UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Role of phosphatases in controlling arabidopsis mapk signalling cascades Lee, Jin Suk 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_spring_lee_jinsuk.pdf [ 14.72MB ]
Metadata
JSON: 24-1.0066360.json
JSON-LD: 24-1.0066360-ld.json
RDF/XML (Pretty): 24-1.0066360-rdf.xml
RDF/JSON: 24-1.0066360-rdf.json
Turtle: 24-1.0066360-turtle.txt
N-Triples: 24-1.0066360-rdf-ntriples.txt
Original Record: 24-1.0066360-source.json
Full Text
24-1.0066360-fulltext.txt
Citation
24-1.0066360.ris

Full Text

ROLE OF PHOSPHATASES IN CONTROLLING ARABIDOPSIS MAPK SIGNALLING CASCADES  by Jin Suk Lee  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  The Faculty of Graduate Studies (Botany)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) April 2008  © Jin Suk Lee, 2008  ABSTRACT Plants possess integrated signalling networks that mediate the responses to various environmental conditions. Mitogen-activated protein kinases (MAPKs) constitute a highly conserved family of enzymes in eukaryotes, and in plants MAPK-based signal transduction modules regulate a large number of physiological processes, including responses to environmental stresses and phytohormones. Regulated dephosphorylation of active MAPKs is a key component of the control of MAPK signalling cascades, and in mammals, members of the MAPK phosphatase (MKP) sub-class of dual-specificity tyrosine phosphatases have been recognized as key players for inactivating MAPKs. Five MKP homologues are found in Arabidopsis thaliana, but only limited information is available concerning their properties and biological roles. Based on initial data derived from my reverse genetics and protein interaction studies of these five potential MKPs, as well as gene function information in the literature, I chose to focus on two putative Arabidopsis MKPs, AtMKP2 and Indole-3-Butyric Acid-response 5 (IBR5). By using a combination of genetic and biochemical studies, I established that the previously uncharacterized MKP designated AtMKP2, participates in the regulation of cellular homeostasis in ozone-challenged tissue, and can influence the activation state of two MAPKs, MPK3 and MPK6. AtMKP2-suppressed plants displayed significantly prolonged MPK3 and MPK6 activation during ozone treatment, and recombinant AtMKP2 was able to dephosphorylate both phospho-MPK3 and phospho-MPK6 in vitro, providing direct evidence that AtMKP2 may target these oxidant-activated MAPKs. A mutation in IBR5, one of the five potential AtMKPs, was previously reported to confer reduced sensitivity to auxin and ABA in Arabidopsis. My protein interaction studies demonstrated that IBR5 and MPK12 are physically coupled and that the C-terminus of ii  MPK12 is essential for its interaction with IBR5. In vitro dephosphorylation assays indicated that recombinant phosphoMPK12 is efficiently dephosphorylated by IBR5. In transgenic plants with reduced expression of the MPK12 gene, root growth is hypersensitive to exogenous auxins, consistent with the lower auxin sensitivity reported for ibr5 mutants. Taken together, my data demonstrate for the first time that both AtMKP2 and IBR5 are bona fide Arabidopsis MAPK phosphatases and that they serve as important regulators of oxidative stress and auxin signalling, respectively, in Arabidopsis.  iii  TABLE OF CONTENTS ABSTRACT……………………………………………………………………………………...ii TABLE OF CONTENTS………………………………………………………………………iv LIST OF TABLES……………………………………………………………………………..vii LIST OF FIGURES……………………………………………………………..……………viii LIST OF ABBREVIATIONS…………………………………………………………………ix ACKNOWLEDGEMENTS……………………………………………………………………xi CO-AUTHORSHIP STATEMENT……………………………………………………………xii 1.  GENERAL INTRODUCTION…………………………………………..………..…..1 1.1 Introduction……………………………………………………………….....…2 1.2 Mitogen-activated protein kinase (MAPK) signaling……………………3 1.3 MAPKs in plants………………………………………………………….....…7 1.4 Mitogen-activated protein kinase phosphatases (MKPs) ………….……12 1.5 MKPs in plants………………………………………………………….....…14 1.6 Thesis objectives……………………………………………………….....…18 1.7 References……………………………..……………………………….....…19  2.  ARABIDOPSIS MAPK PHOSPHATASE 2 (MKP2) POSITIVELY REGULATES  OXIDATIVE STRESS TOLERANCE AND INACTIVATES THE MPK3 AND MPK6 MAPKS……………………………………………………………………………………….27 2.1 Introduction………………………………………….………………….....…28 2.2 Results………………………………………………….……………….....…31 2.2.1  RNAi-silencing yields gene-specific MKP-suppressed genotypes.31  2.2.2  Only At3g06110-silenced plants exhibit enhanced sensitivity to ozone stress…………………………………………………………....33  2.2.3  MPK3 and MPK6 de-activation is delayed in ozone-treated At3g06110-RNAi plants………………………………………….....…34  2.2.4  Locus At3g06110 encodes a functional MKP (AtMKP2) ….……37  2.2.5  Recombinant AtMKP2 dephosphorylates phospho-MPK3 and MPK6 in vitro……………………………………..…………….....…39  2.2.6  AtMKP2 catalysis is stimulated specifically by association with MPK3 and MPK6……………………………………………….....…43  2.2.7  AtMKP2 is predominantly localized in the nucleus………………46  2.2.8  AtMKP2-suppressed plants are hypersensitive to an ROSgenerating biotic stress………………………….…………….....…47 iv  2.3 Discussion……………………………………………………………….....…49 2.4 Experimental procedures……………………………………………….....…53 2.4.1  Plant materials and treatments…………………………..……...…53  2.4.2  Generation of Arabidopsis MKP-RNAi lines………………………54  2.4.3  RNA isolation and RT-PCR analysis………………………………54  2.4.4  Protein extraction and immunoblot analysis………………………55  2.4.5  Ion leakage assay………………………………..…………….....…56  2.4.6  Construction of KIMPK3, KIMPK6, KIMPK12, CAMKK4, CAMKK9, and CIAtMKP2 clones………………………………………….....…56  2.4.7  Recombinant protein production……………………………………56  2.4.8  Phosphatase assay…………………………………………….....…57  2.4.9  In vitro dephosphorylation assay………………………..……....…57  2.4.10  Subcellular localization……………………..………………….....…58  2.5 References……………………..……………………………………….....…59 3.  AR AB IDO PS IS MITOG EN-AC TIVA TED PR OTEIN KIN ASE MPK 12  INTERACTS WITH THE MAPK PHOSPHATASE IBR5 AND REGULATES AUXIN SIGNALLING………………………………………………………………………………...64 3.1 Introduction……………………………………………….…………….....…65 3.2 Results………………………………………….……………………….....…67 3.2.1  Identification of Arabidopsis MPK12 as an IBR5-specific interactor……………………..………………………………….....…67  3.2.2  Activated MPK12 is dephosphorylated by IBR5 in vitro…………73  3.2.3  MPK12 and IBR5 share similar expression patterns………………77  3.2.4  Suppression of MPK12 results in altered auxin responses……...79  3.3 Discussion…………………………………………………………………...…82 3.4 Experimental procedures………………………………..…………….....…85 3.4.1  Yeast two-hybrid assays……………………………………….....…85  3.4.2  Transient protoplast co-expression assay…………………………86  3.4.3  Preparation of kinase-inactive MAPK and constitutively active MAPKK constructs……………………………………….…….....…86  3.4.4  Recombinant protein production………………………………...…87  3.4.5  In vitro binding assay…………….…………………………….....…87  3.4.6  Phosphatase assay…………………………………………….....…88  3.4.7  In vitro dephosphorylation assay………………………………...…88  3.4.8  RNA isolation and RT-PCR……………………………..…….....…89  3.4.9  Histochemical GUS assay…………………………………….....…89 v  3.4.10  Confocal imaging analysis…………………………………….....…89  3.4.11  Generation of MPK12RNAi lines………………………….….....…90  3.4.12  Root growth inhibition assay……………………………………....…90  3.5 References…………..………………………………………………….....…91 4.  GENERAL DISCUSSION…………………………………………………………...94 4.1 The specificity of MAPK dephosphorylation by protein phosphatases.…95 4.2 Regulation of Arabidopsis MKPs……………………………………….....…97 4.3 Participation of MAPK cascades in auxin signalling and auxin-response gene induction………………………………………………………….....…99 4.4 References…………………………………………………………….....…103  vi  LIST OF TABLES Table 2.1  Kinetic parameters of AtMKP2 catalysis with OMFP as substrate……….46  vii  LIST OF FIGURES Figure 1.1  Phylogenetic tree and domain structure of plant mitogen-activated protein  kinases……………………………………………..………………………………….....…9 Figure 2.1  RNAi-mediated gene silencing creates gene family-specific loss-of-  function genotypes……………….……………………………………………….....…33 Figure 2.2  AtMKP2 (At3g06110)-suppressed plants are hypersensitive to ozone and  display prolonged MPK3 and 6 activation………………………..…………….....…36 Figure 2.3  GST-AtMKP2 (GST-At3g06110) dephosphorylates OMFP in a dose- and  time-dependent manner………………………………………………………….....…38 Figure 2.4  AtMKP2 can dephosphorylate both MPK3 and MPK6 in vitro…………..41  Figure 2.5  Dephosphorylation of MPK3 and MPK6 by DsPTP1 was analyzed in  vitro…………………………………………………………………………..……….....…42 Figure 2.6  AtMKP2 is unable to dephosphorylate MPK12 in vitro………………..…43  Figure 2.7  Catalytic activation of AtMKP2 by MPK3 and MPK6……………..………45  Figure 2.8  AtMKP2 is a nuclear protein, and AtMKP2-suppressed plants are  hypersensitive to harpin elicitor………………………………………………….......…48 Figure 3.1  IBR5 interaction with Arabidopsis MPK12………………………………70  Figure 3.2  IBR5 interacts specifically with MPK12…………………………………...…71  Figure 3.3  Identification of the region of MPK12 required for interaction with  IBR5…………………………………………………..……………………………......…72 Figure 3.4  Activated MPK12 is efficiently dephosphorylated by IBR5 in vitro….….75  Figure 3.5  PhosphoMPK12 but not phosphoMPK3 can be dephosphorylated by IBR5  in vitro…………………………………………………………………………………...…76 Figure 3.6  Expression pattern and subcellular localization of MPK12……………...78  Figure 3.7  Suppressing MPK12 expression by RNAi leads to auxin-hypersensitive  phenotypes………………………………………………………………………….....…81  viii  List of Abbreviations 2,4-D  2,4-dichlorophenoxyacetic acid  ABA  abscisic acid  ATP  adenosine triphosphate  CA  constitutively active  CaMV  Cauliflower Mosaic Virus  CBB  Coomassie brilliant blue  cDNA  complementary DNA  DAPI  4',6-diamidino-2-phenylindole  DEX  dexamethasone  DNA  deoxyribonucleic acid  ERK  extracellular signal-regulated kinase  EV  empty vector  GFP  green fluorescent protein  GST  glutathione S-transferase  GUS  β-glucuronidase  HA  hemagglutinin  IAA  indole-3-acetic acid  IBA  indole-3-butyric acid  IP  immunoprecipitation  IPTG  isopropyl β-D-1-thiogalactopyranoside  KI  kinase-inactive  MAPK  mitogen-activated protein kinase  MAPKK (or MKK)  mitogen-activated protein kinase kinase ix  MAPKKK  mitogen-activated protein kinase kinase kinase  MKP  mitogen-activated protein kinase phosphatase  MS  Murashige and Skoog  OMFP  3-O-methylfluorescein phosphate  PAGE  polyacrylamide gel electrophoresis  PCR  polymerase chain reaction  ppb  parts per billion  RNA  ribonucleic acid  RNAi  RNA interference  ROS  reactive oxygen species  RT-PCR  reverse transcriptase polymerase chain reaction  SAUR  small auxin up-regulated  SC  synthetic complete  T-DNA  transfer DNA  WT  wild type  Y2H  yeast two hybrid  YFP  yellow fluorescent protein  x  Acknowledgements  First, I would like to thank my parents, Hae Sim Kim and Jae Bok Lee, and my “dedicated” husband, Kyoung Bae Park, for their patience and endless support during my pursuit of this degree. I would like to thank my supervisor, Brian Ellis who has provided me endless discussions and support for this program. I would also like to thank my committee members, Dr. Jim Kronstard, Dr. Carl Douglas, and Dr. Joerg Bohlmann for their time to review my thesis and scientific advice to this project. I thank my good friends at UBC in particular, Eiko Kawamura, Minako Kaneda, and Hardy Hall for their personal support. I also thank lab members, Dr. Marcus Samuel, Dr. Somrudee Sritubtim, Alana Clegg, Corinne Cluis, Hardy Hall, Dr. Jun Chen, Ankit Walia, QingNing Zeng, Apurva Bhargava, Jia Cheng, and Adrienne Nye for their assistance. I would like to thank my previous supervisor, Ki Won Kwon for his supportive discussions on both academic and personal levels. Finally, I also thank the UBC Faculty of Graduate Studies for educational funding.  xi  Co-Authorship Statement Below is a list of papers that have been published or submitted for publication as a result of this work, and the contribution made by the candidate:  Lee JS, Ellis BE (2007) Arabidopsis MAPK phosphatase 2 (MKP2) positively regulates oxidative stress tolerance and inactivates the MPK3 and MPK6 MAPKs. J Biol Chem 282: 25020-25029. The candidate performed all experiments described in the paper and wrote the manuscript. BE Ellis supervised the work and manuscript preparation.  Lee JS, Wang S, Sritubtim S, Chen JG, Ellis BE. Arabidopsis mitogen-activated protein kinase MPK12 interacts with the MAPK phosphatase IBR5 and regulates auxin signalling (submitted). The candidate performed most of the experiments described in the paper and wrote the manuscript. S. Wang was involved in designing and conducting the transient protoplast analysis. S. Sritubtim generated transgenic Arabidopsis plants expressing a MPK12 promoter:GUS reporter. JG Chen supervised manuscript preparation. BE Ellis supervised the work and manuscript preparation.  xii  1. GENERAL INTRODUCTION  1  1.1 introduction Like all other living organisms, plants must constantly respond and adapt to changes in the external environment in order to sustain normal growth and development. This relies upon perceiving cues from the environment and activating signalling machinery to regulate the appropriate physiological and genetic responses. Many different research groups have studied the signalling molecules and pathways involved, and these studies have revealed that protein phosphorylation , catalyzed by protein kinases, is one of the major mechanisms for controlling cellular functions. Several different types of protein kinases have been identified from plants but these all belong to the protein kinase super-family. One of the most important kinase groups involved in plant signal transduction pathways consists of the members of the mitogen-activated protein kinase (MAPK) cascades (Jonak et al., 2002; Nakagami et al., 2005). In addition to the specificity of protein kinases for their substrate(s), the magnitude and duration of kinase activation is crucial in determining the physiological outcome of protein kinase-based signalling. Within signalling cascades involving MAPKs, a major point of regulation occurs at the level of the MAPK itself. Canonically, MAPKs are activated through phosphorylation of intermediary kinases by other, upstream kinases, and inactivated by dephosphorylation of those same kinases, a process that can be mediated by various phosphoprotein phosphatases. Our understanding of the properties and function of protein phosphatases in regulating MAPK pathways has largely been established in mammals, where the enzymes primarily responsible for MAPK dephosphorylation appear to be a specific sub-class of dual-specificity tyrosine phosphatases referred to as MAPK phosphatases (MKP). MKP homologues have also been tentatively identified in higher plants, based on amino acid sequence similarity to 2  established mammalian MKPs, so MKPs appear to be ubiquitous components of signalling cascades among eukaryotes (Gupta et al., 1998; Ulm et al., 2001; Kerk, et al., 2002; Yamakawa et al., 2004; Katou et al., 2007). In spite of their crucial role in the tight regulation of MAPK pathways, the molecular mechanisms underlining the negative regulation by these MKP proteins have only begun to be unravelled in plants. In the following section, I first describe the major paradigms established in other eukaryotic systems, and then examine our current knowledge of MAPKs and MKPs in plants.  1.2 Mitogen-activated protein kinase (MAPK) signalling MAPK signalling cascades are groups of protein kinases that play a key role in signal transduction in all eukaryotes including animals, yeast, and plants (Widmann et al., 1999; Hamel et al., 2006). These cascades cooperate to transduce signals to specific intracellular targets and thereby initiate cellular responses, such as changes in gene expression, differentiation, development, and stress responses (Chen et al., 2001; MAPK group, 2002; Hamel et al., 2006). A typical MAPK signalling pathway is composed of three classes of protein kinases: a MAPK kinase kinase (MAPKKK), a MAPK kinase (MAPKK) and a MAPK, and each class of these protein kinases occur as a family of multiple sub-types. The activation of MAPKKKs can occur through physical interaction and/or phosphorylation by various factors including receptor kinases, intermediate bridging factors and interlinking MAPKKKKs (Irie et al., 1994; Luttrell and Luttrell, 2003). MAPKKKs are proteinserine/threonine kinases and they activate MAPKKs by phosphorylation of two conserved serine/threonine residues in a conserved -S/T-X3-5-S/T- motif. By contrast, a MAPKK is a dual-specificity kinase that phosphorylates a target MAPK on specific threonine and tyrosine residues in the -TXY- motif located in the MAPK catalytic domain 3  (Widmann et al., 1999). It has been shown that phosphorylation of both threonine and tyrosine in this motif is required for full activation of the MAPK (Widmann et al., 1999). The activated MAPK, as the terminal component of this sequential cascade, acts as a serine/threonine kinase that is able to phosphorylate a wide range of cellular targets such as transcription factors, cytoskeleton proteins, protein phosphatases and other protein kinases. MAPKs transfer phosphate to one or more serine and/or threonine residues within a consensus PXT/SP motif within the protein substrate (Karin and Hunter, 1995; Masuda et al., 2003; Feilner et al., 2005; Yap et al., 2005). Eukayotic cells possess multiple members of each level of the MAPK signaling cascade (MAPKKKs, MAPKKs, MAPKs), and these share significant sequence similarity. Therefore, in order to avoid pathway cross-talk and allow selective activation of each pathway, organization of the MAPK signaling components into functional MAPK modules is essential for their precise regulation. Recent studies have revealed that pathway specificity results, in part, from the use of specific binding motifs that control the strength and orientation of physical interactions as well as discrete scaffold proteins that help segregate components of a pathway and insulate them from inappropriate cross-talk/output (Morrison and Davis, 2003). Thirteen mammalian MAPKs have been identified and these are activated by signalling from a variety of ligands and receptors including tyrosine kinases and G-protein-coupled receptors (Irie et al., 1994; Luttrell and Luttrell, 2003). The three major mammalian MAPK pathways that have been characterized involve the extracellular signal-regulated kinases  (ERK),  the c-Jun N-terminal kinases/stress-activated protein  kinases  (JNK/SAPK) and the p38 kinases (Cohen, 1997; Davis, 2000; Chen et al., 2001; Chang and Karin, 2001; Roux and Blenis, 2004). 4  ERKs (ERK1 and ERK2) are preferentially activated in response to growth factors or treatment with phorbol ester (a tumor promoter), and they are involved in the control of many fundamental cellular processes, including cell proliferation, survival, differentiation, and apoptosis. ERKs are expressed in many tissues and cell types, where they form part of a MAPK module that typically includes Raf MAPKKKs (A-Raf, B-Raf, C-Raf/Raf1) and the MEK1/MEK2 MAPKKs. Many receptors induce the activation of Ras, a small GTPase that binds to, and recruits, Raf-type MAPKKKs to the cell membrane for subsequent activation. Activated Raf kinases are the point of entry into a MAPK cascade in which Raf phosphorylates and activates MEK, and MEK then phosphorylates and activates ERKs. JNK/SAPKs were originally identified as kinases that bind and phosphorylate the c-Jun transcription factor on residues Ser-63 and Ser-73 within its transcriptional activation domain. The JNKs consist of ten isoforms deriving from the three genes JNK1, JNK2 and JNK3 (Waetzig and Herdegen, 2005). They are ubiquitously expressed, and tend to be more responsive to stress stimuli, and are thus involved in inflammatory conditions and cytokine production (Kyriakis and Avruch, 2001). p38 kinase was found as a tyrosine-phosphorylated protein in LPS-stimulated macrophages (Chen et al., 2001; Johnson and Lapadat, 2002). Simultaneously, p38 was identified as a protein that stimulated MAPKAP kinase-2 (MK2) by cellular stressors. There are four p38 family members (-α, -β, -γ and –δ). Similar to the JNK/SAPK pathway, p38 MAP kinases are activated by a variety of cellular stresses including osmotic shock, cytokines, ultraviolet light and heat shock (Kumar et al., 2003; Mikhailov et al., 2005). In general, they participate in signalling cascades controlling cellular responses to cytokines and stress. 5  Mammalian MAPK modules associate with numerous scaffold proteins that regulate their activity and localization in various cells. While the significance of scaffolding is not yet fully defined in most instances, it appears to be a method generally used to segregate individual MAPK modules and may help define specific MAPK pathways. For instance, MEK kinase 1 (MEKK1) is a protein that functions both as a kinase and as a scaffolding protein. MEKK1 interacts with components of the JNK/SAPK module and, as a kinase, promotes the activation of the JNK cascade. As would be expected for an ERK scaffold, when cells were stimulated with activating agents such as sorbitol, the immunoprecipitated MEKK1 complex contained not only MEKK1 but also the activated kinase components, Raf-1, MEK1 and ERK2 (Morrison and Davis, 2003). Another protein that has been demonstrated to have ERK scaffolding properties is MEK partner 1 (MP1). MP1 can selectively promote signalling from MEK1 to ERK1. Recently, MP1 has been suggested to play a specialized role in ERK1 activation at late endosomes (Teis et al. 2002). Members of the JNK Interacting Protein (JIP) group of proteins functions as kinesin motor proteins and as scaffold proteins for both the JNK and p38 kinase signalling modules (Morrison and Davis, 2003). Saccharomyces cerevisiae (budding yeast) has at least five different MAPKs that mediate different physiological processes. Three of these kinases, Fus3, Kss1 and Mpk1 (Slt2), belong to the ERK-type family of MAPKs. Fus3 and Kss1 both regulate mating in response to pheromones, and are activated by the same upstream MAPKK and MAPKKK, but only Fus3 is essential for mating (Sabbagh et al., 2001; Wang and Dohlman, 2004). Kss1 also plays a key role in invasive growth / pseudohyphal development (Roberts and Fink, 1994), and more recently this MAPK has been shown to participate in another pathway that promotes vegetative growth through the regulation  6  of cell integrity (Elion et al., 2005). Mpk1 regulates cell wall integrity and budding in distinct environmental conditions. The Mpk1 pathway is induced in periods of polarized growth and responds to heat, hypo-osmotic shock, cell wall damage and oxidative stress (Staleva et al., 2004). The survival of yeast cells under osmotic stress requires the p38 MAPK homologue, Hog1, which operates in the High Osmolarity Glycerol (HOG) pathway, but has also been shown to respond to heat shock, oxidative stress, and citric acid (Staleva et al., 2004; Lawrence et al., 2004). Finally, the MAPK Smk1, which has an unusual T–N–Y activation motif, regulates sporulation, and is expressed only after meiosis has been initiated in response to carbon and nitrogen deprivation (Krisak et al., 1994). Scaffold proteins are also essential components of the MAPK pathways regulating mating and high-osmolarity responses in yeast. Ste5 and Pbs2 provide specificity by segregating shared kinases and allowing them to interact with pathway-specific kinases and receptors that sense stimuli. Ste5 provides binding sites for Ste11, Ste7 and Fus3 and stimulates phosphorylation (Elion, 2001). Pbs2 acts both as a MAPKK and as a scaffold protein promoting the assembly of the MAPK module involving Ste11 and Hog1 (Whitmarsh and Davis, 1998).  1.3 MAPKs in plants Plant genomes contain more MAPK genes than other eukaryotic genomes and, for that reason, it has been suggested that these enzymes might be involved in many highly specialized signal transduction processes in plants (Mizoguchi et al., 1997; Meskiene and Hirt, 2000). Indeed, plant MAPK signalling has been demonstrated to be involved in responses to a wide range of physiological, developmental and hormonal processes  7  and its activation has been correlated with stimulatory treatments such as wounding, pathogen infection, temperature, touch, hormones, osmotic stress and reactive oxygen species (Tena et al., 2001; Zhang et al., 2001; Nakagami et al., 2005). Publication of the complete Arabidopsis genome sequence allowed the identification of approximately 60 MAPKKKs, 10 MAPKKs and 20 MAPK genes out of 1053 total kinases encoded in the genome, and  made it possible to establish a systematic  nomenclature for plant MAPKKs and MAPKs (MAPK group, 2002). When compared phylogenetically with mammalian MAPKs, all plant MAPKs belong to a single group, the so-called ERK-type sub-family. The canonical members of this family (ERK1 and ERK2) are often activated in response to growth factors in mammals, but in plants, MAPKs have been shown to be activated by a much broader range of stimuli. Based on phylogenetic analysis, plant MAPKs can be further clustered into four distinct groups, AD (Figure 1.1 (MAPK group, 2002)) (Hamel et al., 2006). Group A MAPKs include the two most extensively studied MAPKs, MPK3 and MPK6. These two MAPKs have been found to be involved in numerous processes including environmental, developmental, and hormonal responses (Droillard et al., 2000; Kumar and Klessig, 2000; Samuel et al., 2000; Liu et al., 2003; Zhou et al., 2004; Miles et al., 2005., Wang et al., 2007). Some of the MAPKs of Group B are involved in environmental stress responses (MPK4) and cell division (MPK13) (Calderini et al., 1998; Bögre, 1999; Droillard et al., 2004). Limited information is available for the function(s) of Group C MAPKs at present, although MPK7 expression has been shown to follow a circadian pattern (Schaffer et al., 2003). Group D MAPKs are notable in that they have a –TDY– motif instead of –TEY– in their activation loop, and possess an extended C-terminal region. To date, functional data for 8  a TDY MAPK is only available for rice BWMK1, in contrast to the TEY MAPKs, which have been studied in many plant species including tobacco, tomato, Medicago and Arabidopsis (Meskiene and Hirt, 2000; Cheong et al., 2003; Nakagami et al., 2005).  