UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Metabolic engineering of industrial yeast strains to minimize the production of ethyl carbamate in grape.. Dahabieh, Matthew Solomon 2008

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
[if-you-see-this-DO-NOT-CLICK]
ubc_2008_fall_dahabieh_matthew.pdf [ 1.9MB ]
Metadata
JSON: 1.0066389.json
JSON-LD: 1.0066389+ld.json
RDF/XML (Pretty): 1.0066389.xml
RDF/JSON: 1.0066389+rdf.json
Turtle: 1.0066389+rdf-turtle.txt
N-Triples: 1.0066389+rdf-ntriples.txt
Original Record: 1.0066389 +original-record.json
Full Text
1.0066389.txt
Citation
1.0066389.ris

Full Text

METABOLIC ENGINEERING OF INDUSTRIAL YEAST STRAINS TO MINIMIZE THE  PRODUCTION OF ETHYL CARBAMATE IN GRAPE AND SAKE WINE    by     MATTHEW SOLOMON DAHABIEH  B.Sc. Hon., The University of British Columbia, 2006       A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF   THE REQUIREMENTS FOR THE DEGREE OF    MASTER OF SCIENCE    in     THE FACULTY OF GRADUTATE STUDIES  (Genetics)           THE UNIVERISTY OF BRITISH COLUMBIA  (Vancouver)    April 2008  ©Matthew Solomon Dahabieh, 2008   ABSTRACT    During alcoholic fermentation Saccharomyces cerevisiae metabolizes L‐arginine to ornithine and  urea. S. cerevisiae can metabolize urea through the action of urea amidolyase, encoded by the DUR1,2  gene; however, DUR1,2 is subject to nitrogen catabolite repression (NCR) in the presence of high quality  nitrogen sources during fermentation. Being cytotoxic at high concentrations, urea is exported into wine  where it spontaneously reacts with ethanol, and forms the carcinogen ethyl carbamate (EC).    Urea degrading yeast strains were created by integrating a linear cassette containing the DUR1,2  gene under the control of the S. cerevisiae PGK1 promoter and terminator signals into the URA3 locus of  the Sake yeast strains K7 and K9. The ‘self‐cloned’ strains K7EC‐ and K9EC‐ produced Sake wine with 68%  less  EC.  The  Sake  strains  K7EC‐  and  K9EC‐  did  not  efficiently  reduce  EC  in  Chardonnay  wine  due  to  the  evolutionary adaptation of said strains to the unique nutrients of rice mash; therefore, the functionality  of  engineered  yeasts  must  be  tested  in  their  niche  environments  as  to  correctly  characterize  new  strains.    S.  cerevisiae  possesses  an  NCR  controlled  high  affinity  urea  permease  (DUR3).  Urea  importing  yeast strains were created by integrating a linear cassette containing the DUR3 gene under the control  of the PGK1 promoter and terminator signals into the TRP1 locus of the yeast strains K7 (Sake) and 522  (wine).  In  Chardonnay  wine,  the  urea  importing  strains  K7D3  and  522D3  reduced  EC  by  7%  and  81%,  respectively; reduction by these strains was equal to reduction by the urea degrading strains K7EC‐ and  522EC‐.  In  Sake  wine,  the  urea  degrading  strains  K7EC‐  and  522EC‐  reduced  EC  by  87%  and  84%  respectively, while the urea importing strains K7D3 and 522D3 were significantly less capable of reducing  EC (15% and 12% respectively). In Chardonnay and Sake wine, engineered strains that constitutively co‐ expressed DUR1,2 and DUR3 did not reduce EC more effectively than strains in which either gene was  expressed  solely.  Uptake  of  14C‐urea  under  non‐inducing  conditions  was  enhanced  in  urea  importing  strains; parental strains failed to incorporate any  14C‐urea thus confirming the functionality of the urea  permease derived from the integrated DUR3 cassette.   ii     TABLE OF CONTENTS  ABSTRACT ...................................................................................................................................................... ii  TABLE OF CONTENTS .................................................................................................................................... iii  LIST OF TABLES .............................................................................................................................................. x  LIST OF FIGURES .......................................................................................................................................... xii  LIST OF ABBREVIATIONS .............................................................................................................................. xv  ACKNOWLEDGEMENTS .............................................................................................................................. xix  1 INTRODUCTION ......................................................................................................................................... 1  1.1 Saccharomyces cerevisiae ............................................................................................................ 1  1.2 Yeast strains from nature vs. laboratory yeasts ........................................................................... 3  1.3 S. cerevisiae and industry: Wine yeasts ....................................................................................... 5  1.4 Winemaking and Sake brewing .................................................................................................... 6  1.5 Aspergillus oryzae and its role in Sake brewing ......................................................................... 10  1.6 Yeast nitrogen metabolism during alcoholic fermentation ....................................................... 11  1.7 Nitrogen metabolism and Nitrogen Catabolite Repression (NCR) in S. cerevisiae .................... 12  1.8 Urea and ethyl carbamate (EC) .................................................................................................. 16  1.9 The EC problem .......................................................................................................................... 17  1.9.1 The EC problem: History ............................................................................................... 17  1.9.2 The EC problem: Surveys of EC in alcoholic beverages ................................................ 18  1.9.3 The EC problem: Current methods of lowering EC ....................................................... 19  1.9.3.1 Agricultural methods ....................................................................................... 19  1.9.3.2 Additives (acid urease) .................................................................................... 20  1.9.3.3 Additives (DAP) ................................................................................................ 20   iii     1.9.3.4 Genetic engineering (urease expression) ........................................................ 20  1.9.3.5 Genetic engineering (CAR1) ............................................................................. 20  1.9.3.6 Genetic engineering (DUR1,2) ......................................................................... 21  1.9.4 Alternative methods for EC reduction .......................................................................... 22  1.10 Introduction to DUR3: Role in the cell (urea transport, polyamines, boron) .......................... 23  1.11 Proposed Research ................................................................................................................... 25  1.11.1 Significance of Research ............................................................................................. 25  1.11.2 Hypotheses ................................................................................................................. 25  1.11.2.1  The  metabolically  engineered  Sake  yeast  strains  K7EC‐  and  K9EC‐  should  reduce EC efficiently during Sake brewing trials. ........................................... 25  1.11.2.2 Constitutive co‐expression of DUR1,2 and DUR3 in metabolically engineered  yeasts should result in synergistic EC reduction. ............................................ 26  1.11.3 Main objectives ........................................................................................................... 26  2 MATERIALS AND METHODS ..................................................................................................................... 27  2.1 Strains, plasmids and genetic cassettes ..................................................................................... 27  2.2 Culture conditions ...................................................................................................................... 28  2.3 Genetic construction of the urea degrading yeasts K7EC‐ and K9EC‐ ........................................... 29  2.3.1 Co‐transformation of the DUR1,2 cassette and pUT332 .............................................. 29  2.3.2 Screening of transformants for the integrated DUR1,2 cassette ................................. 29  2.3.3 Genetic characterization ............................................................................................... 30  2.3.3.1 Southern blot analyses .................................................................................... 30  2.3.3.2 Sequence analysis ............................................................................................ 30   iv     2.3.3.3 Analysis of DUR1,2 gene expression by qRT‐PCR ............................................ 31  2.3.3.4 Global gene expression analysis ...................................................................... 32  2.3.4 Phenotypic characterization ......................................................................................... 33  2.3.4.1 Analysis of fermentation rate in Chardonnay must ........................................ 33  2.3.4.2 Analysis of fermentation rate in Sake mash .................................................... 33  2.3.4.3 Analysis of glucose/fructose utilization and ethanol production .................... 34  2.3.5 Functionality analyses ................................................................................................... 35  2.3.5.1 Reduction of EC in Chardonnay wine .............................................................. 35  2.3.5.2 Reduction of EC in Sake wine .......................................................................... 35  2.3.5.3 Quantification of EC in wine by solid phase microextraction and GC/MS ...... 35  2.4 Genetic construction of the urea importing yeasts K7D3, K7EC‐D3, 522D3, and 522EC‐D3 ............... 36  2.4.1 Construction of the DUR3 linear cassette ..................................................................... 36  2.4.1.1 Construction of pHVX2D3 ................................................................................ 36  2.4.1.2 Construction of pHVXKD3 ................................................................................ 37  2.4.1.3 Construction of pUCTRP1 ................................................................................ 38  2.4.1.4 Construction of pUCMD .................................................................................. 39  2.4.2 Sequence analysis of the DUR3 cassette in pUCMD ..................................................... 40  2.4.3  Transformation  of  the  linear  DUR3  cassette  into  S.  cerevisiae  and  selection  of  transformants .............................................................................................................. 43  2.4.3.1 Confirmation of integration via colony PCR .................................................... 43  2.4.4 Genetic characterization ............................................................................................... 43   v     2.4.4.1 Southern blot analyses .................................................................................... 43  2.4.4.2 Analysis of gene expression by northern blotting ........................................... 44  2.4.4.3 Analysis of DUR3 gene expression by qRT‐PCR ............................................... 44  2.4.4.4 Global gene expression analysis ...................................................................... 45  2.4.5 Analysis of urea uptake using 14C‐urea ......................................................................... 45  2.4.6 Phenotypic characterization ......................................................................................... 45  2.4.6.1 Analysis of fermentation rate in Chardonnay must ........................................ 45  2.4.6.2 Analysis of fermentation rate in Sake mash .................................................... 45  2.4.6.3 Analysis for ethanol content  ........................................................................... 45  2.4.7 Functionality of metabolically enhanced yeasts ........................................................... 46  2.4.7.1 Reduction of EC in Chardonnay wine .............................................................. 46  2.4.7.2 Reduction of EC in Sake wine .......................................................................... 46  2.5 Statistical analyses........................................................................................................... 46  3 RESULTS ................................................................................................................................................... 47  3.1 Constitutive expression of DUR1,2 in Sake yeast strains K7 and K9 .......................................... 47  3.1.1  Integration  of  the  linear  DUR1,2  cassette  into  the  genomes  of  Sake  yeast  strains  K7  and K9 .......................................................................................................................... 47  3.1.2 Genetic characterization of K7EC‐ and K9EC‐ ................................................................... 47  3.1.2.1  Correct  integration  of  the  DUR1,2  linear  cassette  into  the  genomes  of  K7EC‐  and K9EC‐ .......................................................................................................... 47  3.1.2.2  Sake  strains  K7EC‐  and  K9EC‐  do  not  contain  the  bla  and  Tn5ble  antibiotic  resistance markers .......................................................................................... 50   vi     3.1.2.3  Sequence  of  the  DUR1,2  cassette  integrated  into  the  genomes  of  K7EC‐  and  K9EC‐ ................................................................................................................. 51  3.1.2.4  Confirmation  of  constitutive  expression  of DUR1,2  in  K7EC‐  and  K9EC‐  by  qRT‐ PCR .................................................................................................................. 52  3.1.2.5  Effect  of  the  integrated  DUR1,2  cassette  on  the  transcriptomes  of  K7EC‐  and  K9EC‐ ................................................................................................................. 53  3.1.3 Phenotypic characterization of K7EC‐ and K9EC‐ ............................................................. 54  3.1.3.1 Fermentation rate of K7EC‐ and K9EC‐ in Chardonnay must .............................. 54  3.1.3.2 Fermentation rate of K7EC‐ and K9EC‐ in Sake mash .......................................... 55  3.1.3.3  Utilization  of  glucose  and  fructose  and  production  of  ethanol  by  K7EC‐  and  K9EC‐ in Sake wine ............................................................................................ 56  3.1.4 Constitutive expression of DUR1,2 in Sake yeast strains K7EC‐  and K9EC‐ reduces EC in  Chardonnay wine by approximately 30% .................................................................... 57  3.1.5 Constitutive expression of DUR1,2 in Sake yeast strains K7EC‐  and K9EC‐ reduces EC in  Sake wine by approximately 68% ................................................................................ 58  3.2 Constitutive expression of DUR3 in the Sake yeast strain K7 and the wine yeast strain 522 .... 59  3.2.1 Sequence of pUCMD ..................................................................................................... 59  3.2.2 Integration of the linear DUR3 cassette into the genomes of yeast strains K7, K7EC‐, K9,  and K9EC‐ ....................................................................................................................... 63  3.2.3 Genetic characterization of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 ....................................... 63  3.2.3.1  Correct  integration  of  the  DUR3  cassette  into  the  genomes  of  K7D3,  K7EC‐D3,  522D3, and 522EC‐D3 .......................................................................................... 63  3.2.3.2  Confirmation  of  constitutive  expression  of  DUR3  in  K7D3  and  K7EC‐D3  by  northern blotting ............................................................................................ 66  vii     3.2.3.3 Quantification of constitutive DUR3 expression in K7D3 and K7EC‐D3 by qRT‐PCR  ........................................................................................................................ 67  3.2.3.4 Effect of the integrated DUR3 cassette on the transcriptome of K7D3 ............ 68  3.2.4  Recombinant  strains  K7D3  and  K7EC‐D3  exhibit  highly  enhanced  urea  uptake  ability  in  conditions of strong NCR ............................................................................................. 69  3.2.5  Recombinant  strains  K7D3  and  K7EC‐D3  exhibit  highly  enhanced  urea  uptake  ability  in  conditions of NCR de‐repression ................................................................................. 72  3.2.6 Phenotypic characterization of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 ................................. 75  3.2.6.1 Fermentation rate of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Chardonnay wine ... 75  3.2.6.2 Ethanol production by K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Chardonnay wine . 77  3.2.6.3 Fermentation rate of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Sake wine ............... 77  3.2.6.4 Ethanol production by K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Sake wine ............. 79  3.2.7  Constitutive  expression  of  DUR3  in  yeast  strains  K7D3  and  522D3  reduces  EC  in  Chardonnay wine by 24.97% and 81.38%, respectively .............................................. 79  3.2.8  Constitutive  expression  of  DUR3  in  yeast  strains  K7D3  and  522D3  reduces  EC  in  Sake  wine by 18.40% and 10.45%, respectively .................................................................. 80  4 DISCUSSION ............................................................................................................................................. 82  4.1 Constitutive expression of the DUR1,2 cassette reduces EC production in wine and Sake ...... 82  4.2 Integration of the DUR1,2 cassette into the genomes of Sake yeast strains K7 and K9 yielded  the functional urea degrading Sake yeasts K7EC‐ and K9EC‐ ......................................................... 83  4.2.1 Genetic characterization of K7EC‐ and K9EC‐ ................................................................... 83  4.2.2 The Sake yeasts K7EC‐ and K9EC‐ conduct efficient alcoholic fermentations .................. 85  4.2.3 The Sake yeasts K7EC‐ and K9EC‐  reduce EC poorly in Chardonnay wine, yet efficiently in  Sake wine ..................................................................................................................... 85  viii     4.3  Constitutive  expression  of  the  urea  permease,  DUR3,  in  yeast  cells  is  a  viable  alternative  method to reduce EC in fermented alcoholic beverages ........................................................... 89  4.3.1 Construction of a linear PGK1p‐DUR3‐PGK1t‐kanMX  cassette for integration into  the  TRP1 locus of wine and Sake yeasts ............................................................................ 89  4.3.2  Integration  of  the  DUR3  cassette  into  the  genomes  of  K7,  K7EC‐  ,  522,  and  522EC‐  yielded the functional urea transporting yeasts K7D3, K7EC‐D3, 522D3,  and 522EC‐D3 ..... 91  4.3.2.1 Integration of the DUR3 cassette into the genomes of K7D3, K7EC‐D3, 522D3, and  522EC‐D3 results in constitutive expression of DUR3 ........................................ 92  4.3.2.2 The integrated DUR3 cassette results in enhanced urea uptake .................... 93  4.3.2.3 The metabolically engineered yeasts K7D3, K7EC‐D3, 522D3, and 522EC‐D3  ferment  at  similar  rates  and  produce  similar  amounts  of  ethanol  in  Chardonnay  and  Sake wine ........................................................................................................ 94  4.3.2.4  Variability  of  metabolically  engineered  yeasts  to  effectively  reduce  EC  in  Chardonnay wine and in Sake wine ................................................................ 95  4.3.2.5  The  metabolically  engineered  yeasts  K7EC‐D3  and  522EC‐D3  do  not  reduce  EC  more effectively than K7EC‐  and 522EC‐  or K7D3  and 522D3  in either Chardonnay  or Sake wine .................................................................................................... 98  5 CONCLUSIONS ....................................................................................................................................... 101  5.1 Future Directions ...................................................................................................................... 103  REFERENCES ............................................................................................................................................. 104     ix     LIST OF TABLES  Table 1.    Ranking of various yeast nitrogen sources according to NCR repression strength ............... 13   Table 2.    Maximum potential ethyl carbamate detected by GC/MS in 20 wines from six countries .. 19   Table 3.    Strains  used  in  the  genetic  construction  and  characterization  of  DUR3  expressing  yeast  strains. .................................................................................................................................... 27   Table 4.    Plasmids  used  in  the  genetic  construction  and  characterization  of  DUR3  expressing  yeast  strains ..................................................................................................................................... 28   Table 5.    Genetic cassettes used in the genetic construction and characterization of DUR3 expressing  yeast strains ........................................................................................................................... 28   Table 6.    Oligonucleotide primers used in sequencing of the integrated DUR1,2 cassette ................. 31   Table 7.    Oligonucleotide primers used in sequencing of DUR3 cassette in pUCMD .......................... 41   Table 8.    Discrepancies between the integrated DUR1,2 cassette of K9EC‐ and published sequences  51   Table 9.    Detailed description of the DNA sequences that comprise the DUR1,2 cassettes ............... 51   Table 10   Effect  of  the  integrated  DUR1,2  cassette  in  the  genome  of  K7  on  global  gene  expression  patterns in S. cerevisiae K7EC‐ (≥ 4‐fold change) ..................................................................... 53   Table 11.   Utilization of glucose and fructose and production of ethanol in Sake wine by parental yeast  strains (K7 and K9), their metabolically engineered counterparts (K7EC‐ and K9EC‐) .............. 57  Table 12.   Reduction of EC by functionally enhanced yeast strains K7EC‐ and K9EC‐ during wine making ...  ............................................................................................................................................... 58  Table 13.   Reduction of EC by functionally enhanced yeast K7EC‐ and K9EC‐ strains during Sake brewing ..  ............................................................................................................................................... 59  Table 14.   Discrepancies between the DUR3 cassette in pUCMD and published sequences ................ 60  Table 15.   Detailed description of the DNA sequences that comprise the DUR3 cassette .................... 60  x     Table 16.   Recombinant yeast strains created by integration of the DUR3 cassette into the TRP1 locus  ............................................................................................................................................... 63  Table 17.   Effect  of  the  integrated  DUR3  cassette  in  the  genome  of  K7  on  global  gene  expression  patterns in S. cerevisiae K7D3 (≥ 4‐fold change) ..................................................................... 69   Table 18.   Ethanol produced by Sake yeast strains (K7, K7EC‐, K7D3, and K7EC‐D3) and wine yeast strains  (522, 522EC‐, 522D3, and 522EC‐D3) in Chardonnay wine ........................................................... 77   Table 19.   Ethanol produced by Sake yeast strains (K7, K7EC‐, K7D3, and K7EC‐D3) and wine yeast strains  (522, 522EC‐, 522D3, and 522EC‐D3) in Sake wine....................................................................... 79  Table 20.   Reduction of EC by functionally enhanced yeast strains during wine making ...................... 80  Table 21.   Reduction of EC reduction by functionally enhanced yeast strains during Sake making ...... 81     xi     LIST OF FIGURES  Figure 1.    Chemical basis of anaerobic fermentation .............................................................................. 5   Figure 2.    Simplified diagram of the Embden‐Meyerhof pathway .......................................................... 6   Figure 3.    Processes involved in red and white winemaking ................................................................... 8   Figure 4.    Contrasting processes in wine and Sake making ................................................................... 10   Figure 5.    Overview of urea metabolism in S. cerevisiae ....................................................................... 11   Figure 6.    Model of reciprocal regulation of GATA factor gene expression and GATA factor regulation  of NCR‐sensitive gene expression .......................................................................................... 14   Figure 7.    Permeases  and  degradative  enzymes  needed  to  utilize  poor  nitrogen  sources  are  transcriptionally silenced during growth in abundant high quality nitrogen sources ........... 14   Figure 8.    Model of the regulatory pathway by which rapamycin and nitrogen starvation induce NCR  regulated gene expression ..................................................................................................... 16   Figure 9.    Synthesis reaction and bioactivation pathway of ethyl carbamate ...................................... 17   Figure 10.   Schematic representation of cloning strategy for creation of pHVX2D3 .............................. 37  Figure 11.   Schematic representation of cloning strategy for creation of pHVXKD3 .............................. 38  Figure 12.   Schematic representation of cloning strategy for creation of pUCTRP1 ............................... 38  Figure 13.   Schematic representation of cloning strategy for creation of pUCMD ................................. 40  Figure 14.   Schematic representation of pUCMD .................................................................................... 42  Figure 15.   Schematic representation of the linear DUR1,2 cassette ...................................................... 47  Figure 16.   Integration of the DUR1,2 cassette into the URA3 locus of K7EC‐ and K9EC‐  was confirmed by  Southern blot analyses using a DUR1,2 probe ....................................................................... 48     xii     Figure 17.   Disruption of the URA3 locus by integration of the DUR1,2 cassette in K7EC‐ and K9EC‐    was  confirmed by Southern blot analyses using a URA3 probe ................................................... 49  Figure 18.   The  genetically  engineered  strains  K7EC‐  and  K9EC‐  do  not  contain  the  bla  and  Tn5ble  antibiotic resistance markers ................................................................................................. 50  Figure 19.   A  schematic  representation  of  new  ORFs  of  more  than  100  codons  generated  during  construction of the DUR1,2 cassette ..................................................................................... 52  Figure 20.   Gene expression analysis (qRT‐PCR) of K7, K7EC‐, K9, and K9EC‐  indicates functionality of the  DUR1,2 cassette and constitutive expression of DUR1,2 in non‐inducing (NCR) conditions .....  ............................................................................................................................................... 53  Figure 21.   Fermentation  profiles  (weight  loss)  of  parental  and  DUR1,2  engineered  Sake  strains  in  Chardonnay wine ................................................................................................................... 55  Figure 22.   Fermentation profiles (weight loss) of parental and DUR1,2 engineered Sake strains in Sake  wine........................................................................................................................................ 56  Figure 23.   DNA  sequence  alignment  of  S288C  and  pUCMD  revealed  nine  discrepancies  along  the  length of DUR3 cassette ........................................................................................................ 62  Figure 24.   A  schematic  representation  of  new  ORFs  of  more  than  100  codons  generated  during  construction of the DUR3 cassette ........................................................................................ 62  Figure 25.   Schematic representation of the linear DUR3 cassette ......................................................... 63  Figure 26.   Integration of the DUR3 cassette into the TRP1 locus of 522D3, 522EC‐D3, K7D3, and K7EC‐D3 was  confirmed by Southern blot analysis using DUR3 and TRP1 probes ..................................... 64  Figure 27.   Schematic  representation  of  the  signals  expected  during  Southern  blot  analysis  of  recombinant  yeasts  containing  the  recombinant  DUR3  cassette  integrated  into  the  TRP1  locus ....................................................................................................................................... 65     xiii     Figure 28.   Alignment of the DNA sequences of S288C, 522, and K7 confirmed the presence of a mutant  EcoR1 site in the DUR3 coding region of K7. ......................................................................... 66  Figure 29.   Constitutive expression of DUR3 (2208 bp) was confirmed by northern blot analysis of K7,  K7EC‐, K7D3, K7EC‐D3 ................................................................................................................... 67  Figure 30.   Analyses of gene expression (qRT‐PCR) of K7, K7EC‐, K7D3, and K7EC‐D3 confirmed functionality  of  the  DUR3  cassette  and  constitutive  expression  of  DUR1,2  and  DUR3  in  non‐inducing  (NCR) conditions .................................................................................................................... 68  Figure 31.   Uptake of 14C‐urea by K7, K7EC‐, K7D3 and K7EC‐D3 under conditions of NCR ........................... 71  Figure 32.   Uptake of 14C‐urea by K7 and K7EC‐ under conditions of NCR ................................................ 72  Figure 33.  Uptake of 14C‐urea by K7, K7EC‐, K7D3 and K7EC‐D3 under conditions of NCR de‐repression .... 73  Figure 34.  Uptake of 14C‐urea by K7 and K7EC‐ under conditions of NCR de‐repression ......................... 74  Figure 35.   Fermentation profiles (weight loss) of (a) Sake yeast strains K7, K7EC‐, K7D3,  and K7EC‐D3  and  (b) wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 in Chardonnay wine. ......................... 76  Figure 36.   Fermentation profiles (weight loss) of (a) Sake yeast strains K7, K7EC‐, K7D3,  and K7EC‐D3  and  (b) wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 in Sake wine. ..................................... 78  Figure 37.   Schematic  representation  of  inducible  DUR1,2  expression  during  Chardonnay  and  Sake  wine fermentation by a urea importing yeast strain ............................................................. 97     xiv     LIST OF ABBREVIATIONS  µg   Microgram   µM   Micromolar   aa   Amino acid   Abs   Absorbance   ANOVA   Analysis of variance   BC   British Columbia    bp   Base pair   cDNA   Complementary deoxyribonucleic acid   Ci   Curie   cm    Centimetre   cM   Centimorgan   Corp.    