UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Genetic and genomic studies of mouse and human NR2E1 in cortical disorders, aggressive behaviour, and… Kumar, Ravinesh A. 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_spring_kumar_ravinesh_a.pdf [ 10.64MB ]
Metadata
JSON: 24-1.0066289.json
JSON-LD: 24-1.0066289-ld.json
RDF/XML (Pretty): 24-1.0066289-rdf.xml
RDF/JSON: 24-1.0066289-rdf.json
Turtle: 24-1.0066289-turtle.txt
N-Triples: 24-1.0066289-rdf-ntriples.txt
Original Record: 24-1.0066289-source.json
Full Text
24-1.0066289-fulltext.txt
Citation
24-1.0066289.ris

Full Text

GENETIC AND GENOMIC STUDIES OF MOUSE AND HUMAN NR2E1 IN CORTICAL DISORDERS, AGGRESSIVE BEHAVIOUR, AND PSYCHIATRIC DISEASE  by  RAVINESH A. KUMAR B.Sc., Simon Fraser University, 1999  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in  THE FACULTY OF GRADUATE STUDIES  (Medical Genetics)  THE UNIVERSITY OF BRITISH COLUMBIA October 2006 © Ravinesh A. Kumar, 2006  Abstract Brain and behavioural disorders represent a leading cause of morbidity and suffering worldwide. The 'fierce' mouse has a spontaneous deletion of Nr2e1 that results in a complex phenotype that includes cortical hypoplasia and socially abnormal behaviours. Notably, functional protein and regulatory equivalency of mouse and human NR2E1 has been established. Furthermore, human studies implicate the genomic region containing NR2E1 in mental illness, although a role for NR2E1 in humans is currently unknown. Here, I integrate mouse models and human molecular genetics to understand the involvement of NR2E1 in human brain-behaviour development. First, we test the hypothesis that the spontaneous 'fierce' deletion involves only Nr2el. It was demonstrated that the 'fierce' mutation results in the loss of all Nr2e1 exons without affecting neighbouring genes. Next, the hypothesis that some humans with cortical malformations will harbour NR2E1 mutations was tested by sequencing the coding, untranslated, splice-site, proximal promoter, and evolutionarily conserved regions of this gene in 60 subjects with microcephaly. Four candidate regulatory mutations were identified. To help interpret these findings, the genomic architecture and molecular evolution of NR2E1 were characterized in 94 ethnically-diverse humans and 13 non-human primates, which indicated strong functional constraint. Finally, the hypothesis that some humans with behavioural and psychiatric disorders will harbour mutations in NR2E1 was tested by sequencing the regions outlined above in 126 humans with impulsive-aggressive disorders, bipolar disorder, or schizophrenia. Eleven candidate regulatory mutations were identified. Taken together, the findings presented in this thesis are consistent with the proposal that non-coding regulatory mutations may be important to the pathogenesis of brain-behavioural disorders in some humans.  ii  ^  Table of Contents  Abstract ^  ii  Table of Contents ^  iii  List of Tables ^  viii  List of Figures ^  ix  List of Abbreviations ^  x  Acknowledgements ^  xii  Dedications ^  xiii  Chapter 1: General Introduction ^  1  1.1^The Cerebral Cortex in Human Development and Disease ^ 1 1.2^Specification and Patterning of the Human Cerebral Cortex ^3 ^1.2.1^Development of the Vertebrate Central Nervous System (CNS) ^ 3 1.2.2^Germinal Zones and Cortical Neurons ^ 3 1.2.3^Cortical Specification and Patterning ^ 6 1.3^The Nuclear Receptor Superfamily as Regulators of Brain Growth ^ 7 ^1.3.1^Nuclear Receptor Superfamily^ 7 1.3.2^Role of Nuclear Receptors in Brain Development ^ 7 1.3.3^Role of Nuclear Receptors in Human Brain Disorders ^ 8 1.4 Nuclear Receptor 2E1 (NR2E1) and Cortical Development ^ 8 ^1.4.1^Cloning and Structure ^ 9 1.4.2^Transcription ^ 11 1.4.3^Function ^ 11 1.4.3.1 Targeted and Spontaneous Deletions of Nr2e1 in Mice ^ 11 1.4.3.2 Role in Brain Development and Neurogenesis ^ 12 1.4.3.3 Role in Eye Development ^ 14 1.4.3.4 Role in Behavioural Development ^ 15 1.4.3.5 Novel 'fierce' phenotypes and strain-dependent effects ^ 17 1.5^Human NR2E1 Genetic Diversity and Expression Variation Studies ^ 19  iii  ^ ^  1.5.1^Patterns and extent of genetic variation at NR2E1 ^ 1.5.2^Regulatory variants and NR2E1 expression ^  1.6 Role of NR2E1 in Human Health and Disease^  19 21  23  ^1.6.1^Support for a Role of NR2E1 in Human Brain-Behaviour Development and Disease ^ 23 1.6.1.1 Genes That Interact with NR2E1 Are Implicated in Human Brain-Behaviour Disorders ^ 24 1.6.1.1.1 Paired Box Gene 6 (PAX6) ^ 24 1.6.1.1.2 Nuclear Receptor Subfamily 4, Group A, Member 2 (NR4A2, also known as NURR1) ^ 24 1.6.1.1.3 Retinoic Acid Receptor, Beta (RAM) ^ 25 1.6.1.1.4 S100 Calcium-binding Protein, Beta (S100,5) ^ 26 1.6.1.1.5 Phosphatase and Tensin Homolog (Pten), p27kipl, Cyclin D1, and Atrophinl (Atnl) ^ 26 1.6.1.1.6 Neurogeninl (Ngnl), Nuclear Receptor Subfamily 0, Group B, Member 1 (NROB1, also known as Dax1), Zinc Finger Protein of Cerebellum 1 (Zic/), and Forkhead Box G1B (Foxglb) ^ 29 1.6.2^Role of NR2E1 in Human Cortical Disorders ^ 30 1.6.2.1 Cortical Disorders ^ 30 1.6.2.2 Genetics of Microcephaly ^ 31 1.6.2.3 Genetic Mouse Models of Microcephaly ^ 32 1.6.2.4 Role of NR2E1 in Microcephaly ^ 33 1.6.3^Role of NR2E1 in Human Aggression and Violence ^ 34 1.6.3.1 Aggression and Violence ^ 34 1.6.3.2 Genetics of Aggression and Violence^ 34 1.6.3.3 Genetic Mouse Models of Aggression and Violence ^ 38 1.6.3.4 Role of NR2E1 in Impulsive-Aggressive Behaviours ^ 38 1.6.4^Role of NR2E1 in Bipolar Disorder and Schizophrenia ^ 40 1.6.4.1 Bipolar Disorder and Schizophrenia ^ 40 1.6.4.2 Genetics of Bipolar Disorder and Schizophrenia ^ 41 1.6.4.3 Genetic Mouse Models of Bipolar Disorder and Schizophrenia ^43 1.6.4.4 Role of NR2E1 in Bipolar Disorder and Schizophrenia^ 43  1.7^Thesis Objectives ^  47  ^1.7.1^Origin and Nature of the 'Fierce' Mutation ^ 47 1.7.2^Role of NR2E1 in Human Cortical Development ^ 47 1.7.3^Role of NR2E1 in Human Aggression and Psychiatric Disorders ^48 CHAPTER 2: UNEXPECTED EMBRYONIC STEM (ES) CELL MUTATIONS REPRESENT A CONCERN IN GENE TARGETING: LESSONS FROM 'FIERCE' MICE ^  49  2.1^Publication Status and Contribution of Individual Authors ^49  iv  2.2^Introduction ^  50  2.3 Materials and Methods ^  52  ^2.3.1^Mice, ES Cells, and Genomic DNA ^ 2.3.2^Characterization, Sequencing, and Analyses of Nr2e1frc ^ 2.3.3^Fluorescent in situ hybridization (FISH) ^ 2.3.4^Expression Analyses ^ 2.3.5^Genotyping, Southern Analyses, and Sensitivity Assays ^  2.4^Results ^  52 52 53 53 54  55  ^2.4.1^The fierce (Nr2e1fre) Deletion Results in the Loss of All Nr2e1 Exons ^ 55 2.4.2^Fluorescent In Situ Hybridization Demonstrates the Absence of the Nr2e1 Locus in Nr2e1- frc Mice ^ 57 2.4.3^Northern Analyses Demonstrate that Transcription of Nr2e1 Neighbouring Genes is Not Altered ^ 58 2.4.4^The Unexpected Nr2e1frc Mutation was Present in the Targeted ES Cell Clone (mEMS4) ^ 58  2.5^Discussion^  61  2.6^Conclusion^  63  CHAPTER 3: MUTATION AND EVOLUTIONARY ANALYSES OF NR2E1 IN HUMAN BRAIN DEVELOPMENT IDENTIFY CANDIDATE REGULATORY MUTATIONS AND STRONG PURIFYING SELECTION ^  64  3.1^Publication Status and Contribution of Individual Authors^64 3.2^Introduction ^  66  3.3 Materials and Methods ^  69  ^3.3.1^Human and non-human primate samples ^ 69 3.3.2^DNA Amplification and Sequencing ^ 71 3.3.3^Transcription Factor Binding Site Analyses ^ 72 3.3.4^Evolutionary, Nucleotide Diversity, and Genetic Differentiation Analyses ^ 73 3.3.5^Haplotype and Linkage Disequilibrium Reconstruction ^ 73  3.4^Results ^  74  ^3.4.1^Candidate NR2E1 mutations identified in patients with cortical abnormalities ^ 74 3.4.2^Alterations of putative transcription factor binding sites by NR2E1 patientvariants ^ 76 3.4.3^Strong purifying selection and low nucleotide diversity at NR2E1 ^ 77 3.4.4^Evidence of non-neutral evolution at NR2E1 ^ 81 3.4.5^Human-specific NR2E1 sites identified ^ 83  v  ^  3.4.6^Haplotype and LD of NR2E1 structure provide effective tools for diseasemapping studies ^  84  3.5^Discussion ^  87  3.6^Conclusion^  93  CHAPTER 4: MUTATION, ASSOCIATION, AND EXPRESSION STUDIES OF HUMAN NR2E1: A GENETIC CANDIDATE FOR IMPULSIVEAGGRESSIVE BEHAVIOURS, BIPOLAR DISORDER AND SCHIZOPHRENIA ^  95  4.1^Publication Status and Contribution of Individual Authors ^95 4.2^Introduction ^ 4.3 Materials and Methods ^ ^4.3.1^Human Samples ^ 4.3.2^DNA Amplification, Sequencing, and Genotyping ^ 4.3.3^Bioinformatic and Statistical Analyses ^ 4.3.4^Expression Analyses ^  4.4^Results ^  97 102 102 104 106 106  107  ^4.4.1^Candidate NR2E1 mutations identified in subjects with behavioural and psychiatric disorders ^ 107 4.4.2^Alterations of transcription factor binding sites by novel NR2E1 variants ^ 109 4.4.3^Lack of evidence of association between three NR2E1 markers to bipolar disorder or schizophrenia ^ 110 4.4.4^Restriction of NR2E1 in human adult forebrain regions ^ 112  4.5^Discussion ^  113  4.6^Conclusion^  118  CHAPTER 5: GENERAL DISCUSSION ^  119  5.1^Clarifying the Nature and Origin of the Fierce Mutation Illuminates Future Studies of Human NR2E1 ^  119  5.2^Independent Resequencing Studies in Humans Unselected for Disease Status are Important for Understanding Patterns of Normal Genetic Variation ^121 ^5.2.1^Completeness and Representation of Public DNA Databases ^ 121 5.2.2^Importance of Non-coding Evolutionary Conserved Sequences ^ 122  vi  5.3 Screening for Mutations by Direct DNA Sequencing is a Powerful Approach for the Discovery of Disease Susceptibility Alleles ^ 123 5.4 Computational Transcription Factor Binding Site (TFBS) Analyses ^125 5.5 Testing the Role of NR2E1 Candidate Mutations in Human Disease ^ 129 5.6 Examination of the Role of NR2E1 in Eye Disorders ^  130  5.7 Testing the Role of Common NR2E1 Polymorphisms in Human Disease ^ 132 5.8^Testing Multiple Loci may Accelerate the Search for Susceptibility Alleles ^134 5.9 The Importance of Endophenotypes In Complex Disease ^ 135 5.10 Gene-Environment Interaction Studies Are Important in Complex Disease ^136 5.11 Genes Underlying Cortical Malformations May Underlie Psychiatric Disorders ^ 137 5.12 Genetic Diversity Studies and Comparative Primate Genomics Represent Promising Tools for Understanding Human Evolutionary History and Disease ^ 139 5.12.1^Patterns of Nucleotide Diversity in Ethnically-Diverse Humans ^ 139 5.12.2 Evaluating Signatures of Selection at NR2E1 ^ 141 5.12.3 Role of NR2E1 in Human Cortical Expansion^ 143 5.12.4 Evolutionary Genomics to Identify Positively Selected Genes ^ 145  5.13 Conclusion^  147  APPENDIX I HUMAN ETHICS APPROVAL CERTIFICATE ^  148  APPENDIX II ANIMAL ETHICS APPROVAL CERTIFICATE ^ 149 REFERENCES ^  150  vii  List of Tables Table 1.1 Background-dependent phenotypic differences among fierce mice ^ 18 Table 1.2 Genetic Variation at NR2E1 ^  20  Table 3.1 Demographic and Clinical Information on Patients with Cortical Malformations ^ 70 Table 3.2 PCR Primers used to Amplify NR2E1 Sequences ^  72  Table 3.3 Characterization of NR2E1 Patient-Variants in Families and Control Subjects ^ 75 Table 3.4 Characterization of NR2E1 Patient-Variants to Detect Alterations in Putative Transcription Factor Binding Sites ^  77  Table 3.5 Human Nucleotide Diversity and Tajima's D at NR2E1 ^  80  Table 3.6 Neutrality Tests using Chimpanzee at Outgroups ^  82  Table 3.7 NR2E1 Sites that are Fixed Among All Humans but Differ in Non-human Species ^ 83 Table 4.1 Clinical and Demographic Data on Subjects ^  103  Table 4.2 Characterization of NR2E1 Patient-Variants in Families and Control Subjects ^ 108 Table 4.3 Characterization of NR2E1 Patient-Variants to Detect Alterations in Putative Transcription Factor Binding Sites ^  109  Table 4.4 (CA)„ Microsatellite Analysis in Bipolar Disorder and Schizophrenia ^ 111 Table 4.5 NR2E1 SNP Analyses in Bipolar Disorder and Schizophrenia ^ 112  viii  List of Figures Figure 1.1 The human cerebral cortex is functionally complex ^  2  Figure 1.2 Dorsal view of the neural tube ^  4  Figure 1.3 The mammalian cortex comprises six cellular layers ^  5  Figure 1.4 Phylogenetic tree of 65 nuclear receptor genes in vertebrates, arthropoids, and nematodes ^  10  Figure 1.5 MRI scans of normal and abnormal cerebral cortices ^  32  Figure 1.6 Importance of gene-environment interaction in aggression and violence ^ 36 Figure 1.7 Key structures in the circuitry underlying emotion regulation ^40 Figure 1.8 NR2E1 resides near a putative susceptibility locus for bipolar disorder ^44 Figure 2.1 The fierce (Nr2e1frc) deletion results in the loss of all Nr2e1 exons. ^ 56 Figure 2.2 Fluorescent in situ hybridization demonstrates the absence of the Nr2e1 locus in Nr2e1"' mice ^  59  Figure 2.3 Northern analyses demonstrate that transcription of Nr2e1 neighboring genes is not altered in Nr2e1frc/fiv mice ^  59  Figure 2.4 The unexpected Nr2eF mutation was present in the targeted ES cell clone (mEMS4) ^  60  Figure 2.5 The origin and history of fierce (Nr2e1 c) mice. ^  62  Figure 3.1 A few common and many rare NR2E1 variants detected in human populations representative for global diversity ^  79  Figure 3.2 Five common SNP-based NR2E1 haplotypes account for the majority of chromosomes examined for global diversity ^  85  Figure 3.3 Weak LD in NR2E1 that generally declines with physical distance ^ 86 Figure 4.1 Northern analysis demonstrates that NR2E1 is restricted to forebrain structures and absent from the hindbrain and spinal cord in the normal adult human brain ^ 113  ix  List of Abbreviations Bacterial Artificial Chromosome^  BAC  Bromodeoxyuridine^  BrdU  Central Nervous System^  CNS  Conserved Elements, Type A^  CE-A  Conserved Elements, Type B^  CE-B  Database for Single Nucleotide Polymorphisms^  db SNP  Diagnostic and Statistical Manual of Mental Disorders ^  DSM  DNA Binding Domain^  DBD  Embryonic Stem Cell^  ES Cell  Fierce^  fry  Fluorescence In Situ Hybridization^  FISH  Insertion-deletion^  Indel  Intermittent Explosive Disorder ^  IED  Lateral Ganglionic Eminence^  LGE  Ligand Binding Domain^  LBD  Linkage Disequilibrium^  LD  Logarithm of Odds^  LOD  Microcephaly^  MIC  Minor Allele Frequency^  MAF  Medical Ganglionic Eminence^  MGE  Nuclear Receptor Subfamily 2 Group E Member 1 —Human Gene ^NR2E1 Nuclear Receptor Subfamily 2 Group E Member 1 —Mouse Gene ^Nr2e1 Nuclear Receptor Subfamily 2 Group E Member 1 —Human Protein^NR2E 1 Nuclear Receptor Subfamily 2 Group E Member 1 —Mouse Protein^Nr2e 1 Polymerase Chain Reaction^  PCR  Position Weight Matrix^  PWM  Single Nucleotide Polymorphism^  SNP  Subventricular Zone^  SVZ  Transcription Factor Binding Site^  TFBS  Ventricular Zone^  VZ  Untranslated Region^  UTR  Wildtype^  WT  xi  Acknowledgements I am indebted to my supervisor Dr. Elizabeth M. Simpson for her commitment, patience, and guidance and to the members of my Thesis Advisory Committee, Dr. Jan Friedman, Dr. Diana Juriloff, and Dr. Kelly McNagny, for their invaluable feedback on my work. It has been an enjoyable experience working with all the members of the Simpson Lab, including my students Ken, Ambrose, Connie, Jason, Dan, Nikki, Jasmine, and Russell; thank you for your dedication to our work. I thank the faculty, trainees, and staff of the Child & Family Research Institute, Centre for Molecular Medicine and Therapeutics, Canada's Michael Smith Genome Sciences Centre, B.C. Cancer Research Center, and Department of Medical Genetics at the University of British Columbia. I am also grateful to the long list of collaborators who made this work possible and to the patients and families who participated in this study. I could not have made it this far without the loving support of my Mom and Dad, my brothers Vick and Roneil, and our dog, Tyson. I also want to extend my thanks to my uncles, aunts, and grandmother who have been encouraging me to do well for as long as I can remember; and to all my cousins for their interest in my studies. I am also grateful for the many great and true friendships that I have acquired along the way —thank you all for believing in me.  Dedications I dedicate this thesis to my grandfather Vishnunath Prasad and to the millions of people and families worldwide suffering (and who will suffer) from a mental illness or some form of brain disorder.  Ravinesh A. Kumar The University of British Columbia May 2006  xii  Chapter 1: General Introduction 1.1 The Cerebral Cortex in Human Development and Disease The cerebral cortex is one of the most functionally complex tissues in the human body and constitutes the seat of our highest mental, cognitive, and behavioural functioning (Figure 1.1) (Wieten 1995). Disruptions in the events leading to cortical development may underlie a multitude of human brain and behavioural disorders, which represent a leading cause of morbidity and suffering worldwide (Lopez and Murray 1998). Cortical disorders, including congenital microcephaly, which involves a significant reduction in the size of the cerebral cortex (Dobyns 2002), may occur at birth. Structural and functional cortical abnormalities may also underlie abnormal behavioural functioning that presents later in life, including impulsiveaggressive behaviours (Davidson et al. 2000) and psychiatric disorders such as bipolar disorder and schizophrenia (Hajek et al. 2005; Lawrie and Abukmeil 1998). An understanding of the molecular mechanisms that generate a structurally and functionally diverse human cortex, including the identification of genes that influence its structural and functional development, will therefore play an important etiologic role in our knowledge of human brain-behaviour development and disease. The genetic determinants of cortical development and disease may be identified through a variety of approaches. Mice, in particular, represent a powerful model organism with which to investigate the molecular basis of corticogenesis, given that numerous physiological, anatomical, and genomic aspects of brain development are highly conserved between mice and humans (Monuki and Walsh 2001). Also of importance are studies in humans, who carry a plethora of naturally occurring mutations. Consequently, mutation-screening and case-control association  1  analyses of candidate genes in humans represent a valuable opportunity for the discovery of genes underlying disorders of human brain and behaviour. The resources are now in place to dissect the molecular determinants of human corticogenesis and behavioural development.  Temporal lobe  -44  Figure 1.1 The human cerebral cortex is functionally complex  The cerebral cortex is divided into four principal lobes. Thefrontal lobe represents the largest lobe in the human brain and is responsible for planning, coordinating, controlling, and executing many aspects of behaviour, including impulse control, judgment, language, memory, motor function, problem solving, sexual behavior, and socialization. The parietal lobe integrates sensory information and is responsible for sensation and perception. The temporal lobe is responsible for auditory processing and hearing. The occipital lobe is the area where most visual signals are sent and is associated with visual processing. Also shown is the cerebellum, which constitutes part of the hindbrain, and is associated with regulation and coordination of movement, posture, and balance. The spinal cord is the major nerve bundle that carries nerve impulses to and from the brain to the rest of the body. (Modified from Evolution of the human brain, http://www.oecd.org/ and from Wayne Weiten, Psychology Third Edition: Themes and Variations, Pacific Grove: Brooks/Cole Publishing Company, 1995).  2  1.2 Specification and Patterning of the Human Cerebral Cortex  1.2.1 Development of the Vertebrate Central Nervous System (CNS) Vertebrate CNS development begins with the formation of the neural plate (Stern 2005). This involves a thickening of ectodermal cells on the dorsal aspect of the developing embryo, followed by the formation of the neural tube, which forms when ridges at the lateral edges of the neural plate curl up to meet at the dorsal midline. Specialized regions of the nervous system, including the myelencephalon (which gives rise to the medulla), metencephalon (which gives rise to the pons and cerebellum), mesencephalon (which gives rise to the midbrain), and prosencephalon (which develop into the diencephalon and telencephalon), begin to emerge during neural tube closure (Figure 1.2). In vertebrates, the developing telencephalon is subdivided into dorsal (pallium) and ventral (subpallium) (Sur and Rubenstein 2005). The pallium may be further subdivided into the medial region (which gives rise to the hippocampal formation/limbic lobe), the dorsal region (which gives rise to the cortex), the lateral region (which gives rise to the olfactory/piriform cortex), and the ventral region (which gives rise to parts of the amygdala). The subpallium is further divided into the medial (MGE) and lateral (LGE) ganglionic eminences, which constitute most of the basal ganglia (Puelles et al. 2000; Puelles et al. 1999; Puelles and Rubenstein 2003).  1.2.2 Germinal Zones and Cortical Neurons The internal cavity created by the neural tube is called the ventricle, which is lined by a layer of ectodermal neuroepithelial cells that leads to the formation of the ventricular zone (VZ) (Goldman and Sim 2005). The VZ contains a mitotically active population of stem (i.e. self-  3  renewing) and progenitor (i.e. restricted capacity and potential) cells that will in part generate the neurons that comprise the six layers of the human cerebral cortex (Figure 1.3), which contain nearly two-thirds of the brain's neuronal mass. The subventricular zone (SVZ) emerges as a second layer of stem and progenitor cells above the VZ. Thus, the VZ and SVZ represent the two chief germinal zones of the mammalian brain and the source of cortical neurons.  Three primary transverse segments of brain  Five secondary transverse segments of brain -Telencephalon (endbrain)  Adult derivatives (and their cavities) Cerebral hemispheres (lateral ventricles)  Prosencephaloi (forebrain)  ---Diencephalon  Thalamus, subthalamus, hypothalamus, epithalamus (third ventricle)  MeSencephalon•-(midbrain)  --Mesencephalon (midbrain)  Midbrain (aqueduct)  Rhombencephalon (hindbrain)  ---Metencephalon  Pons ((astral half of fourth ventricle)  - - Myelencephalcm  Medulla oblongata (caudal half of tOurlh ventricle)  Spinal cord (myelon)  Spinal cord  Spinal Cord (central canal)  Figure 1.2 Dorsal view of the neural tube  The early brain divides into the prosencephalon, mesencephalon, and rhombencephalon, which further differentiate into five vesicles. These in turn give rise to the main regions of the adult brain (Modified from DeMyer W. Neuroanatomy. Baltimore: Williams & Wilkins, 1988).  4  1 2 3 4 5 6 SP  **-44-044-444.+4444+44-444 +++++++++++t ++4+4++++ ++++++++++++++4++ ♦...+4+4-4++++ +4++  ++++++++++++++++  oe  0 0  oeo  WM VZ  41000100000110100010  Figure 1.3 The mammalian cortex comprises six cellular layers The six cellular layers of the cortex overlie a band of white matter (WM). The cortical plate consisting of neurons (green cells, layers 2-6) is sandwiched between layer 1 (upper red cells) and the subplate (SP; lower red cells). Radial neuronal migration during cortical development occurs when neurons migrate on specialized elongated cells known as radial glial cells (solid blue cells) that are found in the ventricular zone (VZ) and span the whole cortical wall. Red line represents subventricular zone (Modified from (Olson and Walsh 2002)).  Human cortical neurons can be divided broadly into two classes (Goldman and Sim 2005). The first are interneurons (which contain the inhibitory neurotransmitter GABA) that are generated primarily by progenitor cells located in the SVZ (Letinic et al. 2002). The second are projection neurons (which contain the excitatory neurotransmitter glutamine) that are generated by progenitor cells located in the VZ (Gorski et al. 2002). The birth of cortical neurons is governed by two concomitant decisions. The first involves the decision to reenter or exit the cell cycle, and the second involves the decision to differentiate into a neuron with a defined laminar fate (Roy et al. 2004). Early-stage progenitors are multipotent and can generate projection neurons of most layers, whereas later-stage progenitors form the superficial layers (Desai and McConnell 2000; Frantz and McConnell 1996; McConnell and Kaznowski 1991). Cells leaving the cell cycle early typically form the deeper cortical layers 5 and 6, whereas later-born cells  5  form the superficial cortical layers 2 to 4 (Parnavelas 2000). Thus, corticogenesis represents a radial 'inside-out' gradient of neurogenesis.  1.2.3 Cortical Specification and Patterning Cortical specification refers to the ways in which the discrete subdivisions of the cerebral cortex are functionally defined and established (Levitt et al. 1997). The sequence of events that specify the cortical VZ and ultimately pattern the cerebral cortex involves a combination of extrinsic (i.e., environmentally-controlled) and intrinsic (i.e., genetically-controlled) mechanisms. Extrinsic influences can contribute to cortical arealization and may involve thalamic input (which is the major afferent source into the cortex) as well as non-VZ cortical neurons that provide additional sources of patterning information (Monuki and Walsh 2001). In addition, extrinsic influences may include nonautonomous (i.e. intercellular) growth factors and morphogens, which can be produced from organizers of the cortical VZ that include the prechordal mesoderm (which produces Shh), the anterior neural ridge (which produces Fgf8), the roof plate region (which produces Bmps), and the cortical hem (which produces Wnts) (Monuki and Walsh 2001). Intrinsic determinants of cortical specification typically include cell-autonomous (i.e. intracellular) agents, which can regulate the decision of cortical progenitors to proliferate and differentiate. Many of these regulators include transcription factors, which are proteins that bind to specific DNA sequences of their target genes to drive or repress their expression. Several transcription factors critical to cortical development have been identified (Monuki and Walsh 2001), including Foxg 1 (which is involved in telencephalic induction), Ngn and Gli3 (which are involved in dorsal telencephalon specification), Lhx2 (which is involved in cortical VZ fate  6  selection), and Emx2 and Pax6 (which are involved in regional expansion of the VZ). Thus, transcription factors represent a key class of proteins with essential roles in the specification and patterning of the cerebral cortex.  1.3 The Nuclear Receptor Superfamily as Regulators of Brain Growth  1.3.1 Nuclear Receptor Superfamily The nuclear receptor superfamily represents a large and varied group of transcription factors that regulate expression of genes with roles as diverse as development, cell differentiation, and organ physiology (Mangelsdorf et al. 1995). Nuclear receptors bind to ligands that include estrogens, androgens, retinoic acids, thyroid hormones, corticosteroids, and Vitamin D. This process is largely mediated through the receptor's ligand-binding domain (LBD). The conformational change induced upon ligand binding enables the nuclear receptor to bind specific DNA elements via its DNA-binding domain (DBD), which is composed of two highly conserved zinc fingers. Binding of the nuclear receptor to DNA thereby enables it to associate with the transcriptional machinery that eventually leads to gene activation or repression. The term 'orphan' refers to a nuclear receptor for which there is no known natural ligand. Some orphan nuclear receptors can function in the absence of a ligand, such as NR4E2 (also known NURR1), the function of which is regulated through stable conformational folding of its LBD that resembles a ligand-bound nuclear receptor (Wang et al. 2003).  1.3.2 Role of Nuclear Receptors in Brain Development Many nuclear receptors are known to play a role in brain development by influencing neurogenesis, neuronal differentiation, and neuronal survival. These include nuclear receptors  7  that bind 1) steroids, including estrogen (Beyer 1999; Brannvall et al. 2002; Tanapat et al. 1999; Wang et al. 2001), androgen (Galea et al. 1999; Zhang et al. 2000), and corticosteroids (Cameron and Gould 1994); 2) thyroid hormones (Hadj-Sahraoui et al. 2000; Morreale de Escobar et al. 2004; Oatridge et al. 2002); and 3) retinoic acids (Chu et al. 2003; Cosgaya et al. 1996). In addition, the orphan nuclear receptors NR2F1 (also known as COUP-TFI) (Studer et al. 2005; Zhou et al. 1999) and NR4A2 (Zetterstrom et al. 1997) regulate neurogenesis and brain development.  1.3.3 Role of Nuclear Receptors in Human Brain Disorders Several nuclear receptors have been implicated in disorders of human brain and behaviour. These include NR4A2 with Parkinson's Disease, schizophrenia, bipolar disorder, and attention deficit hyperactivity disorder (Buervenich et al. 2000; Chen et al. 2001; Hering et al. 2004; Iwayama-Shigeno et al. 2003; Le et al. 2003; Smith et al. 2005) and estrogen receptor with aggression/irritability (Westberg et al. 2003). In addition, the nuclear receptor ligands testosterone, cortisol, and thyroid hormone have been suggested to underlie some aspects of autism (Baron-Cohen 2002; Curin et al. 2003; Hashimoto et al. 1991).  1.4 Nuclear Receptor 2E1  (NR2E1) and Cortical Development  The orphan nuclear receptor 2E1 (NR2E1; also known as TLX) is implicated in many aspects of central nervous system development, including neurogenesis and cortical development. We hypothesize that NR2E1 may act as a critical intrinsic regulator of human corticogenesis and could therefore represent a promising genetic candidate for several human  8  disorders of brain and behaviour, including cortical malformations, impulsive-aggressive behaviours and psychiatric disorders.  1.4.1 Cloning and Structure NR2E1 (accession NM_003269; http://www.ncbi.nlm.nih.gov/) is the first of a family of transcriptional regulators belonging to the second subfamily (group E) of the nuclear receptor superfamily (Figure 1.4) (NRNC 1999). The gene was first identified and cloned in the fruit fly  Drosophila melanogaster and given the name tailless (Pignoni et al. 1990). The vertebrate gene NR2E1 is structurally similar to Drosophila tailless and was first characterized in chicken (Yu et al. 1994), followed by mouse (Monaghan et al. 1995) and human (Jackson et al. 1998). Vertebrate NR2E1 is distinct from other nuclear receptors in two ways (Kobayashi et al. 2000). First, a serine residue substitutes for the canonical lysine residue in the '13 Box' (proximal box; C-terminal "knuckle" of the N-terminal finger) located in the DBD. Second, the 'D Box' (distal box; N-terminal "knuckle" of the C-terminal finger) located in the DBD of NR2E1 is expanded to seven amino acids instead of five that is typical of other nuclear receptors. To date, no ligand for NR2E1 has been identified and as such, NR2E1 belongs to the orphan nuclear receptor superfamily. The NR2E1 protein is predicted to be 42.6 kDa, and is 99% conserved between human and mouse (Jackson et al. 1998). There is a high degree of non-coding conservation of NR2E1 among humans, mice, and Fugu, suggesting similar regulation of this gene in invertebrates and vertebrates (Abrahams et al. 2002). The closest genetic relative of NR2E1, subfamily member  NR2E3, also contains a serine residue in the P Box; however, the first amino acid within its P Box is an asparagine rather than aspartic acid.  9  ^  10I  ^ 110mo FR A I^ ^ Homo TR R 2 95 ^ [loom RAR A I  87  '  0  A  100^Homo R AR li 2 Homo R ARC1 3 97 ^ It IMO ITAR /1. 1 100 { ^ I loom PPAR It 2 3 ^ I loom PPARO  B  200^I loin° ItliV.1112B A 1 ^!Como RFV-ERBB 2^ I) tkosoptula 1175^3 ^ Drosophila F78^I 98 ^ Homo ROR A 1 100^Rattus RZRB 2 74 IOU Homo RI,RO ,^3 31 99 Drosophila liR 3^4 1--- Caenorhabditis CNR3 4 ^ Carnothabilitis CNR14^1^) (; _38/^ Drosophila 1('R^1 100 —I 100 ^Homo UR^2 ) H ^ Homo l.XR 3 ^Mus FXR ^ so Homo Vlili 1 98 ^ Xevoints 4 iN tit 2^) 1 8^S4 100 ^ Homo M I897 3 ^ Mus CAR2 4 J — Drosophila DKR% 1 Oachocerca NCIRI^1^ ^HOMO N(4-1R1 88 ^100 53 ^ llomo NURR1 2 100 ^ Ritual% NOR1^3 ^Drosophila DI6t38^4 ) A ^ racnorlubditis I NRK^4  9  ^4  L  SI 100  ^1  2  54  ^!Aux  3  i  100 ^ llomo ER^I ^ RaRus FRB^2 lop^I fume ERR I^1 ^ Homo ERR2 2 43 ^ Homo OR 3 82^110 MR 2 Homo PR^3 ^ 110m0 AR^4 100 1^ 84us SF l^I 100 1 ^ Mus 1.RHI 2 ^ Drosophila FT/1' ^3  AB  Drosphi la DHR:19^1^ ) ^ Mus GCNFI^1^ ) A 94 ^ Homo HN4^I 1,  loo  r  3 A 18  5  i^ ,  iunw INF-4C 2 ^ Xenopus 1INF4B^3 ^ Drosophila I1NF4^4 77 HI^HOMO IOCRA I 100 ^Homo R XR6 2 ItXRCi^3 ^ Drosophila USP^4 7 100 ---- Homo FR2 1 ^ Homo IRA 2 ^ Drosophila 0121178^I 100 --- Mus MX 1 48 ^ Drosophila 71.1. 2 Homo COUPA 3 55 90^Homo COUPB 2 100 Bootstrap 100 ^ Drosophila SAP^3 Xemmus (1)1 MC^4 100 ^ Alnatish SYNC,^5 Homo EAR2^ 6  loo ^  4  oo  2  Figure 1.4 Phylogenetic tree of 65 nuclear receptor genes in vertebrates, arthropoids, and  nematodes  The length of the branches is proportional to the bootstrap value. Only one version of each individual gene was included in the tree. Subfamilies are indicated by Arabic numerals at the extreme right of the figure, groups by capital letters and brackets, and individual genes by Arabic numerals together with a representative name. The scale shows the length of the maximum possible bootstrap value (100). The bootstrap values defining the subfamilies are boxed in black, except in the case of GCNF1 defined by only one member. Mouse and Drosophila Nr2e1 are boxed in red (Modified from (NRNC 1999)).  10  1.4.2 Transcription In humans, NR2E1 is detected in the fetal forebrain (Strausberg et al. 2002). In addition,  NR2E1 is detected in adult tissues including the amygdala, caudate nucleus, corpus callosum, hippocampus, substantia nigra, subthalamic nucleus, and thalamus (Jackson et al. 1998). In mouse, Nr2e1 is first detected at embryonic day 8 (E8) in the neural epithelium near the anterior limit of developing proscencephalon and spreads caudally into the presumptive diencephalon and newly-formed optic and olfactory evaginations by E8.5 (Monaghan et al. 1995). From E8.5 until birth, Nr2e1 is robustly expressed throughout the dorsal and ventral telencephalic VZ and SVZ, where it is localized primarily in cortical progenitor cells (Monaghan et al. 1995; Roy et al. 2002). Thus, expression of Nr2e1 spans the pallio-subpallial boundary. At E12.5, Nr2e1 is detected in the neural retina, olfactory epithelium, presumptive amygdala, and the periventricular zone of the forebrain (Monaghan et al. 1995). Although Nr2e1 transcription is barely detectable perinatally, it is transcribed once again in neural stem cells in the subgranular layers of the dentate gyri, subventricular zone, and olfactory bulb (Monaghan et al. 1995; Shi et al. 2004). Retinal progenitor cells in the neuroblastic layer also express Nr2e1 (Miyawaki et al. 2004). Recently, it has been demonstrated that Nr2e1 expression is controlled by oxygen concentrations in retinal astrocytes (Uemura et al. 2006).  1.4.3 Function 1.4.3.1 Targeted and Spontaneous Deletions of Nr2e1 in Mice The function of Nr2e1 has been illuminated by studies of targeted and spontaneous deletions of Nr2e1 in mice. Using homologous recombination, Monaghan et al (1997) deleted  11  exons two and three of Nr2e1, and Yu et al (2000) deleted exons three, four, and five (Monaghan et al. 1997; Yu et al. 2000). In addition, the Simpson laboratory reported the serendipitous discovery of a spontaneous Nr2e1 deletion (referred to as 'fierce' or frc')(Young et al. 2002); however, the molecular breakpoints of the fierce mutation were unclear. Importantly, it was unknown whether additional loci might have been disrupted by the spontaneous fierce deletion. As demonstrated in Chapter Two, it is now known that the spontaneous fierce mutation represents a 44 kb deletion that removes all nine Nr2e1 exons, including its proximal promoter (Kumar et al. 2004). Generally, the brain-eye-behaviour phenotypes of mice disrupted for Nr2e1 are similar (discussed in sections 1.4.3.2 to 1.4.3.4). However, Young et al (2002) describe several novel phenotypes in 'fierce' mice not reported in the targeted Nr2e1 mutants, and provide evidence of strain-dependent phenotypic characteristics (discussed in section 1.4.3.5). 1.4.3.2 Role in Brain Development and Neurogenesis Drosophila tailless is required for pattern formation in the embryonic poles. Recessive  mutations of tailless result in abnormal anterior and posterior terminal poles during the syncytial developmental stage (Pignoni et al. 1990). Tailless also plays a role in invertebrate neurogenesis and brain development (Rudolph et al. 1997; Younossi-Hartenstein et al. 1997). Mice deleted for both copies of Nr2e1 (Nr2e1 / ) have a complex CNS phenotype that - -  includes hypoplasia of the cortex, corpus callosum, amygdala, hippocampus, and olfactory bulbs (Land and Monaghan 2003; Monaghan et al. 1997; Young et al. 2002). Nr2e1 has been shown to regulate the timing of cortical neurogenesis during mouse development, as demonstrated by bromodeoxyuridine (BrdU) birthdating studies that indicate shorter cell cycle and precocious neuronal differentiation in Nr2e1 / compared to Nr2e1 +i+ mice from E9 to E14 (Roy et al. 2002). - -  12  The study also indicates that cell death and neuronal migration are relatively unaffected in Nr2e1 / mice, suggesting that aberrant proliferation underlies most of the cortical deficits in - -  these mice. After E14.5, the depletion of late developing progenitors and fewer late-generated differentiated cells cause a preferential reduction of superficial cortical layers 2 and 3 (Land and Monaghan 2003). Thus, although all six cortical layers are present in Nr2e1 _/ mice, loss of -  Nr2e1 predominantly affects the generation and differentiation of neurons destined for superficial cortical layers, which highlights the importance of Nr2e1 in sustaining the population of progenitor cells throughout late prenatal mouse development (Land and Monaghan 2003). Although Nr2e1 / mice do not have 'true' microcephaly, the reduced size of the cerebral - -  cortex together with a mitotic role for Nr2e1 makes these mice amenable for the study of the molecular underpinnings of human microcephaly (Section 1.6.2). Mice deleted for a single copy of Nr2e1 (Nr2e1 +) show premature neurogenesis during early corticogenesis, resulting in neuron numbers that are intermediate to those produced in Nr2e1  +i+  and Nr2e1 / mice (Roy et al. 2004). This observation provides strong support for a - -  dosage requirement for Nr2e1 during cortical development. Nr2e1 has been proposed to interact genetically with Pax6 to pattern the lateral telencephalon and may therefore be essential for the regionalization of the cerebral cortex. This is demonstrated by the removal of one copy of Pax6 on the Nr2e1 / background that results in a - -  significant dorsal shift in gene expression of several cortical markers, which is not observed in otherwise wild-type mice deleted for Nr2e1 (Stenman et al. 2003). The removal of either one or both alleles of Nr2e1 on Pax6" does not worsen the pallial phenotype as compared to the phenotype of Pax6 alone, suggesting that Nr2eland Pax6 function together to establish the -  13  pallio-subpallial boundary. Importantly, mice heterozygous for Pax6 but wild-type for Nr2e1 (Nr2e1 +/+) do not show alterations in cortical gene expression at the pallial-subpallial boundary, indicating that the establishment of this boundary involves an interaction between Pax6 and Nr2el. Nr2e1 has also been shown to influence adult neurogenesis in mice (Shi et al. 2004). Loss of Nr2e1 results in loss of cell proliferation, as demonstrated by lack of BrdU staining in the dentate gyros, SVZ, and olfactory bulbs. Cells isolated from Nr2e1 +A. adult brains are able to proliferate, self-renew, and differentiate into all neural cells types, whereas cells isolated from adult Nr2e1 t. mice fail to proliferate and self-renew. Importantly, re-introduction of Nr2e1 into -  Nr2e1 / cells rescues this deficit. That Nr2e1 is required to maintain adult neural stem cells in an - -  undifferentiated and proliferative state in adult mouse brain suggests a role for this nuclear receptor in the mature brain.  1.4.3.3 Role in Eye Development Nr2e1 / mice have an eye phenotype that includes optic nerve hypoplasia, retinal - -  degeneration, diminished retinal vascularization, impaired regression of hyaloid vessels, and reduced or flat electroretinogram (Young et al. 2002). Overexpression of Nr2e1 results in eye abnormalities that include small eyes and corneal opacities (Simpson EM, unpublished data), which suggest that increased dosage of Nr2e1 influences eye development in mice. This eye phenotype is similar to human aniridia, which can be caused by mutations in PAX6 (Glaser et al. 1992). Given that Nr2e1 and Pax6 interact genetically in the mouse brain (Stenman et al. 2003), it is conceivable that Nr2e1 and Pax6 may similarly cooperate in the eye to influence its development.  14  Loss of Nr2e1 also results in impaired astrocyte network formation and abnormal Muller cell development in the retina (Miyawaki et al. 2004). Given that Nr2e1 is involved in the repression of astrocyte differentiation in the brain, similar mechanisms influenced by Nr2e1 may operate in the retina as well. Zhang et al. (2006) recently reported that mice deleted for Nr2e1 / have enhanced S-cone - -  syndrome (Zhang et al. 2006), which is characterized by an excess of S-cones and reduced rod photoreceptors. Importantly, enhanced S-cone syndrome and related phenotypes have been observed in humans and mice that are mutated for NR2E3 (Akhmedov et al. 2000; Haider et al. 2000), which is the closest genetic relative to NR2E1. Interestingly, the levels of Nr2e3 are reduced in mice deleted for Nr2e1, suggesting that Nr2e1 and Nr2e3 may interact directly or indirectly. Zhang et al also demonstrate reduced retinal size and cell numbers in Nr2e1 -/- mice, which is consistent with other reports (Miyawaki et al. 2004; Young et al. 2002).  