9  Figure 1.1. Phylogenetic tree and domain structure of plant mitogen-activated protein kinases. (Adapted from MAPK group (2002)) Arabidopsis MAPKs are shown in red letters. The organization of the functional domains and motifs, including the phosphorylation motif (TxY) of each MAPK, is shown in cartoon format on the right. Although our knowledge of signal transduction in plants is less well developed than in mammals, recent studies in Arabidopsis have provided interesting insights into the role of MAPK signalling pathways. Genetic studies of the Arabidopsis MAPKKK mutants ctr1, edr1 and mekk1-4 have revealed altered responses to ethylene, pathogen and osmotic/biotic stresses, respectively (Kieber et al., 1993; Mizoguchi et al., 1996; Frye et al., 2001; Suarez-Rodriguez et al., 2006). At the cascade output level, analysis of the Arabidopsis mpk4 mutant revealed its important role as a regulator of pathogen defense responses. MPK4 is a negative regulator of salicylic acid accumulation, but a positive regulator of jasmonic acid and ethylene signalling (Petersen et al., 2000; Brodersen et al., 2006). Recently, the first MPK4 substrate, MAP kinase substrate 1 (MKS1), was identified that couples this kinase to activation of two specific transcription factors, WRKY 25 and WRKY 33 (Andreasson et al., 2005). Two Arabidopsis MAPKs, MPK4 and MPK6, are activated by treatment with various stresses, such as touch, wounding, hyper-osmolarity, and humidity (Ichimura et al., 2000; Desikan et al., 2001). Wounding has also been reported to activate MPK3 and MPK6 in other experiments, and these two closely-related MAPKs are also activated by bacterial elicitors, ozone and H2O2 (Droillard et al., 2002; Jonak et al., 2002; Kovtun et al., 2000). Reactive oxygen species (ROS) have been shown to activate specific MAPKKKs (ANP1, ANP2, and ANP3) and thereby initiate a phosphorylation cascade that leads to MAPKK (MKK4/MKK5) and MAPK (MPK3/MPK6) activation (Kovtun et al., 2000). However, only one complete MAPK cascade, consisting of MEKKI, MKK4/MKK5, and MPK3/MPK6, 10  has been functionally demonstrated in plants. This pathway is initiated by recognition of the bacterial elicitor, flg22, by the plasma membrane-localized FLS2 receptor. This recognition event is transduced to the downstream targets, which include two plantspecific transcription factors of the WRKY family (WRKY22/WRKY29), as the output of the MAPK cascade described above (Asai et al., 2002). Interestingly, the same MAPK module components (MKK4/5-MPK3/6) have been shown to be involved in stomatal development and patterning, indicating that, in addition to their role in stress responses, these kinases help control developmental pathways (Wang et al., 2007). Since ROS have been shown to be important developmental regulators in other eukaryotes (Pouyssegur and Mechta-Grigoriou, 2006), it is tempting to speculate that the oxidantactivated MKK4/5 and MPK3/6 kinases may be helping connect ROS signalling and cell fate decision-making in plants, as well. Previous studies by yeast two-hybrid and transient expression analyses of MAPK cascades have suggested that MAPK pathway components can function in different combinations in plants. It is also becoming clear that a given MAPK component can perform very different functions in different pathways (Asai et al., 2002; Teige et al., 2004), a situation that has been dealt with, in part, in yeast and mammalian systems through the participation of that help define pathway specificity (Whitmarsh and Davis, 1998; Morrison and Davis, 2003). However, to date, only a single scaffold protein has been reported in plants. OMTK1 plays a MAPK scaffolding role and functions in activation of H2O2-induced cell death in plants (Nakagami et al., 2004). OMTK1 from alfalfa (Medicago) directly interacts with Medicago MMK3 in vitro and is found in a protein complex with MMK3 in vivo. Nakagami et al. (2006) recently reported that MEKK1, which is the Arabidopsis MAPKKK most closely related to OMTK1,, also seems  11  to be able to serve as a scaffold protein to target MPK4 activation in the same manner as MMK3 activation is facilitated by OMTK1 in Medicago.  1.4 Mitogen-activated protein kinase phosphatases (MKPs) The activity of any particular MAPK is tightly regulated by a balance between the activities of upstream activating kinases (MAPKKs) and protein phosphatases (Keyse et al., 2000; Pearson et al., 2001). Whereas MAPK activation relies on phosphorylation of both the serine/threonine and tyrosine residues of the conserved –TXY– motif by the upstream kinase (MAPKK), inactivation can be mediated by de-phosphorylation of either of these two residues (Camps et al., 2000). Therefore, three types of protein phosphatases can potentially down-regulate MAPKs: protein-tyrosine phosphatases (PTPs),  protein-serine/threonine  phosphatases  and  dual-specificity  protein  phosphatases (DsPTPs). DsPTPs, a subclass of the protein tyrosine phosphatases (PTPs), have the unique ability to dephosphorylate both phospho-Tyr and phosphoSer/Thr residues in protein substrates and, in mammalian systems, a number of these phosphatases have been identified specifically as MAPK phosphatases (MKPs). At least 10 mammalian MKPs have been identified as regulating MAPKs, and based on their subcellular localization, structural organization, sequence similarity and substrate specificity, these phosphatases have been broadly subdivided into three classes (Theodosiou and Ashworth, 2002; Farooq and Zhou., 2004). The type 1 MKPs include DUSP1, DUSP2, DUSP4, and DUSP5, all of which are localized in the nucleus and are induced transcriptionally by stimuli that also activate MAPKs. It appears that at least two of these MKPs are involved in regulating immune function, since lack of DUSP1 produced a marked increase in the incidence and severity of autoimmune arthritis (Salojin et al., 2006), and DUSP2 was recently reported to target JNK and to positively 12  regulate immune responses (Jeffrey et al., 2006). The members of this group of phosphatases contain a nuclear localization signal (NLS) sequence in their N-terminus (Wu et al., 2005). Type 2 MKPs comprise three closely related cytoplasmic phosphatases, DUSP6, DUSP7 and DUSP9, and these appear to be involved in early development (Dickinson et al., 2002; Christie et al., 2005; Li et al., 2007). MKPs in this subgroup show restricted tissue distribution and distinct substrate preferences towards ERK1 and ERK2. The type 3 MKPs include DUSP8, DUSP10, and DUSP16, all of which display dephosphorylation activity preferentially against the stress-activated MAPKs. They have an extended region either in the N- or C-terminus and are localized both in the nucleus and cytoplasm. Little information is available concerning the functions of the type 3 MKPs, although it has been suggested that DUSP10 has an essential role in immune responses (Zhang et al., 2004). At least three different mechanisms for regulating the activity of MKPs have been suggested in mammals: transcriptional induction, stabilization, and catalytic activation (Keyse, 2000; Jeffery et al., 2007). The transcription of many MKPs is inducible by stimuli that activate MAPK pathways. MKPs belonging to the type I group such as DUSP1, DUSP2, DUSP4 and DUSP5 show the most dramatic transcriptional regulation and this induction is also dependent on MAPK activation, suggesting that they might participate in negative feedback control of MAPK activity (Grumont et al., 1996; Brondello et al., 1997; Dowd et al., 1998; Jeffrey et al., 2006). Some MKPs can be posttranslationally regulated through direct phosphorylation by MAPKs, and it has been shown that ERK phosphorylation of DUSP6 accelerates the degradation of the phosphatase (Marchetti et al., 2005). On the other hand, DUSP1 is rapidly degraded 13  soon after induction, but ERK can enhance its stabilization through phosphorylation (Brondello et al., 1999). Thus, MAPKs can either destabilize or stabilize particular MKPs through their direct phosphorylation. Finally, mammalian MKPs can be catalytically activated by physically binding to their substrate MAPKs. Binding of ERK2 to DUSP6 results in catalytic activation of DUSP6 (Fjeld et al., 2000), and similarly, DUSP1 catalytic activation is mediated by physical interactions with MAPKs such as ERK2, JNK1, and p38 (Slack et al., 2001). At present, two MKPs have been identified in yeast. One of them, Msg5, promotes adaptation to the pheromone response by dephosphorylating the Fus3 MAPK (Andersson et al., 2004). However, the involvement of Msg5 in the maintenance of a low basal level of activity through the cell integrity pathway has also been suggested because the disruption of MSG5 results in increased phospho-Slt2 levels under noninducing conditions (Andersson et al., 2004). The second one yeast MKP, Sdp1, is a DSP whose sequence is highly similar to that of Msg5, and Sdp1 has also been shown to act on Slt2. However, unlike Msg5, the Sdp1 phosphatase controls the amount of phosphorylated Slt2 after heat induction, but not under basal conditions (Hahn and Thiele, 2002). Consistent with these observations, Collister et al. (2002) demonstrated that Sdp1 strongly interacts with Slt2, but could detect no interaction between this phosphatase and other yeast MAPKs such as Fus3, Kss1 and Hog1. This result suggests that, in contrast to Msg5, Sdp1 may highly specific for inactivation of Slt2.  1.5 MKPs in plants All well-characterized mammalian MKPs share high levels of amino-acid sequence identity over their catalytic domains, including the conserved phosphatase active-site motif VxVHCx2GxSRSx5AYLM (Theodosiou and Ashworth, 2002). In the Arabidopsis 14  genome, around 23 DSP catalytic subunit sequences have been identified, but among these, only five (At3g55270/AtMKP1, At3g06110, At3g23610/DsPTP1, At5g23720/PHS1, At2g04550/IBR5) have the MKP-unique AY[L/I]M motif found in all mammalian MKPs (Kerk et al., 2002). Five putative MKPs have also been identified in rice, which is again fewer than the number of rice MAPKs (17) (Katous et al., 2007). This contrast between the small number of MKPs and the relatively large families of MAPKs in plants indicates that individual MKPs may play crucial roles in signal integration in plants through regulation of multiple MAPKs. However, although it is well known that MKPs play a critical role in controlling MAPK pathways in other organisms, there is only limited functional information available concerning the MKP candidates in plants. AtMKP1 (At3g55270) is a 86-kDa phosphatase that is widely expressed in various tissues. It has been shown previously to be a crucial regulator of the Arabidopsis MAPK pathway responding to genotoxic and salt stresses (Ulm et al., 2001). The mkp1 null mutant does not exhibit a visible phenotype under normal growth conditions, but displays hypersensitivity to UV-C and methyl methanesulfonate treatments (Ulm et al., 2001). Subsequent analysis also revealed that mkp1 plants display elevated resistance to salt stress (Ulm et al., 2002). Interestingly, AtMKP1 transcription remained constant during and after stress treatments, which might indicate that regulation at the level of transcription is a less important mode for modulating MKP activities in plants than it is in animals. AtMKP1 was shown to interact with MPK6 and, to a lesser extent, with MPK3 and MPK4, in yeast two-hybrid screens (Ulm et al., 2002). The mkp1 mutant also displayed mis-regulation of MPK6 activity specifically in response to genotoxic stress in planta (Ulm et al., 2002). Despite these indications of a functional relationship between AtMKP1 and MPK6, the ability of AtMKP1 to catalyze de-phosphorylation of any  15  activated MAPKs has yet to be demonstrated experimentally. Putative orthologs of AtMKP1 (NtMKP1 and OsMKP1) have been identified in other plant species and shown to be involved in controlling the activity of wound-induced MAPKs (Yamakawa et al., 2004; Katous et al., 2007). The second predicted MKP, At3g06110, is a small (18-kDa) protein that consists mainly of a canonical phosphatase domain. This gene, which I have designated as AtMKP2, is expressed in all Arabidopsis tissues and developmental stages (Genevestigator). No mutants of this locus have been recovered from forward genetic screens, and no publicly-available T-DNA insertional mutants have been identified. The first DSP to be characterized in Arabidopsis was DsPTP1 (At3g23610). DsPTP1, which was originally identified from the conservation of its DSP signature motif is a 22kDa phosphatase whose expression was reported to occur in roots, leaves, stems, and flowers (Gupta et al., 1998). However, examination of the public microarray datasets revealed that DsPTP1 expression is largely restricted to the male reproductive organs (stamen and pollen) and that DsPTP1 expression is modestly up-regulated in response to BL/H3BO3 treatment (~2 fold), whereas it was found to be down-regulated in response to hypoxia (~2 fold) and syringolin (~2 fold) (Genevestigator analysis). The DsPTP1 protein is predicted to possess an N-terminal transit peptide that would direct the protein to the chloroplast compartment, but this prediction has not been tested experimentally. Among the five Arabidopsis MKP candidates, only recombinant DsPTP1 has been directly demonstrated to be capable of de-phosphorylating an Arabidopsis MAPK (MPK4) (Gupta et al., 1998). However, no physiological context has yet been defined for DsPTP1 activity. The fourth predicted Arabidopsis MKP, PHS1 (propyzamide-hypersensitive 1) 16  (At5g23720), is a 104-kD phosphatase that possesses a DSP catalytic domain in its Cterminal region. The phs1-1 mutant, which carries a nonsense point mutation, was found to display impaired microtubule organization, and the phs1-2 allele that carries a T-DNA insertion in the third exon of the gene is lethal to embryos (Naoi and Hashimoto, 2004). Another group also found that the phs1-3 allele, which carries a T-DNA insertion in the promoter of PHS1, shows abscisic acid hypersensitivity, indicating that PHS1 may play an important role in two distinct cellular processes in plants (Quettier et al., 2006). However, it should be noted that it remains unknown whether PHS1 acts as a canonical MKP with the ability to de-phosphorylate specific MAPK substrates. The original report showed that PHS1 is expressed in roots, leaves, stems, and flowers (Naoi and Hashimoto, 2004), and its mRNA message has since been shown to be markedly upregulated by stress stimuli such as ABA (Quettier et al., 2006). Examination of the public microarray datasets revealed that PHS1 is expressed in all tissue types, with highest level in pollen and stamen, and that PHS1 expression is up-regulated in response to stresses such as Agrobacterium tumefaciens infection and temperature changes (Genevestigator). The PHS1 protein is predicted to possess two nuclear targeting sequences that would direct the protein to the nucleus. These observations indicate that PHS1 shares some similarity with mammalian MKPs belonging to the Type I inducible nuclear phosphatases. Finally, the fifth predicted MKP, IBR5, is a ubiquitously expressed 22-kDa protein first identified as a relatively weak Arabidopsis indole-3-butyric acid-response mutant in a forward genetic screen (Monroe-Augustus et al., 2003). Loss-of-function genotypes of IBR5 show reduced responsiveness to auxin and abscisic acid, compared to wild-type plants (Monroe-Augustus et al., 2003). However, like PHS1, IBR5 dephosphorylating  17  activity towards MAPKs had not been examined.  1.6 Thesis objectives Although activation of MAPKs by phosphorylation cascades has attracted a great deal of research attention, their inactivation through the action of phosphatases such as MKPs has been largely neglected in plants. The overall objective of this study was to advance our knowledge of the role of MAPK phosphatases in controlling MAPK signalling cascades in Arabidopsis. For this purpose, I initially assembled a full set of reverse genetics resources for study of the five putative MKPs encoded in the Arabidopsis genome, and carried out a series of preliminary investigations with each phosphatase (Appendices). Based on these findings, I then concentrated my efforts on detailed characterization of two of the MKP candidates, AtMKP2 (Chapter 2) and IBR5 (Chapter 3).  18  1.7 References Andreasson E, Jenkins T, Brodersen P, Thorgrimsen S, Petersen NH, Zhu S, Qiu JL, Micheelsen P, Rocher A, Petersen M, Newman MA, Bjorn Nielsen H, Hirt H, Somssich I, Mattsson O, Mundy J (2005) The MAP kinase substrate MKS1 is a regulator of plant defense responses. EMBO J 24: 2579-2589 Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L, Boller T, Ausubel FM, Sheen J (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415: 977-983 Andersson J, Simpson DM, Qi M, Wang Y, Elion EA (2004) Differential input by Ste5 scaffold and Msg5 phosphatase route a MAPK cascade to multiple outcomes. EMBO J 23: 2564-2576 Bögre L, Calderini O, Binarova P, Mattauch M, Till S, Kiegerl S, Jonak C, Pollaschek C, Barker P, Huskisson NS, Hirt H, Heberle-Bors E (1999) A MAP kinase is activated late in plant mitosis and becomes localized to the plane of cell division. Plant Cell 11: 101-113 Brodersen P, Petersen M, Bjorn Nielsen H, Zhu S, Newman MA, Shokat KM, Rietz S, Parker J, Mundy J (2006) Arabidopsis MAP kinase 4 regulates salicylic acidand jasmonic acid/ethylene-dependent responses via EDS1 and PAD4. Plant J 47: 532-546 Brondello JM, Brunet A, Pouyssegur J, McKenzie FR (1997) The dual specificity mitogen-activated protein kinase phosphatase-1 and-2 are induced by p42/p44 MAPK cascade. J Biol Chem 272: 1368–1376 Brondello JM, Pouysségur J, McKenzie FR (1999) Reduced MAP kinase phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation. Science 286: 2514-2517 Chen Z, Gibson TB, Robinson F, Silvestro L, Pearson G, Xu B, Wright A, Vanderbilt C, Cobb MH (2001) MAP kinases. Chem Rev 101: 2449-2476 Cohen P (1997) The search for physiological substrates of MAP and SAP kinases in mammalian cells. Trends Cell Biol 7: 353-361 Chang L, Karin M (2001) Mammalian MAP kinase signalling cascades. Nature 410: 37-40 Calderini O, Bogre L, Vicente O, Binarova P, Heberle-Bors E, Wilson C (1998) A cell cycle regulated MAP kinase with a possible role in cytokinesis in tobacco cells. J Cell Sci 111: 3091-3100  19  Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC, Park BO, Koo SC, Yoon HW, Chung WS, Lim CO, Lee SY, Cho MJ (2003) BWMK1, a rice mitogen-activated protein kinase, locates in the nucleus and mediates pathogenesis-related gene expression by activation of a transcription factor. Plant Physiol 132: 1961-1972 Camps M, Nichols A, Arkinstall S (2000) Dual-specificity phosphatases: a gene family for control of MAP kinase function. FASEB J 14: 6-16 Christie GR, Williams DJ, Macisaac F, Dickinson RJ, Rosewell I, Keyse SM (2005) The dual-specificity protein phosphatase DUSP9/MKP-4 is essential for placental function but is not required for normal embryonic development. Mol Cell Biol 25: 8323–8333 Collister M, Didmon MP, MacIsaac F, Stark MJ, MacDonald NQ, Keyse SM (2002) YIL113w encodes a functional dual-specificity protein phosphatase which specifically interacts with and inactivates the Slt2/Mpk1p MAP kinase in S. cerevisiae. FEBS Lett 527: 186-192 Davis RJ (2000) Signal transduction by the JNK group of MAP kinases. Cell 103: 239252 Desikan R, Hancock JT, Ichimura K, Shinozaki K, Neill SJ (2001) Harpin induces activation of the Arabidopsis mitogen-activated protein kinases AtMPK4 and AtMPK6. Plant Physiol 126: 1579-1587 Droillard M, Boudsocq M, Barbier-Brygoo H, Laurière C (2002) Different protein kinase families are activated by osmotic stresses in Arabidopsis thaliana cell suspensions. Involvement of the MAP kinases AtMPK3 and AtMPK6. FEBS Lett 527: 43-50 Dowd S, Sneddon AA, Keyse SM (1998) Isolation of the human genes encoding the pyst1 and Pyst2 phosphatases: characterisation of Pyst2 as a cytosolic dualspecificity MAP kinase phosphatase and its catalytic activation by both MAP and SAP kinases. J Cell Sci 111: 3389–3399 Droillard MJ, Thibivilliers S, Cazalé AC, Barbier-Brygoo H, Laurière C (2000) Protein kinases induced by osmotic stresses and elicitor molecules in tobacco cell suspensions: two crossroad MAP kinases and one osmoregulation-specific protein kinase. FEBS Lett 474: 217-222 Droillard MJ, Boudsocq M, Barbier-Brygoo H, Laurière C (2004) Involvement of MPK4 in osmotic stress response pathways in cell suspensions and plantlets of Arabidopsis thaliana: activation by hypoosmolarity and negative role in hyperosmolarity tolerance. FEBS Lett 574: 42-48  20  Droillard M, Boudsocq M, Barbier-Brygoo H, Laurière C (2002) Different protein kinase families are activated by osmotic stresses in Arabidopsis thaliana cell suspensions. Involvement of the MAP kinases AtMPK3 and AtMPK6. FEBS Lett 527: 43-50 Elion EA, Qi M, Chen W (2005) Signal transduction. Signalling specificity in yeast. Science 307: 687-688 Elion EA (2001) The Ste5p scaffold. J Cell Sci 114: 3967-3978 Feilner T, Hultschig C, Lee J, Meyer S, Immink RG, Koenig A, Possling A, Seitz H, Beveridge A, Scheel D, Cahill DJ, Lehrach H, Kreutzberger J, Kersten B (2005) High throughput identification of potential Arabidopsis mitogen-activated protein kinases substrates. Mol Cell Proteomics 4: 1558-1568 Frye CA, Tang D, Innes RW (2001) Negative regulation of defense responses in plants by a conserved MAPKK kinase. Proc Natl Acad Sci U S A 98: 373-378 Farooq A, Zhou MM (2004) Structure and regulation of MAPK phosphatases. Cell Signal 16: 769-779 Fjeld CC, Rice AE, Kim Y, Gee KR, Denu JM (2000) Mechanistic basis for catalytic activation of mitogen-activated protein kinase phosphatase 3 by extracellular signal-regulated kinase. J Biol Chem 275: 6749-6757 Gupta R, Huang Y, Kieber J, Luan S (1998) Identification of a dual-specificity protein phosphatase that inactivates a MAP kinase from Arabidopsis. Plant J 16: 581589 Grumont RJ, Rasko JEJ, Strasser A, Gerondakis S (1996) Activation of the mitogenactivated  protein  kinase  pathway  induces  transcription  of  the  PAC-1  phosphatase gene. Mol Cell Biol 16: 2913–2921 Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, Ehlting J, Beaudoin N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, Ohashi Y, Scheel D, Sheen J, Xing T, Zhang S, Seguin A, Ellis BE (2006) Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci 11: 192-198 Hahn JS, Thiele DJ (2002) Regulation of the Saccharomyces cerevisiae Slt2 kinase pathway by the stressinducible Sdp1 dual-specificity phosphatase. J Biol Chem 277: 21278-21284 Irie K, Gotoh Y, Yashar BM, Errede B, Nishida E, Matsumoto K (1994) Stimulatory effects of yeast and mammalian 14-3-3 proteins on the Raf protein kinase. Science 256: 1716-1719  21  Ichimura K, Mizoguchi T, Yoshida R, Yuasa T, Shinozaki K (2000) Various abiotic stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. Plant J 24: 655-665 Jonak C, Okrész L, Bögre L, Hirt H (2002) Complexity, cross talk and integration of plant MAP kinase signalling. Curr. Opin. Plant Biol 5: 415-424 Johnson GL, Lapadat R (2002) Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 298: 1911-1912 Jeffrey KL, Brummer T, Rolph MS, Liu SM, Callejas NA, Grumont RJ, Gillieron C, Mackay F, Grey S, Camps M, Rommel C, Gerondakis SD, Mackay CR (2006) Positive regulation of immune cell function and inflammatory responses by phosphatase PAC-1. Nature Immunol 7: 274–283 Jeffrey KL, Camps M, Rommel C, Mackay CR (2007) Targeting dual-specificity phosphatases: manipulating MAP kinase signalling and immune responses. Nat Rev Drug Discov 6: 391-403 Kerk D, Bulgrien J, Smith DW, Barsam B, Veretnik S, Gribskov M (2002) The complement of protein phosphatase catalytic subunits encoded in the genome of Arabidopsis. Plant Physiol 129: 908-925 Katou S, Kuroda K, Seo S, Yanagawa Y, Tsuge T, Yamazaki M, Miyao A, Hirochika H, Ohashi Y (2007) A calmodulin-binding mitogen-activated protein kinase phosphatase is induced by wounding and regulates the activities of stressrelated mitogen-activated protein kinases in rice. Plant Cell Physiol 48: 332-344 Karin M, Hunter T (1995) Transcriptional control by protein phosphorylation: signal transmission from the cell surface to the nucleus. Curr Biol 5: 747-757 Kyriakis JM, Avruch J (2001) Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81: 807-869 Kumar S, Boehm J, Lee JC (2003) p38 MAP kinases: Key signalling molecules as therapeutic targets for inflammatory diseases. Nat Rev Drug Discov 2: 717-726 Krisak L, Strich R, Winters RS, Hall JP, Mallory MJ, Kreitzer D, Tuan RS, Winter E. (1994) SMK1, a developmentally regulated MAP kinase, is required for spore wall assembly in Saccharomyces cerevisiae. Genes Dev 8: 2151-2161 Kumar D, Klessig DF (2000) Differential induction of tobacco MAP kinases by the defense signals nitric oxide, salicylic acid, ethylene, and jasmonic acid. Mol Plant Microbe Interact 13: 347-351 Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72: 427–441 22  Kovtun Y, Chiu WL, Tena G, Sheen J (2000) Functional analysis of oxidative stressactivated mitogen-activated protein kinase cascade in plants. Proc Natl Acad Sci U S A 97: 2940-2945 Keyse SM (2000) Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curr Opin Cell Biol 12: 186-192 Luttrell DK, Luttrell LM (2003) Signalling in time and space: G protein-coupled receptors and mitogen-activated protein kinases. Assay Drug Dev Technol 1: 327-338 Lawrence CL, Botting CH, Antrobus R, Coote PJ (2004) Evidence of a new role for the high-osmolarity glycerol mitogen-activated protein kinase pathway in yeast: regulating adaptation to citric acid stress. Mol Cell Biol 24: 3307-3323 Liu Y, Jin H, Yang KY, Kim CY, Baker B, Zhang S (2003) Interaction between two mitogen-activated protein kinases during tobacco defense signalling. Plant J 34: 149-160 Li C, Scott DA, Hatch E, Tian X, Mansour SL (2007) Dusp6 (Mkp3) is a negative feedback regulator of FGF-stimulated ERK signalling during mouse development. Development 134: 167–176 MAPK Group (2002) Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci 7: 301-308 Masuda K, Shima H, Katagiri C, Kikuchi K (2003) Activation of ERK induces phosphorylation of MAPK phosphatase-7, a JNK specific phosphatase, at Ser446. J Biol Chem 278: 32448-32456 Mikhailov A, Shinohara M, Rieder CL (2005) The p38-mediated stress-activated checkpoint. A rapid response system for delaying progression through antephase and entry into mitosis. Cell Cycle 4: 57-62 Morrison DK, Davis RJ (2003) Regulation of MAP kinase signalling modules by scaffold proteins in mammals. Annu Rev Cell Dev Biol 19: 91-118 Mizoguchi T, Ichimura K, Shinozaki K (1997) Environmental stress response in plants: the role of mitogen-activated protein kinases. Trends Biotechnol 15: 1519 Meskiene I, Hirt H (2000) MAP kinase pathways: molecular plug-and-play chips for the cell. Plant Mol Biol 42: 791-806 Miles GP, Samuel MA, Zhang Y, Ellis BE (2005) RNA interference-based (RNAi) suppression of AtMPK6, an Arabidopsis mitogen-activated protein kinase, results in hypersensitivity to ozone and misregulation of AtMPK3. Environ Pollut 138: 230-237  23  Mizoguchi T, Irie K, Hirayama T, Hayashida N, Yamaguchi-Shinozaki K, Matsumoto K, Shinozaki K (1996) A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogenactivated protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana. Proc Natl Acad Sci U S A 93: 765-769 Marchetti S, Gimond C, Chambard JC, Touboul T, Roux D, Pouyssegur J, Pages G (2005) Extracellular signal-regulated kinases phosphorylate mitogen-activated protein kinase phosphatase 3/DUSP6 at serines 159 and 197, two sites critical for its proteasomal degradation. Mol Cell Biol 25: 854-864 Monroe-Augustus M, Zolman BK, Bartel B (2003) IBR5, a dual-specificity phosphatase-like protein modulating auxin and abscisic acid responsiveness in Arabidopsis. Plant Cell 15: 2979-2991 Nakagami H, Pitzschke A, Hirt H (2005) Emerging MAP kinase pathways in plant stress signalling. Trends Plant Sci 10: 339-346 Nakagami H, Kiegerl S, Hirt H (2004) OMTK1, a novel MAPKKK, channels oxidative stress signalling through direct MAPK interaction. J Biol Chem 279: 26959-26966 Nakagami H, Soukupová H, Schikora A, Zárský V, Hirt H (2006) A mitogen-activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. J Biol Chem 281: 38697-38704 Naoi K, Hashimoto T (2004) A semidominant mutation in an Arabidopsis mitogenactivated  protein  kinase  phosphatase-like  gene  compromises  cortical  microtubule organization. Plant Cell 16: 1841-1853 Petersen M, Brodersen P, Naested H, Andreasson E, Lindhart U, Johansen B, Nielsen HB, Lacy M, Austin MJ, Parker JE, Sharma SB, Klessig DF, Martienssen R, Mattsson O, Jensen AB, Mundy J (2000) Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell 103: 1111-1120 Pouyssegur J, Mechta-Grigoriou F (2006) Redox regulation of the hypoxia-inducible