Corporation   cRNA   Ribonucleic acid derived from cDNA   DAP   Diammonium phosphate   DNA   Deoxyribonucleic acid   DTT   Dithiothreitol   EC   Ethyl carbamate   EDTA   Ethylenediamine tetraacetic acid   ER   Endoplasmic reticulum   EtOH   Ethanol   FDA   Food and Drug Administration   g   Gram   GC   Gas chromatograph   GC/MS   Gas chromatograph coupled mass spectrometry   GM   Genetically modified   GMO   Genetically modified organism   GO   Gene ontology   GRAS   Generally regarded as safe   HPLC   High pressure liquid chromatography   kb   Kilo base pair  xv      kg   Kilogram   L   Litre   LB   Luria‐Bertani medium   LC   Liquid chromatograph   log   Logarithm   LSD   Least significant difference   m   Metre   M   Molarity   m/v   Mass per volume   mCi   Millicurie   mg   Milligram   min   Minute   mL   Millilitre   MLF   Malolactic fermentation   mM   Millimolar   mRNA   Messenger RNA   MS   Mass spectrometry   NAPS   Nucleic Acid Protein Service Unit at The University of British Columbia   NCR   Nitrogen catabolite repression system of S. cerevisiae   ng   Nanogram   nM   Nanomolar   nt   Nucleotide   °C   Degree Celsius   OD   Optical density   O/N   Overnight   ORF   Open reading frame   PB   Protein body   PCR   Polymerase Chain Reaction   PDM   Prise de Mousse   pH   Potential of Hydrogen   ppb   Parts per billion  xvi      ppm   Parts per million   qPCR   Quantitative PCR   qRT‐PCR    Quantitative Reverse Transcriptase PCR   RFLP   Restriction fragment length polymorphism   RNA   Ribonucleic acid   ROX   Passive reference dye used in qPCR   rpm   Revolutions per minute   RQ   Relative quantification   rRNA   Ribosomal RNA   RSD   Relative standard deviation   RT‐PCR   Reverse Transcriptase PCR   s   Second   SAP   Shrimp Alkaline Phosphatase   STDEV   Standard deviation   SGD   Saccharomyces Genome Database (www.yeastgenome.org)   SLR   Signal log ratio (log base = 2)   TBE   Buffer consisting of Tris base, boric acid, EDTA, and water   TE   Buffer consisting of Tris base, EDTA, and water   tRNA   Transfer RNA   TRP   Tryptophan   UAS   Upstream activation sequence   UASNTR   Upstream activation sequence – nitrogen regulated   UIS   Upstream induction sequence   UK    United Kingdom    URA   Uracil   URS   Upstream repression sequence   USA    United States of America    v   Volt   v/v   Volume per volume   w/o   Without   YAN   Yeast assimilable nitrogen   xvii      YEG   Medium consisting of yeast extract and dextrose   YNB   Yeast Nitrogen Base   YPD   Medium consisting of yeast extract, peptone, and dextrose   xviii     ACKNOWLEDGEMENTS    It is with great pleasure that I thank the many people who contributed to this research and to  my development as a scientist. The road that scientists walk is fraught with self‐doubt and frustration;  however, the people mentioned herein have been pivotal in helping me to complete my journey.    I  would  like  to  sincerely  thank  Dr.  Hennie  J.J.  van  Vuuren,  my  research  supervisor,  for  his  support, guidance, invaluable insight, financial assistance, and help in writing this thesis. Working with  Dr. van Vuuren at the  UBC Wine Research Centre  has allowed me to nurture my passion for scientific  research while developing an appreciation for the partnership  between hypothesis‐driven  science and  business. For the opportunities presented to me and the people I have met through Dr. van Vuuren, I am  exceptionally grateful.    I would like to thank the members of my supervisory committee, Dr. Ivan Sadowski and Dr. John  Smit for their advice, criticism, and diverse perspectives on this project. Working with Drs. Sadowski and  Smit was an  invaluable experience and I am ever thankful of their willingness  to accommodate a very  tight completion timeline.    I  would  like  to  thank  Dr.  John  I.  Husnik,  a  former  PhD  student  in  the  van  Vuuren  lab,  for  his  patience,  care,  and  guidance.  John  was  an  indispensable  aide  for  resolving  problems,  clarifying  procedures,  and  sounding  ideas  during  my  early  development  as  a  scientist.  He  has  continued  to  be  generous with his time and assistance despite living and working halfway across the country, and for this  I am thankful.    I  would  like  to  thank  my  past  and  present  Wine  Research  Centre  colleagues,  especially  Calvin  Adams, Dr. Zongli Luo, and Lina Madilao for their warm friendship and valuable scientific collaboration.  My  special  thanks  are  in  order  for  Lina  who  completed  all  of  the  GC/MS  analysis  in  this  study.  To  the  members  of  the  Food,  Nutrition  and  Health  administration  office,  Donna  Bradley,  Tram  Nguyen,  and  Patrick  Leung,  I  offer  my  thanks  for  their  help  in  ordering  and  logistics.  I  would  also  like  to  thank  Dr.  Hugh Brock and Monica of the Genetics Graduate program (GGP) for their respective assistance during  my  time  in  the  program.  Additionally,  I  would  like  to  thank  my  fellow  GGP  student  and  friend,  Kevin  Eade. Kevin’s friendship and coffee break companionship was much appreciated.   xix     I am extremely appreciative of those who funded this research and/or a portion of my studies:  National  Sciences  and  Engineering  Research  Council  of  Canada,  First  Venture  Technology  Corp.  (Vancouver, B.C.) and the Canadian Vintners Association.    Finally, and most importantly, I thank my parents, Elizabeth H. and Joseph Dahabieh. They bore  me, raised me, supported me, taught me, and loved me. Without them I would not be the person I am  today.  xx     1  INTRODUCTION    1.1  Saccharomyces cerevisiae    In the early 20th century intensive genetic research began on the budding yeast Saccharomyces  cerevisiae  and,  ever  since,  scientists  have  championed  yeast  as  the  “Escherichia  coli  of  eukaryotes”  (Miklos  and  Rubin  1996).  S.  cerevisiae  combines  the  ease  of  use  and  brute  force  genetics  of  bacteria  with  the  sophistication  and  elegance  of  higher  eukaryotes,  thus  making  it  an  ideal  organism  to  study  processes fundamental to all eukaryotic cells. Such processes, many of which are conserved from yeast  to  humans,  include  complex  cell  cycle  control,  eukaryotic  meiotic  recombination,  mitochondrial  respiration, and cell fusion events (Griffiths, et al. 2005).    S. cerevisiae is a unicellular eukaryotic fungus which is ubiquitous to wineries worldwide (Perez‐ Ortin,  Garcia‐Martinez  and  Alberola  2002).  While  it  is  assumed  that  its  natural  environment  is  the  winery itself, S. cerevisiae can also be found naturally in rotting grapes and fruits, and in addition, there  may  be  some  yet  undiscovered  natural  habitat  of  budding  yeast  (Perez‐Ortin,  Garcia‐Martinez  and  Alberola  2002).  S.  cerevisiae  feeds  on  the  sugars  and  nutrients  of  crushed  and  rotting  fruit  and,  when  conditions are optimal, reproduce approximately every 90 minutes (Herskowitz 1988). Approximately 10  microns  in  diameter,  yeast  reproduce  asexually  by  mitotic  budding;  however,  they  can  also  undergo  sexual reproduction when haploid cells (created by meiotic division) of opposite mating type fuse, thus  yielding  a  stable  diploid  cell  (Herskowitz  1988).  The  yeast  mating  types  (MATa  and  MATalpha)  can  be  likened to the male and female genders.    Wild isolates of S. cerevisiae also possess the ability to switch mating types such that a haploid  population  of  one  mating  type  can  mate  with  itself  and  achieve  diploidy  (Herskowitz  1988).  The  mechanism  of  mating  type  switching  involves  the  HO  endonuclease  and  has  been  well  characterized  (Nasmyth 1993). Yeasts with this ability are known as homothallic and, from a Darwinian point of view,  achieving  diploidy  is  desirable.  Having  two  copies  of  every  gene  makes  an  organism  genetically  more  stable,  being  able  to  tolerate  loss  of  function  “recessive”  mutations  more  readily  than  a  haploid  equivalent (Greig and Travisano 2003). However, the haploid state can confer certain advantages on the  yeast cell; a second copy of every gene buffers deleterious mutations, but it also buffers advantageous  1     mutations. Thus, a diploid organism may, under certain circumstances, ‘evolve’ or ‘adapt’ to changes in  the environment more slowly than its haploid counterpart (Greig and Travisano 2003). Nevertheless, as  of present, S. cerevisiae has evolved into an organism which seems to function and prosper in a life cycle  stuck between its haploid prokaryotic predecessors and its diploid eukaryotic successors.    Like most bacteria and other microorganisms, yeast replicate rapidly and can be easily cultivated  in  the  laboratory.  They  grown  well  in  liquid  culture  and  on  solid  media,  and  can  be  manipulated  via  standard  microbiological  techniques  (Ausubel,  et  al.  2005).  In  addition  to  other  common  techniques,  yeast  cells  are  remarkably  amenable  to  chemical  or  UV  mutagenesis,  genetic  selection,  recombinant  DNA  methods,  rescue  cloning,  complementation,  and  high  efficiency  transformation  (Griffiths,  et  al.  2005).  However,  the  real  value  of  S.  cerevisiae  lies  in  the  fact  that  yeasts  incorporate  all  of  these  advantages into a eukaryotic background. Thus, fundamental eukaryotic processes can be dissected on a  molecular level when such analysis would be exceedingly difficult or impossible in higher eukaryotes.    The full sequence of the S. cerevisiae genome was published in 1996 (Goffeau, et al. 1996) and  this has made S. cerevisiae even more powerful as a model organism. S. cerevisiae was in fact the first  eukaryotic organism to be completely sequenced and subsequent analysis has revealed that the genome  of the common laboratory strain S288C is approximately 12 Mb in size and consists of 16 independently  assorting chromosomes (Goffeau, et al. 1996). It contains approximately 6000 genes, ~1000 of which are  essential  for  growth  on  rich  media  (Maftahi,  Gaillardin  and  Nicaud  1998),  and  ~25%  of  which  have  human  homologues  (Griffiths,  et  al.  2005).  The  remaining  5000  non‐essential  genes  have  been  systemically  knocked  out  in  the  ‘Saccharomyces  Genome  Deletion  project’  resulting  in  a  knock‐out  collection (Maftahi, Gaillardin and Nicaud 1998) that allows for streamlined reverse genetic analysis. In  addition to the set of 5000 knockouts available, the remaining 1000 essential genes can be investigated  through  the  use  of  readily  available  temperature  sensitive  (TS)  conditional  alleles  (Dohmen  and  Varshavsky  2005).  Finally,  both  expression  and  tiling  DNA  microarrays  exist  for  various  yeast  strains  allowing complex global analysis of the yeast genome, transcriptome and proteome (Dunn, Levine and  Sherlock  2005;  Hauser,  et  al.  2001;  Perez‐Ortin,  Garcia‐Martinez  and  Alberola  2002;  Rossignol,  et  al.  2003; Shobayashi, et al. 2007; Wu, et al. 2006).      2     Of   the   6000   yeast   genes,   the   Saccharomyces   Genome   Database   (SGD   –   http://www.yeastgenome.org) lists known functions or GO (Gene ontology) annotations for about 5000  genes.  The  remaining  1000  yeast  genes  remain  uncharacterized  despite  70  years  of  yeast  genetics.  While some speculate that many of these 1000 genes (uncharacterized ORFs) may not actually code for  functional protein, the general consensus is that they are indeed functional (Pena‐Castillo and Hughes  2007). Upon in silico analysis, many of the 1000 uncharacterized genes contain putative protein domains  which  suggest  some  sort  of  metabolic  function  (Pena‐Castillo  and  Hughes  2007).  Furthermore,  a  large  proportion of the 1000 uncharacterized genes are homologues to genes found solely in other species of  fungi  (Pena‐Castillo  and  Hughes  2007).  Thus,  these  genes  may  be  important  in  aspects  of  fungal  metabolism/physiology,  and  thus  do  not  assay  well  under  standard  laboratory  conditions.  In  fact,  a  growing  consensus  amongst  yeast  biologists  is  that  these  1000  dubious  genes  will  never  become  characterized  until  more  focus  is  placed  on  S.  cerevisiae  outside  the  laboratory  (Pena‐Castillo  and  Hughes 2007). This requires doing away with  traditional laboratory screens and looking at  culturing  S.  cerevisiae  under  natural  conditions,  most  notably  fermentative  conditions.  Under  conditions  of  fermentation,  yeast  cells  are  subjected  to  profoundly  different  stresses  than  under  laboratory  conditions.  These  stresses  include,  but  are  not  limited  to,  osmotic  stress,  ethanol  stress,  nutrient  limitation, oxidative stress, and temperature stress. If some of the 1000 uncharacterized genes are vital  to  these  types  of  stress  responses,  their  functions  will  only  be  revealed  when  yeast  cells  are  cultured  under  conditions  that  create  such  stresses.  For  example,  a  recent  study  of  the  yeast  transcriptome  during  wine  fermentation  identified  a  previously  uncharacterized  fermentation  stress  response  containing  approximately  223  genes,  many  of  which  are  part  of  the  1000  remaining  uncharacterized  yeast genes (Marks, et al. 2008).    1.2  Yeast strains from nature vs. laboratory yeasts    The majority of laboratory strains are descendents of isolates from nature, such as the common  laboratory strain S288C, which is a descendent of a yeast strain isolated from a rotten fig in California in  1938  (Perez‐Ortin,  Garcia‐Martinez  and  Alberola  2002).  However,  today’s  laboratory  strains  are  significantly  different,  both  genetically  and  physiologically,  from  their  wild  type  parents.  Given  the  90  minute generation time of S. cerevisiae, it is not difficult to imagine that over 70 years of growth on rich  laboratory media, a wild strain could evolve such that it no longer requires much of the genetic diversity  3     and  robustness  needed  to  deal  with  constantly  changing  environmental  conditions  (Dunn,  Levine  and  Sherlock  2005).  Without  environmental  pressures  to  maintain  robust  pathways  needed  for  growth  in  nature  (e.g.  sporulation,  pseudohyphal  growth),  natural  isolates  could  quickly  become  homogenized  into  the  less  vigorous  laboratory  strains  we  see  today.  As  such,  many  laboratory  strains  exhibit  dramatically different transcriptional profiles from wild yeasts and also differ in their ability to conduct  robust  and  efficient  alcoholic  fermentations  of  high  sugar  grape  musts  (Hauser,  et  al.  2001).  Additionally,  in  order  to  maintain  stable  haploid  populations,  the  HO  locus  of  various  S.  cerevisiae  laboratory  strains  has  been  purposely  disrupted  (Nasmyth  1993).  Other  important  differences  in  laboratory yeast strains include the addition of various auxotrophic markers which can be used to select  transformants.  These  auxotrophic  markers  often  map  to  defects  in  amino  acid  or  nucleotide  biosynthetic  pathways;  common  markers  include  URA3,  TRP1,  LEU2,  ADE2,  etc.  (Ausubel,  et  al.  1995;  Dohmen and Varshavsky 2005).    In  nature,  many  distinct  strains  of  S.  cerevisiae  have  been  isolated  from  various  environments  worldwide (Dunn, Levine and Sherlock 2005). Environments can vary widely in terms of nutrient (carbon,  nitrogen,  and  minerals)  availability,  temperature,  osmolarity,  etc.  Thus,  while  fundamentally  similar,  each of these strains has adapted, but not yet undergone speciation, in response to various niches in the  environment. These adaptations manifest themselves as differences in growth rate, fermentation rate,  ethanol production, and various resistances when different strains are grown in identical media (Dunn,  Levine and Sherlock 2005; Hauser, et al. 2001).     Despite  differences  between  wild  type  strains  from  nature,  they  tend  to  share  some  common  distinguishing genetic characteristics when comparing them to laboratory strains. As stated previously,  most  laboratory  strains  exist  as  stable  populations  of  haploids;  however,  most  wild  strains  are  homothallic  and  diploid,  polyploid,  or  aneuploid  (Bond,  et  al.  2004;  Dunn,  Levine  and  Sherlock  2005;  Hauser, et al. 2001; Hughes, et al. 2000; Perez‐Ortin, Garcia‐Martinez and Alberola 2002). Compared to  laboratory  strains,  wild  type  strains  also  differ  in  chromosome  length,  contain  large  scale  (~50  kb)  deletions or insertions, contain many more transposons (Ty elements), differ in sporulation rate (0‐75%)  and spore viability (0‐98%), exhibit variable pseudohyphal growth, and are largely heterozygous (Perez‐ Ortin, Garcia‐Martinez and Alberola 2002).   4     1.3  S. cerevisiae and industry: Wine yeasts    The interaction between Homo sapiens and S. cerevisiae dates back almost 8000 years (Perez‐ Ortin,  Garcia‐Martinez  and  Alberola  2002;  Vine,  Harkness  and  Linton  2002).  It  was  first  reported  by  ancient Egyptian civilization that crushed grapes would ‘ferment spontaneously’ and that the resultant  wine  contained  ‘magical  and  anesthetic  properties’  (Vine,  Harkness  and  Linton  2002).  Since  that  time,  humans  have  been  selectively  breeding  the  then  unknown  microorganism,  S.  cerevisiae,  for  desirable  characteristics such as tolerance to high sugar stress, robust fermentation, ethanol tolerance, and good  flavour production (Hauser, et al. 2001).     As  an  art  form,  winemaking  flourished  in  the  ancient  Mediterranean  and  was  quickly  adopted  anywhere where the climate was suitable for viticulture (Goode 2005; Vine, Harkness and Linton 2002).  As a science, however, winemaking was not understood until 1863; Louis Pasteur was the first to isolate  S. cerevisiae and show that it was responsible for the production of ethyl alcohol (ethanol) and carbon  dioxide from simple sugars (glucose) (Figures 1 and 2) (Perez‐Ortin, Garcia‐Martinez and Alberola 2002;  Vine, Harkness and Linton 2002).      Sugar (glucose or fructose) → Ethanol + Carbon dioxide + ATP C6H12O6 + 2Pi + 2ADP → 2CH3CH2OH + 2CO2 + 2 ATP (energy released:118 kJ/mol) Figure  1.  Chemical  basis  of  anaerobic  fermentation.  Under  anaerobic  conditions  S.  cerevisiae  creates  energy (ATP) for biomass by converting sugar into ethanol and carbon dioxide.        5     CH3CH2OH  CH3(CO)H  2 Acetylaldehyde  2 Ethanol 2 NAD+  Glucose  2 CO2  2 NADH  CH3(CO)COOH  Glycolysis  2 ADP  2 Pyruvate  2 ATP  Figure  2.  Simplified  diagram  of  the  Embden‐Meyerhof  pathway.  In  the  presence  of  oxygen,  pyruvate  enters  the  mitochondrial  Krebs  cycle  and  then  undergoes  oxidative  phosphorylation  to  create  maximal  ATP.  Under  anaerobic  conditions,  yeast  shunt  pyruvate  through  alcoholic  fermentation in order to create energy from sugar and restore the intracellular pool of NAD+ that is  depleted through glycolysis.       Today,  no  other  microorganism  is  as  important  to  human  diet  and  the  global  economy  as  S.  cerevisiae (Goode 2005; Vine, Harkness and Linton 2002). Fermentation by yeast is vital to winemaking,  brewing, baking, and the distillation of spirits. Furthermore, in the face of global warming, S. cerevisiae  may soon play a vital role in the paradigm shift from fossil fuel dependency to the use of bio‐ethanol as  a fuel source (Farrell, et al. 2006).    1.4  Winemaking and Sake brewing    Although  it  may  be  a  seemingly  simple  process,  winemaking  (enology)  and  thus  wine  itself  is  incredibly complex. Recent estimates suggest that wine contains approximately 1000 volatile flavor and  aroma compounds (Goode 2005). Furthermore, of the 1000 compounds, an estimated 400 are produced  by S. cerevisiae itself (Goode 2005). In its most fundamental form winemaking can be described as, “the  product  of  fermenting  [with  S.  cerevisiae]  and  processing  grape  juice  or  must”  (Vine,  Harkness  and  Linton 2002).   6       While  human  beings  have  been  actively  fermenting  grapes  and  other  fruits  for  thousands  of  years, the fundamental process has changed very little. The steps involved in modern grape winemaking  are outlined in Figure 3 (Vine, Harkness and Linton 2002).   7     Harvest of ripe grapes  (manual or machine)     De‐stemming and crushing of berries       Treatment with pectolytic enzymes to   aid in clarification and juice extraction         White  Pressing of must to remove     skins and stems   White or  Red?   Red        Inoculation of must with commercial starter  S. cerevisiae culture (~150 available strains) or  allow natural flora yeasts to ferment  (Klockera, Hanseniaspora, Candida,   Metschnikowia, Pichia)          Fermentation at 12‐18ºC   without mixing     Yes      MLF?        Fermentation at 18‐30ºC  with mixing      Malolactic fermentation (MLF) for deacidification of malate to lactate.  Requires addition of lactic acid bacteria (Oenococcus oeni)   or functionally enhanced S. cerevisiae strain ML01 capable of MLF   during alcoholic fermentation (Husnik, et al. 2006)    No     Anti‐microbial treatment  with sulfur dioxide (SO2)          Clarification by racking, fining,  centrifuging, and/or filtering        No   Yes Oak?       Maturation in oak barrels   (most red wines and some  Chardonnays)     Maturation in stainless steel    (most white wines)        Blending (if desired) and bottling   8  Figure 3. Processes involved in red and white winemaking.     In contrast to grape wine, Sake wine is produced from the fermentation of milled rice grains by  S. cerevisiae. Sake is native to Japan but has steadily been gaining popularity around the world. Sake is  characterized by a translucent hue, mild fruity bouquet, relatively high natural alcohol content (15‐20%  v/v),  and  is  served  either  hot  or  cold  (Shobayashi,  et  al.  2007).  As  is  the  case  with  wine  yeasts,  many  different  Sake  yeast  strains  exist  and  certain  strains  have  become  popular  for  particular  sensory  characteristics  that  they  impart  to  the  final  product.  Some  strains  produce  Sake  wine  which  is  rich  in  fruitiness  and  has  high  acidity,  while  others  produce  wine  which  is  milder  and  more  aromatic  in  bouquet. Sake strains K7 and K9 are amongst the most popular and widely used yeasts in the industry  (Kodama  1993;  Wu,  et  al.  2006).  The  process  of  alcoholic  fermentation  is  fundamental  to  both  winemaking  and  Sake  brewing  and  yeast  cells  are  subjected  to  substantial  temperature,  acid,  hypoxic  and ethanol stresses during both wine making and Sake brewing (Kodama 1993; Rossignol, et al. 2003;  Wu,  et  al.  2006).  However,  one  of  the  most  profound  differences  is  the  level  of  osmotic  stress  experienced by yeast cells during wine making. High ethanol levels produced during Sake fermentations  also exert significant ethanol stress on yeast cells.     Typical grape juice is a complex mixture high in carbohydrates, rich in assimilable nitrogen, and  high  in  vitamin/mineral  content  (Ingledew,  Magnus  and  Patterson  1987;  Rossignol,  et  al.  2003).  On  average,  grape  must  contains  approximately  20%  w/v  sugar  (200  g/L)  in  the  form  of  a  mixture  of  sucrose,  glucose  and  fructose  (Rossignol,  et  al.  2003).  Consequently,  at  the  start  of  grape  must  fermentation  yeast  cells  are  subject  to  substantial  osmotic  stress.  Although  yeast  possess  a  cell  wall  composed  of  crosslinked  1,3‐  and  1,6‐glucans  that  protects  them  against  osmotic  forces,  growth  in  grape  must  induces  several  other  metabolic  methods  of  coping  with  said  stress  (Westfall,  Ballon  and  Thorner  2004).  The  primary  method  of  dealing  with  osmotic  stress  is  induction  of  the  high  osmolarity  growth (HOG) pathway (Reviewed in Westfall, Ballon and Thorner 2004; Han, et al. 1994). This pathway,  which  is  highly  conserved  between  most  eukaryotic  cells,  is  responsible  for  the  production  of  intracellular small molecules which help offset the osmotic pressure difference. The principle molecules  produced  in  S.  cerevisiae  are  glycerol  (1,2,3‐propanetriol)  and  trehalose  (α1,1  glucose  disaccharide)  (Westfall,  Ballon  and  Thorner  2004).  Both  molecules  are  produced  after  the  induction  of  biosynthetic  genes  by  the  MAP  kinase  mediated  HOG  pathway,  which  occurs  within  minutes  of  osmotic  stress  (Westfall, Ballon and Thorner 2004). In contrast to the high osmolarity of typical grape must, Sake rice   9     mash contains much less initial free sugar as the majority of carbon is tied up in the form of insoluble  starch (Kodama 1993; Shobayashi, et al. 2007; Wu, et al. 2006).     1.5  Aspergillus oryzae and its role in Sake brewing    Since  S.  cerevisiae  does  not  possess  the  necessary  amylases  needed  to  convert  starch  (β1,4  glucose polymer) to glucose, yeast cells are not able to consume starch as a sole carbon source (Kodama  1993;  Shobayashi,  et  al.  2007;  Wu,  et  al.  2006).  As  a  result,  steamed  rice  must  be  pre‐treated  in  preparation  for  alcoholic  fermentation  (Figure  4).  Sake  brewers  have  long  used  the  fungus  Aspergillus  oryzae as a source of amylases (Kodama 1993; Shobayashi, et al. 2007; Wu, et al. 2006).     At  the  start  of  fermentation  steamed  rice  is  mixed  with  rice  that  has  been  inoculated  with  A.  oryzae, traditionally referred to as ‘koji’. Koji rice is rich in free glucose as well as amylases that are free  to act on the starch of freshly steamed rice. As a result of the presence of koji, glucose is fed into the  fermentation  mixture  at  a  controlled  rate  (amylase  limited)  which  substantially  lowers  the  osmotic  stress experienced by yeast cells (Kodama 1993; Shobayashi, et al. 2007; Wu, et al. 2006). This decrease  in osmotic stress allows more energy to be devoted to biomass and thus enables Sake fermentations to  reach higher titres and higher alcohol concentrations (Shobayashi, et al. 2007; Takagi, et al. 2005; Wu, et  al.  2006).  Consequently,  Sake  wine  contains  the  highest  concentration  of  ethanol  of  any  non‐distilled  alcoholic beverage (Kodama 1993).     Figure 4. Contrasting processes in wine and Sake making. During winemaking, a saccharification  step prior to alcoholic fermentation is unnecessary as the carbon source in grape must is mostly  glucose and fructose. During Sake brewing, saccharification must precede alcoholic fermentation  as S. cerevisiae cannot consume starch as a carbon source.        10   1.6  Yeast nitrogen metabolism during alcoholic fermentation    In order to build significant biomass and then conduct an efficient alcoholic fermentation, yeast  cells require  significant amounts of nitrogen.  Free nitrogen, in the form of ammonia, is used in many  anabolic pathways, while peptides and free amino acids are either used in cellular processes directly, or  are broken down to ammonia, glutamate, and glutamine via catabolic pathways (Cooper 2002; Hofman‐ Bang  1999).  The  principle  nitrogen  source  present  in  grape  must  is  arginine,  of  which  the  metabolism  leads directly to the formation of intracellular urea (Figure 5) (Monteiro and Bisson 1991). Urea forms  from the arginase (CAR1‐ EC 3.5.3.1) dependent breakdown of arginine to ornithine and urea (Cooper  1982). At high concentrations, urea is a toxic and poor nitrogen source for S. cerevisiae, and is therefore  exported to the surrounding medium (Hofman‐Bang 1999). S. cerevisiae possesses the ability to degrade  urea via urea amidolyase (DUR1,2 ‐ EC 3.5.1.54) (Genbauffe and Cooper 1991); however, in the presence  of higher quality nitrogen sources, DUR1,2 expression is repressed while expression of the urea exporter  (DUR4)  is  not  (Whitney,  Cooper  and  Magasanik  1973).  Consequently,  as  long  as  yeast  cells  are  not  starved  for  nitrogen,  which  forces  them  to  degrade  urea,  they  will  preferentially  export  urea  to  the   Figure  5  Overview  of  urea  metabolism  in  S.  cerevisiae.  Arginine  is  imported  into  the  cell  either  by  the  Arginine  specific  transporter  CAN1  or  by  the  general  amino  acid  permease  GAP1.  Following  import  arginine is degraded to ornithine and urea by arginase, the product of the CAR1 gene. Urea can either be  exported by DUR4 or degraded to ammonia and carbon dioxide by DUR1,2. Cells can also reabsorb urea  through the importer DUR3. Adapted from Coulon, et al. (2006).     11     extracellular  environment.  If,  in  the  later  stages  of  fermentation,  yeast  become  starved  for  nitrogen,  urea  can  be  reabsorbed  (DUR3  ‐  TC  2.A.21.6)  (Cooper  and  Sumrada  1975;  ElBerry,  et  al.  1993)  and  metabolized; however, finished wines made from grape varietals with high assimilable nitrogen tend to  possess  significant  residual  urea  (Ough,  Crowell  and  Gutlove  1988;  Ough,  Crowell  and  Mooney  1988;  Ough, et al. 1990; Ough, et al. 1991).      1.7 Nitrogen metabolism and Nitrogen Catabolite Repression (NCR) in S. cerevisiae    The ability to discriminate between various nutrient sources is an important and evolutionarily  conserved theme in biology. Prokaryotes and eukaryotes alike exhibit exquisite regulatory control over  their  metabolic  pathways  in  order  to  exist  in  the  most  energetically  efficient  way  possible.  Such  regulatory systems are often referred to as ‘catabolite repression’ systems because they repress genes  necessary to metabolize a particular nutrient source in the presence of a more favored one (Griffiths, et  al. 2005). Catabolite repression systems occur for both various carbon (Bruckner and Titgemeyer 2002;  Gancedo  1992)  and  nitrogen  sources  (Cooper  2002;  Hofman‐Bang  1999;  Salmon  and  Barre  1998).  Particularly  well  characterized  examples  of  carbon  catabolite  repression  systems  include  the  lactose  (lac) operon in E. coli (Griffiths, et al. 2005) as well as the galactose (GAL) genes in S. cerevisiae (Lohr,  Venkov  and  Zlatanova  1995).  In  terms  of  nitrogen  catabolite  repression  both  prokaryotes  and  eukaryotes  utilize  a  more  global  repression  system  that  encompasses  many  different  catabolic  pathways.    Yeast nitrogen utilization is centered on the usage of both glutamate and glutamine (Hofman‐ Bang 1999). From glutamate and glutamine, wild type S. cerevisiae can synthesize any other amino acid  necessary  and  thus,  glutamate  and  glutamine,  along  with  ammonia,  are  the  nitrogen  sources  most  preferred by yeast (Hofman‐Bang 1999).     Due to its diverse repertoire of nitrogen catabolic pathways, S. cerevisiae can grow solely on a  wide  range  of  nitrogenous  compounds  (e.g.  common  and  uncommon  amino  acids,  urea,  GABA,  allophanate,  allantoin),  as  each  of  these  may  be  converted  in  to  glutamate,  glutamine,  and  ammonia  (Hofman‐Bang  1999).  However,  because  each  non‐optimal  nitrogenous  compound  varies  in  terms  of  ease  of  import  and  degradation,  the  various  nitrogen  sources  can  be  ranked  in  terms  of  quality  or  12     preference (Hofman‐Bang 1999). Furthermore, since it is advantageous to utilize higher quality sources  preferentially, and because yeast posses a catabolite repression system for nitrogen sources, the various  compounds  can  also  be  ranked  in  terms  of  NCR  strength  (Hofman‐Bang  1999).  A  few  common  yeast  nitrogen sources are shown in Table 1.    Table 1. Ranking of various yeast nitrogen sources according to NCR repression strength. Low repression  strength indicates a poor nitrogen source. Adapted from Hofman‐Bang (1999).     NCR repression under  growth in listed media  (Low to High)  1  2  3  4  5  6   Nitrogen Source   Proline  GABA  Urea  Glutamate  Ammonium  Asparagine/Glutamine      The global nitrogen catabolite repression system of S. cerevisiae has been well studied but is far  from  being  understood  in  absolute  detail  (Reviewed  in  Cooper  2002;  Hofman‐Bang  1999).  At  its  core,  the NCR system of S. cerevisiae makes use of four known regulatory transcription factors (GLN3, GAT1,  DAL80,  and  DEH1)  to  control  the  expression  of  all  NCR  sensitive  genes  (Cooper  2002;  Hofman‐Bang  1999).  Two  of  the  factors,  GLN3  and  GAT1,  are  positive  regulators  (activators),  while  the  other  two  factors, DAL80 and DEH1, are negative regulators (repressors) (Cooper 2002; Hofman‐Bang 1999). The  complex interaction of all four transcription factors, as well as various inducers and repressors, at NCR  sensitive promoters allows for highly regulated nitrogen catabolite gene expression (Figures 6 and 7).     13         Figure 6. Model of reciprocal regulation of GATA factor gene expression and GATA factor regulation of  NCR‐sensitive gene expression. Dashed lines indicate weak association/regulation. Adapted from Cooper  (2002).       Figure  7.  Permeases  and  degradative  enzymes  needed  to  utilize  poor  nitrogen  sources  are  transcriptionally  silenced  during  growth  in  abundant  high  quality  nitrogen  sources.  Adapted  from  Cooper (2002).    14     The four NCR transcription factors are referred to as GATA factors because they all exert their  effect  though  the  DNA  consensus  sequence  5’‐GATAA‐3’.  Each  factor  binds  DNA  at  the  GATA  site  through a conserved zinc finger binding domain and each factor is homologous to many other zinc finger  proteins found in higher eukaryotes, including mammals (Bysani, Daugherty and Cooper 1991; Cooper  2002; Cox, et al. 2000; Cox, et al. 2004; Hofman‐Bang 1999; van Vuuren, et al. 1991).    The four NCR GATA factors are controlled by the upstream negative regulator URE2, which is in  turn regulated by the TOR pathway (Target of Rapamycin) (Cooper 2002; Hofman‐Bang 1999). The TOR  pathway,  which  is  conserved  throughout  most  eukaryotic  organisms,  acts  a  master  regulatory  sensor  and signal transduction cascade that assesses and responds, with highly pleiotropic effects, to general  cell  health,  nutrient  availability,  and  growth  (Cooper  2002;  Dann  and  Thomas  2006;  De  Virgilio  and  Loewith  2006).  The  TOR  pathway    acts  primarily  through  two  kinases,  TOR1  and  TOR2,  and  regulates  fundamental cell functions such as the cell cycle, cell division, protein synthesis, etc. (Cooper 2002; Dann  and Thomas 2006; De Virgilio and Loewith 2006).    In terms of controlling NCR, the exact mechanism linking the GATA transcription factors, URE2  and TOR1/2 has yet to be fully worked out. Despite confusion and conflicting data, researchers do agree  on the following relationships (Cooper 2002; Hofman‐Bang 1999):    a. GLN3p localization correlates highly with active transcription of NCR regulated genes  b. NCR regulated genes are largely activated when GLN3p is nuclear  c. URE2p complexes with GLN3p and the complex localizes to the cytoplasm  d. Inhibition of TOR1/2p correlates highly with decreased GLN3p phosphorylation,  which in turn  correlates with GLN3p being nuclear and NCR regulated genes being expressed    The most commonly accepted model of TOR1/2 control on NCR is depicted in Figure 8. In this  model  TOR1/2  keep  NCR  genes  repressed  by  inhibiting  a  phosphatase  which  is  necessary  for  GLN3p  dephosphorylation and nuclear import.     