7 and the engineered strains K7EC‐, K7D3, and K7EC‐D3 largely mimicked uptake under repressive conditions (Figures 31 and 33). Both K7D3 and K7EC‐D3, which contained the integrated DUR3 cassette, were highly capable of incorporating 14C‐urea while the strains that  did  not  contain  the  DUR3  cassette,  K7  and  K7EC‐,  were  unable  to  incorporate  any  appreciable amounts of urea (Figure 33) indicating that constitutive expression of DUR3 from the PGK1 promoter and terminator signals does indeed confer an advantage to engineered yeast cells in terms of urea uptake. Furthermore, data obtained from global gene expression studies during grape wine and Sake wine fermentations confirm that during grape wine fermentation DUR3 is only induced during nitrogen exhaustion  (Rossignol,  et  al.  2003).  Moreover,  during  Sake  wine  making,  DUR3  is  transcriptionally inactive throughout the course of fermentation (Wu, et al. 2006). Taken together, these data indicate that expression of DUR3 from its native promoter is not likely to be a significant reason for the lack of synergistic EC reduction in engineered strains that constitutively import and degrade urea. Although the de‐repressive conditions of the assay permitted full induction of native DUR3, the reason for poor urea   100  uptake in K7 and K7EC‐ may be the use of stationary phase cells for the assay. In order to express DUR3 from  its  native  promoter,  both  an  inducer  must  be  present  (urea)  and  NCR  must  be  de‐repressed (Hofman‐Bang 1999). Despite the de‐repression of NCR, the cells were grown in the absence of an inducer thus maintaining low‐level DUR3 expression; only when cells were exposed to 14C‐urea were both conditions for DUR3 expression met.   In grape wine and Sake wine, the major contributor to EC is urea along with ethanol. Post‐fermentation treatment of wine and Sake with an acid urease resulted in significant reduction of EC (Ough and Trioli 1988); moreover, fermentation of Sake rice mash with CAR1 deficient yeast strains has been shown to produce Sake wine with no detectable urea or EC (Kitamoto, et al. 1991; Yoshiuchi, Watanabe  and  Nishimura  2000).  These  studies  provide  strong  evidence  that  the  most  important precursor  for  EC  is  urea  derived  from  CAR1  mediated  arginine  degradation;  however,  in  certain circumstances, such as wine that has undergone a MLF, a certain percentage of EC could be derived from alternate sources. While this rationale would explain a lack of synergistic EC reduction in a wine that had undergone MLF, it fails to explain the results of this study.  Besides  urea,  a  number  of  other  compounds  have  been  implicated  in  the  formation  of  EC. Carbamyl phosphate and citrulline are known to react with ethanol and form EC (Matsudo 1993; Ough 1976b); however, while they have been detected, carbamyl phosphate and citrulline are not usually found in grape or Sake wine (Ough, Crowell and Gutlove 1988). Citrulline and carbamyl phosphate are by‐products  of  arginine  metabolism  in  lactic  acid  bacteria  and  are  only  found  in  wines  that  have undergone MLF; in lactic acid bacteria arginine is metabolized via the arginine deiminase pathway in which arginine is degraded to citrulline which is then degraded to ornithine and carbamyl phosphate (Liu, et al. 1994). Utilization of the metabolically engineered yeast strain ML01, which conducts parallel alcoholic and malolactic fermentations without the addition of lactic acid bacteria (Husnik, et al. 2006), could help reduce EC in certain applications. In stone fruit spirits such as fruit brandies, amygdalin from the stone has been shown to degrade into cyanide during fermentation, the oxidized form (cyannate) of which reacts with ethanol to form EC (Schehl 2007). Finally, a number of other compounds, such as N‐carbamyl α‐amino acids, N‐carbamyl β‐amino acids, and allantoin (by‐product of purine degradation) have been shown to react with ethanol and form EC (Ough, Crowell and Gutlove 1988); however, the contribution of these compounds to EC in alcoholic beverages has yet to be substantiated.    