factor. Biol Chem 387: 1337-1346 Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH (2001) Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev 22: 153-183 Quettier AL, Bertrand C, Habricot Y, Miginiac E, Agnes C, Jeannette E, Maldiney R (2006) The phs1-3 mutation in a putative dual-specificity protein tyrosine phosphatase gene provokes hypersensitive responses to abscisic acid in Arabidopsis thaliana. Plant J 47: 711-719  24  Roux PP, Blenis J (2004) ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev 68: 320344. Roberts RL, Fink GR (1994) Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Dev 8: 2974-2985 Sabbagh W, Jr, Flatauer LJ, Bardwell AJ, Bardwell L (2001) Specificity of MAP kinase signalling in yeast differentiation involves transient versus sustained MAPK activation. Mol Cell 8: 683-691 Staleva L, Hall A, Orlow SJ (2004) Oxidative stress activates FUS1 and RLM1 transcription in the yeast Saccharomyces cerevisiae in an oxidant-dependent manner. Mol Biol Cell 15: 5574-5582 Samuel MA, Miles GP, Ellis BE (2000) Ozone treatment rapidly activates MAP kinase signalling in plants. Plant J 22: 367-376 Schaffer R, Landgraf J, Accerbi M, Simon V, Larson M, Wisman E (2003) Microarray analysis of diurnal and circadian-regulated genes in Arabidopsis. Plant Cell 13: 113-123 Suarez-Rodriguez MC, Adams-Phillips L, Liu Y, Wang H, Su SH, Jester PJ, Zhang S, Bent AF, Krysan PJ (2006) MEKK1 is required for flg22-induced MPK4 activation in Arabidopsis plants. Plant Physiol 143: 661-669 Salojin KV, Owusu IB, Millerchip KA, Potter M, Platt KA, Oravecz T (2006) Essential role of MAPK phosphatase-1 in the negative control of innate immune responses. J Immunol 176: 1899-1907 Slack DN, Seternes OM, Gabrielsen M, Keyse SM (2001) Distinct binding determinants for ERK2/p38alpha and JNK MAP kinases mediate catalytic activation and substrate selectivity of MAP kinase phosphatase-1. J Biol Chem 276: 16491-16500 Teis D, Wunderlich W, Huber LA (2002) Localization of the MP1-MAPK scaffold complex to endosomes is mediated by p14 and required for signal transduction. Dev Cell 3: 803-814 Tena G, Asai T, Chiu WL, Sheen J (2001) Plant mitogen-activated protein kinase signalling cascades. Curr Opin Plant Biol 4: 392-400 Teige M, Scheikl E, Eulgem T, Dóczi R, Ichimura K, Shinozaki K, Dangl JL, Hirt H (2004) The MKK2 pathway mediates cold and salt stress signalling in Arabidopsis. Mol Cell 15: 141-152 Theodosiou A, Ashworth A (2002) MAP kinase phosphatases. Genome Biol 3: REVIEWS3009 25  Ulm R, Revenkova E, di Sansebastiano GP, Bechtold N, Paszkowski J (2001) Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis. Genes Dev 15: 699-709 Ulm R, Ichimura K, Mizoguchi T, Peck SC, Zhu T, Wang X, Shinozaki K, Paszkowski J (2002) Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1. EMBO J 21: 6483-6493 Widmann C, Gibson S, Jarpe MB, Johnson GL (1999) Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol Rev 79: 143-180 Waetzig V, Herdegen T (2005) Context-specific inhibition of JNKs: overcoming the dilemma of protection and damage. Trends Pharmacol Sci 26: 455-461 Wang Y, and Dohlman HG (2004) Pheromone signalling mechanisms in yeast: a prototypical sex machine. Science 306: 1508-1509 Whitmarsh AJ, Davis RJ (1998) Structural organization of MAP kinase signalling modules by scaffold proteins in yeast and mammals. Trends Biochem Sci 23: 481-485 Wang H, Ngwenyama N, Liu Y, Walker JC, Zhang S (2007) Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. Plant Cell 19: 63-73 Wu JJ, Zhang L, Bennett AM (2005) The noncatalytic amino terminus of mitogenactivated protein kinase phosphatase 1 directs nuclear targeting and serum response element transcriptional regulation. Mol Cell Biol 25: 4792-4803 Yamakawa H, Katou S, Seo S, Mitsuhara I, Kamada H, Ohashi Y (2004) Plant MAPK phosphatase interacts with calmodulins. J Biol Chem 279: 928-936 Yap YK, Kodama Y, Waller F, Chung KM, Ueda H, Nakamura K, Oldsen M, Yoda H, Yamaguchi Y, Sano H (2005) Activation of a novel transcription factor through phosphorylation by WIPK, a wound-induced mitogen-activated protein kinase in tobacco plants. Plant Physiol 139: 127-137 Zhang S, Klessig DF (2001) MAPK cascades in plant defense signalling. Trends Plant Sci 6: 520-527 Zhou F, Menke FL, Yoshioka K, Moder W, Shirano Y, Klessig DF (2004) High humidity suppresses ssi4-mediated cell death and disease resistance upstream of MAP kinase activation, H2O2 production and defense gene expression. Plant J 39: 920-932 Zhang Y, Blattman JN, Kennedy NJ, Duong J, Nguyen T, Wang Y, Davis RJ, Greenberg PD, Flavell RA, Dong C (2004) Regulation of innate and adaptive immune responses by MAP kinase phosphatase 5. Nature 430: 793-797 26  2. ARABIDOPSIS MAPK PHOSPHATASE 2 (MKP2) POSITIVELY REGULATES OXIDATIVE STRESS TOLERANCE AND INACTIVATES THE MPK3 AND MPK6 MAPKS 1  1. A version of this chapter has been published. Lee JS, Ellis BE (2007) Arabidopsis MAPK phosphatase 2 (MKP2) positively regulates oxidative stress tolerance and inactivates the MPK3 and MPK6 MAPKs. J Biol Chem 282: 25020-25029  27  2.1 Introduction To survive, plant cells must maintain redox homeostasis in the face of a range of oxidative challenges from both internal and external sources, including potentially damaging ‘reactive oxygen species’ (ROS) generated by high energy electron transfer systems in the chloroplasts, mitochondria and peroxisomes, and by environmental insults such as UV and ozone (Pellinen et al., 1999; Boldt and Scandalios, 1997; Mittler, 2002). At the same time, there is evidence that specific ROS can also act as signal transduction messengers, most notably in the detection and response processes by which plant cells deal with potential pathogens (Lamb and Dixon, 1997) and herbivores (Leitner et al., 2005), but also in physiological processes such as control of stomatal aperture (Zhang et al., 2001). These seemingly contrasting scenarios require the cell to manage ROS levels through temporally and spatially modulated mechanisms that allow suppression of undesirable ROS accumulation while still permitting intra- or intercellular transmission of ROS-encoded information. The first step in these redox homeostatic mechanisms is the detection and signalling of ROS levels through an orchestrated sequence of intracellular signalling events. Genes encoding mitogen-activated protein kinases (MAPKs) and their upstream activators (MAPK kinases and MAPK kinase kinases) form highly conserved families in eukaryotes, including plants (Hamel et al., 2006; Hirt, 2000; Wrzaczek and Hirt, 2001), and these kinase-based signal transduction modules are known to regulate a host of cellular processes, including responses to oxidant stress (Samuel et al., 2000). In Arabidopsis, the MAPKs most implicated in oxidative stress signalling are MPK3 and MPK6. Suppression of the ozone-activated MAPK, MPK6, results in a marked ozonehypersensitivity phenotype (Miles et al., 2005), as does loss of its close homolog, MPK3 28  (Miles et al., 2005), while constitutive activation of MPK6 in Arabidopsis by ectopic expression of a heterologous tobacco MAPKK, NtMEK, also induces rapid cell death (Liu and Zhang, 2004). Thus, it appears that either loss or unregulated activation of MPK3 and/or MPK6 makes plant cells more vulnerable to oxidative stress. The activation of MAPKs such as MPK3 and MPK6 is the result of MAPKK-catalyzed dual phosphorylation of a –TXY– motif in the activation loop near sub-domain VIII of the kinase domain (Jonak et al., 2002). ROS-elicited activation of these MAPKs is normally transient (Desikan et al., 2001), indicating that the –pT-X-pY– phosphate groups are quickly removed, and the MAPK is de-activated, presumably through the action of phosphoprotein phosphatases. Although much is known about the activation and biological roles of MPK3 and MPK6 in plants (Kovtun et al., 2000), the process by which they are inactivated remains unclear. In mammalian systems, MAPK dephosphorylation is typically catalyzed by a group of specialized dual-specificity phosphotyrosine phosphatases known as MAPK phosphatases (MKPs) that regulate the activities of their MAPK targets through specific dephosphorylation of both phosphotyrosine and phosphothreonine residues (Camps et al., 2000). Because both the magnitude and duration of MAPK activity can dictate the outcome of physiological responses, MKPs play important roles in modulating MAPK signalling processes. The 10 members of the mammalian MKP family exhibit differential specificities towards their MAPK substrates as well as distinct subcellular localization patterns (Dickinson and Keyse, 2006), and they are collectively responsible for the regulated dephosphorylation and inactivation of the 14 presently identified mammalian MAPKs. In contrast, the Arabidopsis genome encodes five potential MKPs, based on the amino acid sequence similarity of the phosphatase catalytic domain to established animal 29  MKPs (Kerk et al., 2002). This five member family of putative AtMKPs includes the previously reported members, AtMKP1, DsPTP1, PHS1 and IBR5, but among these, only one candidate, DsPTP1, has been shown to possess dephosphorylation activity against an Arabidopsis MAPK (MPK4) (Gupta et al., 1998). However, no physiological context has yet been defined for DsPTP1 activity. AtMKP1, on the other hand, was earlier reported to interact strongly with MAPK MPK6 in yeast two-hybrid assays, and the loss-of-function mkp1 mutant displayed mis-regulation of MPK6 activity specifically in response to genotoxic stress in planta (Ulm et al., 2001; Ulm et al., 2002). Despite these indications of a functional relationship between AtMKP1 and MPK6, the ability of AtMKP1 to catalyze dephosphorylation of activated MAPKs has not been demonstrated experimentally. Here, I describe genetic and biochemical studies showing that another putative MKP, AtMKP2 (At3g06110), participates in the regulation of cellular homeostasis in ozonechallenged tissue, and can influence the activation state of MPK3 and MPK6. Suppression of AtMKP2 creates a marked ozone sensitivity phenotype in Arabidopsis plants, and this hypersensitivity is accompanied by prolonged activation of both MPK3 and MPK6. I also show that AtMKP2 is a functional MKP capable of dephosphorylating the conserved –pTEpY– motif of MPK3 and MPK6 in vitro, and that its catalytic activity is significantly increased by association with these MAPKs. Overall, these results demonstrate that AtMKP2, the fifth member of the putative MKP family in Arabidopsis, contributes to the survival of plant cells challenged by redox stress, and that it may do so through its ability to specifically dephosphorylate the oxidant-activated MAPKs, MPK3 and 6.  30  2.2 Results 2.2.1  RNAi-silencing  yields  gene-specific  MKP-suppressed  genotypes Arabidopsis thaliana plants of the Columbia ecotype are relatively ozone-tolerant, and display no visible damage when exposed to ozone (500 ppb) for 24 hours. Such continuous ozone treatment results in rapid activation of two MAPKs, MPK3 and MPK6 (Ahlfors et al., 2004; Miles et al., 2005), which then return to basal levels of activity after ~2 hours, but loss of function for either kinase blocks the de-activation of the other, and is accompanied by increased ozone sensitivity (Miles et al., 2005). To determine whether any of the five putative Arabidopsis MKP candidates (AtMKP1, At3g06110, DsPTP1, PHS1, and IBR5) plays a role in controlling this refractory behaviour, or regulating the ozone tolerance phenotype, I examined the corresponding MKP loss-offunction penotypes. I first sought T-DNA insertional mutant lines lacking each of these five proteins, but were not able to isolate homozygous lines with T-DNA insertions in all cases, either because of a lack of mutant stocks for a particular gene, or because homozygous mutant plants could not be recovered in progeny populations. I therefore designed gene-specific RNAi constructs that target the highly divergent 5’-region of each of the five potential MKP genes. To avoid potentially damaging effects of long-term silencing, I also placed these RNAi constructs under the control of a DEX-inducible promoter. A. thaliana plants were transformed with each of the DEX-inducible MKP-RNAi constructs, and multiple transgenic lines were selected for evaluation. In the absence of DEX-induction, all of these lines grew normally and displayed the wild-type phenotype. 31  A series of T2-generation plants carrying each MKP-RNAi construct were then treated with 30 µM DEX for 24 hr and the expression level of each MKP gene was assessed by RT-PCR. Suppression of transcripts from each of the five endogenous MKP genes was observed to degrees ranging from partial to complete reduction of detectable mRNA (Figure 2.1A). From among the most strongly suppressed RNAi lines, two independent lines for each of the five MKP candidate genes were selected for confirmation of the specificity and effectiveness of the knock-down (Figure 2.1B), and then used for further study. Since high levels of expression of the GVG transactivator in transgenic plants carrying the pTA7002 DEX-inducible cassette have been reported to sometimes display stress phenotypes (Kang et al., 1999), MKP-RNAi transgenic lines were screened by RT-PCR for GVG expression levels (data not shown), and only lines with moderate to low levels of GVG expression were carried forward.  32  A  B  Figure 2.1 RNAi-mediated gene silencing creates gene family-specific loss-offunction genotypes. A, Suppression of AtMKP1, AtMKP2 (At3g06110), DsPTP1, PHS1 and IBR5 expression by DEX-induced RNAi-based gene silencing. The efficiency of silencing of each of the five MKP genes was determined by RT-PCR. Total RNA was extracted from three-week-old RNAi-expressing plants 24 hr after DEX (30 µM) treatment. Expression of an actin gene (ACT8) was also analyzed as a control. B, RTPCR analysis of Arabidopsis MKP candidate genes in each selected MKP-suppressed line 24 hr after DEX treatment (30 µM). Five MKP candidate gene transcripts were amplified by 27 cycles and actin8 was amplified by 25 cycles of PCR, using equal amounts of cDNA. All experiments were conducted at least twice with similar results and representative data from one such experiment are shown.  2.2.2 Only At3g06110-silenced plants exhibit enhanced sensitivity to ozone stress Simultaneous exposure of all five MKP-silenced genotypes to 500 ppb ozone resulted in tissue collapse across the leaf blade of At3g06110-silenced plants within two hours, 33  whereas no damage was observed on wild-type leaves, or on leaves of the other MKPRNAi-suppressed genotypes, at this time-point (Figure 2.2A). Ozone-induced cellular damage can be quantitatively assessed by measurements of ion leakage, indicative of increased membrane permeability. Measurements over an 8-hour ozone exposure period confirmed that At3g06110-silenced plants treated with acute ozone lost control of plasma membrane integrity far more rapidly than did wild type plants (Figure 2.2B). Leaves from wild-type plants did not display any visible tissue collapse by 8 hours and exhibited only a small increase in ion leakage over this exposure period. DEX-treated plants carrying the empty pTA7002 vector also showed no signs of ozone damage under these treatment conditions (data not shown). Overall, these data indicate that loss of At3g06110 function severely compromises the ability of Arabidopsis plants to control redox stress.  2.2.3 MPK3 and MPK6 de-activation is delayed in ozone-treated At3g06110-RNAi plants If MPK3 and 6 de-activation in ozone-treated plants is dependent on MKP activity, I predicted that MKP silencing should prolong MPK3 and MPK6 activation profiles during acute ozone challenge. To test this, expression of each MKP-RNAi construct was induced by DEX treatment, and the induced plants were challenged 24 hours later with 500 ppb ozone. Leaf samples were collected at times from 0 to 8 hours after onset of the ozone exposure and the state of activation of MPK3 and MPK6 was analyzed on Western blots of leaf extracts, using an anti-pERK antibody that recognizes only the doubly-phosphorylated form of these MAPKs. Uniformity of lane loading was monitored by subsequently stripping the blots and re-probing with anti-MPK6 antibodies, since MPK6 levels are known to be unaffected by stress treatments (Ahlfors et al., 2004). 34  The ozone activation profiles of both MPK3 and MPK6 were broadly similar in wild-type and in AtMKP1-RNAi, DsPTP1-RNAi, PHS1-RNAi, and IBR5-RNAi plants (Figure 2.2C), but in ozone-treated At3g06110-RNAi plants, activation of both kinases could be detected for up to ~8 hours, well beyond the point at which both kinases had been largely inactivated in the other MKP-suppressed lines.  35  Figure 2.2 AtMKP2 (At3g06110)-suppressed plants are hypersensitive to ozone and display prolonged MPK3 and 6 activation. A, Ozone-induced phenotype in 24hDEX  (30  µM)-treated  three-week-old  wild-type  and  MKP-suppressed  plants  photographed with or without 2 hr after initiation of ozone exposure (500 ppb). All experiments were conducted three times with identical results and a representative example of each genotype from the same experiment is shown. B, Ozone-induced ion leakage (% of total ion leakage) was measured in whole rosette leaves of wild-type and AtMKP2-silenced (At3g06110i) plants at various times (0, 2, 4, 8 hr) after the initiation of 36  ozone exposure (500 ppb). Mean and standard error were calculated from five rosette leaves per genotype, with three repetitions within an experiment (a total of 15 leaves per genotype). C, AtMPK3 and 6 activation profiles in wild-type and MKP-RNAi lines during ozone exposure. Activated MAPKs were detected in the wild-type and each of five phosphatase-suppressed lines by immunoblotting using anti-pERK1/2 antibody. Immunoblots were reprobed with anti-MPK6 antibody. Wild-type and MKP-RNAi (MKPi) lines were exposed to O3 (500 ppb) for 8 hr and leaf samples were collected at various time points after the beginning of the exposure. Experiments were conducted more than twice with similar results and representative data from one such experiment are shown.  2.2.4 Locus At3g06110 encodes a functional MKP (AtMKP2) Locus At3g06110 encodes a 18-kD protein with a well-conserved dual-specificity phosphatase (DSP) catalytic domain. DSPs act on both phospho-Tyr and phosphoSer/Thr residues in protein substrates, and in animals and yeast the DSP sub-group of MKPs is specifically involved in regulating MAPK activity (Keyse, 2000; Haneda et al., 1999). To determine whether the At3g06110 locus encodes a functional MKP enzyme, I examined the catalytic properties of the recombinant protein. Recombinant GSTchimeric protein was successfully expressed in Escherichia coli, and purified by affinity chromatography (Figure 2.3A). When assayed against the synthetic phosphatase substrate, OMFP, the recombinant protein was shown to dephosphorylate OMFP in a concentration- and time-dependent manner (Figures 2.3B and 2.3C). It is well-established that replacement of the conserved cysteine residue in the catalytic active site (VxVHCx2GxSRSx5AYLM) of canonical dual-specificity phosphatases by serine eliminates enzyme activity (Farooq and Zhou, 2004). As expected, when the C109S mutant was expressed as a GST fusion protein (GST-CIAt3g06110) this form of the gene product was found to possess no phosphatase activity in the OMFP assay system. Taken together, our data demonstrate that the protein encoded by At3g06110 can be considered a bona fide member of the MKP sub-family of eukaryotic dual37  specificity phosphatases, and I therefore named it AtMKP2.  Figure 2.3 GST-AtMKP2 (GST-At3g06110) dephosphorylates OMFP in a dose- and time-dependent manner. A, Purified samples (1 µg) of GST, GST-AtMKP2 (GSTAt3g06110) and GST-CIAtMKP2 (GST-CIAt3g06110) were separated on SDS-PAGE gels and stained with Coomassie Brilliant Blue. The positions of molecular mass 38  markers in kilodaltons are indicated on the left. B, OMFP was incubated with the indicated amounts of GST-AtMKP2 (GST-At3g06110, ○), GST-CIAtMKP2 (GSTCIAt3g06110, ●) or GST (■) at 22 °C for 30 min. The absorbance was measured at 477 nm. C, OMFP was incubated with 2.5 µg of GST-AtMKP2 (GST-At3g06110, ○), GSTCIAtMKP2 (GST-CIAt3g06110, ●), or GST (■) at 22 °C. At the indicated times, the absorbance (477 nm) was measured. All experiments were conducted more than twice with similar results and representative data from one such experiment are shown.  2.2.5 Recombinant AtMKP2 dephosphorylates phospho-MPK3 and MPK6 in vitro The activity of a MAPK is dependent on the phosphorylation status of its –TXY– motif (Kyriakis and Avruch, 2001), and these phospho-amino acid residues are also the target of MKP activity. The observation that loss of AtMKP2 function in AtMKP2-RNAi plants is associated with delayed inactivation of MPK3 and MPK6 (Figure 2.2C) indicated that the  AtMKP2  phosphatase  could  be  directly  or  indirectly  responsible  for  dephosphorylating these two MAPKs. To test this hypothesis, I conducted in vitro MAPK dephosphorylation assays using dually phosphorylated recombinant MPK3 and MPK6 as substrates. To ensure that MAPK autophosphorylation activity would not interfere with the phosphatase assays, MPK3 and MPK6 were first mutagenized at their ATP binding site to inhibit kinase activity. These “kinase inactive” products were expressed as recombinant fusion proteins (GST-KIMPK3, GST-KIMPK6) and phosphorylated by pre-incubation with a recombinant constitutively activated form of the upstream cognate MAPKK, GST-CAMKK4 (Figure 2.4B). The ability of AtMKP2 to dephosphorylate the – pTEpY– motif of MPK3 and MPK6 in vitro was tested by incubating different concentrations of recombinant GST-AtMKP2 with purified phospho-MPK3 or phosphoMPK6 and monitoring the disappearance of the –pTXpY– signal by immunoblot analysis using anti-pERK1/2 antibody. The phosphorylation of both MPK3 and MPK6 was 39  decreased upon incubation with GST-AtMKP2, in a dose-dependent manner, whereas incubation of the phospho-MAPKs with GST alone had no effect on their phosphorylation state (Figures 2.4C and 2.4D). To ascertain whether the ability of GSTAtMKP2 to dephosphorylate phospho-MPK3 and 6 is a reflection of non-specific phosphatase activity, another Arabidopsis MKP, DsPTP1, was expressed as a GST fusion and tested. Although DsPTP1 displays significant sequence similarity to AtMKP2, GST-DsPTP1 recombinant protein was unable to dephosphorylate either phosphoMPK3 or phospho-MPK6 (Figure 2.5). Similarly, when recombinant GST-AtMKP2 was incubated with another phospho-MPK (pMPK12) belonging to the Arabidopsis –TEY– subclass of MAPKs, the phosphatase was unable to de-activate this MPK (Figure 2.6). These results strongly support the idea that both MPK3 and MPK6 are direct and specific targets for AtMKP2.  40  Figure 2.4 AtMKP2 can dephosphorylate both MPK3 and MPK6 in vitro. A, SDSPAGE gel electrophoresis of the purified recombinant GST, GST-AtMKP2, GSTKIMPK3, GST-KIMPK6 and CAMKK4 fusion proteins. B, In vitro phosphorylation of GST-KIMPK3 and GST-KIMPK6 by the GST-CAMKK4. Kinase-negative GST-KIMPK3 and GST-KIMPK6 were incubated with (+) or without (-) GST-CAMKK4 protein in the kinase reaction mixture, and samples were separated on SDS-PAGE and subjected to immunoblot analysis using anti-pERK1/2 antibody. Immunoblots were reprobed with either anti-MPK3 or anti-MPK6 antibody. Phosphorylated MPK3 (C) or MPK6 (D) protein (1 µg) was incubated without or with increasing amounts of GST or GSTAtMKP2 (0 to 5 µg). Phosphorylation levels of MPK3 and MPK6 protein were assessed by immunoblotting with anti-pERK1/2 antibody. Immunoblots were then stripped and reprobed with either anti-MPK3 or anti-MPK6 antibody to detect levels of MPK3 or 41  MPK6 protein. Anti-GST antibody was also used for determining GST and GSTAtMKP2 protein amounts. Experiments were repeated three times with identical results.  Figure 2.5 Dephosphorylation of MPK3 and MPK6 by DsPTP1 was analyzed in vitro. A, SDS-PAGE gel electrophoresis of the purified recombinant GST and GSTDsPTP1 fusion proteins. B, OMFP was incubated with the indicated amounts of GSTDsPTP1 (○) or GST (●) at 22 °C for 30 min. The absorbance was measured at 477 nm. One µg phosphorylated MPK3 (C) or MPK6 (D) was incubated without or with increasing amounts of GST or GST-DsPTP1 (0, 1, 2.5, 5 µg). Phosphorylation levels of 42  MPK3 and MPK6 proteins were assessed by immunoblotting with anti-pERK1/2 antibody. Immunoblots were reprobed with either anti-MPK3 or anti-MPK6 antibody to detect protein levels of MPK3 or MPK6. Anti-GST antibody was also used for determining GST and GST-DsPTP1 protein amounts. Experiments were repeated three times with identical results.  Figure 2.6 AtMKP2 is unable to dephosphorylate MPK12 in vitro. A, Coomassie BB staining of the purified recombinant GST-KIMPK12 protein. B, phosphorylated MPK12 protein (1 µg) was incubated without or with increasing amounts of GST or GSTAtMKP2 (0, 1, 2.5, 5 µg). Phosphorylation levels of MPK12 protein were detected by immunoblotting with anti-pERK1/2 antibody. Recombinant GST, GST-MPK12 and GSTAtMKP2 protein amounts were detected by Coomassie Brilliant Blue (CBB) staining. Experiments were repeated more than twice with identical results.  2.2.6 AtMKP2 catalysis is stimulated specifically by association with MPK3 and MPK6 It has been reported that the in vitro activity of some mammalian MKPs is increased in the presence of their substrate MAPK (Camps et al., 1998; Chen et al., 2001). To examine the effect of Arabidopsis MAPKs on the catalytic activity of AtMKP2, I assayed 43  recombinant GST-AtMKP2 against OMFP in the presence and absence of recombinant MPK3, MPK6, MPK4 or MPK12. The addition of either MPK3 or MPK6 significantly enhanced the phosphatase activity of GST-AtMKP2 (Figure 2.7B), whereas addition of the same amount of either recombinant GST, or two other –TEY– class MAPKs, MPK4 and MPK12, had no effect on the enzyme activity. The observed activation of AtMKP2 by association with MPK3 or 6 reflected primarily a substantial increase in the affinity of AtMKP2 for its OMFP substrate (~5-fold increase in kcat/ Km) (Table 2.1). The stimulatory effect of association with MPK3 or MPK6 was unrelated to MAPK catalytic function, since co-incubation of GST-AtMKP2 with kinase-inactive mutant forms of MPK3 and 6 (GST-KIMPK3 and GST-KIMPK6) resulted in the same degree of enhancement of AtMKP2 phosphatase activity as had been observed with the catalytically active forms (Figure 2.7C).  44  Figure 2.7 Catalytic activation of AtMKP2 by MPK3 and MPK6. A, Coomassie BB staining of the purified recombinant GST, GST-MPK3, GST-MPK4, GST-MPK6, GSTMPK12, GST-KIMPK3 and GST-KIMPK6 proteins. B, The phosphatase activity of AtMKP2 (2.5 µg) in the presence of GST (∆), GST-MPK3 (○), GST-MPK4 (□), GSTMPK6 (●) or GST-MPK12 (■, 10 µg) was measured by monitoring OMFP hydrolysis at 22 °C (absorbance 477 nm). C, Hydrolysis of OMFP by AtMKP2 (2.5 µg) in the presence of GST (∆), GST-KIMPK3 (○) or GST-MPK6 (●, 10 µg). All experiments were  45  conducted more than twice with similar results and representative data from one such experiment are shown. Table 2.1 Kinetic parameters of AtMKP2 catalysis with OMFP as substrate.  All measurements were made at PH 8.0 and 22 °C, using 2.5 µg GST-AtMKP2 and 10 µg GST-MPK3 or 6.  