15         Figure  8.  Model  of  the  regulatory  pathway  by  which  rapamycin  and  nitrogen  starvation  induce  NCR  regulated gene expression. Adapted from Cooper (2002).       1.8  Urea and ethyl carbamate (EC)    The excretion of non‐metabolized urea into wine is the major factor involved in formation of the  compound ethyl carbamate (EC) (Monteiro and Bisson 1991).  Under ambient conditions (wine storage),  ethanol  reacts  with  carbamyl  compounds  present  in  fermented  beverages  to  form  EC  (Ingledew,  Magnus  and  Patterson  1987;  Kodama,  et  al.  1994;  Ough,  Crowell  and  Gutlove  1988)  in  a  time  and  temperature dependent manner (Figure 9). Potentially reactive carbamyl compounds include citrulline  and carbamyl phosphate, which result from arginine and nucleotide metabolism, as well as urea (Ough,  Crowell and Gutlove 1988).    16     a)   b)   Ethyl Carbamate  Vinyl Carbamate  Vinyl Carbamate Epoxide    Figure 9. Synthesis reaction and bioactivation pathway of ethyl carbamate. a) The synthesis of EC  in wines results from the spontaneous reaction of ethanol and urea. b) The epoxide degradation  product  of  EC  binds  DNA,  causing  damage  and  resulting  in  increased  rates  of  cancers  in  test  animals.    1.9  The EC problem    1.9.1  The EC problem: History    During the early part of the 20th century, ethyl carbamate was often administered to humans as  an anesthetic during surgeries. High incidence of lung cancer in surgical patients was the first evidence  supporting  EC’s  role  as  a  toxic  compound  (Nettleship,  Henshaw  and  Meyer  1943).  Elucidation  of  the  compound’s bioactivation pathway and further studies into its carcinogenicity (Ashby 1991; Guengerich  and Kim 1991; Leithauser, et al. 1990) fueled interest of both EC’s prevalence and mechanism of action.  Studies would soon show that vinyl carbamate epoxides, which are highly reactive oxidative degradation  products  of  EC,  interact  with  free  nucleotides  as  well  as  RNA  and  DNA  and  induce  mutations  in  both  through mismatch pairing and direct damage (Dahl, Miller and Miller 1978; Leithauser, et al. 1990; Park,  et al. 1993; Schlatter and Lutz 1990; Zimmerli and Schlatter 1991). Further supporting EC’s role in cancer  is  the  evidence  that  EC  significantly  increases  the  rates  of  liver,  lung,  and  harderian  gland  cancers  in  male and female mice. Moreover, incidence of mammary and ovarian as well as skin and forestomach  cancers was substantially increased in female and male mice, respectively (National Institutes of Health  National Toxicology Program 2004).     17     Known  to  be  a  naturally  occurring  byproduct  of  fermentation,  EC  was  soon  shown  to  be  ubiquitous to nearly all wine and spirits albeit in vastly different quantities (Canas, et al. 1989; Ingledew,  Magnus and Patterson 1987; Ough 1976a; Ough 1976b; Schlatter and Lutz 1990; Zimmerli and Schlatter  1991). As a result of studies showing  that most wines and spirits contain high levels of EC, during the  mid  1980’s  Canada  set  a  legal  limit  of  30  µg/L  on  the  allowable  EC  content  in  wines;  the  US  set  a  voluntary limit of 15 µg/L. Long term toxicology studies eventually gave rise to the 1997 action manual  on the prevention of EC in wine published by the FDA in conjunction with the Department of Viticulture  and  Enology  at  the  University  of  California  Davis  (http://vm.cfsan.fda.gov/~frf/ecaction.html)  (Butzke  and Bisson 1998).            Exposure  to  EC,  which  may  be  significantly  increased  by  the  regular  consumption  of  alcoholic  beverages  (Zimmerli  and  Schlatter  1991),  may  be  a  significant  factor  involved  in  human  cellular  mutagenesis and resultant tumorigenesis. As a result, winemakers have been actively reducing EC levels  in  wines  both  by  agricultural  practices  and,  more  recently,  molecular  biological  means  (Butzke  and   Bisson 1998).    1.9.2  The EC problem: Surveys of EC in alcoholic beverages    Despite  the  government  imposed  limits  on  EC  levels,  table  wines,  Sake  and  other  alcoholic  beverages currently available to consumers contain far more EC than was previously suggested.     In  order  to  assess  the  scope  of  the  EC  problem,  numerous  stuides  have  assayed  EC  levels  in  various  foods  and  beverages.  The  EC  content  of  20  randomly  chosen  wines  from  six  wine  producing  countries (five whites – Riesling, Pinot Gris, and Chenin Blanc; 15 reds – Pinot Noir, Cabernet Sauvignon,  Shiraz,  Zinfandel,  and  Nebbiolo)  is  summarized  in  Table  2  (Reproduced  from  Coulon,  et  al.  (2006)).  As  the data indicates, of the 20 wines, 14 exceeded the Canadian EC legal limit (30 µg/L) and 17 exceeded  the US voluntary limit (15 µg/L) (Coulon, et al. 2006).      18       Table 2. Maximum potential ethyl carbamate detected by GC/MS in 20 wines from six countries. Wines  were heated at 70°C for 48 hours prior to analysis. Adapted from Coulon et al. (2006).  Concentration EC (µg/L) 11.83 9.12 14.63 38.64 57.57 66.15 59.52 46.39 55.41 24.36 44.76 41.32 27.5 38.22 57.68 33.82 51.99 18.61 34.99 36.57  Wine 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20     Area 1 4274 3649 5043 10262 14342 16610 15890 11208 13865 7012 11650 11186 7664 10375 14069 9034 14146 5734 9396 9635  Area 2 4542 3586 4959 10112 15833 16734 15015 13611 14820 6808 12576 10952 8366 10471 14839 9428 12880 5935 9295 9756  Area 3 4185 3887 4948 11269 14632 17430 15260 12213 14618 7895 11677 11368 7868 10508 15974 9832 13899 6047 10417 10811  Mean peak area 4334 3707 4983 10548 14936 16925 15388 12344 14434 7238 11968 11169 7966 10451 14961 9431 13642 5905 9703 10067  SD 186 159 52 629 791 442 451 1207 503 578 527 209 361 69 958 399 671 159 621 647  RSDa (%) 4.29 4.28 1.04 5.97 5.29 2.61 2.93 9.78 3.49 7.98 4.40 1.87 4.53 0.66 6.41 4.23 4.92 2.69 6.40 6.43  a   – Relative standard deviation     In  addition  to  the  goal  of  reducing  EC  in  table  wines,  Sake  wine  has  some  of  the  highest  EC  contents amongst fermented beverages, thus making the reduction of EC in Sake an intensely relevant  and important pursuit. Typical Sake wines have anywhere from 100‐250 µg/L EC (Canas, et al. 1989) due  to a pasteurization process that all Sakes undergo prior to bottling.    1.9.3  The EC problem: Current methods of lowering EC    Current strategies for EC reduction generally fall into three categories: agricultural practices, the  use of wine additives, and genetic engineering of yeasts.    1.9.3.1    Agricultural  methods.  The  yeast  assimilable  nitrogen  (YAN)  and,  more  specifically,  arginine  content of the fermentation substrate directly influences the amount of EC present in the final product  (Butzke and Bisson 1998). Thus, a reasonable approach to controlling EC levels is to limit arginine levels  19     in grape must and rice mash. It is possible to regulate the type and amount of nitrogen in fertilizers in  order  to  minimize  urea  production.  Furthermore,  management  of  legume  ground  cover  foliage  and  nitrogen fixing bacteria can keep juice arginine content below 1000 mg/L, however additional methods  are needed to further reduce EC levels in wines (Butzke and Bisson 1998).     1.9.3.2  Additives (acid urease). Alternative methodologies for EC reduction include the use of post‐ or  peri‐fermentation  additives  (Ough  and  Trioli  1988).  These  additives,  which  are  most  often  lyophilized  preparations of urease from Lactobacillus fermentum, degrade urea in the wine before it has a chance  to form EC; however, urease additives yield variable results due to pH and ethanol sensitivity (Kodama,  et al. 1994) which, can significantly lengthen wine processing time due to necessary enzyme incubation.  The enzyme is also expensive for winemakers to use.    1.9.3.3    Additives  (DAP).  Supplementation  of  grape  musts  with  nitrogen  is  a  common  winemaking  practice.  In  musts  with  low  assimilable  nitrogen,  supplementation  is  crucial  for  preventing  stuck  or  sluggish  fermentations  and  subsequent  spoilage.  Given  the  obvious  inappropriateness  of  supplementation with urea or arginine, the industry makes use of the cheap and efficient supplement  diammonium  phosphate  (DAP);  DAP  is  a  source  of  free  ammonia  and,  as  a  highly  favorable  nitrogen  source,  has  been  shown  to  downregulate  CAR1  during  alcoholic  fermentation  (Marks,  et  al.  2003).  Lessening the cell’s dependence on arginine as a nitrogen source could prove to be a useful method for  lowering EC content in wines.    1.9.3.4  Genetic engineering (urease expression). Another possible method for EC control in wine is the  engineering  of  yeast  strains  which  express  bacterial  or  fungal  ureases  (Ough  and  Trioli  1988).  This  approach,  whether  integrated  or  plasmid  borne,  would  allow  yeast  to  directly  degrade  urea  during  fermentation,  and  eliminates  the  need  for  urease  additives  post‐fermentation.  However,  because  S.  cerevisiae does not possess such an enzyme, a urease expressing strain would be classified as transgenic  thus  resulting  in  difficulty  obtaining  regulatory  approval  for  use.  Furthermore,  transgenic  organisms  carry a strong negative connotation in today’s society thus making their universal acceptance unlikely.    1.9.3.5    Genetic  engineering  (CAR1).  More  central  to  this  work  is  the  genetic  engineering  of  yeast  strains which are disrupted at the CAR1 locus (Kitamoto, et al. 1991). By disrupting CAR1, arginase will  no longer be available to degrade arginine to urea thus preventing the formation of EC in wine. While  20     this  method  does  work  in  the  laboratory  (Kitamoto,  et  al.  1991;  Yoshiuchi,  Watanabe  and  Nishimura  2000), it has not been widely adopted in practice because arginine is one of the major nitrogen sources  for  S.  cerevisiae  (Ingledew,  Magnus  and  Patterson  1987;  Rossignol,  et  al.  2003).  Moreover,  usage  of  Δcar1 strains is difficult due to the diploid nature of all industrial wine and Sake yeasts, and because of  the  high  risk  of  contamination  from  wild  type  CAR1/CAR1  yeasts;  however,  the  problem  of  contamination has been dealt with in the case of Sake yeast by engineering Δcar1 with killer character  (Yoshiuchi,  Watanabe  and  Nishimura  2000).  It  should  be  noted  that  CAR1  knockouts  have  only  been  attempted in Sake yeast since it is generally regarded that yeast’s inability to metabolize arginine would,  in most cases, lead to stuck fermentations and possible spoilage. An antisense mediated method for the  knockdown of CAR1 has been successful in reducing Arginase activity in laboratory yeasts (Park, Shin and  Woo 2001); however, this methodology has yet to be examined in industrial yeasts.    1.9.3.6    Genetic  engineering  (DUR1,2).  Yeast  possess  the  ability  to  degrade  urea  via  DUR1,2  which  encodes a bi‐functional adenosine tri‐phosphate (ATP) and biotin dependent enzyme (urea amidolyase)  that degrades urea to two molecules each of CO2 and NH3 in a two step reaction (Genbauffe and Cooper  1986;  Genbauffe  and  Cooper  1991;  Whitney  and  Cooper  1972;  Whitney  and  Cooper  1973;  Whitney,  Cooper and Magasanik 1973). Urea is first carboxylated using ATP and biotin to form allophanate, after  which allophanate is hydrolyzed to form CO2 and NH3.     Since DUR1,2 is subject to regulation by NCR, and because regulatory mechanisms exist which  allow for production of wines with high residual urea content, it is reasonable to expect that constitutive  expression  of  DUR1,2  should  result  in  substantially  lowered  EC  levels.  Indeed,  our  group  has  explored  this approach, and such yeasts are capable of producing wines which contain up to 89% less EC (Coulon,  et al. 2006).  More specifically, when the DUR1,2 ORF was placed under the control of the yeast PGK1  promoter and terminator signals and a single copy was integrated into the URA3 locus of the industrial  strain UC Davis 522, Chardonnay wine created by the metabolically engineered strain (522EC‐) contained  89.1%  less  EC  (Coulon,  et  al.  2006).  Analysis  of  the  genotype,  phenotype  and  transcriptome  of  522EC‐  suggested  that  the  metabolically  engineered  strain  was  substantially  equivalent  to  its  parent,  thus  making  it  suitable  for  commercialization  (Coulon,  et  al.  2006).  Furthermore,  since  the  urea  degrading  strain  (522EC‐)  contains  no  foreign  DNA  sequences,  it  is  not  classified  as  transgenic  and  thus  has  been   21     given FDA GRAS approval which should make it much more readily accepted by industry and consumers  (Coulon, et al. 2006).    1.9.4  Alternative methods for EC reduction    Realistically,  there  are  only  four  genes  that  can  be  manipulated  to  reduce  EC  in  wine:  urea  production (CAR1), urea degradation (DUR1,2), urea export (DUR4), and urea import (DUR3).     Based  on  the  literature  and  published  data,  we  understand  the  effects  of  manipulating  CAR1  and DUR1,2 expression (Coulon, et al. 2006; Yoshiuchi, Watanabe and Nishimura 2000), and while CAR1  mutants produce almost no EC, CAR1 is not a practical industrial target for EC reduction due to problems  with stuck fermentations. Thus, manipulation of DUR4 and DUR3 remain as potential targets to reduce  EC  in  wine  and  Sake.    One  option  would  be  to  knockout  the  urea  exporter  DUR4,  thus  disabling  the  yeast’s ability to export urea into the wine. Although this sounds like an attractive option, this strategy  would likely cause serious problems for winemakers. Urea is a toxic byproduct of arginine metabolism  and yeast cells need to export urea in order to stay healthy. By knocking out DUR4, urea will accumulate  in  the  cell  and  lead  to  an  adverse  physiological  state  resulting  in  stuck  fermentations.  The  fact  that  existing  recombinant  DUR1,2  yeasts  produce  any  EC  at  all  (Coulon,  et  al.  2006)  suggests  that  under  typical  winemaking  conditions  more  urea  is  produced  than  DUR1,2p,  from  a  constitutively  expressed  copy of DUR1,2, can degrade.     Given the potential problems associated with DUR4 knockouts, we focused our attention on the  urea permease, DUR3. Constitutive expression of DUR3 should result in yeasts which will act like urea  sponges;  not  only  will  these  yeasts  reabsorb  urea  that  they  excreted  as  a  byproduct  of  arginine  metabolism,  but  they  should  also  absorb  a  significant  amount  of  urea  that  is  naturally  present  in  fermentation  substrate.  By  combining  DUR1,2  constitutive  expression  with  that  of  DUR3,  it  should  be  possible to create recombinant yeasts which can conduct efficient and substantially equivalent alcoholic  fermentations with the production of little or no EC.        22     1.10  Introduction to DUR3: Role in the cell (urea transport, polyamines, boron)    During the early 1970’s it was known that yeast cells were capable of metabolizing urea as a sole  nitrogen source (Cooper and Sumrada 1975); however, there was no detailed knowledge of how it was  brought into the cell. Studies using  14C‐urea revealed that entry of urea into the cell is bimodal (Cooper  and  Sumrada  1975;  Sumrada,  Gorski  and  Cooper  1976).  A  facilitated  diffusion  system  brings  urea  into  the cell in an energy independent fashion when urea is present at concentrations greater than 0.5 mM.  More interestingly however, is the presence of an energy (ATP) dependent active transport system (Km =  14 μM) which functions at low concentrations of urea and is sensitive to nitrogen catabolite repression  (Cooper and Sumrada 1975; Sumrada, Gorski and Cooper 1976).    First purified and characterized in 1993, the DUR3 (Degradation of URea) ORF encodes a 735 aa  integral membrane protein which contains 15 predicted transmembrane domains (ElBerry, et al. 1993).  The protein, which localizes to the plasma membrane, utilizes ATP to transport urea into the cell at low  extracellular concentrations. There is some evidence to suggest that the physiological functioning state  of  the  urea  transporter  is  a  multimeric  complex,  however  this  has  not  been  confirmed  (ElBerry,  et  al.  1993).    Expression  of  DUR3  is  regulated  in  a  manner  highly  similar  to  other  genes  in  the  urea  and  allantoin degradative pathways (ElBerry, et al. 1993). Being subject to NCR, the DUR3 promoter contains  two  sets  of  tandem  GATAA  consensus  sequences;  however,  while  the  promoter  contains  efficient  GATAA  transcription  factor  binding  sites  (UASNTR),  high  level  expression  is  strongly  dependent  on  two  upstream  induction  sequences  (UIS)  (Hofman‐Bang  1999).  During  growth  on  proline  media  (no  NCR),  little  DUR3  (and  DUR1,2)  mRNA  can  be  detected  by  northern  blotting  without  the  presence  of  a  gratuitous inducer (oxalurate, an allophanate analogue) (Hofman‐Bang 1999).    The activating transcription factors DAL81 and DAL82 act through the UIS sequences contained  in the DUR3 promoter. The consensus sequence, 5’ (G/C) AAA (A/T) NTGCG (T/C) T (T/G/C) (T/G/C) 3’,  for DAL81 and DAL82 binding is shared between other allophanate induced genes (CAR2, DAL2, DAL4,  DUR1,2 and DUR3 (Hofman‐Bang 1999).     23     During  times  of  strong  NCR,  DUR3  is  actively  repressed  by  the  negative  GATAA  transcription  factor  DAL80,  and  deletion  of  DAL80  results  in  expression  of  DUR3  even  in  the  absence  of  an  inducer  (Hofman‐Bang 1999). Conversely, during NCR de‐repression, DUR3 is actively transcribed, if an inducer is  present, through the actions of the positive GATAA transcription factor GLN3 (Hofman‐Bang 1999).    In  addition  to  the  obvious  role  in  urea  uptake,  DUR3  has  been  shown  to  be  involved  in  other  important cellular processes. DUR3 has been shown to be an important regulator of intracellular boron  concentration  (Nozawa,  et  al.  2006).  Cells  lacking  DUR3  show  decreased  intracellular  boron  concentration; thus, DUR3 appears to function as an active transporter of boron into the cell (Nozawa,  et  al.  2006).  Although  evidence  suggests  DUR3  plays  a  role  in  boron  transport  and  regulation,  a  clear  physiological role for DUR3 in terms of boron utilization has yet to be defined.     The  other  important  role  of  DUR3  is  in  the  uptake  of  polyamines  (Uemura,  Kashiwagi  and  Igarashi 2007). Polyamines, such as putrescine, spermidine, and spermine, are highly regulated peptides  essential  for  cell  growth  and  proliferation  (Uemura,  Kashiwagi  and  Igarashi  2007).  Their  function  is  ubiquitous  to  both  pro‐  and  eukaryotes.  Like  E.  coli,  S.  cerevisiae  possesses  general  polyamine  transporters  (TPO1‐4,  UGA4,  TPO5,  GAP1),  as  well  as  polyamine  specific  transporters  (AGP2).  Interestingly, DUR3 has been shown to specifically uptake polyamines concurrently with urea (Uemura,  Kashiwagi  and  Igarashi  2007).  As  urea  is  a  very  poor  nitrogen  source,  and  does  not  normally  occur  in  significant  quantities  outside  the  cell,  the  main  physiological  role  of  DUR3  may  well  be  polyamine  uptake;  in  fact,  DUR3  mRNA  is  repressed  in  the  presence  of  large  quantities  of  polyamines  (Uemura,  Kashiwagi and Igarashi 2007).    Most interesting is the apparent post‐translational regulation of DUR3 polyamine uptake by the  serine/threonine kinase PTK2 (Uemura, Kashiwagi and Igarashi 2007). PTK2 seems to positively regulate  DUR3 polyamine uptake via the phosphorylation of cytoplasmic residues Thr‐250, Ser‐251, and Thr‐684  (Uemura,  Kashiwagi  and  Igarashi  2007).  Although  DUR3  polyamine  activity  and  subsequent  PTK2  regulation has been preliminarily investigated in the laboratory yeast YPH499 (Uemura, Kashiwagi and  Igarashi 2007), there are no known studies which have investigated the role of DUR3 mediated urea or  polyamine  uptake  during  alcoholic  fermentation.  However,  it  is  known  that  different  strains  of  wine   24     yeast react differentially in terms of fermentation rate and biomass production in response to varying  polyamine concentrations (Uemura, Kashiwagi and Igarashi 2007).     As with polyamine uptake, the DUR3 mediated uptake of boron seems to be post‐translationally  regulated. Although cells lacking DUR3 exhibit lower boron concentrations, the converse situation is not  true i.e. cells overexpressing DUR3 do not show significant increases in boron concentration (Nozawa, et  al.  2006).  Taken  together,  the  cases  of  polyamine  and  boron  uptake  provide  good  evidence  for  the  existence of a DUR3 regulatory protein, presumably PTK2.    1.11  Proposed Research  1.11.1  Significance of Research    Given  the  obvious  governmental  health  concern  regarding  the  EC  content  of  wines,  it  seems  logical  to  pursue  the  goal  of  producing  wines  that  contain  no  EC.  Until  recently  with  the  advent  of  constitutive  DUR1,2  expression  (Coulon,  et  al.  2006),  existing  methods  of  EC  reduction  were  cumbersome, ineffective, expensive, and/or impractical.     The development of non‐transgenic yeast strains which are capable of producing little or no EC  during  an  efficient  and  substantially  equivalent  alcoholic  fermentation  would  be  of  direct  benefit  to  industry and consumers alike. As such, the research described herein is both an application of existing  technology to a novel target, as well as a proof of concept exploration of one possible new method for  EC reduction.    1.11.2  Hypotheses    1.11.2.1  The metabolically engineered Sake yeast strains K7EC‐ and K9EC‐ should reduce EC efficiently  during Sake brewing trials. Given the substantially different environment of Sake mash, it is reasonable  that the EC reduction of functionally enhanced Sake yeasts will be highly superior when fermenting rice  mash  rather  than  grape  must.  Sake  yeasts  have  evolved  to  function  optimally  in  the  nutrient  composition of rice mash and in the presence of ‘koji’, thus the efficiency of the DUR1,2 cassette should  also function optimally. Such a result should reveal the true EC reduction potential of our recombinant   25     yeasts  and  would  affirm  our  belief  that  each  specific  yeast  strain  must  be  tested  in  its  native  environment in order to yield the most accurate results.  1.11.2.2    Constitutive  co‐expression  of  DUR1,2  and  DUR3  in  metabolically  engineered  yeasts  should  result in synergistic EC reduction. DUR1,2/DUR3 yeasts should produce substantially less EC than both  DUR1,2  and  parental  yeasts  due  to  their  ability  to  absorb  native  urea  in  grape  musts  and  to  reabsorb  excreted  urea.  Moreover,  these  yeasts  should  behave  like  their  parental  counterparts  in  all  other  aspects  of  fermentation  i.e.  growth  rate,  ethanol  production,  CO2  production,  kinetics,  etc.  Obtaining  these results will affirm our belief that the problem with current DUR1,2 clones is their ability to export  metabolic  urea  before  it  can  be  completely  degraded.  Additionally  DUR1,2  yeasts  cannot  be  used  to  degrade any urea natively present in the must/mash while DUR1,2/DUR3 yeasts could.    1.11.3  Main objectives    The main objectives of this study are to:    1. Constitutively express DUR1,2 in the Sake yeast strains K7 and K9, characterize the resultant  engineered  strains,  and  evaluate  the  effect  of  constitutive  DUR1,2  expression  on  EC  production in Chardonnay wine    2. Characterize  the  EC  reduction  potential  of  Sake  yeast  clones  K7EC‐  and  K9EC‐  during  small  scale Sake fermentation  3. Construct a genetic cassette capable of maintaining constitutive expression of a functional  DUR3 urea permease in wine and Sake yeasts  4. Constitutively express DUR3 both on its own and concurrently with DUR1,2 during wine and  Sake making in order to assess the effect on EC reduction  5. Characterize the role of DUR3, and its interplay with DUR1,2, in yeast urea metabolism and  EC production during alcoholic fermentation.       26     2  MATERIALS AND METHODS    2.1 Strains, plasmids and genetic cassettes       The  strains,  plasmids,  and  genetic  cassettes  used  in  the  construction  and  characterization  of   DUR1,2 and/or DUR3 expressing yeast strains are listed in Tables 3, 4, and 5, respectively.    Table 3. Strains used in the genetic construction and characterization of DUR3 expressing yeast strains.  Strain  E. coli Subcloning  Efficiency™ DH5α™  Competent Cells  S. cerevisiae K7  S. cerevisiae K9  S. cerevisiae 522   S. cerevisiae K7EC‐  S. cerevisiae K9EC‐  S. cerevisiae 522EC‐  S. cerevisiae K7D3  S. cerevisiae 522D3  S. cerevisiae K7EC‐D3  S. cerevisiae 522EC‐D3   A. oryzae ‘Koji‐Kin’   Description  F‐ φ80lacZΔM15 Δ(lacZYA‐argF)U169 recA1  endA1 hsdR17(rk‐, mk+) phoA  supE44 thi‐1 gyrA96 relA1 λ‐  Industrial Sake yeast strain Kyokai No. 701 (K7)  Industrial Sake yeast strain Kyokai No. 901 (K9)  Industrial wine yeast strain   Sake yeast strain K7 containing the DUR1,2  cassette (Coulon, et al. 2006) integrated at the  URA3 locus  Sake yeast strain K9 containing the DUR1,2  cassette integrated at the URA3 locus  Wine yeast strain 522 containing the DUR1,2  cassette integrated at the URA3 locus  Sake yeast strain K7 containing the DUR3  cassette integrated at the TRP1 locus  Wine yeast strain 522 containing the DUR3  cassette integrated at the TRP1 locus  Sake yeast strain K7 containing the DUR1,2  cassette integrated at the URA3 locus and the  DUR3 cassette integrated at the TRP1 locus  Wine yeast strain 522 containing the DUR1,2  cassette integrated at the URA3 locus and the  DUR3 cassette integrated at the TRP1 locus  Industrial preparation of ‘koji’ grade A. oryzae    Reference  Invitrogen   Brewing Society of Japan  Brewing Society of Japan  UC Davis  This study   This study  (Coulon, et al. 2006)  This study  This study  This study   This study   Vision Brewing  http://www.visionbrewing.com               27     Table  4.  Plasmids  used  in  the  genetic  construction  and  characterization  of  DUR3  expressing  yeast  strains.  Plasmid  Description  Reference  pUT332∆ura3  E. coli/S. cerevisiae episomal shuttle vector containing the  (Gatignol 1987)  Tn5ble (phleomycin) dominant marker.  (Yanisch‐Perron, Vieira  pUC18  High copy number E. coli plasmid that contains AmpR, ori,  and Messing 1985)  and an MCS located within a lacZ coding sequence thus  facilitating cloning via blue/white X‐Gal selection.  pUG6  High copy number E. coli plasmid that contains AmpR,  (Guldener, et al. 1996)  kanMXR, and ori.  pHVX2  A YEplac181 based S. cerevisiae expression vector in which  (Volschenk, et al. 1997)  gene expression is driven from the constitutive PGK1  promoter and terminator signals  pUCTRP1  pUC18 to which the TRP1 coding region was inserted into  This study  the BamH1 site at the MCS  pHVX2D3  pHVX2 to which the DUR3 coding region was inserted  This study  between the PGKp and PGKt via the Xho1 cloning site  pHVXKD3  pHVX2D3 to which a kanMX resistance marker (from pUG6)  This study  was inserted into the Sal1 site of pHVX2D3  This study  pUCMD  pUCTRP1 based plasmid into which the DUR3 expression  cassette (5’‐PGKp‐DUR3‐PGKt‐kanMX‐3’) was PCR blunt  end cloned into the middle of TRP1 via the EcoRV site       Table 5. Genetic cassettes used in the genetic construction and characterization of DUR3 expressing  yeast strains.  Cassette  Description  Reference  DUR1,2   Linear expression cassette containing 5’‐URA3‐PGKp‐ DUR1,2‐PGKt‐URA3‐3’  Linear expression cassette containing 5’‐TRP1‐PGKp‐ DUR3‐PGKt‐kanMX‐TRP1‐3’   DUR3   (Coulon, et al. 2006)  This study       2.2  Culture conditions    E.  coli  DH5α  cells  were  used  for  molecular  cloning  and  propagation  of  plasmids;  cells  were  cultured  according  to  standard  methods  (Ausubel,  et  al.  1995).  Unless  otherwise  indicated,  all  S.  cerevisiae  strains  were  cultured  aerobically  with  shaking  at  30°C  in  either  liquid  YPD  medium  (Difco,  Becton  Dickinson  and  Co.,  USA),  or  on  YPD  +  2%  (w/v)  agar  (Difco,  Becton  Dickinson  and  Co.,  USA)   28     plates. YPD plates supplemented with 300 µg/mL G418 (Sigma, USA) were used to select for positive S.  cerevisiae transformants containing the DUR3 expression cassette.    2.3  Genetic construction of the urea degrading yeasts K7EC‐ and K9EC‐    2.3.1  Co‐transformation of the DUR1,2 cassette and pUT332    S. cerevisiae strains K7 and K9 were co‐transformed with the 9191 bp DUR1,2 cassette (Table 5)  and  pUT332∆ura3  (Gatignol  1987)  combined  at  a  10:1  (DUR1,2  cassette:pUT332)  molar  ratio.  Yeast  strains  were  transformed  using  the  lithium  acetate/polyethylene  glycol/ssDNA  method  (Gietz  and  Woods  2002).  Following  transformation,  cells  were  left  to  recover  in  YEG  at  30°C  for  2  hours  before  plating  on  YEG  plates  supplemented  with  100  µg/mL  phleomycin  (Invitrogen,  USA).  Plates  were  incubated at 30°C until colonies appeared.    2.3.2  Screening of transformants for the integrated DUR1,2 cassette    Colony  PCR  (Ward  1992)  was  used  as  described  to  detect  the  presence  of  the  linear  DUR1,2  cassette  integrated  into  the  yeast  genome  at  the  URA3  locus.  Zymolyase  100  U/mL  (Seikagaku  Corp.,  Japan)  was  used  to  lyse  the  cells  (30  µl  zymolyase  solution).  Primers  InDURURA  (5’‐  TGGTGATATGGTTGATTCTGGTGACATA  ‐3’)  and  OutURAb  (5’‐  TTCCAGCCCATATCCAACTTCCAATTTA  ‐3’)  were used to generate an approximately 1500 bp fragment from the 3’ end of the cassette. The primers  are  specific  for  the  inside  and  outside  of  the  integrated  cassette  in  order  to  detect  integration  and  correct orientation. The yeasts 522 and 522EC‐ were used as negative and positive controls, respectively.  PCR was performed with iProofTM  High Fidelity DNA polymerase (BioRad, USA) using suggested reagent  concentrations  and  1  µl  of  Zymolyase treated  cell  suspension  as  a  template.  The  PCR  program  was  as  follows: 1. Initial denaturation – 3 min at 98°C. 2. Denaturation – 10 sec at 98°C. 3. Annealing – 30 sec at  58.5°C. 4. Extension – 45 sec at 72°C. 5. Cycle to step 2, 30 times. 6. Final extension – 10 min at 72°C.   Colony PCR reactions were visualized on 0.8% agarose gels stained with SYBR™ Safe (Invitrogen, USA).   After identification of positive transformants, engineered strains were cultured for ~10 generations on  non‐selective media (YPD) in order to ensure loss of the co‐transforming plasmid.      29     2.3.3  Genetic characterization     2.3.3.1    Southern  blot  analyses.  Southern  blotting  was  used  to  confirm  integration  of  the  DUR1,2  cassette  into  the  URA3  locus.  Genomic  DNA  from  engineered  strains  K7EC‐  and  K9EC‐  as  well  as  their  respective parent strains was digested with BglII (Roche, Germany) (Ausubel, et al. 1995), and separated  on  a  0.8%  agarose  gel.  Following  gel  preparation,  transfer  and  fixing  to  a  positively  charged  Nylon  membrane  (Roche  Diagnostics,  Germany)  (Ausubel,  et  al.  1995),  the  blots  were  probed  with  PCR  generated fragments specific for DUR1,2 and URA3. The AlkPhosTM Direct Nucleic Acid Labeling and CDP‐ Star Detection system was used as recommended for probe detection (Amersham Biosciences, England).    The  736  bp  DUR1,2  probe  was  generated  by  PCR  using  genomic  DNA  from  S.  cerevisiae  strain  522 as a template and the primers DUR1,2probe5 (5’‐TTAGACTGCGTCTCCATCTTTG‐3’) and DUR1,2F (5’‐ TGCTGGCTTTACTGAAGAAGAG‐3’).  The  927  bp  URA3  probe  was  generated  by  PCR  using  522  genomic  DNA  and  the  primers  3’URA3  (5'‐TGGGAAGCATATTTGAGAAGATG‐3')  and  OutURAb  (5’‐  TTCCAGCCCATATCCAACTTCCAATTTA ‐3’).    2.3.3.2  Sequence analysis. Genomic DNA isolated from strains K7EC‐ and K9EC‐ was used to amplify two  separate  fragments  which  together  encompassed  the  entire  ~10  kb  linear  ura3‐PGK1p‐DUR1,2‐PGK1t‐ ura3  cassette.  Primers  5’OUTURA3Cas  (5'‐AACTAATGAGATGGAATCGGTAG‐3')  and  DUR12rev1  (5’‐ TCCTGGAATGCTGTGATGG‐3’) amplified a 7900 bp fragment on the 5’ end of the cassette, while primers  PGK1forDUR   (5’‐TGGTTTAGTTTAGTAGAACCTCGTGAAACTTAC‐3’)   and   OutURAb   (5’‐   TTCCAGCCCATATCCAACTTCCAATTTA ‐3’) amplified a 7100 bp fragment on the 3’ end of the cassette.     Sequencing was performed by the Nucleic Acid Protein Service Unit (NAPS) at The University of  British Columbia using an Applied Biosystems PRISM 377 sequencer and Applied Biosystems BigDye v3.1  sequencing chemistry. Primers and template were supplied to NAPS in the concentrations specified by  their  sample  submission  requirements.  The  entire  integrated  DUR1,2  cassette  was  sequenced  via  19  different sequencing reads (Table 6) and later assembled in silico using Accelrys DS Gene v1.1 software.  The  assembled  sequences  were  aligned  against  previously  published  sequences  and  those  of  DUR1,2,  URA3,  PGK1p,  and  PGK1t  obtained  from  SGD.  If  any  discrepancies  were  found,  the  specific  read  which  gave rise to the discrepancy was repeated in order to identify bona fide mutations.   30       Table 6.  