101  5  CONCLUSIONS  Amongst  other  reasons,  increased  awareness  surrounding  the  health  benefits  of  wine consumption has caused the popularity of wine to grow worldwide. Wine, and in particular red wine, has been shown to help prevent cardiovascular disease, dietary cancers, diabetes, hypertension, peptic users, and macular degeneration, amongst others (Bisson 2002). Along with a growing appreciation for the  benefits  of  alcoholic  beverage  consumption,  consumers  have  become  increasingly  conscious  of consumption  risks  and  therefore  have  begun  to  demand  increasingly  safe  products.  This  mindset echoes beyond alcoholic beverages and is highlighted by the prevalence of recent food safety issues including mad cow disease, pesticide usage, heavy metal contamination, E. coli O157:H7, GMO corn, and other GMO crops. Of particular concern to this study is the increasing recognition of EC, a naturally occurring and well characterized carcinogen found in wine, Sake, and many other yeast fermented foods and beverages. Indeed, winemakers and governments have become progressively more cognisant of the widespread prevalence of the EC problem. Spearheaded by the FDA and the University of California at Davis’ Department of Enology and Viticulture (Butzke and Bisson 1998), action manuals and data have been  complied  concerning  a  wide  range  of  EC  reduction  techniques.  Until  recently,  none  of  the techniques  employed  have  been  highly  effective  due  to  low  efficacy,  high  cost,  or  lengthened production time. However, in 2006 our group developed a substantially equivalent, self‐cloned, FDA approved, industrial wine yeast (522EC‐) capable of reducing EC in Chardonnay wine by 89%. The amount of EC in wines is proportional to residual urea, thus making EC reduction a matter of eliminating residual urea at the end of alcoholic fermentation. S. cerevisiae strain 522EC‐ is capable of reducing EC by 89% due to constitutive expression of urea amidolyase (DUR1,2) which degrades urea to ammonia and carbon dioxide;  the  native  copy  of  this  gene  is  normally  transcriptionally  silent  in  fermentations  with  rich nitrogen supplies thus resulting in wines with high residual urea and thus high EC .  Numerous industrial strains of S. cerevisiae exist around the world, each filling an environmental niche. Arising from growth on different nutrient sources, strains have developed different fermentative properties and, as such, are uniquely suited to fermentation of different substrates. However, EC is a pervasive problem in all types of alcoholic fermentation and, as a result, EC reduction is important in all yeast strains. The self‐cloned Sake yeast strains K7EC‐ and K9EC‐ containing the constitutively expressed DUR1,2 cassette, were ineffective when tested in wine making trials; however, K7EC‐ and K9EC‐ were   102  highly capable of EC reduction during Sake brewing trials. Thus, it is clear that certain yeast strains are uniquely adapted to specific niches and that they are not optimally functional in other niches. The functionality of enhanced yeast strains must therefore be assessed in their native environment in order to most accurately gauge performance and avoid the identification of false negatives.  In an effort to further reduce EC levels beyond the capability of DUR1,2 technology, this study was also focused on the creation of substantially equivalent, self‐cloned, industrial wine yeasts capable of constitutive urea import. In order to create the industrial strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3 the S. cerevisiae urea permease (DUR3) was expressed under the control of the S. cerevisiae PGK1 promoter and  terminator  signals  and  integrated  into  the  TRP1  locus  of  the  relevant  parental  strains.  DNA sequencing confirmed that the recombinant cassette contained no deleterious mutations or amino acid substitutions.  