2.2.7 AtMKP2 is predominantly localized in the nucleus Activation of MPK3 and MPK6 by ozone exposure was recently reported to trigger their translocation to the nucleus in Arabidopsis (Ahlfors et al., 2004), a response which would place the activated MAPKs in close proximity to potential target nuclear proteins such as transcription factors (Treisman, 1996). If AtMKP2 were actively involved in dephosphorylation of pMPK3 and pMPK6, I postulated that this phosphatase might be found in the same compartment. To examine this question, I generated transgenic plants expressing AtMKP2:yellow fluorescent protein (YFP) fusion products, using either a 390bp native AtMKP2 promoter and the genomic AtMKP2 gene fragment fused to YFP (construct ProAtMKP2:AtMKP2:YFP), or the AtMKP2 cDNA fused to YFP under control  of  the  Cauliflower  Mosaic  Virus  (CaMV)  35S  promoter  (construct  35S:AtMKP2:YFP). Examination of transgenic seedling roots by epifluorescence microscopy showed that, with either construct, ectopically expressed AtMKP2-YFP accumulated predominantly in  46  the nucleus, as assessed by co-localization with the DAPI signal (Figure 2.8A). No fluorescence signal was observed when untransformed wild-type plants were viewed with the same settings (data not shown), while plants expressing YFP alone (construct CaMV35S:YFP) displayed fluorescence throughout the cytoplasm and nucleus (Figure 2.8A), consistent with the subcellular localization pattern reported previously for YFP protein (Duque and Chua, 2003). These results demonstrate that AtMKP2 is a nuclear MKP in Arabidopsis, which places this negative regulator in the same subcellular location as ozone-activated MPK3 and MPK6.  2.2.8 AtMKP2-suppressed plants are hypersensitive to an ROSgenerating biotic stress Challenge with the bacterial elicitor, harpin, has been shown to induce both ROS accumulation (Samuel et al., 2005) and MPK3 and MPK6 activation (Desikan et al., 2001) in plant tissues, ultimately leading to Hypersensitive Response (HR)-like cell death. Because AtMKP2 appears to be associated with the control of cellular redox stress management (Figures 2.2A and 2.2B), and suppression of AtMKP2 expression prolongs the activation of MPK3 and MPK6 in response to oxidative signals (Figure 2C), I asked whether loss of AtMKP2 function might also influence the plant’s response to challenge with harpin. Topical application of low concentrations of recombinant harpin (0.5 ug/ul) to the leaves of wild-type plants did not induce any visible tissue response within 3 days, but when applied to the leaves of AtMKP2-RNAi plants, the same harpin concentration induced rapid cell death and tissue necrosis (Figure 2.8B). Loss of AtMKP2 function thus compromises the ability of Arabidopsis plants to manage both abiotic oxidative stress (ozone), and biotic stress that is known to lead to increased ROS accumulation in the challenged tissues (harpin). 47  Figure 2.8 AtMKP2 is a nuclear protein, and AtMKP2-suppressed plants are hypersensitive to harpin elicitor. A, Upper panel: the subcellular localization of the YFP fusion proteins in the root epidermal cells of 5-day-old transgenic plants containing the AtMKP2:YFP transgene. The yellow fluorescent signal of the YFP itself expressed from the CaMV35S promoter was used as a control. Lower panel: The corresponding nuclei were stained by DAPI.  Scale bar = 10 µm. B, Phenotype of wild-type and  AtMKP2i plants challenged with harpin. Leaves of three-week-old wild-type and AtMKP2i plants were locally infiltrated with harpin (0.5 ug/ul) 24 hr after DEX (30 µM) treatment. The photograph was taken 36 hr after harpin treatment. All experiments were conducted more than twice with similar results and representative data from one such experiment are shown.  48  2.3 Discussion Transient activation of one or both of the MPK3/MPK6 dyad of MAPKs in plant cells is a consistent early response to a wide range of biotic and abiotic stresses that are also typically associated with ROS accumulation in the stressed cells (Ahlfors et al., 2004; Desikan et al., 1999). However, despite this prominence it remains unclear how the activity of these two oxidant-responsive MAPKs is regulated in the context of orchestrating cellular responses. Indeed, the situation is further complicated by indications that, in addition to mediating various stress responses, MPK3 and/or MPK6 (or their putative orthologs) are also involved in plant developmental (Wang et al., 2007; Samaj et al., 2002) and hormone signalling (Ahlfors et al., 2004) pathways. MAPK inactivation in eukaryotes can be catalyzed by different classes of protein phosphatases, including protein-serine/threonine phosphatases and phosphotyrosine phosphatases  (PTPs)  (Keyse,  2000).  Since  MAPK  activation  involves  dual  phosphorylation on both threonine and tyrosine residues, the canonical MAPK deactivators are thought to be the dual-specificity subclass of the PTPs, which have been designated MKPs (Camps et al., 2000). The Arabidopsis genome encodes five candidate MKPs (AtMKP1, At3g06110, DsPTP1, PHS1, and IBR5), based on their catalytic domain sequence conservation (Kerk et al., 2002), and several of these have been implicated in various biological scenarios. Mutants of AtMKP1 were reported to show hypersensitivity to genotoxic stress, but not to other oxidant stresses (Ulm et al., 2001), and to also be less sensitive to elevated salt levels in the growth medium. Subsequent analysis revealed that AtMKP1 interacts with MPK6 and, to a lesser extent, with MPK3 and MPK4 in yeast two-hybrid screens (Ulm et al., 2002). Loss-of-function mutants of PHS1 displayed impaired microtubule organization (Naoi and Hashimoto, 49  2004) and abscisic acid hypersensitivity (Quettier et al., 2006), while ibr5 mutants showed reduced responsiveness to auxin and abscisic acid, compared to wild-type plants (Monroe-Augustus et al., 2003). Only DsPTP1 has been directly demonstrated to be capable of dephosphorylating an Arabidopsis MAPK (MPK4), but no in vivo role for DsPTP1 has yet been established. Indeed, it remains unknown whether the biological impacts of loss-of-function in the PHS1 and IBR5 genes are in any way related to an ability of the respective gene products to act as canonical MKPs and dephosphorylate specific MAPKs. In the present report, I use in vivo functional screening of all five putative Arabidopsis MKPs to demonstrate that the fifth family member, which I have designated AtMKP2, deactivates both MPK3 and MPK6, and positively influences the ability of the plant to withstand oxidative stress. The AtMKP2 gene (At3g06110) appears to fit the model of a cellular “housekeeping gene”, since it is expressed at moderate levels in all Arabidopsis tissues and developmental stages, and its expression is essentially unaffected by either ozone exposure (data not shown) or any of the 87 other treatments recorded in the Genevestigator microarray database (https://genevestigator-1.ethz.ch/at/index.php). The encoded protein is relatively small (18 kD), containing little more than the essential phosphatase catalytic domain. Although AtMKP2 is phylogenetically most closely related to DsPTP1 (64% amino acid sequence identity within the catalytic domain), the genes encoding these two proteins appear to have diverged functionally. Unlike AtMKP2, DsPTP1 expression is largely restricted to the male reproductive organs (stamen and pollen) in Arabidopsis (Genevestigator analysis). In addition, the DsPTP protein is predicted to possess an N-terminal transit peptide that would direct the protein to the chloroplast compartment, and recombinant DsPTP1 dephosphorylates MPK4 in  50  vitro (Gupta et al., 1998), whereas AtMKP2 is localized to the nucleus (Figure 2.8A), and recombinant AtMKP2 is able to dephosphorylate two other MAPKs, MPK3 and MPK6, but not MPK4 (Figures 2.4C and 2.4D). However, while both our in vivo and in vitro data indicate that AtMKP2 could contribute to regulation of the MPK3 and MPK6 activation cycle, it is not clear that the extended activation of these MAPKs in ozone-treated AtMKP2-suppressed plants is necessarily related to the enhanced sensitivity of plants to oxidant. Prolonged activation of ERK1/2 activation in mammalian cells has been reported to trigger cell death (Stanciu et al., 2000) and sustained activation of MPK3 and/or MPK6 also has been shown to be associated with stress-induced cell death in plants (Miles et al., 2005), but the loss of membrane integrity in ozone-challenged AtMKP2-suppressed plants is detected even before MPK3/6 de-activation might normally begin to take effect in wild-type plants (Figure 2.2B). It therefore seems very likely that loss of AtMKP2 function is also affecting other cellular targets, in addition to MPK3 and MPK6 de-activation. Since no TDNA insertional mutants have been identified for this gene, and seedlings in which RNAi-mediated AtMKP2-suppression has been induced show severe developmental defects (Appendix figure A.10), it is possible that AtMKP2 activity is crucial for regulation of early development, either directly or through the modulation of intracellular ROS pools. While the deactivation of MPK3 and MPK6 is substantially delayed in ozone-treated AtMKP2-suppressed plants, it is clear that the inactivation process is not completely blocked. This might indicate that other protein phosphatases, presumably belonging to functional classes other than the MKPs, can participate in dephosphorylation of these two MAPKs. In this context, it is noteworthy that loss of AtMKP1 function in Arabidopsis 51  not only resulted in increased genotoxic stress sensitivity but also reduced the level of MPK6 activation induced by genotoxic agents (Ulm et al., 2002), consistent with the idea that MKP1 may be capable of dephosphorylating MPK6, at least in certain contexts. In Medicago, a wound-induced member of the PP2C class of protein phosphatases (MP2C) was shown to be able to dephosphorylate the phospho-Thr residue within the – pTX-pY– motif on SIMK, a putative ortholog of AtMPK6 (Meskiene et al., 1998). MPK6 thus appears to not only occupy a central position in plant stress signalling pathways, but to be subject to post-translational regulation by multiple players. The ability of recombinant AtMKP2 to dephosphorylate the synthetic substrate, OMFP, in vitro enabled us to examine the impact of co-incubation of the phosphatase with its presumed in vivo substrates, MPK3 and MPK6. The activity of AtMKP2 was found to be markedly increased by such co-incubation, and this effect was independent of MAPK catalytic function (Figures 2.7B and 2.7C). Binding of two different mammalian MKPs to their substrate MAPKs was similarly found to significantly increase the in vitro phosphatase activity (Kyriakis and Avruch, 2001; Camps et al., 1998). The phosphatase activity of NtMKP1 (a tobacco AtMKP1 ortholog) was also recently shown to be markedly stimulated by co-incubation with SIPK (a tobacco MAPK ortholog of Arabidopsis MPK6), whereas another MAPK, wound-induced protein kinase (an Arabidopsis MPK3 ortholog), had a weaker effect (Katou et al., 2005). Association of MKPs with their protein substrate(s) may therefore generally enhance the catalytic activity of MKPs in both animals and plants. Such a mechanism could contribute to regulation of MKP specificity for different MAPKs, an issue about which little is known at the moment in plants. In conclusion, I have shown that AtMKP2, the fifth member of the putative MKP gene 52  family in Arabidopsis, is a functional MAPK phosphatase that possesses the ability to specifically de-activate the Arabidopsis MAPKs, MPK3 and MPK6. The catalytic activity of AtMKP2 is enhanced in vitro by association with its physiological targets, MPK3 and MPK6, and our genetic evidence strongly supports the notion that AtMKP2 function helps control the outcome of the cellular response to oxidant challenge in Arabidopsis.  2.4 Experimental procedures 2.4.1 Plant materials and treatments Wild-type Arabidopsis (ecotype ‘Columbia-0’) and five MKP-RNAi lines (AtMKP1i, AtMKP2i, DsPTP1i, PHS1i, and IBR5i) were used in this study. After sterilization, all seeds were sown on agar-solidified MS medium with or without 50 µg/ml hygromycin and stratified at 4 °C for 3 days before incubation at 22 °C under constant white light for seed germination and seedling growth. One-week-old seedlings were transferred to soil and grown further under environmentally controlled conditions (22 ºC under a 16 hour photoperiod) for 2 weeks. At this point, silencing of each of the five potential MKPs in the appropriate RNAi lines was induced by spraying the plants to run-off with 30 µΜ dexamethasone (DEX). For the ozone treatment, 24 hous following DEX induction, the plants were exposed to ozone (500 ppb) generated by a Delzone ZO-300 ozonegenerating sterilizer (DEL Industries, San Luis Obispo, CA, USA) and monitored with a Dasibi 1003-AH ozone analyzer (Dasibi Environmental Corporation, Glendale, Ca, USA). For the harpin treatment, the third and fourth fully developed leaves on DEX-induced plants were infiltrated with recombinant harpin (0.5 ug/ul) using a 1-ml syringe without needle. Samples for protein and RNA preparation were collected at various times after 53  these treatments, frozen in liquid nitrogen, and stored at -80 ºC until use.  2.4.2 Generation of Arabidopsis MKP-RNAi lines The double-stranded RNA interference (dsRNA) constructs were produced via a PCRmediated approach using the amplification products from the unique N-terminal regions (~300 bp) of AtMKP1, AtMKP2, DsPTP1, PHS1, and IBR5. A minimal intron based on the splice junctions and flanking regions belonging to the fourth intron of MPK6 was integrated into the sense strand primers. The sense strands were then amplified using a primer combination that generated a Xho1 restriction site on one end, and an intron plus restriction site (either EcoR1 or BamH1) sequence on the opposite end of the product. The anti-sense strands were amplified using a primer combination that added a Spe1 site and either EcoR1 or BamH1 restriction sites on the opposite ends of the amplicon. These two products were cloned into Xho1/Spe1-digested pTA7002 by a triple ligation, which placed the RNAi construct under the control of the steroid-inducible promoter (Aoyama and Chua, 1997). Agrobacterium tumefaciens GV3101 carrying the different constructs was grown overnight in LB medium containing 25 µg/ml gentamycin and 50 µg/ml kanamycin. Four-week-old Arabidopsis plants (Col-0) were transformed by the floral dip method (Clough and Bent, 1998).  2.4.3 RNA isolation and RT-PCR analysis To analyze the level of gene expression by reverse transcriptase-mediated PCR, total RNA samples were prepared from 3-week-old plants using the RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions. Concentration of RNA was determined by measuring OD at 260 nm. Reverse transcription was performed using a First-strand cDNA Synthesis Kit (Amersham Pharmacia Biotech) and aliquots of the  54  resulting RT reaction product were used as template for RT-PCR analysis. The following primers were used for RT-PCR : ACT8 forward, 5’-ATTAAGGTCGTGGCA-3’ ; ACT8 reverse,  5’-TCCGAGTTTGAAGAGGCTAC-3’  ;  AtMKP1  forward,  5’-  CGCGGATCCGCGATGTGGAGAGAAGGGCAAAGTTTTG-3’ ; AtMKP1 reverse, 5’CCGGAATTCCGGTTATAGCGCGCTCAGCAGTGCTAGCA-3’ ; AtMKP2 forward, 5’CGCGGATCCGCGATGGAGAAAGTGGTTGATCTCTTCG-3’ ; AtMKP2 reverse, 5’CCGGAATTCCGGAAGCAATCATGCATTACCTTGGATG-3’ ; DsPTP1 forward ; 5’CGCGGATCCGCGCCTTCTTTTCCAATGAGTTCTAGAG-3’ ; DsPTP1 reverse ; 5’CCGGAATTCCGGTCCACAACCACTTGCTTTTCATCCTC-3’ ; PHS1 forward ; 5’CCGCTCGAGCGGATGGCGGAACCTGAGAAGAAGCGAG-3’ ; PHS1 reverse ; 5’TATAGTCCTTTGGATGGTACCGTTTGATTATAGTCCTTTGGATGGTACCGTTTGATGG CGGAATCA-3’  ;  IBR5  forward  ;  5’-  CGCGGATCCGCGATGAGGAAGAGAGAAAGAGAGAACC-3’ ; IBR5 reverse ; 5’CGCGGATCCGCGCTAAGAGCCATCCATTGCAATATCAC-3’.  2.4.4 Protein extraction and immunoblot analysis The frozen tissues were ground in liquid nitrogen and homogenized in extraction buffer (100 mM HEPES, pH 7.5, 5 mM EDTA, 5 mM EGTA, 2 mM DTT, 10 mM Na3VO4, 10 mM NaF, 50 mM β-glycerolphosphate, 1 mM phenylmethylsulfonylfluoride, 1 tablet per 50 ml extraction buffer of proteinase inhibitor cocktail (Roche), 10% glycerol, 7.5% (w/v) polyvinypolypyrrolidone). After centrifugation at 13,000 rpm for 30 min, aliquots of supernatant were frozen immediately in liquid nitrogen and stored at -20°C. The protein concentration was determined using a Bradford assay (Bio-Rad) with BSA as a standard. Immunoblot analysis was performed using anti-phospho-ERK1/2 (1:2000) (New England Biolabs), anti-MPK3 (1:2000) (Sigma), anti-MPK6 (1:5000) (Sigma) or 55  anti-GST (1:5000) (Sigma) antibody as primary antibody, and peroxidase-conjugated goat anti-rabbit IgG (1:5000) or anti-mouse IgG (1:5000) (Dako) as secondary antibody.  2.4.5 Ion leakage assay Ozone-induced cell death was quantified by measuring ion leakage with a Model 2052 digital conductivity meter (VWR) in whole rosette leaves after 4 hour incubation in 5 ml distilled water. Leakage was expressed as percentage of total ion release, quantified after killing the leaves by autoclaving. Fifteen leaves from five plants per genotype were assayed in each of the replicate experiments.  2.4.6 Construction of KIMPK3, KIMPK6, KIMPK12, CAMKK4, CAMKK9, and CIAtMKP2 clones Expression vectors were created for mutant forms of GST-MPK3-, GST-MPK6-, GSTMPK12-, GST-MKK4-, GST-MKK9-, and GST-AtMKP2-encoded proteins in which the ATP binding site was modified to block activity (K67R for KIMPK3, K92R for KIMPK6, and K70R for KIMPK12), or the MKK activation phosphorylation sites were replaced with acidic residues to create a constitutively active kinase (T224D and S230E for CAMKK4, and S195E and S201E for CAMKK9), or the catalytic active site cysteine residue was replaced by serine (C109S for CIAtMKP2). All such modifications were carried out by site-directed mutagenesis with the ExSite PCR-based site-directed mutagenesis kit (Stratagene), using the expression plasmid carrying a GST-MPK3, GST-MPK6, GST-MPK12, GST-MKK4, GST-MKK9, or GST-AtMKP2 cDNA insert, respectively, as template. The mutated constructs were sequenced to confirm the changes and the absence of mismatches.  56  2.4.7 Recombinant protein production Full-length cDNAs corresponding to MPK3, MPK6, MPK12, MKK4, MKK9, AtMKP2 and DsPTP1 were amplified by PCR. The amplicons were purified and digested by the appropriate restriction enzymes and subcloned in either the pGEX 4T-2 or pDESTTM15 vector, which expresses the recombinant protein with a N-terminal GST tag, to yield the vectors pGEX-MPK3, pGEX-MPK6, pGEX-MPK12, pGEX-MKK4, pGEX-MKK9, pGEXAtMKP2 and pGEX-DsPTP1. Wild-type and mutant expression vectors were transformed into the bacterial host strain BL21 (DE3), and expression of protein was induced at mid-log phase by addition of 0.5 mM isopropylthio-β-galactoside (4 hour, 25 °C). Recombinant proteins were purified on a glutathione affinity matrix according to the manufacturer’s protocol (Amersham Pharmacia).  2.4.8 Phosphatase assay Phosphatase activity of AtMKP2 was assayed at 22 °C in a reaction buffer containing 50 mM Tris-HCl (pH 8), 150 mM NaCl, 1 mM EDTA, and 500 µM 3-O-methylfluorescein phosphate (OMFP) in a 0.8 ml final volume. The reaction was quenched by addition of 0.2 ml 5N NaOH, and the amount of product (3-O-methylfluorescein), was determined from the absorbance at 477 nm. Kinetic parameters were determined by LineweaverBurke plot and linear least squares line analysis of initial velocity data obtained from seven different concentrations of OMFP.  2.4.9 In vitro dephosphorylation assay To prepare phosphorylated MPK3 and MPK6, recombinant GST-CAMKK4 was mixed with either recombinant GST-KIMPK3 or GST-KIMPK6 at 1:4 ratio in the kinase buffer (25 mM Tris-HCl pH 7.5, 5 mM β-glycerolphosphate, 2 mM dithiothreitol, 10 mM MgCl2,  57  200 µM ATP) and incubated at 30°C for 30 min. To prepare phosphorylated MPK12, recombinant GST-CAMKK9 was mixed with recombinant GST-KIMPK12. The reaction mixture was then desalted on a Centri-Spin-10 column to separate free ATP from the kinases. To dephosphorylate the MPK3, MPK6 and MPK12 protein various amounts of either recombinant GST or recombinant AtMKP2 and DsPTP1 (0, 1, 2.5, 5 µg) proteins were mixed with 1.0 µg of phosphorylated MPK3, MPK6, or MPK12 preparation and incubated at 30°C for 30 min. The reaction was terminated by addition of concentrated SDS-PAGE sample buffer followed by boiling for 5 min. Samples were separated on a 10% SDS-PAGE gel, and phosphorylation of GST-KIMPK3, GST-KIMPK6 and GSTKIMPK12 was visualized by immunoblot analysis using anti-pERK1/2 antibody which specifically recognizes the dually phosphorylated –pTXpY– motif in phospho-MPK3, phospho-MPK6 and phospho-MPK12.  2.4.10 Subcellular localization Constructs expressing AtMKP2-YFP fusion protein were prepared using the Gateway™ system (Invitrogen). To generate 35S:AtMKP2:YFP, the AtMKP2 open reading frame was amplified and introduced into the pENTRTM vector. One fully sequenced clone was inserted into the vector pGWB41 (Research Institute of Molecular Genetics, Matsue, Japan). To generate the ProAtMKP2:AtMKP2:YFP construct, a 1.5-kb AtMKP2 genomic fragment upstream of the ORF was amplified and the amplified fragment was introduced into the vector pGWB40 (Research Institute of Molecular Genetics, Matsue, Japan). Transgenic Arabidopsis seedlings expressing each AtMKP2:YFP fusion construct were grown in sterile agar culture for 5 days. DNA was stained with 1 mg/ml 4′-6-diamidino-2-phenylindole dihydrochloride (DAPI) for 10 min. Roots were washed three times for 10 min and then mounted in water under glass cover slips for microscopy. 58  The mounted specimens were examined using a Zeiss Axiophot epifluorescence microscope. A wavelength of 514-nm was used for YFP excitation, along with a 63x NA 1.4 oil-immersion lens. Recombinant harpin from E. coli BL-21 cells harboring the pT7-7 plasmid containing the DNA fragment encoding harpinPsph was purified essentially according to Lee et al. (2001) except 40% saturation of ammonium sulfate was used for the precipitation, and desalting and concentrating were achieved through dialysis (14– 18 kDa cutoff).  59  2.5 References Aoyama T, Chua NH (1997) A glucocorticoid-mediated transcriptional induction system in transgenic plants. Plant J 11: 605-612 Ahlfors R, Macioszek V, Rudd J, Brosche M, Schlichting R, Scheel D, Kangasjarvi J (2004) Stress hormone-independent activation and nuclear translocation of mitogen-activated protein kinases in Arabidopsis thaliana during ozone exposure. Plant J 40: 512-522 Boldt R, Scandalios JG (1997) Influence of UV-light on the expression of the Cat2 and Cat3 catalase genes in maize. Free Radic Biol Med 23: 505-514 Camps M, Nichols A, Arkinstall S (2000) Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J 14: 6-16 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 Camps M, Nichols A, Gillieron C, Antonsson B, Muda M, Chabert C, Boschert U, Arkinstall S (1998) Catalytic activation of the phosphatase MKP-3 by ERK2 mitogen-activated protein kinase. Science 280: 1262-1265 Chen P, Hutter D, Yang X, Gorospe M, Davis RJ, Liu Y (2001) Discordance between the binding affinity of mitogen-activated protein kinase subfamily members for MAP kinase phosphatase-2 and their ability to activate the phosphatase catalytically. J Biol Chem 276: 29440-29449 Desikan R, Hancock JT, Ichimura K, Shinozaki K, Neill SJ. (2001) Harpin induces activation of the Arabidopsis mitogen-activated protein kinases AtMPK4 and AtMPK6. Plant Physiol 126: 1579-1587 Dickinson RJ, Keyse SM (2006) Diverse physiological functions for dual-specificity MAP kinase phosphatases. J Cell Sci 119: 4607-4615 Duque P, Chua NH (2003) IMB1, a bromodomain protein induced during seed imbibition, regulates ABA- and phyA-mediated responses of germination in Arabidopsis. Plant J 35: 787-799 Desikan R, Clarke A, Atherfold P, Hancock JT, Neill SJ (1999) Harpin induces mitogen-activated  protein  kinase  activity  during  defence  responses  in  Arabidopsis thaliana suspension cultures. Planta 210: 97-103 Farooq A, Zhou MM (2004) Structure and regulation of MAPK phosphatases. Cell Signal 16: 769-779  60  Gupta R, Huang Y, Kieber J, Luan S (1998) Identification of a dual-specificity protein phosphatase that inactivates a MAP kinase from Arabidopsis. Plant J 16: 581589 Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, Ehlting J, Beaudoin N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, Ohashi Y, Scheel D, Sheen J, Xing T, Zhang S, Seguin A, Ellis BE (2006) Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci 11: 192-198 Hirt H (2000) MAP kinases in plant signal transduction. Results Probl Cell Differ 27: 1-9 Haneda M, Sugimoto T, Kikkawa R (1999) Mitogen-activated protein kinase phosphatase: a negative regulator of the mitogen-activated protein kinase cascade. Eur J Pharmacol 365: 1-7 Jonak C, Okresz L, Bogre L, Hirt H (2002) Complexity, cross talk and integration of plant MAP kinase signalling. Curr Opin Plant Biol 5: 415-424 Kovtun Y, Chiu WL, Tena G, Sheen J (2000) Functional analysis of oxidative stressactivated mitogen-activated protein kinase cascade in plants. Proc Natl Acad Sci 97: 2940-2945 Kerk D, Bulgrien J, Smith DW, Barsam B, Veretnik S, Gribskov M (2002) The complement of protein phosphatase catalytic subunits encoded in the genome of Arabidopsis. Plant Physiol 129: 908-925 Kang HG, Fang Y, Singh KB (1999) A glucocorticoid-inducible transcription system causes severe growth defects in Arabidopsis and induces defense-related genes. Plant J 20: 127-133 Keyse SM (2000) Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curr Opin Cell Biol 12: 186-192 Kyriakis JM, Avruch J (2001) Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev 81: 807-869 Katou S, Karita E, Yamakawa H, Seo S, Mitsuhara I, Kuchitsu K, Ohashi Y (2005) Catalytic activation of the plant MAPK phosphatase NtMKP1 by its physiological substrate salicylic acid-induced protein kinase but not by calmodulins. J Biol Chem 280: 39569-39581 Lamb C, Dixon RA (1997) The oxidative burst in plant disease resistance. Annu Rev Plant Physiol Plant Mol Biol 48: 251-275 Leitner M, Boland W, Mithofer A (2005) Direct and indirect defences induced by piercing-sucking and chewing herbivores in Medicago truncatula. New Phytol 167: 597-606 61  Liu Y, Zhang S (2004) Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis. Plant Cell 16: 3386-3399 Lee J, Klessig DF, Nurnberger T (2001) A harpin binding site in tobacco plasma membranes mediates activation of the pathogenesis-related gene HIN1 independent of extracellular calcium but dependent on mitogen-activated protein kinase activity. Plant Cell 13: 1079-1093 Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405-410 Miles GP, Samuel MA, Zhang Y, Ellis BE (2005) RNA interference-based (RNAi) suppression of AtMPK6, an Arabidopsis mitogen-activated protein kinase, results in hypersensitivity to ozone and misregulation of AtMPK3. Environ Pollut 138: 230-237 Monroe-Augustus M, Zolman BK, Bartel B (2003) IBR5, a dual-specificity phosphatase-like protein modulating auxin and abscisic acid responsiveness in Arabidopsis. Plant Cell 15: 2979-2991 Meskiene I, Bogre L, Glaser W, Balog J, Brandstotter M, Zwerger K, Ammerer G, Hirt H (1998) MP2C, a plant protein phosphatase 2C, functions as a negative regulator of mitogen-activated protein kinase pathways in yeast and plants. Proc Natl Acad Sci 95: 1938-1943 Naoi K, Hashimoto T (2004) A semidominant mutation in an Arabidopsis mitogenactivated  protein  kinase  phosphatase-like  gene  compromises  cortical  microtubule organization. Plant Cell 16: 1841-1853 Pellinen R, Palva T, Kangasjarvi J (1999) Short communication: subcellular localization of ozone-induced hydrogen peroxide production in birch (Betula pendula) leaf cells. Plant J 20: 349-356 Quettier AL, Bertrand C, Habricot Y, Miginiac E, Agnes C, Jeannette E, Maldiney R (2006) The phs1-3 mutation in a putative dual-specificity protein tyrosine phosphatase gene provokes hypersensitive responses to abscisic acid in Arabidopsis thaliana. Plant J 47: 711-719 Samuel MA, Miles GP, Ellis BE (2000) Ozone treatment rapidly activates MAP kinase signalling in plants. Plant J 22: 367-376 Samuel MA, Hall H, Krzymowska M, Drzewiecka K, Hennig J, Ellis BE (2005) SIPK signalling controls multiple components of harpin-induced cell death in tobacco. Plant J 42: 406-416 Samaj J, Ovecka M, Hlavacka A, Lecourieux F, Meskiene I, Lichtscheidl I, Lenart P, Salaj J, Volkmann D, Bogre L, Baluska F, Hirt H (2002) Involvement of the 62  mitogen-activated protein kinase SIMK in regulation of root hair tip growth. EMBO J 21: 3296-306 Stanciu M, Wang Y, Kentor R, Burke N, Watkins S, Kress G, Reynolds I, Klann E, Angiolieri MR, Johnson JW, DeFranco DB (2000) Persistent activation of ERK contributes to glutamate-induced oxidative toxicity in a neuronal cell line and primary cortical neuron cultures. J Biol Chem 275: 12200-12206 Treisman R (1996) Regulation of transcription by MAP kinase cascades. Curr Opin Cell Biol 8: 205-215 Ulm R, Revenkova E, di Sansebastiano GP, Bechtold N, Paszkowski J (2001) Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis. Genes Dev 15: 699-709 Ulm R, Ichimura K, Mizoguchi T, Peck SC, Zhu T, Wang X, Shinozaki K, Paszkowski J (2002) Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1. EMBO J 21: 6483-6493 Wrzaczek M, Hirt H (2001) Plant MAP kinase pathways: how many and what for? Biol Cell 93: 81-87 Wang H, Ngwenyama N, Liu Y, Walker JC, Zhang S (2007) Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. Plant Cell 19: 63-73 Zhang X, Zhang L, Dong F, Gao J, Galbraith DW, Song CP (2001) Hydrogen peroxide is involved in abscisic acid-induced stomatal closure in Vicia faba. Plant Physiol 126: 1438-1448  63  3. ARABIDOPSIS MITOGEN-ACTIVATED PROTEIN KINASE MPK12 INTERACTS WITH THE MAPK PHOSPHATASE IBR5 AND REGULATES AUXIN SIGNALLING 2  2. A version of this chapter has been submitted for publication. Lee JS, Wang S, Sritubtim S, Chen JG, Ellis BE. Arabidopsis mitogen-activated protein kinase MPK12 interacts with the MAPK phosphatase IBR5 and regulates auxin signalling.  