Oligonucleotide primers used in sequencing of the integrated DUR1,2 cassette.   Primer  P1  P2  P3  P4  P5  P6  P7  P8  P9  P10  P11  P12  P13  P14  P15  P16  P17  P18  P19   Primer Name  5'OUTURA3Cas  5'URA3Flank  5'PGK1pro1  5'PGK1pro2  PGK1forDUR  DUR12G  DUR12rev6  DUR12F  DUR12rev5  DUR12E  DUR12D  DUR12rev3  DUR12C  DUR12B  DUR12A  DUR12for3end  InDURURA  3'URA3  OutURAb   Sequence (5’Æ3’)  5'‐AACTAATGAGATGGAATCGGTAG‐3'  5'‐AGTATTCTTAACCCAACTGCACAGA‐3'  5'‐ACAAAATCTTCTTGACAAACGTCACAA3'  5'‐AATTGATGTTACCCTCATAAAGCACGT‐3'  5'‐TGGTTTAGTTTAGTAGAACCTCGTGAAACTTAC‐3'  5'‐TACCAGAACCTGCTGTATCAG‐3'  5'‐TCATCCGCAACTTGTTGCATAG‐3'  5'‐TGCTGGCTTTACTGAAGAAGAG‐3'  5'‐TCGGAATAAACTGCAACTGATC‐3'  5'‐ACCTCTGATAATATCTCCCGAAG‐3'  5'‐TTTTGGCCAATGTTGGATCATATTC‐3'  5'‐TGTCAACTTGCCAATGGATAAAGTAG‐3'  5'‐TTGTAATGAACCTTCCACTTCTC‐3'  5'‐ACACATGCCAAAGTCTTCGAG3'  5'‐ATTTCCAAAAACGCCCAGAATAC‐3'  5'‐TCATCAAGAATACTTGAGATGGATC‐3'  5’‐TGGTGATATGGTTGATTCTGGTGACATA‐3’  5'‐TGGGAAGCATATTTGAGAAGATG‐3'  5’‐TTCCAGCCCATATCCAACTTCCAATTTA‐3’       2.3.3.3  Analysis of DUR1,2 gene expression by qRT‐PCR. Single colonies of parental strains as well as  engineered strains from freshly streaked YPD plates were inoculated into 5 mL YPD and grown overnight  at 30°C on a rotary wheel. Cells were subcultured into 50 mL YPD (final OD600 = 0.05) and again grown  overnight at 30°C in a water shaker bath (180 rpm). Cells were harvested by centrifugation (5000 rpm,  4°C,  5  min)  and  washed  once  with  50  mL  sterile  water.  Cell  pellets  were  resuspended  in  5  mL  sterile  water and OD600 measured. Cell suspensions were used to inoculate sterile 250 mL Schott bottles filled  with  200  mL  filter  sterilized  (0.22  µm,  Millipore,  USA)  Calona  Chardonnay  juice  to  a  final  OD600  =  0.1.  Bottles  were  aseptically  sealed  with  vapour  locks  (sterilized  with  70%  v/v  ethanol)  filled  with  sterile  water. Sealed bottles were incubated at 20°C for 24 hours.    Total RNA from 24 hour fermentations was extracted using the hot phenol method (Ausubel, et  al. 1995); RNA was cleaned up post extraction using a total RNeasy Midi Kit (Qiagen), and quantified on  a  Pharmacia  Ultrospec  3000  UV/Vis  spectrophotometer.  Clean  total  RNA  (1  µg)  was  used  for  cDNA  synthesis  (iScriptTM,  BioRad,  USA)  according  to  the  manufacturer’s  instructions.    iTAQ™  SYBR®  Green  31     Supermix with ROX (BioRad, USA) was used in conjunction with an Applied Biosystems 7500 Real Time  PCR  machine  in  order  to  determine  the  relative  levels  of  gene  expression  in  the  strains  studied.  Real  time  primers  for  both  DUR1,2  and  ACT1  were  automatically  optimized  and  designed  using  Applied  Biosystem’s Primer ExpressTM v2.0 software. The DUR1,2 amplification product was amplified using the  primers   DUR12RTfwd   (5’‐CTCTGGTCCAATGGACGCATA   ‐3’)   DUR12RTrev   (5’‐  GATGGATGGACCAGTCAACGTT‐3’).  ACT1  was  amplified  using  the  primers  act1forward  (5’‐ GTTTCCATCCAAGCCGTTTTG‐3’)  and  act1reverse  (5’‐GCGTAAATTGGAACGACGTGAG‐3’).  For  each  strain,  DUR1,2 and ACT1 expression was analyzed six times and results were averaged. RQ data were analyzed  using the Applied Biosystems RQ Study software v1.2.2.    2.3.3.4    Global  gene  expression  analysis.  Total  RNA  from  strains  K7  and  K7EC‐  was  extracted  after  24  hours of fermentation (Section 2.3.3.3), via the hot phenol method (Ausubel, et al. 1995), quantified on  a NanoDrop ND‐1000 spectrophotometer and visualized on a 0.8% agarose gel. A ‘GeneChip® One‐Cycle  Target Labeling and Control’ kit (Affymetrix, USA) was used according to manufacturer’s instructions for  synthesis and clean up of cDNA and for synthesis, cleanup and fragmentation of biotinylated cRNA from  10 µg of high quality total RNA. Microarray analyses were done in duplicate, each with independently  grown cell cultures.    Four oligonucleotide yeast genome arrays, two per strain, (YGS98; Affymetrix, USA) were used  for  hybridization  of  fragmented  labelled  cRNA.  Preparation  of  hybridization  solution,  hybridization,  washing,  staining,  and  scanning  of  the  microarrays  were  performed  as  per  the  manufacturer’s  instructions  (Eukaryotic  Array  Gene  Chip  Expression  Analysis  and  Technical  Manual;  Affymetrix,  USA).  The  EukGE‐WS2v4  fluidics  protocol  of  Affymetrix  MASv5.0  software  was  used  for  array  staining  and  washing  procedures  while  arrays  were  scanned  using  a  G2500A  GeneArray  Scanner  (Agilent  Technologies, USA).    Data  were  analyzed  with  MASv5.0  and  DMT  software  (Affymetrix,  USA)  running  on  default  settings  (Affymetrix  Statistical  Algorithm  Reference  Guide).  Statistically  significant  and  reproducible  results were  obtained  by  only including genes which responded  similarly in all four cross comparisons  and with change p‐values of ≤0.005 (increasers) or ≥0.995 (decreasers). Reported fold change values are  derived from the average (n=4) of the Signal Log (base 2) Ratio (SLR). Array annotations were linked to  32     their   gene   ontology   (GO)   annotations   using   the   ‘gene_association.sgd.tab’   table   (http://www.yeastgenome.org/gene_list.shtml).     2.3.4  Phenotypic characterization    2.3.4.1  Analysis of fermentation rate in Chardonnay must. Single colonies of parental strains (K7 and  K9) as well as appropriate engineered strains from freshly streaked YPD plates, were inoculated into 5  mL YPD and grown overnight at 30°C on  a rotary wheel. Cells were subcultured into 50 mL YPD (final  OD600 = 0.05) and again grown overnight at 30°C in a water shaker bath (180 rpm). Cells were harvested  by centrifugation (5000 rpm, 4°C, 5 min) and washed once  with 50 mL sterile water. Cell  pellets were  resuspended in 5 mL sterile water and OD600 measured. Cell suspensions were used to inoculate sterile  250 mL Schott bottles filled with 200 mL unfiltered Chardonnay juice obtained from Calona Vineyards,  Kelowna,  BC,  Canada  to  a  final  OD600  =  0.1.  Bottles  were  aseptically  sealed  with  sterilized  (70%  v/v  ethanol) vapour locks filled with sterile water. Sealed bottles were incubated at 20°C, and weighed daily  to monitor CO2 production. Data were plotted in Excel to generate fermentation profiles.     2.3.4.2  Analysis of fermentation rate in Sake mash. Koji rice was prepared in 400 g batches from short  grain  Japanese  Kokoho  Rose  (Safeway,  Canada).  Rice  was  rinsed  with  tap  water  at  room  temperature  until  the  water  ran  clear;  the  rice  was  subsequently  soaked  for  1.5  hours  at  room  temperature  in  enough water to cover the rice. The rice was then drained in a kitchen sieve for 20 min. The rice in the  sieve was then placed over a pot of boiling water and covered with a bamboo steamer lid. The sieve was  arranged in such a way that the rice was not in direct contact with boiling water. After steaming until  soft and slightly transparent, the cooked rice was placed in a stainless steel bowl and cooled to ~30°C.  Upon  reaching  30°C,  the  cooled  rice  was  inoculated  with  1.5  g  of  koji  seeds  (Vision  Brewing,  Washington, USA) mixed with 1 teaspoon of all purpose white flour. The rice was mixed well, covered  with  a  piece  of  moist  Whatman  No.  3  paper,  and  the  bowl  was  sealed  with  plastic  film.  The  covered  bowl was incubated, with occasional mixing, at 30°C for 48 hours, or until the rice grains were covered  with fine white fibres and the entire mixture had a cheese‐like aroma. The koji was then transferred to  sterile 500 mL centrifuge bottles and stored at ‐30°C until use.    Single  colonies  of  parental  strains  (K7  and  K9)  as  well  as  appropriate  engineered  strains  from  freshly  streaked  YPD  plates,    were  inoculated  into  5mL  YPD  and  grown  overnight  at  30°C  on  a  rotary  33     wheel. Cells were subcultured into 50 mL YPD (final OD600 = 0.05) and again grown overnight at 30°C in a  water shaker bath (180 rpm). Cells were harvested by centrifugation (5000 rpm, 4°C, 5 min) and washed  once with 50 mL sterile water. Cell pellets were resuspended in 5 mL sterile water and OD600 measured.     The cell suspension was used to inoculate (final OD600 = 0.1) sterile 250 mL Schott bottles filled  with 13 g ‘koji’ rice, 48 g freshly steamed rice (steamed as per ‘koji’ preparation above), and 100 mL of  water  containing  0.125  g/L  citric  acid.  Bottles  were  aseptically  sealed  with  sterilized  (70%  ethanol)  vapour  locks  filled  with  sterile  water.  Sealed  bottles  were  incubated  at  18°C,  and  weighed  daily  to  monitor CO2 production. Data were plotted in Excel to generate fermentation profiles.    2.3.4.3  Analysis of glucose/fructose utilization and ethanol production. Following fermentation, 1 mL  of fresh unheated Sake was transferred to a sterile 1.5 mL microcentrifuge tube and centrifuged for 10  min at max speed (13K RPM) to pellet cells and any particulate. Supernatant (500 μL) was transferred to  a new autosampler screw cap vial (Agilent, USA).    A  20%  (v/v)  EtOH  standard  was  made  from  100%  EtOH  (Sigma,  USA)  mixed  with  sterile  MilliQ  water (Millipore, USA), and 1 mL of the standard was transferred to new autosampler screw cap vial. A  standard curve corresponding to 4, 8, 12, 16, and 20% (v/v) EtOH was plotted after duplicate injections  of 2, 4, 6, 8, and 10 µL of the 20% standard as outlined below.    A  3  g/L  glucose/fructose  standard  was  made  from  D‐Glucose  (Fisher  Scientific,  USA)  and  D‐ Fructose  (Fisher  Scientific,  USA)  mixed  with  sterile  MilliQ  water  (Millipore,  USA),  and  1  mL  of  the  standard  was  transferred  to  new  autosampler  screw  cap  vial.  A  standard  curve  corresponding  to  0.6,  1.2, 1.8, 2.4, and 3.0 g/L glucose/fructose was plotted after duplicate injections of 2, 4, 6, 8, and 10 µL of  the 20% standard as outlined below.     Samples  were  analyzed  on  an  Agilent  1100  series  liquid  chromatograph  running  Chemstation  Rev  A.09.03  [1417]  software  (Agilent  Technologies,  USA).  The  LC  was  fitted  with  a  Supelcogel  C‐610H  main column [column temperature: 50°C, 30 cm x 7.8 mm ID] (Supelco, USA) that was protected by a  Supelguard C‐610H [5cm x 4.6 mm ID] (Supelco, USA) guard column. A 10 μL sample was run isocratically  with 0.1% (v/v) H3PO4/H20 buffer at a flow rate of 0.75 mL/min. Ethanol was eluted from the column at  34     ~19  min,  fructose  was  eluted  at  ~8  min  and  glucose  was  eluted  at  ~9.5  min,  and  all  compounds  were  detected by a refractive index detector running in positive mode. The concentration of each compound  was determined automatically by Chemstation software as based on the standard curves.     2.3.5 Functionality analyses    2.3.5.1  Reduction  of  EC  in  Chardonnay  wine.  Chardonnay  wine  was  produced  with  K7,  K7EC‐,  K9,  and  K9EC‐  as in Section 2.3.4.1. At the end of fermentation, cells were removed by centrifugation (5000 rpm,  4°C, 5 min), and ~ 50 mL of wine was decanted into sterile 50 mL Schott bottles. Bottles were incubated  in a 70°C water bath for exactly 48 hours to maximize EC production, and then stored at 4°C until GC/MS  analysis (Section 2.3.5.3).    2.3.5.2 Reduction of EC in Sake wine. Sake wine was produced with K7, K7EC‐, K9, and K9EC‐  as in Section  2.3.4.2.  At  the  end  of  fermentation,  cells  and  rice  were  removed  by  centrifugation  (5000  rpm,  4°C,  5  min), and ~ 50 mL of wine was decanted into sterile 50 mL Schott bottles. Bottles were incubated in a  70°C  water  bath  for  exactly  48  hours  to  maximize  EC  production,  and  then  stored  at  4°C  until  GC/MS  analysis (Section 2.3.5.3).    2.3.5.3    Quantification  of  EC  in  wine  by  solid  phase  microextraction  and  GC/MS.  A  10  mL  sample  of  heated (70°C ‐ 48 hours) wine was pipetted into a 20 mL sample vial, to which a magnetic stirring bar  and  3  g  of  NaCl  were  added.  The  vial  was  capped  with  a  PTFE/silicone  septum,  placed  on  a  stirrer  at  22°C, and allowed to equilibrate, while stirring, for 15 min. A Solid Phase Microextraction (SPME) fibre  [65  µm  Carbowax/Divinylbenzene  (CW/DVB)]  was  conditioned  at  250°C  for  30  min  before  use.  After  sample equilibration, the fibre was inserted into the head space. After 30 min, the fibre was removed  from the sample vial and inserted into the injection port for 15 min. A blank run was performed before  each sample run. Quantification was done as follows: an ethyl carbamate (Sigma‐Aldrich) standard stock  solution (0.1 mg/mL) was prepared in distilled H20 containing 12% (v/v) ethanol and 1 mM tartaric acid  at pH 3.1. Calibration standards were prepared with ethyl carbamate concentrations of 5, 10, 20, 40, 90  µg/L. The standard solutions were stored in the refrigerator at 4°C.    Ethyl carbamate in wine was quantified using an Agilent 6890N GC interfaced to a 5973N Mass  Selective Detector. A 60 m x 0.25 mm ID, 0.25 µm thickness DBWAX fused silica open tubular column  35     (J&W  Scientific,  Folsom,  CA,  USA)  was  employed.  The  carrier  gas  was  ultra  high  purity  helium  at  a  constant  flow  of  36  cm/s.  The  injector  and  transfer  line  temperature  was  set  at  250°C.  The  oven  temperature was initially set at 70°C for 2 min then raised to 180°C at 8°C /min and held for 3 min. The  temperature was then programmed to increase by 20°C /min to 220°C where it was held for 15 min. The  total run time was 35.75 min. The injection mode was splitless for 5 min (purge flow: 5 mL/min, purge  time:  5  min).  The  MS  was  operated  in  Selected  Ion  Monitoring  (SIM)  mode  with  electron  impact  ionization;  MS  quad  temperature  150°C  and  MS  source  temperature  230°C.  The  solvent  delay  was  8  min. Specific ions 44, 62, 74, 89 were monitored with a dwell time of 100 msec. Mass 62 was used for  quantification  against  the  mass  spectrum  of  the  authentic  ethyl  carbamate  standard.  Wines  were  analyzed by three separate injections and the data were averaged.     2.4  Genetic construction of the urea importing yeasts K7D3, K7EC‐D3, 522D3, and 522EC‐D3    2.4.1  Construction of the DUR3 linear cassette    In  order  to  express  DUR3  constitutively,  a  cassette  similar  to  the  DUR1,2  cassette  previously  made  by  our  group  (Coulon,  et  al.  2006)  was  constructed.  All  cloning  steps  and  reactions,  unless  otherwise  stated,  were  performed  according  to  standard  molecular  biology  standards  methods  (Ausubel, et al. 1995). All PCR reactions, unless otherwise indicated, were performed using iProofTM High  Fidelity DNA polymerase (BioRad, USA) as per the manufacturer’s instructions.    2.4.1.1  Construction of pHVX2D3. In order to place DUR3 under the control of the constitutive PGK1  promoter and terminator signals, the DUR3 ORF was cloned into pHVX2 (Volschenk, et al. 1997) (Figure  10). The DUR3 ORF was amplified from 522 genomic DNA using the following primers which contained  Xho1 restriction enzyme sites built into their 5’ ends:   1. DUR3forXho1 (5’‐AAAACTCGAGATGGGAGAATTTAAACCTCCGCTAC‐3’)   2. DUR3revXho1 (5’‐AAAACTCGAGCTAAATTATTTCATCAACTTGTCCGAAATGTG‐3’).    Following PCR, 0.8% agarose gel visualization, and PCR cleanup (Qiagen, USA – PCR Purification  Kit), both the PCR product (insert) and pHVX2 (vector) were digested with Xho1 (Roche, Germany). After  the digested vector was treated with SAP (Fermentas, USA) to prevent re‐circularization, the insert and  linearized‐SAP  treated  vector  were  ligated  overnight  at  22°C  (T4  DNA  Ligase  –  Fermentas,  USA);  the  36     ligation  mixture  (5  μL)  was  used  to  transform  DH5α™  competent  cells  (Invitrogen,  USA)  that  were  subsequently  grown  on  100  µg/mL  Ampicillin  (Fisher,  USA)  supplemented  LB  (Difco,  USA)  plates.  Plasmids from a random selection of transformant colonies were harvested (Qiagen, USA – QIAprep Spin  Miniprep kit) and digested by EcoR1 (Roche, Germany); PCR, using inside‐outside primers, was done to  identify plasmids with the desired insert.       Figure  10.  Schematic  representation  of  cloning  strategy  for  creation  of  pHVX2D3.  The  DUR3  ORF  was  PCR amplified from 522 genomic DNA and ligated into the Xho1 site of pHVX2.       2.4.1.2  Construction of pHVXKD3. A kanMX marker was obtained from pUG6 (Guldener, et al. 1996) via  double  digestion with Xho1 and Sal1 (Fermentas, USA).  Following digestion, the 1500 bp kanMX band  was gel purified (Qiagen, USA – Gel Extraction Kit) and ligated into the Sal1 site of linearized‐SAP treated  pHVX2D3. The ligation mixture (5 μL) was used to transform DH5α™ competent cells which were grown  on  LB‐Ampicillin  (100  µg/mL).  Recombinant  plasmids  (Figure  11)  were  identified  by  HindIII  (Roche,  Germany) digestion of plasmids isolated from 24 randomly chosen colonies.     37       Figure  11.  Schematic  representation  of  cloning  strategy  for  creation  of  pHVXKD3.  The  kanMX  marker  was obtained from Xho1/Sal1 digestion of pUG6 and ligated into the Sal1 site of pHVXKD3.    2.4.1.3  Construction  of  pUCTRP1.  The  TRP1  coding  region  was  PCR  amplified  from  522  genomic  DNA  using  TRP1  specific  primers,  each  containing  BamH1  (bold)  and  then  Apa1  (underline)  sites  at  their  5’  ends: BamH1Apa1TRP1ORFfwd (5’‐AAAAAAGGATCCAAAAAAGGGCCCATGTCTGTTATTAATTTCACAGG‐3’);  BamH1Apa1TRP1ORFrev (5’‐AAAAAAGGATCCAAAAAAGGGCCCCTATTTCTTAGCATTTTTGACG‐3’).     Following amplification, cleanup, and quantification, the ~750 bp fragment was ligated into the  BamH1 (Roche, Germany) site of linearized‐SAP treated pUC18 (Figure 12). Recombinant plasmids were  identified primarily through blue/white screening (growth on LB‐Ampicillin supplemented with 50 μg/mL  Xgal) and subsequently confirmed through HindIII/EcoR1 digestion.       Figure 12. Schematic representation of cloning strategy for creation of pUCTRP1. The TRP1 ORF was PCR  amplified from 522 genomic DNA and ligated into the BamH1 site of pUC18.     38     2.4.1.4  Construction of pUCMD. The PGK1p‐DUR3‐PGK1t‐kanMX cassette located within pHVXKD3 was  amplified from pHVXKD3 plasmid DNA using cassette specific primers: 1. pHVXKfwdlong (5’‐ CTGGCACG  ACAGGTTTCCCGACTGGAAAGCGGGCAGTGAG‐3’); pHVXKrevlong (5’‐ CTGGCGAAAGGGGGATGTGCTGCAA  GGCGATTAAGTTGGG‐3’).  Following  amplification,  cleanup,  and  quantification,  the  ~6500  bp  blunt  end  PCR generated fragment was treated with polynucleotide kinase (New England Biolabs, USA) in order to  facilitate  ligation  (O/N  at  22°C)  into  the  blunt  EcoRV  (Fermentas,  USA)  site  of  linearized‐SAP  treated  pUCTRP1.    Recombinant plasmids (Figure 13) were initially identified using E‐lyse analysis (Eckhardt 1978)  and  later  confirmed  via  Apa1  (Stratagene,  USA)  /Sal1  digestion.  Briefly,  E‐lyse  efficiently  screens  large  numbers  of  colonies  for  the  presence  of  plasmid  DNA  by  lysing  the  colonies  within  the  wells  of  an  agarose gel, followed by electrophoresis (Eckhardt 1978). More specifically, after patching onto selective  media,  small  aliquots  of  colonies  were  suspended  in  5  µL  TBE  buffer  and  then  mixed  with  10  µL  SRL  buffer  (25%  v/v  sucrose,  50  µg/mL  RNaseA,  1  mg/mL  lysozyme).  After  mixing  by  pipetting,  cell  suspensions  were  loaded  into  the  wells  of  a  0.2%  (w/v)  SDS  ‐  0.8%  (w/v)  agarose  gel.  After  the  cell  suspension in the wells had become clear indicating cell lysis (~ 30 min), the DNA was electrophoresed  at  20  V  for  45  min,  then  at  80  V  for  45  min.  Finally  the  gel  was  stained  as  required  with  SYBR™  Safe  (Invitrogen, USA).     39       Figure 13. Schematic representation of cloning strategy for creation of pUCMD. The linear PGK1p‐DUR3‐ PGK1t‐kanMX construction was PCR amplified from pHVXKD3 and blunt end cloned into the EcoRV site  of pUCTRP1 to yield pUCMD.       2.4.2  Sequence analysis of the DUR3 cassette in pUCMD    Plasmid pUCMD (Figure 14) was isolated from E. coli (Qiagen, USA – QIAprep Spin Miniprep kit)  and  used  directly  as  a  sequencing  template.  Sequencing  was  performed  by  the  Nucleic  Acid  Protein  Service  Unit  (NAPS)  at  The  University  of  British  Columbia  using  an  Applied  Biosystems  PRISM  377  sequencer  and  Applied  Biosystems  BigDye  v3.1  sequencing  chemistry.  Primers  and  template  were  supplied to NAPS in the concentrations specified by their sample submission requirements. The entire  DUR3  cassette,  beginning  from  the  5’  TRP1  flanking  sequence  and  ending  with  the  3’  TRP1  flanking  sequence, was sequenced via 16 different sequencing reads (Table 6) and later assembled in silico using  Accelrys  DS  Gene  v1.1  software.  The  assembled  sequences  were  aligned  against  previously  published  sequences  and  those  of  DUR3,  TRP1,  PGK1p,  and  PGK1t  obtained  from  SGD.  If  any  discrepancies  were  found, the specific read which gave rise to the discrepancy was repeated in order to identify bona fide  mutations.    40       Table 7. Oligonucleotide primers used in sequencing of DUR3 cassette in pUCMD.   Primer  P1  P2  P3  P4  P5  P6  P7  P8  P9  P10  P11  P12  P13  P14  P15  P16   Primer Name  BamH1TRP1Apa1Fwd  pHVXKlongfwd  pHVXKfwd  pDUR3tfwd  DUR3Xho1fwd  DUR3Xho1rev  pDUR3trev  kanMXORFrev  kanMXORFfwd  pHVXKlongrev  BamH1TRP1Apa1rev  DUR3RTfwd  RevPGKtPst1  PGKpro1  PGKpro2  PGKforDUR   Sequence (5’Æ3’)  5’‐AAAAAAGGATCCAAAAAAGGGCCCATGTCTGTTATTAATTTCACAGG‐3’  5’‐CTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAG‐3’  5’‐CTGGCACGACAGGTTTCCCGACTGG‐3’  5’‐TTTCCGCGGAGCTTTCTAACTGATCTATCC‐3’  5’‐AAAACTCGAGATGGGAGAATTTAAACCTCCGCTAC‐3’  5’‐AAAACTCGAGCTAAATTATTTCATCAACTTGTCCGAAATGTG‐3’  5’‐TTTCCGCGGTGCGGTGTGAAATACC‐3’  5’‐TTAGAAAAACTCACTGAGCATCAAATGAAACTGC‐3’  5’‐ATGGGTAAGGAAAAGACTCACGTTTCGAGG‐3’  5’‐CTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGG‐3’  5’‐AAAAAAGGATCCAAAAAAGGGCCCCTATTTCTTAGCATTTTTGACG‐3’  5’‐GATCGGCCATGGTTGCTACTT‐3’  5’‐TTTTCTGCAGAAGCTTTAACGAACGCAGAATT‐3’  5'‐ACAAAATCTTCTTGACAAACGTCACAA3'  5'‐AATTGATGTTACCCTCATAAAGCACGT‐3'  5'‐TGGTTTAGTTTAGTAGAACCTCGTGAAACTTAC‐3'   41     AmpR   5’ ½ TRP1   rep (pMB1)  PGK1 Promoter   pUCMD (9221bp) 3’ ½ TRP1   kanMX Terminator   kanMX   DUR3   kanMX Promoter   PGK1 Terminator  Figure 14. Schematic representation of pUCMD. The DUR3 linear cassette stretches between Apa1 sites encompassing 5’1/2TRP1‐PGK1p‐   DUR3‐PGK1t‐kanMXp‐kanMX‐kanMXt‐3’1/2TRP1.       42   2.4.3  Transformation of the linear DUR3 cassette into S. cerevisiae and selection of transformants    The 6536 bp DUR3 cassette was cut from pUCMD using Apa1 (Stratagene, USA) (Ausubel, et al.  1995) and visualized on a 0.8% agarose gel. From the gel, the expected 6536 bp band was resolved and  extracted  (Qiagen,  USA  –  Gel  extraction  kit).  After  extraction,  clean  up,  and  quantification  using  a  Nanodrop  ND‐1000  spectrophotometer  (Nanodrop,  USA),  250  ng  of  linear  cassette  was  used  to  transform  S.  cerevisiae  strains  K7,  K7EC‐,  522,  and  522EC‐.  Yeast  strains  were  transformed  using  the  lithium acetate/polyethylene glycol/ssDNA method (Gietz and Woods 2002). Following transformation,  cells were left to recover in YPD at 30°C for 2 hours before plating on to YPD plates supplemented with  300 µg/mL G418 (Sigma, USA). Plates were incubated at 30°C until colonies appeared.     2.4.3.1    Confirmation  of  integration  via  colony  PCR.  Colony  PCR  was  used  as  previously  described  to  detect  the  presence  of  the  linear  DUR3  cassette  integrated  into  the  yeast  genome  at  the  TRP1  locus  (Ward 1992). Zymolyase 100 U/mL (Seikagaku Corp., Japan) was used to lyse the cells (30 µl zymolyase  solution).  Primers  kanMXORFfwd  (5’‐ATGGGTAAGGAAAAGACTCACGTTTCGAGG‐3’)  and  kanMXORFrev  (5’‐TTAGAAAAACTCATCGAGCATCAAATGAAACTGC‐3’)  were  used  to  generate  an  809  bp  fragment  from  the 3’ end of the cassette. 522 genomic DNA was used as a negative control and pUCMD as a positive  control. PCR was performed with iProofTM  High Fidelity DNA polymerase (BioRad, USA) using suggested  reagent  concentrations  and  1  µl  of  Zymolyase  treated  cell  supernatant  as  template.  The  PCR  program  was as follows: 1. Initial denaturation – 3 min at 98°C. 2. Denaturation – 10 sec at 98°C. 3. Annealing –  20 sec at 62.4°C. 4. Extension – 30 sec at 72°C. 5. Cycle to step 2, 30 times. 6. Final extension – 10 min at  72°C.  Colony PCR reactions were visualized on 0.8% agarose gels stained with SYBR™ Safe (Invitrogen,  USA).     2.4.4  Genetic characterization    2.4.4.1  Southern blot analyses. Southern blotting was used to confirm integration of the DUR3 cassette  into  the  TRP1  locus.  Genomic  DNA  from  engineered  strains  K7EC‐,  K7D3,  K7EC‐D3,  522D3,  and  522EC‐D3,  as  well as their respective parent strains, was digested with EcoRI (Roche, Germany) (Ausubel, et al. 1995),  and  separated  on  a  0.8%  agarose  gel.  Following  gel  preparation,  transfer  and  fixing  to  a  positively  charged Nylon membrane (Roche Diagnostics, Germany) (Ausubel, et al. 1995), the blots were probed  with PCR generated fragments specific for DUR3 and TRP1. The AlkPhosTM Direct Nucleic Acid Labeling          43   and CDP‐Star Detection system was used as recommended for probe detection (Amersham Biosciences,  England).    The  661  bp  DUR3  probe  was  generated  using  genomic  DNA  from  S.  cerevisiae  strain  522  as  a  template  and  the  primers  DUR3probefwd  (5’‐  CAGCAGAAGAATTCACCACCGCCGGTAGATC‐3’)  and  DUR3proberev  (5’‐  CAATCAGGTTAATAATTAATAAAATACCAGCGG‐3’).  The  461  bp  TRP1  probe  was  generated  using  genomic  DNA  from  522  as  a  template  and  the  primers  TRP1probefwd  (5’‐  TTAATTTCACAGGTAGTTCTGGTCCATTGG‐3’) and TRP1proberev (5’‐ CAATCCAAAAGTTCACCTGTCCCACCT  GCTTCTG‐3’).     2.4.4.2  Analysis of gene expression by northern blotting.  Fermentations with K7, K7EC‐ K7D3, and K7EC‐D3  in  filter  sterilized  Calona  Chardonnay  must  were  conducted  as  in  Section  2.3.3.3.  After  24  hours,  cells  were  harvested  by  centrifugation  (5000  rpm,  4°C,  4  min),  snap  frozen  in  liquid  nitrogen  (3  min),  and  stored at ‐80°C until RNA extraction. Total RNA was extracted using a hot phenol method (Ausubel, et al.  1995), quantified on a NanoDrop ND‐1000 spectrophotometer and visualized on a 0.8% agarose gel.    Northern  blot  analysis  was  performed  as  described  (Ausubel,  et  al.  1995).  Briefly,  30  μg  total  RNA  was  separated  on  a  1%  agarose‐formaldehyde  denaturing  gel  and  transferred  to  a  positively  charged  Nylon  membrane  (Roche  Diagnostics,  Germany).  Blots  were  probed  with  PCR  generated  fragments specific for DUR3 and the loading control HHF1. The AlkPhosTM Direct Nucleic  Acid Labeling  and CDP‐Star Detection system was used as recommended for probe detection (Amersham Biosciences,  England).     The 661 bp DUR3 probe used for northern blotting was the same as the probe used for Southern  blotting (Section 2.4.4.1). The ~500 bp HHF1 probe was supplied by another member of our lab (Coulon,  et al. 2006).    2.4.4.3  Analysis of DUR3 gene expression by qRT‐PCR. Gene expression analysis of K7, K7EC‐ K7D3, and  K7EC‐D3  was  performed  as  described  in  Section  2.3.3.3  using  total  RNA  from  24  hour  fermentations  (Section  2.4.4.2).  The  DUR3  real  time  PCR  product  was  generated  using  the  primers  DUR3RTfwd  (5’‐ GATCGGCCATGGTTGCTACTT‐3’) and DUR3RTrev (5’‐GCGATAGTGTTCATCCCGGTT‐3’).           44   2.4.4.4  Global gene expression analysis. Following 24 hour fermentations (Section 2.4.4.2), total RNA  from strains K7 and K7D3 was used for transcriptome analysis as described in Section 2.3.3.4.    2.4.5  Analysis of urea uptake using 14C‐urea    In order to assess the effect of DUR3 constitutive expression on urea uptake activity, a  14C‐urea  uptake  assay  was  performed  as  previously  described  (Cooper  and  Sumrada  1975).  Briefly,  appropriate  strains were grown (30°C – 180 RPM) in minimal media (1.7 g/L YNB w/o amino acids w/o ammonium  sulfate, 20 g/L glucose, 1 g/L ammonium sulfate or 1 g/L L‐proline) to approximately 1x107 cells/mL. An  11 mL sample of cell culture was transferred to a 250 mL Erlenmeyer flask containing 80 μL of 36.6 mM  14  C‐urea (Sigma, USA – 6.8 mCi/mmol). Cells were then cultured (30°C – 180 RPM) for 20 min and 1 mL   samples  were  taken  every  2  min.  The  1  mL  samples  were  applied  to  0.22  μm  nylon  filters  (Millipore,  USA)  and  washed  with  25  mL  aliquots  of  cold  minimal  media  to  which  10  mM  urea  (Fisher,  USA)  had  been added. Filters were placed in scintillation vials, filled with scintillation fluid (Fisher, USA) and left  overnight to equilibrate. Samples were then counted in a recently calibrated Beckman LS6000IC liquid  scintillation counter using  the counter’s factory ‘14C quench’ mode. DPM values were then converted  into nano‐mole urea transported (Cooper and Sumrada 1975) and plotted against time in Excel.    2.4.6  Phenotypic characterization    2.4.6.1    Analysis  of  fermentation  rate  in  Chardonnay  must.  Fermentations  of  unfiltered  Calona  Chardonnay  must  with  K7,  K7EC‐,  K7D3,  K7EC‐D3,  522,  522EC‐,  522D3,  and  522EC‐D3  were  performed  as  described in Section 2.3.4.1.    2.4.6.2    Analysis  of  fermentation  rate  in  Sake  mash.  Fermentations  of  Sake  rice  mash  with  K7,  K7EC‐,  K7D3, K7EC‐D3, 522, 522EC‐, 522D3, and 522EC‐D3 were performed as described in Section 2.3.4.2.    2.4.6.3  Analysis for ethanol content. Ethanol production by K7, K7EC‐, K7D3, K7EC‐D3, 522, 522EC‐, 522D3,  and 522EC‐D3 in Chardonnay and Sake wine was quantified as described in Section 2.3.4.3.                45   2.4.7  Functionality of metabolically enhanced yeasts    2.4.7.1  Reduction of EC in Chardonnay wine. Chardonnay wine was produced with K7, K7EC‐, K7D3, K7EC‐ , 522, 522EC‐, 522D3, and 522EC‐D3  as described in 2.3.4.1. Quantification of EC reduction was performed   D3  as described in Section 2.3.5.1.    2.4.7.2  Reduction of EC in Sake wine. Sake wine was produced with K7, K7EC‐, K7D3, K7EC‐D3, 522, 522EC‐,  522D3, and 522EC‐D3 as described in 2.3.4.2. Quantification of EC reduction was performed as described in  Section 2.3.5.2.    2.5 Statistical analyses    Two  factor  ANOVA  analyses  were  used  to  evaluate  the  variations  in  glucose,  fructose,  and  ethanol  measured  in  Chardonnay  and  Sake  wine  produced  by  parental  and  engineered  yeast  strains.  Fisher’s LSD (Least Significant Difference) test was used after ANOVA to determine which means were  statistically  significant  (p<0.05).  All  statistical  calculations  were  performed  in  Excel  2007  (Microsoft,  USA).                           46   3  RESULTS    3.1  Constitutive expression of DUR1,2 in Sake yeast strains K7 and K9    3.1.1  Integration of the linear DUR1,2 cassette into the genomes of Sake yeast strains K7 and K9    In  order  to  constitutively  express  DUR1,2,  the  Sake  yeast  strains  K7  and  K9  were  transformed  with  the  linear  DUR1,2  cassette  (Figure  15).  After  colony  PCR  screening  of  approximately  1500  yeast  transformants for the integration of the DUR1,2 cassette, two metabolically engineered strains, K7EC‐ and  K9EC‐,  were  obtained.  The  designation  ‘EC‐‘  denotes  integration  of  the  linear  DUR1,2  cassette  into  the  URA3 locus.  Srf1 ½ site   Srf1 ½ site   URA3   PGKp   DUR1,2   PGKt   URA3     Figure 15. Schematic representation of the linear DUR1,2 cassette.       3.1.2  Genetic characterization of K7EC‐ and K9EC‐    3.1.2.1  Correct integration of the DUR1,2 linear cassette into the genomes of K7EC‐ and K9EC‐. In order  to  confirm  the  correct  integration  of  the  DUR1,2  cassette,  a  Southern  blot  was  performed  using  PCR  generated DUR1,2 and URA3 probes and the BglII digested genomic DNA of K7EC‐ and K9EC‐.        When probed with DUR1,2, two signals were detected for K7EC‐ and K9EC‐  corresponding to 5.0   kb and 9.0 kb DNA fragments, and one signal was detected for K7 and K9 corresponding to a 5.0 kb DNA  fragment (Figure 16a). The 5.0 kb fragment matches the expected fragment size for the native DUR1,2  locus  while  the  9.0  kb  fragment  matches  the  expected  fragment  size  for  the  presence  of  the  DUR1,2  cassette integrated into the URA3 locus (Figure 16b).                47   Probing with URA3 gave rise to two signals for K7EC‐ and K9EC‐, corresponding to 3.8 kb and 4.4 kb  DNA fragments, and one signal for K7 and K9 corresponding to a 4.4 kb fragment (Figure 17a). The 3.8  kb  fragment  matches  the  expected  fragment  size  for  the  recombinant  URA3  locus,  and  the  4.4  kb  fragment matches the expected fragment size for a non‐disrupted URA3 locus (Figure 17b).    a)      b)     BglII  BglII  5084 bp     DUR1,2 BglII  BglII  9085 bp  ura3  PGK1p  DUR1,2  PGK1t  ura3  Figure  16.  Integration  of  the  DUR1,2  cassette  into  the  URA3  locus  of  K7EC‐  and  K9EC‐ was  confirmed  by  Southern  blot  analyses  using  a  DUR1,2  probe  (a).  All  faint  bands  that  do  not  correspond to a size in the schematic representation were deemed to be non‐specific. For each  sample, the agarose gel is shown on the left while the exposed film is on the right. b) Schematic  representation  of  the  signals  expected  during  Southern  blot  analyses  (DUR1,2  probe)  of      recombinant yeasts containing the recombinant DUR1,2 cassette integrated into the URA3 locus.  The DUR1,2 probe is illustrated with blue hatched lines (b).      48   a)               b)  BglII  BglII 4455 bp  URA3 BglII  BglII 3757 bp  ura3  PGK1p  DUR1,2  PGK1t  ura3  Figure 17.  Disruption of the URA3 locus by integration of the DUR1,2 cassette in K7EC‐ and K9EC‐   was  confirmed  by  Southern  blot  analyses  using  a  URA3  probe  (a).  