Furthermore,  Southern  blotting  confirmed  proper  cassette  integration  into  the  target TRP1 locus. Constitutive expression of DUR3 was confirmed by northern blotting and quantified by qRT‐PCR. Global gene expression analysis indicated that the integration of the DUR3 cassette had a minimal impact on the transcriptome of S. cerevisiae and that no major metabolic pathways were affected by the presence  of  the  DUR3  cassette.  Urea  import  studies  using 14C‐urea  indicated  that  DUR3  cassette containing  strains  indeed  express  functional  DUR3p  and  that  this  functionality  is  preserved  when DUR1,2 and DUR3 are constitutively co‐expressed. Comparisons of small scale Chardonnay and Sake wine making demonstrated that, although constitutive co‐expression of DUR1,2 and DUR3 does not yield synergistic EC reduction in Chardonnay or Sake wine, constitutive expression of DUR3 alone is capable of reducing EC as efficiently as constitutive expression of DUR1,2 in Chardonnay wine yet not in Sake  wine.  Thus,  in  grape  wine  making  applications,  and  specifically  in  musts  which  contain  high endogenous urea, DUR3 constitutive expression is an important, valuable, and alternative strategy for EC reduction. A provisional patent has been filed concerning the constitutive expression of DUR3 in S. cerevisiae for the reduction of EC in grape wine. Furthermore, all of the DUR3 expressing strains can be constructed by self‐cloned means, and thus would be more acceptable both worldwide due to their non‐transgenic nature, and in countries such as Germany and Japan where self‐cloned organisms are not considered as GMO’s.       103  5.1  Future Directions  As a result of this study and previous work by our group (Coulon, et al. 2006), winemakers now have highly effective methods for EC reduction at their fingertips; however, several topics still require investigation.  Firstly,  in  order  to  facilitate  the  commercialization  of  yeast  strains  constitutively expressing  DUR3,  a  cassette  must  be  developed  which  does  not  contain  any  antibiotic  resistance markers.  Secondly,  experiments  should  be  done  in  order  to  confirm  which  of  the  potential  causes discussed in Section 4.3.2.4 are responsible for the constitutive expression of DUR3 not reducing EC efficiently  in  Sake  wine  as  it  does  in  Chardonnay  wine;  answering  this  question  may  allow  for  the subsequent adaptation of DUR3 technology to Sake making. Thirdly, the development of alternative methods of EC reduction would prove to be useful in further reducing EC beyond 90% thus making wines and spirits safer for consumers. Moreover, as urea and EC production by different strains is highly variable,  studies  into  the  molecular  mechanisms  behind  these  variations  will  aid  scientists  and winemakers in engineering new strains or selecting natural strains which produce little or no EC. Finally, it is imperative that, before the yeasts can be commercialized, the proteome and metabolome of the metabolically  enhanced  yeast  strains  described  here  be  characterized  as  to  establish  substantial equivalence.     104  REFERENCES Ashby, J. (1991) Genotoxicity data supporting the proposed metabolic activation of ethyl carbamate (urethane) to a carcinogen: the problem now posed by methyl carbamate. Mutat. Res. 260, 307‐308. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1995) Short Protocols in Molecular Biology, 3rd ed., John Wiley & Sons, Inc., Boston, USA. Baudin, A. (1993) A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucl. Acids Res. 21, 3329‐3330. Bisson, L.F. (2002) The present and future of the international wine industry. Nature 418, 696‐699. Blake, C. C. (1981) Phosphoglycerate kinase. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 293, 93‐104. Bond, U., Neal, C., Donnelly, D. and James, T. (2004) Aneuploidy and copy number breakpoints in the genome of lager yeasts mapped by microarray hybridisation. Curr. Genet. 45, 360‐370. Bruckner, R. and Titgemeyer, F. (2002) Carbon catabolite repression in bacteria: choice of the carbon source and autoregulatory limitation of sugar utilization. FEMS Microbiol. Lett. 209, 141‐148. Butzke,  C.E.  and  Bisson,  L.F.  (1998)  Ethyl  Carbamate  Preventative  Action  Manual.  2008. (http://www.cfsan.fda.gov/~frf/ecaction.html). Bysani, N., Daugherty, J. R. and Cooper, T. G. (1991) Saturation mutagenesis of the UASNTR (GATAA) responsible for nitrogen catabolite repression‐sensitive transcriptional activation of the allantoin pathway genes in Saccharomyces cerevisiae. J. Bacteriol. 173, 4977‐4982. Canas, B. J., Havery, D. C., Robinson, L. R., Sullivan, M. P., Joe, F. L., Jr and Diachenko, G. W. (1989) Ethyl carbamate levels in selected fermented foods and beverages. J. Assoc. Off. Anal. Chem. 72, 873‐876.   105  Cooper,  T.  G.  (1982)  Nitrogen  metabolism  in  S.  cerevisiae;  in  The  molecular  biology  of  the  yeast: metabolism and gene expression. J.N. Strathern, E.W. Jones (ed.), pp. 39‐99, Cold Spring Harbor Press, New York. Cooper, T. G. (2002) Transmitting the signal of excess nitrogen in Saccharomyces cerevisiae from the Tor proteins to the GATA factors: connecting the dots. FEMS Microbiol. Rev. 26, 223‐238. Cooper,  T.  G.,  Ferguson,  D.,  Rai,  R.  and  Bysani,  N.  (1990)  The  GLN3  gene  product  is  required  for transcriptional activation  of allantoin system gene expression in Saccharomyces cerevisiae.  J. Bacteriol. 172, 1014‐1018. Cooper, T. G. and Sumrada, R. (1975) Urea transport in Saccharomyces cerevisiae. J. Bacteriol. 121, 571‐576. Coulon, J., Husnik, J. I., Inglis, D. L., van der Merwe, G. K., Lonvaud, A., Erasmus, D. J. and van Vuuren, H. J. J. (2006) Metabolic Engineering of Saccharomyces cerevisiae to Minimize the Production of Ethyl Carbamate in Wine. Am. J. Enol. Vitic. 57, 113‐124. Cox, J. S. and Walter, P. (1996) A Novel Mechanism for Regulating Activity of a Transcription Factor That Controls the Unfolded Protein Response. Cell, 87, 391‐404. Cox, K. H., Rai, R., Distler, M., Daugherty, J. R., Coffman, J. A. and Cooper, T. G. (2000) Saccharomyces cerevisiae GATA sequences function as TATA elements during nitrogen catabolite repression and when Gln3p is excluded from the nucleus by overproduction of Ure2p. J. Biol. Chem. 275, 17611‐17618. Cox,  K.  H.,  Kulkarni,  A.,  Tate,  J.  J.  and  Cooper,  T.  G.  (2004)  Gln3  Phosphorylation  and  Intracellular Localization in Nutrient Limitation and Starvation Differ from Those Generated by Rapamycin Inhibition of Tor1/2 in Saccharomyces cerevisiae. J. Biol. Chem. 279, 10270‐10278. Dahl, G., Miller, J. and Miller, E. (1978) Vinyl carbamate as a promutagen and a more carcinogenic analog of ethyl carbamate. Cancer Res. 38, 3793‐3804.   106  Dann, S. G. and Thomas, G. (2006) The amino acid sensitive TOR pathway from yeast to mammals. FEBS Letters 580, 2821‐2829. De Virgilio, C. and Loewith, R. (2006) The TOR signalling network from yeast to man. Int. J. Biochem. Cell Bio. 38, 1476‐1481. Dohmen, R. J. and Varshavsky, A. (2005) Heat‐inducible degron and the making of conditional mutants. Methods Enzymol. 399, 799‐822. Dunn, B., Levine, R. P. and Sherlock, G. (2005) Microarray karyotyping of commercial wine yeast strains reveals shared, as well as unique, genomic signatures. BMC Genomics 6, 53‐74. Eckhardt, T. (1978) A rapid method for the identification of plasmid desoxyribonucleic acid in bacteria. Plasmid 1, 584‐588. ElBerry, H. M., Majumdar, M. L., Cunningham, T. S., Sumrada, R. A. and Cooper, T. G. (1993) Regulation of the urea active transporter gene (DUR3) in Saccharomyces cerevisiae. J. Bacteriol. 175, 4688‐4698. Farrell A., E., Plevin R., J., Turner B., T., Jones A., D., O'Hare, M. and Kammen D., M. (2006) Ethanol Can Contribute to Energy and Environmental Goals. Science 311, 506‐508. Gancedo , J. M. (1992) Carbon catabolite repression in yeast. Eur. J. Biochem.  206, 297‐313. Gatignol, A. (1987) Phleomycin resistance encoded by the ble gene from transposon Tn 5 as a dominant selectable marker in Saccharomyces cerevisiae. Mol. Gen. Genetics 207, 342‐348. Genbauffe,  F.  S.  and  Cooper,  T.  G.  (1991)  The  urea  amidolyase  (DUR1,2)  gene  of  Saccharomyces cerevisiae. DNA Seq. 2, 19‐32. Genbauffe, F. S. and Cooper, T. G. (1986) Induction and repression of the urea amidolyase gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 6, 3954‐3964. Gietz, R. D. and Woods, R. A. (2002) Transformation of yeast by lithium acetate/single‐stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 350, 87‐96.   107  Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J. D., Jacq, C., Johnston, M., Louis, E. J., Mewes, H. W., Murakami, Y., Philippsen, P., Tettelin, H. and Oliver, S. G. (1996) Life with 6000 Genes. Science 274, 546‐567. Goode,  J.  (2005)  The  Science  of  Wine:  From  Vine  to  Glass,  University  of  California  Press,  Berkley, California. Greig, D. and Travisano, M. (2003) Evolution: Haploid Superiority. Science 299, 524‐525. Griffiths,  A.  J.  F.,  Miller,  J.  H.,  Suzuki,  D.  T.,  Lewontin,  R.  C.,  and  Gelbart,  W.  M.  (2005)  An Introduction to Genetic Analysis. Eight ed., W. H. Freeman, New York, USA. Guengerich, F. P. and Kim, D. H. (1991) Enzymatic oxidation of ethyl carbamate to vinyl carbamate and its role as an intermediate in the formation of 1,N6‐ethenoadenosine. Chem. Res. Toxicol. 4, 413‐421. Guldener, U., Heck, S., Fielder, T., Beinhauer, J. and Hegemann, J. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucl. Acids Res. 24, 2519‐2524. Hampsey, M. (1997) A review of phenotypes in Saccharomyces cerevisiae. Yeast 13, 1099‐1133. Han,  J.,  Lee,  J.,  Bibbs,  L.  and  Ulevitch,  R.  (1994)  A  MAP  kinase  targeted  by  endotoxin  and hyperosmolarity in mammalian cells. Science 265, 808‐811. Hashizume, K., Okuda, M., Sakurao, S., Numata, M., Koseki, T., Aramaki, I., Kumamaru, T. and Sato, H. (2006) Rice protein digestion by sake koji enzymes: comparison between steamed rice grains and isolated protein bodies from rice endosperm. J. Biosci. Bioeng. 102, 340‐345. Hauser,  N.,  Fellenberg,  R.,  Gil,  R.,  Bastuk,  S.,  Hoheisel,  J.  and  Perez‐Ortin,  J.  (2001)  Whole  genome analysis of a wine yeast strain. Comp. Funct. Genomics 2, 69‐79. Herskowitz, I. (1988) Life cycle of the budding yeast Saccharomyces cerevisiae. Microbiol. Rev. 52, 536‐553.   108  Hitzeman, R. A. (1980) Isolation and characterization of the yeast 3‐phosphoglycerokinase gene (PGK) by an immunological screening technique. J. Biol. Chem. 255, 12073‐12080. Hofman‐Bang, J. (1999) Nitrogen catabolite repression in Saccharomyces cerevisiae. Mol. Biotechnol. 12, 35‐73. Hughes, T., Roberts, C., Dai, H., Jones, A., Meyer, M., Slade, D., Burchard, J., Dow, S., Ward, T., Kidd, M., Friend, S. and Marton, M. (2000) Widespread aneuploidy revealed by DNA microarray expression profiling. Nat. Genet. 25, 333‐337. Husnik, J. I., Volschenk, H., Bauer, J., Colavizza, D., Luo, Z. and van Vuuren, H. J. J. (2006) Metabolic engineering of malolactic wine yeast. Metabol. Eng. 8, 315‐323. Iemura, Y., Takahashi, T., Yamada, T., Furukawa, K. and Hara, S. (1999a) Properties of TCA‐Insoluble peptides in Kimoto (traditional seed mash for sake brewing) and conditions for liberation of the peptides from rice protein. J. Biosci. Bioeng. 88, 531‐535. Iemura, Y., Yamada, T., Takahashi, T., Furukawa, K. and Hara, S. (1999b) Properties of the peptides liberated from rice protein in Sokujo‐moto. J. Biosci. Bioeng. 88, 276‐280. Ingledew, W. M., Magnus, C. A. and Patterson, J. R. (1987) Yeast Foods and Ethyl Carbamate Formation in Wine. Am. J. Enol. Vitic. 38, 332‐335. Ingledew, W. M., Magnus, C. A. and Sosulski, F. W. (1987) Influence of Oxygen on Proline Utilization During the Wine Fermentation. Am. J. Enol. Vitic. 38, 246‐248. Inoue,T . (2000) Cloning and Characterization of a Gene Complementing the Mutation of an Ethanol‐sensitive Mutant of Sake Yeast. Biosci. Biotech. Biochem. 64, 229‐236. Jacobs, E., Dubois, E. and Wiame, J. M. (1985) Regulation of urea amidolyase synthesis in Saccharomyces cerevisiae, RNA analysis, and cloning of the positive regulatory gene DURM. Curr. Genet. 9, 333‐339.   109  Jahnke,  L.  (1983)  Oxygen  requirements  for  formation  and  activity  of  the  squalene  epoxidase  in Saccharomyces cerevisiae. J. Bacteriol  155, 488‐492. Jones  E.  W.,  Pringle  J.  R.,  Broach  J.  R.  (1992)  The  Molecular  and  Cellular  Biology  of  the  Yeast Saccharomyces, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA.  Kessler, D. A. (1992) The safety of foods developed by biotechnology. Science 256, 1747‐1749. Kinzy,  T.  G.  (1994)  Multiple  genes  encode  the  translation  elongation  factor  EF‐1  gamma  in Saccharomyces cerevisiae. Nucl. Acids Res. 22, 2703‐2707. Kitamoto, K., Oda, K., Gomi, K. and Takahashi, K. (1991) Genetic engineering of a sake yeast producing no urea by successive disruption of arginase gene. Appl. Environ. Microbiol. 57, 301‐306. Kizaki, Y., Inoue, Y., Okazaki, N. and Kobayashi, S. (1991) Isolation and determination of protein bodies (PB‐I, PB‐II) in polished rice endosperm. J. Brew. Soc. Jpn. 86, 293‐298. Kliewer, W.M. (1970) Free amino acids and other nitrogenous fractions in wine grapes. J. Food Sci. 35, 17‐21. Kodama, K. (1993) Sake‐brewing yeast; in The Yeasts, Rose, A. H. and Harrison, J. S. (eds.), pp. 129‐168, Academic Press, London, United Kingdom. Kodama, S., Suzuki, T., Fujinawa, S., de la Teja, P. and Yotsuzuka, F. (1994) Urea Contribution to Ethyl Carbamate Formation in Commercial Wines During Storage. Am. J. Enol. Vitic. 45, 17‐24. Lam, K. B. (1977) Isolation and characterization of Saccharomyces cerevisiae glycolytic pathway mutants. J. Bacteriol 130, 746‐749. Leithauser, M. T., Liem, A., Stewart, B. C., Miller, E. C. and Miller, J. A. (1990) 1,N6‐ethenoadenosine formation,  mutagenicity  and  murine  tumor  induction  as  indicators  of  the  generation  of  an electrophilic epoxide metabolite of the closely related carcinogens ethyl carbamate (urethane) and vinyl carbamate. Carcinogenesis 11, 463‐473.   110  Liu, S., Pritchard, G. G., Hardman, M. J. and Pilone, G. J. (1994) Citrulline Production and Ethyl Carbamate (Urethane)  Precursor  Formation  From  Arginine  Degradation  by  Wine  Lactic  Acid  Bacteria Leuconostoc oenos and Lactobacillus buchneri. Am. J. Enol. Vitic. 45, 235‐242. Lohr, D., Venkov, P. and Zlatanova, J. (1995) Transcriptional regulation in the yeast GAL gene family: a complex genetic network. FASEB J. 9, 777‐787. Maftahi, M., Gaillardin, C. and Nicaud, J. M. (1998) Generation of Saccharomyces cerevisiae deletants and basic phenotypic analysis of eight novel genes from the left arm of chromosome XIV. Yeast 14, 271‐280. Malone, R. E. (1990) Dual regulation of meiosis in yeast. Cell, 61, 375‐378. Manivasakam,  P.  (1995)  Micro‐homology  mediated  PCR  targeting  in  Saccharomyces  cerevisiae.  Nuc. Acids Res. 23, 2799‐2800. Marks, V. D., Sui, S. J., Erasmus, D., van der Merwe, G., Brumm, J., Wasserman, W. W., Bryan, J., van Vuuren, H. J. J. (2008) Dynamics of the yeast transcriptome during wine fermentation reveals a novel fermentation stress response. FEMS Yeast Research 8, 35‐52. Marks, V. D.,  van der Merwe, G., van Vuuren, H. J. J. (2003) Transcriptional profiling of wine yeast in fermenting grape juice: regulatory effect of diammonium phosphate. FEMS Yeast Research 3, 269‐287. Matsudo, T. (1993) Determination of ethyl carbamate in soy sauce and its possible precursor. J. Agricult. Food Chem. 41, 352‐356. Miklos, G. G. and Rubin, G. (1996) The Role of the Genome Project in Determining Gene Function: Insights from Model Organisms. Cell, 86, 521‐529. Monteiro, F. F. and Bisson, L. F. (1991) Amino Acid Utilization and Urea Formation During Vinification Fermentations. Am. J. Enol. Vitic. 42, 199‐208. Monteiro, F. F. and Bisson, L. F. (1992) Nitrogen Supplementation of Grape Juice. I. Effect on Amino Acid Utilization During Fermentation. Am. J. Enol. Vitic. 43, 1‐10.   111  Monteiro, F. F., Trousdale, E. K. and Bisson, L. F. (1989) Ethyl Carbamate Formation in Wine: Use of Radioactively Labeled Precursors to Demonstrate the Involvement of Urea. Am. J. Enol. Vitic. 40, 1‐8. Mori,  K.  (1996)  Signalling  from  endoplasmic  reticulum  to  nucleus:  transcription  factor  with  a  basic‐leucine zipper motif is required for the unfolded protein‐response pathway. Genes to Cells 1, 803‐817. Mortimer, R. K. (1966) Genetic mapping in Saccharomyces. Genetics 53, 165‐173. Nasmyth, K. (1993) Regulating the HO endonuclease in yeast. Curr. Opin. Genet. Dev. 3, 286‐294. National  Institutes  of  Health  National  Toxicology  Program.  (2004)  NTP  Technical  Report  on  the Toxicology and Carcinogenesis Studies of Urethane, Ethanol, and Urethane/Ethanol in B6C3F1 Mice (Drinking Water Studies). TR 510, 1‐351. Newstead, S., Kim, H., von Heijne, G., Iwata, S. and Drew, D. (2007) High‐throughput fluorescent‐based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 104, 13936‐13941. Nettleship, A., Henshaw, PS. and Meyer, HL. (1943) Induction of pulmonary tumors in mice with ethyl carbamate (urethane). J. Natl. Cancer Inst. 4, 309‐319. Nikawa, J., Akiyoshi, M., Hirata, S. and Fukuda, T. (1996) Saccharomyces cerevisiae IRE2/HAC1 is involved in IRE1‐mediated KAR2 expression. Nucl. Acids Res. 24, 4222‐4226. Nozawa, A., Takano, J., Kobayashi, M., von Wiren, N. and Fujiwara, T. (2006) Roles of BOR1, DUR3, and FPS1 in boron transport and tolerance in Saccharomyces cerevisiae. FEMS Microbiol. Lett. 262, 216‐222. Ough, C. S. (1976a) Ethyl carbamate in fermented beverages and foods. I. Naturally occurring ethyl carbamate. J. Agric. Food Chem. 24, 323‐328.   112  Ough, C. S. (1976b) Ethyl carbamate in fermented beverages and foods. II. Possible formation of ethyl carbamate from diethyl dicarbonate addition to wine. J. Agric. Food Chem. 24, 328‐331. Ough, C. S., Crowell, E. A. and Gutlove, B. R. (1988) Carbamyl Compound Reactions with Ethanol. Am. J. Enol. Vitic. 39, 239‐242. Ough, C. S., Crowell, E. A. and Mooney, L. A. (1988) Formation of Ethyl Carbamate Precursors During Grape Juice (Chardonnay) Fermentation. I. Addition of Amino Acids, Urea, and Ammonia: Effects of Fortification on Intracellular and Extracellular Precursors. Am. J. Enol. Vitic. 39, 243‐249. Ough, C. S., Huang, Z., An, D. and Stevens, D. (1991) Amino Acid Uptake by Four Commercial Yeasts at Two  Different  Temperatures  of  Growth  and  Fermentation:  Effects  on  Urea  Excretion  and Reabsorption. Am. J. Enol. Vitic. 42, 26‐40. Ough,  C.  S.,  Stevens,  D.,  Sendovski,  T.,  Huang,  Z.  and  An,  D.  (1990)  Factors  Contributing  to  Urea Formation in Commercially Fermented Wines. Am. J. Enol. Vitic. 41, 68‐73. Ough, C. S. and Trioli, G. (1988) Urea Removal from Wine by an Acid Urease. Am. J. Enol. Vitic. 39, 303‐307. Park, H., Shin, M. and Woo, I. (2001) Antisense‐mediated inhibition of arginase (CAR1) gene expression in Saccharomyces cerevisiae. J. Biosci. Bioeng. 92, 481‐484. Park,  K.,  Liem,  A.,  Stewart,  B.  C.  and  Miller,  J.  A.  (1993)  Vinyl  carbamate  epoxide,  a  major  strong electrophilic, mutagenic and carcinogenic metabolite of vinyl carbamate and ethyl carbamate (urethane). Carcinogenesis 14, 441‐450. Pena‐Castillo, L. and Hughes, T. (2007) Why Are There Still Over 1000 Uncharacterized Yeast Genes? Genetics 176, 7‐14. Perez‐Ortin, J., Garcia‐Martinez, J. and Alberola, T. (2002) DNA chips for yeast biotechnology. The case of wine yeasts. J. Biotechnol. 98, 227‐241.   113  Rossignol, T., Dulau, L., Julien, A. and Blondin, B. (2003) Genome‐wide monitoring of wine yeast gene expression during alcoholic fermentation. Yeast 20, 1369‐1385. Salmon, J. and Barre, P. (1998) Improvement of Nitrogen Assimilation and Fermentation Kinetics under Enological  Conditions  by  Derepression  of  Alternative  Nitrogen‐Assimilatory  Pathways  in  an Industrial Saccharomyces cerevisiae Strain. Appl. Environ. Microbiol. 64, 3831‐3837. Schehl, B. (2007) Contribution of the fermenting yeast strain to ethyl carbamate generation in stone fruit spirits. Appl. Microbiol. Biotech. 74, 843‐850. Schlatter,  J.  and  Lutz,  W.  K.  (1990)  The  carcinogenic  potential  of  ethyl  carbamate  (urethane):  risk assessment at human dietary exposure levels. Food Chem. Toxicol. 