64  3.1 Introduction Mitogen-activated protein kinases (MAPKs) constitute a highly conserved family of enzymes in eukaryotes, and in plants MAPK-based signal transduction modules regulate a large number of physiological processes, including responses to environmental stresses and phytohormones (Widmann et al., 1999; MAPK Group, 2002). It has been shown that differences in the duration and magnitude of MAPK activity generated through the counterplay of activating and inactivating agents can regulate signalling specificity and help determine appropriate physiological outcomes (Ebisuya et al., 2005; Murphy and Blenis, 2006). Activation of the MAPKs is regulated via dual phosphorylation of the conserved –TXY– motif located in the activation loop by upstream kinases (MAPKKs), and this activation can be reversed by dephosphorylation through  protein  phosphatases,  including  Tyr-specific  phosphatases,  Ser/Thr  phosphatases and dual-specificity phosphatases (Keyse, 2000). In mammalian systems, MAPK dephosphorylation is typically catalyzed by a group of specialized dual-specificity phosphatases known as MAPK phosphatases (MKPs) that regulate the activities of their MAPK targets through specific dephosphorylation of both phosphotyrosine and phosphothreonine residues (Camps et al., 2000; Owens and Keyse, 2007). The Arabidopsis genome encodes five potential MKPs (AtMKP1, AtMKP2, DsPTP1, PHS1 and IBR5), based on the amino acid sequence similarity of the phosphatase catalytic domain to established animal MKPs. AtMKP2 and DsPTP1 have been shown to possess dephosphorylation activity against Arabidopsis MAPKs (MPK3, 4 and 6) in vitro (Lee and Ellis, 2007; Gupta et al., 1998), although the in vivo substrates and biological function of DsPTP1 remain unknown. AtMKP1 was found to interact with a small subset of MAPKs in yeast two-hybrid assays and to suppress phosphorylation of 65  MPK6 in planta (Ulm et al., 2002). The screening of mutagenized plant populations and reverse genetics led to the identification of other MKP candidate genes implicated in hormonal signalling and the control of microtubule organization (Monroe-Augustus et al., 2003; Naoi and Hashimoto, 2004). While these genetic studies give a strong indication of the physiological importance of MKPs in Arabidopsis, there is little information available concerning the dephosphorylating activity of MKPs on activated MAPKs, or the role the MKPs play in modulating MAPK cascade activity in specific physiological contexts. Auxin is an essential plant hormone that has been implicated in most aspects of plant growth and development. At the whole plant level, auxin regulates tropisms, apical dominance and root development, and ultimately controls the architecture of adult plants (Quint and Gray, 2006). Several studies have implicated MAPK pathway components in auxin signalling. On the other hand, Mockaitis and Howell (2000) reported that auxin treatment led to an increase in the activity of unidentified MAPKs in Arabidopsis, while extracts from auxin-treated tobacco cells also displayed enhanced MAPK activity (Mizoguchi et al., 1994). On the other hand, Kovtun and colleagues, using an Arabidopsis leaf protoplast transient expression system, reported that an oxidative stress-activated MAPK cascade could negatively regulate early auxin responses (Kovtun et al., 2000). Forward genetic screens for auxin-response mutants in Arabidopsis also identified ibr5, a putative MKP, as a reduced sensitivity mutant (Monroe-Augustus et al., 2003), suggesting that IBR5 might act as a positive regulator of auxin signalling by inactivating one or more MAPKs. Although these findings collectively support the involvement of both positive and negative MAPK pathways in auxin signalling, it remains largely unknown how and which MAPK(s) regulate auxin  66  responses in plants. Here, I report the identification of Arabidopsis MAPK (MPK12) as a negative regulator of auxin signalling and a substrate of IBR5. I show that MPK12 specifically interacts with IBR5, and that phosphorylated MPK12 can be dephosphorylated by the IBR5 phosphatase in vitro, confirming its function as an active MKP in Arabidopsis. I also show that suppression of MPK12 in transgenic plants leads to the up-regulation of auxin-responsive genes and to an auxin-hypersensitive root growth phenotype.  3.2 Results 3.2.1 Identification of Arabidopsis MPK12 as an IBR5-specific interactor It has been reported that the inactivation of MAPKs by dual-specificity MKPs involves the formation of a physical complex between the phosphatase and its substrate MAPK (Slack et al., 2001; Hutter et al., 2000). To determine whether the IBR5 protein can interact directly with any of the Arabidopsis MAPKs, I used a directed yeast two-hybrid assay to evaluate in a pair-wise manner the ability of IBR5 to interact with 19 of the 20 members of the Arabidopsis MAPK family. For each pair-wise test, IBR5 fused to the DNA binding domain of GAL4 served as the bait protein, whereas a MAPK fused to the transcriptional activation domain of GAL4 served as the prey. I found that IBR5 strongly interacts with MPK12 but not with any other Arabidopsis MAPKs tested (Figure 3.1A and appendix figure A.18). The interaction between IBR5 and MPK12 was confirmed by selectable marker and β–galactosidase reporter activation upon co-transformation of IBR5 and MPK12 in bait and prey vectors, and vice versa (Figures 3.1A and 3.2). While these results indicated that IBR5 binds specifically to MPK12 in yeast, I wished to 67  establish that the observed two-hybrid interaction reflected a direct physical contact. A polyclonal MPK12 antiserum raised against a MPK12-specific peptide was shown to detect recombinant MPK12 expressed in E. coli (Figure 3.1B), and this was used in an in vitro binding assay. Recombinant GST-IBR5 and GST-MPK12 were purified by glutathione affinity chromatography, after which GST was removed from recombinant GST-MPK12 by proteolytic cleavage. Following co-incubation of GST-IBR5 and MPK12 proteins, the mixture was fractionated over a glutathione column and the eluates were analyzed by SDS/PAGE and Western blot analysis, using MPK12-specific antibodies. In agreement with the two-hybrid data, MPK12 was retained on immobilized GST-IBR5, whereas immobilized GST alone was unable to retain any MPK12 (Figure 3.1C). To confirm that IBR5 also interacts with MPK12 in vivo, I transiently expressed fulllength HA-tagged IBR5 and myc-tagged MPK12 cDNA clones under control of the Cauliflower Mosaic Virus (CaMV) 35S promoter simultaneously in Arabidopsis leaf protoplasts.  Total  protoplast  protein  was  subsequently  extracted,  and  then  immunoprecipitated with anti-MPK12 serum. The immunoprecipitated proteins were subjected to SDS-PAGE and immunoblotting using anti-HA or anti-myc serum. While the anti-MPK12 antiserum was able to pull down both MPK12 and IBR5, the MPK12 pre-immune serum failed to co-precipitate any detectable IBR5 (Figure 3.1D). Together, these data demonstrate that the interaction between IBR5 and MPK12 occurs both in vitro and in vivo. To further characterize the structural requirements of the interaction, deletion variants of MPK12 were fused to the GAL4 activation domain and assayed against IBR5 in the yeast two-hybrid system. The carboxyl-terminal region of MPK12 (residues 210-372) proved to be sufficient for the interaction with IBR5 in yeast, whereas the amino-terminal 68  region of MPK12 with (N+KD) or without (N) the sequence of residues required for activation of MPK12 produced no interaction (Figure 3.3). To determine if catalytic activity of MPK12 is important for binding to IBR5, I also generated a kinase-inactive form of the MAPK by mutagenizing its ATP binding site to replace the essential K residue with R. This mutant protein (KIMPK12) was found to interact with IBR5 as efficiently as the wild type protein in the yeast two-hybrid assay (Figure 3.3).  69  Figure 3.1 IBR5 interaction with Arabidopsis MPK12. (A) IBR5 interacts specifically with MPK12 in yeast. The indicated Gal4 DNA binding (BD) and Gal4 transactivation (AD) fusion constructs were cotransformed into MaV203. Activities of reporter genes were determined either by growth on interaction selective SD/-Leu/-Trp/-Ura. (B) Immunodetection of MPK12 in E.coli extracts before (-) and after (+) IPTG induction. (C) IBR5 and MPK12 interact directly in vitro. Interaction was tested using GST-fused fulllength IBR5 protein expressed in E.coli. IBR5-GST protein was bound to a glutathione column, and purified MPK12 was added. After elution with reduced glutathione, proteins were separated by SDS-PAGE, and MPK12 was detected by anti-MPK12 antibody. GST alone did not bind to MPK12. (D) IBR5 interaction with MPK12 in vivo. HA-tagged IBR5 and  Myc-tagged  MPK12  were  coexpressed  in  Arabidopsis  protoplasts  and  immunoprecipitated (IP) with preimmune or anti-MPK12 serum. The immunoprecipitates were immunoblotted for HA tagged IBR5 with anti-HA antibody. 70  Figure 3.2 IBR5 interacts specifically with MPK12. Quantitative β-galactosidase measurements in a yeast two-hybrid assay were performed using pDEST32-IBR5 in combination with 19 different MAPKs in the pDEST22 vector.  71  Figure 3.3 Identification of the region of MPK12 required for interaction with IBR5. The AD constructs encoding the indicated MPK12 polypeptides and the BD construct of full-length IBR5 were cotransformed into MaV 203. Interaction of the fusion proteins was tested by growth on interaction selective SD/-Leu/-Trp/-Ura media or by quantitative β-galactosidase assay.  72  3.2.2 Activated MPK12 is dephosphorylated by IBR5 in vitro The activity of a MAPK is dependent on the phosphorylation status of its –TXY– motif, and these phospho-amino acid residues are also the target of MKP activity. First, I wanted to test if IBR5 is catalytically active. I chose to test this using the synthetic phosphatase substrate, OMFP, and found that the GST-IBR5 could dephosphorylate OMFP in a time-dependent manner. Therefore, I concluded that the recombinant IBR5 phosphatase was catalytically active (Figure 3.4A). Since only MPK12 among 19 Arabidopsis MAPKs tested was capable of interacting with IBR5, I asked whether phosphorylated MPK12 (phospho-MPK12) can serve as a substrate for IBR5. To test this, I conducted in vitro MAPK dephosphorylation assays using dually-phosphorylated recombinant MPK12 as a substrate for recombinant GSTIBR5 (Figure 3.4A). Because the Arabidopsis MAPKK(s) normally responsible for phosphorylating MPK12 in vivo are unknown, preparation of phospho-MPK12 as a substrate required that I first screen an array of candidate Arabidopsis MAPKKs for this activity. Purified kinase-inactive MPK12 (GST-KIMPK12) protein was therefore incubated with ‘constitutively activated’ forms (GST-CAMKKs) of each of the eight Arabidopsis MAPKKs that are thought to represent functional MKK enzymes (Hamel et al., 2006). When the incubation products were resolved by SDS-PAGE and probed on a Western blotting using an anti-pERK1/2 antibody that recognizes only the doublyphosphorylated form of MAPK, I observed that several upstream MAPKKs, including MKK1, display the ability to phosphoryate and activate MPK12 in vitro (Figure 3.4B). The ability of IBR5 to dephosphorylate the –pTEpY– motif of phospho-MPK12 in vitro was then tested by incubating different concentrations of recombinant GST-IBR5 with equal amount of purified phospho-MPK12 and monitoring the disappearance of the – 73  pTXpY– immuno-signal by Western blot analysis using anti-Perk1/2 antibody. The abundance of the dually-phosphorylated form of MPK12 decreased in an IBR5-dosedependent manner, whereas incubation of phospho-MPK12 with GST alone had no effect (Figure 3.4C). Dephosphorylation of MPK12 is not a general property of Arabidopsis MKP proteins, since another Arabidopsis MKP, AtMKP2, was earlier shown to be unable to dephosphorylate this MPK12 (Lee and Ellis, 2007). Similarly, IBR5 also demonstrates specificity in its MPK substrates, since the recombinant phosphatase lacks the ability to de-activate another phospho-MPK, pMPK3, in vitro (Figure 3.5). Taken together, these results show that IBR5 is an active phosphatase that is able to both bind MPK12 and de-phosphorylate the activated form of this specific MAPK.  74  Figure 3.4 Activated MPK12 is efficiently dephosphorylated by IBR5 in vitro. (A) In vitro phosphatase assay. Left: Purified samples (1 µg) of GST and GST-IBR5 were separated on SDS-PAGE gels and stained with Coomassie Brilliant Blue. The positions of molecular mass markers in kilodaltons are indicated on the left. Right: OMFP was incubated with 2.5 µg of GST-IBR5 (●) or GST (○) at 22 °C. At the indicated times, the 75  absorbance was measured at 477 nm. (B) In vitro phosphorylation of GST-KIMPK12 by the upstream kinases, GST-CAMKKs. Kinase-negative GST-KIMPK12 was incubated with (+) or without (-) each of the eight Arabidopsis GST-CAMKK proteins in the kinase reaction mixture, and samples were separated on SDS-PAGE and subjected to immunoblot analysis using anti-pERK1/2 antibody. (C) Dephosphorylation of MPK12 by IBR5 in vitro. Phosphorylated MPK12 protein (1 µg) by CAMKK1 protein (0.3 µg) was incubated with or without increasing amounts of GST or GST-IBR5 (0, 1, 2.5, 5 µg). Phosphorylation levels of MPK12 protein were assessed by immunoblotting with antipERK antibody. Immunoblot was then stripped and reprobed with anti-MPK12 and antiGST antibodies for assessing the relative amounts of GST, GST-MPK12, and GST-IBR5 proteins. Experiments were repeated three times with identical results.  Figure 3.5 PhosphoMPK12 but not phosphoMPK3 can be dephosphorylated by IBR5 in vitro. Phosphorylated MPK3 protein (1 µg) by CAMKK4 protein (0.3 µg) or phosphorylated MPK12 protein (1 µg) by CAMKK1 protein (0.3 µg) was incubated with or without increasing amounts of GST-IBR5 (0, 1, 2.5, 5 µg). Phosphorylation levels of MPK3 and MPK12 proteins were assessed by immunoblotting with anti-pERK1/2 antibody. Immunoblot was then stripped and reprobed with anti-ERK1/2 antibody to detect levels of MPK3 and MPK12 proteins. Anti-GST antibody was also used for determining GST-MPK3, GST-MPK12, and GST-IBR5 protein amounts.  76  3.2.3 MPK12 and IBR5 share similar expression patterns If the observed functional interaction between MPK12 and IBR5 plays a role in one or more biological processes in vivo, it is anticipated that the expression patterns of the corresponding genes would overlap, and that the two proteins would be located in the same subcellular compartment. RT-PCR analysis detected MPK12 mRNA in all tissues of Arabidopsis tested, but the transcript level of MPK12 was relatively low in the mature roots (Figure 3.6A), indicating that this MAPK could be active in most parts of the plant, as earlier reported for IBR5 as well. A more fine-grained analysis of MPK12 gene expression was obtained by generating transgenic plants containing a MPK12 promoter DNA fragment fused to the β–glucuronidase (GUS) reporter gene. As shown in Figure 3.6B, the GUS reporter gene was expressed in most tissues of Arabidopsis seedlings. Interestingly, however, GUS activity driven by the MPK12 promoter in more mature tissues was most strongly associated with guard cells in the epidermis of the various organs examined (Figure 3.6B), a pattern that differs markedly from that of IBR5 (Monroe-Augustus et al., 2003). To examine the subcellular localization of these two interacting proteins, transgenic plants expressing either a CaMV35S::green fluorescent protein (GFP)-MPK12 construct, or a CaMV35S::yellow fluorescent protein (YFP)-IBR5 construct, were produced. The YFP-IBR5 gene fusion fully complemented the ibr5 mutant phenotype (data not shown), indicating that the chimeric protein provided functional IBR5 activity. Confocal microscopic analysis of the resulting GFP:MPK12 and YFP:IBR5 transgenic plants revealed a strong fluorescent signal in the nucleus for both chimeric constructs, whereas control plants expressing GFP or YFP alone (constructs 35S:GFP and 35S:YFP) displayed fluorescence throughout both the cytoplasm and nucleus (Figure  77  3.6C).  Figure 3.6 Expression pattern and subcellular localization of MPK12. (A) RT-PCR analysis of MPK12 gene expression in root, rosette leaf, cauline leaf, stem, flower, silique harvested from a flowering plant, and the whole 7-day old, light-grown seedling. Arabidopsis ACT8 gene was used as a positive internal control. (B) Histochemical analysis of the GUS reporter gene expression driven by the MPK12 promoter. GUS signal was detected in Arabidopsis seedlings, leaf, flower, and silique. Representative staining patterns are shown. (C) Subcellular localization of MPK12. Root epidermal cells from 5-day-old transgenic plants expressing either the 35S::GFP-MPK12 or 35S::YFPIBR5 were used to visualize the subcellular localization of MPK12 and IBR5 by confocal microscopy. The green fluorescent signal of GFP and the yellow fluorescent signal of YFP expressed from the CaMV35S promoter were used as control (right panel). Scale bar = 10 µm. 78  3.2.4 Suppression of MPK12 results in altered auxin responses Since ibr5 mutants have decreased sensitivity to auxin and ABA (Monroe-Augustus et al., 2003), and MPK12 appears likely to act as a substrate of this phosphatase, I examined the role of MPK12 in the plant response to these hormones by using inducible RNAi suppression to specifically down-regulate the expression of MPK12 in vivo. To this end, a 300-bp fragment of the MPK12 3’-end, the region with the highest sequence divergence from all other AtMPK genes, was selected to generate the MPK12RNAi construct, which was placed under the control of a DEX-inducible promoter (Aoyama and Chua, 1997). A. thaliana plants were transformed with this inducible MPK12RNAi construct, and multiple transgenic lines were selected for evaluation. A series of T2-generation plants found to be carrying the MPK12RNAi insert were treated with 30 µΜ DEX for 24 hour and the level of expression of the endogenous MPK12 gene was assessed by RT-PCR (Figure 3.7A). From among the most strongly MPK12-suppressed RNAi lines, two independent lines (L9 and L17) were chosen for further characterization. I first compared the effect of auxin and ABA on the rate of primary root growth in MPK12RNAi plants with their effect in control (empty vector) plants. As shown in Figure 3.7 (B and C), empty vector (EV) and MPK12RNAi lines all grew normally and displayed wild-type phenotype after DEX-induction. However, in the presence of auxins such as IAA, 2,4-D or IBA, root growth of DEX-induced MPK12RNAi seedlings is reduced relative to the inhibition seen in control (WT and EV) plants. This hypersensitivity to auxins is the reverse of the reduced auxin responsiveness phenotype of ibr5 mutants. By contrast, I observed no change in root growth sensitivity to ABA in MPK12suppressed plants, although reduced sensitivity to ABA was reported to accompany the  79  auxin responsiveness phenotype in the ibr5 mutant (Monroe-Augustus et al., 2003). When I examined the expression profiles of various auxin- and ABA-regulated genes in EV, ibr5 and MPK12-suppressed plants under either control or auxin/ABA-treatment conditions, I observed that auxin-induced genes such as GH3 and SAUR10 are clearly expressed at a higher level in MPK12RNAi plants compared with control (EV) in response to auxin treatment (Figure 3.7D). To confirm this altered expression of auxininducible genes, the MPK12RNAi line was crossed to plants containing the DR5:GUS auxin-responsive  reporter  gene  (Casimiro  et  al.,  2001).  DEX-treated  MPK12RNAi/DR5:GUS seedlings showed increased auxin-regulated expression of this reporter in roots and cotyledons compared with the control (DEX-untreated MPK12RNAi/DR5:GUS line) (5 independent lines tested) (Figure 3.7E). By contrast, I detected no obvious differences between the MPK12RNAi and EV lines in expression of ABA-regulated genes after ABA treatment (data not shown), consistent with the lack of effect of MKP12 suppression in the root growth ABA sensitivity assay.  80  Figure 3.7 Suppressing MPK12 expression by RNAi leads to auxin-hypersensitive phenotypes. (A) MPK12 expression is silenced in the MPK12 RNAi lines. The efficiency of silencing of MPK12 gene was examined by RT-PCR. Total RNA was extracted from three-week-old RNAi-expressing plants 24h after DEX (30 µM) treatment. Actin8 primers were included in the PCR reactions as an internal control. (B) Effects of auxin on the inhibition of root growth in empty vector (EV), ibr5, MPK12RNAi line 9, and MPK12RNAi line 17 plants. Seedlings were grown on ½ MS plates with or without various auxins and the photographs were taken after 8 days growth period. (C) Degree of auxin-dependent root growth inhibition in each genotype. Root length of these plants was measured after the 8 days growth period. Root growth, in terms of length, was calculated from the results of three independent experiments. Error bars indicate SD. (D) Expression of known auxin-induced genes, GH3 and SAUR10 in empty vector (EV), ibr5 and MPK12RNAi Lines with or without 2 hr IAA treatment (1 µM) detected by RTPCR using gene-specific primers. Ten µM DEX was used before the IAA treatment for 20 hr. Actin (ACT8) was used as a control. (E) Expression of the DR5:GUS auxin81  responsive reporter in MPK12RNAi seedlings. 4-day-old MPK12RNAi seedlings carrying DR5:GUS reporter were transferred on to liquid medium containing or lacking 10 µM DEX for 20 h and then treated 10 µM IAA for 2 hr before histochemical staining for GUS activity.  3.3 Discussion Regulated dephosphorylation of active MAPKs is an essential component of the control of  MAPK  signal  cascades,  but  compared  to  the  activation  process,  the  dephosphorylation step has attracted relatively little attention. In mammals, the MKP sub-class of dual-specificity tyrosine phosphatases plays a key role in determining the magnitude and duration of MAPK activation, and MKP homologues are found in all eukaryotes (Camps et al., 2000; Owens and Keyse, 2007). Five Arabidopsis MKP homologues have been identified (AtMKP1, AtMKP2, DsPTP1, PHS1, IBR5), but only limited information is available concerning their properties and biological roles, and this is largely derived from genetic analysis. Thus, mutants of AtMKP1 were reported to show hypersensitivity to genotoxic stress and to also be less sensitive to salt stress (Ulm et al., 2001; Ulm et al., 2002), while AtMKP2-silenced plants showed enhanced sensitivity to ozone stress and prolonged activation of MPK3 and MPK6 (Lee and Ellis, 2007). Loss-of-function mutants of PHS1 displayed impaired microtubule organization (Naoi and Hashimoto, 2004) and ABA hypersensitivity (Quettier et al., 2006), whereas ibr5 mutants showed reduced responsiveness to auxin and abscisic acid, compared with wild-type plants (Monroe-Augustus et al., 2003). However, it remains unknown whether the biological impacts of loss-of-function in the PHS1and IBR5 genes are in any way related to an ability of the respective gene products to act as canonical MKPs and dephosphorylate specific MAPKs. In this report, I describe the identification of an Arabidopsis MAPK (MPK12) as a potential IBR5 substrate and provide genetic evidence 82  that MPK12 acts as a negative regulator of auxin signalling. Recruitment of MAPKs to MKPs is thought to be mediated through so-called “docking” (“D”) domains that can be identified in most members of both families, although specificity in these interactions may be provided by multiple other interacting sites outside of the D-domain (MAPK Group, 2002; Tanoue and Nishida, 2002). Although canonical docking domains are found in the many possible target MPKs in Arabidopsis, IBR5 interacts only with MPK12 in the yeast two-hybrid assay (Figures 3.1A and 3.2), indicative of a high degree of specificity in the protein binding.  Deletion of the C-  terminal region of MPK12, which contains the canonical D-domain, eliminated the binding to IBR5 (Figure 3.3). Since ectopically expressed MPK12 and IBR5 could be coimmunoprecipitated from Arabidopsis cell extracts, the interaction observed in the yeast system also occurs in planta. There have been a few reports of plant MPKs directly interacting with other proteins in the yeast two-hybrid system, including Arabidopsis MPK4 interacting with MKS1 (Andreasson et al., 2005), tobacco SIPK interacting with a putative MAPKK (SIPKK) (Liu et al., 2000) and tobacco WIPK interacting with NtWIF (Yap et al., 2005). Prior to my study, the only previous observation of a MKP-MAPK interaction is for AtMKP1, which was found to interact with Arabidopsis MPK6 and, to lesser extent, with MPK3 and MPK4 (Ulm et al., 2002).  