All  faint  bands  that  do  not  correspond to a size in the schematic representation were deemed to be non‐specific. For each  sample, the agarose gel is shown on the left while the exposed film is on the right. b) Schematic  representation  of  the  signals  expected  during  Southern  blot  analysis  (URA3  probe)  of  recombinant  yeasts  containing  the  recombinant  DUR1,2  cassette  integrated  into  the  URA3  locus. The URA3 probe is illustrated with green hatched lines (b).           49   3.1.2.2  Sake strains K7EC‐ and K9EC‐ do not contain  the bla and  Tn5ble antibiotic resistance markers.  After transformation, K7EC‐ and K9EC‐  were successively sub‐cultured on a non‐selective medium in order  to eliminate pUT332, whose only purpose was to facilitate early screening for transformants. A Southern  blot  using  probes  specific  for  bla  (Ampicillin  resistance)  and  Tn5ble  (Phleomycin  resistance)  revealed  that these genes were absent from K7EC‐ and K9EC‐ , as well as the parental strains K7 and K9 (Figure 18).       Figure 18. The genetically engineered strains K7EC‐ and K9EC‐ do not contain the bla and Tn5ble antibiotic  resistance markers. The plasmid pUT332 was used as a positive control for both bla and Tn5ble. For each  sample, the agarose gel is shown on the left while the exposed film is on the right.           50   3.1.2.3  Sequence of the DUR1,2 cassette integrated into the genomes of K7EC‐ and K9EC‐. To verify the  sequence of the DUR1,2 cassette integrated into the URA3 locus, single strand DNA sequencing of the  cassette in K7EC‐ and K9EC‐ was completed. In silico sequence assembly and subsequent analysis revealed  one nucleotide in the cassette sequence of K9EC‐ that did not match the previously reported recombinant  DUR1,2  sequences  and/or  SGD’s  S288C  DUR1,2  sequence  (Table  8).  The  C  to  T  switch  (theoretical  to  sequenced data) at nucleotide position 821 is located within the 5’URA3 flanking region of the cassette  and is likely due to a genetic polymorphism between the Sake strain K9 and the laboratory strain S288C.  Comparison  of  the  recombinant  DUR1,2  ORF  sequence  in  K7EC‐  and  K9EC‐  and  that  of  SGD  revealed  no  nucleotide  changes  or  amino  acid  substitutions.  A  detailed  description  of  the  DNA  sequences  that  comprise the DUR1,2 cassette is given in Table 9.    Table 8. Discrepancies between the integrated DUR1,2 cassette of K9EC‐ and published sequences.    Nucleotide  Description  position  821  Difference in the 5’ region of the URA3 open reading frame of K9EC‐ CÆT     Table 9. Detailed description of the DNA sequences that comprise the DUR1,2 cassette.  Nucleotide  position  1‐4  5‐950  5‐508  509‐950  951‐2445  2446‐7953  7954‐8235  8236‐9187  8236‐8640  8641‐9187  9188‐9191   Description  5’ SRF1 ½ site  URA3 sequence  5’ non coding sequence  5’ part of URA3 ORF  PGK1 promoter  DUR1,2 ORF  PGK1 terminator  URA3 sequence  3’ part of URA3 ORF  3’ non coding sequence  3’ SRF1 ½ site     In  silico  analysis  of  the  integrated  DUR1,2  cassette  revealed  that  two  new  ORFs  were  created  during  construction  of  the  DUR1,2  cassette;  these  ORFs  were  composed  entirely  of  S.  cerevisiae  sequences (Figure 19). Novel ORF1 (447 bp) is located at nucleotide position 509‐955 while novel ORF2  (792 bp) is located at position 767‐1558.          51     5’ SRF1 ½ site  5’ URA3   Novel ORF1  (447 bp)   DUR1,2  PGK1p   PGK1t   3’ URA3  Novel ORF2 (792 bp)   Figure  19.  A  schematic  representation  of  new  ORFs  of  more  than  100  codons  generated  during  construction of the DUR1,2 cassette. Two new ORFs, entirely composed of S. cerevisiae sequences,  were created.        3.1.2.4    Confirmation  of  constitutive  expression  of  DUR1,2  in  K7EC‐  and  K9EC‐  by  qRT‐PCR.  Total  RNA  from  yeast  cells  in  24  hour  fermentations  of  Chardonnay  must  was  used  to  confirm  and  quantify  constitutive expression of DUR1,2 in K7EC‐ and K9EC‐. Integration of the DUR1,2 cassette in K7EC‐ and K9EC‐  up  regulated  DUR1,2  expression  by  9.13‐fold  and  12.77‐fold,  respectively,  compared  to  the  parental  strains K7 and K9 (Figure 20). Expression of DUR1,2 in K7EC‐ and K9EC‐ was detected in non‐inducing (NCR)  conditions  indicating  that  the  PGK1  promoter  and  terminator  signals  are  effective  at  overcoming  repression by NCR during fermentation.            52   18 16  Relative quantification (fold)  14 12  12.77  10  9.13  8 6 4 2 0  1.00 K7  1.00 K7EC-  K9EC-  K9 Strain    EC‐  EC‐   Figure  20.  Gene  expression  analysis  (qRT‐PCR)  of  K7,  K7 ,  K9,  and  K9 indicates  functionality  of  the  DUR1,2 cassette and constitutive expression of DUR1,2 in non‐inducing (NCR) conditions. Total RNA was  extracted  from  yeast  cells  harvested  after  24  hour  fermentation  (20°C)  in  filter  sterilized  Calona  Chardonnay  must  that  was  inoculated  to  a  final  OD600  =  0.1.  Total  RNA  was  subsequently  reverse  transcribed,  and  the  resultant  cDNA  was  amplified  in  the  presence  of  SYBR  green  dye.  DUR1,2  gene  expression was standardized to ACT1 expression and data for strains K7EC‐  and K9EC‐ were calibrated to  their  respective  parental  strain  K7  and  K9.  Fermentations  were  conducted  in  triplicate  and  the  data  averaged; error bars represent 95% confidence intervals.     3.1.2.5  Effect of  the integrated  DUR1,2 cassette on the transcriptomes  of K7EC‐ and K9EC‐. Total RNA  from  yeast  cells  in  24  hour  fermentations  of  Chardonnay  must  was  used  analyze  the  impact  of  the  integrated  DUR1,2  cassette  on  global  gene  expression  in  K7EC‐.  Reported  changes  in  gene  expression  were cut off at a minimum 4‐fold change in expression (SLRAvg ≥ 2 or SLRAvg ≤ ‐2) to ensure elimination of  experimental noise inherent in microarray analysis; this cut‐off is supported by the previously published  statistical examination of a wine yeast’s transcriptome during fermentation (Marks, et al. 2008).    Integration  of  the  DUR1,2  cassette  into  the  URA3  locus  of  K7EC‐  had  a  minimal  effect  on  the  yeast’s transcriptome. DUR1,2 was upregulated by 6.35‐fold in K7EC‐; URA3 was downregulated by 2.35‐         53   fold but was not included in Table 10 as it fell below the 4‐fold cut off. Besides DUR1,2, two genes were  upregulated greater than 4‐fold in K7EC‐ (Table 10); seven genes were downregulated more than 4‐fold in  K7EC‐.  No  metabolic  pathways  were  affected  by  the  presence  of  the  integrated  DUR1,2  cassette;  however,  integration  of  the  DUR1,2  cassette  downregulated  three  unrelated  genes  involved  in  meiosis/sporulation  (RME1,  SSP1,  SDS3)  indicating  a  possible  negative  effect  on  sporulation  efficiency  (Table 10).      Table  10.  Effect  of  the  integrated  DUR1,2  cassette  in  the  genome  of  K7  on  global  gene  expression  patterns in S. cerevisiae K7EC‐  (≥ 4‐fold change). Reported changes are relative to the parental strain K7.  Total  RNA  from  K7  and  K7EC‐,  harvested  at  24  hours  into  fermentation  of  filter  sterilized  Chardonnay  must,  were  used  for  hybridization  to  microarray.  Fermentations  were  conducted  in  duplicate  and  the  data were averaged (p≤0.005).      Fold Change 6.60 6.35 4.23  Fold Change -5.64 -4.97 -4.67 -4.64 -4.21 -4.16 -4.12  Genes expressed at higher levels in K7ECGene Symbol Biological Process Transcription factor (bHLH) involved in interorganelle RTG1 communication Urea amidolyase DUR1,2 bZIP (basic-leucine zipper) protein involved in unfolded protein HAC1 response Genes expressed at lower levels in K7ECGene Symbol Biological Process Zinc finger protein involved in control of meiosis RME1 Permease involved in methionine transport SEO1 Mating factor alpha MF(Alpha)1 Protein involved in the control of meiotic nuclear divisions and SSP1 spore formation Protein involved in deactylase complex and transcriptional silencing SDS3 during sporulation Protein required for Cytochrome B mRNA stability or 5’ processing CBP1 Protein involved in organization of Golgi RUD3    3.1.3  Phenotypic characterization of K7EC‐ and K9EC‐    3.1.3.1  Fermentation rate of K7EC‐ and K9EC‐  in Chardonnay must. Fermentation profiles of the parental  and  metabolically  engineered  Sake  yeasts  are  shown  in  Figures  21a,b.  As  is  common  in  grape  must,  fermentations  were  robust  and  rapid  (~400  hours).  The  fermentation  profiles  shown  in  Figures  21a,b  indicate substantial equivalence amongst the parent and engineered strains as far as fermentation rate  is concerned.            54   18.00  a)   16.00  Weig h t lo s s  (g )  14.00 12.00 10.00 K7  8.00  K 7E C ‐ 6.00 4.00 2.00 0.00 0  b)   100     200 300 T im e  (Ho u rs)  400  500     18.00 16.00  Weig h t lo s s  (g )  14.00 12.00 10.00 8.00  K9  6.00  K 9E C ‐  4.00 2.00 0.00 0  100  200  300  400  500  T im e  (H o u rs)    Figure  21.  Fermentation  profiles  (weight  loss)  of  parental  and  DUR1,2  engineered  Sake  strains  in  Chardonnay wine. Chardonnay wine was produced by inoculating Sake yeast strains (a) K7 and K7EC‐ and  (b)  K9  and  K9EC‐  into  unfiltered  Calona  Chardonnay  must  (final  OD600  =  0.1).  Fermentations  were  incubated to completion (~400 hours) at 20°C. Fermentations were conducted in triplicate and the data  were averaged; error bars indicate one standard deviation.      EC‐  3.1.3.2    Fermentation  rate  of  K7   and  K9  EC‐   in  Sake  mash.  Fermentation  profiles  of  the  parental  and   metabolically  engineered  Sake  yeasts  are  shown  in  Figures  22a,b.  In  contrast  to  the  fermentations  of          55   Chardonnay  must  in  Section  3.1.3.1,  Sake  fermentations  were  less  robust,  and  slower  (~600  hours  to  completion). The fermentation profiles shown in Figures 22a,b indicate substantial equivalence amongst  the parent and engineered strains as far as fermentation rate is concerned.  20.00 18.00  a)   16.00  Weig h t lo s s  (g )  14.00 12.00 K7  10.00  K 7E C ‐  8.00 6.00 4.00 2.00 0.00 0  100  200  300 400 T im e  (Ho u rs)  500  600     20.00 18.00 16.00  b)  Weig h t lo s s  (g )  14.00 12.00  K9  10.00  K 9E C ‐  8.00 6.00 4.00 2.00 0.00 0  100  200  300 400 T im e  (Ho u rs)  500  600     Figure 22. Fermentation profiles (weight loss) of parental and DUR1,2 engineered Sake strains in Sake  wine. Sake wine was produced by inoculation (final OD600 = 0.1) of Sake yeast strains (a) K7 and K7EC‐ and  (b)  K9  and  K9EC‐  into  white  rice  (Kokako  Rose)  and  koji  mash  (Vision  Brewing).  Fermentations  were  incubated  to  completion  (~600  hours)  at  18°C.  Fermentations  were  conducted  in  triplicate  and  data  averaged; error bars indicate one standard deviation.  3.1.3.3  Utilization of glucose and fructose and production of ethanol by K7EC‐ and K9EC‐  in Sake wine.  The  effect  of  the  DUR1,2  cassette  on  glucose  and  fructose  utilization  as  well  as  ethanol  production  in          56   strains K7EC‐ and K9EC‐  was investigated. Glucose, fructose and ethanol were quantified by LC analysis at  the  end  of  fermentation.  Compared  to  their  respective  parental  strains,  K7EC‐  and  K9EC‐  produced  Sake  wine with substantially equivalent amounts of residual glucose, residual fructose and ethanol (Table 11).    Table 11. Utilization of glucose and fructose and production of ethanol in Sake wine by parental yeast  strains  (K7  and  K9),  their  metabolically  engineered  counterparts  (K7EC‐  and  K9EC‐).  Sake  wine  was  produced by inoculation of Sake yeast strains, K7, K7EC‐, K9 and K9EC‐ in white rice (Kokako Rose) and koji  mash  (Vision  Brewing).  Fermentations  (Figures  22a,b)  were  incubated  to  completion  (~600  hours)  at  18°C.  Glucose  and  fructose  (g/L)  and  ethanol  (v/v)  were  quantified  at  the  end  of  fermentation.  Data  were analyzed for statistical significance (p≤0.05) using two factor ANOVA analysis.                                       Glucose  EC‐   K7  K7   p* K9  Replicate 1  0.059  0.056  ‐‐  0.057  Replicate 2  0.066  0.056  ‐‐  0.114  Replicate 3  0.059  0.051  ‐‐  0.072  Residual glucose average (n=3)  0.06  0.05  ns 0.08  STDEV  0.00  0.00  ‐‐  0.03        Fructose    K7  K7EC‐  p* K9  Replicate 1  0.736  0.733  ‐‐  0.333  Replicate 2  0.841  0.752  ‐‐  0.271  Replicate 3  0.374  0.665  ‐‐  0.338  Residual fructose average (n=3) 0.65  0.72  ns 0.31  STDEV  0.25  0.05  ‐‐  0.04        Ethanol  EC‐   K7  K7   p* K9  Replicate 1  12.23  12.49  ‐‐  12.71  Replicate 2  12.27  12.64  ‐‐  13.59  Replicate 3  11.95  11.93  ‐‐  13.05  Ethanol average (n=3)  12.15  12.35 ns 13.12  STDEV  0.17  0.37  ‐‐  0.44  *  si, ns: significant at p≤0.05, or non‐significant   K9EC‐  0.102  0.103  0.090  0.10  0.01   p*  ‐‐  ‐‐  ‐‐  ns  ‐‐   K9EC‐  0.242  0.361  0.303  0.30  0.06   p*  ‐‐  ‐‐  ‐‐  ns  ‐‐   K9EC‐  13.22  12.71  12.17  12.70  0.53   p*  ‐‐  ‐‐  ‐‐  ns  ‐‐     3.1.4  Constitutive expression of DUR1,2 in Sake yeast strains K7EC‐ and K9EC‐ reduces EC in Chardonnay  wine by approximately 30%     In order to assess the effect of the DUR1,2 cassette on EC reduction in Chardonnay wine, K7EC‐  and K9EC‐ were used to ferment Chardonnay must, and EC content was measured in the resultant wine.          57   Fermentation  profiles  of  the  parental  and  metabolically  engineered  Sake  yeasts  are  shown  in  Figures  21a,b.    In contrast to the usually high amounts of EC found in Sake wine, during laboratory scale wine  fermentations  the  parental  Sake  strains  K7  and  K9  produced  relatively  low  amounts  of  EC,  64.87  and  56.16  ppm,  respectively  (Table  12);  the  engineered  strains  K7EC‐  and  K9EC‐  reduced  by  EC  in  the  Chardonnay wine by 29.88% and 0%, respectively.    Table 12. Reduction of EC by functionally enhanced yeast strains K7EC‐ and K9EC‐ during wine making. The  concentration  of  EC  (µg/L)  in  Chardonnay  wine  produced  by  Sake  yeast  strains  K7,  K7EC‐, K9,  and  K9EC‐  was quantified by GC/MS. Strains were inoculated (final OD600  = 0.1) into unfiltered Calona Chardonnay  must and fermentations were incubated to completion (~350 hours) at 20°C. Fermentation profiles are  given in Figure 21.     Yeast strain  Replicate 1  Replicate 2  Replicate 3  Average (n=3)  STDEV  RSD (%)  Reduction (%)   K7  69.05  63.62  61.93  64.87  3.72  5.73  ‐‐   K7EC‐  46.3  42.94  47.21  45.48  2.25  4.94  29.88   K9  56.13  ‐‐  ‐‐  56.16  ‐‐  ‐‐  ‐‐   K9EC‐  55.18  ‐‐  ‐‐  55.18  ‐‐  ‐‐  ~0       3.1.5  Constitutive expression of DUR1,2 in Sake yeast strains K7EC‐  and K9EC‐ reduces EC in Sake wine  by approximately 68%     To assess the effect of the DUR1,2 cassette on EC reduction in Sake wine, K7EC‐ and K9EC‐ were  used to ferment Sake rice mash (rice and koji), and EC content was measured in the resultant Sake wine.  Fermentation  profiles  of  the  parental  and  metabolically  engineered  Sake  yeasts  are  shown  in  Figures  22a,b.     During laboratory scale Sake wine fermentations the parental Sake strains K7 and K9 produced  significantly more EC (211.19 and 344.16 ppm, respectively ‐ Table 13) than during wine fermentations  (Table  12).  In  Sake  wine,  the  engineered  strains  K7EC‐  and  K9EC‐  reduced  by  EC  by  67.54%  and  68.33%,  respectively (Table 13), making K7EC‐  and K9EC‐  much more effective at EC reduction in Sake wine than in      58     Chardonnay wine. Given the substantial difference in EC production and reduction by identical strains, it  seems  imperative  that  yeast  strains  be  evaluated  in  their  native  environment  to  accurately  assess  the  efficacy of the DUR1,2 cassette.    Table  13.  Reduction  of  EC  by  functionally  enhanced  yeast  strains  K7EC‐  and  K9EC‐  during  Sake  brewing.  The  concentration of EC (µg/L) in  Sake wine, produced  by inoculation (final  OD600 = 0.1) of Sake yeast  strains  K7,  K7EC‐,  K9,  and  K9EC‐  into  white  rice  (Kokako  Rose)  and  koji  mash  (Vision  Brewing),  was  quantified  by  GC/MS.  Fermentations  were  incubated  to  completion  (~600  hours)  at  18°C  and  fermentation profiles are given in Figure 22.                  Yeast strain  Replicate 1  Replicate 2  Replicate 3  Average (n=3)  STDEV  RSD (%)  Reduction (%)   K7EC‐  72.5  79.28  53.85  68.54  13.17  19.22  67.54   K7  224.11  198.7  210.75  211.19  12.71  6.02  ‐‐   K9  241.73  265.01  525.74  344.16  157.68  45.82  ‐‐   K9EC‐  108.92  105.96  112.15  109.01  3.10  2.84  68.33     3.2  Constitutive expression of DUR3 in the Sake yeast strain K7 and the wine yeast strain 522     3.2.1  Sequence of pUCMD    A multicopy episomal plasmid containing the DUR3 ORF inserted between the PGK1 promoter  and terminator signals flanked by TRP1 sequences was constructed; kanMX served as a selective marker  in  pUCMD  (Figure  14).  Single  strand  sequencing  revealed  this  plasmid  contained  the  desired  DNA  fragments  in  the  correct  order  and  orientation.  Furthermore,  in  silico  assembly  of  the  DUR3  coding  region in pUCMD revealed that the DUR3 ORF was identical in amino acid sequence and length to that  published on SGD.    Aligning  the  sequence  data  of  the  DUR3  cassette  with  the  expected  sequence  revealed  nine  single  nucleotide  changes  along  the  length  of  the  cassette  (Table  14),  which  are  highlighted  in  a  DNA  sequence  alignment  between  of  S288C  and  pUCMD  (Figure  23).  A  detailed  description  of  the  DNA  sequences that comprise the DUR3 cassette is given in Table 15.             59   Table  14.  Discrepancies  between  the  DUR3  cassette  in  pUCMD  and  published  sequences.  Nucleotide  mismatches are designated as ‘XÆ Y’, meaning that the predicted nucleotide ‘X’ has been sequenced as  ‘Y’. The DNA alignment of S288C and pUCMD is given in Figure 23.     Nucleotide  position  928  999  1230  1491  1494  3524  3821  3970  4160   Region of cassette   Description   PGK1 promoter  PGK1 promoter  PGK1 promoter  PGK1 promoter  PGK1 promoter  DUR3 ORF  DUR3 ORF  DUR3 ORF  DUR3 ORF   CÆT   CÆT  CÆT  CÆT  GÆA  GÆC: Silent  TÆC: Silent  GÆA: Silent  AÆC: Silent     Table 15.  Detailed description of the DNA sequences that comprise the DUR3 cassette.     Nucleotide  position  1‐6  7‐291  292‐475  476‐1976  1977‐4184  4185‐4467  4468‐4535  4536‐4933  4934‐5743  5744‐5992  5993‐6120  6121‐6510  6511‐6516   Description  5’ Apa1 restriction site  5’ TRP1 sequence  pHVXKD3 vector sequence from cloning strategy  PGK1 promoter  DUR3 ORF  PGK1 terminator  pHVXKD3 vector sequence from cloning strategy  kanMX promoter  kanMX ORF  kanMX terminator  pHVXKD3 vector sequence from cloning strategy  3’ TRP1 sequence  3’ Apa1 restriction site                                        60   Alignment of DNA sequences: S288C and pUCMD    Upper line: S288C, from 1 to 6515  Lower line: pUCMD, from 1 to 6515    Data identity= 99%  901 901 961 961  TAGCATACAATTAAAACATGGCGGGCACGTATCATTGCCCTTATCTTGTGCAGTTAGACG ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| TAGCATACAATTAAAACATGGCGGGCATGTATCATTGCCCTTATCTTGTGCAGTTAGACG CGAATTTTTCGAAGAAGTACCTTCAAAGAATGGGGTCTCATCTTGTTTTGCAAGTACCAC |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| CGAATTTTTCGAAGAAGTACCTTCAAAGAATGGGGTCTTATCTTGTTTTGCAAGTACCAC --------------------------------------------------------------------------CONTINUATION OF PGK1 PROMOTER---------------------------------------------------------------------------  1201 1201  TCAAGACGCACAGATATTATAACATCTGCACAATAGGCATTTGCAAGAATTACTCGTGAG |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| TCAAGACGCACAGATATTATAACATCTGCATAATAGGCATTTGCAAGAATTACTCGTGAG --------------------------------------------------------------------------CONTINUATION OF PGK1 PROMOTER---------------------------------------------------------------------------  1441 1441 1501 1501  CCGTCGCTCGTGATTTGTTTGCAAAAAGAACAAAACTGAAAAAACCCAGACACGCTCGAC |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| CCGTCGCTCGTGATTTGTTTGCAAAAAGAACAAAACTGAAAAAACCCAGATACACTCGAC TTCCTGTCTTCCTATTGATTGCAGCTTCCAATTTCGTCACACAACAAGGTCCTAGCGACG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TTCCTGTCTTCCTATTGATTGCAGCTTCCAATTTCGTCACACAACAAGGTCCTAGCGACG ---------------------------------------------------------------CONTINUATION OF PGK1 PROMOTER AND START OF DUR3 ORF----------------------------------------------------------------  3481 3481  CTTTGCTATCACCAGCCATTTTTATTCCTATTTTAACGTATGTGTTTAAGCCACAAAATT ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| CTTTGCTATCACCAGCCATTTTTATTCCTATTTTAACGTATGTCTTTAAGCCACAAAATT --------------------------------------------------------------------------CONTINUATION OF DUR3 ORF--------------------------------------------------------------------------------  3781 3781 3841 3841 3901  TACAAAATGAATTAGACGAAGAACAAAGAGAACTAGCACGTGGTTTAAAAATTGCATACT |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| TACAAAATGAATTAGACGAAGAACAAAGAGAACTAGCACGCGGTTTAAAAATTGCATACT TCCTATGTGTTTTTTTCGCTTTGGCATTTTTGGTAGTTTGGCCCATGCCCATGTATGGTT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TCCTATGTGTTTTTTTCGCTTTGGCATTTTTGGTAGTTTGGCCCATGCCCATGTATGGTT  3901  CCAAATATATCTTCAGTAAAAAATTCTTTACCGGTTGGGTTGTTGTGATGATCATCTGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCAAATATATCTTCAGTAAAAAATTCTTTACCGGTTGGGTTGTTGTGATGATCATCTGGC  3961  TTTTTTTCAGTGCGTTTGCCGTTTGTATTTATCCACTCTGGGAAGGTAGGCATGGTATAT          61   3961 4021 4021 4081 4081 4141 4141 4201 4201  ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| TTTTTTTCAGTGCATTTGCCGTTTGTATTTATCCACTCTGGGAAGGTAGGCATGGTATAT ATACCACTTTGCGAGGCCTTTACTGGGATCTATCTGGTCAAACTTATAAATTAAGGGAAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATACCACTTTGCGAGGCCTTTACTGGGATCTATCTGGTCAAACTTATAAATTAAGGGAAT GGCAAAATTCGAACCCACAAGATCTGCATGTAGTAACAAGCCAAATTAGTGCGAGAGCAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCAAAATTCGAACCCACAAGATCTGCATGTAGTAACAAGCCAAATTAGTGCGAGAGCAC ATAGACAATCATCACATTTCGGACAAGTTGATGAAATAATTTAGCTCGAGGATTGAATTG |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ATAGACAATCATCACATTTCGGCCAAGTTGATGAAATAATTTAGCTCGAGGATTGAATTG AATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAATA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAATA  Figure 23.  DNA sequence alignment of S288C and pUCMD revealed nine discrepancies along the length  of DUR3 cassette. The sequence obtained from S288C is shown in the upper line and the sequence of  the DUR3 cassette in pUCMD is shown in the lower line. Only a partial sequence of the DUR3 cassette is  displayed.  The  PGK1  promoter  is  shown  in  green,  the  DUR3  ORF  is  shown  in  black,  and  the  PGK1  terminator is shown in blue. Nucleotide mismatches are highlighted in bold and red, and are underlined.  In  the  DUR3  ORF,  mismatches  are  oriented  within  their  respective  codons  by  underlining;  the  stop  codon is italicized.        In  silico  analysis  of  the  integrated  DUR3  cassette  revealed  that  two  new  ORFs  were  created  during  construction  of  the  DUR3  cassette;  these  ORFs  were  composed  of  a  mixture  of  S.  cerevisiae  sequence and pHVXK vector sequence (Figure 24). Novel ORF1 (324 bp) is located at nucleotide position  7‐330 while novel ORF2 (621 bp) is located at position 463‐1083.  5’ Apa1 site  5’ TRP1   3’ Apa1 site PGK1p   DUR3  PGK1t  kanMXp   kanMX   kanMXt 3’ TRP1  Novel ORF2  (621 bp)   Novel ORF1  (324 bp)   Figure  24.  A  schematic  representation  of  new  ORFs  of  more  than  100  codons  generated  during  construction of the DUR3 cassette. Two new ORFs, composed of a mixture of S. cerevisiae sequence and  pHVXK vector sequence, were created.          62   3.2.2  Integration of the linear DUR3 cassette into the genomes of yeast strains K7, K7EC‐, K9, and K9EC‐  To constitutively express DUR3, the linear DUR3 cassette (Figure 25) was transformed into Sake  yeast strains K7 and K7EC‐, and the wine strains 522 and 522EC‐. Following positive selection on a G418  medium and sub‐culturing, the eight strains listed in Table 16 were obtained.  Apa1 site   Apa1 site   TRP1   PGKp   DUR3   PGKt   kanMX   TRP1     Figure 25. Schematic representation of the linear DUR3 cassette.     Table  16.  Recombinant  yeast  strains  created  by  integration  of  the  DUR3  cassette  into  the  TRP1  locus.  The  designation  ‘EC‐‘  corresponds  to  integration  of  the  DUR1,2  cassette  while  ‘D3’  corresponds  to  integration of the DUR3 cassette. ‘EC‐D3’ designates integration of both cassettes.     Parent strain  K7  522  K7  522  EC‐ K7   522EC‐  K7D3  522D3  EC‐D3 K7   522EC‐D3   Genetic modification  Wild type  DUR1,2  DUR3  DUR1,2/DUR3     3.2.3  Genetic characterization of K7D3, K7EC‐D3, 522D3, and 522EC‐D3    3.2.3.1  Correct integration of the DUR3 cassette into the genomes of K7D3,  K7EC‐D3, 522D3, and 522EC‐D3.  A Southern blot, using EcoR1 digested genomic DNA and PCR created DUR3 and TRP1 probes (Figure 26),  was  performed  on  each  of  the  recombinant  yeast  strains  to  assess  proper  integration  of  the  DUR3  cassette into the genome. The DUR3 and TRP1 probes are schematically represented in Figures 27a,b.      In each of the recombinant yeast strains, two signals corresponding to 2.4 kb and 4.7 kb, were  detected when probed for DUR3 (Figure 26). The 2.4 kb fragment matches the expected fragment size  for  the  native  DUR3  locus  while  the  4.7  kb  fragment  matches  the  expected  size  for  the  recombinant  TRP1‐PGK1p‐DUR3‐PGK1t‐kanMX‐TRP1  locus.  In  strains  that  did  not  carry  the  recombinant  DUR3  cassette, only the 2.4 kb signal was detected.           63     When probed for TRP1, three signals, corresponding to 1.5 kb, 3.0 kb and 4.7 kb, were detected  in  each  of  the  strains  containing  the  recombinant  DUR3  cassette  (Figure  26).  The  1.5  kb  fragment  matches  the  expected  fragment  size  for  a  non‐disrupted  TRP1  locus,  while  the  3.0  kb  and  4.7  kb  fragments are in accordance with  the  presence of the recombinant DUR3 cassette integrated into the  TRP1 locus.     Unexpectedly, when any of the K7 derived strains, except for K7EC‐D3, were probed for DUR3, a  novel signal was detected at ~3.5 kb (Figure 26). This fragment corresponds to the disappearance of the  2.4  kb  band  that  represents  the  native  DUR3  locus.  This  result  was  confirmed  by  sequencing  to  be  caused by a restriction fragment length polymorphism (RFLP) between 522 and K7. The DUR3 locus in K7  is mutated such that it no longer contains the EcoR1 site within the coding region (Figure 28) and, as a  DUR3 probe 1  2  3  4  5  6  TRP1 probe 7  1 2 3  4  5  6  7  4680 bp 4680 bp ~ 3500 bp 2444 bp 3088 bp  1452 bp  Figure 26. Integration of the DUR3 cassette into the TRP1 locus of 522D3, 522EC‐D3, K7D3, and K7EC‐D3 was  confirmed  by  Southern  blot  analysis  using  DUR3  and  TRP1  probes.  Approximately  1  µg  of  EcoR1  digested genomic DNA from 522 (lane #1), 522D3  (lane #2), 522EC‐D3  (lane #3), K7 (lane #4), K7EC‐  (lane  #5), K7D3 (lane #6), and K7EC‐D3 (lane #7) was probed with either DUR3 or TRP1. In lane #5 less DNA was  accidentally loaded thus accounting for the faint band pattern. All faint bands that did not correspond  to a size in the schematic representation were deemed to be non‐specific binding.             64   result, the native DUR3 locus in K7 produced a larger signal (~3500 bp). By integrating a copy of DUR3  derived from 522, which contains the internal EcoR1 site, a recombinant locus was created which gives  rise to the same band pattern seen in 522. Although this RFLP should have been observed in K7EC‐D3 it  was not and therefore warrants further investigation.   a)        EcoR1                2444 bp  DUR3  EcoR1  4680 bp  EcoR1  trp1  b)   EcoR1  PGK1p  EcoR1  DUR3  PGK1t  trp1  EcoR1  1452 bp  TRP1    EcoR1  4680 bp  EcoR1  trp1  PGK1p  DUR3  EcoR1  3088 bp  PGK1t  trp1  Figure  27.  Schematic  representation  of  the  signals  expected  during  Southern  blot  analysis  of  recombinant  yeasts  containing  the  recombinant  DUR3  cassette  integrated  into  the  TRP1  locus.  Expected  signals  during  Southern  blotting  with  the  DUR3  probe  (drawn  in  green)  (a).  Expected  signals during Southern blotting with the TRP1 probe (drawn in red) (b).             65   Alignment of DNA sequences: S288C, 522, K7 (1‐240 bp DUR3)   S288C 522 K7  ATGGGAGAATTTAAACCTCCGCTACCTCAAGGCGCTGGGT ......................cAtCcaggGGCGCTGGGa ............cAACaaaCcCcctactcAGGCGCTGGGT  40 18 28  S288C 522 K7  ACGCTATTGTATTGGGCCTAGGGGCCGTATTTGCAGGAAT .CGCTATTGTATTGGGCCTAGGGGCCGTATTTGCAGGAAT .CGCTATTGTATTGGGCCTAGGGGCCGTATTTGCAGGAAT  80 57 67  S288C 522 K7  GATGGTTTTGACCACTTATTTACTGAAACGTTATCAAAAG GATGGTTTTGACCACTTATTTACTGAAACGTTATCAAAAG GATGGTTTTGACCACTTATTTACTGAAACGTTATCAAAAG  120 97 107  S288C 522 K7  GAAATCATCACAGCAGAAGAATTCACCACCGCCGGTAGAT GAAATCATCACAGCAGAAGAATTCACCACCGCCGGTAGAT GAAATCATCACAGCAGAAGAATTtACCACCGCCGGcAGAT  160 137 147  S288C 522 K7  CTGTAAAAACCGGCTTAGTGGCTGCAGCCGTGGTTTCTAG CTGTAAAAACCGGCTTAGTGGCTGCAGCCGTGGTTTCTAG CTGTAAAAACCGGCTTAGTGGCTGCcGCCGTGGTTTCTAG  200 177 187  S288C TTGGATCTGGTGTTCTACATTGTTAACGTCGTCAACAAAG 240 522 TTGGATCTGGTGTTCTACATTGTTAACGTCGTCAACAAAG 217 K7 TTGGATCTGGTGTTCTACATTGTTAACGTCGTCAACAAAG 227   Figure 28. Alignment of the DNA sequences of S288C, 522, and K7 confirmed the presence of a mutant  EcoR1 site in the DUR3 coding region of K7. Only a partial sequence of DUR3 is displayed. The EcoR1 site  in question is displayed in red; other mismatches revealed by sequencing are highlighted in blue.       3.2.3.2    Confirmation  of  constitutive  expression  of  DUR3  in  K7D3  and  K7EC‐D3  by  northern  blotting.  In  order  to  assess  the  constitutive  expression  of  DUR3  from  the  DUR3  cassette  in  K7D3  and  K7EC‐D3,  a  northern blot was performed using PCR generated probes for HHF1 (Histone H4) and DUR3 on freshly  harvested total RNA from K7, K7EC‐, K7D3, and K7EC‐D3. Identical signals matching the predicted transcript  size for HHF1 (312 bp) were observed in all of the strains tested (Figure 29), indicating an abundance of  un‐degraded mRNA in the samples. Signals, which matched the predicted transcript size (2208 bp) for  DUR3,  were  observed  in  strains  K7D3  and  K7EC‐D3  when  probed  for  DUR3  (Figure  29),  thus  confirming  constitutive  expression  of  DUR3  in  non‐inducing  conditions  as  a  result  of  integration  of  the  DUR3  cassette.  No  DUR3  signal  was  detected  in  K7  or  K7EC‐  confirming  that  DUR3  mRNA  is  absent  during  fermentation due to repression by NCR.            66      HHF1  DUR3 K7EC‐D3   K7D3   K7EC‐   K7   K7EC‐D3      K7D3   K7      K7EC‐                2208bp       312bp        Figure  29.  Constitutive  expression  of  DUR3  (2208  bp)  was  confirmed  by  northern  blot  analysis  of  K7,  K7EC‐, K7D3, K7EC‐D3. Total RNA (30 µg) was harvested from 24 hour fermentations of Calona Chardonnay  must inoculated to a final OD600 = 0.1, separated on a 1% agarose‐formaldehyde gel and probed for both  the loading control HHF1 and DUR3.       3.2.3.3  Quantification of constitutive DUR3 expression in K7D3 and K7EC‐D3 by qRT‐PCR. Expression of  DUR3 and DUR1,2 was verified and quantified by qRT‐PCR analysis of cDNA reverse transcribed from the  total  RNA  of  K7,  K7EC‐,  K7D3,  and  K7EC‐D3.    Analyses  were  performed  on  the  same  RNA  samples  as  in  Section 3.2.3.2.    The PGK1 promoter and terminator signals resulted in high level expression, under non‐inducing  (NCR) conditions, of both the DUR1,2 and DUR3 genes in the integrated cassettes (Figure 30); DUR1,2  was upregulated 11.8‐fold in K7EC‐  while DUR3 was upregulated 22.1‐fold in K7D3. High level expression  of  both  DUR1,2  and  DUR3  (17.3‐fold  and  11.5‐fold,  respectively)  was  sustained  in  K7EC‐D3,  when  both  DUR1,2 and DUR3 were integrated into the genome.      In strains in which only one cassette (DUR1,2 or DUR3) was integrated, constitutive expression  of  that  gene  induced  expression  of  the  other  (Figure  30).  Constitutive  expression  of  DUR1,2  in  K7EC‐          67   induced  expression  of  DUR3  by  3.78‐fold.  Likewise,  constitutive  expression  of  DUR3  in  K7D3  induced  expression of DUR1,2 by 3.61‐fold.   18  Relative quantification (fold)  16 14  14.19 12  11.82  10  DUR1,2 DUR3  9.26  8  7.10  6 4  3.78  2 0  3.61  1.00 1.00 K7  K7EC-  K7D3  K7EC-D3  Strain    EC‐  D3  EC‐D3  Figure 30. Analyses of gene expression (qRT‐PCR) of K7, K7 , K7 , and K7  confirmed functionality of  the DUR3 cassette and  constitutive expression of DUR1,2 and DUR3 in non‐inducing  (NCR) conditions.  Total RNA was extracted from cells harvested after 24 hour fermentation (20°C) in filter sterilized Calona  Chardonnay  must  that  was  inoculated  to  a  final  OD600  =  0.1.  Total  RNA  was  subsequently  reverse  transcribed, and the resultant cDNA was amplified in the presence of SYBR green dye. DUR1,2 and DUR3  gene expression was standardized to ACT1 expression and data for K7EC‐, K7D3, K7EC‐D3  was calibrated to  the  parental  strain  K7.  Fermentations  were  conducted  in  triplicate  and  the  data  averaged;  error  bars  represent 95% confidence intervals.      3.2.3.4  Effect of the integrated DUR3 cassette on the transcriptome of K7D3. Total RNA from yeast cells  isolated from 24 hour fermentations in Chardonnay must was used analyze the impact of the integrated  DUR3 cassette on global gene expression in K7D3. Reported changes in gene expression were cut off at a  minimum 4‐fold change in expression  (SLRAvg ≥ 2 or SLRAvg ≤ ‐2)  to ensure elimination of  experimental  noise  inherent  in  microarray  analysis;  this  cut‐off  is  supported  by  the  previously  published  statistical  examination of a wine yeast’s transcriptome during fermentation (Marks, et al. 2008).              