1.4.3.4 Role in Behavioural Development Nr2e1 / mice display numerous behavioural abnormalities. Most notably, Nr2e1 "/ mice - -  are pathologically violent towards conspecifics, such that males will bite, wound, and ultimately kill their siblings and intended mates (Young et al. 2002). In the resident-intruder and neutral arena tests, male and female Nr2e1 -/- mice demonstrated increased aggression in comparison to littermate controls. Females fail to rear their young 50% of the time and demonstrate reduced maternal behaviour. Increased aggression in females makes Nr2e1"/ mice amenable for the -  genetic dissection of female aggression, which is unlike most genetic mouse models of aggression that typically involves the males only. Aggression is also directed towards humans,  15  which is reflected in their 'hard-to-handle' phenotype that includes jumping, vocalizing, and biting. Other behavioural manifestations include impaired cognition, learning and memory deficits, hyperactivity, excitability, fearlessness, and deficits in pre-pulse inhibition (Roy et al. 2002; Young et al. 2002)(Simpson and Wong, unpublished data). There are at least two explanations that may account for the pathological aggression and abnormal social behaviours observed in Nr2e1 / mice. First, the behavioural aberrations may be a - -  direct consequence of altered brain development. This hypothesis is supported by several studies, which indicate that lesions to the forebrain can result in increased aggression (Albert et al. 1985; Lee et al. 1983). A similar neurodevelopmental mechanism may also underlie aberrant maternal behavior in Nr2e1 / mice, a possibility supported by lesion studies of the medial preoptic area of -  -  the rat forebrain, which result in abnormal nest building and pup care (Human 1974, 1986). An alternative hypothesis to account for the behavioural abnormalities is that Nr2e1 needs to be expressed in the adult brain to regulate some aspects of behaviour. This idea is supported by studies that have 'conditionally' disrupted genes in the adult forebrain, which result in behavioural abnormalities that include deficits in learning and memory (Chen et al. 2006), anxiety-like behaviour (Valverde et al. 2004), and schizophrenia-like behaviours (Miyawaki et al. 2004). It could be reasoned that abnormal eye development in Nr2e1 / mice, which leads to - -  reduced vision and blindness, may underlie some aspects of abnormal social behaviours, including aggression and reduced maternal instinct. However, there are reports of blind mice or mice with reduced vision that are not aggressive (Festing 2000) or that appropriately raise their  16  young (Fox and Witham 1997), suggesting that impaired vision and aggression or maternal behaviour are not necessarily linked  1.4.3.5 Novel 'fierce' phenotypes and strain dependent effects -  Young et al (2001) studied the spontaneousfiv deletion on three defined backgrounds: C57BL/6J, 129P3/JEms, and B6129F1 (i.e., first generation offspring generated from a cross between C57BL/6J and 129P3/JEms mice) (Young et al. 2002). Several novel observations (i.e., not described in Nr2e1 targeted mutants (Monaghan et al. 1997; Yu et al. 2000)) were noted that included 1) increased risk of hydrocephalus in C57BL/6J-fiv (but not in 129P3/JEms-frc and B6129F1-fi-c); 2) retarded separation of the inner retinal layer into bipolar and ganglion cell layers in B6129F1-fiT (but not in C57BL/6J-fi.c and 129P3/JEms-fi-c; and 3) impaired regression of the hyaloid vascular system of the eye on all three backgrounds. The identification of novel phenotypes that have not been previously reported in targeted  Nr2e1 mutants may be due to the extent of phenotypic characterization. An alternative explanation is that the spontaneous frc mutation may involve loci other than Nr2el. In this regard, a limitation of the study by Young et al is that they assumed that the phenotypic outcome was most likely due to disruption of Nr2e1. Although this is a reasonable assumption, given that thefrc phenotype resembled that of targeted Nr2e1 mutants, resolving the molecular nature of thefi-c mutation is important to our understanding of the genetic basis of variable expressivity in  fierce mice. That many of the novel phenotypes were strain-dependent argues for the existence of modifier loci (i.e. loci other than the disease locus that modulate phenotypic outcome). In addition to the novel examples described above, background-dependent effects in fierce mice  17  were also demonstrated for phenotypes shared among targeted and spontaneous Nr2e1 strains (Table 1.1).  Table 1.1 Background-dependent phenotypic differences among fierce mice Phenotype  Background-dependent differences'  C57BL/6J-frc weighed significantly less than B6129F1-frc (p < 0.001) All C57BL/6J-fi-c had enlarged ventricles whereas 129P3/JEms-frc and B6129F1-fi-c had few, if any Retinal layers All six layers in C57BL/6J-frc were thinner than controls (p <0.003) but only two layers in 129P3/JEms-frc (photoreceptor temporal p <0.04, full nasal p <0.02) and four layers in B6129F1-frc (bipolar temporal p <0.02, photoreceptor temporal p <0.002, bipolar nasal p = 0.05, photoreceptor nasal p <0.006) were thinner than controls Retinal vessels Retinal vessels were small in size and few in number in all 129P3/JEms-fi-c and B6129F1-frc but were mostly absent in C57BL/6J-frc Electroretinogram (ERG) Non-detectable ERG signal in C57BL/6J-fi-c and 129P3/JEms-frc but a b-wave signals amplitude (-25% of normal) detected in B6129F1-fi-c Exploratory behaviour 2 Time spent in closed arms during elevated plus maze test was less for C57BL/6J-fi.c than B6129F1-fi^c Maternal behaviour Lack of maternal behaviour more evident in C57BL/6J-frc than in 129P3/JEmsfrc and B6129F1-fi-c Aggressive behaviour 2 C57BL/6J-fi^c were more aggressive than B6129F1-frc Weight Ventricle size  i 2  signicant phenotypic differences were detected on all three backgrounds in comparison to control mice 129P3/JEms-frc not examined  The study of thefi-c mutation on several defined genetic backgrounds is a strength of the work reported by Young et al (2001). The identification of background-dependent effects in fierce mice offers an opportunity to map and characterize additional genes that modulate brain, eye, and behavioural development in mice, which may help guide the search for modifier loci in humans. Numerous examples of modifier genes in mice have been reported and some examples in humans are also known (reviewed in (Nadeau 2003).  18  1.5 Human NR2E1 Genetic Diversity and Expression Variation Studies  1.5.1 Patterns and extent of genetic variation at NR2E1 Stephens et al (2001) undertook a systematic survey of genetic variation in 313 genes that included NR2E1 (Stephens et al. 2001). Their sample size consisted of 82 unrelated individuals (unselected for disease) representing African-Americans (n = 20), Asians (n = 20), Caucasians (n = 21), and Hispanic-Latinos (n = 18). A total of 3,499 by of NR2E1 was sequenced, and a total of 14 single nucleotide polymorphisms (SNPs) were identified (Table 1.2). The ancestral state of each variant was determined by comparing each variable site to a single chimpanzee sequence. Data on ancestral and derived states are invaluable for molecular evolutionary studies of genes; however, Stephens et al. do not report ancestral state data for any of the genes they examined. Importantly, the use of multiple non-human primate species would provide a more robust interpretation of the ancestral state. Stephen et al. used only chimpanzee (n =1). Stephens et al. also constructed haplotypes and detected 14 for NR2E1. In addition, they calculated linkage disequilibrium (LD) by computing the Lewontin's coefficient ID'I. LD values for each gene were not reported, nor did the study indicate the SNPs used for their analyses of LD. Rather, LD for each gene was reported as being present or absent; for NR2E1, LD was `present'. For genetic case-control association studies, a more useful measure of LD is the Pearson's correlation r2 (Ardlie et al. 2002), which was not computed by Stephens et al. Two measures of nucleotide diversity were calculated in this study: Ow, which is based on the proportion of segregating sites in a population, and  7C, which  is based on the average number of  nucleotide differences per site between two sequences randomly drawn from the population  19  Table 1.2 Genetic Variation at NR2E1 1 NR2E1 Regions Examined  Nucleotides Screened (bp)  5' Upstream 2 5' UTR Coding Exon/intron boundary' 3' UTR Total Screened  849 168 1180 1201 101 3499  Percentage of Total Region Screened' n/a 27% 100% n/a 7.5% -  Number of SNPs Detected 4 1 1 7 1 14  modified from (Stephens et al. 2001) genomic region immediately upstream of 5' UTR up to 100 bases into the introns from the exon/intron boundaries 4n/a, not applicable 2 3  (Hartl 1997). The Ow and it for NR2E1 were 7 x le and 3.0 x 10 4 , respectively, which were lower than the average Ow (9.6 x 10 4 ) and it (5.8 x 10 4) for all 313 genes combined. For each of the 313 genes, Stephens et al. also calculated the test statistic Tajma's D, which is the difference between  it  and Ow and is often used to detect departures from the neutral  expectation of molecular evolution (Tajima 1989). A positive value may indicate selective advantage for heterozygotes, whereas negative values may indicate positive (i.e., adaptive) or negative (i.e., purifying) selection. Of the 313 genes examined, the majority showed negative values for Tajima's D value, which included NR2E1 (D = -1.3495). Stephens et al. interpreted this as evidence for a recent expansion of the human population. Nucleotide diversity data, in combination with frequency data of ancestral and derived alleles, can also be used to compute additional classical tests of molecular neutrality, such as Fu and Li's D* and F*; however, these statistics were not calculated by Stephens et al.  20  The study of Stephens et al., one of the first large-scale reports of LD and haplotype variation on a genome-wide level, provides valuable insight into the nature and extent of sequence variation in ethnically-diverse human populations. An important strength of this study is the means by which sequence variants were identified, namely, through direct DNAresequencing, which represents the most unbiased way of detecting SNPs. The SNPs discovered by Stephens et al. were deposited in the database for single nucleotide polymorphisms (dbSNP; http://www.ncbi.nlm.nih.gov/projects/SNP/) . However, only 10 of the fourteen NR2E1 SNPs identified in the study were deposited, and data regarding the allele frequency and ethnic distribution were unavailable. Stephens et al. did not sequence the entire 5' and 3' UTRs of  NR2E1 (only 27 and 7.5% of the total 5' and 3' were sequenced, respectively) nor did they examine evolutionarily conserved regions, which are likely to harbour functionally important variants (Drake et al. 2006). In light of these issues, further re-sequencing studies of NR2E1 in unrelated ethnically-diverse humans as well as non-human primates are justified. Importantly, the elucidation of LD, haplotype structure, and molecular evolution using re-sequenced data is important for human studies of NR2E1. With respect to the importance of studying putative regulatory regions, Stranger et al (2005) recently report evidence of cis acting NR2E1 regulatory -  variants that may influence the expression of this gene, as discussed below.  1.5.2 Regulatory variants and NR2E1 expression Stranger et al (2005) performed a genome-wide association study of gene expression using SNPs distributed across 630 protein-coding genes using lymphoblastoid cell lines derived from 60 unrelated individuals of European descent. The genomic regions tested for association with gene expression variation were in cis to the gene of interest (defined in the study as proximal 1-  21  Mb regions). The study detected strong and highly significant SNP-to-expression associations for only 60 genes, which included NR2E1. Importantly, this study applied three methodologies for multiple test corrections, and in most cases there was substantial overlap of the signals from all three methods for the significant SNP-to-expression associations, which increases the likelihood that the signals are true positives. Nonetheless, the regulatory potential of each SNP on gene expression needs to be experimentally validated by methods such as binding and transfection assays. There are several assumptions and limitations to the study of Stranger et al (2005). First, the study makes the assumption that the only factors contributing to gene expression differences are the gene-associated SNPs. However, other factors may also influence gene expression levels. For instance, it is possible that SNP-SNP interactions may underlie some of the gene-expression associations. The model used by Stranger et al do not test for such possible interactions but consider only the effects of each SNP alone. Second, the study screened a panel of only 60 individuals, which could explain why only a small number of genes had significant signals (i.e., limited power). Consequently, their analyses can only detect large effects. Future studies should include a larger sample set to enable detection of smaller effects that may also be of biological relevance. Third, the study restricted their analyses to regions located less than 1 Mb from the genes of interest, with the assumption that most cis-acting regulatory variants will be found within these limits. Although this is a reasonable assumption (i.e., the proximal promoters of most genes are within 1 Mb of the transcription start site), the study cannot capture regulatory sequences such as enhancers that can be located > 1Mb from the gene in either direction of the transcription start site (Lettice et al. 2003)). Fourth, this study examined gene expression using a  22  single cell type (i.e., lymphoblastoid); the number of significant SNP-to-expression associations may increase if additional cell types are tested. This would be particularly important for NR2E1, which is expressed primarily in the brain.  1.6 Role of NR2E1 in Human Health and Disease  1.6.1 Support for a Role of NR2E1 in Human Brain-Behaviour Development and Disease Many lines of evidence support a role for NR2E1 in human brain and behavioural development and disease. First, mouse and human NR2E1 have similar temporal and spatial transcription of NR2E1. Given that mice lacking Nr2e1 have brain-behaviour abnormalities, humans lacking NR2E1 may produce similar phenotypes. Second, Abrahams et al (2005) have completely corrected the abnormal cortical abnormalities and pathological aggression of Nr2e1 /  - -  mice using a genomic clone spanning the human NR2E1 locus, which includes its endogenous promoter and regulatory elements (Abrahams et al. 2005). This provides robust evidence that human and mouse NR2E1 are functionally equivalent, at least in mice. Importantly, this work establishes the first, and so far the only, genetic mouse model of behavior in which a human gene is able to correct mouse pathological behaviour. Third, mutations in human and mouse NR2E3, which is the gene most closely related to NR2E1, produce similar developmental abnormalities of the eye in both species (Akhmedov et al. 2000; Haider et al. 2000). This bolsters the proposal that human and mouse NR2E1 mutations might also produce similar developmental abnormalities. Fourth, several genes known or proposed to interact with Nr2e1 are themselves implicated in human disorders of brain and behaviour, as discussed below.  23  1.6.1.1 Genes That Interact with NR2E1 Are Implicated in Human Brain-Behaviour Disorders 1.6.1.1.1 Paired Box Gene 6 (PAX6) Pax6 is proposed to interact genetically with Nr2e1 (Section 1.4.3.2) (Stenman et al. 2003). Stober et al (1999) performed a case-control association analysis involving 294 patients with schizophrenia, 157 with affective disorder, and 217 control subjects, and found a significant association of the high-activity dinucleotide repeat polymorphism of the PAX6 promoter with the paranoid subtype of schizophrenia (Stober et al. 1999). It is speculated that the role of PAX6 in CNS specification, including synaptic guidance and connections in later development, may link this gene to schizophrenia. Importantly, Stober et al provide preliminary evidence that neurodevelopmental genes such as PAX6 may underlie some aspects of schizophrenia, which is consistent with the `neurodevelopmental hypothesis' of schizophrenia (Rapoport et al. 2005; Strakowski et al. 2005). Heyman et al (1999) genotyped individuals from a single family that segregated for eye abnormalities characteristic of PAX6 mutations (Heyman et al. 1999). They found that individuals with PAX6 mutations had higher rates of psychiatric disorders and showed significant abnormalities on tests of frontal lobe function, thereby implicating mutations of PAX6 with a neurobehavioural phenotype.  1.6.1.1.2 Nuclear Receptor Subfamily 4, Group A, Member 2 (NR4A2, also known as NURR1) Yu et al (2000) used RT-PCR and Northern blot analyses to demonstrate that Nr4a2 is upregulated in mice deleted for Nr2e1 (Yu et al. 2000). Since Nr4a2 is essential for the genesis and differentiation of dopaminergic neurons (Zetterstrom et al. 1997), which are thought to be implicated in the etiology of schizophrenia (Willner 1997), Chen et al screened 177 unrelated  24  patients with schizophrenia for mutations in NR4A2. They found a rare variant in the first exon in two patients but not in 133 nonpsychotic control subjects. However, further in vitro work is clearly needed to implicate a functional role for this variant in the pathogenesis of schizophrenia (Chen et al. 2001). Buervenich et al (2000) screened patients with schizophrenia and bipolar disorder and found two different NR4A2 missense mutation in two patients with schizophrenia as well as another missense mutation in a patient with bipolar disorder (Buervenich et al. 2000) and demonstrated reduced transcriptional activity by all three mutations (Buervenich et al. 2000). Le et al (2003) screened 201 patients with Parkinson disease and detected two mutations in the first exon of NR4A2 that resulted in a significant decrease of NR4A2 mRNA in cell lines of affected individuals (Le et al. 2003).  1.6.1.1.3 Retinoic Acid Receptor, Beta (RAO)  Kobayashi et al (2000) demonstrated that Nr2e1 acts as a cell type-specific regulator for RAR/32 by binding to a cis element within its promoter, which confers Nr2e1 and retinoic acid-  dependent transactivation (Kobayashi et al. 2000). Krezel et al (1998) characterized RAR/32 knockout mice and demonstrated impaired control of locomotor behaviour as well as dysfunction of dopamine signaling, which resemble multiple aspects of schizophrenia (Krezel et al. 1998). Importantly, there are multiple compelling lines of evidence that implicate retinoids and their receptors, including RAR/32, in the etiology of schizophrenia (reviewed in (Goodman 1998).  25  1.6.1.1.4 S100 Calcium-binding Protein, Beta (S100/3)  Shi et al demonstrated that S100fl, which contains a consensus Nr2e1 binding site in its promoter, was upregulated in the brains of Nr2e1 / mice; gel shift assays were used to - -  demonstrate that Nr2e1 could specifically bind to the promoter of 5100fl in vitro (Shi et al. 2004). At least seven studies have implicated elevated levels of 5100fi in schizophrenia (reviewed in (van Beveren et al. 2006)); these results represent the most robust in comparison to all other neural growth factors examined in the peripheral blood of schizophrenic patients. Liu et al (2005) performed a case-control association study in 384 patients with schizophrenia and 401 control subjects (Liu et al. 2005). They found a significant association with a S100fl haplotype (which is associated with increased S100,8 expression) with schizophrenia. Rothermundt et al (2004) demonstrated an association between glial cell dysfunction and elevated levels of 5100fl in schizophrenia (Rothermundt et al. 2004). 1.6.1.1.5 Phosphatase and Tensin Homolog (Pten),p27kipl, Cyclin Dl, and Atrophinl (Atnl)  Zhang et al (2006) studied retinal development in Nr2e1 / mice and performed gene - -  expression profiling using Q-PCR and Western blotting to analyze global gene regulation by Nr2e1 at E15.5 and PO (Zhang et al. 2006). They found a total of 83 and 130 known genes that showed expression level changes at E 15.5 and P0, respectively; the expression of 27 genes was altered at both stages. Many of the genes demonstrated to be significantly dysregulated by Nr2e1 are also of particular interest to human brain and behaviour biology; however, one limitation to such interpretations is that Zhang et al. studied the effects of Nr2e1 in the retina that may not hold true in the brain.  26  Zhang et al. demonstrated that the mRNA and protein levels for Pten were significantly upregulated in Nr2e1 "/- mice (Zhang et al. 2006). They also used a luciferase-based assay to demonstrate dysregulation of Pten by Nr2e1, specifically, that Nr2e1 is able to suppress Pten activity. In addition, they identified a consensus Nr2e/-binding sequence in the promoter of Pten and demonstrated direct binding of Nr2e1 to the Pten promoter using gel shift assays. The data therefore suggest that Nr2e1 modulates the expression of Pten by directly binding to its promoter. They also analyzed downstream targets of Pten, including cyclin D1 and p27kipl (Gottschalk et al. 2001; Weng et al. 2001), and demonstrated that cyclin D1 protein levels were markedly lower in mutant versus wildtype Nr2e1 mice; however, the levels of p27kipl were not significantly altered. These results are in partial agreement with Miyawaki et al. (2004), who also examined p27kipl and cyclin Dl levels in mutant versus wildtype Nr2e1 mice and found that both proteins were reduced in the retina (Miyawaki et al. 2004). Zhang et al suggest that the discrepancy might result from uneven immunostaining of the sections as well as cell counting errors (Zhang et al. 2006). Pten is known to negatively regulate neural stem cell proliferation (Groszer et al. 2006; Groszer et al. 2001), and human mutations in this gene result in Bannayan-Riley-Ruvalcaba phenotype that is characterized in part by macrocephaly (i.e., large head) (Longy et al. 1998). Cell cycle regulatory genes such as cyclin D1 and p27kip1 have been proposed to be excellent candidates for human cortical malformations (Crino 2005; Ross and Walsh 2001). Given that loss of Nr2e1 in the mouse retina results in a marked reduction in cyclin Dl, which may underlie the abnormal retinal laminar arrangements (Miyawaki et al. 2004), I hypothesize that a similar mechanism may underlie the abnormal cortical laminar arrangements characteristic of Nr2e1 "/-  27  mice (Land and Monaghan 2003). Taken together, the regulation of Pten cyclin Dl expression -  by Nr2e1 and the promising role of Pten cyclin D1 in human brain development support a role -  for Nr2e1 in human brain development. Zhang et al. (2006) also demonstrated an interaction between Atnl and Nr2e1 (Zhang et al. 2006). They performed an extensive yeast two-hybrid screen using a rat hippocampus library and the LBD of Nr2e1 as bait and identified three independent positive clones corresponding to the C terminus of rat Atnl. The interaction was confirmed in mammalian cells using coimmunoprecipitation and further confirmed using GST pull-down assays, which demonstrated that Nr2e1 binds specifically to the LBD of Atnl . To test the possibility that Atn works as a transcriptional repressor, Zhang et al. used a standard luciferase reporter assays and showed that full-Atnl or a truncated version containing the Nr2el-interacting region can repress transcription, which demonstrates that Atnl is important for Nr2el-mediatied repression. Poly-Q expansion in Atnl is responsible for the human neurodegenerative disease, dentatorubralpallidoluysian atrophy (DRPLA), which is characterized by ataxia, myoclonus, choreoathetosis, epilepsy, and dementia (Koide et al. 1994). It has also been hypothesized that Atnl may underlie psychotic symptoms that present in schizophrenia and bipolar. Several studies have examined the role of the poly-Q repeat in Atnl; however, there have been no significant associations found to date (Morris-Rosendahl et al. 1997; Sasaki et al. 1996).  28  1.6.1.1.6 Neurogeninl (Ngnl), Nuclear Receptor Subfamily 0, Group B, Member 1 (NROB1, also known as Dax1), Zinc Finger Protein of Cerebellum 1 (Zic/), and Forkhead Box G1B (Foxglb)  In addition to the interactions described above, several other genes proposed to be dysregulated by Nr2e1 are of note. In particular, Ngnl,NrObl,Zicl, and Foxgl were all found to be significantly upregulated in Nr2e1 / mice versus wildtype controls (Zhang et al. 2006). Ngnl - -  encodes a basic-helix-loop transcription factor that contributes to the specification of a neuronal versus glial identify in cortical progenitors (Nieto et al. 2001). A complex rearrangement involving a 2.2 kb deletion of intron 1 as well as the entire exon 2 of NrObl, a member of the orphan nuclear receptor family, has been described in one patient with schizophrenia (Salvi et al. 2002). Heterozygous mutations involving human Z/C/ is involved in Dandy-Walker malformation (Grinberg et al. 2004), which is the most common congenital malformation of the cerebellum. Although human NR2E1 is expressed primarily in the forebrain, low levels of NR2E1 expression in the cerebellum has been detected by reverse transcriptase PCR (Nishimura et al. 2004). Finally, studies in mice have implicated a role for Foxgl in corticogenesis and telencephalic development (Hanashima et al. 2004; Martynoga et al. 2005). Recently, a chromosomal alteration involving human FOXG1B together with altered transcript levels of this gene have been reported in a patient with microcephaly and mental retardation. Future studies of Ngnl, NrObl , Zicl, and Foxgl would need to establish whether they are direct or indirect targets of Nr2e1 .  29  1.6.2 Role of NR2E1 in Human Cortical Disorders 1.6.2.1 Cortical Disorders Human cortical disorders can fall into several classes that reflect the molecular and cellular origins of the primary defect (Francis et al. 2006). These include proliferation and neuronal generation disorders (which may involve abnormal neuron numbers and/or comprised neuronal survival), neuronal migration disorders (which may involve abnormal cell migration), extracellular matrix integrity disorders (which may involve perturbations between glia limitans and extracellular matrix), and connectivity disorders (which may involve perturbed synapse formation and white matter tract growth and/or maintenance). Given the role of Nr2e1 in proliferation and neuronal generation, this gene is an appropriate candidate for cortical disorders involving deficits in neuronal proliferation and generation, which include primary microcephaly and microcephaly with simplified gyral patterns (MSG). Microcephaly is a clinical diagnosis that refers to a head circumference that is significantly less than expected for an individual's age and sex. It is therefore a surrogate measurement of reduced cortical size (Warkany 1981) and can be classified as either primary (Figure 1.5 A, B), which involves a static developmental anomaly that is present at birth, or secondary, which involves a progressive neurodegenerative condition that develops postnatally (Woods 2004). Microcephaly can be associated with simplified gyral patterning of the cerebral cortex and a slight reduction in white matter volume (Figure 1.5 C) (Barkovich et al. 2001). The simplified gyral pattern does not involve abnormal cortical lamination but rather an immatureappearing cortex, which suggests defects in cell division and neuronal proliferation. Other phenotypes that may be present in microcephaly include agenesis of the corpus callosum,  30  thickened cortical gray matter, and other cortical dysplasias including polymicrogyria (i.e., many small gyri) (Francis et al. 2006). The etiology of microcephaly includes environmental factors (e.g., congenital toxoplasma infection, alcohol consumption during pregnancy) as well as genetic determinants (Cowie 1987). 1.6.2.2 Genetics of Microcephaly  There is a strong genetic predisposition to primary microcephaly, which can be inherited in an autosomal recessive manner (autosomal recessive primary microcephaly; MCPH) (OMIM ID 251200). To date, six genetic loci have been identified for MCPH (MCPH1-MCPH6)  (Jackson et al. 1998; Jamieson et al. 1999; Leal et al. 2003; Moynihan et al. 2000; Pattison et al. 2000; Roberts et al. 1999). Positional cloning strategies have identified the causative genes for four of these loci, namely Microcephalin (Jackson et al. 2002), ASPM (Bond et al. 2002), CDK5RAP2 (Bond et al. 2005), and CENPJ (Bond et al. 2005). Given that many families with  MCPH do not map to any of the 6 known loci (Kumar et al. 2004; Roberts et al. 2002), additional MCPH loci are expected. To date, no genes for microcephaly with simplified gyral patterns have been identified.  31  Figure 1.5 MRI scans of normal and abnormal cerebral cortices (A) An axial magnetic resonance imaging (MRI) scan of a normal individual, showing the normal architecture of the cerebral cortex. (B) An axial MRI scan (reproduced at the same relative size) of an individual with primary microcephaly. The brain is greatly reduced in size. The cerebral cortex is smaller in surface area, but shows relatively normal gyri and sulci. (C) An axial MRI (at the same relative size) from an individual with microcephaly and simplified gyral pattern. The cortex is not greatly thickened but there are relatively few preserved gyri. Scale bar = 2cm. (Modified from (Mochida and Walsh 2001)).  1.6.2.3 Genetic Mouse Models of Microcephaly Nr2e1 -/- mice represent a reasonable model for microcephaly, given that the mitotic role of Nr2e1 in the cortex may contribute to our understanding of reduced cortical size in human microcephaly. A few other candidate mouse models of microcephaly exist. Mice lacking cyclin  D l have small brains, reduced body size, and motor abnormalities (Sicinski et al. 1995). In Ndel mouse mutants, mitotic rates and cell fate choice are perturbed, which results in reduced cerebral cortical size in addition to absence of superficial cortical layers (Feng and Walsh 2004).  32  1.6.2.4 Role of NR2E1 in Microcephaly Multiple lines of evidence (in addition to those outlined in section 1.5.1) support a role for NR2E1 in microcephaly. First, all evidence to date suggests that microcephaly is a primary disorder of neurogenic mitosis rather than one of neuronal migration, given that all four known microcephaly genes are expressed in the neuroepithelium. In support of this, some patients with microcephaly have small brains that function relatively normally for their size, which would not be expected if neurons were displaced abnormally throughout the brain. That Nr2e1 is involved in neurogenic mitosis in mice supports it as a candidate for microcephaly. Furthermore, mice deleted for Nr2e1 have reduced cortical size that resembles human microcephaly. Second, genes that regulate the formation of later-generated upper cortical layers like Nr2e1 are suitable candidates for microcephaly, given that preferential neuronal loss in superficial cortical layers 2 and 3 has been described in some patients with microcephaly (Mochida and Walsh 2001). Third, some patients with cortical abnormalities have been described to harbour de novo interstitial deletions that include the NR2E1 locus (Chery et al. 1989; Evers et al. 1996; Hopkin et al. 1997). For instance, Hopkin et al (1997) report an interstitial deletion that includes NR2E1 in a boy with severe intrauterine growth retardation and severe congenital MIC, which resemble some aspects of Nr2e1 / mice. Fourth, cortical dysplasia can result from Pax6 haploinsufficiency in humans - -  (Schmahl et al. 1993; Sisodiya et al. 2001). In mouse, double heterozygotes for Nr2e1 and Pax6 interact genetically to alter the normal development of the telencephalon (Stenman et al. 2003). Thus, we anticipate that NR2E1 will interact genetically with PAX6 to regulate human brain development, supporting a multigenic mechanism. Other genes that are known or proposed to  33  interact with Nr2e1, including cyclin D1, Zic5, and Foxgl, are also known to underlie the etiology of some cortical disorders (discussed in Section 1.6.1.1)..  1.6.3 Role of NR2E1 in Human Aggression and Violence 1.6.3.1 Aggression and Violence Aggression and violence constitute a major public health concern and may be studied from a health-based, biomedical perspective. The World Report on Violence and Health defined violence as: "The intentional use of physical force or power, threatened or actual, against oneself, another person, or against a group or community that either results in or has a high likelihood of resulting in injury, death, psychological harm, maldevelopment or deprivation" (Krug et al. 2002). Aggression and violence (which includes impulsive-aggressive behaviours, psychopathy, hostility, and rage) constitute a variable and multidimensional phenotype that may involve unwarranted and intentional acts of aggression that inflict bodily or mental threat, abuse or injury to others or to oneself (Filley et al. 2001; Turecki 2005). Such behaviors are commonly associated (but not equated) with criminality and can also present as a symptom secondary to a medical condition including psychiatric disorders (APA 2000; Gothelf et al. 1997; Nolan et al. 1999). The determinants of aggression and violence are complex and can include genetic factors, as discussed below.  1.6.3.2 Genetics of Aggression and Violence There has been a growing recognition of genetics as a powerful influence on human aggressive and violent behaviors, which is supported by at least three lines of evidence, namely, twin, adoption, and human and mouse molecular genetic studies. Twin studies demonstrate a  34  statistically significant higher concordance rate for criminality in monozygotic twins than in dizygotic twins (Christiansen 1968; Lyons 1996). In a twin study conducted by Coccaro et al., heritabilities of 47%, 40%, and 28% were reported for direct physical aggression, indirect physical aggression, and verbal aggression, respectively (Coccaro et al. 1997). A meta-analysis of adoption studies indicate that genetic contributions may account for approximately half the variance in criminal and aggressive behaviors (Raine 1993). The direct analysis of candidate genes also reveals a potential role for genes in human aggression and violence. An association between polymorphisms within the tryptophan hydroxylase gene (TPH) has been independently replicated in aggression, impulsive violence, suicide, and anger-related traits (Hennig et al. 2005; Nielsen et al. 1994; Nielsen et al. 1998; Rujescu et al. 2002; Turecki et al. 2001; Zaboli et al. 2006), although others have not found significant associations (Mann et al. 1997; Zalsman et al. 2001). Mutations in the monoamine oxidase A gene (MAOA) has been found to segregate with aggressive-violent behaviour in at least one pedigree (Brunner et al. 1993; Brunner et al. 1993). In addition, the low-activity promoter allele of MAOA has been shown to predict violent and antisocial outcome in the presence of a maladaptive environment (Caspi et al. 2002), which emphasizes the importance of incorporating environmental variables into genetic studies of aggression (Figure 1.6). However, some studies do not support a link between MAOA coding (Schuback et al. 1999; Tivol et al. 1996) or promoter (Koller et al. 2003; Ono et al. 2002; Vanyukov et al. 1995) variations, suggesting that MAOA mutations account for only a small proportion of violence, or that other factors may be involved.  35  7  111Clr ld Mode and Neglect  .11 Maltreated Children  MAOA 'Low-activity'  All Ie  MAOA 'High-activity' Allele  Alterned Brain Mettbolism Development  Normal Behavloors  Figure 1.6 Importance of gene-environment interaction in aggression and violence A gene-environment interaction model of childhood maltreatment, MAOA activity, and the development of antisocial behaviour (Caspi et al. 2002). The process of early brain development is constantly modified and altered by environmental life experiences. Childhood maltreatment constitutes one aspect of these environmental influences, which present the developing child's brain with experiences that may adversely affect the child's future development and (behaviour) functioning. These adverse experiences pose adaptational challenges on physiological systems, including the serotonergic system, and either prevent or allow the child to cope with stressful situations. If serotonin were to accumulate abnormally, which may be occurring in maltreated children harbouring the low MAOA-activity allele, then the 'flight and fight' responses may effectively be in 'high gear' all the time. This may lead to the inability to handle stressful situations, even ones the rest of us cope with easily. Over time, the sum of maltreatment, serotonin activity, changes in brain metabolism and development may translate into aberrant patterns of behaviour, including antisocial, criminal, and violent. It is important to bear in mind that the model proposed here represents a simplified one and that the illustrated pathways are  36  likely to overlap (e.g. phenotypic overlap between 'aberrant' and 'normal' behaviours) (modified from Kumar 2003).  There are some obvious limitations inherent in genetic studies of aggression and violence, which may in part explain the lack of replicability across studies. For one, existing studies have used very different populations for molecular analyses of the same gene. In addition, different measures (both qualitative and quantitative) are used to define aggression and violence. Importantly, most studies fail to distinguish between impulsive reactive violence and predatory violence, which are each likely to have their own distinct biological bases (Blair et al. 2006). The terms 'aggression and violence' themselves reflect heterogeneous manifestations that can include impulsivity, criminality, anger, psychopathy and suicidal behaviours, each of which may have multifaceted underpinnings that may or may not include genetic components. Thus, a limitation of many genetic studies of aggression and violence is due to uncontrolled experimental variables, which can include age, gender, education, socioeconomic status, substance abuse, and medication use. The heterogeneous nature of the aggression-violence phenotype together with their complex underpinnings can make recruitment of large and homogenous subjects difficult. Nonetheless, despite some key limits, the genetic dissection of aggression is warranted in light of studies that do provide evidence of some genetic involvement. For instance, it took only a single pedigree that segregated for aggressive behaviours (including arson, aggressive outbursts, attempted rape, and impulsivity) to identify a point mutation in the MAOA gene, a finding that would later pave the way for additional studies of MAOA.  37  Critical for genetic studies of aggression and violence is the understanding that genes do not directly code for aggression or violence, per se (i.e., there is no 'gene for violence'). Rather, mutations and/or polymorphisms in genes contribute to variations in biological processes (e.g., differences in neurocognitive functioning) that in turn lead to individual differences that may ultimately determine differential predispositions to aggressive and violent behaviours.  1.6.3.3 Genetic Mouse Models of Aggression and Violence Genetic mouse models also highlight the remarkable diversity of genes that may be involved in the genetic determination of aggression (Hen 1996; Lederhendler 2003; Nelson and Chiavegatto 2000, 2001; Sluyter et al. 2003). In some instances, mutations and polymorphisms in the mouse and human orthologs are associated with aggression in both species. Examples includes TPH (Hennig et al. 2005; Kulikov et al. 2005; Rujescu et al. 2002; Turecki et al. 2001; Zaboli et al. 2006), MA0,4 (Brunner et al. 1993; Brunner et al. 1993; Cases et al. 1995; Caspi et al. 2002), and COMT (Gogos et al. 1998; Rujescu et al. 2003; Volavka et al. 2004). Consequently, genes known to regulate aggression in mice are reasonable candidates for understanding human aggression as well.  1.6.3.4 Role of NR2E1 in Impulsive Aggressive Behaviours -  NR2E1 is a candidate for impulsive-aggressive behaviours. First, Abrahams et al. (2005) have successfully corrected the inherited pathological aggression in Nr2eT' mice using the human NR2E1 orthologue, which establishes functional equivalency between mouse and human NR2E1 in mice (Abrahams et al. 2005). Loss of Nr2e1 in mice, which leads to structural abnormalities involving the frontal cortex, hippocampus, amygdala, and corpus callosum, may  38  directly underlie the pathological aggression in these animals. Studies in other rodents also demonstrate that lesions of the forebrain result in increased aggression (Albert et al. 1985; Lee et al. 1983). It could be argued that NR2E1 mutations in humans may lead to aggression by similar mechanisms involving developmental defects of the brain. In support of this, some humans with violent behaviours have brain abnormalities that resemble some aspects of the brain phenotype observed in Nr2e1 / mice. For instance, damage to the human prefrontal lobe has been associated - -  with increased hostility, aggression, criminality, and impulsivity (Brower and Price 2001), and frontal lobe dysfunctions have been described in psychopaths and murders (Lapierre et al. 1995) (Raine et al. 1997). In addition, hippocampal and corpus callosum abnormalities have been described in psychopaths (Laakso et al. 2001; Raine et al. 2004; Raine et al. 2003). Furthermore, abnormalities in neuronal density have been described in violent humans (Critchley et al. 2000). Impulsive aggression and violence may also be due to dysfunction in several cortical structures involved in emotion regulation (Figure 1.7). Another demonstration of how studies in Nr2e1 / mice may inform human violence - -  research is provided by preliminary data from the Simpson laboratory that indicates that the selective serotonin re-uptake inhibitor (SSRI) fluoxetine (i.e., Prozac®) can significantly decrease aggression in Nr2e1"/ mice in the resident-intruder test (Simpson and Hoffmann, -  unpublished data). Importantly, SSRIs have been shown to alleviate aggression in humans with impulsive-aggressive disorders (New et al. 2004).  39  Figure 1.7 Key structures in the circuitry underlying emotion regulation (A) Orbital prefrontal cortex (green) and the ventromedial prefrontal cortex (red). (B) Dorsolateral prefrontal cortex (purple). (C) Amygdala. (D). Antrerior cingulate cortex. Each of these interconnected structures (A-D) plays a role in different aspects of emotion regulation, and abnormalities in one or more of these regions and/or in the interconnections among them are associated with failures of emotion regulation and also increased propensity for impulsive aggression and violence. (Modified from (Davidson et al. 2000).  1.6.4 Role of NR2E1 in Bipolar Disorder and Schizophrenia 1.6.4.1 Bipolar Disorder and Schizophrenia Bipolar disorder and schizophrenia are leading causes of morbidity worldwide and share numerous epidemiologic features, including lifetime prevalence of 1%, similar age of onset  40  (typically prior to age 25), and equal presentation in both males and females (Nurnberger and Berrettini 1998). Bipolar disorder (also called manic-depressive illness) is characterized by mood disturbances that can range from extreme mania (elation) to severe depression, but may be accompanied by psychotic features (delusions and hallucinations) as well as cognitive changes. Schizophrenia is characterized by positive symptoms that include psychoses, delusions, hallucinations, and disorganization in thought, as well as by negative symptoms such as negative affect and ahedonia (APA 2000).  