Confocal microscopic  examination of GFP:MPK12 and YFP:IBR5 transgenic plants indicated that both MPK12 and IBR5 are nucleus-localized, consistent with the idea that MPK12 can potentially interact with IBR5. While IBR5 and MPK12 share broadly similar gene expression patterns in juvenile tissues, as revealed by both RT-PCR and histochemical analyses of a GUS reporter gene, MPK12 expression becomes intensely concentrated in the guard cells in more mature plants, which may indicate that this MAPK participates in different  83  biological processes at various points during development. The ability of IBR5 to physically interact with MPK12 would indicate that MPK12 is an IBR5 substrate, and indeed I was able to demonstrate that recombinant IBR5 is able to dephosphorylate phosphorylated-MPK12 in vitro (Figure 3.4C), whereas it had no effect on a different phosphorylated MAPK (AtMPK3) (Figure 3.5). Since another MKP protein (AtMKP2) was unable to dephosphorylate MPK12 (Lee and Ellis, 2007), these data demonstrate, first, that IBR5 satisfies the key criterion for its identification as a MKP (i.e. dephosphorylation of an active MAPK), and second, that its catalytic activity, like its protein-protein interaction profile, shows a rather high degree of specificity for MPK12 among the Arabidopsis MPKs. The binding of MKPs to their substrate MAPKs has been reported to sometimes enhance the catalytic activity of MKPs. The association between mammalian MKP3 and ERK has shown to activate the phosphatase activity of MKP3 (Camps et al., 1998). In plants, the catalytic activity of NtMKP1 (a tobacco AtMKP1 ortholog) was increased strongly by the binding of SIPK (a tobacco MAPK ortholog of Arabidopsis MPK6), but only weakly by the binding of WIPK (a tobacco MAPK ortholog of Arabidopsis MPK3) (Katou et al., 2005). Similarly, the activity of AtMKP2 was found to be significantly stimulated by co-incubation with either MPK3 or MPK6 (Lee and Ellis, 2007). In contrast to these observations, co-incubation of IBR5 with MPK12 had very little effect on the catalytic activity of IBR5 toward a synthetic phosphatase substrate (data not shown), even though IBR5 interacts with, and effectively dephosphorylates MPK12. Thus, it appears that not all plant MKPs undergo MAPK-dependent activation. While a number of observations indicate that MAPK cascades might play both positive and negative roles in auxin signalling, specific MPKs that could be playing such roles 84  have yet to be identified. My analysis of the previously uncharacterized Arabidopsis MAPK, MPK12, strongly supports the notion that it acts as a negative regulator of auxin signalling. Suppression of MPK12 expression resulted in increased auxin sensitivity in the root growth inhibition assay (Figures 3.7C and 3.7D) and the auxin-responsive DR5GUS reporter displays increased expression in the MPK12RNAi genetic background. This phenotype is consistent both with the reduced auxin sensitivity and DR5-GUS expression reported earlier for ibr5 mutants (Monroe-Augustus et al., 2003), and with my evidence that MPK12 is likely a physiological substrate of IBR5. However, IBR5 may well have additional substrates, since the loss-of-function phenotypes of ibr5 mutants are pleiotropic, extending to biological phenomena beyond the reciprocal auxin response sensitivity effect it shares with MKP12-suppressed plants. Similarly, the expression profile of IBR5 in mature plants extends to far more tissues than does the MPK12 expression pattern (Figures 3.6A and 3.6B). It may therefore be the case that MPK12 is an authentic IBR5 substrate in specific physiological contexts, but not in others. From this perspective, the pronounced association of MPK12 expression with mature guard cells (Figure 3.6B), together with other reports that both MAPK signalling and auxin signalling may be involved in regulating guard cell function (Blatt and Thiel, 1994; Wang et al., 2006; Gudesblat et al., 2007) is intriguing. This relationship deserves to be examined more closely.  3.4 Experimental procedures 3.4.1 Yeast two-hybrid assays The ProQuest yeast two-hybrid system (Invitrogen) was used. pDEST32-IBR5 and each of 19 Arabidopsis MAPKs (in pDEST22 vector) were introduced into the yeast strain, 85  MaV203. Positive clones were isolated on the basis of three selectable markers: HIS3, URA3, and LacZ. Deletion constructs of MPK12 were generated by PCR and subcloned into pDEST22. Positive interactions were indicated by activation of HIS3 or URA3 and quantified by a liquid β-galactosidase assay according to the manufacturer’s instructions.  3.4.2 Transient protoplast co-expression assay Transient expression assays were performed with protoplasts isolated from rosette leaves of 3–4-week-old Arabidopsis plants. The open reading frames of MPK12 and IBR5 were cloned in frame with an N-terminal Myc or HA tag into the pUC19 vector under the control of the double 35S enhancer promoter of CaMV followed by the translational enhancer from the 5’-leader of tobacco mosaic virus, and terminated by a 3’-untranslated region derived from the nopaline synthetase gene (Tiwari et al., 2003). The procedures for protoplast isolation and transfection assays have been described previously (Kovtun et al., 2000). Extracts prepared from the protoplasts were then used for immunocomplex assay with antibodies raised against MPK12, HA or Myc.  3.4.3 Preparation of kinase-inactive MAPK and constitutively active MAPKK constructs The kinase-inactive mutant MAPKs and constitutively active mutant MAPKKs were generated by QuickChange site-directed mutagenesis (Stratagene) and confirmed by sequencing. The conserved Lys residues in the ATP binding domains of MAPKs were replaced by the Arg amino acid to block activity (K67R for KIMPK3, and K70R for KIMPK12), or the Ser or Thr residues in the activation loop in MKKs were replaced with acidic residues to create a constitutively active kinase (T218E and S224D for CAMKK1,  86  T220D and T226E for CAMKK2, for S235E and T241D for CAMKK3, T224D and S230E for CAMKK4, T215E and S221E for CAMKK5, S221D and T227E for CAMKK6, S193E and S199D for CAMKK7, and S195E and S201E for CAMKK9).  3.4.4 Recombinant protein production Full-length cDNAs corresponding to MPK3 (At3g45640), MPK12 (At2g46070), MKK1 (At4g26070), MKK2 (At4g29810), MKK3 (At5g40440), MKK4 (At1g51660), MKK5 (At3g21220), MKK6 (At5g56580), MKK7 (At1g18350), MKK9 (At1g73500), and IBR5 (At2g04550) were amplified by PCR. The amplicons were purified and digested by the appropriate restriction enzymes and subcloned in either the the pGEX 4T-2 or pDEST15 vector, which expresses the recombinant protein with a N-terminal GST tag. Wild-type and mutant recombinant KIMPK3, KIMPK12, CAMKK1, CAMKK2, CAMKK3, CAMKK4, CAMKK5, CAMKK6, CAMKK7, CAMKK9, IBR5 were expressed as glutathione Stransferase (GST) fusion proteins as previously described (Lee and Ellis, 2007). The protein concentrations of the recombinant proteins were determined with the Bio-Rad detection system using BSA as a standard, and the purity of the protein fractions was determined by Coomassie Brilliant Blue staining after 10% SDS-PAGE.  3.4.5 In vitro binding assay GST, GST-IBR5, and GST-MPK12 proteins were expressed in E. coli as described above and the GST sequences were removed from recombinant GST-MPK12 by proteolytic cleavage. GST or GST-IBR5 proteins were bound to a glutathione Sepharose 4B column and the loaded matrix was then incubated with purified MPK12 protein in binding buffer (20 mM HEPES, pH 7.4, 1 mM EDTA, 5 mM MgCl2, 1 mM DTT, 0.1% Triton X-100, 1 mg/ml BSA, and 1X complete protease inhibitors [Roche]) for 4  87  hour at 4 °C with gentle shaking. After three washes with PBS buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4, pH 7.3), GST or GST-IBR5 protein bound to the column was eluted with a buffer containing 10 mM reduced glutathione in 50 mM Tris-HCl at pH 8. The eluted proteins were concentrated, fractionated on 10% SDS-PAGE and subjected to Western-blot hybridization using anti-MPK12 antibody.  3.4.6 Phosphatase assay Phosphatase activity of IBR5 was assayed at 22 °C in a reaction buffer containing 50 mM Tris-HCl (pH 8), 150 mM NaCl, 1 mM EDTA, and 500 µM 3-O-methylfluorescein phosphate (OMFP) in a 0.8-ml final volume. The reaction was quenched by addition of 0.2 ml of 5 N NaOH, and the amount of product (3-O-methylfluorescein) was determined from the absorbance at 477 nm.  3.4.7 In vitro de-phosphorylation assay The in vitro de-phosphorylation assay was conducted essentially as described previously, but with phospho-MPK12 as substrate (Lee and Ellis, 2007). To prepare phosphorylated MPK12, recombinant GST-CAMKK1 was incubated with recombinant GST-KIMPK12. Recombinant GST-CAMKK4 was incubated with recombinant GSTKIMPK3 for preparation of phosphorylated MPK3. To de-phosphorylate the phosphoMPK3 or phospho-MPK12 proteins, various amounts of either recombinant GST or recombinant IBR5 proteins were then mixed with the phosphorylated MPK3 or MPK12 preparation. The phosphorylation state of GST-KIMPK3 and GST-KIMPK12 was visualized by immunoblot analysis using anti-pERK antibody which specifically recognizes the dually phosphorylated -pTXpY- motif in phospho-MPK3 and phosphoMPK12.  88  3.4.8 RNA isolation and RT-PCR Total RNA from different plant tissues, intact 3-week-old plants, or 8-day-old seedlings grown on ½ MS supplemented with 10 µM DEX, with or without 1 µM IAA treatment, was isolated with the RNeasy plant mini kit (Qiagen) according to the manufacturer’s instructions. RT-PCR was performed as described (Lee and Ellis, 2007) using the following primers: ACT8 forward, 5’-ATTAAGGTCGTGGCA-3’ ; ACT8 reverse, 5’TCCGAGTTTGAAGAGGCTAC-3’  ;  MPK12  CACCATGTCTGGAGAATCAAGCTCT-3’ TCAGTGGTCAGGATTGAATT-3’  ; ;  MPK12 GH3  ATGGAGGAGTCGTTGAACTCTGTG-3’  ;  GH3  AAGCTCCATTATTGGCGTGAAACTC-3’  ;  SAUR10  CGAAGTCGGTACATCGTTCCTATC-3’  ;  SAUR10  forward, reverse, forward, reverse,  5’5’5’5’-  forward,  5’-  reverse,  5’-  CATGGAGATAAGAGACCTGAAGAAGA-3’.  3.4.9 Histochemical GUS assay A 1.3 Kb genomic fragment containing the MPK12 promoter sequences was amplified from Arabidopsis genomic DNA by PCR and cloned into a pCAMBIA1381Z binary vector, forming an a MPK12 promoter-GUS fusion, which was transformed into wild-type Columbia (Col) Arabidopsis plants. Histochemical analysis of the GUS reporter gene was performed as described (Malamy and Benfey, 1999) using T2 MPK12-GUS transgenic plants of different developmental ages. For the DR5 /MKP2RNAi analysis, five progeny from each of two MPK12RNAi/DR5 crosses were analyzed.  3.4.10 Confocal imaging analysis Roots from 5-day-old transgenic plants harboring each 35S::GFP, 35S::GFP-MPK12,  89  35S::YFP and 35S::YFP-IBR5 were used for confocal microscopy analysis. The specimens were examined using a LSM 5 PASCAL EXCITER laser scanning microscope (Zeiss) equipped with an argon laser. The 488-nm and 514-nm lines of the argon laser were used for GFP and YFP excitation, respectively, along with a 63x NA 1.4 oil-immersion lens.  3.4.11 Generation of MPK12RNAi lines The unique C-terminal region of MPK12 was PCR amplified with the following primer pairs:  5’-CCGCTCGAGGATACCCGAAACAACAGTTTGCTGC-3’/5’-  CGGAATTCCTATGAGCTGCAAAAACTACTTACCTCAATCAAATCATTCAAACATGTTT CT-3’  and  5’-GGACTAGTGATACCCGAAACAACAGTTTGCTGC-3’/5’-  CGGAATTCAATCAAATCATTCAAACATGTTTCTC-3’. The PCR products were ligated to the minimal fourth intron of the AtMPK6 gene in both sense and antisense orientations (Samuel and Ellis, 2002). The resulting construct was then cloned into pTA7002, which placed the RNAi construct under the control of the DEX-inducible promoter (Aoyama and Chua, 1997). This binary vector construct was transformed into Agrobacterium tumefaciens strain GV3101 and then transformed into Arabidopsis with the floral dip method (Chough and Bent, 1998).  3.4.12 Root growth inhibition assay All seeds used for root growth analysis were freshly harvested from plants grown under a 16 hour light/8 hour dark growth regime. The seeds were surface-sterilized and placed on ½ MS plates, with or without appropriate concentrations of auxin (IAA, IBA, or 2,4-D), and DEX at a final concentration of 10 µM. Eight days after germination, the roots were photographed and measured.  90  3.5 References Aoyama T, Chua NH (1997) A glucocorticoid-mediated transcriptional induction system in transgenic plants. Plant J 11: 605-612 Andreasson E, Jenkins T, Brodersen P, Thorgrimsen S, Petersen NH, Zhu S, Qiu JL, Micheelsen P, Rocher A, Petersen M, Newman MA, Bjørn Nielsen H, Hirt H, Somssich I, Mattsson O, Mundy J (2005) The MAP kinase substrate MKS1 is a regulator of plant defense responses. EMBO J 24: 2579-2589 Blatt M, Thiel G (1994) K+ channels of stomatal guard cells: bimodal control of the K+ inward-rectifier evoked by auxin. Plant J 5: 55-68 Camps M, Nichols A, Arkinstall S (2000) Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J 14: 6-16 Casimiro I, Marchant A, Bhalerao RP, Beeckman T, Dhooge S, Swarup R, Graham N, Inzé D, Sandberg G, Casero PJ, Bennett M (2001) Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell 13: 843-852 Camps M, Nichols A, Gillieron C, Antonsson B, Muda M, Chabert C, Boschert U, Arkinstall S (1998) Catalytic activation of the phosphatase MKP-3 by ERK2 mitogen-activated protein kinase. Science 280: 1262-1265 Chough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 Ebisuya  M,  Kondoh  K,  Nishida  E  (2005) The duration, magnitude and  compartmentalization of ERK MAP kinase activity: mechanisms for providing signalling specificity. J Cell Sci 118: 2997-3002 Gupta R, Huang Y, Kieber J, Luan S (1998) Identification of a dual-specificity protein phosphatase that inactivates a MAP kinase from Arabidopsis. Plant J 16: 581589 Gudesblat GE, Iusem ND, Morris PC (2007) Guard cell-specific inhibition of Arabidopsis MPK3 expression causes abnormal stomatal responses to abscisic acid and hydrogen peroxide. New Phytol 173: 713-721 Hutter D, Chen P, Barnes J, Liu Y (2000) Catalytic activation of mitogen-activated protein (MAP) kinase phosphatase-1 by binding to p38 MAP kinase: critical role of the p38 C-terminal domain in its negative regulation. Biochem J 1: 155-163 Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, Ehlting J, Beaudoin N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, Ohashi Y, Scheel D, Sheen J, Xing T, Zhang S, Seguin A, Ellis BE (2006) Ancient signals:  91  comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci 11: 192-198 Keyse SM (2000) Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curr Opin Cell Biol 12: 186-192 Kovtun Y, Chiu WL, Tena G, Sheen J (2000) Functional analysis of oxidative stressactivated mitogen-activated protein kinase cascade in plants. PNAS 97: 29402945 Katou S, Karita E, Yamakawa H, Seo S, Mitsuhara I, Kuchitsu K, Ohashi Y (2005) Catalytic activation of the plant MAPK phosphatase NtMKP1 by its physiological substrate salicylic acid-induced protein kinase but not by calmodulins. J Biol Chem 280: 39569-39581 Lee JS, Ellis BE (2007) Arabidopsis MAPK phosphatase 2 (MKP2) positively regulates oxidative stress tolerance and inactivates the MPK3 and MPK6 MAPKs. J Biol Chem 282: 25020-25029 Liu Y, Zhang S, Klessig DF (2000) Molecular cloning and characterization of a tobacco MAP kinase kinase that interacts with SIPK. Mol Plant Microbe Interact 13: 118124 MAPK Group (2002) Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci 7: 301-308 Murphy LO, Blenis J (2006) MAPK signal specificity: the right place at the right time. Trends Biochem Sci 31: 268-275 Monroe-Augustus M, Zolman BK, Bartel B (2003) IBR5, a dual-specificity phosphatase-like protein modulating auxin and abscisic acid responsiveness in Arabidopsis. Plant Cell 15: 2979-2991 Mockaitis K, Howell SH (2000) Auxin induces mitogenic activated protein kinase (MAPK) activation in roots of Arabidopsis seedlings. Plant J 24: 785-796 Mizoguchi T, Gotoh Y, Nishida E, Yamaguchi-Shinozaki K, Hayashida N, Iwasaki T, Kamada H, Shinozaki K (1994) Characterization of two cDNAs that encode MAP kinase homologues in Arabidopsis thaliana and analysis of the possible role of auxin in activating such kinase activities in cultured cells. Plant J 5: 111-122 Malamy JE, Benfey PN (1997) Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development 124: 33-44 Naoi K, Hashimoto T (2004) A semidominant mutation in an Arabidopsis mitogenactivated  protein  kinase  phosphatase-like  gene  compromises  cortical  microtubule organization. Plant Cell 16: 1841-1853 Owens DM, Keyse SM (2007) Differential regulation of MAP kinase signalling by dualspecificity protein phosphatases. Oncogene 26: 3203-3213 92  Quint M, Gray WM (2006) Auxin signalling. Curr Opin Plant Biol 9: 448-453 Quettier AL, Bertrand C, Habricot Y, Miginiac E, Agnes C, Jeannette E, Maldiney R (2006) The phs1-3 mutation in a putative dual-specificity protein tyrosine phosphatase gene provokes hypersensitive responses to abscisic acid in Arabidopsis thaliana. Plant J 47: 711-719 Slack DN, Seternes OM, Gabrielsen M, Keyse SM (2001) Distinct binding determinants for ERK2/p38alpha and JNK map kinases mediate catalytic activation and substrate selectivity of map kinase phosphatase-1. J Biol Chem 276: 16491-16500 Samuel MA, Ellis BE (2002) Double jeopardy: both overexpression and suppression of a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. Plant Cell 14: 2059-2069 Tanoue T, Nishida E (2002) Docking interactions in the mitogen-activated protein kinase cascades. Pharmacol Ther 93: 193-202 Tiwari SB, Hagen G, Guilfoyle T (2003) The roles of auxin response factor domains in auxin-responsive transcription. Plant Cell 15: 533–543 Ulm R, Ichimura K, Mizoguchi T, Peck SC, Zhu T, Wang X, Shinozaki K, Paszkowski J (2002) Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1. EMBO J 21: 6483-6493 Ulm R, Revenkova E, di Sansebastiano GP, Bechtold N, Paszkowski J (2001) Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis. Genes Dev 15: 699-709 Widmann C, Gibson S, Jarpe MB, Johnson GL (1999) Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol Rev 79: 143-180 Wang H, Ngwenyama N, Liu Y, Walker JC, Zhang S (2007) Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. Plant Cell 19: 63-73 Yap YK, Kodama Y, Waller F, Chung KM, Ueda H, Nakamura K, Oldsen M, Yoda H, Yamaguchi Y, Sano H (2005) Activation of a novel transcription factor through phosphorylation by WIPK, a wound-induced mitogen-activated protein kinase in tobacco plants. Plant Physiol 139: 127-137  93  4. GENERAL DISCUSSION  94  Including the work described in the thesis appendices, my experiments collectively represent the first attempt to scrutinize the entire MAPK phosphatase family of plant signal transduction regulators. A survey of gene expression patterns, loss-of-function phenotypes and MKP-MAPK interactions across the Arabidopsis MKP gene family provided initial insight into the scope and centrality of their biological functions in Arabidopsis plants, and allowed me to select two members of this five-member family for more detailed examination. When the results of this exploration of AtMKP2 and IBR5 are integrated with the previously available information for the other MKP family members, and compared with the existing knowledge for the much more extensively examined mammalian MAPK phosphatases, a number of interesting observations can be made, as discussed in the following sections.  4.1 The specificity of MAPK dephosphorylation by protein phosphatases Although the results of in vitro dephosphorylation assays may not accurately reflect the situation in vivo, it seems that most known MKPs have preferred substrates. For example, mammalian DUSP9 displays some specificity towards ERK over JNK/SAPK or p38 kinases (Muda et al., 1997). Similarity, DUSP6 completely inactivates ERK but not other MAPKs (Groom et al., 1996). By contrast, DUSP10 and DUSP16 have little activity with ERK1 and 2, and seem to prefer JNK and p38 kinases (Theodosiou et al., 1999; Masuda et al., 2001; Tanoue et al., 2001). Similar to mammalian MKPs, Arabidopsis AtMKP2 and IBR5 showed an analogous pattern of substrate specificity. AtMKP2 can dephosphorylate phospho-MPK3 and 6, whereas a closely-related Arabidopsis MKP (DsPTP1) cannot, and AtMKP2 is unable to  95  inactivate a different phospho-MAPK (pMPK12) protein. IBR5, on the other hand, is capable of dephosphorylating pMPK12 but not another phospho-MAPK, pMPK3. While this is obviously not a comprehensive survey of possible enzyme-substrate relationships, the data are consistent with a rather high degree of substrate specificity within the Arabidopsis MKP family. Analysis of the dephosphorylation profiles of all 20 Arabidopsis phospho-MAPKs by these phosphatases, combined with protein interaction assays, would provide a more complete profile of the substrate specificities of AtMKP2 and IBR5 against all MAPKs. However, before such a survey could be contemplated, it would be necessary to initially establish which upstream MKK is capable of phosphorylating each of the 20 Arabidopsis MAPKs, so that recombinant phosphoprotein substrates could be generated. Despite the attention devoted to plant MAPK signalling in recent years, a complete picture of functional MKK-MPK relationships has yet to emerge. Interestingly, two Arabidopsis MKPs, AtMKP1 and AtMKP2, both show evidence of interacting with, or influencing, the same MAPK, MPK6. In contrast to the ozone hypersensitivity displayed by AtMKP2-silenced Arabidopsis plants, I did not detect any altered ozone sensitivity in AtMKP1-silenced plants. This is consistent with the observations of Ulm et al. (2001; 2002), who subjected mkp1 plants to other abiotic stresses, including H2O2 and also reported that they showed no alterations in their sensitivity to oxidative stress. By contrast, mkp1 plants are reported to be hypersensitive to genotoxic stress and to show enhanced tolerance to salt stress (Ulm et al., 2001, 2002), phenotypes that are not displayed by AtMKP2-silenced plants. Thus, despite the evidence for a common association with MPK6, AtMKP1 and AtMKP2 appear to control different biological responses. Furthermore, In addition to MKPs, the involvement of Ser/Thr-specific, AP2C1 and Tyr-specific, AtPTP1 phosphatases in  96  ‘MPK6 kinase signalling’ has also been reported recently (Gupta and Luan, 2003; Schweighofer et al., 2007). The fact that MPK6 inactivation could be carried out by these multiple specific phosphatases indicate that signals entering plant MAPK cascades could possibly be integrated and partitioned at the level of phosphatases capable of inactivating particular MAPKs, as one mechanism for determining the cellular response to external stimuli. However, it must be remembered that MKP substrate interactions in vivo may be specific to a certain cell type or physiological state, which means that the temporal and spatial pattern of expression of specific MAPKs and cognate phosphatases may play an important role in determining which phosphatase can act on which MAPK in any particular time and location For example, in mammalian systems, DUSP1 and DUSP6 appear to be induced with different kinetics, and in different compartments of the cell, resulting in distinct patterns of control of cytoplasmic and nuclear ERK activities (Reffas and Schlegel, 2000). My promoter::GUS experiments also emphasize that different MKP family members possess quite distinct patterns of expression during growth and development.  4.2 Regulation of Arabidopsis MKPs A number of mammalian MKPs encoded by “immediate-early” genes have been identified (Grumont et al., 1996; Dowd et al., 1998; Keyse, 2000). Since expression of genes encoding these phosphatases is highly inducible by conditions that also activate MAPK pathways, it has been suggested that the induced phosphatases may play a crucial role in the feedback control of MAPK-regulated transcription (Grumont et al., 1996; Brondello et al., 1997; Dowd et al., 1998). However, from our observations with AtMKP2, and previous reports of AtMKP1 (Ulm et al., 2002) and IBR5 (MonroeAugustus et al., 2003), it seems that regulation of plant MKP function is mainly 97  controlled at the post-transcriptional level in Arabidopsis. RNAi suppression of the five Arabidopsis MKP homologues demonstrated that only loss of AtMKP2 affected the dephosphorylation of ozone-activated MPK3 and MPK6. However, the levels of AtMKP2 transcripts do not change markedly in ozone-treated wild-type Arabidopsis plants, nor was the transcriptional response of any of the five MKPs in ozone-treated mpk6 or mpk3 mutant plants dramatically different from the wild-type pattern MPK3 and MPK6 are already strongly phosphorylated by upstream activating kinase(s) within 30 min of ozone challenge, so the behaviour of AtMKP2 transcripts in wild-type and mutant plants indicates that neither ozone treatment nor the activation state of these MAPKs play a major role in controlling AtMKP2 expression. In the case of genotoxic stress-treated plants, the activity level of MPK6 was highest in mkp1 plants, intermediate in the wild type and lowest in an MKP1-overexpressing line, which may be taken to indicate a role for MKP1 as a regulator of genotoxic stress responses through inactivation of MPK6. However, as with AtMKP2 in ozone-treated plants, it was shown that AtMKP1 transcript levels remain constant during and after genotoxic stress treatments (Ulm et al., 2002). Similarly, it has been reported that IBR5 transcript levels are not altered by either auxin or ABA treatments, indicating IBR5 function is not regulated transcriptionally (Monroe-Augustus et al., 2003). My in vitro phosphatase assays with recombinant AtMKP2 demonstrated that the association of MAPK substrates, either MPK3 or MPK6, with purified AtMKP2 enhances the latter’s catalytic activity, and that this stimulatory effect of association of AtMKP2 with its MAPK substrates was unrelated to MAPK activity. These results indicate that AtMKP2 could be activated in vivo following binding to its respective substrates. AtMKP1 was earlier reported to interact with a subset of MAPKs, MPK3, MPK4 and 98  MPK6 in yeast two-hybrid assays (Ulm et al., 2002), but no evidence has yet been published concerning possible substrate-induced increases in AtMKP1 activity. However, the phosphatase activity of NtMKP1 (a tobacco AtMKP1 ortholog) was recently shown to be markedly stimulated by co-incubation with SIPK (a tobacco MAPK ortholog of Arabidopsis MPK6) and, with less effect, by WIPK (a tobacco MAPK ortholog of Arabidopsis MPK3) (Katou et al., 2005). This is not a universal model, however, since although I found that IBR5 interacts with and effectively dephosphorylates MPK12, I could not detect any obvious changes in IBR5 catalytic activity when the recombinant phosphatase was co-incubated in vitro with its substrate, MPK12. Known mammalian MKP regulatory mechanisms, however, may offer an alternative regulatory mechanism for IBR5. For instance, the mammalian MKP, DUSP1, physically interacts with pERK1 and this interaction results in phosphorylation of DUSP1 by pERK1. This phosphorylation does not directly affect the phosphatase activity of DUSP1, but instead leads to its stabilization by reducing the rate of proteosome-mediated degradation of the phosphatase (Brondello et al., 1999). In light of this example, it would obviously be interesting to examine whether pMPK12 can phosphorylate IBR5, and if so, to explore the functional consequences of such an event.  