68   Integration of the DUR3 cassette into the TRP1 locus of K7D3 had a minimal effect on the yeast’s  transcriptome. DUR3 was upregulated by 36.95‐fold in K7D3; TRP1 was downregulated by 1.25‐fold but  was  not  included  in  Table  17  as  it  fell  below  the  4‐fold  cut  off.  Besides  DUR3,  three  genes  were  upregulated  greater  than  4‐fold  in  K7D3  (Table  17);  one  gene  (HAC1)  was  common  to  both  of  the  engineered strains K7EC‐ and K7D3 (Tables 10 and 17). Four genes were downregulated more than 4‐fold  in K7D3. Despite falling below the 4‐fold cut off, one gene (RUD3) was included in Table 17 because it was  common to the list of genes downregulated in both K7EC‐ and K7D3 (Tables 10 and 17) and because it is  very close to the 4‐fold cut off. No metabolic pathways were affected by the presence of the integrated  DUR3  cassette;  however,  integration  of  the  DUR3  cassette  upregulated  one  gene  (FIG1)  and  downregulated  one  gene  (TID3)  involved  in  meiosis/sporulation  indicating  a  possible  effect  on  meiosis/sporulation efficiency (Table 17).      Table 17. Effect of the integrated DUR3 cassette in the genome of K7 on global gene expression patterns  in S. cerevisiae K7D3 (≥ 4‐fold change). Reported changes are relative to the parental strain K7. Total RNA  from  K7  and  K7D3,  harvested  at  24  hours  into  fermentation  of  filter  sterilized  Chardonnay  must,  were  used  for  hybridization  to  microarrays.  Fermentations  were  conducted  in  duplicate  and  the  data  were  averaged (p≤0.005).     Fold Change 36.95 5.67 4.93 4.24  Fold Change -8.18 -7.31 -5.98 -3.98  Genes expressed at higher levels in K7D3 Gene Symbol Biological Process Urea permease DUR3 bZIP (basic-leucine zipper) protein involved in unfolded protein HAC1 response Protein required for chromosome condensation BRN1 Integral membrane protein required for efficient mating and low FIG1 affinity Ca2+ transport Genes expressed at lower levels in K7D3 Gene Symbol Biological Process Meiotic protein required for synapsis and meiotic recombination; TID3 interaction partner with DMC1p SNT309 Splicing factor protein TOA1 Transcription factor IIA, large chain RUD3 Protein involved in organization of Golgi    3.2.4  Recombinant strains K7D3 and K7EC‐D3 exhibit highly enhanced urea uptake ability in conditions of  strong NCR    Radiolabelled  14C‐urea uptake assays were performed to confirm constitutive urea uptake as a  result of integration of the DUR3 cassette.          69   The  parental  Sake  strain  K7,  and  the  recombinant  yeast  K7EC‐  containing  the  DUR1,2  cassette  integrated into the URA3 locus, failed to incorporate any significant amount of radiolabelled urea in a  minimal medium containing 1% (w/v) ammonium sulphate (Figure 31). This is likely due to the NCR of  the DUR genes in the presence of the preferred nitrogen source (ammonium sulphate). In contrast, K7D3  and  K7EC‐D3  were  highly  efficient  at  urea  uptake  (Figure  31),  confirming  that  integration  of  the  DUR3  cassette results in the production of a functional protein that localizes to the yeast plasma membrane,  and that control of DUR3 by the PGK1 promoter and terminator signals is capable of overcoming native  repression by NCR.    A  significant  difference  in  the  urea  uptake  rates  of  K7D3  and  K7EC‐D3  was  observed  (Figure  31),  despite integration of identical DUR3 cassettes in both strains. The observed difference in urea uptake  between K7D3 and K7EC‐D3  can be explained by the need for urea degradation (DUR1,2p) after its import  by  the  cell.  While  DUR1,2  must  be  induced  and  then  synthesized  in  K7D3,  DUR1,2p  is  constitutively  expressed in K7EC‐D3 leading to rapid degradation of urea to which might mask an increased uptake; the  radiolabel would be quickly lost as 14CO2.             70     14  EC‐  D3  EC‐D3   Figure  31.    Uptake  of  C‐urea  by  K7,  K7 ,  K7   and  K7 under  conditions  of  NCR.    Strains  were  cultured (final OD600 = 1) in a 1% (w/v) ammonium sulphate minimal medium prior to exposure to 0.27  mM  14C‐urea  (6.8  mCi/mmol).  Assays  were  conducted  in  triplicate  and  the  data  averaged;  error  bars  represent one standard deviation.       When compared to either K7D3 or K7EC‐D3, both K7 and K7EC‐ exhibited relatively poor urea uptake  under the conditions tested (Figure 31). In order  to differentiate between K7 and K7EC‐, Figure 31 was  modified by significantly reducing the scale of the Y‐axis; the maximum value of the Y‐axis was reduced  from 7.0 nmole (Figure 31) to 0.1 nmole (Figure 32). K7 was capable of accumulating significantly more  urea  than  K7EC‐  (Figure  32),  probably  due  to  the  constitutive  expression  of  DUR1,2  in  K7EC‐;  14C‐urea  might  be  actively  degraded  as  it  is  imported  into  the  cell  thus  giving  the  illusion  that  transport  is  less  efficient.  This  phenomenon  was  also  observed  when  the  abilities  of  K7D3  and  K7EC‐D3  to  transport  urea  into the cell were compared (Figure 31).           71        14  EC‐   Figure 32. Uptake of  C‐urea by K7 and K7 under conditions of NCR. Strains were cultured (final OD600  =  1)  in  a  1%  (w/v)  ammonium  sulphate  minimal  medium  prior  to  exposure  to  0.27  mM  14C  urea  (6.8  mCi/mmol).  Assays  were  conducted  in  triplicate  and  the  data  averaged;  error  bars  represent  one  standard deviation.       3.2.5  Recombinant strains K7D3 and K7EC‐D3 exhibit highly enhanced urea uptake ability in conditions of  NCR de‐repression    Radiolabelled   14  C‐urea  uptake  assays  were  performed  in  order  to  assess  the  ability  of   engineered  strains  containing  the  integrated  DUR3  cassette  to  uptake  urea  under  non‐repressive  conditions.            72   Both  the  parental  Sake  strain  K7,  and  the  recombinant  yeast  K7EC‐  containing  the  DUR1,2  cassette  integrated  into  the  URA3  locus,  did  not  incorporate  any  significant  amount  of  14C‐urea  in  a  minimal medium containing 1% (w/v) L‐proline (Figure 33). This result, which parallels the inability of K7  and K7EC‐ to incorporate 14C‐urea in an ammonium sulphate minimal medium (Figure 31), is likely due to  the  slow  induction  and  membrane  trafficking  of  functional  DUR3p.  In  contrast,  K7D3  and  K7EC‐D3  were  highly efficient at urea uptake (Figure 33), confirming that integration of the DUR3 cassette results in the  production  of  a  functional  protein,  and  that  transcription  of  DUR3  from  the  PGK1  promoter  and  terminator signals is strong regardless of NCR state.         14  EC‐  D3  EC‐D3   Figure  33.  Uptake  of  C‐urea  by  K7,  K7 ,  K7   and  K7 under  conditions  of  NCR  de‐repression. Strains were cultured (final OD600 = 1) in a 1% (w/v) L‐proline minimal medium prior to exposure to 0.27  mM  14C  urea  (6.8  mCi/mmol).  Assays  were  conducted  in  triplicate  and  the  data  averaged;  error  bars  represent one standard deviation.          73   When compared to either K7D3 or K7EC‐D3, both K7 and K7EC‐ exhibited relatively poor urea uptake  under  conditions  of  NCR  de‐repression  (Figure  33),  K7  was  capable  of  accumulating  significantly  more  urea than K7EC‐  (Figure 34). To differentiate between K7 and K7EC‐, Figure 33 was modified by reducing  the scale of the Y‐axis; the maximum value of the Y‐axis was reduced from 7.0 nmole (Figure 33) to 0.1  nmole  (Figure  34).  K7  was  capable  of  accumulating  significantly  more  urea  than  K7EC‐  (Figure  34);  14C‐ urea  might  be  actively  degraded  as  it  is  imported  into  K7EC‐  where  DUR1,2  is  constitutively  expressed,  thus masking the strain’s true ability to import urea.      Figure  34.  Uptake  of  14C‐urea  by  K7  and  K7EC‐  under  conditions  of  NCR  de‐repression. Strains  were  cultured (final OD600 = 1) in a 1% (w/v) L‐proline minimal medium prior to exposure to 0.27 mM 14C urea  (6.8  mCi/mmol).  Assays  were  conducted  in  triplicate  and  the  data  averaged;  error  bars  represent  one  standard deviation.             74   3.2.6  Phenotypic characterization of K7D3, K7EC‐D3, 522D3, and 522EC‐D3    3.2.6.1    Fermentation  rate  of  K7D3,  K7EC‐D3,  522D3, and  522EC‐D3  in  Chardonnay  wine.  The  fermentation  profiles  of  the  parental  and  metabolically  engineered  strains  are  shown  in  Figures  35a,b.  The  robust  fermentations were completed within 300 hours, and the fermentation rates of all but one engineered  strain closely matched those of their respective parental strains, thus indicating substantial equivalence.   The  engineered  strain  K7EC‐D3  completed  the  fermentation  by  approximately  200‐250  hours  while  the  strains  K7EC‐,  and  K7D3  required  300  hours  to  finish;  the  parental  strain  K7  also  required  300  hours  to  complete the fermentation.             75   25.00  a)  Weig h t  lo s s  (g )  20.00  K7  15.00  K 7 E C ‐ K 7 D 3 10.00  K 7 E C ‐D 3  5.00  0.00 0  50  100  150  200  250  300  350  T im e   (H o u rs)     25.00  20.00 Weig h t lo s s  (g )  b)   522  15.00  522 E C ‐ 522 D 3 10.00  522 E C ‐D 3  5.00  0.00 0  50  100  150  200  250  300  350  T im e  (H o u rs)    EC‐  D3    EC‐D3   Figure 35. Fermentation profiles (weight loss) of (a) Sake yeast strains K7, K7 , K7 , and K7 and (b)  wine yeast strains 522, 522EC‐, 522D3, and 522EC‐D3  in Chardonnay wine. Chardonnay wine was produced  from unfiltered Calona Chardonnay must inoculated to a final OD600 = 0.1 and incubated to completion  (~300  hours)  at  20°C.  Fermentations  were  conducted  in  triplicate  and  data  were  averaged;  error  bars  indicate one standard deviation.                76   3.2.6.2  Ethanol production by K7D3,  K7EC‐D3, 522D3, and 522EC‐D3  in Chardonnay wine. The effect of the  DUR3 cassette on ethanol production in Chardonnay wine by strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3 was  investigated  by  LC  analysis  at  the  end  of  fermentation.  Compared  to  their  respective  parental  strains,  K7D3,  K7EC‐D3,  522D3,  and  522EC‐D3  produced  Chardonnay  wine  with  substantially  equivalent  ethanol  content (Table 18).    Table  18.  Ethanol  produced  by  Sake  yeast  strains  (K7,  K7EC‐,  K7D3,  and  K7EC‐D3)  and  wine  yeast  strains  (522, 522EC‐, 522D3, and 522EC‐D3) in Chardonnay wine. Ethanol content (%v/v) was measured by LC at the  end of fermentation. Fermentation profiles are given in Figures 35a,b. Data were analyzed for statistical  significance (p≤0.05) using two factor ANOVA analysis.      K7  K7EC‐  Replicate 1  12.89  12.84  Replicate 2  12.90  12.75  Replicate 3  12.96  12.97  Ethanol average (n=3)  12.92  12.85  STDEV  0.04  0.11          522  522EC‐  Replicate 1  13.65  13.71  Replicate 2  13.60  13.65  Replicate 3  13.71  13.66  Ethanol average (n=3)  13.65  13.67  STDEV  0.06  0.03  * si, ns: significant at p≤0.05, or non‐significant   K7D3  12.89  13.01  12.97  12.96  0.06    522D3  13.74  13.71  13.55  13.67  0.10   K7EC‐D3  12.91  12.95  12.89  12.92  0.03    EC‐D3 522   13.54  13.62  13.58  13.58  0.04   p*  ‐‐  ‐‐  ‐‐  ns  ‐‐    p*  ‐‐  ‐‐  ‐‐  ns  ‐‐       3.2.6.3  Fermentation rate of K7D3, K7EC‐D3, 522D3, and 522EC‐D3 in Sake wine. The fermentation profiles of  the  parental  and  metabolically  engineered  strains  are  shown  in  Figures  36a,b.  In  all  cases,  the  fermentations  proceeded  at  a  slower  rate  than  those  in  grape  must;  fermentations  were  completed  within 450 hours compared to 300 hours in Chardonnay grape must (Figure 35). The fermentation rates  of  engineered  strains  closely  matched  those  of  the  respective  parental  strains,  thus  indicating  substantial equivalence in fermentation rate.             77   12.00  a)   Weig ht los s  (g )  10.00 8.00  K7 K 7  E C ‐  6.00  K 7  D 3 K 7  E C ‐D 3  4.00 2.00 0.00 0  100  200  300  400  500  H o u rs  b)  12.00  Weig h t lo s s  (g )  10.00 8.00  522 522 E C ‐  6.00  522 D 3 522 E C ‐D 3  4.00 2.00 0.00 0  100  200  300  400  500  H o u rs    Figure 36. Fermentation profiles (weight loss) of (a) Sake yeast strains K7, K7EC‐, K7D3,  and K7EC‐D3  and (b)  wine  yeast  strains  522,  522EC‐,  522D3,  and  522EC‐D3  in  Sake. Sake  wine  was  produced  from  white  rice  (Kokako  Rose)  and  koji  mash  (Vision  Brewing)  inoculated  to  a  final  OD600  =  0.1  and  incubated  to  completion (~450 hours) at 18°C. Fermentations were conducted in triplicate and data were averaged;  error bars indicate one standard deviation.             78   3.2.6.4    Ethanol  production  by  K7D3,  K7EC‐D3,  522D3,  and  522EC‐D3  in  Sake  wine.  The  effect  of  the  DUR3  cassette on ethanol production in Sake wine by strains K7D3,  K7EC‐D3, 522D3, and 522EC‐D3  was investigated  by  LC  analysis  at  the  end  of  fermentation.  Compared  to  their  respective  parental  strains,  K7D3,  K7EC‐D3,  522D3, and 522EC‐D3 produced Sake wine with substantially equivalent ethanol content (Table 19).     Table  19.  Ethanol  produced  by  Sake  yeast  strains  (K7,  K7EC‐,  K7D3,  and  K7EC‐D3)  and  wine  yeast  strains  (522, 522EC‐, 522D3, and 522EC‐D3) in Sake wine. Ethanol content (% v/v) was measured by LC at the end of  fermentation.  Fermentation  profiles  are  given  in  Figures  36a,b.  Data  were  analyzed  for  statistical  significance (p≤0.05) using two factor ANOVA analysis.       K7  K7EC‐  Replicate 1  9.33  9.22  Replicate 2  9.20  8.14  Replicate 3  10.01  8.14  Ethanol average (n=3)  9.51  8.50  STDEV  0.44  0.62          522  522EC‐  Replicate 1  8.78  7.46  Replicate 2  8.80  7.81  Replicate 3  8.61  9.22  Ethanol average (n=3)  8.73  8.16  STDEV  0.10  0.93  * si, ns: significant at p≤0.05, or non‐significant   K7D3  8.90  9.58  9.64  9.37  0.41    522D3  8.77  8.99  8.98  8.91  0.12   K7EC‐D3  8.63  8.96  9.01  8.87  0.21    EC‐D3 522   8.99  8.86  8.37  8.74  0.33   p*  ‐‐  ‐‐  ‐‐  ns  ‐‐    p*  ‐‐  ‐‐  ‐‐  ns  ‐‐        3.2.7  Constitutive expression of DUR3 in yeast strains K7D3 and 522D3 reduces EC in Chardonnay wine  by 24.97% and 81.38%, respectively.    In order to assess the reduction of EC by functionally enhanced yeast strains, Chardonnay wine  was made with the parental strains K7 and 522 and the recombinant strains K7EC‐, K7D3, K7EC‐D3, 522EC‐,  522D3,    and  522EC‐D3  and  the  EC  content  quantified  by  GC/MS  at  the  end  of  fermentation.  The  fermentation profiles are given in Figures 35a,b.   During  wine  making,  K7D3  and  522D3  reduced  EC  as  efficiently  as  K7EC‐  and  522EC‐,  respectively  (Table  20).  In  Chardonnay  wine,  K7D3  reduced  EC  by  12.64%  while  K7EC‐  reduced  EC  by  6.85%;  522D3           79   reduced  EC  by  82.96%  while  522EC‐  reduced  EC  by  81.48%.  Constitutive  co‐expression  of  DUR1,2  and  DUR3 did not result in synergistic EC reduction in K7EC‐D3 or 522EC‐D3 (Table 20).    Table 20. Reduction of EC by functionally enhanced yeast strains during wine making. The concentration  of  EC  (µg/L)  in  Chardonnay  wine  produced  by  Sake  yeast  strains  K7,  K7EC‐,  K7D3,  and  K7EC‐D3  and  wine  yeast strains 522, 522EC‐, 522D3, and 522EC‐D3 from unfiltered Calona Chardonnay must was quantified by  GC/MS. Triplicate fermentations were incubated to completion (~300 hours) at 20°C and fermentation  profiles are given in Figures 35a,b.     Yeast strain  Replicate 1  Replicate 2  Replicate 3  Average (n=3)  STDEV  RSD (%)  Reduction (%)    Yeast strain  Replicate 1  Replicate 2  Replicate 3  Average (n=3)  STDEV  RSD (%)  Reduction (%)   K7   K7EC‐   K7D3   K7EC‐D3   34.19 40.31 28.69 34.40 5.81 16.89 --  34.25 30.98 30.89 32.04 1.91 5.96 6.85  29.39 29.98 30.78 30.05 0.70 2.33 12.64  29.74 31.29 30.06 30.36 0.82 2.70 11.73    522     522EC‐     522D3   199.3 169.95 177.61 182.29 15.22 8.34 --  31.32 37.32 32.66 33.77 3.15 9.33 81.48  28.76 29.89 34.56 31.07 3.07 9.88 82.96    522  EC‐D3     36.63 38.61 31.3 35.51 3.78 10.64 80.52      3.2.8    Constitutive  expression  of  DUR3  in  yeast  strains  K7D3  and  522D3  reduces  EC  in  Sake  wine  by  18.40% and 10.45%, respectively.    To assay the EC reduction of functionally enhanced yeast strains during Sake making, Sake wine  was brewed with the parental strains K7 and 522 and the recombinant strains K7EC‐, K7D3, K7EC‐D3, 522EC‐,  522D3,  and  522EC‐D3  and  the  EC  content  quantified  by  GC/MS  at  the  end  of  fermentation.    The  fermentation profiles are given in Figures 36a,b.    As  observed  before  (Section  3.1.5),  engineered  Sake  yeast  strains  reduce  EC  more  effectively  when  assessed  by  brewing  Sake;  the  Sake  yeasts  K7EC‐  and  K7EC‐D3  both  reduced  EC  content  by  ~84%          80   (Table 21). During the wine making trial described in Section 3.2.7, K7EC‐ and K7EC‐D3 both reduced EC by  only ~15% (Table 20).    In contrast to the results described in Section 3.2.7 for Chardonnay wine, constitutive expression  of DUR3 did not reduce EC as effectively as constitutive expression of DUR1,2 (Tables 20 and 21). In Sake  wine, K7D3 reduced EC by 14.97% while K7EC‐ reduced EC by 87.07%; 522D3 reduced EC by 11.49% while  522EC‐  reduced  EC  by  84.30%  (Table  21).  Constitutive  co‐expression  of  DUR1,2  and  DUR3  had  no  synergistic  effect  on  EC  reduction  during  Sake  production  (Table  21);  there  was  no  appreciable  difference  in  EC  reduction  between  the  DUR1,2  expressing  strains  and  those  which  constitutively  expressed both DUR1,2 and DUR3.    Table 21. Reduction of EC by functionally enhanced yeast strains during Sake making. The concentration  of  EC  (µg/L)  in  Sake  wine  produced  by  Sake  yeast  strains  K7,  K7EC‐,  K7D3,  and  K7EC‐D3  and  wine  yeast  strains 522, 522EC‐, 522D3, and 522EC‐D3 from white rice (Kokako Rose) and koji mash (Vision Brewing) was  quantified by GC/MS. Triplicate fermentations were incubated to completion (~450 hours) at 18°C and  the fermentation profiles are given in Figures 36a,b.    Yeast strain  K7  K7EC‐  K7D3  K7EC‐D3  Replicate 1  109.83 13.37 93.42 15.72 Replicate 2  80.68 12.3 79.86 18.6 Replicate 3  108.26 12.96 80.77 17.79 Average (n=3)  99.59 12.88 84.68 17.37 STDEV  16.40 0.54 7.58 1.49 RSD (%)  16.47 4.19 8.95 8.58 Reduction (%)  -87.07 14.97 82.56           EC‐ D3 EC‐D3 Yeast strain  522  522   522   522   Replicate 1  77.05 11.6 85.85 16.12 Replicate 2  104.01 12.17 82.17 13.07 Replicate 3  85.11 18.03 67.57 13.51 Average (n=3)  88.72 13.93 78.53 14.23 STDEV  13.84 3.56 9.67 1.65 RSD (%)  15.60 25.56 12.31 11.60 Reduction (%)  -84.30 11.49 83.96                81   4  DISCUSSION    4.1  Constitutive expression of the DUR1,2 cassette reduces EC production in wine and Sake    A common theme throughout the history of mankind has been the lack of effective solutions to  problems  until  the  advent  of  certain  technologies.  Such  has  been  the  case  for  the  problem  of  EC  in  fermented  foods  and  beverages,  more  specifically  EC  in  grape  and  Sake  wine.  Since  its  discovery  and  subsequent  characterization  as  a  carcinogen  in  the  mid  20th  century  (Nettleship,  Henshaw  and  Meyer  1943), EC has been found ubiquitously in almost all wines and spirits (Canas, et al. 1989; Coulon, et al.  2006). Although the actual health implications of EC consumption by humans has yet to be definitively  established, the Canadian government has imposed a legal limit (30 µg/L) and the US FDA has imposed a  voluntary  limit  (15  µg/L)  on  the  EC  content  of  wines  (Butzke  and  Bisson  1998).  Furthermore,  several  agencies, including the National Institute of Health’s National Toxicology Programme and the University  of California Davis Department of Enology and Viticulture, have published preventative action manuals  for limiting the EC content of wines and spirits (Butzke and Bisson 1998).     Despite the mandatory and voluntary limits imposed on the EC content in food and beverages,  its  presence  continues  to  be  a  pervasive  problem.  A  recent  survey  by  our  group  found  that  of  20  randomly chosen, commercially available wines from six wine producing countries, 14 and 17 exceeded  the  Canadian  and  US  limits,  respectively  (Coulon,  et  al.  2006).  It  is  therefore  obvious  that  current  methods  for  EC  reduction  in  wine  are  largely  ineffective.  Methods  currently  suggested  to  reduce  EC  include  agricultural  practices  to  control  grape  must  arginine  content  (Butzke  and  Bisson  1998),  the  addition  of  lyophilized  acid  urease  preparations  to  wine  (Kodama,  et  al.  1994;  Ough  and  Trioli  1988),  and, to a lesser extent, the metabolic engineering of CAR1 deficient yeast strains was exploited to limit  EC in Sake (Kitamoto, et al. 1991; Park, Shin and Woo 2001; Yoshiuchi, Watanabe and Nishimura 2000).     Until  recently,  the  previously  mentioned  methods  were  the  only  methods  of  EC  reduction  available to winemakers. However, in 2006 our group developed a functionally enhanced strain of the  popular industrial wine yeast 522 that is capable of reducing EC levels by 89% (Coulon, et al. 2006). This  result, which is a consequence of the constitutive expression of an otherwise inactive urea amidolyase  (DUR1,2) gene, far exceeds any other method of EC reduction and does not lengthen production time or          82   incur any additional costs to winemakers/consumers. The metabolically enhanced 522 strain contains a  constitutively expressed DUR1,2 gene, no antibiotic resistance marker genes or foreign DNA and is thus  non‐transgenic  and  ‘self‐cloned’.  This  yeast  has  received  approval  from  the  FDA,  Health  Canada,  and  Environment Canada for commercial wine production.      4.2  Integration of the DUR1,2 cassette into the genomes of Sake yeast strains K7 and K9 yielded the  functional urea degrading Sake yeasts K7EC‐ and K9EC‐    S. cerevisiae produces wine with varying amounts of residual urea, mainly due to NCR of its urea  amidolyase  encoding  gene  (DUR1,2  ‐  YBR208C);  synthesis  of  the  urea  degrading  urea  amidolyase  enzyme is thus prevented and urea is excreted in to the wine (Kodama, et al. 1994; Monteiro and Bisson  1991;  Monteiro,  Trousdale  and  Bisson  1989;  Ough,  et  al.  1990;  Ough,  et  al.  1991;  Stevens  and  Ough  1993). The successful integration of the DUR1,2 cassette (Figure 15) (Coulon, et al. 2006) into the URA3  locus of the popular Sake yeast strains K7 and K9 yielded the urea degrading strains K7EC‐ and K9EC‐. In  addition to the URA3 flanking sequences required for homologous recombination, the DUR1,2 cassette  contains the S. cerevisiae DUR1,2 gene under the control of the constitutive S. cerevisiae PGK1 promoter  and terminator signals.    4.2.1  Genetic characterization of K7EC‐ and K9EC‐    The targeted integration of the DUR1,2 cassette into the URA3 locus (YEL021W) was confirmed  on Southern blots hybridized with both DUR1,2 and URA3 (Figures 16 and 17). These blots revealed that  K7EC‐ and K9EC‐  both contain a single copy of the ~9.1 kb linear DUR1,2 cassette integrated into one of  their  URA3  loci.  Genomic  hybridization  also  confirmed  that  both  the  diploid  strains  K7EC‐  and  K9EC‐  retained a non‐disrupted URA3 locus, thus maintaining their uracil prototrophy. Nutritional prototrophy  is important for industrial yeasts as they are required to ferment substrates with highly variable nutrient  contents.    As the DUR1,2 cassette does not contain any antibiotic resistance markers, no positive selection  method  was  available  to  identify  transformants  that  carried  the  integrated  cassette;  as  a  result,  urea  degrading yeasts were initially identified by colony PCR. Screening was completed with the assistance of          83   the  co‐transforming  plasmid  pUT332  which  contains  both  the  bla  and  Tn5ble  resistance  markers  (Ampicillin  and  phleomycin,  respectively);  pUT332  was  used  in  order  to  reduce  the  number  of  transformants  that  had  to  be  screened  by  colony  PCR.  By  successive  subculturing  on  non‐selective  media,  the  plasmid  was  lost  and  this  was  confirmed  on  Southern  blots  hybridized  with  the  bla  and  Tn5ble genes (Figure 18).  Sake strains  K7EC‐ and K9EC‐  are the first metabolically engineered Sake yeast  strains  to  be  constructed  without  the  integration  of  antibiotic  resistance  markers  or  E.  coli  vector  sequences,  thus  making  them  suitable  for  commercialization;  these  strains  will  be  more  likely  to  be  accepted by consumers than strains containing antibiotic resistance marker genes or foreign DNA.    One  strand  of  the  integrated  DUR1,2  cassettes  in  K7EC‐  and  K9EC‐  was  sequenced.  Upon  comparison to previously published sequences (Coulon, et al. 2006), a single nucleotide difference was  observed  in  the  sequence  of  K9EC‐  (Table  8).  This  single  nucleotide  difference  was  localized  to  the  5’  URA3  flanking  region  of  the  cassette  and  is  likely  due  to  a  genetic  polymorphism  between  the  Sake  strain  K9  and  the  wine  strain  522.  No  differences  were  observed  in  the  DUR1,2  coding  region  or  the  PGK1 promoter and terminator signals.     Analysis of DUR1,2 expression during wine fermentation revealed that integration of the DUR1,2  cassette indeed relieves repression of DUR1,2 by NCR, as the PGK1 promoter is much stronger than the  inducible/repressible, NCR sensitive DUR1,2 promoter. DUR1,2 mRNA was approximately 10‐fold more  abundant in K7EC‐ and K9EC‐ than in their respective parent strains (Figure 20).    The global gene expression pattern of the engineered strain K7EC‐ as compared to the pattern of  the parent strain K7 was studied at 24 hours into Chardonnay must fermentation. Besides DUR1,2 (6.35‐ fold overexpression), nine genes were affected ≥ 4‐fold; thus, it is evident that integration of the DUR1,2  cassette into the genome of S. cerevisiae K7 had a minimal effect (0.15% change) on the transcription of  the 5795 ORFs (4692 verified and 1103 uncharacterized, SGD, March, 2008) in the yeast cell. One gene  of interest that was upregulated ≥ 4‐fold in K7EC‐  (Table 10) was HAC1 (4.23‐fold), a transcription factor  involved in the unfolded protein response (Cox and Walter 1996, Mori 1996, Nikawa, et al. 1996); this  response  is  likely  needed  to  support  the  increased  translation  and  folding  of  DUR1,2p  constitutively  expressed  from  the  strong  PGK1  promoter;  indeed,  HAC1  was  also  upregulated  (5.67‐fold)  in  the  engineered  strain  K7D3  which  contains  the  DUR3  gene  under  the  control  of  the  PGK1  promoter  and          84   terminator signals (Table 17). The data also suggests that no metabolic pathways were affected by the  presence of the DUR1,2 cassette integrated into K7EC‐; however, three (RME1, SSP1, SDS3) of the seven  genes  downregulated  in  K7EC‐  are  involved  in  different  aspects  of  meiosis/sporulation  (Table  10).  As  sporulation can be triggered by nutrient deficiency (Malone 1990), it is reasonable that the integration  of the DUR1,2 cassette, which results in constitutive utilization of urea as a nitrogen source, may cause  yeast cells to alter or delay their response to nutrient limitation.    4.2.2  The Sake yeasts K7EC‐ and K9EC‐ conduct efficient alcoholic fermentations     As  measures  of  substantial  equivalence,  fermentation  rates,  glucose/fructose  utilization  and  ethanol  production  was  evaluated  in  the  metabolically  engineered  strains  K7EC‐  and  K9EC‐.  Prior  to  commercialization, engineered yeasts must obtain approval from regulatory agencies such as the FDA,  Health  Canada,  and  Environment  Canada.  In  North  America,  approval  is  granted  on  the  basis  of  substantial  equivalence,  which  means  that  should  a  foodstuff  from  a  genetically  modified  organism  (GMO) be proven to be ‘as safe as’ the food produced by traditional means, then both should be treated  equally (Kessler 1992). Proof of substantial equivalence and safety for a genetically engineered organism  generally  requires  detailed  data  regarding  the  organism’s  genotype,  phenotype,  transcriptome,  proteome, and metabolome.     In  both  Chardonnay  must  and  Sake  mash,  K7EC‐  and  K9EC‐  conducted  efficient  alcoholic  fermentations (Figures 21 and 22), comparable to those of the parental strains K7 and K9; fermentations  were  completed  in  ~300  hours  in  Chardonnay  wine  and  ~500‐600  hours  in  Sake  wine.  Furthermore,  residual  glucose  and  fructose  in  Sake  wine  produced  with  K7EC‐  and  K9EC‐  (0.05,  0.010  g/L  glucose  and  0.72, 0.30 g/L fructose, respectively) and the parental strains K7 and K9 were comparable (0.06, 0.08 g/L  glucose and 0.65, 0.31 g/L fructose, respectively). All four yeasts produced similar amounts of ethanol in  Sake wine (Table 11).      4.2.3 The Sake yeasts K7EC‐ and K9EC‐ reduce EC poorly in Chardonnay wine, yet efficiently in Sake wine     The  two  functionally  enhanced  Sake  yeasts  K7EC‐  and  K9EC‐  were  evaluated  for  their  ability  to  reduce EC  content in both Chardonnay  wine and Sake wine. In Chardonnay wine, K7EC‐ and K9EC‐  were          85   ineffective in reducing EC; K7EC‐ and K9EC‐ reduced EC by 30% and 0%, respectively (Table 12). In contrast,  K7EC‐ and K9EC‐ both effectively reduced EC by 68% in Sake wine (Table 13).     During the course of Sake fermentations, yeast cells are exposed to a substantially different set  of environmental conditions and stresses than those experienced during wine fermentation.  Specialized  Sake  yeast  strains  have  been  selected  for  the  production  of  Sake  wine  (Shobayashi,  et  al.  2007)  and  fermentation conditions undoubtedly play a role in Sake yeast metabolism. While several environmental  parameters  may  play  a  role  in  explaining  the  ineffective  EC  reduction  of  Sake  strains  K7EC‐  and  K9EC‐  during Chardonnay wine making (Tables 12 and 13), the effect of yeast available nitrogen on native NCR  controlled genes is likely the predominant factor.      The type and quantity of yeast assimilable nitrogen (YAN) in Sake mash is substantially different  from grape must. Grape must of almost all varietals is usually high in free arginine and proline (Kliewer  1970). In contrast, Sake mash is rich in polypeptides that form structures known as protein bodies (PB)  (Kizaki,  et  al.  1991).    These  protein  bodies,  which  fall  into  two  major  categories  (PB‐I  and  PB‐II),  are  primarily composed of prolamins and glutelins, respectively (Hashizume, et al. 2006). During the course  of the fermentation yeast draw on the pool of free amino acids which is replenished by degradation of  PB  by  koji‐provided  acid  carboxypeptidases  and  acid  proteases  (Hashizume,  et  al.  2006;  Iemura,  et  al.  1999a; Iemura, et al. 1999b). This controlled release process, which may limit the large scale induction  of certain amino acid catabolic enzymes, functions to prevent nitrogen exhaustion (Wu, et al. 2006) and  subsequent TOR mediated transcriptional reprogramming leading to the de‐repression of NCR sensitive  genes (Cooper 2002; Hofman‐Bang 1999).    In contrast to the nitrogen available in Sake mash, yeasts draw on the large pool of free amino  acids in grape must to create biomass during fermentation. However, at approximately 2‐4 days into the  fermentation,  cells  stop  dividing  and  enter  a  stationary  growth  phase  in  which  they  ferment  actively.  While there is new evidence to suggest that ethanol stress may play a role transitioning into stationary  phase (Marks, et al. 2003; Marks, et al. 2008), the general consensus in the literature, however, is that  nitrogen  exhaustion  is  the  primary  reason  why  yeast  cells  enter  into  stationary  phase  (Hauser,  et  al.  2001;  Rossignol,  et  al.  2003;  Shobayashi,  et  al.  2007;  Wu,  et  al.  2006).  Nitrogen  exhaustion,  which  is  detected by the TOR pathway, is accompanied by large scale transcriptional changes leading to the de‐         86   repression of genes involved in the catabolism of poor nitrogen sources, including urea (Cooper 2002;  Hofman‐Bang 1999). Interestingly, the second most abundant amino acid in grape must (Kliewer 1970),  proline, is not metabolized during fermentation. Proline catabolism requires molecular oxygen and, as  fermentations  are  anaerobic,  proline  cannot  be  utilized  (Ingledew,  Magnus  and  Sosulski  1987).  Thus,  after  nitrogen  exhaustion  shifts  cells  into  stationary  phase,  the  high  concentration  of  proline  in  the  ferment  likely  reinforces,  sustains  and  strengthens  the  transcriptional  reprogramming  associated  with  NCR de‐repression.      Of particular interest to EC reduction is the de‐repression of the NCR sensitive urea amidolyase  encoding  gene  DUR1,2.  Induction  of  DUR1,2  allows  yeast  to  degrade  urea  in  an  increasingly  nitrogen  scarce  environment.  Thus,  during  the  later  stages  of  wine  fermentation,  DUR1,2  can  be  induced  and  maintained throughout the fermentation as long as yeast are starved for nitrogen. As a result, parental  strains produce less EC overall since they tend to induce DUR1,2 at the middle/end of the fermentation,  thereby  reducing  the  effectiveness  of  functionally  enhanced  clones  (Table  12).  During  Sake  brewing  however,  no  nitrogen  exhaustion  is  experienced  by  yeast  cells  and  DUR1,2,  along  with  the  other  NCR  sensitive genes, remains largely repressed, resulting in higher absolute EC values and an increase in the  effectiveness  of  the  metabolically  enhanced  yeasts  containing  the  constitutive  DUR1,2  cassette  (Table  13). Data obtained from global gene expression studies during grape wine and Sake wine fermentations  confirm that, during grape wine fermentation, the native DUR1,2 and DUR3 genes are both induced at  the transition into stationary phase (Rossignol, et al. 2003); this is consistent with nitrogen exhaustion  and subsequent transcriptional reprogramming inducing stationary phase. In Sake wine making, DUR1,2  and DUR3 are transcriptionally inactive throughout the course of fermentation (Wu, et al. 2006), which  is consistent with an adequate nitrogen supply.    