1.6.4.2 Genetics of Bipolar Disorder and Schizophrenia There is strong evidence indicating that bipolar disorder and schizophrenia have major genetic etiologies. First, family studies indicate that the first-degree relatives of bipolar disorder and schizophrenia probands are at increased risk for these and related (e.g., hypomanic, recurrent unipolar, schizoaffective) disorders (Baron et al. 1982; Gershon et al. 1988; Kendler et al. 1993; Maier et al. 1993; Winokur et al. 1982). Second, studies using monozygotic (MZ) and dizygotic (DZ) twins demonstrate substantial heritability. The concordance rates for monozygotic bipolar disorder twins range from 40-97% while in dizygotic twins the concordance rates range from 538% (Angst et al. 1980; Kieseppa et al. 2004; McGuffin et al. 2003). For schizophrenia, the concordance rate for monozygotic twins is also higher than for dizygotic twins, with rates ranging from 40-50% (Cardno and Gottesman 2000). Given that the standard twin model assumes that MZ correlations can be no more than twice the magnitude of DZ correlations (i.e., MZ:DZ ratio is 100:50), the observed MZ:DZ ratios, which generally exceed two for each of bipolar disorder and schizophrenia, suggest that many genes are likely to be involved in the etiology of these disorders. Third, adoption studies in both bipolar disorder and schizophrenia  41  demonstrate that adoptees have an increased risk for developing these disorders if born to a bipolar disorder or schizophrenia parent, respectively (Craddock and Jones 1999; Kety et al. 1976). Fifth, linkage studies have reproducibly identified several loci (including the region containing NR2E1; see below) that may harbour bipolar disorder and schizophrenia susceptibility loci (reviewed in (Craddock et al. 2005). The lack of simple inheritance patterns suggests that bipolar disorder and schizophrenia are complex, non-Mendelian disorders that may involve oligogenic inheritance, incomplete penetrance, and epistatic effects. Susceptibility genes for bipolar disorder and schizophrenia have been isolated through a variety of approaches, including positional cloning, cytogenetics, functional genomics, and postmortem brain expression studies. Interestingly, several susceptibility loci are shared between these two disorders, providing support to the proposal that bipolar disorder and schizophrenia may have shared genetic etiologies (Berrettini 2003). Susceptibility loci for bipolar disorder include D-Amino-acid oxidase activator (DADA) (Hattori et al. 2003), Brain derived neurotrophic factor (BDNF) (Green and Craddock 2003; Sklar et al. 2002), and Disrupted in Schizophrenia 1 (DISCI) (Macgregor et al. 2004). Several of the most promising susceptibility loci for schizophrenia include Dysbindin (DTNBP 1) (Numakawa et al. 2004; Straub et al. 2002; Weickert et al. 2004) and Neuregulin 1 (NRG1) (Hashimoto et al. 2004; Stefansson et al. 2003; Stefansson et al. 2002), D-Amino-acid oxidase (DAD) and DADA (Chumakov et al. 2002), Regulator of G-protein signaling 4 (RGS4) (Chowdari et al. 2002), Catechol-O-methlytransferase (COMT) (Bray et al. 2003; Chen et al. 2004), and DISCI (Millar et al. 2000). There is evidence to suggest that regulatory variation in DTNBP I and NRG1 may underlie schizophrenia. For the case of DTNBP1, this is supported by the lack of schizophrenia-  42  associated coding variation (Williams et al. 2004) together with evidence suggesting that cisacting polymorphisms may affect DTNBP1 expression in human brain (Bray et al. 2003). For NRG1, the 5' end of at least one schizophrenia-associated haplotype is suggested to alter mRNA expression. In addition, behavioural analysis of Nrgl hypomorphic mice (Stefansson et al. 2004), together with evidence for altered mRNA in the brains of patients with schizophrenia, (Hashimoto et al. 2004) suggest that alterations in NRG1 expression may underlie disease etiology.  1.6.4.3 Genetic Mouse Models of Bipolar Disorder and Schizophrenia Given the complex clinical presentation of bipolar disorder and schizophrenia, it is not surprising that no genetic mouse model recapitulates all, or even most, of the clinical features of these disorders. Most mouse models that do exist share one to a few characteristics with bipolar disorder or schizophrenia. Among these are mice that that are heterozygous for either NRG1 or its receptor ErbB4 (that show deficits in pre-pulse inhibition and fewer functional NMDA receptors) (Stefansson et al. 2002), mice deleted for NMDA -R1 (that show increased motor activity and stereotypy as well as deficits in social interactions) (Mohn et al. 1999), and mice deleted for GAD65 (that show deficits in prepulse inhibition) (Heldt et al. 2004). In contrast to these examples, Nr2e1"/ mice share numerous brain-behaviour features observed in some -  patients with bipolar disorder or schizophrenia (discussed in section 1.6.4.4).  1.6.4.4 Role of NR2E1 in Bipolar Disorder and Schizophrenia NR2E1 is an excellent positional candidate for bipolar disorder and schizophrenia. NR2E1, which is located on human chromosome 6q21-22 at location 108.6 Mb (ENS112333;  43  www.ensembl.org), maps to the locus that achieved the greatest genomewide significant linkage at position 108.5 MB in the largest meta-analyses of bipolar disorder using original genotype data conducted to date (Figure 1.8) (McQueen et al. 2005). In addition, reproducible evidence from genome-wide family-based analyses has identified a schizophrenia locus (SCZD5; OMIM ID 603175) on Chromosome 6q13-26, where NR2E1 resides (Cao et al. 1997; Levinson et al. 2000; Martinez et al. 1999).  5.0  4 0 .•  30  2 .0' O 10  00  • 1 O .'  -2 0 "t^ 0^15^30^45^60^75^90^105 120 135 I50 165 160 19::  eM  Figure 1.8 NR2E1 resides near a putative susceptibility locus for bipolar disorder The greatest LOD score (4.19) from pooled analysis of genotype data across 11 studies was achieved at physical location 108.5 Mb (115 cM), which is the region close to which NR2E1 maps (108.6 Mb; solid black vertical line). The LOD scores from the pooled analysis (solid black peak) are overlaid with the LOD scores from the data set-specific analysis (solid non-black lines). The horizontal dashed line indicates the genomewide significance threshold (3.03) (Modified from (McQueen et al. 2005)).  NR2E1 is also an excellent functional candidate for bipolar disorder and schizophrenia. This is because loss of Nr2e1 in mice results in several behavioural phenotypes that are common to a subset of individuals with bipolar disorder and schizophrenia. First, aggressive-violent behaviours are increased in bipolar disorder and schizophrenia in comparison to the general  44  population (although only a small proportion of patients with bipolar disorder and schizophrenia are violently aggressive) (Feldmann 2001; Hodgins 1992; Posternak and Zimmerman 2002; Schanda et al. 2004; Swanson et al. 1990). Several genes, including COMT and 5 HTTR, have -  been implicated with aggression in schizophrenia (Han et al. 2006). In this regard, the identification of the genetic underpinnings of bipolar disorder and schizophrenia could also contribute to an understanding of the etiology of aggression and violence. Second, deficits in prepulse inhibition are observed in Nr2e1 / mice (Wong and Simpson, unpublished data) and in - -  patients with bipolar disorder or schizophrenia (Braff et al. 2005; Kumari et al. 2005; Meincke et al. 2004; Perry et al. 2001). Third, cognitive impairment is observed in Nr2e1 / mice (Wong and - -  Simpson, unpublished data) (Roy et al. 2002) as well as in patients with bipolar disorder or schizophrenia (Gruzelier et al. 1988) (Liddle 1987; Liddle and Morris 1991). Loss of Nr2e1 in mice also results in numerous neurodevelopmental phenotypes that have been described in a subset of bipolar disorder and schizophrenia. The most prominent gross brain abnormality in schizophrenia is enlarged ventricles and reduced cortical volumes that can also be accompanied by reductions in temporal lobe, frontal lobe, hippocampal, corpus callosal and amygdala volumes, which are all regions affected in Nr2e1 -1 mice (Chen et al. 2004; DeLisi et -  al. 1991; Hajek et al. 2005; Lawrie and Abukmeil 1998; Lieberman et al. 1993; Nelson et al. 1998; Swayze et al. 1990; Velakoulis et al. 1999; Wright et al. 2000). Importantly, in many of these studies, the absence of morphological changes between first onset and later presentation, as well as lack of gliosis (an indicator of cell death), suggests that the brain changes are not degenerative but are present early in the course of the disorder (i.e., the lesion precedes the symptoms). This is support for the neurodevelopmental hypothesis of bipolar disorder and  45  schizophrenia (Rapoport et al. 2005; Strakowski et al. 2005). The absence of gliosis in the brains of Nr2e1 / mice also indicates that their brain abnormalities are due to abnormal - -  neurodevelopment rather than neurodegeneration (Roy et al. 2002; Young et al. 2002). Other similarities that are common between Nr2e1 / mice and bipolar disorder and schizophrenia - -  include 1) aberrant neurogenesis (Benes et al. 1998; Selemon and Goldman-Rakic 1999); 2) aberrant arrangement of cortical neurons in superficial layers II and III (Arnold 1999; Arnold et al. 1991; Falkai et al. 2000; Jakob and Beckmann 1986); and 3) deficits in olfactory bulb structure and function (Moberg et al. 1999; Turetsky et al. 2003; Turetsky et al. 2000). In at least one study, differences in brain abnormalities between patients and control subjects were suggested to be due to genetic influences (Rijsdijk et al. 2005). Individuals who have suffered perintal complications are more than twice as likely to develop schizophrenia as individuals without such complications (Geddes and Lawrie 1995; Kunugi et al. 2001). Of particular note are complications that reflect chronic hypoxia or acute asphyxia. It has been suggested that ischemic damage may lead to neuronal loss in brain regions that are sensitive to anoxic conditions and known to be involved in schizophrenia, such as the hippocampus (Kudrna 1994; Rosso et al. 2000). In addition, fetal hypoxia has been shown to predict reduction in gray matter in the cortex of patients with schizophrenia but not in control subjects (Cannon et al. 1993). Together, these observations indicate a possible role for lack of oxygen in the pathogenesis of schizophrenia. Given that Nr2e1 expression is influenced by oxygen concentrations in retinal astrocytes (Uemura et al. 2006), it is conceivable that its expression is also controlled in the brain by oxygen, and that hypoxic conditions may affect  46  NR2E1 function that may in turn lead to the deficits observed in association with obstetrical complication in a subset of patients with schizophrenia.  1.7 Thesis Objectives  1.7.1 Origin and Nature of the 'Fierce' Mutation Although Young et al. (2002) had previously demonstrated that fierce mice are deleted for at least Nr2e1 (Young et al. 2002), the precise molecular nature of the spontaneous mutation remained unresolved. The serendipitous discovery of these mice during a gene targeting experiment intended to delete the Zfa gene (Banks et al. 2003) made it unclear whether more than one gene contributed to the complex brain-behaviour features of these mutants. The application of fierce mice to future single-gene studies of human brain-behaviour disorders rested in part on a thorough investigation of these issues. To test the hypothesis that the fierce mutation (and the complex fierce phenotype) involves only Nr2e1 and not its immediate neighbouring genes, we initiated a series of computational, molecular and expression studies to elucidate the precise molecular nature of the spontaneous fierce mutation (Chapter Two). In addition, we elucidated the origin of the fierce mutation by studying cell lines that were used throughout the gene-targeting experiments designed to disrupt the Zfa gene.  1.7.2 Role of NR2E1 in Human Cortical Development The role of NR2E1 in human abnormal corticogenesis is unknown, and genetic studies examining the role of this gene in human corticogenesis have never been reported. To test the hypothesis that humans with abnormal cortical development may harbour coding or regulatory  47  NR2E1 mutations, we undertook the first mutation analyses of this gene by sequencing its entire coding, complete 5' and 3' untranslated, splice-site, proximal promoter, and evolutionarily conserved non-coding regions in 60 unrelated patients with cortical disorders, and we genotyped candidate mutations in 94 control subjects and 29 relatives (Chapter Three). To direct the present and future studies of NR2E1, we also elucidated its molecular evolution, genetic diversity, haplotype structure, and linkage disequilibrium by sequencing an additional 94 unaffected humans representing populations from Africa, the Americas, Asia, Europe, the Middle East, and Oceania, as well as representatives of four non-human primate species. We used in silico tools to predict the effects of candidate mutations on neural transcription factor binding sites (TFBS).  1.7.3 Role of NR2E1 in Human Aggression and Psychiatric Disorders The inherited nature of violent behaviour in Nr2e1 / mice together with strong positional - -  evidence for involvement in psychiatric disease makes NR2E1 an attractive candidate for genetic studies of aggression and psychiatric disorders; however, its role in human behavioural disorders and mental illness is unknown. To test the hypothesis that mutations in NR2E1 may underlie impulsive-aggressive behaviours, bipolar disorder, and schizophrenia, we initiated the first mutation screen and case-control association analyses in humans with these disorders and examined the expression of human NR2E1 in adult brain regions not previously studied (Chapter Four).  48  Chapter 2: Unexpected Embryonic Stem (ES) Cell Mutations Represent a Concern in Gene Targeting: Lessons from `Fierce' Mice  2.1 Publication Status and Contribution of Individual Authors This chapter has been published:  Ravinesh A. Kumar, Ka Ling Chan, Ambrose H.W. Wong, Ken Q. Little, Evica RajcanSeparovic, Brett S. Abrahams, and Elizabeth M. Simpson. (2004). Unexpected Embryonic  Stem (ES) Cell Mutations Represent a Concern in Gene Targeting: Lessons from 'Fierce' Mice. Genesis 38:51-7. [PMID 14994267] The project described in this chapter was conceived and initiated by Dr. E.M. Simpson. The project became focused under my direction. Mr. B.S. Abrahams was in charge of the collaboration that developed with the Dr. Rajcan-Separovic. I generated the majority of the sequence data described in this chapter. Students whom I trained myself also generated some of the data (KLC, AHWW, KQL). I also wrote the paper, created all tables and figures, and saw the manuscript through to publication.  Figure 2.1: Data from the Simpson Lab (myself) and BIO S&T (Montreal, Quebec). Data analyses by me.  Figure 2.2: Data from the Rajcan-Separovic Lab. Analyses by Dr. Rajcan-Separovic. Figure 2.3: Data from the Simpson Lab (myself, KLC, AHWW, and KQL). Data analyses by me.  Figure 2.4: Data from the Simpson Lab (myself). Data analyses by me. Figure 2.5 Data from the Simpson Lab (myself). Data analyses by me.  49  2.2 Introduction The need for caution when interpreting the results of gene targeting experiments was underscored nearly a decade ago by one of the leading toolmakers (Smithies 2001) of homologous recombinant technology (Shehee et al. 1993). Indeed, the occurrence of errors near sites of homologous recombination has been well documented (Doetschman et al. 1988; Hasty et al. 1991; Schwartzberg et al. 1990; Shehee et al. 1993; Thomas and Capecchi 1990; Zheng et al. 1991). This is because standard molecular biology screening protocols (i.e., polymerase chain reaction (PCR) and Southern analysis) can typically detect anomalous homologous or illegitimate recombination events near the intended target site (Matise et al. 2000). More elusive are linked 'distant' mutations in embryonic stem (ES) cells that may interfere with genotypephenotype interpretation, and for which no means of standard molecular detection is available. Evidence for these mutations is indirect and anecdotal: for example, the presence of unexpected ES cell mutations has been used to explain the occurrence of early generation phenotypes in knockout mice that disappear after backcrossing (Moulson et al. 2003) (Leslie P. Kozak and Beverly H. Koller, pers. Comm.). These events are too rapid to attribute to strain-specific modifier loci, but are attributed to unlinked or distant ES cell mutations. Here we demonstrate for the first time the validity of such speculations, and make recommendations to avoid this serious problem. The initial characterization of the Zfa knockout mice revealed an unexpected brainbehavior phenotype. Given that the transcription of Zfa is restricted to the germ cell lineage of adult testis (Ashworth et al. 1990), its targeted mutagenesis was hypothesized to result in failure of spermatogenesis. Thus, it was both a surprise and a concern when the resulting mice had a  50  phenotype present in both sexes that included abnormal brains and violent behavior. The relatively low frequency of correct targeting at the Zfa locus raised the possibility that a repeat within the vector may have produced an anomalous integration event near Zfa (Banks et al. 2003). However, we had confirmed correct 5' and 3' targeting by Southern analyses in the ES cell clone that gave rise to the Zfa colony (Banks et al. 2003). Further Southern analyses using neomycin and thymidine kinase vector-specific probes did not identify unexpected bands in this clone. Taken together, there was no evidence to support our initial hypothesis that misincorporation of the targeting vector into a locus 'near' the Zfa gene was responsible for the phenotype observed in affected mice. We then hypothesized that an unrelated 'distant' mutation may have been responsible for the abnormal brain and violent behavior observed in these 'fierce' mice, which we later demonstrated are deleted for, and fail to transcribe, the nuclear hormone receptor Nr2e1 (Young et al. 2002). Evidence that lead us to suspect two segregating loci included a single mouse that was wild-type for Zfa but clearly displayed 'hard-to-handle' and violent behaviors. However, the precise molecular nature of the spontaneous mutation remained unresolved. Specifically, the size, complexity, and location of breakpoints were unknown. Further, it was unclear whether more than one locus contributed to the phenotype. Importantly, its spontaneous occurrence during the gene targeting of the unrelated Zfa gene (Banks et al. 2003), left its origin uncertain. In particular, it was unclear whether the unexpected mutation occurred in an ES cell, or later in a mouse during the derivation of the Zfa colony. Indeed, the utility and reliability of fierce mice as a model for investigating the genetic basis of abnormal brain development and pathological violence was contingent on a thorough investigation of these questions.  51  2.3 Materials and Methods  2.3.1 Mice, ES Cells, and Genomic DNA The derivation of the Zfalc()/K° strain has been described previously (Banks et al. 2003). Approval for the use of all mice was obtained through the Office of Research Services and Administration, The University of British Columbia, and the Department of Medical Genetics (protocol numbers A99-0217 and A99-0275). DNA from 129 E14TG2a ES cells (Hooper et al. 1987) and targeted clones mEMS2, mEMS3, and mEMS4 was harvested as previously described (Laird et al. 1991).  2.3.2 Characterization, Sequencing, and Analyses of Nr2elfrc We sequenced directly from genomic Nr2e1-fr c/frc DNA using APATM technology provided by BIO S&T (Montreal, PQ). The following primers were employed: oEMS2048 ( 5'-AAGACTGGAAGTGAGGAAGCTGTG-3'), oEMS2049 (5'-GAAGCTGTGGGAAGGGAAAGGAAC-3'), oEMS2050 (5'-CCTCTGAGATAGCCTGTCCTGAAC-3'), oEMS2051 (5'-ACACCTCGGTGTTCCTCTGAATAC-3'), oEMS2052 (5'-AGAGTATTCAGAGGAACACCGAGG-3'), oEMS2053 (5'-CCGAGGTGTTCAGGACAGGCTATC-3'), oEMS2054 (5'-GGTTCCTTTCCCTTCCCACAGCTT-3'), oEMS2055 (5'-CACAGCTTCCTCACTTCCAGTCTT-3'), oEMS2056 (5'-GAACCCTCTGAGATAGCCTGTCCT -3'), and oEMS2057 (5'-AGGACAGGCTATCTCAGAGGGTTC-3'). The 188-bp Lacel sequence was localized using a masked (http://repeatmasker.genome.washington.edu/) query against the  52  Mouse Ensemble database (http://www.ensembl.org , build 23). bEMS4 (GenBank AF52042). bEMS40 (mouse CITB BAC Clone; address 26C4) was recovered by screening Research Genetics Mouse BAC DNA Pools Release II under the following conditions: 30 cycles, 94°C for 30 sec., 58°C for 30 sec., and 72°C for 55 sec. using oEMS1651 (5'TCCACTTGCTGTCTTTCCTG-3') and oEMS 1652 (5'-CAGAGGGTTCCTTTCCCTTC-3'). Sequence alignment and comparisons were performed using Sequencher software (Gene Codes Corporation, Ann Arbour, MI). Physical map distances between Zfa, Nr2e1, Snx3, and Lacel on Chromosome 10 were obtained using the UCSC Genome Browser (http://genome.ucsc.edu/; mouse assembly Feb. 2003).  2.3.3 Fluorescent in situ hybridization (FISH) Metaphase chromosome preparation, probe development, and FISH analyses were performed as previously described (Abrahams et al. 2003).  2.3.4 Expression Analyses Total wild-type (WT) and Nr2e/frc/frc mouse RNA were prepared from brain, spleen, liver, and kidney using TRIsol Reagent (InvitrogenTM, Burlington, Ontario). Gel preparation, electrophoresis, and RNA transfer were performed using NorthernMax-Gly protocol according to manufacturer's instructions (Ambion, Austin, TX). We generated  32 P-radiolabeled  probes by  random labeling using Ready-To-Gon" DNA Labeling Beads (Amersham, Piscataway, NJ) on the following templates: Lacel (1030-bp insert from pEMS914-1, Mus musculus cDNA); Snx3 (RT-PCR amplification of total RNA from C57BL/6J brain, 403 bp, using oEMS 1226 (5'TCCTATCTTCAAGCTGAAGGAATC-3') and oEMS1228 (5'-  53  TGCGCAGCATGCTAGTTAGT-3'); Nr2e1 and GAPDH as previously described (Young et al. 2002). Hybridization using ULTRAHyb, and washes using Low and High Stringency Wash Buffer were performed as per manufacturer's instructions (Ambion, Austin, TX). Signals were detected using storage phosphor imaging screens (BIO-RAD, Hercules, CA).  2.3.5 Genotyping, Southern Analyses, and Sensitivity Assays PCR products were generated from each of WT mice, Nr2e1"' mice, and ES cell clones E14TG2a, mEMS2, mEMS3, and mEMS4 under the following conditions: 1) Nr2e1 assay (30 cycles): 94° for 30 sec., 58° for 30 sec., and 72° for 55 sec. using oEMS296 (5'CTCCCAGCAATCTAGTTTCCC-3') and oEMS298 (5'-CTCTAGCAAAACTGCAGCTGC-3'); and 2) Nr2e1frc assay: (35 cycles); 94° for 30 sec., 60° for 30 sec., and 72° for 55 sec. using oEMS650 (5'-GGCGGAGGGAGCTTAAATAG-3') and oEMS 1957 (5'GGGATTCATCCTATTCCACAAA-3'). PCR products were electrophoresed in 2% agarose gel, transferred to a positively charged nylon membrane (Ambion, Austin, TX), and hybridized with labeled PCR products from the Nr2e1 and Nr2elfrc assays. Probes were 32 P-labeled by random labeling using Ready-To-GoTM DNA Labeling Beads (Amersham, Piscataway, NJ). Hybridization, washes, and detection were performed as described above. The sensitivity assay was developed by serially diluting Nr2e1"' DNA into WT DNA, followed by PCR, Southern analyses, and detection as described above.  54  2.4 Results  2.4.1 The fierce (Nr2elfre) Deletion Results in the Loss of All Nr2e1 Exons We characterized the molecular nature of the Nr2e1frc allele using a BAC, bEMS4, which spans the wild-type Nr2e1 locus (Abrahams et al. 2002). We demonstrated that the Nr2e1frc deletion was contained within the region defined by bEMS4 using PCR assays specific to the BAC ends. To further define the deletion, we designed a series of PCR assays from bEMS4 sequence and amplified each on wild-type and 'fierce' (Nr2elfrc/frc) genomic DNA, which identified an approximately 40-kb deletion and the approximate breakpoints. Comparison of wild-type sequence with genomic DNA sequence from Nr2e1 '°/f"` mice further defined the deletion as 44.4-kb, which included all Nr2e1 coding and untranslated regions but not exons of adjacent genes (Figure 2.1 a). Specifically, the 5' breakpoint resided 1.6 kb upstream of exon 1 and the 3' breakpoint 23.5 kb downstream of the terminal exon. Interestingly, an unknown 188by insert interrupted the deletion breakpoints. To determine the identity of the 188-bp sequence, we first performed a masked query against the NCBI non-redundant (nr) database (BLASTN 2.2.6; April-09-2003), which did not recover any significant hits. Importantly, this demonstrated that the 188-bp insert does not represent vector material. We next searched the C57BL/6J Mouse Ensembl database (build 23), which localized the 188-bp sequence to intron 2 of Lacel (ENSMUSG00000038302; E-value 10 12). The distance separating the 188-bp insert at Nr2elfr c from its cognate (i.e. endogenous) site in Lacel was calculated as 139 kb using UCSC Genome Browser (http://genome.ucsc.edu/;  55  -  a  52.5 Mb^42.4 Mb fa^ Nr2e1  42.3 Mb^ 42.2 Mb Snx^ 3 Lacel 4 ^ O. 4 3 2 1^1 2^3 4 5 6^7 8 9 10 11 12  U  —  Nr2e1^1^1 2 3 4 5 6 7 8 9  477  tel-4  IIIIIIIIIY 44.4 kb deletion  Nr2elfrc tel  —/#77  '  V  188 by insertion  —  fre  if-1+11-4 ^ 188 by  //-1-H-1-77  b  I I I I I I I I I I I I I/-•  V  Nr2e1 TAGAGATCGGAGATCAAGGCTCCCTCGGCG-------------44.4 ^Nr2e1frc  TAGAGATCGGAGATCAAGGCTCCCTCGGC^GTATGTATATGTGTATGTGGGTATATGTATGTACATATAT  ^Nr2e1 frc Lacel AAGACACATATTAATGTAATGTAATATAT ^GTATGTATATGTGTATGTGGGTATATGTATGTACATATAT Lace/ AAGACACATATTAATGTAATGTAATATAT •  GTATGTATATGTGTATGTGGGTATATGTATGTACATATAT  Nr2e1 ^ Nr2e1frc GTATATATTAATGTTTTCAGTGATTTAGTTTCTGGTTTATTAATTTCTTAATTTTTATTTATTTTATTACATTTC Nr2e1 frc Lacel GTATATATTAATGTTTTCAGTGATTTAGTTTCTGGTTTATTAATTTCTTAATTTTTATTTATTTTATTACATTTC Lace/ GTATATATTAATGTTTTCAGTGATTTAGTTTCTGGTTTATTAATTTCTTAATTTTTATTTATTTTATTACATTTC  V  Nr2e1  ^TTCAGAC  Nr2e1frc CTTTCCACTTGCTGTCTTTCCTGACTTTGTGGAATAGGATGAATCCCTGTTGATTTTAAAGTGTTACATTCAGAC Nr2elfrc Lacel CTTTCCACTTGCTGTCTTTCCTGACTTTGTGGAATAGGATGAATCCCTGTTGATTTTAAAGTGTTACATTCTAAT Lacel CTITCCACTTGCTGICTTTCCTGACTTTGIGGAATAGGATGAATCCCTGTTGATTTTAAAGTGTTACATTCTAAT  Nr2e1 TTTTTCTTCTGCTCTGCCATGAC Nr2e1frc TTTTTCTTCTGCTCTGCCATGAC Nr2e1 ft Lacel AGAAGCATTTCATGAAATTACCT Lacel AGAAGCATTTCATGAAATTACCT  Figure 2.1 The fierce (Nr2elfrc) deletion results in the loss of all Nr2e1 exons.  (a) Schematic of WT Nr2e1 and Nr2elfrc loci illustrates the 44.4-kb deletion and transposition of 188-bp sequence (red box) from Lacel . Grey arrowheads indicate deletion boundaries. Diagonal hatched lines represent discontinuous DNA sequence. Distance from the centromere is indicated above each gene. Horizontal arrows below each gene indicate direction of transcription. (b) DNA sequence at breakpoints of Nr2e/frc. The 188-bp insertion at Nr2elfrc differs by 3 bases (boxed) from its cognate (Lacel) sequence. Color scheme reflects gene color-coding in (a).  56  mouse assembly Feb. 2003). These results supported our earlier radiation hybrid mapping data that placed the cognate 188 by on Chromosome 10, proximal to Nr2el. To test the hypothesis that Lacel may have also been mutated by the event that created the Nr2elfrc deletion-insertion, we performed direct genomic DNA sequencing across the 188-bp region of Lacel in Nr2elfrc/-15' mice. Note that selection during backcrossing for ES cell-derived Nr2eF would have maintained the tightly linked original Lacel (Fig. 2.1b). We established that  the 188 by is intact at its cognate site, which indicates that a transposition event (duplicationinsertion) was involved in the insertion of the 188 by in the Nr2el* allele. However, the new copy is not exact: we detected a 3-bp mismatch between the 188 by at Nr2elfr c and the wild-type sequence (Figure 2.1 b). We initially suspected that the 3-bp difference might reflect inter-strain polymorphisms between the C57BL/6J and 129 strains, which were the two strains involved in the derivation of the Nr2elfrc/frc mice. However, we recovered and sequenced a portion of a BAC, bEMS40, containing wild-type 129 Lacel, and did not detect any differences between the C57BL/6J, 129, and  Nr2e/frc/-frc cognate  188-bp sequences. Thus, we conclude that the 3-bp  difference in the Nr2elfrc mutation arose due to errors during the transposition event. We also aligned and examined all breakpoint junctions for evidence of repetitive elements, microdomains, or homology tracts that may suggest recombinatorial processes leading to the deletion-insertion (Roth and Wilson 1986; Zhu et al. 2002); however, we detected none.  2.4.2 Fluorescent In Situ Hybridization Demonstrates the Absence of the Nr2e1 Locus in Nr2e/fre/fre Mice We also demonstrated the absence of the 44.4-kb material in  Nr2e/frdfrc mice  by  performing FISH using probes from within and throughout the deletion (Figure 2.2). We  57  conclude that the 44.4-kb sequence is absent in Nr2e1"' mice and find no evidence that this material is present elsewhere in the genome (Figure 2.2).  2.4.3 Northern Analyses Demonstrate that Transcription of Nr2e1 Neighbouring Genes is Not Altered Finally, to further support the conclusion that the abnormal brain development and violent behavior observed in Nr2e lfrc/frc mice is attributable solely to the loss of Nr2e1, we demonstrated the integrity of the neighboring genes. This is particularly important given that 1) Lacel sequence participated in the event that created the Nr2e1 fre deletion-insertion and 2) a position effect caused by the 44.4-kb deletion at Nr2e1 frc may affect the expression of nearby genes. We therefore performed northern analyses and demonstrated that the neighboring genes, Lacel and Snx3, are transcribed normally in Nr2e/frcifrc mice (Figure 2.3). Thus, we conclude that the brain and behavior phenotype seen in the Nr2e/frc/frc mice results only from the single-gene disruption of Nr2e 1 .  2.4.4 The Unexpected Nr2elik Mutation was Present in the Targeted ES Cell Clone (mEMS4) We next sought to determine when the Nr2elfrc mutation arose, namely, whether the mutation was present at the ES cell stage or if it arose during the derivation of the knockout colony. We therefore genotyped the parental E14TG2a ES cell line and three targeted clones using Nr2e1 `-specific PCR and Southern assays (Fig. 2.4 a-d). We did not detect the Nr2elfrc mutation in the parental ES cells. Importantly, however, we did demonstrate that the mutation existed in the one targeted clone (mEMS4) that gave rise to the mutant mice. We considered the  58  Figure 2.2 Fluorescent in situ hybridization demonstrates the absence of the Nr2e1 locus in Nr2e1frcv-frc mice Hybridization with probes spanning the 44.4-kb region detects (a) both copies of Nr2e1 (arrows) on metaphase chromosomes from WT mice, (b) one copy (arrow) on Nr2e1frd+ mice, and (c) no signal from Nr2e1frdfrc mice. Importantly, these data also demonstrate that the 44.4-kb sequence is not elsewhere in the Nr2e/frc/frc genome. Brain^Heart^Kidney  Lace1  Snx3 Nr2e1 GAPDH  Figure 2.3 Northern analyses demonstrate that transcription of Nr2e1 neighboring genes is not altered in Nr2e lfrc/frc mice RNA prepared from WT and Nr2e1-fi'v-frc brain, heart, and kidney hybridized sequentially with Lacel and Snx3 probes were positive for both transcripts in Nr2e/-frc/frc mice. Probing with an Nr2e1-specific cDNA as a control demonstrated expected brain-specific Nr2e1 transcript only in WT mice. Probing with GAPDH demonstrates equal loading of RNA.  59  ^  possibility that our Nr2elfrc assays were not sensitive enough to detect the Nr2e1frc mutation if it was present in the E14TG2a ES cells at a low frequency. Thus, we repeated our assays on Nr2elfrc/frc DNA that was serially diluted with wild-type DNA to determine the sensitivity level for detecting Nr2elfrc in the E 1 4TG2a cells. We conclude that, if Nr2elfrc existed in E 1 4TG2a cells, it was present in less than 1/10 5 cells (Fig. 2.4 e-f). Thus, Nr2elf' likely arose during electroporation but could have been present at a low frequency in the parental ES cell strain.  Figure 2.4 The unexpected Nr2elfrc mutation was present in the targeted ES cell clone (mEMS4) (a) Nr2e1-specific PCR and (b) Southern analysis of the PCR products generated in a) co^ ca co (a) probed with its PCR product detects 2^ a N^ N^CO^•cl.^ ,..^ _^(/)^(/)^U)^0^1-^E .c)^ Nr2e1 in ES cell clones mEMS2, 3, 4, and 2^2^2^Ha) 8t w w w parental cell line E14TG2a, but not in H 5 E E E I Z z Nr2e1 frarc mice. (c) Nr2el frc -specific PCR^a and (d) Southern analysis of the PCR products generated in (c) probed with its PCR product demonstrates that Nr2el fre existed in mEMS4. (e) PCR results show that the Nr2el f' is present in the original ES cell population at less than 1/10 3 cells. (f) Southern analysis of the PCR products generated in (e) probed with its PCR product enhances the sensitivity level of detection to less than 1/10 5 cells.  MEE  Nr2e1  Nr2e1  Nr2elfrc  Nr2e1 frc  45  _e^ I-^ (0^  e  0 0 (.) 0 0 0 0 o o — t  o 2^ L., oc) 0o o.^o o o —: 0 0 .1._a^ o^...., o^CD CD °.. 0 CD 0. 0 ^..L.: ^ <  a) fC  o. E  a) 0  z  Nr2el frc  f Nr2e iffy  60  2.5 Discussion  The delineation of the origin of the Nr2elfrc allele in ES cells highlights an important concern in gene targeting, namely, that ES cells harbor distant and unexpected mutations. Such distant mutations can result in the misattribution of genotype to phenotype, such as in our case, where we initially attributed the 'fierce' phenotype to the targeted Zfa allele. Remarkably, had it not been for discrepancy between our expected phenotype and genotype, and the large numbers of mice generated and examined at each generation, we might have lost the Nr2elfrc allele and the 'fierce' mice. Our present understanding of the origin and history of Nr2elfrc (Fig. 5) begets three recommendations to circumvent this potential concern. Although our data do not prove that Nr2e1 pre-existed in the E14TG2a cells, our work raises awareness of this possibility (Figure 5 a). Given that chromosomal abnormalities occur frequently in ES cells (Liu et al. 1997; Longo et al. 1997) and that these aberrations increase with extended culture (Cervantes et al. 2002; Nagy 2000), ES cells may harbor point mutations, microdeletions, and other subchromosomal mutations that increase at each passage. Indeed, our E14TG2a cells were first described in 1987 and now are a high passage ES cell stock (Hooper et al. 1987). Interestingly, the lethal mutation accompanying Ucpl targeting (Enerback et al. 1997) came from the same ES cell stock that gave rise to Nr2elfrc . Thus, at least two independent unexpected mutations have occurred with these ES cells. We therefore suggest there may be an  advantage to using fresh or low passage ES cells. We show that the correctly targeted ZfaK° allele and Nr2elfrc were both on Chromosome 10 in the mEMS4 ES cell clone (Figure 2.4). We deduce from the segregation data (see below)  61  Figure 2.5 The origin and history of fierce (Nr2e1frc/-frc) mice. (a) Of three clones targeted for Zfa through electroporation (mEMS2 and 3, correctly 3' only; mEMS4, correctly at both ends), only one (mEMS4) carried Nr2elf', which was injected into C57BL/6J blastocysts, giving rise to the chimera that produced subsequent generations. (Recommendation #1: use fresh ES cells; Recommendation #2: study mice from more than one clone). Distances not to scale (b) The correctly targeted ZfaK° and Nr2e1fre were together on Chromosome 10 in the ES cell and chimera, but segregated by at least generation six (N6) in C57BL/6J mice after backcrossing (BX). Values below the generation number (N) represent the theoretical percentage of the genome that will be C57BL/6J. (Recommendation #3: backcross to 'clean out' `distant' mutations) (c) Matings between siblings heterozygous for either Zfalw or Nr2e1frc were used to obtain Zfaw/K° and Nr2el^mice, frc/frc respectively. (Yellow and red chromosomes: ES cell 129 and C57BL/6J, respectively).  a^E14T2Ga ES cells Recommendation #1 Zfa^Nr2e1' ^ Zfa^Nr2e1 Electroporation  I^  ES mEMS2 1^  ^ Zfa^Nr2e1  • ^  Zfa^NrIel  b  Chimera^/^C57BL/6J Zfa KO  Nr2elirc ^  Zfa Nr2e1^_  ^•  • X f■mice Zfa^Nr2e1^Zfa Nr2e1 1(1st BX) Recommendation #3 N1 (50%)  N2 (75%)  ZfaK° Nr2elfi'  x x C57BL/6J Zfa Nr2e1  (2nd BX)  ZfaK° Nr2e1fir X C57BL/6J Zfa Nr2e1 ZfaK °  )(6th BX)  Nr2eIfr'  X C57BL/6J Zfa Nr2e1 \  Segregation zi,K 0 Nr2e1^Zfa Nr2elfi r ■=■1111 ■•■•■=■••• ■■••■■• Zfa^Nr2e1^Zfa^Nr2e1 Intercross  1  ,f) C0^Nr2e1 Zia Nr2e1fir Oimi■• •••=i==i4P ON=■10111•11011=0 ■••■•C=1110111111110 zfaKO^Nr2e1 Zfa Nr2e1" N6F1 ZfalWa°^N6F1 Nr2elfirifit  would have provided an early indication of a problem (Figure 2.4). Thus, we strongly recommend the phenotypic characterization of mice derived from more than one independent ES cell clone, especially if the phenotype is inconsistent with the expression pattern or otherwise unanticipated. Backcrossing, initially performed to establish a pure genetic background (Bucan and Abel 2002; Gerlai 1996; Simpson et al. 1997), ultimately led to the derivation of two distinct mutant mouse strains, Nr2e1frc/frc and ZfaK0/K0 (Figure 5 c). However, the generation (N) at  62  ^••  ZAK° N,26fir  C  ES cell clones they would not all have carried Nr2e1frc and  1 ES mEMS3  ^• Zfa^Nr2e1  that they were in cis on this chromosome (Figure 2.5 a) and  that had we generated mice from multiple correctly targeted  4  Recommendation #2 ES mEMS4  N6 (96.9%)  subsequent generations (Figure 2.5 b). We further deduce  •  ^  ZfaK° Nr2e1• ^Zfak° Nr2e1  •  were similarly positioned in the chimera and initial  ^•  which the Nr2e1frc mutation segregated from the Zfa knockout allele remained unknown. An extensive retrospective analysis of mouse breeding data including, where available, genotype and phenotype for all mice used, beginning with the initial chimera crosses, established that the two loci (10.1 Mb apart) segregated by at least N6 (C57BL/6J) and N5 (129) (Figure 5 b). We therefore recommend the use of backcrossing to 'clean out' unexpected 'distant' ES cell mutations. Inbreeding early, regardless of genetic background, will increase the probability of maintaining an unwanted mutation.  2.6 Conclusion The molecular genetic characterization reported here demonstrates that Nr2e1frc is a deletion-insertion that only affects a single gene. Further, our work establishes that the 'fierce' phenotype can be attributable entirely to this unexpected mutation. Critically, we report that the deletion of an entirely unrelated gene in an ES cell may go undetected during gene targeting despite the use of rigorous molecular screening protocols. The serendipitous discovery of the `fierce' mice emphasizes that the integrity of ES cells cannot be taken for granted. In light of the recent first draft publication of the mouse genome and subsequent identification of over 5,600 new predicted transcripts (Waterston et al. 2002), the genetics community can reasonably anticipate a systematic and global increase in the generation of knockout mouse models of human health and disease. Consequently, the need for caution in gene targeting has never been greater.  63  Chapter 3: Mutation and Evolutionary Analyses of NR2E1 in Human Brain Development Identify Candidate Regulatory Mutations and Strong Purifying Selection 3.1 Publication Status and Contribution of Individual Authors  This chapter has been submitted for publication: Ravinesh A. Kumar, Stephen Leach, Russell Bonaguro, John Chen, Daniel W. Yokom, Brett S. Abrahams, Laurie Seaver, Charles Schwartz, William Dobyns, Angela R. BrooksWilson, and Elizabeth M. Simpson. (200J. Mutation and Evolutionary Analyses of NR2E1 in  Human Brain Development Identify Candidate Regulatory Mutations and Strong Purifying Selection  The project described in this chapter was conceived and initiated by Dr. E.M. Simpson. Ethical approval for this study was initiated by Brett Abrahams, Dr. E.M. Simpson, and myself The project became focused under my direction and I was in charge of the collaborations that developed with the Schwartz, Dobyns, and Brooks-Wilson Laboratories. I generated the majority of the sequence data (under the supervision of SL and ARB-W) described in this chapter, which included 1,010 kb of human and 87 kb of non-human primate sequences. Students, whom I trained myself, also generated some of the data (RB, JC, DWY). Patients and control subjects were recruited by our collaborators (LS, CS, and WB). DNA from healthy and ethnically-diverse humans was obtained from the Coriell Cell Repositories (http://coriell.umdnj.edu/) . All statistical, evolutionary, and bioinformatic analyses were carried out by myself. I also wrote the paper, created all tables and figures, and will see this manuscript through to publication.  Table 3.1: Data from the Seaver, Schwartz, and Dobyns Lab. Data analyses by me. Table 3.2: Data from the Simpson Lab (myself and DWY).  64  Table 3.3: Data from the Brooks-Wilson and Simpson Labs (myself, SL, and RB): Data analysis by me  Table 3.4: Data from the Simpson Lab (myself). Data analyses by me. Table 3.5: Data from the Simpson Lab (myself). Data analyses by me. Table 3.7: Data from the Simpson Lab (myself). Data analyses by me. Figure 3.1: Data from the Brooks-Wilson and Simpson Labs (myself, SL, RB, JC, and DWY): Data analysis by me.  Figure 3.2: Data from the Simpson Lab (myself). Data analyses by me. Figure 3.3: Data from the Simpson Lab (myself). Data analyses by me.  65  3.2 Introduction Genes with expression patterns and developmental functions consistent with a role in regulating neurogenesis and cortical size are key candidates for studying the genetic basis of human brain development and evolution (Gilbert et al. 2005; Kornack and Rakic 1998; Rakic 1995). To date, however, only a limited number of genes has been identified that is expressed at sites of cortical neurogenesis that regulate neural stem cells and forebrain size. One such gene is the nuclear receptor 2E1 (NR2E1; also known as TLX), for which a clear role in mouse brain development makes it an excellent candidate for genetic studies of human abnormal brain development and evolution. NR2E1 is expressed in human fetal brain (Strausberg et al. 2002) and in embryonic mouse forebrain (Monaghan et al. 1995), and is also detected in the adult forebrain of human and mice (Jackson et al. 1998; Shi et al. 2004). Nr2e1 is required for normal temporal regulation of cortical neurogenesis during embryonic development and is required for proliferation and differentiation of neural progenitor cells in the embryonic and adult mouse cortex (Roy et al. 2004; Roy et al. 2002; Shi et al. 2004). Mice deleted for both copies of Nr2e1 (Nr2e1 / ) show cortical hypoplasia, reduced forebrain size, limbic system abnormalities, - -  cognitive impairment, short stature, vision problems, and abnormal social behaviours (Christie et al. 2006; Kumar et al. 2004; Land and Monaghan 2003; Miyawaki et al. 2004; Roy et al. 2002; Young et al. 2002). Mice deleted for a single copy of Nr2e1 (Nr2e1 +i) show premature neurogenesis during early corticogenesis that results in neuron numbers that are intermediate to that produced in Nr2e1 +i+ and Nr2e1 ' mice (Roy et al. 2004), which provides strong support for -  dosage sensitivity for Nr2e1 during cortical development.  66  Multiple additional lines of evidence support a role for NR2E1 in human brain development. First, we have recently corrected the cortical abnormalities of Nr2e1 "/ mice using a -  genomic clone spanning the human NR2E1 locus including its endogenous promoter (Abrahams et al. 2005), providing robust evidence that human and mouse NR2E1 are functionally equivalent in mice. Second, mutations in human and mouse NR2E3, the gene most closely related to NR2E1, produce similar eye developmental abnormalities (Akhmedov et al. 2000; Haider et al. 2000), suggesting that human and mouse NR2E1 mutations might also cause a similar phenotype. Third, some individuals with cortical abnormalities have de novo interstitial deletions encompassing the NR2E1 locus (Chery et al. 1989; Evers et al. 1996; Hopkin et al. 1997). Fourth, cortical malformations can result from Pax6 haploinsufficiency in humans and mice (Schmahl et al. 1993; Sisodiya et al. 2001). In mouse, double heterozygotes for Nr2e1 and Pax6 interact genetically to alter the normal development of the telencephalon (Stenman et al. 2003). Thus, we anticipate that NR2E1 will interact genetically with PAX6 to regulate human brain development, which supports a multigenic mechanism involving NR2E1 in abnormal brain development. Finally, it has been proposed that cell cycle regulatory genes such as cyclin D1 are excellent candidates for human cortical malformations (Crino 2005; Ross and Walsh 2001). Notably, loss of Nr2e1 in the mouse retina results in a marked reduction in cyclin D1 that likely underlies the abnormal retinal laminar arrangements (Miyawaki et al. 2004), indicating that a similar mechanism may underlie the abnormal cortical laminar arrangements characteristic of Nr2e1"/ mice (Land and Monaghan 2003). Taken together, this evidence strongly supports the hypotheses that some human cortical disorders may be inherited in a single gene or multigene  67  fashion involving 1) NR2E1 null mutations (complete absence of NR2E1) and; 2) NR2E1 regulatory mutations (altered levels of NR2E1). In this study, we report the first genetic analyses of NR2E1 in clinically-defined patients. To test the hypothesis that humans with abnormal cortical development may have null or regulatory mutations in NR2E1, we sequenced the coding, 5' and 3' untranslated, splice-site, proximal promoter, and evolutionarily conserved non-coding regions in 60 unrelated patients with unexplained congenital microcephaly, a neurodevelopmental disorder characterized by marked reduction in cortical size that may result from failure of neurogenesis (Dobyns 2002; Mochida and Walsh 2001). To guide the present and future studies of NR2E1, we also elucidated its molecular evolution, genetic diversity, haplotype structure, and linkage disequilibrium (LD) by sequencing an additional 94 unaffected humans representing Africa, the Americas, Asia, Europe, the Middle East, and Oceania, as well as four representatives of the non-human primate species.  