4.3 Participation of MAPK cascades in auxin signalling and auxin-response gene induction Complete sequencing of the Arabidopsis genome has revealed that the MAPK family consists of >60 MAPKKKs, 10 MAPKKs, and 20 MAPK genes (MAPK group, 2002; Hamel et al., 2006). Despite numerous studies of the involvement of MAPKs in stress responses, hormone responses, and developmental processes, only three of these 20  99  MAPKs (MPK3, MPK4, and MPK6) have been studied in detail. The research reported in this thesis provides new functional information for a previously uncharacterized MAPK, MPK12, and points to its involvement in auxin signalling. MPK12-suppressed lines showed increased auxin sensitivity in the classical root growth inhibition assay, and increased levels of transcription of known auxin-regulated genes. While these results clearly support a role for MPK12 as a negative regulator of auxin signalling, a precise mechanism of MPK12 in controlling auxin responses remains to be elucidated. One well-established function of an activated MAPK in eukaryotic cells is in controlling gene expression through activation of target transcription factors, thereby linking stimuli to appropriate pattern of gene expression. The increased expression of auxin-induced genes such as GH3 and SAUR10 and the DR5:GUS auxin-responsive reporter gene in the MPK12-suppressed lines would be consistent with the idea that transcription factors acting on the promoters of these genes are direct or indirect targets of MPK12, and that these phosphorylation events lead to suppression of expression of the auxin-inducible genes. Interestingly, when I used an in vitro phosphorylation assay to identify potential upstream activating kinases of MPK12, using the eight Arabidopsis MAPKKs that are thought to represent functional MKK enzymes (Hamel et al., 2006), I identified four MAPKKs (MKK1, MKK6, MKK7, and MKK9) as possible upstream kinases of MPK12. This apparent redundancy again emphasizes the potential complexity in MAPKassociated signalling in plants, since both the MKKs capable of activating MPK12, and MPK12 itself, can have distinct expression profiles across growth stages and tissue types. There is already indirect evidence that a given MAPK can perform very different functions in different pathways in plants. For instance, it has been reported that  100  MKK4/MKK5-MPK6 cascade is involved in ethylene signalling, while a MKK2-MPK6 cascade has been shown to have a role in cold/salt stress signalling (Kim et al., 2003; Liu and Zhang, 2004; Teige et al., 2004). Furthermore, a MKK3-MPK6 module appears to be involved in jasmonic acid signalling (Takahashi et al., 2007). Thus, identification of upstream kinase responsible for activating MPK12 in the context of auxin signalling would need to demonstrate not only that such a reaction can be effected in vitro, but also that the cognate proteins are present in the same cellular compartment at the same time. A similar caveat applies to the issue of determining which phosphatase(s) participates in regulation of the MAPK module(s) associated with the cellular response to auxin. Various biochemical approaches to address these challenges can be envisioned, including yeast two-hybrid library screens to detect novel interactors, isolation and characterization of in vivo protein complexes through the use of TAP-tagged ectopic protein  expression,  assay  of  phosphorylation/de-phosphorylation  reactions  on  recombinant protein macroarrays, and mass spectrometry-based phospho-protein profiling. Higher resolution gene expression profiling would also help establish which proteins are likely to be expressed concurrently in the same location, while in vivo protein-protein interaction methods such as FRET could demonstrate their physical proximity. Finally, genetic approaches also provide a powerful tool for confirming the biological relevance of any potential relationships indicated by the biochemical data. Thus, both the use of knock-out and over-expression transgenic lines, combined with tissue-specific promoters and site-directed mutagenesis of the genes of interest, can make it possible to dissect the details of the cellular machinery that depends on the proper functioning of 101  these MAPK signal networks and their phosphatase regulators.  102  4.4 References Brondello JM, Brunet A, Pouyssegur J, McKenzie FR (1997) The dual specificity itogen-activated protein kinase phosphatase-1 and-2 are induced by p42/p44 MAPK cascade. J Biol Chem 272: 1368-1376 Brondello JM, Pouyssegur J, McKenzie FR (1999) Reduced MAP kinase phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation. Science 286: 2514-2517 Dowd S, Sneddon AA, Keyse SM (1998) Isolation of the human genes encoding the pyst1 and Pyst2 phosphatases: characterisation of Pyst2 as a cytosolic dualspecificity MAP kinase phosphatase and its catalytic activation by both MAP and SAP kinases. J Cell Sci 111: 3389-3399 Groom LA, Sneddon AA, Alessi DR, Dowd S, Keyse SM (1996) Differential regulation of the MAP, SAP and RK/p38 kinases by Pyst1, a novel cytosolic dualspecificity phosphatase. EMBO J 15: 3621-3632 Gupta R, Luan S (2003) Redox control of protein tyrosine phosphatases and mitogenactivated protein kinases in plants. Plant Physiol 132: 1149-1152 Grumont RJ, Rasko JEJ, Strasser A, Gerondakis S (1996) Activation of the mitogenactivated protein kinase pathway induces transription of the PAC-1 phosphatase gene. Mol Cell Biol 16: 2913-2921 Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, Ehlting J, Beaudoin N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, Ohashi Y, Scheel D, Sheen J, Xing T, Zhang S, Seguin A, Ellis BE (2006) Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci 11: 192-198 Keyse SM (2000) Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Cur Opin Cell Biol 12: 186-192 Katou S, Karita E, Yamakawa H, Seo S, Mitsuhara I, Kuchitsu K, Ohashi Y (2005) Catalytic activation of the plant MAPK phosphatase NtMKP1 by its physiological substrate salicylic acid-induced protein kinase but not by calmodulins. J Biol Chem 280: 39569-39581 Kim CY, Liu Y, Thorne ET, Yang H, Fukushige H, Gassmann W, Hildebrand D, Sharp RE, Zhang S (2003) Activation of a stress-responsive mitogen-activated protein kinase cascade induces the biosynthesis of ethylene in plants. Plant Cell 15: 2707–2718  103  Muda M, Boschert U, Smith A, Antonsson B, Gillieron C, Chabert C, Camps M, Martinou I, Ashworth A, Arkinstall S (1997) Molecular cloning and functional characterization of a novel mitogen-activated protein kinase phosphatase, MKP4. J Biol Chem 272: 5141-5151 Masuda K, Shima H, Watanabe M, Kikuchi K (2001) MKP-7, a novel mitogenactivated protein kinase phosphatase, functions as a shuttle protein. J Biol Chem 276: 39002-39011 Monroe-Augustus M, Zolman BK, Bartel B (2003) IBR5, a dual-specificity phosphatase-like protein modulating auxin and abscisic acid responsiveness in Arabidopsis. Plant Cell 15: 2979-2991 MAPK Group (2002) Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci 7: 301-308 Liu Y, Zhang S (2004) Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis. Plant Cell 16: 3386-3399 Reffas S, Schlegel W (2000) Compartment-specific regulation of extracellular signalregulated kinase (ERK) and c-Jun N-terminal kinase (JNK) mitogen-activated protein kinases (MAPKs) by ERK-dependent and non-ERK-dependent inductions of MAPK phosphatase (MKP)-3 and MKP-1 in differentiating P19 cells. Biochem J 3: 701-708 Schweighofer A, Kazanaviciute V, Scheikl E, Teige M, Doczi R, Hirt H, Schwanninger M, Kant M, Schuurink R, Mauch F, Buchala A, Cardinale F, Meskiene I (2007) The PP2C-type phosphatase AP2C1, which negatively regulates MPK4 and MPK6, modulates innate immunity, jasmonic acid, and ethylene levels in Arabidopsis. Plant Cell 19: 2213-2224 Theodosiou A, Smith A, Gillieron C, Arkinstall S, Ashworth A (1999) MKP5, a new member  of  the  MAP  kinase  phosphatase  family,  which  selectively  dephosphorylates stress-activated kinases. Oncogene 18: 6981-6988 Tanoue T, Yamamoto T, Maeda R, Nishida E (2001) A novel MAPK phosphatase MKP-7 acts preferentially on JNK/SAPK and p38α and β MAPKs. J Biol Chem 276: 26629-26639 Teige M, Scheikl E, Eulgem T, Doczi R, Ichimura K, Shinozaki K, Dangl JL, Hirt H (2004) The MKK2 pathway mediates cold and salt stress signalling in Arabidopsis. Mol Cell 15: 141-152 Takahashi F, Yoshida R, Ichimura K, Mizoguchi T, Seo S, Yonezawa M, Maruyama K, Yamaguchi-Shinozaki K, Shinozaki K (2007) The mitogen-activated protein  104  kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis. Plant Cell 19: 805-818 Ulm R, Revenkova E, di Sansebastiano GP, Bechtold N, Paszkowski J (2001) Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis. Genes Dev 15: 699-709 Ulm R, Ichimura K, Mizoguchi T, Peck SC, Zhu T, Wang X, Shinozaki K, Paszkowski J (2002) Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1. EMBO J 21: 6483-6493  105  APPENDICES  106  A.1 Introduction The MAPKs are key components of cellular signal transduction pathways which become activated in response to a wide variety of external stimuli in eukaryotes. In plants, a variety of genes encoding MAPKs have been identified. There are 20 MAPKs in the Arabidopsis genome, which suggests that the MAPK cascades in plants may be quite complex (MAPK group, 2002). Compared with mammalian MAPKs, all plant MAPKs have highest homology to the ERK subfamily and phylogenetic analysis of plant MAPKs indicates that there are four distinct sub-classes (MAPK group, 2002). The MAPKs investigated so far have been found to be mainly involved in environmental and hormonal responses. For example, in Arabidopsis, MPK3 and MPK6 of group A, and MPK4 of group B, are known to be activated by a diverse set of stresses, including pathogens, and osmotic, cold, and oxidative stress (Samuel et al., 2000; Asai et al., 2002; Kovtun et al., 2000). MAPK pathways are regulated at multiple levels to ensure the specificity, timing, and strength of their action (Pouysségur et al., 2002). One critical aspect of this regulation is reversible phosphorylation of MAPKs, which involves negative regulation of MAPKs achieved by dephosphorylation of the TxY motif by phosphatases. Dual-specificity phosphatases (DsPTPs) have the unique ability to dephosphorylate both phospho-tyr and phospho-ser/thr residues in protein substrates and a number of these specialized phosphatases have been identified specifically as MKPs in other eukaryotes (Camps et al., 2000; Theodosiou and Ashworth, 2002; Dickinson and Keyse, 2006). In mammalian cells, at least ten MKPs have been identified so far, and they can be divided into three distinct groups on the basis of their subcellular localization, substrate specificity, and patterns of transcriptional regulation (Dickinson and Keyse, 2006). These well107  characterized mammalian MKPs share high levels of amino-acid sequence identity over their catalytic domains, including the highly conserved phosphatase active-site motif, VxVHCx2GxSRSx5AYLM (Theodosiou and Ashworth, 2002). In the Arabidopsis genome, around 23 DSP catalytic subunit sequences have been identified, but among these, only five  (At3g55270/AtMKP1,  At3g06110,  At3g23610/DsPTP1,  At5g23720/PHS1,  At2g04550/IBR5) have the MKP-unique AY[L/I]M motif (Kerk et al., 2002). Even with the implied importance of MKPs in controlling MAPK pathways in other organisms, the only functional data previously available for Arabidopsis MKPs was for AtMKP1. AtMKP1 was initially cloned by Ulm et al (2001 and 2002) in a forward genetics study of genotoxic responses in Arabidopsis. These authors observed that AtMKP1 plays an important role for controlling MPK6 activity in response to genotoxic stress. In view of the lack of information concerning the biological roles of the other four MKP candidates, I chose to use reverse genetics approaches to gain some initial insight into theei biological function in Arabidopsis. Using promoter:GUS constructs, and histochemical staining for GUS expression, potential MKP promoter activity was first examined throughout the plant development for each MKP. Along with these expression patterns of the five MKP candidate genes, phenotypic characterization of loss-offunction mutants provided some initial insight into additional aspects of the biological functions for each of five potential MKPs in Arabidopsis. I initially sought Arabidopsis T-DNA insertion lines lacking each of these five MKP candidates. However, since I was only able to isolate homozygous lines with T-DNA insertions in two out of five potential MKPs, I used an RNA interference (RNAi) approach to generate transgenic lines in which expression of each of the five putative MKPs was suppressed. Because constitutive expression of an MKP-RNAi constructs 108  could potentially show damaging effects of long term silencing, the RNAi constructs were placed under the control of a dexamethasone-inducible (Aoyama and Chua, 1997). The original concept of a linear model of signalling by MAPK has now been modified and improved by incorporating the concept of multi-component signalling complexes, in which the interactions of signalling molecules, including kinases, phosphatases, and scaffold proteins, dictate the signalling response to extracellular stimuli, depending on the cellular context. Therefore, identification of MAPK partners, substrates, and negative regulators of all the components of the cascade complex has become a crucial part of improving our understanding MAPK signalling in plants. Several approaches have been used to study specific MAPK signalling molecules in plants, including yeast two-hybrid analysis, functional complementation of yeast mutants, co-immunoprecipitation, and in vitro/in vivo kinase assays. For example, several potential MAPK cascades in plants, MEKK1-MKK1/2-MPK4, MKK4/5-MPK3/6, MKK2-MPK6, and MKK3-MPK7 have been tentatively identified by these approaches (Ichimura et al., 1998; Asai et al., 2002; Teige et al., 2004; Dóczi et al., 2007). As part of developing a general overview of the roles of the five Arabidopsis MKP candidates, I also assessed the ability of these five potential MKPs to interact with all 20 Arabidopsis MAPKs via yeast two-hybrid analysis on pairwise protein-protein interactions. The results of these reverse genetics analyses are described in this Chapter.  A.2 Experimental procedures  109  A.2.1 Plant Materials All plants used in this work were Arabidopsis thaliana ecotype ‘Columbia’ and defined as wild-type for all experiments. All Arabidopsis plants were cultivated in Redi-earth ® (Sun Gro Horticulture, Vancouver, BC, Canada) and grown at 22 °C under 16 hours: 8 hour light: dark cycle.  A.2.2 Generation of the five potential MKP promoter:GUS fusion constructs To generate MKP promoter:GUS constructs, DNA fragments corresponding to a region of the AtMKP1, At3g06110, DsPTP1, PHS1, and IBR5 genes’ ATG start codons (1759 bp, 410 bp, 870 bp, 707 bp, and 1924 bp, respectively) were amplified using primer combinations  5’-CGCGGATCCAATATAATATATGTTGAGCGTAAGAGA-3’  and  5’-  CCCAAGCTTAAGAACACAAAAGGAAAAGAGAGATGG-3’  (AtMKP1),  5’-  CCGGAATTCAAAAGAAGAATTAGTAGAGTGCTGCTA-3’  and  5’-  CGCGGATCCAGACGAAAACTCTTAATCAGAAAGATA-3’  (At3g06110),  5’-  CCGGAATTCTCGTTTTTAGATAACACTGTTTCAAAG-3’  and  5’-  CGCGGATCCGGCCAAATAGTAAAATTTCCTTTCTAT-3’  (DsPTP1),  5’-  CCGGAATTCTGTTCAGGATTTTTGTTAATTCAATA-3’  and  5’-  CGCGGATCCAGAAATGTCTTTTTCTTCAAATGTCAG-3’  (PHS1),  5’-  CCCAAGCTTTTTGTAGATTTTGGTGTTTTTATACT-3’  and  5’-  CCCAAGCTTGACGGAGAAGAAGGAGAGACTTGAGAA-3’  (IBR5).  The  fragments  were introduced into the pCR2.1 vector (Invitrogen), sequence verified, and then subsequently cloned into pCAMBIA1381Z to generate the constructs AtMKP1:GUS, At3g06110:GUS, DsPTP1:GUS, PHS1:GUS, and IBR5:GUS.  110  A.2.3 Generation of transgenic Arabidopsis plants expressing MKP promoter:GUS reporters Each of five potential MKP promoter:GUS fusion constructs was introduced into Arabidopsis plants via the floral dip method (Clough and Bent, 1998). Briefly, 300 ml cultures  of Agrobacterium tumefaciens GV3101 carrying  each of the MKP  promoter:GUS constructs was grown for 24 hours at 28 °C with shaking at 200 rpm. The cultured bacterial cells were collected by centrifugation at 4000 x g for 15 minutes. The pellet was then resuspended in 300 ml 5% sucrose containing 0.05% Silwet L-77 (Lehle Seeds). Flowering Arabidopsis thaliana ecotype ‘Columbia’ plants with approximately 10 cm bolts were dipped into the A. tumefaciens suspension for five seconds twice. Dipped plants were held in the dark for 24 hours prior to their transfer back to normal growth chamber conditions. The T1 seeds were harvested and transformants were selected by resistance to hygromycin B. Individual tissue samples from T1 plants were screened for expression of GUS via histochemical analysis of GUS activity, and at least 10 GUS-expressing T1 plants were allowed to grow until seed set. GUS activity in each of five MKP promoter:GUS T2 plants was then analyzed throughout development.  A.2.4 Histochemical GUS assay The histochemical staining and fixation method for GUS activity were performed as described previously by Jefferson (1987) and Malamy and Benfey (1997), respectively. Briefly, transgenic plants were subjected to heptane treatment for 10 minutes and then air-dried for 5 minutes to evaporate residual heptane. Afterwards, selected tissue samples were incubated in a GUS reaction solution (0.5 mg/ml X-gluc, 0.1% Triton X100, 0.25 mM K4Fe(CN)6·3H2O, 0.25 mM K3Fe(CN)6, 50 mM sodium phosphate buffer, 111  pH 7.0) for ~12 hours at 37 °C. Excess staining solution was removed and the tissue samples were cleared by incubation for 15 minutes at 57 °C in 20% methanol containing 0.24 N HCl. This solution was replaced with in 60% ethanol containing 7% (w/v) NaOH for 15 minutes at room temperature. Samples were then re-hydrated for 5 minutes each in 40%, 20%, and 10% (v/v) ethanol at room temperature. Cleared samples were then placed in storage buffer (5% v/v ethanol, 20% v/v glycerol) and GUS activity was recorded photographically.  A.2.5 Generation of Arabidopsis MKP-RNAi lines The double-stranded RNA interference (dsRNA) constructs were produced via a PCRmediated approach using the amplification products from the unique N-terminal regions (~300 bp) of AtMKP1, At3g06110, DsPTP1, PHS1, and IBR5. A minimal intron based on the splice junctions and flanking regions belonging to the fourth intron of AtMPK6 was integrated into the sense-strand primers (Table A.1). The sense strands were then amplified using a primer combination that generated a Xho1 restriction site on one end, and an intron plus restriction site (either EcoR1 or BamH1) sequence on the opposite end of the product. The anti-sense strands were amplified using a primer combination that added a Spe1 site and either EcoR1 or BamH1 restriction sites on the opposite ends of the amplicon. These two products were cloned into Xho1/Spe1-digested pTA7002 by a triple ligation, which placed the RNAi construct under the control of the steroid-inducible promoter (Aoyama and Chua, 1997). Agrobacterium tumefaciens GV3101 carrying the different constructs was grown overnight in LB medium containing 25 µg/ml gentamycin and 50 µg/ml kanamycin. Four-week-old Arabidopsis plants (Col0) were transformed by the floral dip method as described (Clough and Bent, 1998).  112  Table A.1. Primers used for generating the MKP-RNAi constructs. Construct  Primer  Sequence  AtMKP1RNAi  AtMKP1SF  ccgctcgagcggATGTGGAGAGAAGGGCAAAGTTTTGA  AtMKP1SR  cggaattccgCTATGAGCTGCAAAAACTACTTACCTCCAC ACTGCCTACCAACCCAAATGTA  AtMKP1AF  ggactagtccATGTGGAGAGAAGGGCAAAGTTTTGA  AtMKP1AR  cggaattccgCACACTGCCTACCAACCCAAATGTA  At3g06110RNAi At3g06110SF  ccgctcgagcggATGGAGAAAGTGGTTGATCTCTTCGGA GT  At3g06110SR  cggaattccgCTATGAGCTGCAAAAACTACTTACCTCCAG ATTGAATAGCTTGGTCGATGAA  DsPTP1RNAi  At3g06110AF  ggactagtccATGGAGAAAGTGGTTGATCTCTTCGGAGT  At3g06110AR  cggaattccgcaGATTGAATAGCTTGGTCGATGAA  DsPTP1SF  ccgctcgagcggATGAGTTCTAGAGACAGAGGATCACCTT C  DsPTP1SR  cggaattccgCTATGAGCTGCAAAAACTACTTACCTCTCG AACAACCTTGTAAACAAAGTCA  PHS1RNAi  DsPTP1AF  ggactagtccATGAGTTCTAGAGACAGAGGATCACCTTC  DsPTP1AR  cggaattccgTCGAACAACCTTGTAAACAAAGTCA  PHS1SF  ccgctcgagcggATGATATGGTCACTAGGAGAGAGGAAT AC  PHS1SR  cggaattccgCTATGAGCTGCAAAAACTACTTACCTCATA ACTGCTGCTTCTTCCTTACGAG  IBR5RNAi  PHS1AF  ggactagtccATGATATGGTCACTAGGAGAGAGGAATAC  PHS1AR  cgggatcccgATAACTGCTGCTTCTTCCTTACGAG  IBR5SF  ccgctcgagcggATGAGGAAGAGAGAAAGAGAGAACCCT TG  IBR5SR  cggaattccgCTATGAGCTGCAAAAACTACTTACCTCATT ATCAAGACCATGATAAGTGAAT  IBR5AF  ggactagtccATGAGGAAGAGAGAAAGAGAGAACCCTTG  IBR5AR  cgggatcccgATTATCAAGACCATGATAAGTGAAT  113  A.2.6 Phenotypic analyses and plant growth conditions For observation of the phenotype in young seedlings, T2 seeds of the each of the MKPRNAi and empty vector (EV) lines were sterilized and germinated on ½ MS plates in the absence and presence of 10 µM dexamethasone (DEX). The seeds were stratified at 4 °C for 3 days before incubation at 22 °C under constant white light for seed germination and seedling growth. The phenotype of one-week-old seedlings on ½ MS plates with or without DEX was observed and recorded compared with appropriate empty vector (EV) lines. For morphometric analysis of 2- or 6-week-old mature plants, the plants were sprayed every day with a solution containing 30 µM DEX.  A.2.7 RNA isolation and RT-PCR analysis Twenty-four hours following DEX (30 µM) induction, Arabidopsis tissues were harvested immediately frozen in liquid nitrogen and stored at -80 °C. To analyze the level of gene expression by reverse transcriptase-mediated PCR, total RNA samples were prepared from 3-week-old plant tissues using the RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions. The concentration of RNA was determined by measuring OD at 260 nm. Reverse transcription was performed using a First-strand cDNA Synthesis Kit (Amersham Pharmacia Biotech) and aliquots of the resulting RT reaction product were used as template for RT-PCR analysis. The following primers were used for RT-PCR : ACT8 forward, 5’-ATTAAGGTCGTGGCA-3’ ; ACT8 reverse, 5’TCCGAGTTTGAAGAGGCTAC-3’  ;  AtMKP1  forward,  5’-  CGCGGATCCGCGATGTGGAGAGAAGGGCAAAGTTTTG-3’ ; AtMKP1 reverse, 5’CCGGAATTCCGGTTATAGCGCGCTCAGCAGTGCTAGCA-3’ ; At3g06110 forward, 5’CGCGGATCCGCGATGGAGAAAGTGGTTGATCTCTTCG-3’ ; At3g06110 reverse, 5’-  114  CCGGAATTCCGGAAGCAATCATGCATTACCTTGGATG-3’ ; DsPTP1 forward ; 5’CGCGGATCCGCGCCTTCTTTTCCAATGAGTTCTAGAG-3’ ; DsPTP1 reverse ; 5’CCGGAATTCCGGTCCACAACCACTTGCTTTTCATCCTC-3’ ; PHS1 forward ; 5’CCGCTCGAGCGGATGGCGGAACCTGAGAAGAAGCGAG-3’ ; PHS1 reverse ; 5’TATAGTCCTTTGGATGGTACCGTTTGATTATAGTCCTTTGGATGGTACCGTTTGATGG CGGAATCA-3’  ;  IBR5  forward  ;  5’-  CGCGGATCCGCGATGAGGAAGAGAGAAAGAGAGAACC-3’ ; IBR5 reverse ; 5’CGCGGATCCGCGCTAAGAGCCATCCATTGCAATATCAC-3’.  A.2.8 Generation of bait and prey constructs Full-length cDNA clones corresponding to the open reading frame of each of the five potential MKPs and twenty distinct MAPKs were isolated from Arabidopsis cDNA and cloned into a GatewayTM entry vector, either pENTR (Invitrogen) or pCR8 (Invitrogen). Each cloned MKP and MAPK was sequence-verified to ensure integrity of the cloned gene prior to their transfer into the GatewayTM compatible yeast two-hybrid bait and prey vectors, pDEST32 (Invitrogen) and pDEST22 (Invitrogen), respectively.  A.2.9 Yeast two-hybrid assay Yeast two-hybrid experiments were performed with the ProQuest yeast two-hybrid system (Invitrogen). Briefly, baits in the pDEST32 vector were first transformed into Saccharomyces cerevisiae Mav203 (MATα, leu2-3, 112, trp1-901, his3∆200, ade2-101, gal4∆, gal80∆, SPAL10::URA3, GAL1::lacZ, HIS3UAS GAL1::HIS3@LYS2, can1R, cyh2R) and then transformed with preys in the pDEST22 vector, using the LiAc/PEG transformation method (Yeast Protocols Handbook; invitrogen). To identify yeast transformants displaying a positive interaction, the transformants were screened on minimal synthetic  115  dropout (SD) medium lacking leucine, tryptophan, and histidine (SD-leu-trp-his) in the presence of 25 mM 3-aminotriazole (3-AT) and leucine, tryptophan, and uracil (SD-leutrp-ura). Recombinant hybrid proteins were tested for self-activation and nonspecific protein-binding properties. The appropriate 3-AT concentrations capable of suppressing unspecific reporter activation were determined individually for every bait construct.  A.3 Results A.3.1. Generation of transgenic plants expressing each of five MKP promoter:GUS reporter constructs. To examine the expression pattern of the five potential MKP genes, 5’-upsteam regions of the each of the five MKP-homologous genes were fused to the β-glucuronidase (GUS) reporter. A total of 20 T1 lines resistant to hygromycin B were screened for GUS activity, and most of these showed visible GUS staining. Patterns of expression were consistent between lines, and at least 10 transgenic lines (T2) were generated and analyzed for each construct. Transgenic plants obtained from Dr. Somrudee Sritubtim harboring pCAMBIA1381Z, a promoterless:GUS fusion construct, and pCAMBIA1301, a 35S promoter:GUS fusion construct were used as a negative and positive control, respectively (Figure A.1).  116  Figure A.1 Analysis of GUS activity of a negative and positive control for GUS assay. Two-week-old transgenic plants expressing promoterless:GUS and 35S promoter:GUS fusions were examined for GUS activity. (A) pCAMBIA1381Z-containing plants (negative control) showed no blue staining in any plant tissues. (B) pCAMBIA1301-containing plants showed strong GUS staining in almost all plant tissues.  A.3.2. Analysis of MKP gene expression throughout plant development To investigate the physiological role(s) of five putative MKP genes in Arabidopsis, I first examined tissue specificity of expression of each of the five MKP genes throughout plant development. I performed histochemical analysis using transgenic plants containing the upstream promoter regions of the five MKP genes fused to the GUS reporter gene. More than 10 independent lines were examined for each construct, at various stages of development. GUS staining in AtMKP1 promoter:GUS plants was detected in all major tissue types (stems, leaves, roots, flowers) at all time points examined (Figure A.2). In most tissues, strong GUS expression was observed in the vasculature. The At3g06110 promoter:GUS fusion protein also seemed to be expressed in various tissues, but I primarily noted its strong expression in the trichomes of younger leaves of  117  a 10-day-old seedlings (Figure A.3B). This pattern of expression, which is very similar to that exhibited in plants containing promoter:reporter constructs from genes known to be necessary for trichome development continued in the mature trichomes (Figures A.3C, A.3D and A.3E). In addition, GUS expression was observed in young anthers in mature A3g06110 promoter:GUS plants (Figures A.3E and A.3F). GUS staining in DsPTP1 promoter:GUS plants was found to be restricted to the region around shoot apical meristems (Figure A.4). After bolting, GUS expression was detected in flowering stems as well (Figure A.4F), but no GUS expression was found in mature plants (data not shown). The PHS1 promoter generated GUS staining in many tissues, but most strongly in the hypocotyls, stems, and lateral root primordia (Figure A.5). Strong GUS staining in IBR5 promoter:GUS plants was observed in many tissues, including the vascular system, leaves, flowers, and roots (Figure A.6). Thus, IBR5, like AtMKP1, was expressed widely throughout development.  118  Figure A.2 Analysis of AtMKP1 gene expression throughout plant development. GUS-histochemical staining of young (A, 7 days after germination) and older (B,C, and D, 14, 21, and 28 days after germination, respectively) Arabidopsis plants, showing GUS expression in all major tissue types (leaves, stem, roots, and flowers) at all time points examined.  Figure A.3 Analysis of At3g06110 gene expression throughout plant development. (A) GUS-histochemical staining of young At3g06110pro:GUS-expressing Arabidopsis seedlings (7 days after germination) showing GUS activity in the hypocotyls (H). GUShistochemical staining of young (B, 10 days after germination) and older (C and D, 21 and 35 days after germination, respectively) Arabidopsis plants, showing strong GUS expression in the trichomes (T) and young anthers (YA).  119  Figure A.4 Analysis of DsPTP1 gene expression throughout plant development. (A) GUS-histochemical staining of young DsPTP1pro:GUS-expressing Arabidopsis seedlings (7 days after germination) showing GUS activity in the hypocotyls (H) and vascular tissue (VT). GUS-histochemical staining of young (B, 14 days after germination) and older (C,D,E and F, 21 and 28 days after germination) Arabidopsis plants, showing GUS expression strongly in the shoot apical meristem (SAM) and flowing stem (FS).  