Another difference between grape must and rice mash concerns osmotic stress. As a result of  the  continuous  saccharification  process  during  Sake  brewing,  (Figure  4),  yeasts  are  subjected  to  substantially  less osmotic stress during Sake fermentation than during wine fermentation  where all of  the  sugars  are  present  at  inoculation  (Takagi,  et  al.  2005;  Wu,  et  al.  2006).  This  reduced  stress  during   Sake  fermentations  is  thought  to  play  a  role  in  the  ability  of  Sake  yeasts  to  produce  up  to  20%  (w/v)  ethanol  in  Sake  wine  (Shobayashi,  et  al.  2007).  During  osmotic  stress,  yeast  cells  activate  the  ‘high  osmolarity growth’ (HOG) pathway which allows cells to survive osmotic stress via the biosynthesis and          87   intracellular  retention  of  small  molecules  such  as  trehalose  and  glycerol  (Westfall,  Ballon and  Thorner  2004).  These  molecules  help  to  offset  the  osmotic  pressure  created  by  the  high  concentration  of  extracellular  sugars  (often  20‐30%  w/v,  equimolar  amounts  of  glucose  and  fructose  in  grape  must),  which  would  otherwise  crenate  the  cells.  Although  S.  cerevisiae  has  evolved  to  tolerate  substantial  osmotic  stress,  induction  and  maintenance  of  tolerance  mechanisms  requires  significant  energy  expenditure that could otherwise be devoted to biomass creation and other metabolic processes (Wu,  et  al.  2006).  For  Sake  yeast,  which  has  evolved  in  a  niche  of  markedly  reduced  osmotic  stress,  the  osmotic  shock  in  grape  must  may  be  a  factor  in  explaining  the  poor  EC  reduction  of  engineered  Sake  strains  during  wine  making.  Specifically,  the  yeast  stress  response  tends  to  down‐regulate  translation  globally,  which  in  turn  could  decrease  the  levels  of  DUR1,2p  (Cooper  2002;  Hauser,  et  al.  2001;  Rossignol, et al. 2003).     Finally, the addition of koji to Sake fermentations plays an important role in the availability of  some vital auxiliary factors. One such factor is ergosterol, a cholesterol derivative compound present in  yeast cell membranes that is vital for ethanol tolerance (Inoue 2000). Ethanol causes rigidity of the cell  membrane  and  induces  fatal  cracks;  ergosterol,  like  cholesterol,  functions  to  decrease  the  packing  density of membrane phospholipids and increase membrane fluidity, thus counteracting the effects of  ethanol  (Inoue  2000).  Yeast  cells  require  oxygen  to  synthesize  ergosterol  (Jahnke  1983),  and  during  anaerobic  fermentations  this  dependency  on  ergosterol  may  be  a  limiting  factor  on  cell  viability  and  ethanol  production.  In  fact,  wine  fermentations  are  often  oxygenated  briefly  prior  to  or  during  fermentation  in  order  to  facilitate  the  production  of  ergosterol  (Rossignol,  et  al.  2003).  In  Sake  fermentations however, ergosterol is supplied primarily from koji which are cultured aerobically (Wu, et  al.  2006),  and  as  such  Sake  yeast  may  have  evolved  to  be  dependent  on  this  external  source  of  ergosterol.  In  fact,  Sake  yeast  strains  were  shown  to  induce  all  of  the  ergosterol  biosynthetic  genes  during the course of Sake fermentation thus indicating an unexpected shortage of ergosterol despite the  presence of koji derived ergosterol (Wu, et al. 2006).  Thus, when functionally enhanced Sake yeasts are  used to ferment grape must which is not oxygenated, the lack of ergosterol contribution from koji may  play a role in a reduction in cell health, viability and EC reduction.     Given the observed differences in the EC reduction of the functionally enhanced yeasts K7EC‐ and  K9EC‐ in grape must and Sake mash, it is imperative that, in order to gather the most relevant data, the          88   functionality  of  engineered  yeasts  be  tested  in  their  niche  environments;  this  should  prevent  the  identification of false negatives and will expedite commercialization of new strains.    4.3  Constitutive expression of the urea permease, DUR3, in yeast cells is a viable alternative method  to reduce EC in fermented alcoholic beverages    The  most  efficient  metabolically  enhanced  wine  yeast  522EC‐,  which  contains  the  DUR1,2  cassette integrated into the URA3 locus, reduced EC by 89% in Chardonnay wine (Coulon, et al. 2006). In  order  to  further  improve  EC  reduction,  we  created  yeast  strains  that  acted  as  ‘urea  sponges’,  reabsorbing any urea secreted during fermentation or urea native to the must. This goal was completed  through the constitutive expression of the urea permease DUR3 (YHL016C), a NCR sensitive gene native  to S. cerevisiae (Cooper and Sumrada 1975; ElBerry, et al. 1993; Sumrada, Gorski and Cooper 1976). Due  to the abundance of other high quality nitrogen sources during primary fermentation, there is no need  for yeast cells to actively import urea, thus the urea transporter is transcriptionally silenced. Given the  success of the constitutively expressed DUR1,2 cassette previously characterized by our group (Coulon,  et  al.  2006),  we  chose  to  utilize  similar  methodology  in  order  to  transcriptionally  activate  and  constitutively express DUR3 in wine and Sake yeasts.     4.3.1  Construction of a linear PGK1p‐DUR3‐PGK1t‐kanMX cassette for integration into the TRP1 locus  of wine and Sake yeasts    Although  constitutive  expression  of  DUR3  could  have  been  more  easily  achieved  through  an  episomal plasmid expression system, creation of a linear cassette for integration into the yeast genome  was a more attractive option. The main problem with a plasmid borne system is that without a positive  selection pressure, such as the addition of antibiotics to the must, plasmid loss in S. cerevisiae generally  occurs within 3‐5 generations (Jones, Pringle and Broach 1992) thereby reverting engineered strains to  wild  type.  Coupled  with  the  nutrient  prototrophy  of  industrial  yeasts,  positive  selection  during  winemaking  is  extremely  impractical  as  grape  must/rice  mash  is  essentially  a  ‘rich’  medium  for  yeast  growth.  Furthermore,  addition  of  antibiotics  to  the  fermentation  substrate  is  undesirable  and  negates  the  goal  of  creating  ‘self‐cloned’  yeast  strains.  Additionally,  S.  cerevisiae  is  highly  amenable  to  gene           89   uptake  and  integration  via  homologous  recombination  (Ausubel,  et  al.  1995;  Griffiths  et  al.,  2005),  making precise manipulation, replacement, and deletion of genes in the genome possible.    In order to create a linear cassette for the constitutive expression of DUR3 (Figure 25), the DUR3  ORF was placed under the control of the S. cerevisiae PGK1 promoter and terminator signals (Figure 10).  PGK1 (YCR012W) encodes 3‐phosphoglycerate kinase (EC 2.7.2.3) which is a key enzyme in the glycolytic  pathway responsible for transferring the acyl phosphate from 1,3‐bisphosphoglycerate to ADP thereby  creating one molecule of energy rich ATP (Blake 1981; Hitzeman 1980; Lam 1977). Being a key enzyme in  the ubiquitous process of glycolysis, PGK1, while technically inducible, is constitutively expressed so long  as  yeast  are  grown  in  the  presence  of  glucose  (Lam  1977).  During  both  wine  and  Sake  fermentation  glucose is abundant and cells never experience carbon exhaustion (Marks, et al. 2008; Wu, et al. 2006).  Additionally, as glycolysis is essential during fermentation (Lam 1977), placing DUR3 under the control of  PGK1 ensured constitutive expression throughout the course of fermentation.     As this section of the research was to be a proof of concept study only, the antibiotic resistance  marker  kanMX  was  used  in  order  to  simplify  the  selection  of  positive  clones  (Figure  11).  A  positive  selection marker allowed us to distinguish DUR3 clones from untransformed cells thus eliminating the  need  for  costly  and  time  consuming  colony  PCR  selection.  While  this  approach  was  suitable  for  this  study,  it  will  be  necessary  to  construct  an  antibiotic  resistance  free  cassette  similar  to  that  of  DUR1,2  when DUR3 strains are developed for commercial purposes.     In  order  to  target  the  linear  DUR3  expression  cassette  to  a  specific  locus  in  the  genome  the  PGK1p‐DUR3‐PGK1t‐kanMX  cassette  was  flanked  on  either  side  with  300  bp  of  TRP1  homology  and  successfully integrated into the TRP1 locus (Figure 13). While homologous recombination in S. cerevisiae  is  possible  in  laboratory  strains  with  as  few  as  40  nucleotides  of  flanking  homology  (Baudin  1993;  Manivasakam  1995),  we  used  300  homologous  nucleotides  on  either  end  of  the  DUR3  cassette  to  ensure efficient and specific integration into the TRP1 locus. Shorter regions of homology increases the  likelihood  that  strain  sequence  polymorphisms  will  reduce  integration  efficiency.  Efficiencies  increase  30‐ to 50‐fold when flanking sequences of several hundred base pairs in length are used (Wach 1996).              90   While the DUR3 cassette could have been integrated into any locus, the TRP1 locus was chosen  for  a  number  of  reasons.  Firstly,  TRP1  is  a  well  characterized  and  common  auxotrophic  marker  (Hampsey 1997; Mortimer 1966; Stolz 1998). Secondly, TRP1 is closely located (1 cM) to the centromere  of chromosome four (Mortimer 1966) and is thus highly stable, as genetic recombination during meiosis  is  proportional  to  a  locus’  distance  from  the  centromere  (Griffiths,  et  al.,  2005).    As  a  result  of  this  genetic stability, engineered strains would be suitable for active dry yeast production and industrial use.    Prior to integration into test strains, the DUR3 cassette in the plasmid pUCMD was sequenced  (single strand) to confirm its structure; analysis revealed that the plasmid contained all the desired DNA  fragments in the correct order and orientation (Figure 14). Furthermore, sequencing data revealed nine  single  nucleotide  changes  along  the  length  of  cassette  (Table  14  and  Figure  23);  however,  all  four  mismatches in the DUR3 coding region were silent and the deduced DUR3p was identical in amino acid  sequence  and  length  to  that  published  for  DUR3p  on  SGD.  Five  of  the  nine  base  pair  mismatches  localized  to  the  PGK1  promoter;  four  were  C  to  T  conversions.  Given  that  the  in  silico  sequence  was  assembled from single pass, single strand sequencing, the most logical explanation for the mismatches is  sequencing error. This conclusion is supported by the fact that none of the identified mismatches in the  PGK1  promoter  were  previously  reported  in  the  utilization  of  the  PGK1  promoter  for  constitutive  expression  (Coulon,  et  al.  2006;  Husnik,  et  al.  2006;  Volschenk,  et  al.  1997).  Furthermore,  during  characterization of the wine yeast ML01 (Husnik, et al. 2006), two mismatches that were found in one  copy  of  the  PGK1  promoter  were  absent  in  the  other  copy  (Husnik,  et  al.  2006),  indicating  that  the  sequence  of  the  PGK1  promoter  may  be  prone  to  sequencing  errors.  Given  that  the  integrated  DUR3  cassette was fully functional, further sequencing of the cassette to identify bona fide mismatches was  deemed non‐essential.     4.3.2    Integration  of  the  DUR3  cassette  into  the  genomes  of  K7,  K7EC‐  ,  522,  and  522EC‐  yielded  the  functional urea transporting yeasts K7D3, K7EC‐D3, 522D3,  and 522EC‐D3     Like DUR1,2, DUR3 is subject to transcriptional repression by NCR during fermentation, resulting  in  the  inability  of  S.  cerevisiae  to  re‐absorb  excreted  urea  in  the  presence  of  good  nitrogen  sources  (ElBerry, et al. 1993; Hofman‐Bang 1999). This inability to absorb excreted urea is a contributing factor in  the  production  of  wines  with  high  residual  urea,  thus  leading  to  high  EC.  In  order  to  constitutively          91   express  DUR3  throughout  fermentation,  the  DUR3  cassette  (Figure  25)  was  integrated  into  the  TRP1  locus of K7, K7EC‐  , 522, and 522EC‐, which yielded the functionally enhanced strains K7D3, K7EC‐D3, 522D3,  and  522EC‐D3  (Table  16).  The  enhanced  strains  were  genetically,  phenotypically,  and  functionally  characterized.    4.3.2.1  Integration of the DUR3 cassette into the genomes of K7D3, K7EC‐D3, 522D3, and 522EC‐D3  results  in constitutive expression of DUR3. Correct integration of the DUR3 cassette into the TRP1 locus was  confirmed by Southern blots probed with both DUR3 and TRP1 fragments. S. cerevisiae strains K7D3, K7EC‐ ,  522D3,  and  522EC‐D3  were  all  shown  to  contain  a  single  copy  of  the  ~6.5  kb  linear  DUR3  cassette   D3  integrated  in  their  TRP1  loci  (Figure  26).  Blotting  also  confirmed  that  the  diploid  strains  K7D3,  K7EC‐D3,  522D3, and 522EC‐D3 retained a non‐disrupted TRP1 locus, thus maintaining their tryptophan prototrophy  and wild type phenotype.    In  the  DUR3  cassette,  expression  of  DUR3  is  controlled  by  the  PGK1  promoter  and  terminator  signals.  As  was  previously  observed  (Section  4.2.1)  during  the  characterization  of  DUR1,2  cassette  clones, PGK1 is a strong promoter capable of driving constitutive expression under NCR conditions. To  confirm  the  constitutive  expression  of  DUR3  from  the  integrated  DUR3  cassette,  a  northern  blot  was  hybridized with a DUR3 probe; blots of K7, K7EC‐, K7D3, and K7EC‐D3 total RNA revealed strong expression  of DUR3 in K7D3 and K7EC‐D3 (Figure 29). RNA for the northern blot was isolated from cells 24 hours into a  fermentation of Chardonnay must; at 24 hours, quality nitrogen sources are still abundant and thus NCR  is still strong. Thus, under the control of the PGK1 promoter and terminator signals, DUR3 expression is  high in cells containing the integrated DUR3 cassette despite non‐inducing conditions. Quantification of  constitutive expression by qRT‐PCR revealed a 14‐ and 7‐fold increase in DUR3 mRNA at 24 hours into  Chardonnay  must  fermentations  in  K7D3  and  K7EC‐D3,  respectively  (Figure  30).  Furthermore,  high  level  expression of both DUR1,2 and DUR3 was maintained in K7EC‐D3  (12‐ and 7‐fold, respectively), which had  both  the  DUR1,2  and  DUR3  cassettes  integrated  into  its  genome.  These  data  suggest  that  K7,  and  presumably  other  strains  of  S.  cerevisiae,  is  tolerant  to  altered,  high  level  expression  of  multiple  proteins. Coupled with data confirming the functionality of both DUR1,2p (Table 21) and DUR3p (Figure  31), this result validates the metabolic engineering of S. cerevisiae for polygenic traits. In strains in which  only  one  cassette  (DUR1,2  or  DUR3)  was  integrated,  constitutive  expression  of  that  gene  induced  expression of the other gene (Figure 30). These results indicate a certain amount of cross talk between          92   the  regulatory  mechanisms  for  DUR1,2  and  DUR3.  Presumably  when  cells  are  actively  degrading  urea  instead  of  exporting  it  (constitutive  expression  of  DUR1,2),  the  urea  degradation  intermediate,  allophanate, causes induction of DUR3. Allophanate is a known inducer of all DUR genes (Cooper 1982;  Cooper 2002; Cooper and Sumrada 1975; ElBerry, et al. 1993; Hofman‐Bang 1999; Uemura, Kashiwagi  and  Igarashi  2007;  Whitney  and  Cooper  1972;  Whitney,  Cooper  and  Magasanik  1973)  and  exerts  its  effect  through  an  upstream  induction  sequence  that  binds  the  transcriptional  activators  DAL81  and  DAL82, and through an upstream activation sequence that binds the NCR GATA factor GLN3 (Hofman‐ Bang  1999).  Similarly,  when  cells  are  actively  importing  urea  (constitutive  expression  of  DUR3),  the  increased  intracellular  urea  concentration  induces  DUR1,2  expression  such  that  the  intracellular  concentration of urea can be lowered before it becomes toxic.     The global gene expression patterns of the metabolically engineered strain K7D3 and the parent  strain  K7  were  studied  at  24  hours  into  Chardonnay  must  fermentation.  Besides  DUR3  (36.95‐fold  overexpression),  seven  genes  were  affected  ≥  4‐fold;  thus,  it  is  evident  that  integration  of  the  DUR3  cassette into the genome of S. cerevisiae K7 had a minimal effect (0.1% change) on the transcription of  the 5795 ORFs (4692 verified and 1103 uncharacterized, SGD, March, 2008) in the yeast cell. One gene  that  was  upregulated  ≥  4‐fold  in  K7D3  (Table  17)  was  common  to  those  upregulated  in  the  DUR1,2  cassette  containing  engineered  strain  K7EC‐  (Table  10);  HAC1  (5.67‐fold)  encodes  a  transcription  factor  involved in the unfolded protein response and is likely needed for increased translation and folding of  DUR3 constitutively expressed from the strong PGK1 promoter. The data also suggests that no metabolic  pathways  were  affected  by  the  presence  of  the  DUR3  cassette  integrated  into  K7EC‐.  However,  integration  of  the  DUR3  cassette  into  K7D3  appears  to  have  had  some  effect  on  the  regulation  of  meiosis/sporulation,  processes  controlled  by  nutrient  deficiency  (Malone  1990).  One  gene  (FIG1)  was  upregulated  and  one  gene  (TID3)  was  downregulated  in  K7D3  (Table  17);  both  are  involved  in  meiosis/sporulation.  As  constitutive  expression  of  DUR3  results  in  increased  nitrogen  availability  it  is  reasonable that the DUR3 cassette would exert some effect on sporulation gene regulation.    4.3.2.2    The  integrated  DUR3  cassette  results  in  enhanced  urea  uptake.  In  order  to  confirm  the  production  of  a  functional  urea  permease  encoded  by  the  integrated  DUR3  cassette,  and  to  correlate  DUR3 constitutive expression with increased urea uptake, the uptake of radiolabelled urea by K7, K7EC‐,  K7D3, and K7EC‐D3 was studied. Under the conditions tested, the strains K7D3 and K7EC‐D3  were both highly          93   capable of importing 14C‐urea while K7 and K7EC‐ were unable to incorporate any appreciable amounts of  14  C‐urea  (Figure  31).  These  data  indicate  that  integration  of  the  DUR3  cassette  is  responsible  for  the   constitutive expression of an active urea permease (DUR3p) under NCR conditions.     In  the  14C‐urea  uptake  assay,  the  strains  K7,  K7EC‐,  K7D3,  and  K7EC‐D3  were  cultured  in  an  ammonium sulphate minimal medium that results in repression of all NCR sensitive genes (Cooper 1982;  Hofman‐Bang 1999). In all of the strains (K7, K7EC‐, K7D3 and K7EC‐D3) transcription of DUR3 from its native  promoter was repressed due the presence of ammonium sulphate; however in strains K7D3 and K7EC‐D3,  DUR3 was expressed despite the presence of ammonium sulphate in the medium due to the presence of  the recombinant DUR3 cassette. Given that the conditions of fermentation are largely repressive to NCR  sensitive  genes,  the  efficient  uptake  of  14C‐urea  by  K7D3  and  K7EC‐D3  in  conditions  of  strong  NCR  is  indicative of efficient EC reduction.    Despite integration of the same DUR3 cassette, K7D3 and K7EC‐D3  exhibited different rates of  14C‐ urea uptake; K7D3  was able to incorporate approximately 3‐fold more  14C‐urea than K7EC‐D3  (Figure 31).  Since there is no data or rationale to explain why K7D3 would be more efficient at urea uptake than K7EC‐ D3    , the  most  logical  explanation  is  that  the  constitutive  expression  of  DUR1,2  in  K7EC‐D3  masks  the   accumulation of  14C‐urea. In order to counteract the influx of toxic urea, K7D3 must induce transcription  of DUR1,2 and, in turn, produce functional DUR1,2p. DUR1,2 is known to be controlled at the level of  transcription (Genbauffe and Cooper 1986; Genbauffe and Cooper 1991); enzyme activity correlates well  with transcript abundance and the half‐life of DUR1,2 transcripts is the same in both the presence and  absence of an inducer (Jacobs, Dubois and Wiame 1985). In the case of K7EC‐D3, DUR1,2 is constitutively  expressed  and  the  functional  enzyme  is  capable  of  degrading  urea  as  it  is  incorporated  into  the  cell.  Thus, both K7D3 and K7EC‐D3  likely incorporate urea with equivalent efficiencies, however, this conclusion  was  not  confirmed  by  experimental  data.  The  same  masking  phenomenon  was  observed  when  comparing the uptake of 14C‐urea by K7 and K7EC‐ (Figure 32).     4.3.2.3  The metabolically engineered yeasts K7D3, K7EC‐D3, 522D3, and 522EC‐D3  ferment at similar rates  and  produce  similar  amounts  of  ethanol  in  Chardonnay  and  Sake  wine.  As  measures  of  substantial  equivalence, fermentation rate and ethanol production was evaluated in the metabolically engineered  strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3. In both Chardonnay must and Sake mash, K7D3, K7EC‐D3, 522D3,          94   and  522EC‐D3  conducted  substantially  equivalent  alcoholic  fermentations  (Figures  35  and  36).  Furthermore, the amount of ethanol produced in Chardonnay and Sake wine by K7D3, K7EC‐D3, 522D3, and  522EC‐D3  was shown to be similar (Tables 18 and 19). These results indicate that the K7D3, K7EC‐D3, 522D3,  and 522EC‐D3 strains are suitable for commercialization from a fermentation standpoint.    4.3.2.4  Variability of metabolically engineered yeasts to effectively reduce EC in Chardonnay wine and  in Sake wine. In order to assess the EC reduction potential of the engineered strains K7D3, K7EC‐D3, 522D3,  and 522EC‐D3,  fermentations of both Chardonnay must and Sake rice mash were conducted after which  the EC content of the resultant wines was quantified. Consistent with prior observations of K7EC‐ (Section  4.2.2),  EC  reduction  by  K7EC‐  in  Chardonnay  wine  was  inefficient  (6.85%  ‐  Table  20)  due  to  low  EC  production  by  the  parental  strain  K7.  As  expected,  production  of  Sake  wine  with  K7EC‐  yielded  highly  efficient  EC  reduction  (87%  ‐  Table  21).  Furthermore,  522EC‐  was  effective  at  reducing  EC  in  both  Chardonnay wine and Sake wine (81% and 84%, respectively ‐ Tables 20 and 21).     In  Chardonnay  wine,  K7D3  and  522D3  reduced  EC  as  efficiently  as  K7EC‐  and  522EC‐,  respectively  (Table 20); both K7D3 and K7EC‐ reduced EC by ~10% while 522D3 and 522EC‐ both reduced EC by ~81%. The  observed equivalency in EC reduction is likely a function of the need for cells to degrade urea once it is  internalized,  as  urea  is  toxic  to  cells  at  high  concentrations.  Presumably,  the  3.6‐fold  induction  of  DUR1,2  observed  in  K7D3  (Figure  30),  coupled  with  constitutive  urea  import,  is  responsible  for  the  strain’s  ability  to  reduce  EC  as  efficiently  as  K7EC‐.  Despite  the  lack  of  gene  expression  data,  the  same  rationale is likely responsible for the reduction of EC in Chardonnay wine by 522D3. These data suggest  that K7 and 522 are highly sensitive to changes in the expression of genes involved in urea metabolism  and  that  engineering  yeasts  to  induce  large  scale  expression  changes  (greater  than  5‐fold)  may  be  unnecessary.  Furthermore,  these  data  are  important  because  they  validate  the  application  of  DUR3  constitutive  expression  for  the  reduction  of  EC  in  grape  wine,  specifically  in  wine  derived  from  musts  with high endogenous urea. In such cases, EC reduction would likely be greatest in wine fermented by  urea importing yeasts (DUR3 cassette) rather than urea degrading yeasts (DUR1,2 cassette).         In  Sake  wine,  K7D3  and  522D3  were  much  less  effective  in  reducing  EC  than  their  DUR1,2  counterparts K7EC‐ and 522EC‐ (Table 21). These results can be explained by the requirements for DUR1,2  expression in S. cerevisiae (Figure 37). In a system analogous to the well characterized lac operon in E.          95   coli,  NCR  in  S.  cerevisiae  functions  to  force  cells  to  metabolize  the  most  energetically  favourable  nutrients. As such, expression of NCR regulated genes is highly dependent on two conditions being met:  the presence of an inducer and the presence of an NCR associated transcriptional activator like GLN3.  Indeed,  expression  of  DUR1,2  was  shown  to  be  highly  dependent  on  GLN3  under  induced  conditions  (Cooper, et al. 1990). Likewise, DUR1,2 expression on a proline medium (no NCR – GLN3 active) was very  low  without  an  inducer  present  (Cooper,  et  al.  1990).  As  discussed  previously  (Section  4.2.3),  fermentations  of  grape  must  can  be  subject  to  nitrogen  exhaustion  and  thus  yeasts  may  undergo  transcriptional  de‐repression  of  NCR  sensitive  genes  i.e.  GLN3  becomes  activated.  During  Chardonnay  must  fermentation  K7D3  and  522D3  constitutively  imported  urea  thus  fulfilling  the  inducer  requirement  for  DUR1,2  expression.  Upon  nitrogen  limitation,  transcriptional  reprogramming  likely  activated  GLN3  and,  because  of  the  constitutive  presence  of  urea,  DUR1,2  was  induced  enabling  K7D3  and  522D3  to  degrade urea and reduce  EC. In  contrast, fermentations of Sake rice mash are not subject to nitrogen  exhaustion  due  to  the  presence  of  koji  enzymes  and  rice  protein  bodies.  Although  K7D3  and  522D3  still  constitutively  imported  urea  during  Sake  fermentations,  GLN3  remained  inactive  due  to  a  plentiful  supply  of  good  nitrogen.  Thus,  without  satisfying  both  conditions  for  transcriptional  activation,  the  native  DUR1,2  genes  remained  repressed  in  K7D3  and  522D3  and  constitutively  absorbed  urea  likely  diffused back out of the cell, where it could form EC in the resultant Sake wine. Indeed, the facilitated  diffusion system for urea (DUR4), which allows leakage from the cell, is energy independent, insensitive  to NCR, and present in cells growing in the absence of any inducer (Cooper and Sumrada 1975).             96   Minimal leakage of urea    Figure 37. Schematic representation of inducible DUR1,2 expression during Chardonnay and Sake wine  fermentation  by  a  urea  importing  yeast  strain.  During  Chardonnay  fermentation  partial  activation  of  GLN3  coupled  with  the  constitutive  presence  of  the  inducer  allows  for  expression  of  DUR1,2  and  reduction of EC. Despite the constitutive presence of the inducer, constant NCR maintains repression of  DUR1,2 during Sake fermentations and constitutively imported urea is allowed to leak from the cell and  form EC.    While Figure 37 explains the most likely reason for the inability of K7D3  and 522D3  to reduce EC  efficiently  in  Sake  wine,  there  may  be  other  minor  issues.  Firstly,  yeast  growth  in  rice  mash  may  influence  the  degree  of  protein  mistargeting,  a  common  problem  for  membrane  protein  over  expression.  Unlike  soluble  proteins,  which  are  translated  and  kept  in  the  cytosol,  membrane  proteins  must navigate the protein trafficking system which, consequently, is subject to a number of rate limiting  steps  (Reviewed  in  Wagner,  et  al.  2006).  In  eukaryotes,  membrane  protein  production  begins  on  the  rough  endoplasmic  reticulum  (ER)  where  ribosomes  bound  to  ER  translate  proteins  which  are  immediately  translocated  into  the  ER  lumen  (Wagner,  et  al.  2006).  From  there,  proteins  can  begin  to  undergo a variety of post‐translational modifications (most commonly glycosylation) and quality control  checks (Wagner, et al. 2006). Proteins leave the ER by means of COPII coated vesicles that travel along  microtubules  through  the  cis‐,  mid‐  and  trans‐  Golgi  apparatus  before  being  excreted  into  the  plasma  membrane via additional vesicles (Wagner, et al. 2006). Since protein trafficking machinery is limited in  its  speed  and  efficiency,  and  must  be  shared  with  other  essential  membrane  proteins,  excess          97   overexpressed  protein  often  backs  up  (Wagner,  et  al.  2006).  Such  backups  are  often  dealt  with  via  ubiquitin‐proteasome  mediated  degradation  (Wagner,  et  al.  2006),  or,  as  more  often  the  case  in  S.  cerevisiae, excess protein is diverted to the vacuole where it is either stored or degraded (Wagner, et al.  2006). Although expressed from a high copy plasmid rather than an integrated cassette, a recent study  of  the  polyamine  transport  function  of  DUR3p  reported  significant  amounts  of  over  expressed  DUR3p  localizing  to  the  vacuole  suggesting  a  high  degree  of  degradation  (Uemura,  Kashiwagi  and  Igarashi  2007).  This  result  was  subsequently  confirmed  by  another  study  looking  at  optimizing  S.  cerevisiae  membrane protein over expression (Newstead, et al. 2007). Thus, if cell growth in rice mash increases  DUR3p  mistargeting  relative  to  growth  in  grape  must,  or,  more  likely,  if  cell  survival  in  Sake  wine  (perhaps due to high ethanol stress and low osmotic stress) requires the expression of a greater number  of  membrane  proteins,  the  amount  of  functional  DUR3p  would  be  diminished,  thus  lowering  the  EC  reduction ability.     Finally, Sake brewing may change the primary physiological role of DUR3p. As noted previously  DUR3p  is  primarily  an  active  transporter  of  urea,  however  it  has  also  been  shown  to  be  involved  in  boron  transport  (Nozawa,  et  al.  2006)  and  polyamine  uptake  (Uemura,  Kashiwagi  and  Igarashi  2007).  While little is known about boron’s role in fermentation, polyamines have been shown to be crucial for  cell  growth  (Tabor  and  Tabor  1999);  polyamine  levels  are  elevated  in  actively  growing  cells  (Monteiro  and  Bisson  1992).  Polyamines  may  be  especially  important  for  growth  in  the  substantially  different  nutrient environment of rice mash; thus, during Sake brewing,  an increased  need for polyamines, and  perhaps boron, may decrease the amount of over expressed DUR3p available for urea uptake, thereby  lowering EC reduction ability.    4.3.2.5    The  metabolically  engineered  yeasts  K7EC‐D3  and  522EC‐D3  do  not  reduce  EC  more  effectively  than  K7EC‐  and  522EC‐  or  K7D3  and  522D3  in  either  Chardonnay  or  Sake  wine.  The  effect  of  both  the  DUR1,2 and DUR3 cassettes on EC reduction was evaluated in Chardonnay and Sake wine. Strains K7EC‐D3  and 522EC‐D3 were not capable of producing Chardonnay or Sake wine with less EC than K7EC‐ and 522EC‐ or  K7D3  and 522D3  (Tables 20 and 21). Thus, it seems that constitutive expression of both DUR1,2 and DUR3  offers  no  synergistic  advantage  over  the  constitutive  expression  of  either  gene  alone  and  that,  in  the  case of metabolic engineering of S. cerevisiae to reduce EC in wine, it is prudent to limit engineering to           98   one  gene.  Yeast  strains  constitutively  expressing  only  a  single  gene  are  logistically  and  functionally  simpler, more cost effective, and can more expediently receive regulatory approval.    Data  from  this  study  suggested  that  in  K7EC‐D3,  which  has  both  cassettes  integrated,  high  level  expression  of  both  DUR1,2  and  DUR3  was  maintained  (Figure  30),  and  that  both  cassettes  produce  functional enzymes (Figure 31). Moreover, urea degrading and urea importing yeast strains (integration  of  the  DUR1,2  and  DUR3  cassettes,  respectively)  each  reduce  EC  by  up  to  90%  (Tables  20  and  21);  however,  the  lack  of  synergistic  EC  reduction  in  strains  constitutively  co‐expressing  DUR1,2  and  DUR3  suggests the presence of confounding factors which must still be investigated. One such factor may be  the induction of the native copies of DUR3 in the engineered strains at or near the end of fermentation.  If and when, at the end of fermentation, yeasts are subject to nitrogen exhaustion, the de‐repression of  NCR may result in the expression of DUR3; if the level of DUR3 expression from the native promoter is  equal or near equal to that of expression from the PGK1 promoter then it follows that integration of the  DUR3 cassette should not confer any advantage in terms of urea uptake and EC reduction. To test this  hypothesis, the ability for yeasts to uptake urea under conditions of NCR de‐repression was examined  (Figures  33  and  34).  These  14C‐uptake  assays  were  completed  in  an  L‐proline  minimal  medium  to  simulate conditions of NCR de‐repression. Proline has long been recognized as a poor quality nitrogen  source  for  yeast  (Hofman‐Bang  1999;  Ingledew,  Magnus  and  Sosulski  1987).  Under  de‐repressive  conditions, uptake of urea by the parental strain K7 and the engineered strains K7EC‐, K7D3, and K7EC‐D3  largely mimicked uptake under repressive conditions (Figures 31 and 33). Both K7D3 and K7EC‐D3, which  contained the integrated DUR3 cassette, were highly capable of incorporating  14C‐urea while the strains  that  did  not  contain  the  DUR3  cassette,  K7  and  K7EC‐,  were  unable  to  incorporate  any  appreciable  amounts  of  urea  (Figure  33)  indicating  that  constitutive  expression  of  DUR3  from  the  PGK1  promoter  and  terminator  signals  does  indeed  confer  an  advantage  to  engineered  yeast  cells  in  terms  of  urea  uptake.  