68  3.3 Materials and Methods  3.3.1 Human and non-human primate samples Approval for this study was obtained from The University of British Columbia (Certificate of Approval # C99-0524), Child and Family Research Institute of British Columbia (Certificate of Approval # W00-0005), and the Department of Medical Genetics (Certificate of Approval #6-320). The research followed the Canada's Tri-Council Statement on "Ethical Conduct for Research Involving Humans" (section 2.5-2.7). We studied 60 unrelated patients with congenital microcephaly (with or without simplified gyral patterns) and additional features present in  Nr2e1 / mice, including short stature, vision problems, and abnormal social behaviours. Patient - -  demographic and clinical data are reported in Table 3.1. For a subset of patients, additional unaffected and affected family members, including parents and siblings, were also studied. For the majority of the patients, ethnically-matched control subjects were studied. For genetic diversity and molecular evolutionary studies, we examined 18 human populations unselected for disease status, which included African (African-American, Mbuti, Biaka), the Americas (Cheyenne, Mayan, Quechua, Karitiana), Asian (Indo-Pakistani, Chinese, Japanese), European (Russian, Italian, Northern European, Icelandic), Middle Eastern (Ashkenazi Jewish, Druze Arab), and Oceanic people (Pacific and Melanesian). DNA samples were obtained from the Coriell Cell Repository (http://coriell.umdnj.edu/) . Great ape tissues were obtained from University of Washington (Eichler Lab). DNAs (3 chimpanzees, 3 gorillas, 3 orangutans) were isolated from either lymphoblast or fibroblast using the Gentra Puregene kit (Minneapolis, MN). Macaque DNAs (2 rhesus macaques, 2 Japanese macaques) were obtained from Oregon Regional Primate Research Center (Beaverton, OR).  69  Table 3.1 Demographic and Clinical Information on Patients with Cortical Malformations  Patient ID^Ethnicity°^Sex" Brain Abnormality°  MRd  Seizures°  Psychosis'  Statures  Vision Problems" Other'  CMS 3226^b^m^mic CMS 5041^b^m^mic CMS 5811^b^m^mic CMS 5162^w^m^mic CMS 4775^w^m^mic CMS 5207^b^m^mic CMS 5315^b^m^mic CMS 7456^u^m^mic CMS 5538^b^m^mic CMS 5838^b^m^mic CMS 5151^w^m^mic 12856^u^m^mic 17763^w^m^mic 8348^b^m^mic 11362^w^m^mic 29494^w^m^mic LP95-042a2^w^m^mic msg LP97-105^u^f^mic msg xax LP98-038a1^w^f^mic msg LP98-052^w^m^mic msg pmg LP98-095^w^f^mic msg LP99-035^w^m^mic msg LP99-100a1^w-me^f^mic msg LP99-156^w^m^mic msg bch LR00-025^u^m^mic msg LR00-144^w^m^mic msg LR00-182a1^w-ash j^f^mic msg LR00-188^w-me^m^mic msg LR00-196^u^m^mic msg acc LR00-204^u^f^mic msg LR01-068^w^f^mic msg LR01-099^u^f^mic msg bch xax acc LR01-148^u^f^mic msg bch xax LR01-171^w-me^m^mic msg LR01-194^w^m^mic msg bch acc LR01-224^w^m^mic msg xax LR01-265^w^f^mic msg LR01-271^w^f^mic msg acc LR01-314^u^m^mic msg LR01-338^w^f^mic msg LR01-356^w-me^m^mic msg bch LR02-005^w^f^mic msg xax LR02-016a3^w^u^mic msg bch LR02-046^w^f^mic msg acc LR02-080^u^m^mic msg LR02-085^w^f^mic msg LR02-112^u^f^mic msg xax LR02-153^w-me^f^mic msg bch LR02-154a1^w^f^mic msg xax LR02-171^u^m^mic msg acc LR02-304^u^m^mic msg LR02-421^w^m^mic msg LR03-059^u^f^mic msg xax LR03-184a1^u^m^mic msg bch LR03-277^u^m^mic msg xax  yes yes yes yes yes yes yes yes yes yes yes yes yes yes yes yes Severe u Moderate Severe Mild Severe Severe Severe u Severe Severe u Severe Severe re u Severe Severe Mild Severe Moderate Severe u u u u u u u u Mod-severe u u u u u dd dd u u  yes no yes yes yes yes yes no no no no no yes yes no yes yes u no yes no u yes u yes yes yes u  no yes yes yes no no no yes yes yes yes yes yes yes yes no u u no u no u u u u u u u  short normal short short short normal short u normal normal normal normal normal u normal short u u u u u u u u u u normal u  u u yes yes no yes no yes yes yes no u u u no u yes no u yes u no u yes yes u  u u u u no u no u u u u u u u u u u u u no u u u no no u  u u u u normal u normal u u normal u u u u u  u u u u u yes u u u u u u u u u u no^early death u no no^early death no u^jejuna! u early death u u early death u no u u jeluunaal n u u optic atrophy no no u yes no u no no u u u u u amblyopia u u sclerocomea micr scl u u u u u  U  u  u  II  u u u u u u u u u u  a b, black; w, white; w-me, white-Middle Eastern; w- ash j, white Ashkenazi Jewish; u, unknown pf,  female; m, male; u, unknown  ° am, agenesis of the corpus callosum; bch, brainstem-cerebellar hypoplasia; mic, microcephaly; msg, microcephaly with simplified gyral pattern;  pmg, polymIcrogyria; xax, enlarged extra-axial space mental retardation; u, unknown; note that for some patients, MR was scored as being present (i.e., 'yes') whereas for other patients the severity of MR was noted (i.e., mild, moderate, moderate-severe (Mod-severe), or severe); dd, developmental delay e-gu, data unavailable hmicr sd, micropthalmia and sclerocomea ljejunal, jejuna! atresia; -, no other phenotypes noted d MR,  70  3.3.2 DNA Amplification and Sequencing We sequenced NR2E1 using DNA amplicons generated from 20 PCR assays that covered the coding (1,146 bp), complete 5' and 3' untranslated regions (UTRs; 1,973 bp), exon-flanking regions including consensus splice-sites (1,719 bp), and evolutionarily conserved regions including proximal promoter (1,528 bp). Polymerase chain reactions (PCR) were performed in a 96-well microtitre plate thermal cycler. PCR reactions were prepared in a total volume of 20 Ill using 10 ng of genomic template, and the following reagents from Invitrogen (Burlington, Ontario): 1X buffer, 1 mM MgSO4, 0.2 mM dNTPs, 0.5 mM primer (each of forward and reverse (Table 3.2)), and 0.0125 units Pfx polymerase. Thermal cycling was performed as follows: 30 cycles, 94°C for 2 mins, annealing T (58-63°C) for 30 secs, 68°C for 1 min. PCR products were purified using magnetic beads from Agencourt Bioscience Corporation (Beverly, MA) as per manufacturer's instructions. Non-human primate sequencing reactions used 10-20 ng of DNA under similar conditions. Sequencing reactions performed in 384-well plates were as follows: BD Ready Rxn Mix V3 (0.54 IA), 5X Reaction Buffer (0.43 Ill), 5^Primer (0.26 W; Table 2)), 0.2 piM 18 MC2 ddH2O (0.77 41), and DNA (5-100 ng). Sequences were visually inspected and scored by at least two individuals using either Consed (Gordon et al. 1998) or Sequencher (Gene Codes, Ann Arbor, MI). Every human variant that was identified only once (i.e. singletons) was confirmed by repeating the PCR and sequencing process. The CA-repeat assay (D6S 1594; GenBank Accession Z52880) was prepared in a total volume of 15 ill using 10-50 ng of genomic template, and the following reagents from Invitrogen (Burlington, Ontario): 1X buffer, 2.5 mM MgSO4, 0.25 mM dNTPs, and 0.04 units Pfx polymerase. Primers (0.5mM) were fluorescently labeled with FAM  71  Table 3.2 PCR Primers used to Amplify NR2E1 Sequences Assay  Forwards Name^Sequence^  Name  Reverse!) ^ Sequence  oEMS1988 5'-TACGCCTTAAATCCGAGGTC-3' ^oEMS1989 5'-CGATCAAGCATGGTGTCAAG-3' oEMS1990 5'-TGACACCGAGTCTGGAGAAA-3' ^oEMS2031 5'-GTCGCCTCCATTATCTGCAC-3' oEMS1994 5'-CAGCTCTGCTTGGGGAAG-3' ^oEMS1995 5'-AAAACGCTTTTCCCCCTCT-3' ^ oEMS1998 5'-TCCTTCTTGCCGTGAAATATAC-3' oEMS2032 5'-GGAAAACTAGATTGCTGGGAAAT-3' ^ oEMS2033 5'-CCAGGGACGCCCTATTCC-3' oEMS2034 5'-GAGGAAGAAGGAAGAACAGCA-3' ^ oEMS2035 5'-CCCACACTCTGCATGCCTAT-3' oEMS2036 5'-GACAGGTGGGTGTCAGTCG-3' ^ Euml oEMS2037 5'-TGTGTCCATATCAAGCAGCA-3' oEMS2038 5'-CTCCACGAAATGCTCCAACT-3' ^ CE1713 oEMS2011 5'-GGAGAGCAGAGCGATGTCAC-3' oEMS2012 5'-TCACGAGACAAGCTGGTTGA-3' ^ CE193 oEMS2013 5'-CCTCCCACAGCACAATCTC-3' oEMS2016 5'-GTCCCAGACTCGTCTCAGGT-3' ^ Exon2 oEMS1966 5'-TTCGGTGCTAATCCCTTCAG-3' oEMS1967 5'-AGAGGAAGGGAGAGGTCAGG-3' Exon3 oEMS1968 5'-GGACTGGCCCTCTTGAAGTA-3' ^oEMS1969 5'-TCCCAGCATCTGGAAAGAAG-3' ^ Exon4 oEMS1970 5'-CTCCCTCAGATTCCCTCTCC-3' oEMS2039 5'-AACTGGGTGCGTCCCTCT-3' ^ Exon5 oEMS1972 5'-TACCCACCAATGTCAACTGC-3' oEMS1973 5'-AACCCACAGGAAGAAGCAAG-3' ^ Exon6 oEMS1974 5'-TGGGAAAATAAGGGAAAGCTAGA-3' oEMS1975 5'-ATTTAAATAACAATGCAAGCAGTCA-3' Exon7 oEMS1976 5'-CTTTCATACAATATAGCCGGTTTACA-3 'oEMS1977 5'-AACATGCAGGTTCCCATAGC-3' Exon8 oEMS1978 5'-GATTACAGACACATGCCACCAT-3' oEMS1979 5'-CACCCACCCTGAGAGATAGG-3' Exon9 oEMS2040 5'-TTCAAGTGTAAGACGTTAGTTTCCA-3' oEMS2041 5'-CTGTGGCAACCCCCAGTT-3' XUTRa oEMS2042 5'-AAAGCATTCCAGTAGCTATGACC-3' oEMS2043 5'-GTTGCCTGGCCTATGGTATT-3' YUTRO oEMS2044 5'-CATTATTAAGTGGCCTTCAGAACT-3' oEMS2045 5'-CAGTTTTCGGAAAGGCATTG-3' 3'UTRc oEMS2046 5'-CCAGACAGGAAACGAATATGG-3' oEMS2047 5'-CCTTGTTTCTGGTGGGTGAG-3' CEIIA CE12A CE13A CE14A 5'UTRa 5'UTRb  a5' TGTAAAACGACGGCCAGT 3' sequence (-21 M1 3F) was added to the 5' end of each forward primer to facilitate sequencing b5*-CAGGAAACAGCTATGAC-3' sequence (M13R) was added to the 5' end of each reverse primer to facilitate sequencing -  -  (ABI, Foster City, CA). Post-PCR products were diluted 1:30 with ddH2O and 1 gl was combined with a 9.5 121 mix of formamide and Gene Scan 400HD ROX as per manufacturer's instructions (ABI, Foster City, CA). Samples were denatured at 95°C for 5 mins and placed on ice until loaded on to the ABI 3100 Genetic Analyzer (ABI, Foster City, CA). PCR fragments were analyzed using Gene Mapper 3.0 (ABI, Foster City, CA). 3.3.3 Transcription Factor Binding Site Analyses  To determine whether genetic variants at NR2E1 (i.e. candidate mutations, polymorphisms, and human-specific nucleotides) have a predicted impact on putative binding sites for known neural transcription factors, we performed TFBS analyses using Matlnspector  72  (Quandt et al. 1995). We analyzed the minor and major alleles at each variant site together with 50 by of surrounding sequence using the Optimized Matrix Similarity thresholds. We focused specifically on transcription factors with brain-relevant roles that include cortical patterning, neural cell proliferation and differentiation, neuronal apoptosis, neuronal survival, and synaptic plasticity.  3.3.4 Evolutionary, Nucleotide Diversity, and Genetic Differentiation Analyses The following standard measures of genetic diversity were calculated using DnaSP Version 3.0 (Rozas and Rozas 1999): S (the number of segregating sites); and Ow and it (nucleotide diversity). The proportion of variation attributable to differences among the different human populations (i.e. a relative measure of population differentiation and subdivision) was estimated by the FsT statistic as previously described (Akey et al. 2002). The following statistical tests of selection were performed using DnaSP Version 3.0 (Rozas and Rozas 1999): Tajima's D-test; Fu and Li's D * and F* ; and Fay and Wu's H. Non-human primate outgroups were used to infer the ancestral and derived states of human variants. The p values for Tajima's D and Fay and Wu's H were estimated from 10,000 coalescent simulations of an infinite site locus that conditioned on the sample size. Human and non-human primate sequence data were aligned using MEGA version 3.0 (Kumar 2004), and human-specific variants were identified visually and confirmed by at least two individuals.  3.3.5 Haplotype and Linkage Disequilibrium Reconstruction We reconstructed haplotypes and estimated their frequencies by implementing PHASE (V. 2.0). We calculated haplotype diversity for each population as 2n(1-Exi 2 )/(2n-1), where xi is  73  the frequency of haplotype i and n is the sample number. Pairwise linkage disequilibrium (LD) between each common SNP was computed as ID'I and r2 using DnaSP Version 3.0 (Rozas and Rozas 1999). We did not analyze the indels because gaps are excluded from the LD analyses (Rozas and Rozas 1999). Significance of LD was tested using Fisher's exact test after Bonferroni adjustment for multiple tests.  3.4 Results  3.4.1 Candidate NR2E1 mutations identified in patients with cortical abnormalities To determine whether humans with abnormal cortical development have null or regulatory mutations in NR2E1, we sequenced the coding, complete 5' and 3' untranslated regions (UTR), exon-flanking regions including the consensus splice-sites, and evolutionarily conserved regions including the proximal promoter in 60 unrelated patients with unexplained congenital microcephaly. We did not detect any synonymous (silent) or nonsynonymous (amino acid altering) coding variants. However, we identified 12 patients harboring 15 novel non-coding variants (i.e. variants that have not been previously reported in the literature or described in public DNA repositories (http://www.ncbi.nlm.nih.gov/projects/SNP/; Build 124) (Table 3.3). Each of these variants was present in the heterozygote state. Thirty-three percent of these variants resided within the proximal promoter, 33% within an UTR, and 33% within intronic sequence. Transitions and transversions accounted for 47% and 53% of all variants, respectively. Reamplifying and resequencing both strands of DNA independently confirmed all variants. We amplified and sequenced the regions corresponding to the 15 novel variants in 94 control subjects without cortical malformations who were ethnically matched for the majority of patients. Of the 15 novel variants identified in the patients, 13 were not detected in the control  74  subjects (herein referred to as `patient-variants'). The 13 patient-variants were represented in a total of 11 patients (i.e., some patients harboured multiple variants) (Table 3.3). We sequenced 16 family members for seven of these patients. In all cases, at least one unaffected parent carried the same variant as the patients, indicating that these variants were inherited and therefore unlikely to cause disease, at least in a simple Mendelian fashion. Given that the parents of the remaining 4 patients were unavailable for typing, we cannot exclude the possibility that the remaining novel variants (g.-555C>T, g.8213T>C, g.14617A>C, and g.20765C>A) in these patients are de novo (i.e. candidate mutations).  Table 3.3 Characterization of NR2E1 Patient-Variants in Families and Control Subjects Sampleb  Locationb  Nucleotide Vedanta Patient  LR00-144 LR00-144 LR00-144 LR02-304 LP98-052 LR00-204 LR03-184a1 LR03-184a1 CMS 5151 CMS 8348 LR00-204 12856 XS LR01-194 LR01-148 LR03-277 LR03-277  PPR CE11A 3' UTR CE12A PPR PPR PPR Intron 1 5' UTR Intron 3 Intron 5 Intron 7 Intron 7 3UTR 3' UTR 3' UTR  g.-1767G>T g.-2945A>G g.21502T>C g.-1726C>A g.-1453C>G g.-1453C>G g.-1431C>A g.151T>A g.-555C>T g.8213T>C g.11559C>T g.14617A>C g.14718C>T g.20765C>A g.21762C>A g.21796G>A  Frequency of PatientVariant in Control Subjects ('  Genotyped  G/T A/G T/C C/A C/G GIG C/A T/A C/T T/C VT A/C C/T C/A C/A WA  Unaffected Unaffected Affected Father^Mother^Sibling G/G^T/T A/A^A/G T/C^T/T C/A^C/C C/G^C/C C/C^C/G C/C^C/A T/T^T/A n/a^n/a n/a^n/a C/T^C/C n/a^n/a C/C^C/T n/a^n/a C/A^C/C G/G^WA  G/G A/A T/C n/a n/a n/a C/C T/T n/a n/a n/a n/a n/a n/a n/a n/a  0/150 (0%) 0/130 (0%) 0/178 (0%) 0/150 (0%) 0/150 (0%) 0/150 (0%) 0/150 (0%) 0/150 (0%) 0/156 (0%) 0/146 (0%) 2/176 (1%) 0/178 (0%) 0/178 (0%) 0/168 (0%) 0/90 (0%) 1/90 (1%)  a nte that patients LP98-052 and LR00-204 both harboured identical variants (i.e., g.-1453C>G). Thus, a total of 15  novel variants were identified  b PPR, proximal promoter region (defined as a 2.0-kb region upstream of the initiator Met codon); CE, evolutionary conserved  element within PPR (as described in Abrahams et al. 2002); UTR, untranslated region cg genomic; numbering based on Antonarakis and the Nomendature Working Group [1998], where A of the initiator Met codon in exon 1 is denoted nucleotide +1. Human genomic NR2E1 sequence: NCB! AL078596 dn/a, parents unavailable for genotyping and/or patient does not have an affected sibling a numbers represent the total number of successfully sequenced chromosomes and not the total number of chromosomes screened  75  3.4.2 Alterations of putative transcription factor binding sites by NR2E1 patientvariants To determine the impact of the 13 patient-variants on transcription factor binding, we performed in silico transcription factor binding site (TFBS) analyses. We restricted our analyses to transcription factors expressed in the brain. Of the 13 patient-variants, eight were predicted to create or abolish binding of transcription factors known to have roles in neuronal proliferation and survival, cortical patterning, neuronal differentiation, and synaptic plasticity (Table 3.4). To determine whether functional constraint may exist at the sites corresponding to the 13 patient-variants, we determined the orthologous nucleotide at each of the sites for chimpanzee, gorilla, orangutan, macaque, mouse, and Fugu. In 8 instances, the major human nucleotide was conserved among all 4 primates examined. Notably, in four instances (g.-1726C>A, g.-555C>T, g.151T>A, g.8213T>C), the major human nucleotide was conserved to Fugu (Table 3.4); 2 of these include the candidate mutations described above (g.-555C>T and g.8213T>C). The absence of nucleotide variability at these non-coding sites between human and Fugu, which are separated by 900 million years (Kumar and Hedges 1998), suggests strong functional constraint. To determine whether the NR2E1 patient-variants may reside within cis-acting UTR motifs that are known to be critical for many aspects of gene expression and regulation (Mignone et al. 2002) , we searched for the presence of experimentally-validated functional motifs in the 5' and 3' UTR of NR2E1 using UTRscan (Mignone et al. 2005). We identified three motifs in the 5' UTR (15-LOX-DICE, IRES, Brd-Box) and two in the 3' UTR (IRES, Brd-Box); however, none of these motifs included a candidate mutation. To determine whether any of the patient-variants may alter 3' UTR binding for microRNAs (miRNA), which are known to regulate genes (Bartel  76  2004), we aligned the 3' UTR of NR2E1 against known miRNA motifs (Xie et al. 2005). We detected two motifs; however, neither included a candidate mutation.  Table 3.4 Characterization of NR2E1 Patient-Variants to Detect Alterations in Putative Transcription Factor Binding Sites Nucleotide^LocatIons Transcription factor Transcription factor(s) ^ Variant'^ binding site^  Role in brain^  Orthologous nucleotide in other species` Human Apex Managua Mnuna Fngn  g.-1767G>T PPR^Created^/A-/^ Regulator of neuronal development^G^G^G^Na^Na Created^Neural-restrictive-silencer-element ^Repressor of muftiple neuronal genes g.-1726C>A CE12A^Abolished^SP1^  Regulator of neuronal survival^C^C^C^C^C  g.-1453C>G PPR^Created^Early growth response gene 3 product Regulator of synaptic plasticity ^C^C^C^Na^Na Repressor of 5-HT1A receptor In neurons Created^NUDR^ g.-555C>T^5' UTR^Abolished^E2F^  Regulator of cortical patterning^C^C^C^C^C  Repressor of 5-HT1A receptor in neurons^T^T^T^T^T g.151T>A^Intron 1^Abolished^NUDR^ Abolished^Early growth response gene 3 product^Regulator of synaptic plasticity g.8213T>C^Intron 3^Abolished^OCT-1^ Created^BRN-5^ Created^PAX-6^  Regulator of neuronal differentiation ^T^T^T^T^T Regulator of neuronal differentiation Regulator of neuronal proliferation and fate  g.14617A)C Intron 7^Abolished^MEF2^ Abolished^BCL-6^  Regulator of neurogenesis^A^A^Na^Na^Na Regulator of neuronal differentiation  g.14718C>T Intron 7^Created^TBX5^  Regulator of eye morphogenesIs^C^N^Na^rife^Na  genomic; numbering based on Antonarakis and the Nomenclatu Nomenclature Working Group [19981, where A of the initiator Met codon In axon 1 is denoted nucleotide +1. ;:tuman genomic NR2E1 sequence: NCBI AL078596.  bPPR, proximal promoter region (defined as a 2.0-kb region upstream of the initiator Met codon); CE, evolutionary conserved element within PPR (as described in Abrahams at al. 2002); UTR, untranslated region `apes indude chimpanzee, gorilla, end orangutan. Na, ortholgous region does not align with human sequence (in the case of 'Macaque', this region was sequenced but does not align; N, refers to nucleotide variability among apes  3.4.3 Strong purifying selection and low nucleotide diversity at NR2E1 To gain further insight into the extent and pattern of genetic variation at NR2E1, we sequenced the same coding and non-coding regions as in the patients in 94 unaffected, ethnically-diverse humans representing Africa, the Americas, Asia, Europe, the Middle East, and Oceania, as well as in representative individuals of four non-human primate species. The sample size chosen was sufficient to detect alleles with minor allele frequencies of 10% or greater with 90% power. We did not detect a single non-synonymous or synonymous change in the coding region of any human sample. In addition, we did not detect a single non-synonymous change in  77  any non-human primate sample. The complete lack of synonymous variation among humans, and the complete absence of non-synonymous variation between humans and non-human primates, suggests that NR2E1 has undergone strong purifying selection. In this ethnically-diverse sample, we observed a total of 25 non-coding variants, of which 7 reside in UTRs, 13 in intronic sequence, and 5 within putative regulatory elements (Figure 3.1 a; Variants #1-25). Transitions and transversions accounted for 64% and 36%, respectively, of variants. Insertions and deletions (i.e. indels) accounted for 12% of the variability identified at NR2E1. Of the 25 variants, 20 were novel (http://www.ncbi.nlm.nih.gov/projects/SNP/; dbSNP Build 124) (Figure 3.1 b). Thirteen of the variants were observed only once (i.e. singletons), which we independently confirmed by reamplification and resequencing. Importantly, none of the 13 patient-variants was present in the ethnically-diverse normal samples. We determined the frequencies of all 25 variants in each ethnic group. Only 6 of the 25 variants (#s 2, 7, 8, 14, 17, and 21) were common (i.e. minor allele frequency (MAF) 5%) (Figure 3.1 c). For each human variant, we also inferred the ancestral and derived states by comparing it to the orthologous nonhuman primate sequence (Figure 3.1 d). Interestingly, chimpanzee, gorilla, and orangutan were all polymorphic for the same G/A transition (variant 8) seen in humans. The MAFs for variant 8 in chimpanzee, gorilla, and orangutan were 33%, 17%, and 33%, respectively. Given that we also sequenced two species of macaques, we were able to infer the most likely derived state (i.e. G; Figure 3.1 d). To our knowledge, this is the first report of a human polymorphic site that is also polymorphic for the same alleles across these 3 great apes species.  78  a  CE11A CE12A CE13A CE14A ^1^CE17B CE19B  ^  4 567  8  NR2E1 locus  b  Variant # 1^2 3^4^5^6^7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Variant T/C G/A G/- C/T T/C GTE G/C G/A G/A C/T G/A C/G A/G C/G C/T --/TC TC/- C/G C/T C/A G/A G/A T/C C/A GfT dbSNPNNNNNN Y Y N YNNN N N N N N N Y Y N N N N  ,§^ c^ (n) Africa^36 Mbuti^8 Biaka^8 African-American 20 Americas^28 Cheynne^4 Mayan^8 Quechua^8 Karltlana^8 Asia^18 lndo-Pakistani^4 Chinese^8 Japanese^6 Europe (C)^24 Russian^8 Italian^16 Europe (N)^34 Northern^18 Icelandic^16 Middle East^26 Ashkenazi Jewish 18 Druze Arab^8 Oceania^22 Pacific^14 Melanesia^8 Total^188  N^  y,^1:€^Vd,^ra  FINE^Ra^ij2^  wg- 6 `ia ,  arl° <0 6 A  e  n E`  Fl  1th  .00 .00  .00  .00  .03  .03  .00  .14  .06  .00  .03  .00  .00  .14  .00  .03  .00  .03  .03  .00  .53 .00  .00 .00 .00 .00 .00 .00  .00 .00 .00  .00 .00 .00  .00 .13 .00  .13 .00 .00  .00 .00 .00  .00 .13 .20  .00 .13 .05  .00 .00 .00  .13 .00 .00  .00 .00 .00  .00 .00 .00  .25 .13 .10  .00 .00 .00  .00 .13 .00  .00 .00 .00 .13 .00 .00  .00 .13 .00  .00 .00 .00  .38 .00 .50 .00 .60 .00  .00 .11  .00  .00  .00  .00  .11  .43  .00  .11  .00  .00  .00  .32  .00  .00  .00  .00  .00  .00  .14 .00  .00 .00 .00 .00  .25 .13 .00 .13  .00 .00 .00 .00  .00 .00 .00 .00  .00 .00 .00 .00  .00 .00 .00 .00  .25 .13 .00 .13  .00 .50 .75 .25  .00 .00 .00 .00  .25 .13 .00 .13  .00 .00 .00 .00  .00 .00 .00 .00  .00 .00 .00 .00  .25 .13 .25 .63  .00 .00 .00 .00  .00 .00 .00 .00  .00 .00 .00 .00  .00 .00 .00 .00  .00 .00 .00 .00  .00 .00 .00 .00  .50 .25 .00 .00  .00  .00  .00 .00 .00 .00  .00 .11  .00  .00  .00  .00  .11  .56  .00  .11  .00  .00  .00  .11  .00  .00  .00  .00  .22 .00  .00 .25 .00 .13 .00 .00  .00 .00 .00  .00 .00 .00  .00 .00 .00  .00 .00 .00  .25 .13 .00  .25 .50 .83  .00 .00 .00  .25 .13 .00  .00 .00 .00  .00 .00 .00  .00 .25 .00 .13 .00 .00  .00 .00 .00  .00 .00 .00  .00 .00 .00 .00 .00 .00  .00 .00 .00 .00 .00 .00  .25 .00 .25 .00 .17 .00  .00 .00  .00  .00  .00  .00  .00  .33  .00  .00  .00  .00  .00  .04  .04  .00  .13  .00  .50 .00  .00 .00 .00 .00  .00 .00  .00 .00  .00 .00  .00 .00  .00 .00  .50 .25  .00 .00  .00 .00  .00 .00  .00 .00  .00 .00  .00 .06  .00 .06  .00 .00  .00 .00 .19 .00  .00 .00 .00 .00  .38 .00 .56 .00  .00 .09  .03  .00  .00  .00  .09  .44  .00  .09  .00  .03  .00  .00  .06  .00  .09  .00  .00  .00  .44 .00  .00 .17 .00 .00  .06 .00  .00 .00  .00 .00  .00 .00  .17 .00  .33 .56  .00 .00  .17 .00  .00 .00  .00 .06  .00 .00  .00 .00  .11 .00  .00 .00  .17 .00 .06 .00  .00 .00  .00 .00  .50 .00 .38 .00  .00 .00  .00  .04  .00  .00  .00  .38 .00  .00 .00  .00 .13  .00 .00  .00 .00  .00 .00  .42 .44  .04  .00 .00 .00 .00 .09  .09  .00  .00  .00  .00  .07 .07 .13 .13  .00 .00  .00 .00  .00 .00  .00 .00  .01  .00  .00  .00  .00  .00  .00  .04  .00  .04  .00  .15 .00  .00  .38  .00 .00  .00 .00  .00 .00  .00 .00  .00 .13  .00 .00  .06 .00  .00 .00  .17 .13  .00 .00  .00 .00 .00 .13  .44 .00 .25 .00  .09  .68  .00  .00  .00  .00  .00  .00  .00  .00  .00  .00  .00  .18 .09  .07 .13  .71 .75  .00 .00  .00 .00  .00 .00  .00 .00  .00 .00  .00 .00  .00 .00  .05 .005 .005 .005 .005 .05 .41  .01  .00  .00 .00 .00 .00 .00 .21 .07 .00 .00 .00 .00 .00 .13 .13 .04 .005 .005 .005 .09 .02 .005 .05 .005 .005 .005 .35 .01  .03 .03 .00 .00 .00 .00 .05 .05 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .04 .00 .00 .06 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .00 .005 .01 .005 .03  .00 .00 .05  C G ^8 T b G C f 3 6 OA 6 C 3 x A C C - TC C C A1 x _T... d Chimpanzee Gorilla^6TGGCTGGG/AGCGXACC/T- TOCCCGx T C G C C^G x TC G Orangutan G x ACT - TC C 6 TG G C T G G G/A G C Ax A CC T TC C x x^C Rhesus Macaque T C CG G 4 TC G C G G G G C X x^ x C G Japanese Macaque 4 T^C A CC T TO C C C^G A G C T G G G G C  Figure 3.1 A few common and many rare NR2E1 variants detected in human populations representative for global diversity (a) Functional and putatively functional regions of NR2E1 were resequenced, including coding (dark purple boxes), 5' and 3' untranslated (light purple boxes), and human non-coding regions that are conserved (Abrahams et al. 2002) in mouse (CE-A; red boxes) and mouse and Fugu (CE-B; yellow boxes). (b) A total of 26 variants was identified (Variants # 1-25 and CA-repeat, see Figure 2). The nucleotide in the first position represents the human major (i.e., consensus) allele; the position is as per human NR2E1 accession number NT_025741 (http://www.ncbi.nlm.nih.gov/) . Variants catalogued in dbSNP ('Y') are distinguished from those that are newly discovered here (`N'). The DNA context of each variant is shown. (c) The number of chromosomes surveyed (n) and minor allele frequencies for each variable site are indicated for 18 world populations. (d) The corresponding chimpanzee, gorilla, orangutan, rhesus macaque, and Japanese macaque alleles are indicated. 'x' indicates that no sequence was obtained due to failed PCR or sequencing reaction. ^indicates that no corresponding nucleotide was present at that position in the non-human primate.  79  We estimated the levels of human nucleotide diversity by computing Ow, which is based on the proportion of segregating sites (S) in a population, and  TC, which  is based on the average  number of nucleotide differences per site between two sequences randomly drawn from the population (Hartl 1997) (Table 3.5). The total human estimates for O w (5.7 x 10 -4 ± 0.17 x 10 4) and it (2.6 x 10 4 ± 0.20 x 10 4) for NR2E1 fall at the lower 20% and 30% of previous studies, respectively (Przeworski et al. 2000).  Table 3.5 Human Nucleotide Diversity and Tajima's D at NR2E1 Population  n  S  Africa  36  12  Americas  28  6  Asia  18  6  Europe (C)  24  3  Europe (N)  34  7  Middle East  26  7  Oceania  22  5  188  21  Total Human  Ow  7t  (±SD)  (±SD)  0.00045 (0.00018) 0.00024 (0.00012) 0.00027 (0.00014) 0.00013 (0.00008) 0.00027 (0.00013) 0.00029 (0.00014) 0.00022 (0.00004) 0.00057 (0.00017)  0.00024 (0.00004) 0.00029 (0.00005) 0.00027 (0.00006) 0.00017 (0.00002) 0.00027 (0.00004) 0.00022 (0.00003) 0.00020 (0.00004) 0.00026 (0.00002)  rls  Tajima's  8  -1.45  0  0.61  0  -0.36  1  0.83  1  -0.04  5  -0.75  0  -0.18  11  -1.50  n, number of alleles; S, number of segregating sites; ri s , number of singleton mutations  80  3.4.4 Evidence of non-neutral evolution at NR2E1 To elucidate the human molecular evolution of NR2E1, we used the nucleotide diversity measures to calculate Tajima's D, which compares the number of nucleotide polymorphisms (Ow) with the mean pairwise difference between sequences (it) (Tajima 1989) (Table 3.5). Positive and negative values of this test correspond to departures from the neutral expectations of molecular evolution. We obtained a negative value for Tajima's D in the ethnically-diverse population, which is consistent with another report that obtained a negative Tajima's D at NR2E1 (Stephens et al. 2001). To further evaluate the role of natural selection at NR2E1, we used the ancestral and derived states of each variant from the ethnically-diverse population to perform three additional tests: Fu and Li's D* (which compares the number of derived nucleotide variants observed only once in a sample with the total number of nucleotide variants (Fu and Li 1993)), Fu and Li's F* (which compares the number of derived nucleotide variants observed only once in a sample with the mean pairwise differences between sequences (Fu and Li 1993)), and Fay and Wu's H (which compares the number of derived nucleotide variants at low and high frequencies with the number of variants at intermediate frequencies (Fay and Wu 2000)) (discussed further in Section 5.1.11). We obtained statistically significant negative values for Fu and Li's D* and F* (Table 3.6). Together, Tajima's D, Fu and Li's D*, and Fu and Li's F* results suggest that NR2E1 has undergone non-neutral evolution. However, based on these tests alone, we cannot exclude the possibility that demographic factors such as population expansions may also explain deviations from neutrality (Fu 1997; Kreitman 2000).  81  Table 3.6 Neutrality Tests using Chimpanzee at Outgroups  Population Africa Americas Asia Europe (C) Europe (N) Middle East Oceania Total Human  Fu and Li's  Fu and Li's  D*  F*  -2.77## 1.27 1.33 -0.24 1.24 -1.97 1.22 -3.08##  -2.79# 1.26 1.11 0.07 1.13 -1.81 0.96 -2.63#  Fay and Wu's  0.89 1.14 0.86 0.31 0.77 0.69 0.19 0.98  "p< 0.02 #p<0.05  We sought further evidence of non-neutral evolution by calculating the FsT statistic, a classical measure of genetic differentiation and local positive selection (Akey et al. 2002; Fullerton et al. 2002; Lewontin and Krakauer 1973). FST values range from 0 to 1 and increase as the difference in allele frequencies between populations become more pronounced. In our study, variants 8 and 21 demonstrated FST values of 0.43 and 0.35, respectively, which are higher than the average FST reported for non-coding regions in a similar set of human populations (Akey et al. 2002). To determine whether variants 8 and 21 may change TFBS, we performed in silico TFBS analyses (Quandt et al. 1995). For variant 8, the major allele G does not create nor abolish a TFBS, however, the presence of the minor allele A creates 3 TFBS, namely the heterodimers of the bHLH transcription factors HAND2 and E12, Activator protein 4, and Myf5 myogenic bHLH protein. For variant 21, only the major allele G creates a TFBS for the cell cycle regulator E2F.  82  3.4.5 Human-specific NR2E1 sites identified Insight into the evolution of human-specific traits, such as enlarged cerebral cortex, may be gained by the identification of human-specific sites (i.e., nucleotides that are fixed among all humans but absent from non-human species) (Enard and Paabo 2004). To identify such sites, we aligned 6,137 by of human and non-human coding and non-coding sequences. We identified 26 human-specific (divergent) sites. Of these 26, five resided within functional (i.e., exons) or putatively functional (i.e., evolutionarily conserved non-coding) regions of NR2E1: one synonymous coding variant and 4 putative regulatory variants (Table 3.7). We extended our analysis to mouse, and determined that 4 divergent sites still remained (the 3' UTRs between human and mouse NR2E1 could not be aligned) (Table 3.7). To determine whether these 4 variants may disrupt or create TFBS, we performed in silico TFBS analyses. We did not detect any alterations of TFBS for transcription factors expressed in the brain.  Table 3.7 NR2E1 Sites that are Fixed Among All Humans but Differ in Non-human Species  Region CE11A 5' UTR 5' UTR Exon 4 e 3' UTR  Location (bp) 136 1405 1449 3613 5439  Humans'  Great Apes b  Old World Monkeys c  Moused  G T A A C  A C T T T  A C T T T  A C T T  'includes all humans examined (African, Asia, Americas, Europe, Middle East, Oceania) b includes all chimpanzees, gorillas, orangutans examined cincludes all rhesus and Japanese macaques examined d -, denotes no corresponding base at that position (i.e., unalignable) e CCA (Pro) to CCI (Pro)  83  3.4.6 Haplotype and LD of NR2E1 structure provide effective tools for diseasemapping studies To inform future association and linkage-based studies of NR2E1, we elucidated haplotype structure and linkage disequilibrium (LD) using a subset of the 21 novel variants identified in our analyses of ethnically-diverse humans. To characterize the haplotype structure of human NR2E1, we inferred haplotypes using bi-allelic variants whose MAFs were 5% or greater. Genotypes of all markers were in Hardy-Weinberg equilibrium. For each individual, we inferred haplotypes (Figure 3.2 a) and estimated the population haplotype frequencies for all 7 human populations (Figure 3.2 b). We also typed a 12-allele CA-repeat in the 3' UTR (dinucleotide repeat range 17-31). We then re-constructed haplotypes using the CA-repeat data and the five most common haplotypes (Figure 3.2 c). Our characterization of haplotype structure in NR2E1 identified five haplotypes and CA-repeat alleles that would be useful for diseasemapping studies. To empirically estimate the degree of nonrandom association between NR2E1 variants, we calculated LD using two statistics: Lewontin's coefficient^and Pearson's correlation r2 (Ardlie et al. 2002). We used all the variants with MAFs equal to or greater than 5% except indel variant 17 for technical reasons (Section 3.3.5). We calculated LD using the total human population because sample size for each ethnically-diverse group was small. Despite our markers being only a few kilobases apart, in most cases we observed weak LD in this region. The only substantial LD in NR2E1 was between variants 2 and 7 (ID'I = 0.894; r2 = 0.880; Fisher p < 0.001, significant using the conservative Bonferroni correction) (Figure 3.3 a). The low levels of  84  ^  Figure 3.2 Five common SNP-based NR2E1 haplotypes account for the majority of chromosomes examined for global diversity  (a) The SNP-based haplotypes for both chromosomes of every •••=•NA10493 individual are illustrated. Central Northern Middle Africa Americas Asia 0 HO Haplotype ' Europe Europe^East Each row represents one 6 V Malral r3V, .°° GGACIG 0.138 0.440^0.422 0.426^0.426 0.333 (0.006) (0.001)^(0.001) (0.004) (0.007)^(0.005) chromosome. Each column 0.350 0.232 2 GGGC1A 0.497 0.137 0.217 0.377 (0.009) (0.014) (0.017) (0.001) (0.011) (0.013) 0.008 0.191 0.033 3 GGGCIG 0.225 0.006 0.165 represents one variable site, L::. 3 (0.009) (0.016) (0.017) (0.001) (0.010) (0.013) ^' 0.111 0.318 4 GGGG1G 0.109 the number of which is (0.007) (0.017) (0.002) 0.088 0.152 5 GGGCOA _ 0.123 (0.009) (0.004) (0.012) indicated above each 0.107 0.086 6 ACGC1G^0.103 (0.009) (0.012) (0.015) column (see Figure 1B). 0.003 7 ACGC 1A^0.004 0.005 (0.009) (0.012) (0.015) 0.11•1 0.001 8 GG0(31A 0.030 Black boxes indicate the (0.007) (0.006) 0.0008 0.0004 0.0004 0.0004 0.001 9 G G AC IA 0.001 major allele; white boxes (0.006) (0.004) (0.004) (0.004) (0.007) (0.005) nn _ 0.002 0.002 10 OGGCOG 0.002 (0.009) (0.012) (0.012) 1 represent the minor allele. 11 GGAG1G^_ 0.002 (0.009) Coriell Cell Repositories 0.0003 12 GGACOG^_ N,,A A 1 : 73. : 1 NA ••=1 7 6, 60 (0.003) 5 13 ACACIG ID codes are indicated. , `SNP' refers to single MA =:1=• nucleotide polymorphism (i.e. single nucleotide substitutions with minor 9 allele frequencies 1%). l .9 `Prob' is the probability of .996 haplotype assignment, where 1.00 = 100% 0 A0 .1% 1111: NA 11152 probable (i.e. individual is ,958 ... ... =DIM 1. either homozygous at all CN i"""7",,I.;132 sites, or heterozyote for only one site). MB, Mbuti; . BK, Biaka; AA, AfricanPA PA American; CH, Cheyenne; MA, Mayan; QU, 6 Quechua; KA, Karitiana; ammo IP, Indo-Pakistani; CN, Chinese; JA, Japanese; IT, Italian; RU, Russian; NE, Northern European; IC, Icelandic; AJ, Ashkenazi Jewish; DA, Druze Arab; PA, Pacific Islanders; ME, Melanesian. (b) Estimated population haplotype frequencies of the 13 most frequent SNP-based NR2E1 haplotypes. indicates that the haplotype is absent from the population. '1' and '0' represent present and absence of TC indel, respectively. (c) The frequency (Y-axis) of the CA-repeat allele (X-axis) with the 5 most common NR2E1 haplotypes (Z-axis) is plotted for the global diversity population. wn  ^MB  ^JA  ^var.. rto ‘7, 6 1111111MMIINA10492^IT 1.00 •••=C3 NA17327 1.00 MB MMIIII1 IINA 0492^IT IIMMEND NA17327 O rr 111111111••• .17328 7o0 MB 1.00 MO =SC= wo493^. IT ^•=0 NA17328 RU •11111=0 NA13619 595 MB •••••=1NA10494 1. MB=EMI:IN/kit:49a^0 RU ==li•NA13619 ma 1111111•MONAINse . 90 , 7 A MB =BONN NA10496  Estimated Haplotype Frequendes (Standard Error)  RU =MEMO 0013618 1.00 BK •11111111:840104139 BK =NOY NA10469 NM132g 1.00 BK Malan NA10473 1.00 ^ZVI rOM NA BK •••••:7N010473^RU MODEM NA13620 BK NEMEC NA10470 . 998^NE MOMS NA17001 .999 NE CO 111 :; BK ••1•••NA10470 NE =MEM NA17002 ., BK =M^ N= NA10411 1.00 N EEE E =DIM 0017002 ^' BK 1•11111..:11.410471^NNN AA NM IIMONA17031 too  AA MINVIIIIDNA17031  N A ; ;3: N NA :17 004 II.: NE MI11102 NA17004 NA17005 AA 11111111•CINA17033 .988^NE 1111111111110^..5 AA =IC= N017033^NE •1101110 NA17005 MOE= NA17006 .9. AA •••••ZNA17034^NE .995 AA MOIDIIIIIIINA17034 NA N A 11 77W6 00 7 .992 NE AA 111111111111111NA17035 ^ 1.00 =.1 00 144. 11 77 .0p 0 E7 .9 =17 .1c w N E ms AA •1111111•11117NA17036 AA 11111111W1NA17035^ 1,00 g. NE MBE= NA17008 ' AA =MIMIC NA17036 NA17009 A, S NE =MEMO AA 1111••■•NA17037^ 1.00 AA ECM= NA17037^w NE MTME NA17009 , C IINIZ=M NA15755 ., AA IIIIIIIIMICNA17038 .996 AA 11111121111180017038^.. IC 111117•1110 NM5755 1.00 AA ■•^NA17039 1.00 C ME7111•• N015756 . C IMI=I=M NA15756 AA MN^0017039 . NA15757 100 C 1=•1 AA MSS^NA17040^ 1.00 AA =MEICINA17040 011 :111 N A 1 65 77 587 1110.0 .... . 11... icCCC 7 Aj CH =1MICINAl2065 988 CH MII IIICEN NAl2085^IC =OMNINA15758 C 11111111111111C NA15759 . NAl2068^ CH =M EMO^ .891 IC ME=MM. NA15759 CM CEINIMEMINAl2068 MA MINI=:INA10975 .995 IC =MEC) NA15760 9 MA ENDEME NA ^0 75 IC 111111•■• NA15762 1.00 MA MININCIIIMI N010979 .997 IC 1111111:1=M NA15762 MA 11111:1=M NA10979 IC MINIM NA15763 ..., 0010976 MA CCEMONA18976 .999 AU IIIIIIIIIIIIIII2NA17032 995  AA M711•••NA17032  m MA =SMIENA10978 .2 MA INO111•11NA10978 m au ME7=MNA11200 QQQ k OU ••=1MMENA11200 OU MMEINEMINA11197 OU M=IMIINA11197 OU IIMMEAMINA11198 IIIMINNA111 OU INDDENNA111998 OU NIIME 0U MEN= NA11199 KA =MEM NA10968 KA =MENIIIINA10968 KA IIIINICENNA10966 KA ••=1•MMINA10965 KA MMICIMENA10967 KA M:IMMONA10967 KA M•CIIIIIINA10969 KA 17171111111•NA10989 IP MIIIIIIMNA10887 IP 111111:11111•NA10657 IP •••••:NA11860 P COIIMMENA11860 CO MMINCENNA11321 CO NA11321 CN ^•■=1NA11323 • CN = 71=ENA11323  .995  AJ =WINO NA17361 100 17  1.00 1.00  .996 .996 1.00 .997  1M 2M AJ 111111:1 A.l AA:jj MD=. ..:1 .1. 0017382 .9" AJ^ 0l 1111111MMI NA17383 1.00 AI MIMED NA 17383 ....1 Z•0111111• NA"364 1.00 .81 A =DM= 0017384 W Al MONO 0017365 A, . AJ MUMS NA17385 .,j Al MUM= 0017388 . .o Al MEM= NA17366 i Al =EMU 00 17 367 too ME CI] NA ,1367  .998  AJ Aj ..a11111. OA 11111111 ..2 1.11 NA NN'111177,22 3183 :1: DA^19^N011522 DA •11111111110 74011521 .995 0 .. .. NA 1 52 1 ..  996 889 .9%  DA /55/ .En  .995  CN =CM= NA11324 CN ^MI N011587 .10^IIIIIIINA11587 JA 111111:11111111NA11589 1111USIIIINA11589 JO 11111111MICNA11590 JA =DM= NA11590 IT MODEMMINA17321 IT =DM= NA17321 IT ■•■=INA1T322 IT =ENEDNA17322 & IT =MINE NA17323 0  a  M•21J A17323  1,00 995  1810  1.00  11111111 * IT 11•0NA17424 100 *I IT IIIIIIIIMEMNA17024 FT NENE= NA17325 .964 IT IIMIUMNA17325 IT 3.28 .964 MI^NA17 IT 111111110EINA173213  .  R  999  1.00  1D0  4 NA 1 1 5524  PA0 111111 D ". ..A n111110 NA ; 1755 4 1.00 74017385 PA MIME 74017385 PA ... N017355 180 PA^MP N017380 PA NAT73348177 .976 Pq PA 11111111•MMI 0017388 1 00 PA =DMZ 0017388 PA 11•1101111111 NA17369 1 co  .995  ▪  =111.111 RAA 1433:  PA 21101111M 74017390 11111101111111 NA17391 1,00 PA M•7••• NA17391 ME NMI= 0010540 1.00 ME M:M• 0010540 ME IMICIIIME NA10639 gel ME =REMO 0010539 ME MINIM NA10641 ME MUUMUU MA10541 ME INCI••• NA10542 , 0010542 ME  85  Oceania  Total Humans  0.673 (0.025) 0.091 (0.005) 0.136 (0.0003) _  0.402 (0.004) 0.290 (0005) 0.114 (0.005) 0.079 (0.002) 0.053 (0.002) 0.042 (0.004) 0.011 (0.005) 0.006 (0.002) 0.002 (0.004) 0.001 (0.002)  7  C  _ 0.008 (0.024) 0.082 (0.025) 0.008 (0.024) -  _  0.0003 (0.0014)  0.0001 (0.0003) 0.0005 0.0001 (0.005) (0.0005) -  LD observed at NR2E1 may be due to increased recombination or gene conversion (discussed further in General Discussion Section 5.1.11.1). However, reliable measures of LD depend strongly on sample size, which for this analysis was small. In addition, we combined ethnic groups, which may affect LD calculations due to stratification. Consequently, LD analyses on larger samples are warranted to provide a more robust interpretation of the extend of LD levels at NR2E1. We also examined the relationship between LD and distance using both ID'I and r2 , which indicated a general decrease in the level of LD with increasing distance (Figure 3.3 b-c).  Figure 3.3 Weak LD in NR2E1 that generally declines with physical distance  (a) Pairwise linkage disequilibrium (LD) between variants (excluding indels) with a frequencies 5% were calculated using ID'I (values below black diagonals boxes) and r2 (values above black diagonal boxes). **Fisher p<0.001; significant by Bonferroni Correction. *Fisher 0.01<p<0.05; significant by Bonferroni Correction. Relationship between physical distance (X-axis) and (b) ID'I and (c) r2 are demonstrated for each population individually. The linear regression line is plotted for both ID'I and r2  r2  2  ID?  2 7 8 14 21  7  8  14  0.800** 0.010 0.894** 0.32 0329 0.016 0.016 0.060 0.171  0.000 0.009 0.010 0.000  0.056 0.272* 0.136  21 0.001 0.000 0.029* 0.001  1.000 0.900 0.800 0.700 0.800  ID?  0.500 0.400  .  