Figure A.5 Analysis of PHS1 gene expression throughout plant development. GUS-histochemical staining of Arabidopsis plants containing PHS1pro:GUS construct, showing GUS expression strongly in the hypocotyls (H), root (R) and stem (S).  120  Figure A.6 Analysis of IBR5 gene expression throughout plant development. GUS-histochemical staining of Arabidopsis plants containing IBR5pro:GUS construct, showing GUS expression widely throughout development, including all major tissue types (leaves, stem, roots, and flowers).  121  A.3.3. Analysis of transgenic Arabidopsis plants expressing each of five potential MKP-RNAi construct To gain insight into the functions of the five Arabidopsis MKP-like genes, I next sought Arabidopsis T-DNA insertional mutant loss-of-function lines lacking any of these MKP candidates, AtMKP1, At3g06110, DsPTP1, PHS1, and IBR5, respectively. I was only able to isolate homozygous lines with T-DNA insertions in PHS1 and IBR5, so I used an RNA interference (RNAi) approach to generate transgenic lines in which expression of each of the five putative MKPs was conditionally suppressed. The unique 5’ regions (~300 bp) of each of the five phosphatase cDNAs were used to construct appropriate double-stranded RNA products that could be expressed in vivo under the control of DEX-inducible promoter (Aoyama and Chua, 1997). More than twenty-five hygromycin B-resistant T1 plants were transferred to soil to obtain T2 generation plants. Transgenic seedlings from these individual plants were then first screened for the function of each of MKP-RNAi construct by growing them on the media including hygromycin B in the absence and presence of 10 µM DEX. For comparison, pTA7002 empty vector lines were also screened. Except for the AtMKP1-RNAi lines, each of the MKP-RNAi lines displayed a distinct abnormal phenotype on DEX-containing media, whereas the same genotypes grown in the absence of DEX showed a phenotype similar to that of pTA7002 empty vector lines grown in the same conditions. More than five lines for each genotype, all of which showed similar phenotype, were chosen for further analysis. For AtMKP1-RNAi lines, I randomly chose a series of T2 generation plants since I didn’t observe any phenotypic differences between plants grown in the presence and absence of DEX, compared with the control.  122  The 7-day-old T2 generation seedlings carrying each MKP-RNAi construct were transferred and grown into the soil for another two weeks and then treated with 30 µM DEX for 24 hour and the expression level of each MKP gene was assessed by RT-PCR. Suppression of transcripts from each of the five endogenous MKP genes was observed to degrees ranging from partial to complete reduction of detectable mRNA (Figure A.7). From among the most strongly suppressed RNAi lines, two independent lines for each of the five MKP candidate genes were selected for further detailed phenotypic analysis.  Figure A.7 RNAi-mediated gene silencing creates gene family-specific loss-offunction genotypes. Suppression of AtMKP1, AtMKP2 (At3g06110), DsPTP1, PHS1 and IBR5 expression by DEX-induced RNAi-based gene silencing. The efficiency of silencing of each of the five MKP genes was determined by RT-PCR. Total RNA was extracted from three-week-old RNAi-expressing plants 24 hr after DEX (30 µM) treatment. Expression of an actin gene (ACT8) was also analyzed as a control.  As noted above, examination of DEX-induced AtMKP1-RNAi plants revealed no morphological differences as compared pTA7002 empty vector transgenic plants (Figures A.8 and A.9). However, DEX-induced At3g06110-RNAi lines displayed a dwarf 123  phenotype in the seedlings (Figures A.10A and A.10B). Further phenotypic analysis of At3g06110-RNAi lines also showed reduced trichome branching and density compared with empty vector transgenic lines (Figures A.10C to A.10F). In addition, an examination of the cotyledon and true leaves of the At3g06110-RNAi lines revealed simpler and disrupted venation patterns (Figures A.10G to A.10J). However, these developmental defects seemed to be restricted to the juvenile tissues, since I couldn’t detect any apparent defects in mature plants, compared with the control plants grown under normal growth conditions (data not shown). DEX-induced DsPTP1-RNAi lines also showed a mild growth phenotype, having a slight decrease in growth rate in the seedlings (Figures A.11A and A.11B). When grown in soil, mature DsPTP1-RNAi plants displayed early senescence (Figures A. 11C to A.11F). DEX-induced PHS1-RNAi lines displayed  severe  abnormalities,  including  stunting,  red-pigmented  roots  and  spontaneous lesion formation (Figure A.12). IBR5 suppression also resulted in an abnormal phenotype, with growth defects and pale leaves (Figure A.13).  124  Figure A.8 Phenotypic analyses of 7-day-old light-grown empty vector seedlings with or without DEX. 7-day-old pTA7002 empty vector seedlings were grown in the absence (A) and presence (B) of 10 µM DEX.  Figure A.9 Phenotypic analyses of 7-day-old light-grown AtMKP1-RNAi seedlings with or without DEX. Seven-day-old AtMKP1-RNAi seedlings were grown in the absence (A) and presence (B) of 10 µM DEX.  125  Figure A.10 Phenotypic analyses of At3g06110-RNAi seedlings with or without DEX. Seven-day-old At3g06110-RNAi seedlings were grown in the absence (A) and presence (B) of 10 µM DEX. (C and D) Leaves of the pTA7002 empty vector line (C) and the At3g06110-RNAi line (D) display obvious differences in trichome density. Representative Individual trichomes are shown from pTA7002 empty vector line (E) and the At3g06110-RNAi line (F), highlighting the differences in branch number. Bars= 100 µm (G) to (J) Vascular systems of cleared specimens of empty vector line (G) and (I) and At3g06110-RNAi (H) and (J) plants were viewed with dark-field optics. Photographs showing venation patterns of cotyledons (G and H) and leaves (I and J) of the seedlings grown on ½ MS plates containing10 µM DEX for 12 days. 126  Figure A.11 Phenotypic analyses of DsPTP1-RNAi seedlings with or without DEX. Seven-day-old DsPTP1-RNAi seedlings were grown in the absence (A) and presence (B) of 10 µM DEX. (C and D) Twenty-four-day-old pTA7002 empty vector (C) and DsPTP1-RNAi (D) plants were grown in soil. Plants were treated with 30 µM DEX at 21 day post-germination. (E and F) Twenty-eight-day-old pTA7002 empty vector (E) and DsPTP1-RNAi (F) plants were grown in soil. Plants were treated with 30 µM DEX at 21 days post-germination.  127  Figure A.12 Phenotypic analyses of PHS1-RNAi seedlings with or without DEX. Seven-day-old PHS1-RNAi seedlings were grown in the absence (A) and presence (B) of 10 µM DEX. 24-day-old pTA7002 empty vector (C) and PHS1-RNAi (D and E) plants were grown in soil. Plants were treated with 30 µM DEX at 23 (D) and 21 (E) day postgermination.  Figure A.13 Phenotypic analyses of IBR5-RNAi seedlings with or without DEX. Seven-day-old IBR5-RNAi seedlings were grown in the absence (A) and presence (B) of 10 µM DEX.  128  A.3.4. Identification of MAPKs interacting with each of the five Arabidopsis MKP candidates The Arabidopsis genome encodes twenty distinct MAPKs (MAPK group, 2002; Hamel et al., 2006). However, in contrast to the many members of the MAPK family, only five MKPs, including AtMKP1, At3g06110, DsPTP1, PHS1 and IBR5 are predicted in the genome. To test whether these five MKP candidates can actually interact directly with any of Arabidopsis MAPK(s), I performed yeast two-hybrid analysis in a pair-wise manner. For each pair-wise test, each of the five open reading frames of MKPs was fused to the DNA binding domain of GAL4, to serve as the bait proteins, whereas each of the 20 Arabidopsis MAPKs fused to the transcriptional activation domain of GAL4 served as the prey proteins. Each bait and prey combination was co-expressed in yeast, and interaction growth assays were carried out on selection media (lacking histidine or uracil) by monitoring culture growth visually. This analysis revealed that, among all 20 Arabidopsis MAPKs examined, AtMKP1 interacts with MPK3 and MPK6 but not with any other MAPKs tested (Figure A.14). At3g06110 shows specific interaction with MPK8 and MPK15 (Figure A.15). None of the MAPK proteins, however, shows interaction with DsPTP1 (Figure A.16). I also found that PHS1 interacts with MKP12 and MKP18 (Figure A.17), and IBR5 specifically interacts with MPK12 (Figure A.18).  129  Figure A.14 Yeast two-hybrid interactions between AtMKP1 and 20 MAPKs. Specific interaction of AtMKP1 (bait) with all 20 MAPKs in Arabidopsis tested in the yeast two-hybrid system. Yeast cells (Mav203) carrying the AtMKP1 and each of MAPK were grown for 2 days at 30 °C on medium lacking leucine and tryptophan (SD-Leu-Trp), and diluted 1:100 in water. Diluted cultures were spotted on medium lacking leucine, tryptophan and uracil (SD-Leu-Trp-Ura) as well as SD-Leu-Trp to monitor the interaction.  Figure A.15 Yeast two-hybrid interactions between At3g06110 and 20 MAPKs. Specific interaction of At3g06110 (bait) with all 20 MAPKs in Arabidopsis tested in the yeast two-hybrid system. Yeast cells (Mav203) carrying the AtMKP1 and each of MAPK were grown for 2 days at 30 °C on medium lacking leucine and tryptophan (SD-Leu-Trp), and diluted 1:100 in water. Diluted cultures were spotted on medium lacking leucine, tryptophan and uracil (SD-Leu-Trp-Ura) as well as SD-Leu-Trp to monitor the interaction.  130  Figure A.16 Yeast two-hybrid interactions between DsPTP1 and 20 MAPKs. Specific interaction of DsPTP1 (bait) with all 20 MAPKs in Arabidopsis tested in the yeast two-hybrid system. Yeast cells (Mav203) carrying the AtMKP1 and each of MAPK were grown for 2 days at 30 °C on medium lacking leucine and tryptophan (SD-Leu-Trp), and diluted 1:100 in water. Diluted cultures were spotted on medium lacking leucine, tryptophan and uracil (SD-Leu-Trp-Ura) as well as SD-Leu-Trp to monitor the interaction.  Figure A.17 Yeast two-hybrid interactions between PHS1 and 20 MAPKs. Specific interaction of PHS1 (bait) with all 20 MAPKs in Arabidopsis tested in the yeast twohybrid system. Yeast cells (Mav203) carrying the AtMKP1 and each of MAPK were grown for 2 days at 30 °C on medium lacking leucine and tryptophan (SD-Leu-Trp), and diluted 1:100 in water. Diluted cultures were spotted on medium lacking leucine, tryptophan and uracil (SD-Leu-Trp-Ura) as well as SD-Leu-Trp to monitor the interaction. 131  Figure A.18 Yeast two-hybrid interactions between IBR5 and 20 MAPKs. Specific interaction of IBR5 (bait) with all 20 MAPKs in Arabidopsis tested in the yeast twohybrid system. Yeast cells (Mav203) carrying the AtMKP1 and each of MAPK were grown for 2 days at 30 °C on medium lacking leucine and tryptophan (SD-Leu-Trp), and diluted 1:100 in water. Diluted cultures were spotted on medium lacking leucine, tryptophan and uracil (SD-Leu-Trp-Ura) as well as SD-Leu-Trp to monitor the interaction.  132  A.4 Discussion Differences in the duration and magnitude of MAPK activation form a crucial determinant of the biological outcome(s) controlled by these kinases (Sabbagh et al., 2001; Ebisuya et al., 2005; Murphy et al., 2006). This highlights the importance of negative regulatory mechanisms in determining MAPK signalling outputs and it is now clear that a major point of control occurs at the level of MAPK, via phosphoprotein phosphatases. In plants, activation of MAPK cascades has been associated with a wide range of developmental, hormonal and stress responses, including pathogen invasion and oxidative stress. On the other hand, relatively little is known about the corresponding MAPK deactivation processes. To gain some initial insight into the biological function of the five putative MKP genes (At3g55270/AtMKP1, At3g06110, At3g23610/DsPTP1, At5g23720/PHS1, At2g04550/IBR5) in Arabidopsis, I used a range of reverse genetics approaches such as examination of transgenic plants carrying each of the five MKP promoter:GUS and DEX-inducible RNAi constructs, and a directed MKP-MAPK yeast two-hybrid analysis. The results are discussed in detail below. The characterization of the transgenic plants expressing AtMKP1 promoter-GUS construct revealed that AtMKP1 is expressed in all major tissue types (leaves, stem, roots, and flowers) throughout plant development (Figure A.2). To investigate the biological function of AtMKP1 in plant development, I also examined the phenotype of AtMKP1-suppressed plants. As shown in Figure A.8, the growth and development of AtMKP1-RNAi seedlings in the presence of DEX was indistinguishable from that of pTA7002 empty vector lines. Ulm et al. (2002), however, reported that AtMKP1 played an important role in plant responses to certain stress treatment conditions such as genotoxic and salt stresses. These authors also showed that AtMKP1 specifically 133  interacted with MPK3, MPK4, and MPK6 when they performed directed yeast twohybrid assays between MKP1 and nine different MAPKs (MPK1-9). Consistent with this report, my yeast two-hybrid analyses also revealed that AtMKP1 interacts only with MPK3 and MPK6 out of all 20 Arabidopsis MAPKs (Figure A.14). Strong GUS expression driven by the At3g06110 promoter, another MKP candidate in Arabidopsis, was observed throughout the young leaf primordia and then in developing and mature trichomes in 10-day-old seedlings (Figure A.3B). This expression pattern is consistent with the expression patterns observed for other genes necessary for proper trichome development such as GL1, GL3, EGL3, TRY, and GL2 (Rerie et al., 1994; Payne et al., 2000; Schellmann et al., 2002; Zhang et al., 2003). In mature plants, I also found strong GUS activity in young anthers as well as in the trichomes (Figures A.3E and A.3F). The predominant expression of At3g06110 in the trichomes and anthers could indicate that At3g06110 plays a role in trichome and pollen development in Arabidopsis. To examine that possibility more closely, I analyzed the phenotype of At3g06110-RNAi lines compared to pTA7002 empty vector transgenic plants. Wild-type and pTA7002 empty vector rosette leaf trichomes were predominantly three-branched (Figures A.10C and A.10E). However, scanning electron microscophy of the surface of rosette leaves showed a reduction in the overall number of trichomes, and a reduction in trichome branch frequency, in At3g06110-suppressed transgenic lines (Figures A.10D and A.10F). On the other hand, At3g06110-RNAi lines did not show any morphological abnormality in floral development or obvious defects in other reproductive organs (data not shown). Since the transcription of At3g55270/AtMKP1 and At2g04550/IBR5 was also detected in the anthers, it is possible that the effect of At3g06110 suppression in pollen development might be compensated for by one or more MKP homologs in  134  Arabidopsis. In addition to the defect in trichome development, At3g06110RNAi seedlings grown in the presence of DEX also showed other developmental defects such as abnormal venation patterns and dwarfism (Figures A.10B, A.10H and A.10J). Together, these observations suggest that At3g06110 activity is crucial for regulation of early development in Arabidopsis. The yeast two-hybrid analyses revealed that this MKP candidate, At3g06110, can interact specifically with two Arabidopsis MAPKs, MPK8 and MPK15 (Figure A.15). These MAPKs belong to the group D MAPKs (MAPK group, 2002), and share a high degree of sequence similarity. Group D MAPKs are notable for the presence of a –TDYmotif and not a –TEY- motif and little is known about the function of this sub-class of MAPKs. Although the interaction between At3g06110 and MPK8/15 needs to be verified in planta, this specific physical interaction in yeast suggests that MPK8 and MPK15 may be substrates of At3g06110, and that the developmental defects observed in At3g06110-suppressed lines could potentially provide clues about the biological role of these MAPKs in Arabidopsis. Analysis of At3g23610/DsPTP1 expression by RNA gel blot analysis had earlier indicated that this gene is expressed in most Arabidopsis organs including root, stems, leaves, and flowers (Gupta et al., 1998). However, the results obtained in the present study using DsPTP1 promoter:GUS plants showed that its expression was restricted to the region around the shoot apical meristem, to the roots, and to the flowering stems (Figure A.4). To obtain additional support for the transcriptional patterns of DsPTP1, I also checked the expression profiles of this gene by examination of the public microarray datasets. Interestingly, these microarray data showed that DsPTP1 expression is largely restricted to the male reproductive organs (stamen and pollen) in 135  Arabidopsis (Genevestigator analysis). These discrepancies highlight the need for multiple approaches when assessing gene expression patterns. Several reasons may account for such differences. Analysis of promoter::GUS transgenic lines allowed me to precisely assess tissue- and cell-specificity of DsPTP1 gene expression. However, the promoter:GUS construct that I used would not reveal the possible involvement of introns or untranslated regions, and the observed GUS expression does not reflect post-transcriptional regulation of DsPTP1 mRNA levels. The RNA gel blot and microarray experiments used by other researchers report the actual presence and accumulation of DsPTP1 transcripts, but the plants used in those experiments were handled by different laboratories, so they might have been grown and harvested in different growth/experimental conditions. The detection sensitivity and reliability of microarray experiments is also limited by RNA abundance (Meyers et al., 2004), and DsPTP1 transcript abundance is relatively low. Gupta et al. (1998) originally cloned DsPTP1 and suggested that DsPTP1 specifically dephosphorylates and inactivates Arabidopsis MPK4, using an in vitro kinase assay. However, no direct evidence has been presented on whether MPK4 is the physiological substrate of DsPTP1. In my survey, I explored the possibility of DsPTP1 binding to MAPKs and obtained no indication in the yeast two-hybrid assay that DsPTP1 could interact with any of Arabidopsis MAPKs, including MPK4 (Figure A.16). Nevertheless, although DsPTP1 could not interact with any of MAPKs in this system, I cannot rule out the possibility that the interaction between DsPTP1 and MAPK(s) may be transient and/or too weak to detect in yeast. My characterization of DsPTP1 function using conditional loss-of-function DsPTP1RNAi transgenic plants appeared to indicate a possible role for this phosphatase as a 136  negative regulator of leaf senescence (Figure A.11). It would be interesting to use DsPTP1 manipulation as a novel means of generating information on the molecular basis of senescence in Arabidopsis. Analysis of At5g23720/PHS1 expression by RT-PCR analysis by Naoi and Hashimoto (2004) earlier indicated that this gene is expressed in all Arabidopsis organs tested, including leaves, stems, flowers and roots. My characterization of the transgenic plants expressing PHS1 promoter:GUS construct in this study has not only confirmed the constitutive expression of this gene in most Arabidopsis organs, but has also provided evidence for strong and specific expression in the hypocotyls, stems, and lateral root primordia (Figure A.5). The screening of mutagenized plant populations and application of reverse genetics recently led to the identification of the PHS1 gene as a regulator of ABA signalling and pointed to its involvement in the control of microtubule organization (Naoi and Hashimoto, 2004; Quettier et al., 2006). PHS1-RNAi lines also displayed severe abnormalities, including reddish roots in the seedlings (Figure A.12B) and spontaneous lesion formation in mature plants (Figures A.12D and A.12E). These genetic studies give a strong indication of the physiological importance of PHS1 in Arabidopsis, but it still remains unknown whether the biological impacts of PHS1 loss-of-function is in any way related to the dephosphorylating activity of MKP on activated specific MAPKs. Interestingly, by using the yeast two-hybrid assay I was able to detect specific physical interaction between PHS1 and two MAPKs, MPK12 and MPK18, out of all 20 Arabidopsis MAPKs (Figure A.17). Hence, it is possible that one of these two MAPKs is a substrate of PHS1 implicated in ABA signalling while the other is a substrate in microtubule-related processes. However, this concept must be considered with caution  137  since PHS1 could also have substrates other than MAPKs involved in these cellular processes. Promoter:GUS analysis of At2g04550IBR5 expression revealed that this gene is expressed in most Arabidopsis organs, including root, stems, leaves, and flowers, and that it continues to be expressed widely throughout plant development (Figure A.6). Consistent with this expression pattern, it has been reported that the IBR5 protein could be detected in all Arabidopsis organs tested (Monroe-Augustus et al., 2003). Loss-of-function mutants of IBR5 displayed reduced responsiveness to auxin and ABA, compared with wild-type plants (Monroe-Augustus et al., 2003) and phenotypic analysis of IBR5-RNAi lines in my study revealed an abnormal phenotype, with growth defects and pale leaves (Figure A.13). To determine whether the IBR5 protein can interact directly with any member of the Arabidopsis MAPK family, I again used the yeast twohybrid system. I found that MPK12 specifically interacts with IBR5 in yeast (Figure A.18), implying a possible role for this MAPK in auxin and/or ABA signalling in Arabidopsis. This hypothesis could be tested by examining the responsiveness of mpk12 Loss-offunction mutant plants to these hormones, auxin and ABA. In summary, this initial survey of the Loss-of-function phenotypes, expression profiles and MKP-MPK interactions for the five Arabidopsis MKP candidates generated a wide range of new information as well as confirming some previous scattered observations obtained by other groups. From the menu of research possibilities that my findings offered, I subsequently selected two topics for more detailed work, as described in Chapters 3 and 4 of this thesis.  138  A.5 References Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L, Boller T, Ausubel FM, Sheen J (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415: 977-983 Aoyama T, Chua NH (1997) A glucocorticoid-mediated transcriptional induction system in transgenic plants. Plant J 11: 605-612 Camps M, Nichols A, Arkinstall S (2000) Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J 14: 6-16 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 Dóczi R, Brader G, Pettkó-Szandtner A, Rajh I, Djamei A, Pitzschke A, Teige M, Hirt H (2007) The Arabidopsis mitogen-activated protein kinase kinase MKK3 is upstream of group C mitogen-activated protein kinases and participates in pathogen signalling. Plant Cell 19: 3266-3279 Dickinson RJ, Keyse SM (2006) Diverse physiological functions for dual-specificity MAP kinase phosphatases. J Cell Sci 119: 4607-4615 Ebisuya  M,  Kondoh  K,  Nishida  E (2005) The duration, magnitude and  compartmentalization of ERK MAP kinase activity: mechanisms for providing signalling specificity. J Cell Sci 118: 2997-3002 Gupta R, Huang Y, Kieber J, Luan S (1998) Identification of a dual-specificity protein phosphatase that inactivates a MAP kinase from Arabidopsis. Plant J 16: 581589 Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, Ehlting J, Beaudoin N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, Ohashi Y, Scheel D, Sheen J, Xing T, Zhang S, Seguin A, Ellis BE (2006) Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci 11: 192-198 Ichimura K, Mizoguchi T, Irie K, Morris P, Giraudat J, Matsumoto K, Shinozaki K (1998) Isolation of ATMEKK1 (a MAP kinase kinase kinase) interacting proteins and analysis of a MAP kinase cascade in Arabidopsis. Biochem Biophys Res Commun 253: 532–543 Jefferson RA (1987) Assaying chimeric genes in plants: The GUS gene fusion system. Plant molecular biology reporter 5: 387-405  139  Kovtun Y, Chiu WL, Tena G, Sheen J (2000) Functional analysis of oxidative stressactivated mitogen-activated protein kinase cascade in plants. Proc Natl Acad Sci U S A 97: 2940-2945 Kerk D, Bulgrien J, Smith DW, Barsam B, Veretnik S, Gribskov M (2002) The complement of protein phosphatase catalytic subunits encoded in the genome of Arabidopsis. Plant Physiol 129: 908-925 MAPK Group (2002) Mitogen-activated protein kinase cascades in plants: a new nomenclature. Trends Plant Sci 7: 301-308 Monroe-Augustus M, Zolman BK, Bartel B (2003) IBR5, a dual-specificity phosphatase-like protein modulating auxin and abscisic acid responsiveness in Arabidopsis. Plant Cell 15: 2979-2991 Malamy JE, Benfey PN (1997) Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development 124: 33-44 Murphy LO, Blenis J (2006) MAPK signal specificity: the right place at the right time. Trends Biochem Sci 31: 268-275 Monroe-Augustus M, Zolman BK, Bartel B (2003) IBR5, a dual-specificity phosphatase-like protein modulating auxin and abscisic acid responsiveness in Arabidopsis. Plant Cell 15: 2979-2991 Naoi K, Hashimoto T (2004) A semidominant mutation in an Arabidopsis mitogenactivated  protein  kinase  phosphatase-like  gene  compromises  cortical  microtubule organization. Plant Cell 16: 1841-1853 Pouysségur J, Volmat V, Lenormand P (2002) Fidelity and spatio-temporal control in MAP kinase (ERKs) signalling. Biochem Pharmacol 64: 755-763 Payne CT, Zhang F, Lloyd AM (2000) GL3 encodes a BHLH protein that regulates trichome development in Arabidopsis through interaction with GL1 and TTG1. Genetics 156: 1349-1362 Quettier AL, Bertrand C, Habricot Y, Miginiac E, Agnes C, Jeannette E, Maldiney R (2006) The phs1-3 mutation in a putative dual-specificity protein tyrosine phosphatase gene provokes hypersensitive responses to abscisic acid in Arabidopsis thaliana. Plant J 47: 711-719 Rerie WG, Feldmann KA, Marks MD (1994) The GLABRA2 gene encodes a homeo domain protein required for normal trichome development in Arabidopsis. Genes Dev 8: 1388-1399 Samuel MA, Miles GP, Ellis BE (2000) Ozone treatment rapidly activates MAP kinase signalling in plants. Plant J 22: 367-376  140  Sabbagh W Jr, Flatauer LJ, Bardwell AJ, Bardwell L (2001) Specificity of MAP kinase signalling in yeast differentiation involves transient versus sustained MAPK activation. Mol Cell 8: 683-691 Schellmann S, Schnittger A, Kirik V, Wada T, Okada K, Beermann A, Thumfahrt J, Jurgens G, Hu¨ lskamp M (2002) TRIPTYCHON and CAPRICE mediate lateral inhibition during trichome and root hair patterning in Arabidopsis. EMBO J 21: 5036-5046 Theodosiou A, Ashworth A (2002) MAP kinase phosphatases. Genome Biol 3: REVIEWS3009 Teige M, Scheikl E, Eulgem T, Doczi R, Ichimura K, Shinozaki K, Dangl JL, Hirt H (2004) The MKK2 pathway mediates cold and salt stress signalling in Arabidopsis. Mol Cell 15: 141-152 Ulm R, Revenkova E, di Sansebastiano GP, Bechtold N, Paszkowski J (2001) Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis. Genes Dev 15: 699-709 Ulm R, Ichimura K, Mizoguchi T, Peck SC, Zhu T, Wang X, Shinozaki K, Paszkowski J (2002) Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1. EMBO J 21: 6483-6493 Zhang F, Gonzalez A, Zhao M, Payne CT, Lloyd A (2003) A network of redundant bHLH proteins functions in all TTG1-dependent pathways of Arabidopsis. Development 130: 4859-4869  141  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066360/manifest

Comment

Related Items