28, 205‐211. Shobayashi, M., Ukena, E., Fujii, T. and Iefuji, H. (2007) Genome‐wide expression profile of sake brewing yeast under shaking and static conditions. Biosci. Biotechnol. Biochem. 71, 323‐335. Smart, W. C., Coffman, J. A. and Cooper, T. G. (1996) Combinatorial regulation of the Saccharomyces cerevisiae CAR1 (arginase) promoter in response to multiple environmental signals. Mol. Cell. Biol. 16, 5876‐5887. Stevens, D. F. and Ough, C. S. (1993) Ethyl Carbamate Formation: Reaction of Urea and Citrulline with Ethanol in Wine Under Low to Normal Temperature Conditions. Am. J. Enol. Vitic. 44, 309‐312. Stolz, L. E. (1998) INP51, a yeast inositol polyphosphate 5‐phosphatase required for phosphatidylinositol 4,5‐bisphosphate homeostasis and whose absence confers a cold‐resistant phenotype. J. Biol. Chem. 273, 11852‐11861. Sumrada,  R.,  Gorski,  M.  and  Cooper,  T.  (1976)  Urea  transport‐defective  strains  of  Saccharomyces cerevisiae. J. Bacteriol. 125, 1048‐1056. Tabor, H. and Tabor, C. W. (1999) A Guide to the Polyamines. Seymour S. Cohen. Analytical Biochem. 274, 150. Oxford University Press, New York, USA.   114  Takagi, H., Takaoka, M., Kawaguchi, A. and Kubo, Y. (2005) Effect of L‐Proline on Sake Brewing and Ethanol Stress in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 71, 8656‐8662. Uemura,  T.,  Kashiwagi,  K.  and  Igarashi,  K.  (2007)  Polyamine  Uptake  by  DUR3  and  SAM3  in Saccharomyces cerevisiae. J. Biol. Chem. 282, 7733‐7741. van Vuuren, H. J. J., Daugherty, J. R., Rai, R. and Cooper, T. G. (1991) Upstream induction sequence, the cis‐acting element required for response to the allantoin pathway inducer and enhancement of operation of the nitrogen‐regulated upstream activation sequence in Saccharomyces cerevisiae. J. Bacteriol. 173, 7186‐7195. Vine, R. P., Harkness, E. M. and Linton, S. J. (2002) Winemaking: From Grape Growing to Marketplace, Second ed., Kluwer Academic/Plenum, New York. Volschenk, H., Viljoen, M., Grobler, J., Bauer, F., Lonvaud‐Funel, A., Denayrolles, M., Subden, R. E. and Van Vuuren, H. J. J. (1997) Malolactic Fermentation in Grape Musts by a Genetically Engineered Strain of Saccharomyces cerevisiae. Am. J. Enol. Vitic. 48, 193‐197. Wach,  A.  (1996)  PCR‐synthesis  of  marker  cassettes  with  long  flanking  homology  regions  for  gene disruptions in S. cerevisiae. Yeast 12, 259‐265. Ward, A. (1992) Rapid analysis of yeast transformants using colony‐PCR. Biotechniques, 13, 350.  Wagner,  S.,  Bader,  M.  L.,  Drew,  D.  and  de  Gier,  J.  (2006)  Rationalizing  membrane  protein overexpression. Trends in Biotech. 24, 364‐371. Westfall, P. J., Ballon, D. R. and Thorner, J. (2004) When the stress of your environment makes you go HOG wild. Science 306, 1511‐1512. Whitney, P. A. and Cooper, T. G. (1972) Urea Carboxylase and Allophanate Hydrolase. Two components of adenosine triphosphate: urea amidolyase in Saccharomyces  cerevisiae.  J. Biol. Chem. 247, 1349‐1353.   115  Whitney, P. A. and Cooper, T. (1973) Urea carboxylase from Saccharomyces cerevisiae. Evidence for a minimal two‐step reaction sequence. J. Biol. Chem. 248, 325‐330. Whitney,  P.  A.,  Cooper,  T.  G.  and  Magasanik,  B.  (1973)  The  induction  of  urea  carboxylase  and allophanate hydrolase in Saccharomyces cerevisiae. J. Biol. Chem. 248, 6203‐6209. Wu, H., Zheng, X., Araki, Y., Sahara, H., Takagi, H. and Shimoi, H. (2006) Global gene expression analysis of yeast cells during sake brewing. Appl. Environ. Microbiol. 72, 7353‐7358. Yanisch‐Perron,  C.,  Vieira,  J.  and  Messing,  J.  (1985)  Improved  M13  phage  cloning  vectors  and  host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103‐119. Yoshiuchi, K., Watanabe, M. and Nishimura, A. (2000) Breeding of a non‐urea producing sake yeast with killer character using a kar1‐1 mutant as a killer donor. J. Indust. Microbiol. Biotech. 24, 203‐209. Zimmerli, B. and Schlatter, J. (1991) Ethyl carbamate: analytical methodology, occurrence, formation, biological activity and risk assessment. Mutat. Res. 259, 325‐350. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066389/manifest

Comment

Related Items