0.300 0.200 0.100 0.000  Distance (bp) 1.000  C  0.900 0.800 0.700 0.800  r2  0.500 0.400 0.300 0.200 0.100 0.000 0  ^  2000  ^  4000  Distance (bp)  ^  6000  ^  8000  3.5 Discussion The present study represents the first genetic report of NR2E1 in clinical samples. In addition, it provides the most comprehensive evolutionary study of NR2E1 reported to date. Our studies of NR2E1 are noteworthy in several respects. First, we used a direct resequencing approach, which is the most reliable, complete, and impartial means of mutation and polymorphism discovery. Second, unlike most candidate gene studies, our experiments were designed to identify mutations and polymorphisms in key non-coding regions (in addition to coding regions), in particular, evolutionarily conserved sequences that may harbour functionally important and disease-causing variants (Drake et al. 2006). Third, we studied a diverse collection of human genomic DNAs representing the world's major continental populations as a means to thoroughly assess the natural genetic variation at this locus. Fourth, unlike many genetic studies, we have used multiple non-human primate species (and multiple subjects within each) as a means to greatly enhance the reliability of ancestral-state inferences and elucidation of the molecular evolution of NR2E1. Our work indicates that protein-coding null mutations in NR2E1 do not contribute to cortical abnormalities in the patients examined here. However, one limitation of this study is low statistical power due to small sample size; consequently, future studies using larger patient samples are required to better understand the role of NR2E1 in human cortical development. In addition, this study cannot exclude the possibility that deletions involving NR2E1 may underlie abnormal cortical development in some patients. This is because a limitation of the DNA sequencing approach is its inability to detect large deletions. Thus, alternative experimental strategies, including quantitative PCR and comparative genomic hybridization, are warranted.  87  Taken together, our preliminary results are inconclusive to rule out NR2E1 as a candidate for human cortical disorders. We identified and characterized 13 non-coding patient-variants that have not been previously described. Of these, 4 represent suitable candidate regulatory mutations for cortical malformations (g.-555C>T, g.8213T>C, g.14617A>C, and g.20765C>A) given that 1) we could not exclude them as being de novo; 2) we could not detect them in 159-183 unaffected humans; 3) three were predicted to alter TFBS for neural transcriptional regulators with roles in cortical patterning (g.555C>T), neuronal differentiation/proliferation (g.8213T>C and g.14617A>C), and neurogenesis (g.14617A>C); and 4) the major human alleles for g.-555C>T and g.8213T>C are conserved between human and Fugu, suggesting strong functional constraint. Several additional patient-variants are of note. For one, 3 of 13 patient-variants (g.1767G>T, g.-2945A>G, and g.21502T>C) were identified in a single patient (LR00-144). Two of these patient-variants were inherited from one parent and one patient-variant was inherited from the other; consequently, this patient is effectively a compound heterozygote for NR2E1 patient-variants. The NR2E1 regions in which all three variants reside make them excellent functional variants: 2 reside within the proximal promoter (of which one resides within a region conserved between human and mouse) and 1 resides within the 3' UTR. It is interesting that the presence of 3 patient-variants in this patient correlates with a more severe phenotype (severe mental retardation, spasticity, seizures, early death) than her sibling, who harboured a single patient variant (g.21502T>C) and presented with less severe symptoms (microcephaly with simplified gyral patterns, no mental retardation). Given that the sibling harbored only g.21502T>C, we hypothesize that this variant is necessary but not sufficient to produce a clinical  88  outcome. Also of note is patient-variant g.-1453C>G, which was identified in two unrelated patients (LP98-052 and LR00-204) but absent in 338 unaffected chromosomes. This variant is located within the proximal promoter region and is predicted to alter two binding sites for brainexpressed transcription factors. The 4 candidate mutations identified in this study could conceivably underlie human cortical disorders by altering the levels of NR2E1. This hypothesis is supported by the demonstration that Nr2e1 +/ mice show premature cortical neurogenesis (Roy et al. 2004), which -  suggests dosage sensitivity for Nr2e1 during mammalian cortical development. There is also evidence to support the hypothesis that the 9 patient-variants demonstrated not to be de novo may still underlie cortical malformations. For instance, each child with an NR2E1 variant may harbor a second variant, at another genetically-interacting locus, that is absent in the parent. In support of this, we note that mice that are double heterozygotes for mutations at Nr2e1 and Pax6 interact genetically to alter normal forebrain development (Stenman et al. 2003). Thus, a multigenic mechanism involving NR2E1 and additional loci may underlie the cortical phenotypes in some patients examined here. Extensive future work will be required to investigate the function of each candidate mutation in the pathogenesis of human cortical disorders. Although TFBS prediction programs represent a primary tool for biologists, they can only infer the binding potential for transcription factors but not the functionality of the sites. Consequently, TFBS prediction is not entirely reliable, which represents a major limitation of our work. Future experimental work is required to test our predictions. Our genetic diversity and evolutionary analyses of NR2E1 in ethnically-diverse unaffected humans will inform future genetic studies of human cortical disorders. First, our data  89  indicate strong evolutionary constraint (i.e. purifying selection) at human NR2E1 as demonstrated by 1) a complete lack of synonymous and non-synonymous changes in the coding regions of all ethnically-diverse humans examined; 2) a complete lack of non-synonymous coding changes between humans, chimpanzees, gorillas, orangutans, and macaques; and 3) low nucleotide diversity in non-coding regions. In comparison to other studies and databases that consider genetic diversity of brain-related genes among and between humans and non-human primates (Cargill et al. 1999; Dorus et al. 2004; Freudenberg-Hua et al. 2003) (QFbase Macaca  fascicularis cDNA database; http://genebank.nibio.go.ip/gbank/qfbase/index.html), our data indicate that NR2E1 has experienced very strong evolutionary constraint. The implication of these findings is that any future identification of an NR2E1 coding variant in a patient with a brain-behaviour phenotype is likely to be related to the disorder. Importantly, the striking absence of synonymous changes, which are typically considered to be selectively neutral (Enard and Paabo 2004), may suggest a functional constraint that operates at the RNA level to maintain its secondary structure or stability, as described for other genes (Capon et al. 2004; Chamary and Hurst 2005; Duan et al. 2003). Second, it has been proposed that patients with microcephaly may be classified into two groups: a 'high-functioning' group characterized by relatively mild phenotypes, and a lowfunctioning' group characterized by more severe phenotypes, which can include motor deficits, seizures, and early death (Gilbert et al. 2005). In molecular evolutionary studies of genes underlying high- and low-functioning microcephaly, only the high-functioning group demonstrated adaptive evolution (Evans et al. 2004; Kumar et al. 2002; Wang and Su 2004). The absence of signatures of adaptive evolution in the coding region of NR2E1 suggests that this  90  gene is a more suitable candidate for the `low-functioning' microcephaly group. We note that for those individuals in our study for which information on early death was available, 40% presented with candidate NR2E1 mutations, a subset of whom also had motor deficits and seizures. Thus, future genetic studies of NR2E1 may consider enriching the study group with low-functioning microcephaly. Our analyses of ethnically-diverse humans may suggest adaptive evolution at NR2E1 that acts on regulatory sites, which constitute an important class of non-coding sequences that are potential targets of Darwinian selection (Wray et al. 2003). First, there was an excess of rare, derived NR2E1 variants, as indicated by the significantly negative Fu and Li's D* and F* values, which may be evidence of a 'selective sweep' (i.e. the rare variants have 'hitch-hiked' along with a variant on which positive selection has occurred) (Fay and Wu 2000). In this regard, it is conceivable that one or more of the human-specific NR2E1 sites identified in the present study may have been fixed by positive selection in a manner similar to that proposed for ASPM, which is mutated in some patients with microcephaly (Bond et al. 2003; Kumar et al. 2004; Woods et al. 2005). Second, we obtained high FsT scores for variants 8 and 21, which indicates local positive selection (Lewontin and Krakauer 1973). Of particular interest is variant 8 that is located in the 5' UTR, which, in general, represents a key regulatory region that is known to be a good target of positive selection (Osada et al. 2005). We note that the overall substitution rate in the 5' UTR is increased in comparison to the substitution rates in synonymous sites at NR2E1. Under the assumptions of molecular neutrality, one would expect similar substitution rates for UTR and synonymous sites if positive selection were not operating (Osada et al. 2005). Therefore, higher rate of substitution in the 5' UTR than in synonymous sites provides additional evidence of  91  positive selection. Interestingly, the derived A allele of variant 8 creates a transcription factor binding site for Myf5, which is known to be regulated in neurons (Daubas et al. 2000). This allele is present only in humans and great apes, which could suggest that neuronal regulation by Myf5 may have contributed to increased brain size of these primates versus other non-human primates, such as macaques. Despite some evidence for non-neutral evolution, an alternative interpretation that involves demographic and population factors, such as an expanding population, may also explain the patterns of genetic variation at NR2E1 (discussed further in Section 5.1.12). Our analysis of human NR2E1 ancestral states using non-human primate data has revealed an important finding. In determining the ancestral state of human variant 8, we discovered that at least one subject from each of chimpanzee, gorilla, and orangutan harboured the minor allele A. To our knowledge, we are aware of only one study that reports chimpanzee and gorilla being polymorphic for the same polymorphism seen in humans (Kidd et al. 2004). In that case, it was suggested that ancestral state inference could be resolved by sequencing orangutan (Kidd et al. 2004). Here, we provide the first example of a human polymorphic site that is also polymorphic for the same alleles in chimpanzee, gorilla, and orangutan. Given that we also sequenced two species of macaques, we were able to infer the most likely derived state. Thus, we strongly recommend that multiple non-human primate species be used, as well as multiple subjects within each, to robustly infer ancestral states of human polymorphisms. The knowledge of the genetic architecture of NR2E1 generated in this study provides additional tools for future disease-mapping studies of brain-behaviour disorders. Our results expand those of one other study that examined normal genetic architecture at NR2E1 (Stephens et al. 2001); however, our analyses employed over twice as much sequence data (including  92  evolutionarily conserved regions not previously examined) from a more diverse set of humans and non-human primates. First, we identified and characterized a set of 6 variants (of which 4 are novel) that are present at minor allele frequencies suitable for linkage and association analyses. We have further characterized the CA-repeat (D6S1594; GenBank Accession Z52880) located in the terminal exon of NR2E1 (previously only studied in 8 CEPH (Centre d'Etudes du Polymorphisme Humaine) families) in the major world populations. Second, we have identified five common NR2E1 haplotypes, of which three are found in all world populations examined in our study, which will be valuable for linkage analyses and association studies. We also report the haplotype structure for every individual, which will enable others to make direct comparisons using data generated at other loci (the populations we choose to examine are publicly available through http://coriell.umdnj.edu/) . Third, we demonstrate weak linkage disequilibrium at NR2E1, which indicates that ideally all variants should be typed at this locus to reduce the chances of false negative associations. Fourth, for all markers and haplotypes identified in this study in the ethnically-diverse population, we have characterized their frequency in each of the major world populations. This information can reduce or eliminate false positive and negative associations that can arise as a result of population stratification, which is a well established confound in human disease-mapping efforts (Freedman et al. 2004; Kang et al. 1999).  3.6 Conclusion In conclusion, our analysis of human NR2E1 has identified candidate regulatory mutations that we hypothesize may underlie cortical abnormalities. These findings coupled with  93  our genetic diversity and evolutionary analyses will guide future examinations of NR2E1 in human health and disease.  94  Chapter 4: Mutation, Association, and Expression Studies of Human NR2E1: A Genetic Candidate for ImpulsiveAggressive Behaviours, Bipolar Disorder and Schizophrenia 4.1 Publication Status and Contribution of Individual Authors  This chapter is in preparation for publication: Ravinesh A. Kumar, Stephen Leach, Russell Bonaguro, Alan McLean, Brett S. Abrahams, Sheilagh Hodgins, Gustavo Turecki, Emil Coccarro, Walter Muir, Douglas Blackwood, Angela R. Brooks-Wilson, and Elizabeth M. Simpson (200J. Mutation, Association, and Expression Studies of Human NR2E1: A Genetic Candidate for Impulsive-Aggressive  Behaviours, Bipolar Disorder and Schizophrenia  The project described in this chapter was conceived and initiated by Dr. E.M. Simpson. Ethical approval for this study was initiated by Brett Abrahams, Dr. E.M. Simpson, and myself The project became focused under my direction, and I was in charge of the clinical collaborations that developed with the Hodgins, Turecki, Coccarro, Muir, and Blackwood Laboratories. I generated the majority of the sequence data (under the supervision of SL and ARB-W) described in this chapter (together with some data generated by RB), which included 844 kb of human sequences. Patients and control subjects were recruited by our collaborators (SH, GT, EC, WM, and DB). Association analyses were carried out in the Blackwood Laboratory (AM and DB). I wrote the paper, created all tables and figures, and will see this manuscript through to publication.  Table 4.1: Data from the Hodgins, Turecki, Coccaro, Muir, and Blackwood Labs. Data analyses by me.  Table 4.2: Data from the Simpson Lab (myself and RB). Data analyses by me. Table 4.3: Data from the Simpson Lab (myself). Data analyses by me.  95  Table 4.4: Data from the Blackwood Lab. Data analyses by AM and DB. Table 4.5: Data from the Blackwood Lab. Data analyses by AM and DB. Figure 4.1: Data from the Simpson Lab (myself). Northern blot purchased from Clontech (Palo Alto, CA.) Data analyses by me.  96  4.2 Introduction Impulsive-aggressive behaviours constitute a variable and multidimensional phenotype that may involve unwarranted and intentional acts of aggression or violence that inflict bodily or mental threat, abuse or injury to others or to oneself (Filley et al. 2001; Turecki 2005). Such behaviors are commonly associated with criminality, but can also present as a symptom secondary to a medical condition including psychiatric disorders (APA 2000; Gothelf et al. 1997; Nolan et al. 1999). Thus, impulsive-aggressive behaviours may be successfully studied from a health-based, biomedical perspective. A genetic basis for aggression and violence is well documented. First, twin studies show a higher concordance rate for criminality and aggression in monozygotic twins than in dizygotic twins (Christiansen 1968; Coccaro et al. 1997; Grove et al. 1990; Lyons 1996). Second, a review of adoption studies indicate that genetic contributions may account for approximately half the variance in some forms of criminal behaviors (Raine 1993). Third, genetic factors may underlie structural and functional abnormalities of the hippocampus, amygdala, corpus callosum, and frontal lobes that have been described in some humans with impulsive-aggressive behaviors (Anderson et al. 1999; Brower and Price 2001; Critchley et al. 2000; Filley et al. 2001; Grafman et al. 1996; Kiehl et al. 2001; Kiehl et al. 2004; Laakso et al. 2001; Lapierre et al. 1995; Raine et al. 1997; Raine et al. 2004; Raine et al. 2003; Soderstrom et al. 2002; Yang et al. 2005) . Fourth, human molecular genetic studies have implicated several genes in these behaviors, including TPH (Hennig et al. 2005; Rujescu et al. 2002; Turecki et al. 2001; Zaboli et al. 2006), MAOA (Brunner et al. 1993; Brunner et al. 1993; Caspi et al. 2002), and COMT (Rujescu et al. 2003; Volavka et al. 2004). Finally, genetic studies in mice have identified numerous genes that regulate aggression in this species, including Tph (Kulikov et al.  97  2005), Maoa (Cases et al. 1995), and Comt (Gogos et al. 1998); the implication of these genes in both human and mouse aggression validates the efficacy of mouse models of human aggression. Despite the breadth of evidence supporting a role for genetics in these behaviors, molecular genetic studies are limited, in part, due to the lack of suitable candidate genes having strong functional and positional evidence supporting a role in human impulsive-aggressive behaviours. The orphan nuclear receptor NR2E1 (also known as TLX) is an excellent functional candidate gene for human impulsive-aggressive behaviors. Mice deleted for both copies of Nr2e1 (Nr2e1"/ ; also known as 'fierce' mice) are pathologically violent towards conspecifics, -  such that males bite, wound, and ultimately kill their siblings and intended mates (Kumar et al. 2004; Young et al. 2002). Increased aggression is also present in female Nr2e1 / mice, which - -  make them amenable for the genetic dissection of human female aggression as well. The extreme aggression of Nr2e1 / mice is also directed towards humans, as reflected in their 'hard-to-handle' - -  phenotype that includes jumping, vocalizing, and biting. Notably, we have recently corrected the violently aggressive phenotype in Nr2e1 / mice using a genomic clone spanning the human - -  NR2E1 gene that includes its endogenous promoter (Abrahams et al. 2005), demonstrating that human and mouse NR2E1 are functionally equivalent in mice. To date, this represents the first genetic mouse model of violent behavior in which a human gene is able to correct mouse pathological aggression. Nr2e1 / mice also manifest with 1) hypoplasia of the hippocampus, amygdala, corpus - -  callosum, and frontal lobes, 2) increased volume of the lateral ventricles, 3) altered neurogenesis, 4) reduction of superficial cortical layers II and III, 5) olfactory bulb hypoplasia, 6) retinal abnormalities, 7) cognitive impairment, 8) fearlessness, 9) excitability, 10) short stature (i.e.,  98  from nose to rump) and, 11) post-natal growth failure (Christie et al. 2006; Land and Monaghan 2003; Monaghan et al. 1997; Roy et al. 2004; Shi et al. 2004; Stenman et al. 2003; Stenman et al. 2003; Young et al. 2002). Mice heterozygous for a deletion of Nr2e1 (Nr2e1 +) show premature neurogenesis during early cortical development, resulting in neuron numbers that are intermediate to those produced in Nr2e1 +i+ and Nr2e1 -/- mice (Roy et al. 2004). This observation provides strong support for dosage sensitivity of Nr2e1 during brain development. The incidence of impulsive-aggressive behaviours is increased in some genetically influenced psychiatric disorders, including bipolar disorder and schizophrenia (Craddock et al. 2005; Feldmann 2001; Hodgins 1992; Posternak and Zimmerman 2002; Schanda et al. 2004; Swanson et al. 1990), although these behaviours occur in only a small proportion of patients with these mental disorders (Corrigan and Watson 2005; Wessely and Castle 1998). Candidate gene studies in bipolar disorder and schizophrenia may contribute to an understanding of the molecular antecedents of aggression and violence (Han et al. 2006; Jones et al. 2001; Lachman et al. 1998; Strous et al. 2003). Notably, NR2E1 is an excellent positional and functional candidate gene for bipolar disorder and schizophrenia. NR2E1 is located on human chromosome 6q21-22 at 108.6 Mb (ENS112333; www.ensembl.org ) and coincides with the locus that achieved the most significant genomewide linkage (at position 108.5 MB) in the largest meta-analyses of bipolar disorder conducted to date (McQueen et al. 2005). Furthermore, in one of the largest studies of schizophrenia that examined 1000 affected sibling pairs from 8 independent family collections, the greatest supportive linkage was detected on Chromosome 6q (Levinson et al. 2000), on which NR2E1 resides at Chromosome 6q13-26 (Schizophrenia 5 (SCZD5), OMIM Locus ID 603175). Functional support for NR2E1 in bipolar disorder and schizophrenia is  99  demonstrated by many phenotypic similarities (in addition to aggression) that are shared between Nr2e1 -1" mice and some patients with bipolar disorder and schizophrenia, including 1) increased volume of the lateral ventricles and reductions in temporal lobe, frontal lobe, hippocampal, corpus callosal and amygdal volumes (Barkataki et al. 2006; Chen et al. 2004; DeLisi et al. 1991; Hajek et al. 2005; Lawrie and Abukmeil 1998; Lieberman et al. 1993; Nelson et al.; Swayze et al. 1990; Velakoulis et al. 1999; Wong et al. 1997; Wright et al. 2000); 2) aberrant neurogenesis and altered arrangement of cortical neurons in superficial layers II and III (Arnold 1999; Arnold et al. 1991; Benes et al. 1998; Falkai et al. 2000; Jakob and Beckmann 1986); 3) cognitive impairment (Tamminga and Holcomb 2005); 4) deficits in GABAergic interneuron involvement (Benes and Berretta 2001; Keverne 1999); and 5) olfactory bulb dysfunction and abnormalities (Moberg et al. 1999; Turetsky et al. 2003; Turetsky et al. 2000). Based on the strong functional and positional support for NR2E1 in impulsive-aggressive behaviors, bipolar disorder, and schizophrenia, we hypothesized that some humans with these conditions may have mutations in NR2E1. In further support of this hypothesis, we note that some genes known to interact with NR2E1, including NURR1 (Buervenich et al. 2000; Chen et al. 2000; Iwayama-Shigeno et al. 2003; Yu et al. 2000), Pax6 (Heyman et al. 1999; Stenman et al. 2003; Stober et al. 1999), RAR/32 (Goodman 1998; Kobayashi et al. 2000; Krezel et al. 1998), and S100b (Rothermundt et al. 2004; Shi et al. 2004), may themselves be implicated in violent behavior, bipolar disorder, or schizophrenia,. In addition, mutations in mouse and human NR2E3, the gene most closely related to NR2E1, result in similar eye phenotypes in both these species (Akhmedov et al. 2000; Haider et al. 2000), suggesting that human and mouse NR2E1 mutations might cause a similar phenotype too. To test this hypothesis, we sequenced the entire coding,  100  complete 5' and 3' untranslated (UTR), splice-site, proximal promoter, and six evolutionaryconserved non-coding regions of NR2E1 in 126 humans with phenotypes resembling Nr2e1 /  - -  mice, from families showing possible linkage at 6q21 and in groups of schizophrenia and bipolar patients. We also sequenced an additional 94 control subjects without any known history of psychiatric or behavioral disorders. We applied bioinformatic approaches including transcription factor binding site (TFBS) analyses to predict the potential impact of candidate NR2E1 mutations. In addition, we performed a case-control association study in approximately 400 patients with bipolar disorder, 400 with schizophrenia, and 400 ethnically-matched controls using 2 putative regulatory single nucleotide polymorphisms (SNPs) and a 3' UTR microsatellite marker. Finally, we examined NR2E1 expression in normal human adult brain in regions not previously reported. The present study represents the first genetic investigation of NR2E1 in humans with impulsive-aggressive behaviors, bipolar disorder, and schizophrenia.  101  4.3 Materials and Methods  4.3.1 Human Samples Approval for this study was obtained from The University of British Columbia (Certificate of Approval # C99-0524), Child & Family Research Institute (Certificate of Approval # WOO0005), and the Department of Medical Genetics (Certificate of Approval #6-3-20). The research followed Canada's Tri-Council Statement on "Ethical Conduct for Research Involving Humans" (section 2.5-2.7). Demographic and clinical data for subjects are reported in Table 4.1. Subjects in this study included several subgroups and were recruited from various centers. Subjects were invited to participate if they had aggressive-impulsive behaviours that included psychopathy, violent behaviour, and severe personality disorders, and were resident within a large forensic psychiatric hospital or were detained in a secure environment specializing in the treatment and rehabilitation of violent offenders. Patients with DSM-IV intermittent explosive disorder were assessed with the Life History of Aggression (LHA), the Buss-Durkee Hostility Inventory (BDHI), the Motor Aggression and Research Criteria for Intermittent Explosive Disorder (IEDIR), the Eysenck Personality Questionnaire II (EPQII), and the Barratt Impulsiveness Scale (BIS11) as previously described (Goveas et al. 2004). Subjects with paraphilic disorders attended a sexual disorder clinic in Baltimore, Maryland, as previously described (Berlin et al. 1991). Subjects with self-directed impulsive-aggressive behaviours all committed suicide in the Montreal metropolitan area, and each had a very high score in measures of aggressive behavior, as assessed by the Brown Goodwin lifetime history of aggression questionnaire and the Buss Durkee hostility inventory adapted to proxy-based interviews (Dumais et al. 2005). Patients with  102  Table 4.1 Clinical and Demographic Data on Subjects Diagnosis  /web  Sample Sizes Total Male Female  Male^Female  Caucasian African-American  MUTATION ANALYSES Psychopathic and Violent  24  24  0  34 (14-57)  n/a  24  0  Intermittent Explosive Disorder  4  3  1  32 (24-38)  54  2  2  0  30 (21-56)  n/a  8  0  Paraphilic Disorder  8  8  Suicide  4  3  1  45 (42-49)  21  4  0  Severe Mental Retardation  9  na  na  na  na  9  0  Bipolar Disorder Type I  39  15  24  38 (26-52)  40 (24-67)  39  0  Schizophrenia  33  23  10  39 (15-82)  40 (24-58)  28  5  Autism  5  na  na  na  na  na  na  336 41  151 13  185 28  48 (24-92) 37 (24-75)  47 (25-86) 40 (24-89)  336 41  0 0  Schizophrenia  370  256  114  53 (22-88)  49 (21-89)  370  0  Controls  480  250  227  50 (25-89)  48 (19-86)  480  0  ASSOCIATION ANALYSES Bipolar Disorder Type 1 Type 2  a na,  not available bmean age reported (years); brackets indicate age range; na, not available c na, not available  mild to severe mental retardation and behavioral problems were recruited from the Greenwood Genetics Centre, Greenwood, South Carolina, as previously described (Schuback et al. 1999). Patients with autism and a history of violence were obtained from the Autism Genetics Exchange Resource (AGRE) (http://www.agre.org/). The majority of patients with bipolar disorder and schizophrenia were contacted through their consultant psychiatrist. Diagnoses were reached by consensus between two trained psychiatrists and were based on DSM-IV criteria (APA 2000) following direct interview of the patient using the Schedule for Affective Disorders and Schizophrenia semi structured interview (lifetime version). Diagnostic information was also obtained from hospital records and in many  103  cases from relatives. Samples from a few patients with bipolar disorder and schizophrenia were also obtained from Coriell Cell Repository (http://coriell.umdnj.edu/) . In addition, we obtained ten samples from schizophrenia patients who belonged to a pedigree collection of the National Institute of Mental Health Schizophrenia Genetics Initiative and show linkage to 6q21-22 (Cao et al. 1997; Levinson et al. 2000; Martinez et al. 1999). For mutation analyses, we studied 94 control subjects without any known behavioural or DSM-IV psychiatric disorders. Six additional family members (five from three unrelated patients with bipolar disorder and one from a patient with schizophrenia) were studied as well.  4.3.2 DNA Amplification, Sequencing, and Genotyping For mutation analyses, we sequenced genomic NR2E1 using DNA amplicons generated from 20 PCR assays that cover the coding (1,146 bp), complete 5' and 3' untranslated regions (UTRs) (1,973 bp), exon-flanking regions including consensus splice-sites (1,719 bp), and evolutionary conserved regions including proximal promoter (1,528 bp). Polymerase chain reactions (PCR) were performed in a 96-well microtitre plate thermal cycler. PCR reactions were prepared in a total volume of 20 using 10 ng of genomic template, and the following reagents from Invitrogen (Burlington, Ontario): 1X buffer, 1 mM MgSO4, 0.2 mM dNTPs, 0.5 mM primer, and 0.0125 units Pfx polymerase. Thermal cycling (30 cycles) was performed as follows: 30 cycles, 94°C for 2 mins, annealing T (58-63°C) for 30 secs, 68°C for 1 min. PCR products were purified using magnetic beads (Agencourt Bioscience Corporation, Beverly, MA) as per the manufacturer's instructions. PCR and sequencing used primers previously described (Section 3.3.2; Table 3.2 ). Sequences were visually inspected and scored by at least two individuals using  104  either Consed (Gordon et al. 1998) or Sequencher (Gene Codes, Ann Arbor, MI). Every human variant identified was confirmed by repeating the PCR and sequencing process. For case-control association analyses, we genotyped the D6S1594 microsatellite by performing PCRs in a 12 ul reaction volume containing 2.5pmol of each primer, lx Sigma PCR Buffer, 0.2 mM dNTPs, 0.25 units of Sigma Taq and 2Ong of Genomic DNA. Primers were synthesized by Invitrogen (Burlington, Ontario) with one of the two primers labeled 5' with FAM (ABI, Foster City, CA). A MJ Research PTC-225 machine was used to amplify DNA fragments with 35 cycles of 20 secs at 94°C, 30 secs at 55°C and lmins at 72°C. This was preceded by an initial denaturation step of 2 mins at 94°C and ended with an extension step of 20 mins at 72°C. PCR products were run in an ABI 3730 DNA Analyzer (Foster City, CA) with GS500 liz size standards. Allele sizes were determined using Genemapper (3.0) analysis software (ABI, Foster City, CA) and checked for quality manually. For SNP genotyping, the target sequence for each SNP was submitted to the Assay By Design Service for Custom SNP Genotyping Assays (ABI, Foster City, CA), or when possible the SNP assay was ordered as an Assay On Demand Assay. Genotyping was performed in 384 well-plates using the TaqMan polymerase chain reaction-based method (ABI, Foster City, CA). The final volume PCR reaction was 5 gl using 10 ng of genomic DNA, 2.5 gl of Taqman Master Mix (ABI, Foster City, CA) and 0.125g1 of 40x Assay By design Genotyping Assay Mix (ABI, Foster City, CA), or 0.250 of 20x Assay On Demand Genotyping Assay (ABI, Foster City, CA). The cycling parameters were as follows: 95°C for 10 mins, followed by 40 cycles of denaturation at 92°C for 15 secs and annealing/extension at 60°C for 1 min. PCR plates were then read on an ABI PRISM 7900HT instrument with SDS v2.1 software (Foster City, CA).  105  4.3.3 Bioinformatic and Statistical Analyses Transcription factor binding site (TFBS) analyses was performed using MatInspector (Quandt et al. 1995). We analyzed the minor and major alleles at each variant site together with 50 by of surrounding sequence using the Optimized Matrix Similarity thresholds. We focused specifically on transcription factors with brain-relevant roles that include cortical patterning, neural cell proliferation and differentiation, neuronal apoptosis, neuronal survival, and synaptic plasticity. For genetic association analyses, allele and genotype distributions in patients and control subjects were compared by the ftest using the CLUMP program (Sham and Curtis 1995) to assess significance. Alleles 105, 107, 109, 111, 113, 119, 123, 137, 139 were too infrequent for separate analysis (i.e., square cell size 5) and were therefore combined into a single allele. Comparisons were therefore made with 9 alleles (i.e. 117, 121, 125, 127, 129, 131, 133, 135, and the combined rare group).  4.3.4 Expression Analyses Hybridization analysis using an NR2E1 partial cDNA probe (pEMS741; cDNA 769 to 1847 bp) was performed on adult human brain multitissue northern blot (Clontech, Palo Alto, CA) as per the manufacturer's instructions. Prehybridization (52°C, 90 min) and hybridization (51°C, 15 hrs) were performed using ExpressHyb Solution (Clontech) as described by the manufacturer. 32  P-radiolabeled probes were generated by random primer labeling using Ready-To-GoTM DNA  Labeling Beads (Amersham, Piscataway, NJ). Washes included: twice with Wash Solution 1  106  (Clontech) at room temperature for 30 min; and twice with Wash Solution 2 (Clontech) at 50°C for 40 min. The membrane was exposed to autoradiographic film with an intensifying screen at — 80°C for 2 days. The blot was stripped using 0.5% SDS for 10 min. and reprobed with GAPDH (pEMS722) as previously described (Young et al. 2002). The membrane was exposed to autoradiographic film with an intensifying screen at -80° C for 15 min.  4.4 Results  4.4.1 Candidate NR2E1 mutations identified in subjects with behavioural and psychiatric disorders To determine whether humans with impulsive-aggressive behaviors, bipolar disorder, or schizophrenia have mutations in NR2E1, we sequenced the entire coding regions, complete 5' and 3' UTR, exonic-flanking sequences including consensus splice-sites, and six evolutionary conserved regions including the proximal promoter in 126 humans with phenotypes resembling Nr2e1 -/- mice, in families with evidence of linkage to 6q21, or in bipolar disorder and schizophrenia patient groups. In total, we generated approximately 6.3 kb of sequence per individual. We did not detect any coding region variants. However, we identified 13 subjects harboring 12 non-coding variants (Table 4.2) that have not been previously observed in 94 healthy humans (Kumar and Simpson, unpublished data) or in public DNA repositories (http://www.ncbi.nlm.nih.gov/projects/SNP/; Build 124). Each of these variants (herein referred to as patient-variants) was present in the heterozygote state. Twenty-three percent of these variants resided within the proximal promoter, 53% within a UTR, and 23% within intronic sequence. Transitions and transversions accounted for 82% and 18% of all variants, respectively. All variants were independently confirmed by reamplifying and resequencing both strands of  107  ^  DNA. We amplified and sequenced the regions corresponding to these variants in 94 appropriately-matched control subjects not previously studied for NR2E1 (Table 4.2). None of  Table 4.2 Characterization of NR2E1 Patient-Variants in Families and Control Subjects Sample^Phenotype°^Location°^Nucleotide Variant°^  Genotypes  Frequency of Candidate Mutation in Control Subjects°  Patient Unaffected Unaffected Affected Father^Mother Sibling 3000^Bipolar disorder^PPR^g.-3079A>G^A/G^A/A^A/G^n/a^0/128(0%) 929^Bipolar disorder^Intron 5^g.11595T>C^T/C^T/T^T/T^X^0/176 (0%) 3542^Bipolar disorder^3'UTR^g.20920G>A^G/A^n/a^G/G^n/a^0/150 (0%) gEMS680 Schizophrenia ^CE13A^g.-1220-1221insT^G/insT^n/a^n/a^G/G 3^Schizophrenia^Intron 7^g.14314-14319delACTCT ACTCT/-- n/a^n/a^n/a^0/66 (0%) 9^Schizophrenia^3'UTR^g.20826A>G^A/G^n/a^n/a^n/a^0/166 (0%) gEMS453 Violent offender^PPR^g.-3079A>G ^A/G^n/a^n/a^n/a^0/126 (0%) SD5^Paraphilic disorder^5' UTR^g.-555C>T^C/T^n/a^n/a^n/a^0/154 (0%) gEMS454 Violent offender ^5' UTR^g.-555C>T^C/T^n/a^n/a^n/a^0/156 (0%) SD4^Paraphilic offender^Intron 1^g.2078G>C^G/C^n/a^n/a^n/a 1 FW^Intermittent explosive disorder 3'UTR ^g.21762C>A^C/A^n/a^n/a^n/a^0/90 (0%) gEMS455 Violent offender ^3'UTR^g.21857C>T^C/T^n/a^n/a^n/a^0/90 (0%) CMS4989 Psychosis +^3'UTR^3bp deletion^CTT/—^n/a^n/a^n/a^0/90 (0%) CMS4989 Psychosis +^3'UTR^g.21846G>A^G/A^n/a^n/a^n/a^0/90 (0%) 8 4,  mental retardation, seizures, vision problems, low IQ  ° PPR, proximal promoter region (defined as a 2.0-kb region upstream of the initiator Met codon); CE, evolutionary conserved element within PPR (as described in Abrahams at al. 2002); UTR, untranslated region  `g,genomic; numbering based on Antonarakis and the Nomenclature Working Group [1998], where A of the initiator Met codon in axon 1 is denoted nucleotide +1. Human genomic NR2E1 sequence: NCB! AL078596  d ri/a, parents unavailable for genotyping and/or patient does not have an affected sibling; X, an additional 9 affected family members were genotyped, of whom one harbored g.11595T>C  ° numbers represent total number of successfully sequenced chromosomes and not total number of chromosomes screened; -, appropriately-matched chromosomes unavailable for genotyping  the 12 patient-variants was detected in control subjects. We also sequenced 15 additional family members. For 10 of the 12 patient-variants, parents and siblings were unavailable to confirm de novo status; therefore, we cannot exclude the possibility that these variants are de novo and represent candidate mutations. Notably, two of these variants represent indels involving three (g.21890-21893deICTT) and five (g.14314-14319delACTCT) base pair deletions. Interestingly, the 5 by deletion was identified in a patient with schizophrenia who came from a family with evidence of 6q21-linkage (and g.20826A>G was also identified in a patient with evidence for 6q21-linkage). For two of the 12 patient-variants, at least one unaffected parent harbored the  108  patient's variant, indicating that this variant was not de novo. In one of these cases, the variant (g.11595T>C) was also detected in a relative with bipolar disorder. For the remaining variant (g.1220-1221insT), an affected sibling did not harbor the variant, indicating that the variant does not predict disease.  4.4.2 Alterations of transcription factor binding sites by novel NR2E1 variants To determine the impact of the 12 patient-variants on transcription factor binding, we performed in silico TFBS analyses using Matlnspector (Quandt et al. 1995). We restricted our analyses to transcription factors expressed in the brain. Of the 12 patient-variants, seven were predicted to create or abolish binding of transcription factors known to have roles in neuronal proliferation and survival, cortical patterning, neuronal differentiation, and synaptic plasticity (Table 4.3).  Table 4.3 Characterization of NR2E1 Patient-Variants to Detect Alterations in Putative Transcription Factor Binding Sites  Nucleotide Variant°  LLocation  Transcription tion factor Transcription binding site^factor  g.-1220-1221insT  CE13A  Created  Orthologous nucleotide in other species°  Role in brain Human  Apes  E2F  Regulator of cortical patterning and neuronal apoptosis  +ins  -ins  -ins  -ins^n/a  Regulator of cortical patterning and neuronal apoptosis  C  C  C  C^C  Masque  mtvv.e Riau  g.-555C>T  5' UTR  Abolished  E2F  g.2078G>C  Intron 1  Abolished  AP2  Regulator of neural gene expression and development  G  G  G  G^G  g.11595T>C  Intron 5  gait1r461r4319  Abolished  Elm-2  Regulator of neural cell differentiation  T  T  C  T^rda  Intron 7  Abolished  Crx  Regulator of photoreceptor differentiation  ACTCT  ACTCT  n/a  n/a^n/a  g.20828A>G  3'UTR  Abolished  Nfat  Regulator of neuronal survivial  A  A  A  rite^n/a  g.21857C>T  3'UTR  Created  Foxa2  Expressed in brain  C  C  C  Na^Na  • g,genomic; numbering based on Anboriarakis and the Nomenclature Working Group (1998], where A of the initiator Met codon in axon 1 is denoted nucleotide +1. Human genomic NR2E1 sequence: NCB! AL078598. °PPR, proximal promoter region (defined as a 2.0-kb region upstream of the initiator Met codon); CE, evolutionary conserved element within PPR (as described in Abrahams at al. 2002); UTR, untranslated region c+Ins, T insertion; -Ins, no T inserstion; Na ortholgous region does not align with human sequence  To determine whether functional constraint may exist at sites corresponding to the 12 patient-variants, we determined the orthologous nucleotide at each of the sites for chimpanzee,  109  gorilla, orangutan, macaque, mouse, and Fugu. Notably, in two instances (g.-555C>T, g.2078G>C), the major human nucleotide was conserved to Fugu (Table 4.3). The absence of nucleotide variability at these non-coding sites between human and Fugu, which are separated by 900 million years (Kumar and Hedges 1998), suggests strong functional constraint. To determine whether the NR2E1 patient-variants may reside within cis-acting UTR motifs, we searched for the presence of experimentally-validated 5' and 3' UTR motifs using UTRscan (Mignone et al. 2005). We did not identify any motifs that included a candidate mutation. To determine whether any of the candidate mutations may alter 3' UTR binding for microRNAs (miRNA), we aligned the 3' UTR of NR2E1 against known miRNA motifs (Xie et al. 2005), but we did not detect a motif that included a candidate mutation.  4.4.3 Lack of evidence of association between three NR2E1 markers to bipolar disorder or schizophrenia To determine whether NR2E1 polymorphisms may associate with bipolar disorder and schizophrenia, we typed a (CA) n microsatellite (D6S1594) located at position 108.6 Mb within the 3' UTR in bipolar disorder, schizophrenia, and ethnically-matched controls. Allele lengths in bipolar disorder, schizophrenia, and controls ranged from 105 by to 139 by (Table 4.4). We did not detect any significant differences between repeat lengths in controls versus bipolar disorder (x2 2.18, p>0.05) and controls versus schizophrenia (x 2 12.6, p = 0.1). We also genotyped two SNPs selected because of their putative regulatory roles: 'SNP 1' that resides within the proximal promoter in a region conserved between humans and mouse (variant 2 in Figure 3.1); and `SNP2' that resides in the 5' UTR (variant 7 in Figure 3.1). Controls were not in Hardy-Weinberg equilibrium (HWE), which could be due to technical  110  artifacts such as genotyping errors or, alternatively, result from violations of HWE assumptions, including nonrandom mating or positive selection. We found no evidence of an association between SNP 1 in bipolar disorder versus control (x 2 0.69, p>0.05) or schizophrenia versus control (x 2 0.57, p>0.05). We also did not find an association between SNP 2 in bipolar disorder versus control (x 2 0.20, p>0.05) or schizophrenia versus control (x 2 0.42, p>0.05) (Table 4.5).  