Furthermore,  data  obtained  from  global  gene  expression  studies  during  grape  wine  and  Sake  wine fermentations confirm that during grape wine fermentation DUR3 is only induced during nitrogen  exhaustion  (Rossignol,  et  al.  2003).  Moreover,  during  Sake  wine  making,  DUR3  is  transcriptionally  inactive throughout the  course of fermentation  (Wu, et al. 2006). Taken together, these data indicate  that expression of DUR3 from its native promoter is not likely to be a significant reason for the lack of  synergistic EC reduction in engineered strains that constitutively import and degrade urea. Although the  de‐repressive conditions of the assay permitted full induction of native DUR3, the reason for poor urea          99   uptake in K7 and K7EC‐ may be the use of stationary phase cells for the assay. In order to express DUR3  from  its  native  promoter,  both  an  inducer  must  be  present  (urea)  and  NCR  must  be  de‐repressed  (Hofman‐Bang  1999).  Despite  the  de‐repression  of  NCR,  the  cells  were  grown  in  the  absence  of  an  inducer  thus  maintaining  low‐level  DUR3  expression;  only  when  cells  were  exposed  to  14C‐urea  were  both conditions for DUR3 expression met.     In  grape  wine  and  Sake  wine,  the  major  contributor  to  EC  is  urea  along  with  ethanol.  Post‐ fermentation  treatment  of  wine  and  Sake  with  an  acid  urease  resulted  in  significant  reduction  of  EC  (Ough and Trioli 1988); moreover, fermentation of Sake rice mash with CAR1 deficient yeast strains has  been  shown  to  produce  Sake  wine  with  no  detectable  urea  or  EC  (Kitamoto,  et  al.  1991;  Yoshiuchi,  Watanabe  and  Nishimura  2000).  These  studies  provide  strong  evidence  that  the  most  important  precursor  for  EC  is  urea  derived  from  CAR1  mediated  arginine  degradation;  however,  in  certain  circumstances,  such  as  wine  that  has  undergone  a  MLF,  a  certain  percentage  of  EC  could  be  derived  from alternate sources. While  this rationale would explain a lack  of synergistic EC reduction in a wine  that had undergone MLF, it fails to explain the results of this study.    Besides  urea,  a  number  of  other  compounds  have  been  implicated  in  the  formation  of  EC.  Carbamyl phosphate and citrulline are known to react with ethanol and form EC (Matsudo 1993; Ough  1976b);  however,  while  they  have  been  detected,  carbamyl  phosphate  and  citrulline  are  not  usually  found in grape or Sake wine (Ough, Crowell and Gutlove 1988). Citrulline and carbamyl phosphate are  by‐products  of  arginine  metabolism  in  lactic  acid  bacteria  and  are  only  found  in  wines  that  have  undergone  MLF;  in  lactic  acid  bacteria  arginine  is  metabolized  via  the  arginine  deiminase  pathway  in  which  arginine  is  degraded  to  citrulline  which  is  then  degraded  to  ornithine  and  carbamyl  phosphate  (Liu, et al. 1994). Utilization of the metabolically engineered yeast strain ML01, which conducts parallel  alcoholic and malolactic fermentations without the addition of lactic acid bacteria (Husnik, et al. 2006),  could help reduce EC in certain applications. In stone fruit spirits such as fruit brandies, amygdalin from  the stone has been shown to degrade into cyanide during fermentation, the oxidized form (cyannate) of  which reacts with ethanol to form EC (Schehl 2007). Finally, a number of other compounds, such as N‐ carbamyl  α‐amino  acids,  N‐carbamyl  β‐amino  acids,  and  allantoin  (by‐product  of  purine  degradation)  have been shown to react with ethanol and form EC (Ough, Crowell and Gutlove 1988); however, the  contribution of these compounds to EC in alcoholic beverages has yet to be substantiated.           100   5  CONCLUSIONS    Amongst  other  reasons,  increased  awareness  surrounding  the  health  benefits  of  wine  consumption  has  caused  the  popularity  of  wine  to  grow  worldwide.  Wine,  and  in  particular  red  wine,  has been shown to help prevent cardiovascular disease, dietary cancers, diabetes, hypertension, peptic  users, and macular degeneration, amongst others (Bisson 2002). Along with a growing appreciation for  the  benefits  of  alcoholic  beverage  consumption,  consumers  have  become  increasingly  conscious  of  consumption  risks  and  therefore  have  begun  to  demand  increasingly  safe  products.    This  mindset  echoes  beyond  alcoholic  beverages  and  is  highlighted  by  the  prevalence  of  recent  food  safety  issues  including mad cow disease, pesticide usage, heavy metal contamination, E. coli O157:H7, GMO corn, and  other  GMO  crops.  Of  particular  concern  to  this  study  is  the  increasing  recognition  of  EC,  a  naturally  occurring and well characterized carcinogen found in wine, Sake, and many other yeast fermented foods  and beverages. Indeed, winemakers and governments have become progressively more cognisant of the  widespread prevalence of the EC problem. Spearheaded by the FDA and the University of California at  Davis’ Department of Enology and Viticulture (Butzke and Bisson 1998), action manuals and data have  been  complied  concerning  a  wide  range  of  EC  reduction  techniques.  Until  recently,  none  of  the  techniques  employed  have  been  highly  effective  due  to  low  efficacy,  high  cost,  or  lengthened  production  time.  However,  in  2006  our  group  developed  a  substantially  equivalent,  self‐cloned,  FDA  approved, industrial wine yeast (522EC‐) capable of reducing EC in Chardonnay wine by 89%. The amount  of EC in wines is proportional to residual urea, thus making EC reduction a matter of eliminating residual  urea at the end of alcoholic fermentation. S. cerevisiae strain 522EC‐ is capable of reducing EC by 89% due  to  constitutive  expression  of  urea  amidolyase  (DUR1,2)  which  degrades  urea  to  ammonia  and  carbon  dioxide;  the  native  copy  of  this  gene  is  normally  transcriptionally  silent  in  fermentations  with  rich  nitrogen supplies thus resulting in wines with high residual urea and thus high EC .    Numerous industrial strains of S. cerevisiae exist around the world, each filling an environmental  niche. Arising from growth on different nutrient sources, strains have developed different fermentative  properties  and,  as  such,  are  uniquely  suited  to  fermentation  of  different  substrates.  However,  EC  is  a  pervasive problem in all types of alcoholic fermentation and, as a result, EC reduction is important in all  yeast  strains.  The  self‐cloned  Sake  yeast  strains  K7EC‐  and  K9EC‐  containing  the  constitutively  expressed  DUR1,2  cassette,  were  ineffective  when  tested  in  wine  making  trials;  however,  K7EC‐  and  K9EC‐  were          101   highly capable of EC reduction during Sake brewing trials. Thus, it is clear that certain yeast strains are  uniquely  adapted  to  specific  niches  and  that  they  are  not  optimally  functional  in  other  niches.  The  functionality of enhanced yeast strains must therefore be assessed in their native environment in order  to most accurately gauge performance and avoid the identification of false negatives.    In an effort to further reduce EC levels beyond the capability of DUR1,2 technology, this study  was also focused on the creation of substantially equivalent, self‐cloned, industrial wine yeasts capable  of constitutive urea import. In order to create the industrial strains K7D3, K7EC‐D3, 522D3, and 522EC‐D3 the  S. cerevisiae urea permease (DUR3) was expressed under the control of the S. cerevisiae PGK1 promoter  and  terminator  signals  and  integrated  into  the  TRP1  locus  of  the  relevant  parental  strains.  DNA  sequencing confirmed that the recombinant cassette contained no deleterious mutations or amino acid  substitutions.  Furthermore,  Southern  blotting  confirmed  proper  cassette  integration  into  the  target  TRP1 locus. Constitutive expression of DUR3 was confirmed by northern blotting and quantified by qRT‐ PCR. Global gene expression analysis indicated that the integration of the DUR3 cassette had a minimal  impact on the transcriptome of S. cerevisiae and that no major metabolic pathways were affected by the  presence  of  the  DUR3  cassette.  Urea  import  studies  using  14C‐urea  indicated  that  DUR3  cassette  containing  strains  indeed  express  functional  DUR3p  and  that  this  functionality  is  preserved  when  DUR1,2  and  DUR3  are  constitutively  co‐expressed.  Comparisons  of  small  scale  Chardonnay  and  Sake  wine  making  demonstrated  that,  although  constitutive  co‐expression  of  DUR1,2  and  DUR3  does  not  yield  synergistic  EC  reduction  in  Chardonnay  or  Sake  wine,  constitutive  expression  of  DUR3  alone  is  capable of reducing EC as efficiently as constitutive expression of DUR1,2 in Chardonnay wine yet not in  Sake  wine.  Thus,  in  grape  wine  making  applications,  and  specifically  in  musts  which  contain  high  endogenous  urea, DUR3  constitutive expression is  an important, valuable, and alternative  strategy for  EC reduction. A provisional patent has been filed concerning the constitutive expression of DUR3 in S.  cerevisiae for the reduction of EC in grape wine. Furthermore, all of the DUR3 expressing strains can be  constructed by self‐cloned means, and thus would be more acceptable both worldwide due to their non‐ transgenic  nature,  and  in  countries  such  as  Germany  and  Japan  where  self‐cloned  organisms  are  not  considered as GMO’s.                 102   5.1  Future Directions    As a result of this study and previous work by our group (Coulon, et al. 2006), winemakers now  have highly effective methods for EC reduction at their fingertips; however, several topics still require  investigation.  Firstly,  in  order  to  facilitate  the  commercialization  of  yeast  strains  constitutively  expressing  DUR3,  a  cassette  must  be  developed  which  does  not  contain  any  antibiotic  resistance  markers.  Secondly,  experiments  should  be  done  in  order  to  confirm  which  of  the  potential  causes  discussed  in  Section  4.3.2.4  are  responsible  for  the  constitutive  expression  of  DUR3  not  reducing  EC  efficiently  in  Sake  wine  as  it  does  in  Chardonnay  wine;  answering  this  question  may  allow  for  the  subsequent  adaptation  of  DUR3  technology  to  Sake  making.  Thirdly,  the  development  of  alternative  methods  of  EC  reduction  would  prove  to  be  useful  in  further  reducing  EC  beyond  90%  thus  making  wines and spirits safer for consumers. Moreover, as urea and EC production by different strains is highly  variable,  studies  into  the  molecular  mechanisms  behind  these  variations  will  aid  scientists  and  winemakers in engineering new strains or selecting natural strains which produce little or no EC. Finally,  it  is  imperative  that,  before  the  yeasts  can  be  commercialized,  the  proteome  and  metabolome  of  the  metabolically  enhanced  yeast  strains  described  here  be  characterized  as  to  establish  substantial  equivalence.               103   REFERENCES  Ashby,  J.  (1991)  Genotoxicity  data  supporting  the  proposed  metabolic  activation  of  ethyl  carbamate  (urethane) to a carcinogen: the problem now posed by methyl carbamate. Mutat. Res. 260, 307‐ 308.  Ausubel,  F.M.,  Brent,  R.,  Kingston,  R.E.,  Moore,  D.D.,  Seidman,  J.G.,  Smith,  J.A.  and  Struhl,  K.  (1995)  Short Protocols in Molecular Biology, 3rd ed., John Wiley & Sons, Inc., Boston, USA.  Baudin,  A.  (1993)  A  simple  and  efficient  method  for  direct  gene  deletion  in  Saccharomyces  cerevisiae.  Nucl. Acids Res. 21, 3329‐3330.  Bisson, L.F. (2002) The present and future of the international wine industry. Nature 418, 696‐699.  Blake, C. C. (1981) Phosphoglycerate kinase. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 293, 93‐104.  Bond,  U.,  Neal,  C.,  Donnelly,  D.  and  James,  T.  (2004)  Aneuploidy  and  copy  number  breakpoints  in  the  genome of lager yeasts mapped by microarray hybridisation. Curr. Genet. 45, 360‐370.  Bruckner,  R.  and  Titgemeyer,  F.  (2002)  Carbon  catabolite  repression  in  bacteria:  choice  of  the  carbon  source and autoregulatory limitation of sugar utilization. FEMS Microbiol. Lett. 209, 141‐148.  Butzke,  C.E.  and  Bisson,  L.F.  (1998)  Ethyl  Carbamate  Preventative  Action  Manual.  2008.  (http://www.cfsan.fda.gov/~frf/ecaction.html).  Bysani,  N.,  Daugherty,  J.  R.  and  Cooper,  T.  G.  (1991)  Saturation  mutagenesis  of  the  UASNTR  (GATAA)  responsible for nitrogen catabolite repression‐sensitive transcriptional activation of the allantoin  pathway genes in Saccharomyces cerevisiae. J. Bacteriol. 173, 4977‐4982.  Canas, B. J., Havery, D. C., Robinson, L. R., Sullivan, M. P., Joe, F. L., Jr and Diachenko, G. W. (1989) Ethyl  carbamate levels in selected fermented foods and beverages. J. Assoc. Off. Anal. Chem. 72, 873‐ 876.           104   Cooper,  T.  G.  (1982)  Nitrogen  metabolism  in  S.  cerevisiae;  in  The  molecular  biology  of  the  yeast:  metabolism and gene expression. J.N. Strathern, E.W. Jones (ed.), pp. 39‐99, Cold Spring Harbor  Press, New York.  Cooper, T. G. (2002) Transmitting the signal of excess nitrogen in Saccharomyces cerevisiae from the Tor  proteins to the GATA factors: connecting the dots. FEMS Microbiol. Rev. 26, 223‐238.  Cooper,  T.  G.,  Ferguson,  D.,  Rai,  R.  and  Bysani,  N.  (1990)  The  GLN3  gene  product  is  required  for  transcriptional  activation  of  allantoin  system  gene  expression  in  Saccharomyces  cerevisiae.  J.  Bacteriol. 172, 1014‐1018.  Cooper, T. G. and Sumrada, R. (1975) Urea transport in Saccharomyces cerevisiae. J. Bacteriol. 121, 571‐ 576.  Coulon, J., Husnik, J. I., Inglis, D. L., van der Merwe, G. K., Lonvaud, A., Erasmus, D. J. and van Vuuren, H.  J.  J.  (2006)  Metabolic  Engineering  of  Saccharomyces  cerevisiae  to  Minimize  the  Production  of  Ethyl Carbamate in Wine. Am. J. Enol. Vitic. 57, 113‐124.  Cox, J. S. and Walter, P. (1996) A Novel Mechanism for Regulating Activity of a Transcription Factor That  Controls the Unfolded Protein Response. Cell, 87, 391‐404.  Cox, K. H., Rai, R., Distler, M., Daugherty, J. R., Coffman, J. A. and Cooper, T. G. (2000) Saccharomyces  cerevisiae GATA sequences function as TATA elements during nitrogen catabolite repression and  when Gln3p is excluded from the nucleus by overproduction of Ure2p. J. Biol. Chem. 275, 17611‐ 17618.  Cox,  K.  H.,  Kulkarni,  A.,  Tate,  J.  J.  and  Cooper,  T.  G.  (2004)  Gln3  Phosphorylation  and  Intracellular  Localization  in  Nutrient  Limitation  and  Starvation  Differ  from  Those  Generated  by  Rapamycin  Inhibition of Tor1/2 in Saccharomyces cerevisiae. J. Biol. Chem. 279, 10270‐10278.  Dahl,  G.,  Miller,  J.  and  Miller,  E.  (1978)  Vinyl  carbamate  as  a  promutagen  and  a  more  carcinogenic  analog of ethyl carbamate. Cancer Res. 38, 3793‐3804.           105   Dann, S. G. and Thomas, G. (2006) The amino acid sensitive TOR pathway from yeast to mammals. FEBS  Letters 580, 2821‐2829.  De Virgilio, C. and Loewith, R. (2006) The TOR signalling network from yeast to man. Int. J. Biochem. Cell  Bio. 38, 1476‐1481.  Dohmen, R. J. and Varshavsky, A. (2005) Heat‐inducible degron and the making of conditional mutants.  Methods Enzymol. 399, 799‐822.  Dunn, B., Levine, R. P. and Sherlock, G. (2005) Microarray karyotyping of commercial wine yeast strains  reveals shared, as well as unique, genomic signatures. BMC Genomics 6, 53‐74.  Eckhardt, T. (1978) A rapid method for the identification of plasmid desoxyribonucleic acid in bacteria.  Plasmid 1, 584‐588.  ElBerry, H. M., Majumdar, M. L., Cunningham, T. S., Sumrada, R. A. and Cooper, T. G. (1993) Regulation  of the urea active transporter gene (DUR3) in Saccharomyces cerevisiae. J. Bacteriol. 175, 4688‐ 4698.  Farrell A., E., Plevin R., J., Turner B., T., Jones A., D., O'Hare, M. and Kammen D., M. (2006) Ethanol Can  Contribute to Energy and Environmental Goals. Science 311, 506‐508.  Gancedo , J. M. (1992) Carbon catabolite repression in yeast. Eur. J. Biochem.  206, 297‐313.  Gatignol, A. (1987) Phleomycin resistance encoded by the ble gene from transposon Tn 5 as a dominant  selectable marker in Saccharomyces cerevisiae. Mol. Gen. Genetics 207, 342‐348.  Genbauffe,  F.  S.  and  Cooper,  T.  G.  (1991)  The  urea  amidolyase  (DUR1,2)  gene  of  Saccharomyces  cerevisiae. DNA Seq. 2, 19‐32.  Genbauffe,  F.  S.  and  Cooper,  T.  G.  (1986)  Induction  and  repression  of  the  urea  amidolyase  gene  in  Saccharomyces cerevisiae. Mol. Cell. Biol. 6, 3954‐3964.  Gietz, R. D. and Woods, R. A. (2002) Transformation of yeast by lithium acetate/single‐stranded carrier       DNA/polyethylene glycol method. Methods Enzymol. 350, 87‐96.     106   Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J. D.,  Jacq, C., Johnston, M., Louis, E.  J.,  Mewes, H. W., Murakami, Y.,  Philippsen, P., Tettelin,  H.  and  Oliver, S. G. (1996) Life with 6000 Genes. Science 274, 546‐567.  Goode,  J.  (2005)  The  Science  of  Wine:  From  Vine  to  Glass,  University  of  California  Press,  Berkley,  California.  Greig, D. and Travisano, M. (2003) Evolution: Haploid Superiority. Science 299, 524‐525.  Griffiths,  A.  J.  F.,  Miller,  J.  H.,  Suzuki,  D.  T.,  Lewontin,  R.  C.,  and  Gelbart,  W.  M.  (2005)   An Introduction to Genetic Analysis. Eight ed., W. H. Freeman, New York, USA.  Guengerich, F. P. and Kim, D. H. (1991) Enzymatic oxidation of ethyl carbamate to vinyl carbamate and  its role as an intermediate in the formation of 1,N6‐ethenoadenosine. Chem. Res. Toxicol. 4, 413‐ 421.  Guldener, U., Heck, S., Fielder, T., Beinhauer, J. and Hegemann, J. (1996) A new efficient gene disruption  cassette for repeated use in budding yeast. Nucl. Acids Res. 24, 2519‐2524.  Hampsey, M. (1997) A review of phenotypes in Saccharomyces cerevisiae. Yeast 13, 1099‐1133.  Han,  J.,  Lee,  J.,  Bibbs,  L.  and  Ulevitch,  R.  (1994)  A  MAP  kinase  targeted  by  endotoxin  and  hyperosmolarity in mammalian cells. Science 265, 808‐811.  Hashizume, K., Okuda, M., Sakurao, S., Numata, M., Koseki, T., Aramaki, I., Kumamaru, T. and Sato, H.  (2006) Rice protein digestion by sake koji enzymes: comparison between steamed rice grains and  isolated protein bodies from rice endosperm. J. Biosci. Bioeng. 102, 340‐345.  Hauser,  N.,  Fellenberg,  R.,  Gil,  R.,  Bastuk,  S.,  Hoheisel,  J.  and  Perez‐Ortin,  J.  (2001)  Whole  genome  analysis of a wine yeast strain. Comp. Funct. Genomics 2, 69‐79.  Herskowitz, I. (1988) Life cycle of the budding yeast Saccharomyces cerevisiae. Microbiol. Rev. 52, 536‐ 553.           107   Hitzeman, R. A. (1980) Isolation and characterization of the yeast 3‐phosphoglycerokinase gene (PGK) by  an immunological screening technique. J. Biol. Chem. 255, 12073‐12080.  Hofman‐Bang, J. (1999) Nitrogen catabolite repression in Saccharomyces cerevisiae. Mol. Biotechnol. 12,  35‐73.  Hughes, T., Roberts, C., Dai, H., Jones, A., Meyer, M., Slade, D., Burchard, J., Dow, S., Ward, T., Kidd, M.,  Friend, S. and Marton, M. (2000) Widespread aneuploidy revealed by DNA microarray expression  profiling. Nat. Genet. 25, 333‐337.  Husnik,  J.  I.,  Volschenk,  H.,  Bauer,  J.,  Colavizza,  D.,  Luo,  Z.  and  van  Vuuren,  H.  J.  J.  (2006)  Metabolic  engineering of malolactic wine yeast. Metabol. Eng. 8, 315‐323.  Iemura,  Y.,  Takahashi,  T.,  Yamada,  T.,  Furukawa,  K.  and  Hara,  S.  (1999a)  Properties  of  TCA‐Insoluble  peptides in Kimoto (traditional seed mash for sake brewing) and conditions for liberation of the  peptides from rice protein. J. Biosci. Bioeng. 88, 531‐535.  Iemura,  Y.,  Yamada,  T.,  Takahashi,  T.,  Furukawa,  K.  and  Hara,  S.  (1999b)  Properties  of  the  peptides  liberated from rice protein in Sokujo‐moto. J. Biosci. Bioeng. 88, 276‐280.  Ingledew, W. M., Magnus, C. A. and Patterson, J. R. (1987) Yeast Foods and Ethyl Carbamate Formation  in Wine. Am. J. Enol. Vitic. 38, 332‐335.  Ingledew,  W.  M.,  Magnus,  C.  A.  and  Sosulski,  F.  W.  (1987)  Influence  of  Oxygen  on  Proline  Utilization  During the Wine Fermentation. Am. J. Enol. Vitic. 38, 246‐248.  Inoue,T  .  (2000)  Cloning  and  Characterization  of  a  Gene  Complementing  the  Mutation  of  an  Ethanol‐ sensitive Mutant of Sake Yeast. Biosci. Biotech. Biochem. 64, 229‐236.  Jacobs, E., Dubois, E. and Wiame, J. M. (1985) Regulation of urea amidolyase synthesis in Saccharomyces  cerevisiae, RNA analysis, and cloning of the positive regulatory gene DURM. Curr. Genet. 9, 333‐ 339.           108   Jahnke,  L.  (1983)  Oxygen  requirements  for  formation  and  activity  of  the  squalene  epoxidase  in  Saccharomyces cerevisiae. J. Bacteriol  155, 488‐492.  Jones  E.  W.,  Pringle  J.  R.,  Broach  J.  R.  (1992)  The  Molecular  and  Cellular  Biology  of  the  Yeast  Saccharomyces, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA.   Kessler, D. A. (1992) The safety of foods developed by biotechnology. Science 256, 1747‐1749.  Kinzy,  T.  G.  (1994)  Multiple  genes  encode  the  translation  elongation  factor  EF‐1  gamma  in  Saccharomyces cerevisiae. Nucl. Acids Res. 22, 2703‐2707.  Kitamoto, K., Oda, K., Gomi, K. and Takahashi, K. (1991) Genetic engineering of a sake yeast producing  no urea by successive disruption of arginase gene. Appl. Environ. Microbiol. 57, 301‐306.  Kizaki, Y., Inoue, Y., Okazaki, N. and Kobayashi, S. (1991) Isolation and determination of protein bodies  (PB‐I, PB‐II) in polished rice endosperm. J. Brew. Soc. Jpn. 86, 293‐298.  Kliewer, W.M. (1970) Free amino acids and other nitrogenous fractions in wine grapes. J. Food Sci. 35,  17‐21.  Kodama, K. (1993) Sake‐brewing yeast; in The Yeasts, Rose, A. H. and Harrison, J. S. (eds.), pp. 129‐168,  Academic Press, London, United Kingdom.  Kodama,  S.,  Suzuki,  T.,  Fujinawa,  S.,  de  la  Teja,  P.  and  Yotsuzuka,  F.  (1994)  Urea  Contribution  to  Ethyl  Carbamate Formation in Commercial Wines During Storage. Am. J. Enol. Vitic. 45, 17‐24.  Lam, K. B. (1977) Isolation and characterization of Saccharomyces cerevisiae glycolytic pathway mutants.  J. Bacteriol 130, 746‐749.  Leithauser,  M.  T.,  Liem,  A.,  Stewart,  B.  C.,  Miller,  E.  C.  and  Miller,  J.  A.  (1990)  1,N6‐ethenoadenosine  formation,  mutagenicity  and  murine  tumor  induction  as  indicators  of  the  generation  of  an  electrophilic  epoxide  metabolite  of  the  closely  related  carcinogens  ethyl  carbamate  (urethane)  and vinyl carbamate. Carcinogenesis 11, 463‐473.           109   Liu, S., Pritchard, G. G., Hardman, M. J. and Pilone, G. J. (1994) Citrulline Production and Ethyl Carbamate  (Urethane)  Precursor  Formation  From  Arginine  Degradation  by  Wine  Lactic  Acid  Bacteria  Leuconostoc oenos and Lactobacillus buchneri. Am. J. Enol. Vitic. 45, 235‐242.  Lohr, D., Venkov, P. and Zlatanova, J. (1995) Transcriptional regulation in the yeast GAL gene family: a  complex genetic network. FASEB J. 9, 777‐787.  Maftahi,  M.,  Gaillardin,  C.  and  Nicaud,  J.  M.  (1998)  Generation  of  Saccharomyces  cerevisiae  deletants  and basic phenotypic analysis of eight novel genes from the left arm of chromosome XIV. Yeast  14, 271‐280.  Malone, R. E. (1990) Dual regulation of meiosis in yeast. Cell, 61, 375‐378.  Manivasakam,  P.  (1995)  Micro‐homology  mediated  PCR  targeting  in  Saccharomyces  cerevisiae.  Nuc.  Acids Res. 23, 2799‐2800.  Marks,  V.  D.,  Sui,  S.  J.,  Erasmus,  D.,  van  der  Merwe,  G.,  Brumm,  J.,  Wasserman,  W.  W.,  Bryan,  J.,  van  Vuuren, H. J. J. (2008) Dynamics of the yeast transcriptome during wine fermentation reveals a  novel fermentation stress response. FEMS Yeast Research 8, 35‐52.  Marks,  V.  D.,    van  der  Merwe,  G.,  van Vuuren,  H.  J.  J.  (2003)  Transcriptional  profiling  of wine  yeast  in  fermenting  grape  juice:  regulatory  effect  of  diammonium  phosphate.  FEMS  Yeast  Research  3,  269‐287.  Matsudo, T. (1993) Determination of ethyl carbamate in soy sauce and its possible precursor. J. Agricult.  Food Chem. 41, 352‐356.  Miklos,  G.  G.  and  Rubin,  G.  (1996)  The  Role  of  the  Genome  Project  in  Determining  Gene  Function:  Insights from Model Organisms. Cell, 86, 521‐529.  Monteiro,  F.  F.  and  Bisson,  L.  F.  (1991)  Amino  Acid  Utilization  and  Urea  Formation  During  Vinification  Fermentations. Am. J. Enol. Vitic. 42, 199‐208.  Monteiro, F. F. and Bisson, L. F. (1992) Nitrogen Supplementation of Grape Juice. I. Effect on Amino Acid       Utilization During Fermentation. Am. J. Enol. Vitic. 43, 1‐10.     110   Monteiro,  F.  F.,  Trousdale,  E.  K.  and  Bisson,  L.  F.  (1989)  Ethyl  Carbamate  Formation  in  Wine:  Use  of  Radioactively Labeled Precursors to Demonstrate the Involvement of Urea. Am. J. Enol. Vitic. 40,  1‐8.  Mori,  K.  (1996)  Signalling  from  endoplasmic  reticulum  to  nucleus:  transcription  factor  with  a  basic‐ leucine  zipper  motif  is  required  for  the  unfolded  protein‐response  pathway.  Genes  to  Cells  1,  803‐817.  Mortimer, R. K. (1966) Genetic mapping in Saccharomyces. Genetics 53, 165‐173.  Nasmyth, K. (1993) Regulating the HO endonuclease in yeast. Curr. Opin. Genet. Dev. 3, 286‐294.  National  Institutes  of  Health  National  Toxicology  Program.  (2004)  NTP  Technical  Report  on  the  Toxicology  and  Carcinogenesis  Studies  of  Urethane,  Ethanol,  and  Urethane/Ethanol  in  B6C3F1  Mice (Drinking Water Studies). TR 510, 1‐351.  Newstead, S., Kim, H., von Heijne, G., Iwata, S. and Drew, D. (2007) High‐throughput fluorescent‐based  optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces  cerevisiae. Proc. Natl. Acad. Sci. USA 104, 13936‐13941.  Nettleship, A., Henshaw, PS. and Meyer, HL. (1943) Induction of pulmonary  tumors in mice with ethyl  carbamate (urethane). J. Natl. Cancer Inst. 4, 309‐319.  Nikawa, J., Akiyoshi, M., Hirata, S. and Fukuda, T. (1996) Saccharomyces cerevisiae IRE2/HAC1 is involved  in IRE1‐mediated KAR2 expression. Nucl. Acids Res. 24, 4222‐4226.  Nozawa, A., Takano, J., Kobayashi, M., von Wiren, N. and Fujiwara, T. (2006) Roles of BOR1, DUR3, and  FPS1  in  boron  transport  and  tolerance  in  Saccharomyces  cerevisiae.  FEMS  Microbiol.  Lett.  262,  216‐222.  Ough,  C.  S.  (1976a)  Ethyl  carbamate  in  fermented  beverages  and  foods.  I.  Naturally  occurring  ethyl  carbamate. J. Agric. Food Chem. 24, 323‐328.           111   Ough, C. S. (1976b) Ethyl carbamate in fermented beverages and foods. II. Possible formation of ethyl  carbamate from diethyl dicarbonate addition to wine. J. Agric. Food Chem. 24, 328‐331.  Ough, C. S., Crowell, E. A. and Gutlove, B. R. (1988) Carbamyl Compound Reactions with Ethanol. Am. J.  Enol. Vitic. 39, 239‐242.  Ough,  C.  S.,  Crowell,  E.  A.  and  Mooney,  L.  A.  (1988)  Formation  of  Ethyl  Carbamate  Precursors  During  Grape Juice (Chardonnay) Fermentation. I. Addition of Amino Acids, Urea, and Ammonia: Effects  of Fortification on Intracellular and Extracellular Precursors. Am. J. Enol. Vitic. 39, 243‐249.  Ough, C. S., Huang, Z., An, D. and Stevens, D. (1991) Amino Acid Uptake by Four Commercial Yeasts at  Two  Different  Temperatures  of  Growth  and  Fermentation:  Effects  on  Urea  Excretion  and  Reabsorption. Am. J. Enol. Vitic. 42, 26‐40.  Ough,  C.  S.,  Stevens,  D.,  Sendovski,  T.,  Huang,  Z.  and  An,  D.  (1990)  Factors  Contributing  to  Urea  Formation in Commercially Fermented Wines. Am. J. Enol. Vitic. 41, 68‐73.  Ough, C. S. and Trioli, G. (1988) Urea Removal from Wine by an Acid Urease. Am. J. Enol. Vitic. 39, 303‐ 307.  Park, H., Shin, M. and Woo, I. (2001) Antisense‐mediated inhibition of arginase (CAR1) gene expression  in Saccharomyces cerevisiae. J. Biosci. Bioeng. 92, 481‐484.  Park,  K.,  Liem,  A.,  Stewart,  B.  C.  and  Miller,  J.  A.  (1993)  Vinyl  carbamate  epoxide,  a  major  strong  electrophilic,  mutagenic  and  carcinogenic  metabolite  of  vinyl  carbamate  and  ethyl  carbamate  (urethane). Carcinogenesis 14, 441‐450.  Pena‐Castillo,  L.  and  Hughes,  T.  (2007)  Why  Are  There  Still  Over  1000  Uncharacterized  Yeast  Genes?  Genetics 176, 7‐14.  Perez‐Ortin, J., Garcia‐Martinez, J. and Alberola, T. (2002) DNA chips for yeast biotechnology. The case of  wine yeasts. J. Biotechnol. 98, 227‐241.           112   Rossignol,  T.,  Dulau,  L.,  Julien,  A.  and  Blondin,  B.  (2003)  Genome‐wide  monitoring  of  wine  yeast  gene  expression during alcoholic fermentation. Yeast 20, 1369‐1385.  Salmon, J. and Barre, P. (1998) Improvement of Nitrogen Assimilation and Fermentation Kinetics under  Enological  Conditions  by  Derepression  of  Alternative  Nitrogen‐Assimilatory  Pathways  in  an  Industrial Saccharomyces cerevisiae Strain. Appl. Environ. Microbiol. 64, 3831‐3837.  Schehl,  B.  (2007)  Contribution  of  the  fermenting  yeast  strain  to  ethyl  carbamate  generation  in  stone  fruit spirits. Appl. Microbiol. Biotech. 74, 843‐850.  Schlatter,  J.  and  Lutz,  W.  K.  (1990)  The  carcinogenic  potential  of  ethyl  carbamate  (urethane):  risk  assessment at human dietary exposure levels. Food Chem. Toxicol. 28, 205‐211.  Shobayashi, M., Ukena, E., Fujii, T. and Iefuji, H. (2007) Genome‐wide expression profile of sake brewing  yeast under shaking and static conditions. Biosci. Biotechnol. Biochem. 71, 323‐335.  Smart,  W.  C.,  Coffman,  J.  A.  and  Cooper,  T.  G.  (1996)  Combinatorial  regulation  of  the  Saccharomyces  cerevisiae  CAR1  (arginase)  promoter  in  response  to  multiple  environmental  signals.  Mol.  Cell.  Biol. 16, 5876‐5887.  Stevens, D. F. and Ough, C. S. (1993) Ethyl Carbamate Formation: Reaction of Urea and Citrulline with  Ethanol in Wine Under Low to Normal Temperature Conditions. Am. J. Enol. Vitic. 44, 309‐312.  Stolz, L. E. (1998) INP51, a yeast inositol polyphosphate 5‐phosphatase required for phosphatidylinositol  4,5‐bisphosphate  homeostasis  and  whose  absence  confers  a  cold‐resistant  phenotype.  J.  Biol.  Chem. 273, 11852‐11861.  Sumrada,  R.,  Gorski,  M.  and  Cooper,  T.  (1976)  Urea  transport‐defective  strains  of  Saccharomyces  cerevisiae. J. Bacteriol. 125, 1048‐1056.  Tabor,  H.  and  Tabor,  C.  W.  (1999)  A  Guide  to  the  Polyamines.  Seymour  S.  Cohen.  Analytical  Biochem.  274, 150. Oxford University Press, New York, USA.           113   Takagi,  H.,  Takaoka,  M.,  Kawaguchi,  A.  and  Kubo,  Y.  (2005)  Effect  of  L‐Proline  on  Sake  Brewing  and  Ethanol Stress in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 71, 8656‐8662.  Uemura,  T.,  Kashiwagi,  K.  and  Igarashi,  K.  (2007)  Polyamine  Uptake  by  DUR3  and  SAM3  in  Saccharomyces cerevisiae. J. Biol. Chem. 282, 7733‐7741.  van Vuuren, H. J. J., Daugherty, J. R., Rai, R. and Cooper, T. G. (1991) Upstream induction sequence, the  cis‐acting element required for response to the allantoin pathway inducer and enhancement of  operation of the nitrogen‐regulated upstream activation sequence in Saccharomyces cerevisiae.  J. Bacteriol. 173, 7186‐7195.  Vine, R. P., Harkness, E. M. and Linton, S. J. (2002) Winemaking: From Grape Growing to Marketplace,  Second ed., Kluwer Academic/Plenum, New York.  Volschenk, H., Viljoen, M., Grobler, J., Bauer, F., Lonvaud‐Funel, A., Denayrolles, M., Subden, R. E. and  Van Vuuren, H. J. J. (1997) Malolactic Fermentation in Grape Musts by a Genetically Engineered  Strain of Saccharomyces cerevisiae. Am. J. Enol. Vitic. 48, 193‐197.  Wach,  A.  (1996)  PCR‐synthesis  of  marker  cassettes  with  long  flanking  homology  regions  for  gene  disruptions in S. cerevisiae. Yeast 12, 259‐265.  Ward, A. (1992) Rapid analysis of yeast transformants using colony‐PCR. Biotechniques, 13, 350.   Wagner,  S.,  Bader,  M.  L.,  Drew,  D.  and  de  Gier,  J.  (2006)  Rationalizing  membrane  protein  overexpression. Trends in Biotech. 24, 364‐371.  Westfall, P. J., Ballon, D. R. and Thorner, J. (2004) When the stress of your environment makes you go  HOG wild. Science 306, 1511‐1512.  Whitney, P. A. and Cooper, T. G. (1972) Urea Carboxylase and Allophanate Hydrolase. Two components  of  adenosine  triphosphate:  urea  amidolyase  in  Saccharomyces  cerevisiae.  J.  Biol.  Chem.  247,  1349‐1353.           114   Whitney,  P.  A.  and  Cooper,  T.  (1973)  Urea  carboxylase  from  Saccharomyces  cerevisiae.  Evidence  for  a  minimal two‐step reaction sequence. J. Biol. Chem. 248, 325‐330.  Whitney,  P.  A.,  Cooper,  T.  G.  and  Magasanik,  B.  (1973)  The  induction  of  urea  carboxylase  and  allophanate hydrolase in Saccharomyces cerevisiae. J. Biol. Chem. 248, 6203‐6209.  Wu, H., Zheng, X., Araki, Y., Sahara, H., Takagi, H. and Shimoi, H. (2006) Global gene expression analysis  of yeast cells during sake brewing. Appl. Environ. Microbiol. 72, 7353‐7358.  Yanisch‐Perron,  C.,  Vieira,  J.  and  Messing,  J.  (1985)  Improved  M13  phage  cloning  vectors  and  host  strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103‐119.  Yoshiuchi, K., Watanabe, M. and Nishimura, A. (2000) Breeding of a non‐urea producing sake yeast with  killer character using a kar1‐1 mutant as a killer donor. J. Indust. Microbiol. Biotech. 24, 203‐209.  Zimmerli,  B.  and  Schlatter,  J.  (1991)  Ethyl  carbamate:  analytical  methodology,  occurrence,  formation,  biological activity and risk assessment. Mutat. Res. 259, 325‐350.           115   

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
United States 80 1
Canada 23 1
China 5 1128
Brazil 4 1
Russia 4 0
Sweden 2 0
India 1 0
France 1 0
Taiwan 1 0
City Views Downloads
Unknown 75 4
Vancouver 17 0
Ashburn 8 0
Montreal 4 0
Boardman 4 0
Shenzhen 2 16
Gothenburg 2 0
Beijing 2 0
Henderson 1 0
Seattle 1 0
Phoenix 1 0
Surrey 1 0
Wilmington 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066389/manifest

Comment

Related Items