Table 4.4 (CA),, Microsatellite Analysis in Bipolar Disorder and Schizophrenia Allele Lengtha  105 107 109 111 113 117 119 121 123 125 127 129 131 133 135 137 139  Controlsb  Bipolar Disorderb^Schizophrenia b  0.2% (1) 0.0% (0) 0.3% (2) 0.6% (3) 0.3% (2) 0.3% (21) 0.6% (3) 2.0% (11) 0.6% (3) 5.0% (27) 14% (73) 29% (159) 25% (133) 13.% (72) 4.8% (26) 0.6% (3) 0.2% (1)  0.0% (0) 0.2% (1) 0.2% (1) 0.2% (1) 0.0% (0) 4.1% (24) 0.7% (4) 2.5% (15) 0.8% (5) 5.1% (30) 12% (73) 30% (178) 27% (158) 12% (71) 3.9% (23) 0.8% (5) 0.2% (1)  0.0% (0) 0.2% (1) 0.0% (0) 0.2% (1) 0.0% (0) 4.2% (26) 0.2% (1) 1.1% (7) 0.0% (0) 5.8% (36) 15.4% (95) 33% (204) 23% (141) 13.% (82) 3.2% (20) 0.6% (4) 0.0% (0)  618 540 590 Total asize of PCR product bvalue in parenthesis refers to total number of chromosomes  111  Table 4.5 NR2E1 SNP Analyses in Bipolar Disorder and Schizophrenia  ' Case-Control^bb^Allele^Genotype'^ X2  SNPa SNP 1  ^  C^G^C/C C/G G/G  Bipolar Disorder^359^.96^.04^.91^.09^0^0.69^>0.5 (687) (31)^(328)^(31)^(0) Schizophrenia^382^.97^.03^.93^.07^0^0.057^>0.5 (739) (25)^(357)^(25)^(0) Control^401^.97^.03^.93^.07^0 (774) (28)^(373)^(28) (0) ^ SNP 2  G^C^G/G G/C C/C  Bipolar Disorder^355^.95^.05^.91^.09^0^0.20^>0.5 (678) (32)^(323)^(32) (0) Schizophrenia^379^.97^.03^.93^.07^0^0.42^>0.5 (739) (25)^(354)^(25) (0) Control^402^.97^.04^.93^.07^.01 (776) (31)^(374)^(28) (3) a The final names for 'SNP1' and b number of subjects examined  'SNP2' may change  'reported as frequencies. Numbers in parenthesis refer to total number of alleles examined  4.4.4 Restriction of NR2E1 in human adult forebrain regions We analyzed expression of NR2E1 in several regions of the adult human central nervous system not specifically examined previously, including the putamen, medulla, frontal lobe, occipital pole, temporal lobe, and spinal cord. A single transcript of approximately 4.0 kb was detected in cerebral cortex, occipital pole, frontal lobe, temporal lobe, and putamen, but not in cerebellum, medulla, and spinal cord (Figure 4.1).  112  E a) .o  A  kb  a) 12^-§ _1^.0 o o^ 0 a)^ To^a  a)^a^*8^"22 M^co^0^Li_ -0^.c  E  -  4.4 —  2.4 —  1.4 —  B 1.5 —  Figure 4.1 Northern analysis demonstrates that NR2E1 is restricted to forebrain structures and absent from the hindbrain and spinal cord in the normal adult human brain (A) Probing a human brain northern blot with an NR2E1-specific cDNA demonstrates expression in cerebral cortex (whole), occipital lobe, frontal lobe, temporal lobe, and putamen. Expression is absent in the cerebellum, medulla, and spinal cord. (B) Probing with GAPDH demonstrates approximately equal loading of RNA.  4.5 Discussion  The present study represents the first genetic investigation of NR2E1 in humans with impulsive-aggressive behaviors, bipolar disorder, and schizophrenia. A strength of our mutation analyses is that we used a direct DNA sequencing approach, which is the most reliable, complete, and impartial means of mutation discovery (Goldman et al. 1996; Rapoport et al. 2005). In addition, our experiments were designed to identify mutations in key non-coding  113  regions (in addition to coding regions), in particular, evolutionary conserved sequences that are known to harbour functionally important and disease-causing variants (Drake et al. 2006). The identification of both rare (Liu et al. 2005) and common (Emison et al. 2005) regulatory variation using systematic mutation screening is especially important in studies of nonMendelian complex disorders such as the ones examined here. Our mutation screening analyses do not demonstrate that protein-coding mutations in NR2E1 contribute to behavioral and psychiatric disorders in the subjects examined here. However, one limitation of this study is low statistical power due to small sample size. In particular, although we studied 126 humans with brain-behaviour phenotypes resembling some aspects of Nr2e1 / mice, our study is represented by many small subgroups, each of which may - -  have varying genetic and/or non-genetic contributions. Consequently, future studies using larger and homogenous patient samples are necessary. In addition, future genetic studies should ideally control for confounding variables such as age, gender, education, socioeconomic status, substance abuse, medication, or other social factors that may seriously confound genetic studies of brain and behavioral disorders. Importantly, this study cannot exclude the possibility that deletions involving NR2E1 may underlie behavioural and psychiatric disorders in some patients. This is because a limitation of the DNA sequencing approach is its inability to detect large deletions. Thus, alternative experimental strategies, including quantitative PCR and comparative genomic hybridization, are warranted. Taken together, our preliminary results are inconclusive to rule out NR2E1 as a candidate for human behavioural and psychiatric disorders. We identified 11 candidate non-coding mutations, of which several are of particular note. Two of the 11 candidate mutations (g.14314-14319delACTCT and g.20826A>G) were identified  114  in two patients with schizophrenia belonging to a pedigree with evidence of linkage to 6q21-22. In two relatives with bipolar disorder, we identified g.11595T>C that is predicted to abolish the TFBS for Brn 2, a regulator of neural cell differentiation. We also detected two indel mutations -  not previously reported in public DNA databases. Notably, one of these (g.1431414319delACTCT) represents the largest NR2E1 deletion variant reported to date. This candidate mutation, which resides in intron 7, abolishes the TFBS for Crx, a regulator of photoreceptor differentiation. Also of interest is g.-555C>T, which we detected in two unrelated patients with impulsive-aggressive behaviors. The same candidate mutation has been observed in an individual with reduced cortical size (Section 3.4.1). Mutations that affect cortical patterning and cause gross malformations may also influence subtle cognitive and behavioral defects (Monuki and Walsh 2001); consequently, g.-555C>T, which has not been observed in 172 healthy humans (Sections 3.4.1 and 3.4.3) is an interesting candidate for brain-behaviour disorders. This is strengthened by the observation that g.-555C>T, the major nucleotide of which is conserved to  Fugu, is predicted to abolish a binding site for E2F, a known regulator of cortical patterning. It would be interesting to see whether brain imaging detects abnormalities in cortical structure or function in the two individuals bearing g.-555C>T , in light of the fact that abnormalities involving the forebrain have been reported in subjects with impulsive-aggressive behaviors (Brower and Price 2001; Laakso et al. 2001; Raine et al. 2004). Another variant of note is g.21762C>A, which we detected in a patient with DSM-IV intermittent explosive disorder (IED). This candidate mutation has also been detected previously in a patient with cortical abnormality but not in 139 healthy humans (Sections 3.4.1 and 3.4.3). Interestingly, IED likely involves an inability to control violent impulses that is thought to be due to cortical lesions  115  and/or dysfunction (Best et al. 2002; Coccaro 1998). Thus, it is interesting that two individuals with the same candidate mutation both present with a disorder that involves the cortex. There is evidence to support the hypothesis that the candidate mutations identified here may underlie a brain-behavioral phenotype. This is because mice heterozygous for Nr2e1 deletions show premature cortical neurogenesis early in development (Roy et al. 2004), which suggests dosage sensitivity for NR2E1 during early brain development. Ten of 11 candidate mutations identified here reside within regions that could conceivably influence gene dosage of NR2E1, including the proximal promoter and UTRs. Importantly, genetic studies of promoter and UTR regulatory SNPs in other genes have been shown to influence aggressive-violent behaviours and psychiatric disorders (Albanese et al. 2001; Arinami et al. 1997; Caspi et al. 2002; Okuyama et al. 1999). It is also possible that the patient-variants demonstrated not to be de novo may still underlie a phenotype. For instance, each patient with an NR2E1 variant may harbor a second variant at another genetically-interacting locus that is absent in the parent. In support of this, we note that mice that are double heterozygotes for mutations at Nr2e1 and Pax6 interact genetically to alter normal forebrain development (Stenman et al. 2003). Thus, a multigenic mechanism involving NR2E1 and additional loci, together with reduced penetrance, may underlie the phenotypes in some patients examined here. Despite the potential role of these variants in human disease, our results are preliminary. Further extensive characterization of these candidate mutations would help clarify their involvement in the pathogenesis of behavioral and psychiatric disorders. Our preliminary case-control association analyses of NR2E1 examined a single microsatellite marker and two SNPs that may be functionally important. Our data indicate that  116  these markers are not directly involved in bipolar disorder or schizophrenia. However, this does not rule out the possibility that other NR2E1 polymorphisms may influence these disorders because this association study may not have included enough polymorphisms to detect linkage disequilibrium across the whole gene. In support of this, our own analyses of LD (Section 3.4.6) together with data obtained from the International HapMap Project (release #20; http://www.hapmap.org/) indicate that the two SNP markers we genotyped tend to segregate together and reside within the same haplotype block. Therefore, the markers used in this study do not effectively capture the complete haplotype information for NR2E1. Consequently, this preliminary association analyses cannot conclusively exclude the role of common NR2E1 variants in bipolar disorder or schizophrenia. In light of these issues, future studies in our lab our examining additional markers, including haplotypes comprised of each, in these disorders (discussed further in Sections 5.1.7 and 5.1.8). The detection of NR2E1 in the normal adult forebrain is consistent with the forebrainspecific expression patterns observed in adult mice (Shi et al. 2004). We did not detect NR2E1 in cerebellum, medulla, and spinal cord, which is also consistent with the lack of hindbrain expression observed in mouse. Our results in humans are consistent with and expand those of others with one exception, which reported low levels of NR2E1 expression in the cerebellum, as assayed by reverse transcriptase PCR (Nishimura et al. 2004). Expression of NR2E1 in the frontal and temporal lobes support a role for this gene in human aggressive-violent behaviours and psychiatric disease. Furthermore, functional neuroimaging studies provide evidence to suggest that genetically-mediated metabolic disturbances of the frontal lobe may predispose to violence (Filley et al. 2001).  117  4.6 Conclusion Our analysis of the human NR2E1 gene provides some evidence that rare genetic variants within putative regulatory regions may contribute to human behavioural and psychiatric disorders. Our work contributes to a growing body of literature that suggests the involvement of genetic determinants in complex disorders of human brain and behavior. The candidate mutations identified here will facilitate future research into the molecular basis of human impulsive-aggressive behaviors, bipolar disorder, and schizophrenia.  118  Chapter 5: General Discussion The work presented in this thesis integrated mouse models and human molecular genetic studies to understand the role of NR2E1 in human brain-behaviour disorders. Here, I synthesize my major findings and propose experimental strategies to further understand the role of NR2E1 in human health and disease. Furthermore, I offer suggestions regarding future directions that the fields of psychiatric genetics and evolutionary genomics may take.  5.1 Clarifying the Nature and Origin of the Fierce Mutation Illuminates Future Studies of Human NR2E1 The serendipitous discovery of the fierce mutation during a gene-targeting experiment designed to delete the Zfa gene laid the groundwork for the experiments described in Chapter Two. Our reasons for elucidating the nature and origin of the fierce mutation were twofold. First, given the complex nature of the fierce phenotype (Young et al. 2002), which included a few features not reported in mice targeted for Nr2e1 (e.g. impaired regression of the hyaloid vascular system of the eye) (Monaghan et al. 1997; Yu et al. 2000), it was important to elucidate the precise molecular nature of the spontaneous mutation, and to assess whether other genes may have been affected during its disruption. Second, the unexplained origin of the fierce mutation represented an opportunity with which to explore the complex nature of events that may potentially complicate gene-targeting experiments in general. We demonstrated that the fierce mutation was a 44.4 kb deletion involving the entire Nr2e1 locus only, and that the neighbouring genes Snx3 and Lacel were unaffected transcriptionally. Testing the integrity of transcription of Snx3 and Lacel was of particular  119  importance, given that intergenic deletions may affect expression of neighbouring genes without necessarily affecting their nucleotide sequence (i.e., 'position effects') (Kleinjan and van Heyningen 1998). This is exemplified by at least one study that suggests that position effects involving SNX3 and neighbouring loci may underlie the microcephaly, microphthalmia, ectrodactyly, and prognathism (MMEP) phenotype (Vervoort et al. 2002). Although we did demonstrate transcription of the neighbouring genes Snx3 and Lacel, our tests were performed in adult tissues only. Consequently, we cannot rule out the possibility that the spontaneous deletion of Nr2e1 also removed a time- or tissue-specific enhancer of another gene that could be located a large distance away. Such a possibility is supported by at least one study demonstrateing that disruption of a Shh-enhancer sequence located over 1 Mb away from Shh results in limb defects (Lettice et al. 2003). It can also be argued that the fierce phenotype results from a mutation in another gene on the same chromosome, but more distant than those examined. Such a gene might be close enough to segregate with NR2E1, but outside the examined region. However, at least two groups have generated targeted Nr2e1 mice that display a phenotype essentially identical to  fierce mice, thereby strengthening our main conclusion in Chapter Two that the fierce phenotype is most likely attributable to the deletion of Nr2e1 and its neighbouring genes. We raise awareness of the possibility that the fierce mutation may have preexisted in the ES cell line that was intended to generate the targeted disruption of Zfa. Others have raised similar concerns with their genes of interest (i.e., unexpected ES cell mutations may lead to genotype-phenotype misattribution (Moulson et al. 2003) (Leslie P. Kozak and Beverly H. Koller, pers. comm.). We therefore published three recommendations for future gene targeting experiments (Section 2.6).  120  5.2 Independent Resequencing Studies in Humans Unselected for Disease Status are Important for Understanding Patterns of Normal Genetic Variation  5.2.1 Completeness and Representation of Public DNA Databases  DNA databases such as dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP/) are a rich source of information for studies of human genetic diversity. To assess the quality and completeness of DNA databases, Reich et al (2003) performed a large-scale independent resequencing study and demonstrated that nearly 54% of independently identified SNPs with minor allele frequencies greater than 10% were represented, which attests to the wealth of data available (Reich et al. 2003). But this study also indicates that nearly half of all independently identified SNPs were missing, which highlights the incompleteness of these resources. Along these lines, Freudenberg-Hua et al (2003, 2005) demonstrate that low-frequency, rare alleles are seriously underrepresented in the public databases (Freudenberg-Hua et al. 2003; FreudenbergHua et al. 2005), and Carlson et al. (2003) point out that allele frequency data are often underrepresented for non-Caucasian ethnic groups (Carlson et al. 2003). There may also exist a bias with respect to the nature of variation currently being reported (e.g., SNPs versus indels). Certainly, the completeness and representation of these databases will improve with time; however, it is nonetheless invaluable to independently ascertain the levels and patterns of genetic variation for one's gene(s) of interest through direct DNA re-sequencing, which represents the most reliable, complete, and impartial means of polymorphism and mutation discovery. Thus, resequencing of NR2EI across multiple ethnic groups and non-human primates represented both a goal and strength of my work.  121  Eighty-percent of the NR2E1 variants discovered in our study of unaffected and ethnically-diverse humans were novel. As a result, elucidation of this gene's normal nucleotide diversity, haplotype structure, LD patterns, and molecular evolution, which utilized a subset to all of the novel variants, established a unique NR2E1 resource that helped guide the patient studies reported in Chapters Three and Four. An understanding of the patterns of nucleotide variation also has important implications for understanding human evolutionary history and disease, including the demographic events and the impact of selection that may shape diversity at NR2E1 (Section 5.1.11). Importantly, the systematic characterization of NR2E1 will also help direct future investigations of this gene. This includes case-control association analyses, which in general may be confounded by factors such as unknown genomic architecture (e.g. distribution of polymorphisms, haplotypes, and LD) and evolutionary history (e.g. effects of Darwinian selection) of the candidate genes (Freedman et al. 2004; Jorm and Easteal 2000; Schulze and McMahon 2002; Stoltenberg and Burmeister 2000; Tishkoff and Verrelli 2003). The finding of weak LD at NR2E1, for example, alerted us to examine additional markers along the entire length of this locus in a case-control analysis in bipolar disorder and schizophrenia, which is currently underway.  5.2.2 Importance of Non-coding Evolutionary Conserved Sequences An important aspect of my studies is that they were designed to discover NR2E1 variants in six evolutionarily conserved non-coding sequences, which were defined and characterized in the Simpson laboratory (Abrahams et al. 2002). Such regions are likely to harbour functionally important and disease-causing variants (Drake et al. 2006). Four of these NR2E1 regions represent conserved elements (CE) between human and mouse and are located within the  122  proximal promoter of NR2E1 (CE-A), and the remaining two are conserved between human, mouse, and Fugu and are located within the first intron (CE-B). In total, we discovered 4 novel putative regulatory SNPs (rSNPs) that resided within these conserved elements, one of which resided within a CE-B. We hypothesize that all or a subset of these CE variants are important for NR2E1 regulation. This hypothesis recently received support by Stranger et al (2005) who demonstrated possible cis-acting effects of NR2E1 regulatory polymorphisms (Stranger et al. 2005). The role of each novel and putative cis-acting NR2E1 SNP identified here should be investigated with regard to effects on NR2E1 expression. This may be accomplished by using SNPs within the expressed sequence of NR2E1 (e.g., one of seven UTR SNPs that I characterized in healthy humans) as a marker tag that coincides with one of the candidate cisacting polymorphisms. If an individual is heterozygous for an NR2E1 UTR polymorphism and is also heterozygous for a candidate regulatory polymorphism at a putative cis-acting site, then each UTR marker allele can effectively serve as an internal control against which expression of the other allele can be measured quantitatively by one of several described methods of allele discrimination (Cowles et al. 2002; Singer-Sam et al. 1992; Yon et al. 2002) . Such a method would enable the detection of genuine cis-acting phenomena that may affect NR2E1 expression, while at the same time controlling for trans-acting confounders (given that allele discrimination is performed within the same individual) (Bray et al. 2003).  5.3 Screening for Mutations by Direct DNA Sequencing is a Powerful Approach for the Discovery of Disease Susceptibility Alleles  123  The work presented in this thesis is the first analyses of NR2E1 in a clinical group. For mutation analyses, we screened a total of 186 unrelated humans with brain-behaviour disorders and generated a total of approximately 1.2 Mb of re-sequenced NR2E1 data. Thirty-two percent of these subjects represent patients with severe cortical malformations, and the remaining 68% are patients with behavioural and psychiatric disorders, including impulsive-aggressive behaviours, bipolar disorder, and schizophrenia. In total, we identified 25 novel variants that were specific to subjects with brainbehaviour disorders. Each of these variants was absent from approximately 94 appropriatelymatched controls. In addition, we did not detect these variants in 94 ethnically-diverse unaffected humans. Finally, each of the 25 variants was absent from dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP/; Build 124). Thus, all patient-variants defined as being novel were absent in approximately 376 control alleles. Further investigation in a larger number of control chromosomes to distinguish between rare polymorphisms and pathogenic alteration is required. Our hypothesis that the rare variants identified here may influence susceptibility to common and complex disorders is supported by other studies that suggest the involvement of rare variants in complex disease. For example, in a recent study that examined six candidate genes for osteoporosis (a common late-onset bone disorder), rare haplotypes of parathyroid hormone related peptide receptor type 1 (PTHR1) and vitamin D receptor (VDR) were found to be significantly associated with bone mineral density, a surrogate phenotype for osteoporosis (Liu et al. 2005). In addition, rare variants in potassium chloride co-transporter 3 (SLC12A6)  124  (Meyer et al. 2005) and synaptojanin 1 (SYNJ1) have been suggested to underlie bipolar disorder in some patients. The identification of rare, non-coding and putative regulatory NR2E1 variants serves as a foundation for future genetic investigations of this gene in patients with brain-behaviour disorders. However, an alternative interpretation of these findings is that the "candidate mutations" simply represent rare variants in the general human population that do not at all influence disease processes. More broadly, it is possible that no variation at this locus is responsible for human disorders. Nonetheless, future directions building on this work could test for association of the rare putative regulatory variants in a large number of cases and controls. Alternative strategies to understand the role of NR2E1 are discussed in Section 5.1.5. Finally, alternative experiments to screen for deletions in the same set of samples examined here could include comparative genomic hybridization (CGH), BAC arrays, and quantitative-PCR.  5.4 Computational Transcription Factor Binding Site (TFBS) Analyses As an initial step in understanding the potential regulatory role of each of the rare, noncoding variants described above, I was interested in assessing the putative functional impact of these variants using in silico approaches, bearing in mind that such strategies can only infer the binding potential for transcription factors but not the functionality of the site, which would require experimentation using in vitro and/or or in vivo approaches (discussed in Section 5.1.5). Moreover, computational programs can only predict known TFBS; consequently, such programs will overlook as of yet undiscovered TFBS. Thus, in silico strategies to detect TFBS are accompanied by these key limitations. Nonetheless, the use of computational strategies to  125  identify and characterize TFBS represents an important primary tool for biologists. Towards this end, the development of computational algorithms designed to identify TFBS has become an integral goal of human genetic research. To detect and predict alterations in putative TFBS, I used the program MatInspector, which offers several advantages over other prediction programs. First, MatInspector currently represents the largest library available for public searches of TFBS that are based largely on experimentally verified binding sites. Second, as with several other prediction programs, the algorithms used by MatInspector are based on position weight matrices (PWM) that are superior to simple IUPAC consensus sequences; however, unlike most other applications, the PWM algorithms used my MatInspector have been refined to include 'families' of matrices (i.e. the assignment of an individual matrix for a TFBS to a family consisting of matrices that represent similar DNA patterns) as well as 'optimized matrix thresholds' (versus 'fixed thresholds') that are more biologically meaningful. Together, the use of PWM families and optimized thresholds can effectively reduce the number of false positives, and increase the sensitivity and specificity of TFBS prediction as compared to most other programs of its kind. Several recent works highlight the application of MatInspector to identify and characterize putative TFBS. Sinnett et al (2006) analyzed the proximal promoter region of 197 genes by screening for the presence of SNPs in 40 individuals of diverse ethnic backgrounds (Sinnett et al. 2006). They detected 1,838 SNPs of which 75% were predicted to have a functional impact for known transcription factors by abolishing or creating putative binding sites. The in silico identification of these predicted binding sites are the basis of subsequent in vitro studies evaluating the functional impact of each SNP, which is currently underway (Sinnett et al.  126  2006). Theuns et al. (2006) examine the promoter sequence of the amyloid precursor-protein APP, which has been implicated in Alzheimer Disease (AD), by screening for the presence of  SNPs in 291 patients with AD. They detected eight novel sequences and demonstrated, using luciferase reporter and transient transfection assays, that three novel variants showed nearly twofold neuron-specific increases in APP transcription. They used Matlnspector to assess the putative functional impact of these variants, which indicated that the mutations abolished a binding site for AP-2 and HES-1, and created a binding site for Oct 1 . Theuns et al indicate that future studies are required to specifically examine the role of these altered TFBS in AD (Theuns et al. 2006). Fourteen of 25 (56%) novel NR2E1 variants identified in my study are predicted to alter (i.e., abolish or create) binding of neural transcription factors. Of these, four reside in the proximal promoter, one in the 5' UTR, two in intron 1, and the remaining seven reside beyond intron 2 (including 2 that reside in the 3' UTR). The criteria I used for deciding whether a TFBS was lost or gained were based on a 'subtraction approach': I compared all TFBS predicted to occur along a 51 by 'mutant' NR2E1 sequence (i.e. ± 25 by on either side of the candidate mutation) to all TFBS predicted to occur along a 51 by `wildtype' NR2E1 sequence (i.e. ± 25 by on either side of the corresponding wildtype nucleotide). Thus, the only difference between the two input sequences was a single base corresponding to the novel candidate mutation. Consequently, any difference(s) in TFBS prediction would be attributable solely to the candidate mutation. As an additional criterion, I focused only on proteins that were expressed in cells and tissues of the CNS, under the assumption that proteins not expressed in the CNS would be less relevant to my study of the predominately CNS-specific NR2E1 in patients with brain-behaviour  127  disorders. The criterion used to determine whether a given sequence would be recognized by a binding factor was based on the PWM and optimization thresholds briefly discussed above (but more thoroughly outlined in the MatInspector program (Cartharius et al. 2005; Quandt et al. 1995)). Transcription factors typically bind to short degenerate sequence motifs in the range of 6-12 by in length; consequently, such sequences can occur frequently in a genome and many of these may not be of any biological importance. Therefore, computational strategies are likely to identify many TFBS that are biologically irrelevant. MatInspector is designed to reduce the number of false positive TFBS matches by refining the PWM algorithms To further increase the likelihood of identifying real TFBS, I examined blocks of evolutionary conserved non-coding regions in the promoter and first intron of NR2E1 (Section 5.1.2), which represents a strength to my approach. Two of the 14 TFBS alterations (due to variants g. —1726C>A, which abolishes an SP1 site, and g.-1220-1221insT, which creates an E2F site) occur within regions of the NR2E1 proximal promoter initially examined due to their high conservation between human and mouse (i.e., minimum of 70% identify across at least 100 ungapped bp). For one of these sites (g.1726C>A), the human consensus allele C was conserved between humans, non-human primates, mouse, and Fugu, suggesting strong functional constraint. We note that for all 14 TFBS alterations, the major allele was conserved among all great apes, and in 11 of these instances, the major allele was conserved to macaque. Although this could suggest evolutionary constraint, an alternative interpretation of this data is that enough time has not elapsed for changes to accumulate. This is supported by Yi et al (2002) who demonstrate that the substitution rates among primates are exceedingly low (1.19 x 10 -9 substitutions per site per year between human  128  and chimpanzee and 1.5 x 10 -9 substitutions per site per year between human) (Yi et al. 2002). Thus, sites conserved between humans and non-human primates in our study of NR2E1 may simply reflect the fact that not enough time has elapsed for the TFBS to accumulate changes, which would therefore not indicate purifying selection. Five of the candidate mutations that were predicted to alter TFBS reside in introns beyond intron 2 (one in intron 3, one in intron 5, and three in intron 7). Although almost all annotated TFBS occur within 2 kb of a promoter (Hannenhalli and Levy 2002), this is widely viewed as a reflection of where people look for TFBS rather than an indication that most TFBS are found within the proximal promoter. Others have shown that TFBS mutations that are located within the body of a gene may contribute to disease, which supports the hypothesis that the five intronic NR2E1 variants may represent putative TFBS with implications in disease. Vasiliev et al. (1999) showed that a point mutation located centrally within intron 6 of the TDO2 gene, which has been implicated in Tourette syndrome and attention deficit hyperactivity disorder, disrupts a binding site for the YY-1 transcription factor, as determined using an electrophoretic mobility shift assay (EMSA) (Vasiliev et al. 1999). Prokunina et al. (2002) demonstrated that the minor allele of a SNP in intron 4 of PDCD1, associated with human systemic lupus erythematosus, disrupts binding of the transcription factor RUNX1, as determined by EMSA (Prokunina et al. 2002). Future in vitro studies of TFBS detection using genome-level approaches such as ChIP-Chip experiments may provide a better indication of the global distribution of TFBS.  5.5 Testing the Role of NR2E1 Candidate Mutations in Human Disease  129  The computational strategy I used for predicting alterations in TFBS should be followed up with in vitro studies. Several approaches are routinely used in the laboratory to demonstrate whether alterations in TFBS may affect transcription factor binding. These include electromobility shift assays as well as luciferase-based reporter assays. A promising in vivo strategy to assess the role of the candidate NR2E1 regulatory mutations is to use the 'fierce rescue paradigm'. Abrahams et al (2005) demonstrated that wild type genomic NR2E1 (including its endogenous promoter) is successfully able to correct the brain and behavioural abnormalities in Nr2e1 / mice (Abrahams et al. 2005). To test the role of a - -  candidate mutation, one could therefore generate transgenic mice that contain the candidate mutation, and then test for the rescue of the 'fierce' phenotype. The inability to rescue the fierce phenotype would support the proposal that the mutation is responsible for brain-behavioural abnormalities. Thus, the 'humanization' of mice using slightly modified NR2E1 sequence represents an in vivo approach to assessing the role of candidate NR2E1 mutations in human disease.  5.6 Examination of the Role of NR2E1 in Eye Disorders Patients presenting with eye abnormalities that resemble those of Nr2e1 l mice (reviewed -  in section 1.4.3.2) represent an excellent study population for future genetic investigations of NR2E1, which is supported by several lines of evidence. First, mutations in mouse and human NR2E3, the gene most closely related to NR2E1, cause enhanced S-cone syndrome and related phenotypes Zhang et al (2006) has recently demonstrated that enhanced S-cone syndrome also manifests in Nr2e1"/" mice, which show reduced levels of Nr2e3 (Zhang et al. 2006). Second, the Simpson laboratory has ameliorated multiple aspects of the abnormal eye phenotype in Nr2e1"/"  130  mice, including radial asymmetry and mottling and, to some extent, vessel number, using a human genomic clone of NR2E1, and therefore demonstrated functional protein and regulatory equivalency between these orthologs in a mouse (Abrahams et al. 2005). Third, overexpression of mouse Nr2e1 results in eye abnormalities that mimic those of autosomal dominant human aniridia, which is caused by mutations in PAX6 (Glaser et al. 1992). In mice, double heterozygotes for mutations at Nr2e1 and Pax6 interact indirectly to alter normal forebrain development (Stenman et al. 2003); therefore, it is conceivable that NR2E1 and PAX6 may also cooperate in the eye to regulate its development. Interestingly, overexpression of human PAX6 in wildtype mice leads to eye abnormalities (Schedl et al. 1996). Nr2e1 is also known to directly interact with Pax2, which regulates Pax6 (Yu et al. 2000). In this respect, NR2E1 and PAX6 pathways may converge indirectly through PAX2. Importantly, human PAX2 mutations are associated with eye abnormalities (Higashide et al. 2005; Schimmenti et al. 2003), providing further support for a role of NR2E1 in human eye disorders. I propose that several patient groups would represent suitable candidates for future genetic studies of NR2E1. First, I hypothesize that humans with enhanced S-cone who do not harbour mutation in NR2E3 may instead harbour mutations in NR2E1. Importantly, 6% of the patients with enhanced S-cone syndrome studied by Haider et al (1999) did not harbour NR2E3 mutations. Second, patients who present with autosomal dominant aniridia but who do not harbour mutations in PAX6 may instead harbour mutations in NR2E1. Towards this end, we have initiated a collaboration with Dr. Michael Walter of the University of Alberta, who has recently provided us with DNA samples from patients diagnosed with aniridia but without known mutations in PAX6. Third, I hypothesize that patients with Gillespie Syndrome (partial aniridia,  131  mental retardation, and cerebellar ataxia) would also represent suitable subjects for study, given that PAX6 mutations have not been associated with any patients with this disorder. It could be speculated that patients with Gillespie Syndrome may harbour mutations at several loci, and that NR2E1 mutations may contribute to aniridia in these patients. Even though NR2E1 transcription is strongest in the forebrain, low levels have been detected in the human cerebellum (Nishimura et al. 2004). Thus, it is conceivable that NR2E1 mutations may underlie aniridia and cerebellar ataxia in Gillespie Syndrome. Finally, I hypothesize that Aicardi Syndrome, a rare genetic disorder of cerebro-ocular development, would also be worthwhile to investigate for mutations in NR2E1. Aicardi Syndrome shares several features with Nr2e1 / mice, including persistent fetal - -  retinal vasculature, agenesis of the corpus callosum, and optic nerve hypoplasia (Carney et al. 1993; Del Pero et al. 1986; Ganesh et al. 2000; Rosser 2003). There have been no mutations described for Aicardi syndrome; although, Xp22 has been implicated in this disorder (Ropers et al. 1982).  5.7 Testing the Role of Common NR2E1 Polymorphisms in Human Disease The common-disease common-variant (CDCV) hypothesis predicts that high frequency molecular variants in the human population may significantly contribute to the genetic risk of highly prevalent and complex disease (Collins et al. 1997). A recent report describing the role of the receptor tyrosine kinase RET gene in Hirschsprung disease (HSCR), which has been known to associate with mental retardation and microcephaly (Murphy et al. 2006; Tanteles et al. 2006), exemplifies the importance of common variants within conserved, non-coding regions in disease etiology (Emison et al. 2005). HSCR is a multifactorial, non-Mendelian disorder that is influenced by rare high-penetrance coding region RET mutations in concert with mutations in  132  other genes (Bolk et al. 2000). A high-frequency HSCR-associated RET haplotype (also present in the general population) was recently identified that lacked coding-sequence mutations (Carrasquillo et al. 2002), which suggested that either non-coding mutations at RET or mutations in a second gene linked to RET may underlie HSCR in some individuals. It was demonstrated that a single, common (MAF 1% to 45% in Africans and Asians, respectively), low penetrance, non-coding SNP residing in a conserved enhancer-like sequence in the first intron of RET makes a 20-fold greater contribution to HSCR risk than do rare alleles of this gene. This example underscores the importance of single common non-coding alleles in complex disease and lends support to the proposal that similar disease-susceptibility mechanisms could operate at other loci such as NR2E1. In collaboration with Drs. Blackwood and Muir of the University of Edinburgh, Scotland, we tested the CDCV hypothesis by performing an NR2E1 case-control association analyses in approximately 400 individuals with bipolar disorder, 400 with schizophrenia, and 400 appropriately-matched controls. We selected common variants (i.e. minor allele frequencies _^ 5%) that are of putative functional importance, including one SNP located in a human-mouse conserved region in the proximal promoter, one SNP in the 5' UTR, and a microsatellite marker in the 3' UTR. Our analyses did not detect any significant associations with these markers; however, this does not rule out the possibility that other markers at NR2E1 may be involved in bipolar disorder or schizophrenia (Section 5.1.1). An alternative explanation is that markers may be involved in other clinical groups. Future association studies should examine the role of specific allele combinations (i.e. NR2E1 haplotypes) using markers characterized in this study. Haplotype-based association analyses have been successfully used in psychiatric genetics. For  133  example, a haplotype containing two non-coding SNPs in the COMT gene (one SNP in intron 1 and another near the 3' UTR) is significantly associated with schizophrenia (Shifman et al. 2002). Importantly, this haplotype has subsequently been shown to associate with reduced COMT expression in the human brain (Bray et al. 2003), providing further support for the role of this genetic marker.  5.8 Testing Multiple Loci may Accelerate the Search for Susceptibility Alleles There have been numerous studies that have shown linkage and association to Chromosome 6q in bipolar disorder and schizophrenia; however, many of these findings have not been replicated. Kohn and Lerer suggest that there are at least five 'foci' along the long arm of Chromosome 6 (centered at 96Mb, 105Mb, 126Mb, 136Mb, and 162Mb) that may harbour a disease-susceptibility allele(s) for bipolar disorder, schizophrenia, and other neuropsychiatric disorders (Kohn and Lerer 2005). In this respect, future association studies examining the role of NR2E1 may consider using a combination of SNPs from several foci along the long arm of Chromosome 6. Evidence for strain-dependent effects on the brain-behaviour phenotype in Nr2e1 / mice indicate the role of modifier genes (Young et al. 2002), which support multigenic - -  mechanisms of disease etiology for NR2E1 in humans. A multigenic approach is a strategy that should become mainstream in psychiatric genetics, given its potential to detect genetic epistatic effects, which are likely to operate for many complex disorders. For instance, in a genome-wide scan for alcoholism susceptibility genes, the use of multiple SNPs was able to explain all of the linkage evidence in the two linkage regions examined, which was not the case using single SNPs (Chen et al. 2005). The importance of testing multiple loci is also important in light of the fact  134  that the 'linkage peak' may represent a very large region (sometimes on the order of millions of base pairs). Large regions may contain hundreds of genes that may be good positional candidates for disease susceptibility. Testing multiple genes (and many thousands of markers) using standard association analyses will be labour-intensive. Fortunately, recent technical developments make large-scale genotyping of genetic variants feasible. Of particular interest is the introduction of microarraybased technologies, which have the capability of genotyping many hundreds to thousands of variants within a single experiment and can therefore rapidly screen large numbers of affected individuals at once. Towards this end, members of the Simpson laboratory are currently designing a microarray-based system using markers that reside along the long arm of Chromosome 6. Importantly, the majority of NR2E1 variants detected in my study (of which more than 80% were novel at the time of this writing) will be incorporated into this project.  5.9 The Importance of Endophenotypes In Complex Disease The study of `endophenotypes' will improve genetic investigations of complex disorders. An endophenotye represents an elementary phenotype that may better link a proximal genetic defect to the distal disease itself (Gottesman and Gould 2003; Gottesman and Shields 1973). For instance, endophenotypes of bipolar disorder and schizophrenia may involve brain function (e.g. cognitive impairment, attention deficit, verbal learning and memory deficits) and brain structure (e.g., anterior cingulated volume reduction, early-onset white matter abnormalities) (Hasler et al. 2006; Tamminga and Holcomb 2005). Since it has been shown that relatives unaffected for the clinical phenotype (e.g., schizophrenia) can present with an endophenotype (e.g., cognitive impairment) (Cannon et al. 1998; MacDonald et al. 2003; Park et al. 1995; Staal et al. 2000)  135  (Fanous et al. 2001), the inclusion of clinically 'unaffected' relatives (i.e., presumed gene carriers) may increase the power of genetic studies by providing a stronger genetic signal to detect genetic risk factors (Gottesman and Gould 2003). Future case-control association analyses of NR2E1 should examine endophenotypes. Our finding of no association between NR2E1 markers and bipolar disorder or schizophrenia could be because NR2E1 is a modifier, rather than a susceptibility, gene for these disorders. That is, rather than altering the liability to bipolar disorder or schizophrenia itself, NR2E1 may influence clinical features associated with these disorders instead. In support of this, a significant linkage peak over the NR2E1 locus is seen only with psychotic bipolar disorder (accompanied by psychosis) but not when nonpsychotic bipolar disorder (absence of psychoses) was included in the analyses (Park et al. 2005; Park et al. 2004). Thus, it could be argued that genetic variation at NR2E1 may modify susceptibility to psychoses rather than to bipolar disorder itself. For studies in schizophrenia, the utility of endophenotypes is exemplified by associations detected only between polymorphisms and an endophenotype rather than to the diagnosis of schizophrenia itself. These include associations between DRD4 and catatonia (Kaiser et al. 2000) and delusions (Serretti et al. 2001), CCK and positive symptoms (Zhang et al. 2000), and 5 HT promoter and -  auditory hallucinations (Malhotra et al. 1998). On the whole, association studies using endophenotypes are scarce, but I expect that these types of studies will be more widely used as our definitions and understanding of endophenotypes become clearer.  5.10 Gene-Environment Interaction Studies Are Important in Complex Disease  136  The role of environment is important to consider in the study of complex disorders. This is because no twin or adoption study demonstrates 100% heritability, providing strong support for non-genetic as well as genetic factors. The importance of environment on mouse aggression supports this as well (Nyberg et al. 2004). In humans, the importance of gene-environment interactions (G x E) has been exemplified by Caspi et al (2002) who demonstrate that the 'lowactivity' functional polymorphism in the promoter of the MAOA gene confers greater susceptibility to the development of antisocial behaviours in children who suffer from maltreatment (an environmental variable), compared to maltreated children harbouring the 'highactivity' variant of the same gene (Caspi et al. 2002). G x E studies must become widely adopted in the fields of behaviour and psychiatric genetics if we are to better understand the underpinnings of some complex traits. The choice of what variable to examine (i.e., what specific gene(s), what specific environmental factor(s)) must be well supported by solid biological evidence that gives rise to a testable hypothesis. In the study by Caspi et al (2002), for instance, the well-recognized relationship between childhood abuse and stress levels was the impetus behind formulating a hypothesis that links genetic variation in a brain-metabolizing enzyme in childhood to abnormal social behaviours during adulthood. The inclusion of environmental factors in psychiatric genetic research holds great promise and should be widely adopted.  5.11 Genes Underlying Cortical Malformations May Underlie Psychiatric Disorders Genes that cause severe human cortical malformations may play a role in psychiatric disorders as well. For instance, variations in the LIS] gene, which is mutated in humans with  137  lissencephaly (a severe cortical disorder of neuronal migration) (Kato and Dobyns 2003), may underlie cognitive deficits in schizophrenia and bipolar disorder (Tabares-Seisdedos et al. 2006). In addition, Lipska et al. (2006) have recently demonstrated reduced LIS1 expression in patients with schizophrenia (Lipska et al. 2006). That Lisl may interact with Reelin, which itself has been implicated in cortical malformations as well as bipolar disorder and schizophrenia (Fatemi et al. 2001), exemplifies the link between corticogenesis and psychiatric disease. Additional support is provided by the NUDEL protein that has been implicated in lissencephaly through its interaction with Lisl (Toyo-Oka et al. 2005)and has also been implicated in schizophrenia through its interaction with DISCI (Brandon et al. 2004). Of the four causative genes identified for microcephaly (Bond et al. 2002; Bond et al. 2005; Jackson et al. 2002), none has been examined for its role in psychiatric disorders. However, there is some evidence that may support a link between microcephaly genes and psychiatric disease. Kunugi et at (1996, 2001) showed that preschizophrenics had smaller birth head circumference than nonschizophrenic control subjects (Kunugi et al. 2001; Kunugi et al. 1996), although others have not found such an association (Ichiki et al. 2000). The finding of smaller head circumference in schizophrenia compared to non-schizophrenia was also demonstrated in elderly patients (Jones and Lewis 1991). These studies therefore may suggest that genes that influence cortical development may also influence susceptibility to schizophrenia and other psychiatric disorders. Genes that regulate cortical size may also influence psychiatric disorders without necessarily causing microcephaly. I propose that non-coding regulatory mutations in microcephaly genes could influence behavioural and psychiatric disorders. Future work should  138  investigate the role of each of the four known microcephaly genes in psychiatric disorders. This should include systematic mutation screening across exonic and evolutionary conserved noncoding regions in schizophrenia patient groups. Given that primary microcephaly is often inherited in an autosomal-recessive manner and that the majority of mutations reside in coding regions, I anticipate that some patients with schizophrenia (and normal head circumference) may harbour non-coding, heterozygous regulatory mutations.  5.12 Genetic Diversity Studies and Comparative Primate Genomics Represent Promising Tools for Understanding Human Evolutionary History and Disease The data presented in Chapter Three has led to the provisional conclusion that evolutionary forces such as positive selection have shaped the genetic variation at NR2E1; however our data are also consistent with alternative explanations that involve background selection as well as demographic factors such as population expansion, which I discuss at greater length in this section.  5.12.1 Patterns of Nucleotide Diversity in Ethnically-Diverse Humans Our NR2E1 data indicate that Africans exhibit greater nucleotide diversity than do nonAfricans, which is consistent with the patterns of diversity found at other loci (reviewed in (Przeworski et al. 2000)). This increased diversity is due primarily to an increased number of unique rare variants in the African population. Our work also shows that NR2E1 haplotypes found outside of Africa are mostly a subset of those found within Africa. The reduced number of unique rare variants in non-African populations together with the observation that non-African  139  NR2E1 haplotypes are primarily a subset of African NR2E1 haplotypes lend support to the 'Out of Africa' hypothesis of the origin of modern humans, which states that a subset of Africans migrated out of Africa and populated the Old World (i.e. Asia, Europe, Oceania) (Stringer and Andrews 1988). It is interesting that the two variants found to be in strongest LD (i.e., 2 and 7) had a unique population distribution pattern that was restricted to the Americas, Asia, Northern Europe, and Oceania. One interpretation for this is that migration and/or admixture may underlie the significantly strong LD between these variants. Variants that are shared across multiple human populations are likely to predate the African exodus. These variants may be interpreted as being more ancestral to those that are unique and found in a single population, which may be of more recent origin. In this regard, variants 2, 7, 8, 10, 14, 15, 17, 21, and 24, which are shared across at least two populations, are likely to be older than the other variants. The majority of chromosomes surveyed across populations had most of their NR2E1 haplotypes in common, which is consistent with other reports (Bonnen et al. 2002) (Schneider et al. 2003). The pronounced regional differences in allele frequencies at some loci (e.g. high FST values reported for SNPs 8 and 21) generated haplotype distributions that varied markedly across some populations. Of particular note are the two most frequent haplotypes, H1 and H2, which differ by two substitutions and together account for 70% of the total chromosomes sampled. The frequency of H1 in the African population was less than in the non-African populations, whereas the frequency of H2 in Africa was markedly higher than in non-African populations. These differences were due to marked differences in allele frequencies in variants 8 and 21 in the  140  African versus non-African populations. This suggests that factors other than demographic history, such as natural selection (a locus-specific force), may underlie at least some of the patterns of genetic variation at NR2E1.  5.12.2 Evaluating Signatures of Selection at NR2E1 Several molecular evolutionary tests are available to assess signatures of Darwinian selection. The choice of test depends in part on the nature of the sequence data being examined (e.g. coding versus noncoding). Given the almost complete lack of coding variation in human and non-human primate NR2E1 (i.e., only 2 synonymous changes detected among all primates examined), I could not use tests that are based on non-synonymous and synonymous coding changes, including the widely-used Ka/K, (Hurst 2002) and McDonald-Kreitman tests (McDonald and Kreitman 1991). Therefore, to examine whether signatures of selection may exist at NR2E1, I applied a series of classical tests amenable to non-coding data. I calculated several summary statistics that are frequently used to test departures from neutrality, including Tajima's D, Fu and Li's D * and F* , and Fay and Wu's H (defined in Section 3.4.3). The direction of these statistics allows us to make inferences about the types of forces (i.e., demographic versus evolutionary) that may underlie the observed patterns of nucleotide variation at a locus. In particular, significantly negative D values signifying an excess of low frequency alleles are consistent with positive selection (i.e., genetic hitchhiking, in which neutral variants are driven to high frequency in a population due to their linkage with a positively selected variant that results in a 'selective sweep'), negative selection (i.e., background selection, in which neutral variants are removed from the population due to recurrent action of purifying selection at tightly linked sites), or population expansion. On the other hand, significantly  141  positive values signifying an excess of alleles at intermediate frequencies is consistent with balancing selection (e.g. heterozygote advantage) or population bottlenecks. We observed negative values for Tajima's D, Fu and Li's D * , and Fu and Li's H; however, only Fu and Li's D * and H* were statistically significant. The statistically negative Fu and Li's D * and H* values, as discussed above, are consistent with positive selection, negative selection, or population expansion. That Fu and Li's D * and H* are relatively more sensitive to background selection than to positive selection (Fu 1997) indicates that negative selection may be the primary evolutionary force acting on NR2E1. This interpretation is consistent with our finding of strong evolutionary constraint (i.e., purifying selection) in the coding region of  NR2E1. Our finding of non-significant values for Fay and Wu H, which is more sensitive to recent positive selection (Fay and Wu 2000), is further support that positive selection may not be the predominant force. Our significant negative values for Fu and Li's D * and H* is also consistent with population expansion because low frequency variants in a population would be preserved in an expanding population (Harpending et al. 1998). Evidence for a recent expansion of the human population was provided by Stephens et al (2001) who found that 281 of the 313 genes, which included NR2E1, had negative values for Tajima's D. Sampling a larger number of loci for evidence of non-neutral evolution using the same ethnically-diverse subjects studied here may help distinguish between demography and selection in our data set. Interpreting a test's departure from the neutral expectations of molecular evolution is challenging in light of the fact that statistical signatures of selection and demographic events can be similar using the family of tests applied here. The D, D * , F* , and H statistics do not provide  142  unambiguous evidence of natural selection. Importantly, the D, D * , F* , and H statistics rely on simplifying assumptions about the demographic histories of the populations in which the samples were ascertained (e.g., constant population size). In addition, these statistics assume the absence of recombination. That the patterns of nucleotide diversity and LD structure at NR2E1 suggest population expansion and presence of recombination, respectively, indicate that these assumptions may have been violated, which can lead to false support for selection. A powerful way to help distinguish between demographic forces and positive selection is to analyze coding sequence data and applying tests of neutrality that do not make assumptions about demographic history, such as the the KIK, (Hurst 2002) and McDonald-Kreitman tests (McDonald and Kreitman 1991); however, I was unable to apply any of these tests due to the paucity of coding variants. Our analyses of FsT may indicate spatial heterogeneity in selection acting on variants 8 and 21. Dramatic allele frequency changes at these variant sites among different ethnic groups suggests local adaptation (Hamblin and Di Rienzo 2000). Variants 8 and 21 reside in the 5' UTR and in a CpG island in intron 2, respectively, which represent functionally relevant regions of  NR2E1 (Osada et al. 2005). However, it is noted that FsT values can vary widely among sites, which reflects the high variance of the coalescent process even for neutral alleles. Therefore, our analyses of FsT does not provide strong evidence of spatial heterogeneous selection, although these dramatic frequency changes on an otherwise highly conserved loci are noteworthy.  5.12.3 Role of NR2E1 in Human Cortical Expansion  143  I proposed that NR2E1 is an appropriate molecular candidate for understanding the genetic basis of human brain evolution, in particular, the dramatic enlargement of the cerebral cortex in the lineage leading to Homo sapiens. This is in light of the suggestion that the expansion of the human cortex is due to genes expressed at sites of cerebral cortical neurogenesis that control the proliferation of neuronal stem cells (Rakic 1995). Recent support for this proposal is provided by molecular evolutionary studies of ASPM and Microcephalin, mutations in which cause human microcephaly (Bond et al. 2002; Jackson et al. 2002). Interestingly, the reduced brain size of individuals with microcephaly is comparable to that of great apes and early hominoids (Wood and Collard 1999), which supports the proposal that genes involved in cortical development may conceivably contribute to cortical expansion during human evolution. Indeed, both APSM and Microcephalin show robust signatures of adaptive evolution in the evolutionary lineage leading to humans (Evans et al. 2004; Evans et al. 2004). Intriguingly, recent evidence suggests that both ASPM and Microcephalin continue to evolve adaptively in modern day humans (Evans et al. 2005; Mekel-Bobrov et al. 2005). Human-specific variants (i.e., nucleotides that are fixed in humans and absent from all other species) have been hypothesized to underlie the evolution of human-specific traits, including larger brains, enhanced cognitive abilities, and complex social behaviors (Andres et al. 2004; Kitano et al. 2004; Nahon 2003; Shi et al. 2003) . Conceivably, the putative regulatory and coding human-specific NR2E1 variants identified here (Table 3.7) may have been driven to fixation by positive selection during human evolution, and may contribute to human-specific phenotypes. Stone and Wray (2001) support such a proposal by suggesting that changes in the expression patterns of transcription factors by cis-regulatory variation due to single base pair  144  changes may influence phenotypic evolution (Stone and Wray 2001). In addition, King and Wilson (1975) assert that changes in gene regulation are likely to underlie the evolution of human-specific phenotypes (King and Wilson 1975). It is intriguing to speculate about the mechanisms by which NR2E1 regulatory humanspecific variants may underlie the expansion of the cerebral cortex. Given that the increased number of cells in the human cortex is likely to reflect evolutionary modifications that control cell-cycle kinetics (Rakic 1995), human-specific NR2E1 variants may increase cell production by allowing for an increase in the number of founder progenitor cells. That Nr2e1 influences the decision of neural precursors to proliferate or differentiate is consistent with such a proposal (Roy et al. 2004; Shi et al. 2004). Elucidating the effects of the human-specific NR2E1 variants on the decision for neural stem cells to proliferate or differentiate would be important. On a broader scale, future studies may consider taking a genomics approach for the discovery and characterization of human-specific variants in genes that are candidates for human disorders of brain and behaviour. Despite the recognized importance of human-specific variants Kitano, 2004 #858; Nahon, 2003 #506; Shi, 2003 #859; Andres, 2004 #894}, there have been no large-scale studies of this sort.  5.12.4 Evolutionary Genomics to Identify Positively Selected Genes The large-scale identification of loci that show evidence of positive selection would be an important goal of human and medical genetics. This is because genes that show signatures of positive selection in the human lineage are likely to underlie human-specific phenotypes, such as those discussed above. Consequently, mutations in such genes may to give rise to human-related disorders that include psychiatric disease and mental retardation. At least several studies to date  145  demonstrate positive selection in genes known to underlie psychiatric and behavioural phenotypes, including attention deficit hyperactivity disorder (ADHD) and novelty-seeking (Ding et al. 2002; Seaman et al. 2000), aggression and impulsivity (Gilad et al. 2002), speech and language disorders (Enard et al. 2002; Zhang et al. 2002), and microcephaly (Evans et al. 2004; Wang and Su 2004). Importantly, detecting the signatures of positive selection might help narrow down the candidate region as well as candidate alleles that may contribute to disease susceptibility (Przeworski et al. 2000). To date, there have been no systematic, genome-wide examinations of positive selection in genes and/or alleles hypothesized to underlie psychiatric disorders such as schizophrenia and bipolar disorder. I propose that large-scale investigations will be important in identifying disease-susceptibility variants for complex disease. Importantly, evidence of selection may also identify genes and alleles that underlie disease resistance. The identification of protective genetic factors is generally understudied in human and medical genetics, but particularly in behaviour and psychiatric genetics, where the focus currently seems to be on genetic risk factors of disease. Primate comparative and evolutionary genomics are promising tool for the biologist because they can help to prioritize the large list of theoretical genetic candidates for human (brain-behaviour) disease. However, genome-wide studies are likely to falsely identify genes with evidence of selection, and this could easily be followed by the development of ad hoc explanations regarding the role of selection in candidate genes. Formulating a priori hypotheses about the role of natural selection at a locus may provide a safeguard against misinterpretation of results, but such hypotheses require some knowledge on the biological functions of the genes of interest. In my study, the well-characterized role and function of NR2E1 allowed for the  146  formulation of a reasonable hypothesis. However, even if a gene with a strong a priori hypothesis shows evidence of selection, extensive experimental work is required to elucidate its relationship to human health and disease. Finally, evidence for selection can be challenged by other alternative explanations, such as demographic and evolutionary factors. Therefore, some degree of skepticism regarding the role of Darwinian selection is warranted.  5.13 Conclusion The studies reported in this thesis represent the first genetic investigation of NR2E1 in humans with cortical, impulsive-aggressive, and psychiatric disorders. Our discovery of novel patient-variants warrants further investigation of NR2E1 in humans with brain-behavioural abnormalities. The identification of mutations in NR2E1 will be a first step towards the longterm goal of developing more effective counseling and therapeutics for the treatment of disorders of brain and behavior.  147  Appendix I Human Ethics Approval Certificate  The University of British Columbia Office of Research Services, Clinical Research Ethics Board — Room 210, 828 West 10 th Avenue, Vancouver, BC V5Z 1L8  Certificate of Expedited Approval: Renewal Clinical Research Ethics Board Official Notification PRINCIPAL INVESTIGATOR  NUMBER  DEPARTMENT  C99-0524  Simpson, E.M. INSTITLMON(S) WHERE RESEARCH WILL BE CARRIED OUT  Children's & Women's Health Centre CO-INVESTIGATORS:  Kumar, Ravinesh, Medicine SPONSORING AGENCIES  Canadian Institutes of Health Research TITLE:  Genetic & In-Vivo Studies to Define the Role of NR2EI in Aggressive Behaviour APPROVAL RENEWAL DATE  12 June 2006  TERM (YEARS)  AMENDMENT:  AMENDMENT APPROVED:  1  CERTIFICATION:  In respect of clinical trials:  1. The membership of this Research Ethics Board complies with the membership requirements for Research Ethics Boards defined in Division 5 of the Food and Drug Regulations. 2. The Research Ethics Board carries out its functions in a manner consistent with Good Clinical Practices. 3. This Research Ethics Board has reviewed and approved the clinical trial protocol end informed consent form for the trial which is to be conducted by the qualified investigator named above at the specified clinical trial site. This approval and the views of this Research Ethics Board have been documented in writing.  The Chair of the UBC Clinical Research Ethics Board has reviewed the documentation for the above named project. The research study, as presented in the documentation, was found to be acceptable on ethical grounds for research Involving human subjects and was approved for renewal by the UBC Clinical Research Ethics Board. The CREB approval for renewal of this study expires one year from the date of renewal. C.  ,  Approval of the Clinical Research Ethics Board by one of  Dr. Gail Bellward, Chair Dr. James McCormack, Associate Chair Dr. John Russell, Associate Chair Dr. Caron Strahlendorf, Associate Chair  148  Appendix II Animal Ethics Approval Certificate The University of British Columbia  ANIMAL CARE CERTIFICATE Breeding Programs  PROTOCOL NUMBER:  A03-0108  INVESTIGATOR OR COURSE DIRECTOR:^Simpson, DEPARTMENT:  E.M.  Medical Genetics  PROJECT TITLE: BREEDING: Inherited Aggression in 'Fierce' Mice: What does it Model in Humans? ANIMALS:  Mice 2467  APPROVAL DATE:^04-12-21  The Animal Care Committee has examined and approved the use of animals for the above breeding program, and have been given an assurance that the animals involved will be cared for in accordance with the principles contained in Care of Experimental Animals - A Guide for Canada, published by the Canadian Council on Animal Care.  provel of the UBC Committee on Animal Care by one of: Dr. W.K. Milsom, Chair Dr. J. Love, Director, Animal Care Centre M. L. Macdonald, Manager This certificate is valid for one year from the above approval date provided there is no change in the experimental procedures. Annual review is required by the CCAC and some granting agencies. A copy of this certificate must be displayed in your animal facility.  Office of Research Services and Administration 110, 6190 Agronomy Road, Vancouver, V6T 1Z3 Phone: 604-827-5111 FAX: 604-822-5093  References Abrahams BS, Chong AC, Nisha M, Milette D, Brewster DA, Berry ML, Muratkhodjaev F, Mai S, Rajcan-Separovic E, Simpson EM (2003) Metaphase FISHing of transgenic mice recommended: FISH and SKY define BAC-mediated balanced translocation. Genesis 36: 134-41 Abrahams BS, Kwok MC, Trinh E, Budaghzadeh S, Hossain SM, Simpson EM (2005) Pathological aggression in "fierce" mice corrected by human nuclear receptor 2E1. J Neurosci 25: 6263-70 Abrahams BS, Mak GM, Berry ML, Palmquist DL, Saionz JR, Tay A, Tan YH, Brenner S, *Simpson EM, *Venkatesh B (2002) Novel vertebrate genes and putative regulatory elements identified at kidney disease and NR2E1/fierce loci. Genomics 80: 45-53 (*authors contributed equally) Akey JM, Zhang G, Zhang K, Jin L, Shriver MD (2002) Interrogating a high-density SNP map for signatures of natural selection. Genome Res 12: 1805-14 Akhmedov NB, Piriev NI, Chang B, Rapoport AL, Hawes NL, Nishina PM, Nusinowitz S, Heckenlively JR, Roderick TH, Kozak CA, Danciger M, Davisson MT, Farber DB (2000) A deletion in a photoreceptor-specific nuclear receptor mRNA causes retinal degeneration in the rd7 mouse. Proc Natl Acad Sci U S A 97: 5551-6 Albanese V, Biguet NF, Kiefer H, Bayard E, Mallet J, Meloni R (2001) Quantitative effects on gene silencing by allelic variation at a tetranucleotide microsatellite. Hum Mol Genet 10: 1785-92  150  Albert DJ, Walsh ML, Longley W (1985) Medial hypothalamic and medial accumbens lesions which induce mouse killing enhance biting and attacks on inanimate objects. Physiol Behav 35: 523-7 Anderson SW, Bechara A, Damasio H, Tranel D, Damasio AR (1999) Impairment of social and moral behavior related to early damage in human prefrontal cortex. Nat Neurosci 2: 1032-7 Andres AM, Soldevila M, Navarro A, Kidd KK, Oliva B, Bertranpetit J (2004) Positive selection in MAOA gene is human exclusive: determination of the putative amino acid change selected in the human lineage. Hum Genet 115: 377-86 Angst J, Frey R, Lohmeyer B, Zerbin-Rudin E (1980) Bipolar manic-depressive psychoses: results of a genetic investigation. Hum Genet 55: 237-54 APA (2000) Diagnostic and Statistical Manual of Mental Disorders. Americal Psychiatric Association, Washington Ardlie KG, Kruglyak L, Seielstad M (2002) Patterns of linkage disequilibrium in the human genome. Nat Rev Genet 3: 299-309 Arinami T, Gao M, Hamaguchi H, Tort M (1997) A functional polymorphism in the promoter region of the dopamine D2 receptor gene is associated with schizophrenia. Hum Mol Genet 6: 577-82 Arnold SE (1999) Neurodevelopmental abnormalities in schizophrenia: insights from neuropathology. Dev Psychopathol 11: 439-56 Arnold SE, Hyman BT, Van Hoesen GW, Damasio AR (1991) Some cytoarchitectural abnormalities of the entorhinal cortex in schizophrenia. Arch Gen Psychiatry 48: 625-32  151  Ashworth A, Skene B, Swift S, Lovell-Badge R (1990) Zfa is an expressed retroposon derived from an alternative transcript of the Zfx gene. Embo J 9: 1529-34 Banks KG, Johnson KA, Lerner CP, Mahaffey CL, Bronson RT, Simpson EM (2003) Retroposon compensatory mechanism hypothesis not supported: Zfa knockout mice are fertile. Genomics 82: 254-60 Barkataki I, Kumari V, Das M, Taylor P, Sharma T (2006) Volumetric structural brain abnormalities in men with schizophrenia or antisocial personality disorder. Behav Brain Res 169: 239-47 Barkovich AJ, Kuzniecky RI, Dobyns WB (2001) Radiologic classification of malformations of cortical development. Curr Opin Neurol 14: 145-9 Baron-Cohen S (2002) The extreme male brain theory of autism. Trends Cogn Sci 6: 248-254 Baron M, Gruen R, Asnis L, Kane J (1982) Schizoaffective illness, schizophrenia and affective disorders: morbidity risk and genetic transmission. Acta Psychiatr Scand 65: 253-62 Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 28197 Benes FM, Berretta S (2001) GABAergic interneurons: implications for understanding schizophrenia and bipolar disorder. Neuropsychopharmacology 25: 1-27 Benes FM, Kwok EW, Vincent SL, Todtenkopf MS (1998) A reduction of nonpyramidal cells in sector CA2 of schizophrenics and manic depressives. Biol Psychiatry 44: 88-97 Berlin F, Hunt W, Malin H, Dyer A, Lahne G, Dean S (1991) A five-year plus follow-up survey of criminal recidivism within a treated cohort of 406 pedophiles, 111 exhibitionists and  152  109 sexual aggressive: Issues and outcomes. American Journal of Forensic Psychology: 5-28 Berrettini W (2003) Evidence for shared susceptibility in bipolar disorder and schizophrenia. Am J Med Genet C Semin Med Genet 123: 59-64 Best M, Williams JM, Coccaro EF (2002) Evidence for a dysfunctional prefrontal circuit in patients with an impulsive aggressive disorder. Proc Natl Acad Sci U S A 99: 8448-53 Beyer C (1999) Estrogen and the developing mammalian brain. Anat Embryol (Berl) 199: 37990 Blair RJ, Peschardt KS, Budhani S, Mitchell DG, Pine DS (2006) The development of psychopathy. J Child Psychol Psychiatry 47: 262-76 Bolk S, Pelet A, Hofstra RM, Angrist M, Salomon R, Croaker D, Buys CH, Lyonnet S, Chakravarti A (2000) A human model for multigenic inheritance: phenotypic expression in Hirschsprung disease requires both the RET gene and a new 9q31 locus. Proc Natl Acad Sci U S A 97: 268-73 Bond J, Roberts E, Mochida GH, Hampshire DJ, Scott S, Askham JM, Springell K, Mahadevan M, Crow YJ, Markham AF, Walsh CA, Woods CG (2002) ASPM is a major determinant of cerebral cortical size. Nat Genet 32: 316-20 Bond J, Roberts E, Springell K, Lizarraga SB, Scott S, Higgins J, Hampshire DJ, Morrison EE, Leal GF, Silva EO, Costa SM, Baralle D, Raponi M, Karbani G, Rashid Y, Jafri H, Bennett C, Corry P, Walsh CA, Woods CG (2005) A centrosomal mechanism involving CDK5RAP2 and CENPJ controls brain size. Nat Genet 37: 353-5  153  Bond J, Scott S, Hampshire DJ, Springell K, Cony P, Abramowicz MJ, Mochida GH, Hennekam RC, Maher ER, Fryns JP, Alswaid A, Jafri H, Rashid Y, Mubaidin A, Walsh CA, Roberts E, Woods CG (2003) Protein-truncating mutations in ASPM cause variable reduction in brain size. Am J Hum Genet 73: 1170-7 Bonnen PE, Wang PJ, Kimmel M, Chakraborty R, Nelson DL (2002) Haplotype and linkage disequilibrium architecture for human cancer-associated genes. Genome Res 12: 1846-53 Braff DL, Light GA, Ellwanger J, Sprock J, Swerdlow NR (2005) Female schizophrenia patients have prepulse inhibition deficits. Biol Psychiatry 57: 817-20 Brandon NJ, Handford EJ, Schurov I, Rain JC, Pelling M, Duran-Jimeniz B, Camargo LM, Oliver KR, Beher D, Shearman MS, Whiting PJ (2004) Disrupted in Schizophrenia 1 and Nudel form a neurodevelopmentally regulated protein complex: implications for schizophrenia and other major neurological disorders. Mol Cell Neurosci 25: 42-55 Brannvall K, Korhonen L, Lindholm D (2002) Estrogen-receptor-dependent regulation of neural stem cell proliferation and differentiation. Mol Cell Neurosci 21: 512-20 Bray NJ, Buckland PR, Owen MJ, O'Donovan MC (2003) Cis-acting variation in the expression of a high proportion of genes in human brain. Hum Genet 113: 149-53 Bray NJ, Buckland PR, Williams NM, Williams HJ, Norton N, Owen MJ, O'Donovan MC (2003) A haplotype implicated in schizophrenia susceptibility is associated with reduced COMT expression in human brain. Am J Hum Genet 73: 152-61 Brower MC, Price BH (2001) Neuropsychiatry of frontal lobe dysfunction in violent and criminal behaviour: a critical review. J Neurol Neurosurg Psychiatry 71: 720-6  154  Brunner HG, Nelen M, Breakefield XO, Ropers HH, van Oost BA (1993) Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A. Science 262: 578-80 Brunner HG, Nelen MR, van Zandvoort P, Abeling NG, van Gennip AH, Wolters EC, Kuiper MA, Ropers HH, van Oost BA (1993) X-linked borderline mental retardation with prominent behavioral disturbance: phenotype, genetic localization, and evidence for disturbed monoamine metabolism. Am J Hum Genet 52: 1032-9. Bucan M, Abel T (2002) The mouse: genetics meets behaviour. Nat Rev Genet 3: 114-23 Buervenich S, Carmine A, Arvidsson M, Xiang F, Zhang Z, Sydow 0, Jonsson EG, Sedvall GC, Leonard S, Ross RG, Freedman R, Chowdari KV, Nimgaonkar VL, Perlmann T, Anvret M, Olson L (2000) NURR1 mutations in cases of schizophrenia and manic-depressive disorder. Am J Med Genet 96: 808-13 Cameron HA, Gould E (1994) Adult neurogenesis is regulated by adrenal steroids in the dentate gyrus. Neuroscience 61: 203-9 Cannon TD, Mednick SA, Parnas J, Schulsinger F, Praestholm J, Vestergaard A (1993) Developmental brain abnormalities in the offspring of schizophrenic mothers. I. Contributions of genetic and perinatal factors. Arch Gen Psychiatry 50: 551-64 Cannon TD, van Erp TG, Huttunen M, Lonnqvist J, Salonen 0, Valanne L, Poutanen VP, Standertskjold-Nordenstam CG, Gur RE, Yan M (1998) Regional gray matter, white matter, and cerebrospinal fluid distributions in schizophrenic patients, their siblings, and controls. Arch Gen Psychiatry 55: 1084-91  155  Cao Q, Martinez M, Zhang J, Sanders AR, Badner JA, Cravchik A, Markey CJ, Beshah E, GuroffJJ, Maxwell ME, Kazuba DM, Whiten R, Goldin LR, Gershon ES, Gejman PV (1997) Suggestive evidence for a schizophrenia susceptibility locus on chromosome 6q and a confirmation in an independent series of pedigrees. Genomics 43: 1-8 Capon F, Allen MH, Ameen M, Burden AD, Tillman D, Barker JN, Trembath RC (2004) A synonymous SNP of the comeodesmosin gene leads to increased mRNA stability and demonstrates association with psoriasis across diverse ethnic groups. Hum Mol Genet 13: 2361-8 Cardno AG, Gottesman, II (2000) Twin studies of schizophrenia: from bow-and-arrow concordances to star wars Mx and functional genomics. Am J Med Genet 97: 12-7 Cargill M, Altshuler D, Ireland J, Sklar P, Ardlie K, Patil N, Shaw N, Lane CR, Lim EP, Kalyanaraman N, Nemesh J, Ziaugra L, Friedland L, Rolfe A, Warrington J, Lipshutz R, Daley GQ, Lander ES (1999) Characterization of single-nucleotide polymorphisms in coding regions of human genes. Nat Genet 22: 231-8 Carlson CS, Eberle MA, Rieder MJ, Smith JD, Kruglyak L, Nickerson DA (2003) Additional SNPs and linkage-disequilibrium analyses are necessary for whole-genome association studies in humans. Nat Genet 33: 518-21 Carney SH, Brodsky MC, Good WV, Glasier CM, Greibel ML, Cunniff C (1993) Aicardi syndrome: more than meets the eye. Sury Ophthalmol 37: 419-24 Carrasquillo MM, McCallion AS, Puffenberger EG, Kashuk CS, Noun N, Chakravarti A (2002) Genome-wide association study and mouse model identify interaction between RET and EDNRB pathways in Hirschsprung disease. Nat Genet 32: 237-44  156  Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Frisch M, Bayerlein M, Werner T (2005) Matlnspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21: 2933-42 Cases 0, Seif I, Grimsby J, Gaspar P, Chen K, Pournin S, Muller U, Aguet M, Babinet C, Shih JC, et al. (1995) Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA [see comments]. Science 268: 1763-6 Caspi A, McClay J, Moffitt TE, Mill J, Martin J, Craig IW, Taylor A, Poulton R (2002) Role of genotype in the cycle of violence in maltreated children. Science 297: 851-4 Cervantes RB, Stringer JR, Shao C, Tischfield JA, Stambrook PJ (2002) Embryonic stem cells and somatic cells differ in mutation frequency and type. Proc Natl Acad Sci USA 99: 3586-90 Chamary JV, Hurst LD (2005) Evidence for selection on synonymous mutations affecting stability of mRNA secondary structure in mammals. Genome Biol 6: R75 Chen AP, Ohno M, Giese KP, Kuhn R, Chen RL, Silva AJ (2006) Forebrain-specific knockout of B-raf kinase leads to deficits in hippocampal long-term potentiation, learning, and memory. J Neurosci Res 83: 28-38 Chen BK, Sassi R, Axelson D, Hatch JP, Sanches M, Nicoletti M, Brambilla P, Keshavan MS, Ryan ND, Birmaher B, Soares JC (2004) Cross-sectional study of abnormal amygdala development in adolescents and young adults with bipolar disorder. Biol Psychiatry 56: 399-405 Chen G, Rajkowska G, Du F, Seraji-Bozorgzad N, Manji HK (2000) Enhancement of hippocampal neurogenesis by lithium. J Neurochem 75: 1729-34  157  Chen L, Liu N, Wang S, Oh C, Carriero NJ, Zhao H (2005) Whole-genome association studies on alcoholism comparing different phenotypes using single-nucleotide polymorphisms and micro satellites. BMC Genet 6 Suppl 1: S130 Chen X, Wang X, O'Neill AF, Walsh D, Kendler KS (2004) Variants in the catechol-omethyltransferase (COMT) gene are associated with schizophrenia in Irish high-density families. Mol Psychiatry 9: 962-7 Chen YH, Tsai MT, Shaw CK, Chen CH (2001) Mutation analysis of the human NR4A2 gene, an essential gene for midbrain dopaminergic neurogenesis, in schizophrenic patients. Am J Med Genet 105: 753-7 Chery M, Formiga LF, Mujica P, Andre M, Stehelin D, Dozier C, Gilgenkrantz S (1989) Interstitial deletion of the long arm of chromosome 6 Ann Genet 32: 82-6 Chowdari KV, Mimics K, Semwal P, Wood J, Lawrence E, Bhatia T, Deshpande SN, B KT, Ferrell RE, Middleton FA, Devlin B, Levitt P, Lewis DA, Nimgaonkar VL (2002) Association and linkage analyses of RGS4 polymorphisms in schizophrenia. Hum Mol Genet 11: 1373-80 Christiansen KO (1968) Threshold of tolerance in various population groups illustrated by results from Danish criminological twin study. Int Psychiatry Clin 5: 107-20 Christie BR, Li AM, Redila VA, Booth H, Wong BK, Eadie BD, Ernst C, Simpson EM (2006) Deletion of the nuclear receptor Nr2e 1 impairs synaptic plasticity and dendritic structure in the mouse dentate gyms. Neuroscience 137: 1031-7  158  Chu PW, Cheung WM, Kwong YL (2003) Differential effects of 9-cis, 13-cis and all-trans retinoic acids on the neuronal differentiation of human neuroblastoma cells. Neuroreport 14: 1935-9 Chumakov I, Blumenfeld M, Guerassimenko 0, Cavarec L, Palicio M, Abderrahim H, Bougueleret L, Barry C, Tanaka H, La Rosa P, Puech A, Tahri N, Cohen-Akenine A, Delabrosse S, Lissarrague S, Picard FP, Maurice K, Essioux L, Millasseau P, Grel P, Debailleul V, Simon AM, Caterina D, Dufaure I, Malekzadeh K, Belova M, Luan JJ, Bouillot M, Sambucy JL, Primas G, Saumier M, Boubkiri N, Martin-Saumier S, Nasroune M, Peixoto H, Delaye A, Pinchot V, Bastucci M, Guillou S, Chevillon M, Sainz-Fuertes R, Meguenni S, Aurich-Costa J, Cherif D, Gimalac A, Van Duijn C, Gauvreau D, Ouellette G, Fortier I, Raelson J, Sherbatich T, Riazanskaia N, Rogaev E, Raeymaekers P, Aerssens J, Konings F, Luyten W, Macciardi F, Sham PC, Straub RE, Weinberger DR, Cohen N, Cohen D (2002) Genetic and physiological data implicating the new human gene G72 and the gene for D-amino acid oxidase in schizophrenia. Proc Natl Acad Sci U S A 99: 13675-80 Coccaro EF (1998) Impulsive aggression: a behavior in search of clinical definition. Hary Rev Psychiatry 5: 336-9 Coccaro EF, Bergeman CS, Kavoussi RJ, Seroczynski AD (1997) Heritability of aggression and irritability: a twin study of the Buss-Durkee aggression scales in adult male subjects. Biol Psychiatry 41: 273-84 Collins FS, Guyer MS, Charkravarti A (1997) Variations on a theme: cataloging human DNA sequence variation. Science 278: 1580-1  159  Corrigan PW, Watson AC (2005) Findings from the National Comorbidity Survey on the frequency of violent behavior in individuals with psychiatric disorders. Psychiatry Res 136: 153-62 Cosgaya JM, Garcia-Villalba P, Perona R, Aranda A (1996) Comparison of the effects of retinoic acid and nerve growth factor on PC 12 cell proliferation, differentiation, and gene expression. J Neurochem 66: 89-98 Cowie VA (1987) Microcephaly: a review of genetic implications in its causation. J Ment Defic Res 31 (Pt 3): 229-33 Cowles CR, Hirschhorn JN, Altshuler D, Lander ES (2002) Detection of regulatory variation in mouse genes. Nat Genet 32: 432-7 Craddock N, Jones I (1999) Genetics of bipolar disorder. J Med Genet 36: 585-94 Craddock N, O'Donovan MC, Owen MJ (2005) The genetics of schizophrenia and bipolar disorder: dissecting psychosis. J Med Genet 42: 193-204 Crino PB (2005) Molecular pathogenesis of focal cortical dysplasia and hemimegalencephaly. J Child Neurol 20: 330-6 Critchley HD, Simmons A, Daly EM, Russell A, van Amelsvoort T, Robertson DM, Glover A, Murphy DG (2000) Prefrontal and medial temporal correlates of repetitive violence to self and others. Biol Psychiatry 47: 928-34 Curin JM, Terzic J, Petkovic ZB, Zekan L, Terzic IM, Susnjara IM (2003) Lower cortisol and higher ACTH levels in individuals with autism. J Autism Dev Disord 33: 443-8  160  Daubas P, Tajbakhsh S, Hadchouel J, Primig M, Buckingham M (2000) Myf5 is a novel early axonal marker in the mouse brain and is subjected to post-transcriptional regulation in neurons. Development 127: 319-31 Davidson RJ, Putnam KM, Larson CL (2000) Dysfunction in the neural circuitry of emotion regulation--a possible prelude to violence. Science 289: 591-4 Del Pero RA, Mets MB, Tripathi RC, Torczynski E (1986) Anomalies of retinal architecture in Aicardi syndrome. Arch Ophthalmol 104: 1659-64 DeLisi LE, Hoff AL, Schwartz JE, Shields GW, Halthore SN, Gupta SM, Henn FA, Anand AK (1991) Brain morphology in first-episode schizophrenic-like psychotic patients: a quantitative magnetic resonance imaging study. Biol Psychiatry 29: 159-75 Desai AR, McConnell SK (2000) Progressive restriction in fate potential by neural progenitors during cerebral cortical development. Development 127: 2863-72 Ding YC, Chi HC, Grady DL, Morishima A, Kidd JR, Kidd KK, Flodman P, Spence MA, Schuck S, Swanson JM, Zhang YP, Moyzis RI( (2002) Evidence of positive selection acting at the human dopamine receptor D4 gene locus. Proc Natl Acad Sci U S A 99: 309-14 Dobyns WB (2002) Primary microcephaly: new approaches for an old disorder. Am J Med Genet 112: 315-7 Doetschman T, Maeda N, Smithies 0 (1988) Targeted mutation of the Hprt gene in mouse embryonic stem cells. Proc Natl Acad Sci USA 85: 8583-7  161  Dorus S, Vallender EJ, Evans PD, Anderson JR, Gilbert SL, Mahowald M, Wyckoff GJ, Malcom CM, Lahn BT (2004) Accelerated evolution of nervous system genes in the origin of Homo sapiens. Cell 119: 1027-40 Drake JA, Bird C, Nemesh J, Thomas DJ, Newton-Cheh C, Reymond A, Excoffier L, Attar H, Antonarakis SE, Dermitzakis ET, Hirschhorn JN (2006) Conserved noncoding sequences are selectively constrained and not mutation cold spots. Nat Genet 38: 223-227 Duan J, Wainwright MS, Comeron JM, Saitou N, Sanders AR, Gelernter J, Gejman PV (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet 12: 205-16 Dumais A, Lesage AD, Lalovic A, Seguin M, Tousignant M, Chawky N, Turecki G (2005) Is violent method of suicide a behavioral marker of lifetime aggression? Am J Psychiatry 162: 1375-8 Emison ES, McCallion AS, Kashuk CS, Bush RT, Grice E, Lin S, Portnoy ME, Cutler DJ, Green ED, Chakravarti A (2005) A common sex-dependent mutation in a RET enhancer underlies Hirschsprung disease risk. Nature 434: 857-63 Enard W, Paabo S (2004) Comparative primate genomics. Arum Rev Genomics Hum Genet 5: 351-78 Enard W, Przeworski M, Fisher SE, Lai CS, Wiebe V, Kitano T, Monaco AP, Paabo S (2002) Molecular evolution of FOXP2, a gene involved in speech and language. Nature 418: 869-72  162  Enerback S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME, Kozak LP (1997) Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387: 90-4 Evans PD, Anderson JR, Vallender EJ, Choi SS, Lahn BT (2004) Reconstructing the evolutionary history of microcephalin, a gene controlling human brain size. Hum Mol Genet 13: 1139-45 Evans PD, Anderson JR, Vallender EJ, Gilbert SL, Malcom CM, Dorus S, Lahn BT (2004) Adaptive evolution of ASPM, a major determinant of cerebral cortical size in humans. Hum Mol Genet 13: 489-94 Evans PD, Gilbert SL, Mekel-Bobrov N, Vallender EJ, Anderson JR, Vaez-Azizi LM, Tishkoff SA, Hudson RR, Lahn BT (2005) Microcephalin, a gene regulating brain size, continues to evolve adaptively in humans. Science 309: 1717-20 Evers LJ, Schrander-Stumpel CT, Engelen JJ, Hoorntje TM, Pulles-Heintzberger CF, Schrander JJ, Albrechts JC, Peters J, Fryns JP (1996) Deletion of the long arm of chromosome 6: two new patients and literature review. Clin Genet 50: 138-44 Falkai P, Schneider-Axmann T, Honer WG (2000) Entorhinal cortex pre-alpha cell clusters in schizophrenia: quantitative evidence of a developmental abnormality. Biol Psychiatry 47: 937-43 Fanous A, Gardner C, Walsh D, Kendler KS (2001) Relationship between positive and negative symptoms of schizophrenia and schizotypal symptoms in nonpsychotic relatives. Arch Gen Psychiatry 58: 669-73  163  Fatemi SH, Kroll JL, Stary JM (2001) Altered levels of Reelin and its isoforms in schizophrenia and mood disorders. Neuroreport 12: 3209-15 Fay JC, Wu CI (2000) Hitchhiking under positive Darwinian selection. Genetics 155: 1405-13 Feldmann TB (2001) Bipolar disorder and violence. Psychiatr Q 72: 119-29 Feng Y, Walsh CA (2004) Mitotic spindle regulation by Ndel controls cerebral cortical size. Neuron 44: 279-93 Festing M (2000) Mouse Genome Informatics: Inbred strains of mice. The Jackson Laboratory Filley CM, Price BH, Nell V, Antoinette T, Morgan AS, Bresnahan JF, Pincus JH, Gelbort MM, Weissberg M, Kelly JP (2001) Toward an understanding of violence: neurobehavioral aspects of unwarranted physical aggression: Aspen Neurobehavioral Conference consensus statement. Neuropsychiatry Neuropsychol Behav Neurol 14: 1-14. Fox R, Witham B (1997) Handbook on geneticallyh standardized JAX mice. The Jackson Laboratory, Bar Harbor Francis F, Meyer G, Fallet-Bianco C, Moreno S, Kappeler C, Socorro AC, Tuy FP, Beldjord C, Chelly J (2006) Human disorders of cortical development: from past to present. Eur J Neurosci 23: 877-93 Frantz GD, McConnell SK (1996) Restriction of late cerebral cortical progenitors to an upperlayer fate. Neuron 17: 55-61 Freedman ML, Reich D, Penney KL, McDonald GJ, Mignault AA, Patterson N, Gabriel SB, Topol EJ, Smoller JW, Pato CN, Pato MT, Petryshen TL, Kolonel LN, Lander ES, Sklar P, Henderson B, Hirschhorn JN, Altshuler D (2004) Assessing the impact of population stratification on genetic association studies. Nat Genet 36: 388-93  164  Freudenberg-Hua Y, Freudenberg J, Kluck N, Cichon S, Propping P, Nothen MM (2003) Single nucleotide variation analysis in 65 candidate genes for CNS disorders in a representative sample of the European population. Genome Res 13: 2271-6 Freudenberg-Hua Y, Freudenberg J, Winantea J, Kluck N, Cichon S, Bruss M, Propping P, Nothen MM (2005) Systematic investigation of genetic variability in 111 human genesimplications for studying variable drug response. Pharmacogenomics J 5: 183-92 Fu YX (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147: 915-25 Fu YX, Li WH (1993) Statistical tests of neutrality of mutations. Genetics 133: 693-709 Fullerton SM, Bartoszewicz A, Ybazeta G, Horikawa Y, Bell GI, Kidd KK, Cox NJ, Hudson RR, Di Rienzo A (2002) Geographic and haplotype structure of candidate type 2 diabetes susceptibility variants at the calpain-10 locus. Am J Hum Genet 70: 1096-106 Galea LA, Perrot-Sinal TS, Kavaliers M, Ossenkopp KP (1999) Relations of hippocampal volume and dentate gyms width to gonadal hormone levels in male and female meadow voles. Brain Res 821: 383-91 Ganesh A, Mitra S, Koul RL, Venugopalan P (2000) The full spectrum of persistent fetal vasculature in Aicardi syndrome: an integrated interpretation of ocular malformation. Br J Ophthalmol 84: 227-8 Geddes JR, Lawrie SM (1995) Obstetric complications and schizophrenia: a meta-analysis. Br J Psychiatry 167: 786-93  165  Gerlai R (1996) Gene-targeting studies of mammalian behavior: is it the mutation or the background genotype? [see comments] [published erratum appears in Trends Neurosci 1996 Jul;19(7):271]. Trends Neurosci 19: 177-81 Gershon ES, DeLisi LE, Hamovit J, Nurnberger JI, Jr., Maxwell ME, Schreiber J, Dauphinais D, Dingman CW, 2nd, Guroff JJ (1988) A controlled family study of chronic psychoses. Schizophrenia and schizoaffective disorder. Arch Gen Psychiatry 45: 328-36 Gilad Y, Rosenberg S, Przeworski M, Lancet D, Skorecki K (2002) Evidence for positive selection and population structure at the human MAO-A gene. Proc Natl Acad Sci U S A 99: 862-7 Gilbert SL, Dobyns WB, Lahn BT (2005) Genetic links between brain development and brain evolution. Nat Rev Genet 6: 581-90 Glaser T, Walton DS, Maas RL (1992) Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat Genet 2: 232-9 Gogos JA, Morgan M, Luine V, Santha M, Ogawa S, Pfaff D, Karayiorgou M (1998) CatecholO-methyltransferase-deficient mice exhibit sexually dimorphic changes in catecholamine levels and behavior. Proc Natl Acad Sci U S A 95: 9991-6 Goldman D, Lappalainen J, Ozaki N (1996) Direct analyis of candidate genes in impulsive behaviours. Genetics of criminal and antisocial behaviour. Wiley, Chichester, pp 139-154 Goldman SA, Sim F (2005) Neural progenitor cells of the adult brain. Novartis Found Symp 265: 66-80; discussion 82-97 Goodman AB (1998) Three independent lines of evidence suggest retinoids as causal to schizophrenia. Proc Natl Acad Sci U S A 95: 7240-4  166  Gordon D, Abajian C, Green P (1998) Consed: a graphical tool for sequence finishing. Genome Res 8: 195-202 Gorski JA, Talley T, Qiu M, Puelles L, Rubenstein JL, Jones KR (2002) Cortical excitatory neurons and glia, but not GABAergic neurons, are produced in the Emxl-expressing lineage. J Neurosci 22: 6309-14 Gothelf D, Apter A, van Praag HM (1997) Measurement of aggression in psychiatric patients. Psychiatry Res 71: 83-95 Gottesman, II, Gould TD (2003) The endophenotype concept in psychiatry: etymology and strategic intentions. Am J Psychiatry 160: 636-45 Gottesman, II, Shields J (1973) Genetic theorizing and schizophrenia. Br J Psychiatry 122: 15-30 Gottschalk AR, Basila D, Wong M, Dean NM, Brandts CH, Stokoe D, Haas-Kogan DA (2001) p27Kipl is required for PTEN-induced G1 growth arrest. Cancer Res 61: 2105-11 Goveas JS, Csernansky JG, Coccaro EF (2004) Platelet serotonin content correlates inversely with life history of aggression in personality-disordered subjects. Psychiatry Res 126: 2332 Grafman J, Schwab K, Warden D, Pridgen A, Brown HR, Salazar AM (1996) Frontal lobe injuries, violence, and aggression: a report of the Vietnam Head Injury Study. Neurology 46: 1231-8 Green E, Craddock N (2003) Brain-derived neurotrophic factor as a potential risk locus for bipolar disorder: evidence, limitations, and implications. Curr Psychiatry Rep 5: 469-76  167  Grinberg I, Northrup H, Ardinger H, Prasad C, Dobyns WB, Millen KJ (2004) Heterozygous deletion of the linked genes ZIC1 and ZIC4 is involved in Dandy-Walker malformation. Nat Genet 36: 1053-5 Groszer M, Erickson R, Scripture-Adams DD, Dougherty JD, Le Belle J, Zack JA, Geschwind DH, Liu X, Kornblum HI, Wu H (2006) PTEN negatively regulates neural stem cell selfrenewal by modulating GO-G1 cell cycle entry. Proc Natl Acad Sci U S A 103: 111-6 Groszer M, Erickson R, Scripture-Adams DD, Lesche R, Trumpp A, Zack JA, Kornblum HI, Liu X, Wu H (2001) Negative regulation of neural stem/progenitor cell proliferation by the Pten tumor suppressor gene in vivo. Science 294: 2186-9 Grove WM, Eckert ED, Heston L, Bouchard TJ, Jr., Segal N, Lykken DT (1990) Heritability of substance abuse and antisocial behavior: a study of monozygotic twins reared apart. Biol Psychiatry 27: 1293-304 Gruzelier J, Seymour K, Wilson L, Jolley A, Hirsch S (1988) Impairments on neuropsychologic tests of temporohippocampal and frontohippocampal functions and word fluency in remitting schizophrenia and affective disorders. Arch Gen Psychiatry 45: 623-9 Hadj-Sahraoui N, Seugnet I, Ghorbel MT, Demeneix B (2000) Hypothyroidism prolongs mitotic activity in the post-natal mouse brain. Neurosci Lett 280: 79-82 Haider NB, Jacobson SG, Cideciyan AV, Swiderski R, Streb LM, Searby C, Beck G, Hockey R, Hanna DB, Gorman S, Duhl D, Carmi R, Bennett J, Weleber RG, Fishman GA, Wright AF, Stone EM, Sheffield VC (2000) Mutation of a nuclear receptor gene, NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate. Nat Genet 24: 127-31  168  Hajek T, Carrey N, Alda M (2005) Neuroanatomical abnormalities as risk factors for bipolar disorder. Bipolar Disord 7: 393-403 Hamblin MT, Di Rienzo A (2000) Detection of the signature of natural selection in humans: evidence from the Duffy blood group locus. Am J Hum Genet 66: 1669-79 Han DH, Kee BS, Min KJ, Lee YS, Na C, Park DB, Lyoo IK (2006) Effects of catechol-0methyltransferase Va1158Met polymorphism on the cognitive stability and aggression in the first-onset schizophrenic patients. Neuroreport 17: 95-9 Hanashima C, Li SC, Shen L, Lai E, Fishell G (2004) Foxgl suppresses early cortical cell fate. Science 303: 56-9 Hannenhalli S, Levy S (2002) Predicting transcription factor synergism. Nucleic Acids Res 30: 4278-84 Harpending HC, Batzer MA, Gurven M, Jorde LB, Rogers AR, Sherry ST (1998) Genetic traces of ancient demography. Proc Natl Acad Sci U S A 95: 1961-7 Hartl C (1997) Principles of Population Genetics, 3rd edn. edn. Sinauer, Sunderland, Mass. Hashimoto R, Straub RE, Weickert CS, Hyde TM, Kleinman JE, Weinberger DR (2004) Expression analysis of neuregulin-1 in the dorsolateral prefrontal cortex in schizophrenia. Mol Psychiatry 9: 299-307 Hashimoto T, Aihara R, Tayama M, Miyazaki M, Shirakawa Y, Kuroda Y (1991) Reduced thyroid-stimulating hormone response to thyrotropin-releasing hormone in autistic boys. Dev Med Child Neurol 33: 313-9 Hasler G, Drevets WC, Gould TD, Gottesman, II, Manji HK (2006) Toward Constructing an Endophenotype Strategy for Bipolar Disorders. Biol Psychiatry  169  Hasty P, Rivera-Perez J, Chang C, Bradley A (1991) Target frequency and integration pattern for insertion and replacement vectors in embryonic stem cells. Mol Cell Biol 11: 4509-17 Hattori E, Liu C, Badner JA, Bonner TI, Christian SL, Maheshwari M, Detera-Wadleigh SD, Gibbs RA, Gershon ES (2003) Polymorphisms at the G72/G30 gene locus, on 13q33, are associated with bipolar disorder in two independent pedigree series. Am J Hum Genet 72: 1131-40 Heldt SA, Green A, Ressler KJ (2004) Prepulse inhibition deficits in GAD65 knockout mice and the effect of antipsychotic treatment. Neuropsychopharmacology 29: 1610-9 Hen R (1996) Mean genes. Neuron 16: 17-21 Hennig J, Reuter M, Netter P, Burk C, Landt 0 (2005) Two types of aggression are differentially related to serotonergic activity and the A779C TPH polymorphism. Behav Neurosci 119: 16-25 Hering R, Petrovic S, Mietz EM, Holzmann C, Berg D, Bauer P, Woitalla D, Muller T, Berger K, Kruger R, Riess 0 (2004) Extended mutation analysis and association studies of Nurrl (NR4A2) in Parkinson disease. Neurology 62: 1231-2 Heyman I, Frampton I, van Heyningen V, Hanson I, Teague P, Taylor A, Simonoff E (1999) Psychiatric disorder and cognitive function in a family with an inherited novel mutation of the developmental control gene PAX6. Psychiatr Genet 9: 85-90 Higashide T, Wada T, Sakurai M, Yokoyama H, Sugiyama K (2005) Macular abnormalities and optic disk anomaly associated with a new PAX2 missense mutation. Am J Ophthalmol 139: 203-5  170  Hodgins S (1992) Mental disorder, intellectual deficiency, and crime. Evidence from a birth cohort. Arch Gen Psychiatry 49: 476-83 Hooper M, Hardy K, Handyside A, Hunter S, Monk M (1987) HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 326: 292-5 Hopkin RJ, Schorry E, Bofinger M, Milatovich A, Stern HJ, Jayne C, Saal HM (1997) New insights into the phenotypes of 6q deletions. Am J Med Genet 70: 377-86 Hurst LD (2002) The Ka/Ks ratio: diagnosing the form of sequence evolution. Trends Genet 18: 486 Ichiki M, Kunugi H, Takei N, Murray RM, Baba H, Arai H, Oshima I, Okagami K, Sato T, Hirose T, Nanko S (2000) Intra-uterine physical growth in schizophrenia: evidence confirming excess of premature birth. Psychol Med 30: 597-604 Iwayama-Shigeno Y, Yamada K, Toyota T, Shimizu H, Hattori E, Yoshitsugu K, Fujisawa T, Yoshida Y, Kobayashi T, Tom M, Kurumaji A, Detera-Wadleigh S, Yoshikawa T (2003) Distribution of haplotypes derived from three common variants of the NR4A2 gene in Japanese patients with schizophrenia. Am J Med Genet B Neuropsychiatr Genet 118: 204 Jackson A, Panayiotidis P, Foroni L (1998) The human homologue of the Drosophila tailless gene (TLX): characterization and mapping to a region of common deletion in human lymphoid leukemia on chromosome 6q21. Genomics 50: 34-43 Jackson AP, Eastwood H, Bell SM, Adu J, Toomes C, Carr IM, Roberts E, Hampshire DJ, Crow YJ, Mighell AJ, Karbani G, Jafri H, Rashid Y, Mueller RF, Markham AF, Woods CG  171  (2002) Identification of microcephalin, a protein implicated in determining the size of the human brain. Am J Hum Genet 71: 136-42 Jackson AP, McHale DP, Campbell DA, Jafri H, Rashid Y, Mannan J, Karbani G, Corry P, Levene MI, Mueller RF, Markham AF, Lench NJ, Woods CG (1998) Primary autosomal recessive microcephaly (MCPH1) maps to chromosome 8p22-pter. Am J Hum Genet 63: 541-6 Jakob H, Beckmann H (1986) Prenatal developmental disturbances in the limbic allocortex in schizophrenics. J Neural Transm 65: 303-26 Jamieson CR, Govaerts C, Abramowicz MJ (1999) Primary autosomal recessive microcephaly: homozygosity mapping of MCPH4 to chromosome 15. Am J Hum Genet 65: 1465-9 Jones G, Zammit S, Norton N, Hamshere ML, Jones SJ, Milham C, Sanders RD, McCarthy GM, Jones LA, Cardno AG, Gray M, Murphy KC, Owen MJ (2001) Aggressive behaviour in patients with schizophrenia is associated with catechol-O-methyltransferase genotype. Br J Psychiatry 179: 351-5 Jones GH, Lewis JE (1991) Head circumference in elderly long-stay patients with schizophrenia. Br J Psychiatry 159: 435-8 Jorm AF, Easteal S (2000) Assessing candidate genes as risk factors for mental disorders: the value of population-based epidemiological studies. Soc Psychiatry Psychiatr Epidemiol 35: 1-4 Kaiser R, Konneker M, Henneken M, Dettling M, Muller-Oerlinghausen B, Roots I, Brockmoller J (2000) Dopamine D4 receptor 48-bp repeat polymorphism: no association with  172  response to antipsychotic treatment, but association with catatonic schizophrenia. Mol Psychiatry 5: 418-24 Kang AM, Palmatier MA, Kidd KK (1999) Global variation of a 40-bp VNTR in the 3'untranslated region of the dopamine transporter gene (SLC6A3). Biol Psychiatry 46: 15160 Kato M, Dobyns WB (2003) Lissencephaly and the molecular basis of neuronal migration. Hum Mol Genet 12 Spec No 1: R89-96 Kendler KS, McGuire M, Gruenberg AM, O'Hare A, Spellman M, Walsh D (1993) The Roscommon Family Study. I. Methods, diagnosis of probands, and risk of schizophrenia in relatives. Arch Gen Psychiatry 50: 527-40 Kety SS, Rosenthal D, Wender PH, Schulsinger F (1976) Studies based on a total sample of adopted individuals and their relatives: why they were necessary, what they demonstrated and failed to demonstrate. Schizophr Bull 2: 413-28 Keverne EB (1999) GABA-ergic neurons and the neurobiology of schizophrenia and other psychoses. Brain Res Bull 48: 467-73 Kidd KK, Pakstis AJ, Speed WC, Kidd JR (2004) Understanding human DNA sequence variation. J Hered 95: 406-20 Kiehl KA, Smith AM, Hare RD, Mendrek A, Forster BB, Brink J, Liddle PF (2001) Limbic abnormalities in affective processing by criminal psychopaths as revealed by functional magnetic resonance imaging. Biol Psychiatry 50: 677-84  173  Kiehl KA, Smith AM, Mendrek A, Forster BB, Hare RD, Liddle PF (2004) Temporal lobe abnormalities in semantic processing by criminal psychopaths as revealed by functional magnetic resonance imaging. Psychiatry Res 130: 27-42 Kieseppa T, Partonen T, Haukka J, Kaprio J, Lonnqvist J (2004) High concordance of bipolar I disorder in a nationwide sample of twins. Am J Psychiatry 161: 1814-21 King MC, Wilson AC (1975) Evolution at two levels in humans and chimpanzees. Science 188: 107-16 Kitano T, Liu YH, Ueda S, Saitou N (2004) Human-specific amino acid changes found in 103 protein-coding genes. Mol Biol Evol 21: 936-44 Kleinjan DJ, van Heyningen V (1998) Position effect in human genetic disease. Hum Mol Genet 7: 1611-8 Kobayashi M, Yu RT, Yasuda K, Umesono K (2000) Cell-type-specific regulation of the retinoic acid receptor mediated by the orphan nuclear receptor TLX. Mol Cell Biol 20: 8731-9. Kohn Y, Lerer B (2005) Excitement and confusion on chromosome 6q: the challenges of neuropsychiatric genetics in microcosm. Mol Psychiatry 10: 1062-73 Koide R, Ikeuchi T, Onodera 0, Tanaka H, Igarashi S, Endo K, Takahashi H, Kondo R, Ishikawa A, Hayashi T, et al. (1994) Unstable expansion of CAG repeat in hereditary dentatorubral-pallidoluysian atrophy (DRPLA). Nat Genet 6: 9-13 Koller G, Bondy B, Preuss UW, Bottlender M, Soyka M (2003) No association between a polymorphism in the promoter region of the MAOA gene with antisocial personality traits in alcoholics. Alcohol Alcohol 38: 31-4  174  Kornack DR, Rakic P (1998) Changes in cell-cycle kinetics during the development and evolution of primate neocortex. Proc Natl Acad Sci U S A 95: 1242-6 Kreitman M (2000) Methods to detect selection in populations with applications to the human. Annu Rev Genomics Hum Genet 1: 539-59 Krezel W, Ghyselinck N, Samad TA, Dupe V, Kastner P, Borrelli E, Chambon P (1998) Impaired locomotion and dopamine signaling in retinoid receptor mutant mice. Science 279: 863-7 Krug EG, Mercy JA, Dahlberg LL, Zwi AB (2002) The world report on violence and health. Lancet 360: 1083-8 Kuchna I (1994) Quantitative studies of human newborns' hippocampal pyramidal cells after perinatal hypoxia. Folia Neuropathol 32: 9-16 Kulikov AV, Osipova DV, Naumenko VS, Popova NK (2005) Association between Tph2 gene polymorphism, brain tryptophan hydroxylase activity and aggressiveness in mouse strains. Genes Brain Behav 4: 482-5 Kumar A, Blanton SH, Babu M, Markandaya M, Girimaji SC (2004) Genetic analysis of primary microcephaly in Indian families: novel ASPM mutations. Clin Genet 66: 341-8 Kumar A, Markandaya M, Girimaji SC (2002) Primary microcephaly: microcephalin and ASPM determine the size of the human brain. J Biosci 27: 629-32 Kumar R (2003) Violence begets violence; or does it? A brain enzyme protects victims of childhood abuse from becoming antisocial and criminal. Clinical Genetics 63: 180-183  175  Kumar RA, Chan KL, Wong AH, Little KQ, Rajcan-Separovic E, Abrahams BS, Simpson EM (2004) Unexpected embryonic stem (ES) cell mutations represent a concern in gene targeting: lessons from "fierce" mice. Genesis 38: 51-7 Kumar S, Hedges SB (1998) A molecular timescale for vertebrate evolution. Nature 392: 917-20 Kumar TK, and Nei M. (2004) MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5 Kumari V, Das M, Hodgins S, Zachariah E, Barkataki I, Howlett M, Sharma T (2005) Association between violent behaviour and impaired prepulse inhibition of the startle response in antisocial personality disorder and schizophrenia. Behav Brain Res 158: 15966 Kunugi H, Nanko S, Murray RM (2001) Obstetric complications and schizophrenia: prenatal underdevelopment and subsequent neurodevelopmental impairment. Br J Psychiatry Suppl 40: s25-9 Kunugi H, Takei N, Murray RM, Saito K, Nanko S (1996) Small head circumference at birth in schizophrenia. Schizophr Res 20: 165-70 Laakso MP, Vaurio 0, Koivisto E, Savolainen L, Eronen M, Aronen HJ, Hakola P, Repo E, Soininen H, Tiihonen J (2001) Psychopathy and the posterior hippocampus. Behav Brain Res 118: 187-93 Lachman HM, Nolan KA, Mohr P, Saito T, Volavka J (1998) Association between catechol 0methyltransferase genotype and violence in schizophrenia and schizoaffective disorder. Am J Psychiatry 155: 835-7  176  Laird PW, Zijderveld A, Linders K, Rudnicki MA, Jaenisch R, Berns A (1991) Simplified mammalian DNA isolation procedure. Nucleic Acids Res 19: 4293 Land PW, Monaghan AP (2003) Expression of the transcription factor, tailless, is required for formation of superficial cortical layers. Cereb Cortex 13: 921-31 Lapierre D, Braun CM, Hodgins S (1995) Ventral frontal deficits in psychopathy: neuropsychological test findings. Neuropsychologia 33: 139-51 Lawrie SM, Abukmeil SS (1998) Brain abnormality in schizophrenia. A systematic and quantitative review of volumetric magnetic resonance imaging studies. Br J Psychiatry 172: 110-20 Le WD, Xu P, Jankovic J, Jiang H, Appel SH, Smith RG, Vassilatis DK (2003) Mutations in NR4A2 associated with familial Parkinson disease. Nat Genet 33: 85-9 Leal GF, Roberts E, Silva EO, Costa SM, Hampshire DJ, Woods CG (2003) A novel locus for autosomal recessive primary microcephaly (MCPH6) maps to 13q12.2. J Med Genet 40: 540-2 Lederhendler, II (2003) Aggression and violence: perspectives on integrating animal and human research approaches. Horm Behav 44: 156-60 Lee SC, Yamamoto T, Ueki S (1983) Characteristics of aggressive behavior induced by nucleus accumbens septi lesions in rats. Behav Neural Biol 37: 237-45 Letinic K, Zoncu R, Rakic P (2002) Origin of GABAergic neurons in the human neocortex. Nature 417: 645-9  177  Lettice LA, Heaney SJ, Purdie LA, Li L, de Beer P, Oostra BA, Goode D, Elgar G, Hill RE, de Graaff E (2003) A long-range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly. Hum Mol Genet 12: 1725-35 Levinson DF, Holmans P, Straub RE, Owen MJ, Wildenauer DB, Gejman PV, Pulver AE, Laurent C, Kendler KS, Walsh D, Norton N, Williams NM, Schwab SG, Lerer B, Mowry BJ, Sanders AR, Antonarakis SE, Blouin JL, DeLeuze JF, Mallet J (2000) Multicenter linkage study of schizophrenia candidate regions on chromosomes 5q, 6q, 10p, and 13q: schizophrenia linkage collaborative group III. Am J Hum Genet 67: 652-63 Levitt P, Barbe MF, Eagleson KL (1997) Patterning and specification of the cerebral cortex. Annu Rev Neurosci 20: 1-24 Lewontin RC, Krakauer J (1973) Distribution of gene frequency as a test of the theory of the selective neutrality of polymorphisms. Genetics 74: 175-95 Liddle PF (1987) Schizophrenic syndromes, cognitive performance and neurological dysfunction. Psychol Med 17: 49-57 Liddle PF, Morris DL (1991) Schizophrenic syndromes and frontal lobe performance. Br J Psychiatry 158: 340-5 Lieberman J, Jody D, Geisler S, Alvir J, Loebel A, Szymanski S, Woerner M, Borenstein M (1993) Time course and biologic correlates of treatment response in first-episode schizophrenia. Arch Gen Psychiatry 50: 369-76 Lipska BK, Peters T, Hyde TM, Halim N, Horowitz C, Mitkus S, Weickert CS, Matsumoto M, Sawa A, Straub RE, Vakkalanka R, Herman MM, Weinberger DR, Kleinman JE (2006)  178  Expression of DISCI binding partners is reduced in schizophrenia and associated with DISCI SNPs. Hum Mol Genet 15: 1245-58 Liu J, Shi Y, Tang J, Guo T, Li X, Yang Y, Chen Q, Zhao X, He G, Feng G, Gu N, Zhu S, Liu H, He L (2005) SNPs and haplotypes in the S1 00B gene reveal association with schizophrenia. Biochem Biophys Res Commun 328: 335-41 Liu PY, Zhang YY, Lu Y, Long JR, Shen H, Zhao LJ, Xu FH, Xiao P, Xiong DH, Liu YJ, Recker RR, Deng HW (2005) A survey of haplotype variants at several disease candidate genes: the importance of rare variants for complex diseases. J Med Genet 42: 221-7 Liu X, Wu H, Loring J, Hormuzdi S, Disteche CM, Bornstein P, Jaenisch R (1997) Trisomy eight in ES cells is a common potential problem in gene targeting and interferes with germ line transmission. Dev Dyn 209: 85-91 Longo L, Bygrave A, Grosveld FG, Pandolfi PP (1997) The chromosome make-up of mouse embryonic stem cells is predictive of somatic and germ cell chimaerism. Transgenic Res 6: 321-8 Longy M, Coulon V, Duboue B, David A, Larregue M, Eng C, Amati P, Kraimps JL, Bottani A, Lacombe D, Bonneau D (1998) Mutations of PTEN in patients with Bannayan-RileyRuvalcaba phenotype. J Med Genet 35: 886-9 Lopez AD, Murray CC (1998) The global burden of disease, 1990-2020. Nat Med 4: 1241-3 Lyons MJ (1996) A twin study of self-reported criminal behaviour. Genetic of criminal and antisocial behaviour (Ciba Foundation Symposium). Wiley, Chichester, pp 115-128  179  MacDonald AW, 3rd, Pogue-Geile MF, Johnson MK, Carter CS (2003) A specific deficit in context processing in the unaffected siblings of patients with schizophrenia. Arch Gen Psychiatry 60: 57-65 Macgregor S, Visscher PM, Knott SA, Thomson P, Porteous DJ, Millar JK, Devon RS, Blackwood D, Muir WJ (2004) A genome scan and follow-up study identify a bipolar disorder susceptibility locus on chromosome 1q42. Mol Psychiatry 9: 1083-90 Maier W, Lichtermann D, Minges J, Hallmayer J, Heun R, Benkert 0, Levinson DF (1993) Continuity and discontinuity of affective disorders and schizophrenia. Results of a controlled family study. Arch Gen Psychiatry 50: 871-83 Malhotra AK, Goldman D, Mazzanti C, Clifton A, Breier A, Pickar D (1998) A functional serotonin transporter (5-HTT) polymorphism is associated with psychosis in neurolepticfree schizophrenics. Mol Psychiatry 3: 328-32 Mangelsdorf DJ, Thurnmel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, et al. (1995) The nuclear receptor superfamily: the second decade. Cell 83: 835-9 Mann JJ, Malone KM, Nielsen DA, Goldman D, Erdos J, Gelernter J (1997) Possible association of a polymorphism of the tryptophan hydroxylase gene with suicidal behavior in depressed patients. Am J Psychiatry 154: 1451-3 Martinez M, Goldin LR, Cao Q, Zhang J, Sanders AR, Nancarrow DJ, Taylor JM, Levinson DF, Kirby A, Crowe RR, Andreasen NC, Black DW, Silverman JM, Lennon DP, Nertney DA, Brown DM, Mowry BJ, Gershon ES, Gejman PV (1999) Follow-up study on a susceptibility locus for schizophrenia on chromosome 6q. Am J Med Genet 88: 337-43  180  Martynoga B, Morrison H, Price DJ, Mason JO (2005) Foxg 1 is required for specification of ventral telencephalon and region-specific regulation of dorsal telencephalic precursor proliferation and apoptosis. Dev Biol 283: 113-27 Matise MP, Auerbach W, Joyner AL (2000) Production of targeted embryonic stem cell clones. In: Joyner AL (ed)) Gene Targeting: A Practical Approach, Second edn. Oxford University Press, New York, pp 119-126 McConnell SK, Kaznowski CE (1991) Cell cycle dependence of laminar determination in developing neocortex. Science 254: 282-5 McDonald JH, Kreitman M (1991) Adaptive protein evolution at the Adh locus in Drosophila. Nature 351: 652-4 McGuffin P, Rijsdijk F, Andrew M, Sham P, Katz R, Cardno A (2003) The heritability of bipolar affective disorder and the genetic relationship to unipolar depression. Arch Gen Psychiatry 60: 497-502 McQueen MB, Devlin B, Faraone SV, Nimgaonkar VL, Sklar P, Smoller JW, Abou Jamra R, Albus M, Bacanu SA, Baron M, Barrett TB, Berrettini W, Blacker D, Byerley W, Cichon S, Coryell W, Craddock N, Daly MJ, Depaulo JR, Edenberg HJ, Foroud T, Gill M, Gilliam TC, Hamshere M, Jones I, Jones L, Juo SH, Kelsoe JR, Lambert D, Lange C, Lerer B, Liu J, Maier W, Mackinnon JD, McInnis MG, McMahon FJ, Murphy DL, Nothen MM, Nurnberger JI, Pato CN, Pato MT, Potash JB, Propping P, Pulver AE, Rice JP, Rietschel M, Scheftner W, Schumacher J, Segurado R, Van Steen K, Xie W, Zandi PP, Laird NM (2005) Combined analysis from eleven linkage studies of bipolar disorder  181  provides strong evidence of susceptibility Loci on chromosomes 6q and 8q. Am J Hum Genet 77: 582-95 Meincke U, Light GA, Geyer MA, Braff DL, Gouzoulis-Mayfrank E (2004) Sensitization and habituation of the acoustic startle reflex in patients with schizophrenia. Psychiatry Res 126: 51-61 Mekel-Bobrov N, Gilbert SL, Evans PD, Vallender EJ, Anderson JR, Hudson RR, Tishkoff SA, Lahn BT (2005) Ongoing adaptive evolution of ASPM, a brain size determinant in Homo sapiens. Science 309: 1720-2 Meyer J, Johannssen K, Freitag CM, Schraut K, Teuber I, Hahner A, Mainhardt C, Mossner R, Volz HP, Wienker TF, McKeane D, Stephan DA, Rouleau G, Reif A, Lesch KP (2005) Rare variants of the gene encoding the potassium chloride co-transporter 3 are associated with bipolar disorder. Int J Neuropsychopharmacol 8: 495-504 Mignone F, Gissi C, Liuni S, Pesole G (2002) Untranslated regions of mRNAs. Genome Biol 3: REVIEWS0004.1-0004.10 Mignone F, Grillo G, Licciulli F, Iacono M, Liuni S, Kersey PJ, Duarte J, Saccone C, Pesole G (2005) UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs. Nucleic Acids Res 33: D141-6 Millar JK, Wilson-Annan JC, Anderson S, Christie S, Taylor MS, Semple CA, Devon RS, Clair DM, Muir WJ, Blackwood DH, Porteous DJ (2000) Disruption of two novel genes by a translocation co-segregating with schizophrenia. Hum Mol Genet 9: 1415-23  182  Miyawaki T, Uemura A, Dezawa M, Yu RT, Ide C, Nishikawa S, Honda Y, Tanabe Y, Tanabe T (2004) Tlx, an orphan nuclear receptor, regulates cell numbers and astrocyte development in the developing retina. J Neurosci 24: 8124-34 Moberg PJ, Agrin R, Gur RE, Gur RC, Turetsky BI, Doty RL (1999) Olfactory dysfunction in schizophrenia: a qualitative and quantitative review. Neuropsychopharmacology 21: 32540 Mochida GH, Walsh CA (2001) Molecular genetics of human microcephaly. Cuff Opin Neurol 14: 151-6 Mohn AR, Gainetdinov RR, Caron MG, Koller BH (1999) Mice with reduced NMDA receptor expression display behaviors related to schizophrenia. Cell 98: 427-36 Monaghan AP, Bock D, Gass P, Schwager A, Wolfer DP, Lipp HP, Schutz G (1997) Defective limbic system in mice lacking the tailless gene. Nature 390: 515-7 Monaghan AP, Grau E, Bock D, Schutz G (1995) The mouse homolog of the orphan nuclear receptor tailless is expressed in the developing forebrain. Development 121: 839-53 Monuki ES, Walsh CA (2001) Mechanisms of cerebral cortical patterning in mice and humans. Nat Neurosci 4 Suppl: 1199-206 Morreale de Escobar G, Obregon MJ, Escobar del Rey F (2004) Role of thyroid hormone during early brain development. Eur J Endocrinol 151 Suppl 3: U25-37 Morris-Rosendahl DJ, Burgert E, Uyanik G, Mayerova A, Duval F, Macher JP, Crocq MA (1997) Analysis of the CAG repeats in the SCA1 and B37 genes in schizophrenic and bipolar I disorder patients: tentative association between B37 and schizophrenia. Am J Med Genet 74: 324-30  183  Moulson CL, Martin DR, Lugus JJ, Schaffer JE, Lind AC, Miner JH (2003) Cloning of wrinklefree, a previously uncharacterized mouse mutation, reveals crucial roles for fatty acid transport protein 4 in skin and hair development. Proc Natl Acad Sci USA Moynihan L, Jackson AP, Roberts E, Karbani G, Lewis I, Cony P, Turner G, Mueller RF, Lench NJ, Woods CG (2000) A third novel locus for primary autosomal recessive microcephaly maps to chromosome 9q34. Am J Hum Genet 66: 724-7 Murphy HR, Carver MJ, Brooks AS, Kenny SE, Ellis IH (2006) Two brothers with GoldbergShprintzen syndrome. Clin Dysmorphol 15: 165-9 Nadeau JH (2003) Modifier genes and protective alleles in humans and mice. Curr Opin Genet Dev 13: 290-5 Nagy A (2000) Cre recombinase: the universal reagent for genome tailoring. Genesis 26: 99-109 Nahon JL (2003) Birth of 'human-specific' genes during primate evolution. Genetica 118: 193208 Nelson MD, Saykin AJ, Flashman LA, Riordan HJ (1998) Hippocampal volume reduction in schizophrenia as assessed by magnetic resonance imaging: a meta-analytic study. Arch Gen Psychiatry 55: 433-40 Nelson RJ, Chiavegatto S (2000) Aggression in knockout mice. Ilar J 41: 153-62 Nelson RJ, Chiavegatto S (2001) Molecular basis of aggression. Trends Neurosci 24: 713-9 New AS, Buchsbaum MS, Hazlett EA, Goodman M, Koenigsberg HW, Lo J, Iskander L, Newmark R, Brand J, O'Flynn K, Siever LJ (2004) Fluoxetine increases relative metabolic rate in prefrontal cortex in impulsive aggression. Psychopharmacology (Berl) 176: 451-8  184  Nielsen DA, Goldman D, Virkkunen M, Tokola R, Rawlings R, Linnoila M (1994) Suicidality and 5-hydroxyindoleacetic acid concentration associated with a tryptophan hydroxylase polymorphism. Arch Gen Psychiatry 51: 34-8 Nielsen DA, Virkkunen M, Lappalainen J, Eggert M, Brown GL, Long JC, Goldman D, Linnoila M (1998) A tryptophan hydroxylase gene marker for suicidality and alcoholism. Arch Gen Psychiatry 55: 593-602 Nieto M, Schuurmans C, Britz 0, Guillemot F (2001) Neural bHLH genes control the neuronal versus glial fate decision in cortical progenitors. Neuron 29: 401-13 Nishimura M, Naito S, Yokoi T (2004) Tissue-specific mRNA expression profiles of human nuclear receptor subfamilies. Drug Metab Pharmacokinet 19: 135-49 Nolan KA, Volavka J, Mohr P, Czobor P (1999) Psychopathy and violent behavior among patients with schizophrenia or schizoaffective disorder. Psychiatr Sery 50: 787-92 NRNC NRNC (1999) A unified nomenclature system for the nuclear receptor superfamily. Cell 97: 161-3 Numakawa T, Yagasaki Y, Ishimoto T, Okada T, Suzuki T, Iwata N, Ozaki N, Taguchi T, Tatsumi M, Kamijima K, Straub RE, Weinberger DR, Kunugi H, Hashimoto R (2004) Evidence of novel neuronal functions of dysbindin, a susceptibility gene for schizophrenia. Hum Mol Genet 13: 2699-708 Numan M (1974) Medial preoptic area and maternal behavior in the female rat. J Comp Physiol Psychol 87: 746-59 Numan M (1986) The role of the medial preoptic area in the regulation of maternal behavior in the rat. Ann N Y Acad Sci 474: 226-33  185  Nurnberger JI, Berrettini W (1998) Psychiatric Genetics. Chapman and Hall, London Nyberg J, Sandnabba K, Schalkwyk L, Sluyter F (2004) Genetic and environmental (inter)actions in male mouse lines selected for aggressive and nonaggressive behavior. Genes Brain Behav 3: 101-9 Oatridge A, Barnard ML, Puri BK, Taylor-Robinson SD, Hajnal JV, Saeed N, Bydder GM (2002) Changes in brain size with treatment in patients with hyper- or hypothyroidism. AJNR Am J Neuroradiol 23: 1539-44 Okuyama Y, Ishiguro H, Toni M, Arinami T (1999) A genetic polymorphism in the promoter region of DRD4 associated with expression and schizophrenia. Biochem Biophys Res Commun 258: 292-5 Olson EC, Walsh CA (2002) Smooth, rough and upside-down neocortical development. Curr Opin Genet Dev 12: 320-7 Ono H, Shirakawa 0, Nishiguchi N, Nishimura A, Nushida H, Ueno Y, Maeda K (2002) No evidence of an association between a functional monoamine oxidase a gene polymorphism and completed suicides. Am J Med Genet 114: 340-2 Osada N, Hirata M, Tanuma R, Kusuda J, Hida M, Suzuki Y, Sugano S, Gojobori T, Shen CK, Wu CI, Hashimoto K (2005) Substitution rate and structural divergence of 5'UTR evolution: comparative analysis between human and cynomolgus monkey cDNAs. Mol Biol Evol 22: 1976-82 Park N, Cheng R, Juo SH, Liu J, Loth JE, Endicott J, Gilliam TC, Baron M (2005) Absence of psychosis may influence linkage results for bipolar disorder. Mol Psychiatry 10: 235-7  186  Park N, Juo SH, Cheng R, Liu J, Loth JE, Lilliston B, Nee J, Grunn A, Kanyas K, Lerer B, Endicott J, Gilliam TC, Baron M (2004) Linkage analysis of psychosis in bipolar pedigrees suggests novel putative loci for bipolar disorder and shared susceptibility with schizophrenia. Mol Psychiatry 9: 1091-9 Park S, Holzman PS, Goldman-Rakic PS (1995) Spatial working memory deficits in the relatives of schizophrenic patients. Arch Gen Psychiatry 52: 821-8 Parnavelas JG (2000) The origin and migration of cortical neurones: new vistas. Trends Neurosci 23: 126-31 Pattison L, Crow YJ, Deeble VJ, Jackson AP, Jafri H, Rashid Y, Roberts E, Woods CG (2000) A fifth locus for primary autosomal recessive microcephaly maps to chromosome 1q31. Am J Hum Genet 67: 1578-80 Perry W, Minassian A, Feifel D, Braff DL (2001) Sensorimotor gating deficits in bipolar disorder patients with acute psychotic mania. Biol Psychiatry 50: 418-24 Pignoni F, Baldarelli RM, Steingrimsson E, Diaz RJ, Patapoutian A, Merriam JR, Lengyel JA (1990) The Drosophila gene tailless is expressed at the embryonic termini and is a member of the steroid receptor superfamily. Cell 62: 151-63 Posternak MA, Zimmerman M (2002) Anger and aggression in psychiatric outpatients. J Clin Psychiatry 63: 665-72 Prokunina L, Castillejo-Lopez C, Oberg F, Gunnarsson I, Berg L, Magnusson V, Brookes AJ, Tentler D, Kristjansdottir H, Grondal G, Bolstad AI, Svenungsson E, Lundberg I, Sturfelt G, Jonssen A, Truedsson L, Lima G, Alcocer-Varela J, Jonsson R, Gyllensten UB, Harley JB, Alarcon-Segovia D, Steinsson K, Alarcon-Riquelme ME (2002) A regulatory  187  polymorphism in PDCD1 is associated with susceptibility to systemic lupus erythematosus in humans. Nat Genet 32: 666-9 Przeworski M, Hudson RR, Di Rienzo A (2000) Adjusting the focus on human variation. Trends Genet 16: 296-302 Puelles L, Kuwana E, Puelles E, Bulfone A, Shimamura K, Keleher J, Smiga S, Rubenstein JL (2000) Pallial and subpallial derivatives in the embryonic chick and mouse telencephalon, traced by the expression of the genes Dlx-2, Emx-1, Nkx-2.1, Pax-6, and Tbr-1. J Comp Neurol 424: 409-38 Puelles L, Kuwana E, Puelles E, Rubenstein JL (1999) Comparison of the mammalian and avian telencephalon from the perspective of gene expression data. Eur J Morphol 37: 139-50 Puelles L, Rubenstein JL (2003) Forebrain gene expression domains and the evolving prosomeric model. Trends Neurosci 26: 469-76 Quandt K, Frech K, Karas H, Wingender E, Werner T (1995) Matlnd and Matlnspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23: 4878-84 Raine A (1993) The psychopathology of crime. Genetic and crime. Academic Press, San Diego, pp 47-79 Raine A, Buchsbaum M, LaCasse L (1997) Brain abnormalities in murderers indicated by positron emission tomography. Biol Psychiatry 42: 495-508 Raine A, Ishikawa SS, Arce E, Lencz T, Knuth KH, Bihrle S, LaCasse L, Colletti P (2004) Hippocampal structural asymmetry in unsuccessful psychopaths. Biol Psychiatry 55: 18591  188  Raine A, Lencz T, Taylor K, Hellige JB, Bihrle S, Lacasse L, Lee M, Ishikawa S, Colletti P (2003) Corpus callosum abnormalities in psychopathic antisocial individuals. Arch Gen Psychiatry 60: 1134-42 Rakic P (1995) A small step for the cell, a giant leap for mankind: a hypothesis of neocortical expansion during evolution. Trends Neurosci 18: 383-8 Rapoport JL, Addington AM, Frangou S, Psych MR (2005) The neurodevelopmental model of schizophrenia: update 2005. Mol Psychiatry 10: 434-49 Reich DE, Gabriel SB, Altshuler D (2003) Quality and completeness of SNP databases. Nat Genet 33: 457-8 Rijsdijk FV, van Haren NE, Picchioni MM, McDonald C, Toulopoulou T, Pol HE, Kahn RS, Murray R, Sham PC (2005) Brain MM abnormalities in schizophrenia: same genes or same environment? Psychol Med 35: 1399-409 Roberts E, Hampshire DJ, Pattison L, Springell K, Jafri H, Corry P, Mannon J, Rashid Y, Crow Y, Bond J, Woods CG (2002) Autosomal recessive primary microcephaly: an analysis of locus heterogeneity and phenotypic variation. J Med Genet 39: 718-21 Roberts E, Jackson AP, Carradice AC, Deeble VJ, Mannan J, Rashid Y, Jafri H, McHale DP, Markham AF, Lench NJ, Woods CG (1999) The second locus for autosomal recessive primary microcephaly (MCPH2) maps to chromosome 19q13.1-13.2. Eur J Hum Genet 7: 815-20 Ropers HH, Zuffardi 0, Bianchi E, Tiepolo L (1982) Agenesis of corpus callosum, ocular, and skeletal anomalies (X-linked dominant Aicardi's syndrome) in a girl with balanced X/3 translocation. Hum Genet 61: 364-8  189  Ross ME, Walsh CA (2001) Human brain malformations and their lessons for neuronal migration. Annu Rev Neurosci 24: 1041-70 Rosser T (2003) Aicardi syndrome. Arch Neurol 60: 1471-3 Rosso IM, Cannon TD, Huttunen T, Huttunen MO, Lonnqvist J, Gasperoni TL (2000) Obstetric risk factors for early-onset schizophrenia in a Finnish birth cohort. Am J Psychiatry 157: 801-7 Roth DB, Wilson JH (1986) Nonhomologous recombination in mammalian cells: role for short sequence homologies in the joining reaction. Mol Cell Biol 6: 4295-304 Rothermundt M, Ponath G, Molt V (2004) SlOOB in schizophrenic psychosis. Int Rev Neurobiol 59: 445-70 Roy K, Kuznicki K, Wu Q, Sun Z, Bock D, Schutz G, Vranich N, Monaghan AP (2004) The Tlx Gene Regulates the Timing of Neurogenesis in the Cortex. J Neurosci 24: 8333-8345 Roy K, Thiels E, Monaghan AP (2002) Loss of the tailless gene affects forebrain development and emotional behavior. Physiol Behav 77: 595-600 Rozas J, Rozas R (1999) DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15: 174-5 Rudolph KM, Liaw GJ, Daniel A, Green P, Courey AJ, Hartenstein V, Lengyel JA (1997) Complex regulatory region mediating tailless expression in early embryonic patterning and brain development. Development 124: 4297-308 Rujescu D, Giegling I, Bondy B, Gietl A, Zill P, Moller HJ (2002) Association of anger-related traits with SNPs in the TPH gene. Mol Psychiatry 7: 1023-9  190  Rujescu D, Giegling I, Gietl A, Hartmann AM, Moller HJ (2003) A functional single nucleotide polymorphism (V 158M) in the COMT gene is associated with aggressive personality traits. Biol Psychiatry 54: 34-9 Salvi R, Gomez F, Fiaux M, Schorderet D, Jameson JL, Achermann JC, Gaillard RC, Pralong FP (2002) Progressive onset of adrenal insufficiency and hypogonadism of pituitary origin caused by a complex genetic rearrangement within DAX-1. J Clin Endocrinol Metab 87: 4094-100 Sasaki T, Billett E, Petronis A, Ying D, Parsons T, Macciardi FM, Meltzer HY, Lieberman J, Joffe RT, Ross CA, McInnis MG, Li SH, Kennedy JL (1996) Psychosis and genes with trinucleotide repeat polymorphism. Hum Genet 97: 244-6 Schanda H, Knecht G, Schreinzer D, Stompe T, Ortwein-Swoboda G, Waldhoer T (2004) Homicide and major mental disorders: a 25-year study. Acta Psychiatr Scand 110: 98-107 Schedl A, Ross A, Lee M, Engelkamp D, Rashbass P, van Heyningen V, Hastie ND (1996) Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell 86: 71-82 Schimmenti LA, Manligas GS, Sieving PA (2003) Optic nerve dysplasia and renal insufficiency in a family with a novel PAX2 mutation, Argl 15X: further ophthalmologic delineation of the renal-coloboma syndrome. Ophthalmic Genet 24: 191-202 Schmahl W, Knoedlseder M, Favor J, Davidson D (1993) Defects of neuronal migration and the pathogenesis of cortical malformations are associated with Small eye (Sey) in the mouse, a point mutation at the Pax-6-locus. Acta Neuropathol (Berl) 86: 126-35  191  Schneider JA, Pungliya MS, Choi JY, Jiang R, Sun XJ, Salisbury BA, Stephens JC (2003) DNA variability of human genes. Mech Ageing Dev 124: 17-25 Schuback DE, Mulligan EL, Sims KB, Tivol EA, Greenberg BD, Chang SF, Yang SL, Mau YC, Shen CY, Ho MS, Yang NH, Butler MG, Fink S, Schwartz CE, Berlin F, Breakefield XO, Murphy DL, Hsu YP (1999) Screen for MAOA mutations in target human groups. Am J Med Genet 88: 25-8 Schulze TG, McMahon FJ (2002) Genetic association mapping at the crossroads: which test and why? Overview and practical guidelines. Am J Med Genet 114: 1-11 Schwartzberg PL, Robertson EJ, Goff SP (1990) Targeted gene disruption of the endogenous cabl locus by homologous recombination with DNA encoding a selectable fusion protein. Proc Natl Acad Sci USA 87: 3210-4 Seaman MI, Chang FM, Quinones AT, Kidd KK (2000) Evolution of exon 1 of the dopamine D4 receptor (DRD4) gene in primates. J Exp Zool 288: 32-8 Selemon LD, Goldman-Rakic PS (1999) The reduced neuropil hypothesis: a circuit based model of schizophrenia. Biol Psychiatry 45: 17-25 Serretti A, Lilli R, Lorenzi C, Lattuada E, Smeraldi E (2001) DRD4 exon 3 variants associated with delusional symptomatology in major psychoses: a study on 2,011 affected subjects. Am J Med Genet 105: 283-90 Sham PC, Curtis D (1995) An extended transmission/disequilibrium test (TDT) for multi-allele marker loci Ann Hum Genet 59 (Pt 3): 323-36 Shehee WR, Oliver P, Smithies 0 (1993) Lethal thalassemia after insertional disruption of the mouse major adult beta-globin gene. Proc Natl Acad Sci U S A 90: 3177-81  192  Shi J, Xi H, Wang Y, Zhang C, Jiang Z, Zhang K, Shen Y, Jin L, Zhang K, Yuan W, Wang Y, Lin J, Hua Q, Wang F, Xu S, Ren S, Xu S, Zhao G, Chen Z, Jin L, Huang W (2003) Divergence of the genes on human chromosome 21 between human and other hominoids and variation of substitution rates among transcription units. Proc Natl Acad Sci U S A 100: 8331-6 Shi Y, Chichung Lie D, Taupin P, Nakashima K, Ray J, Yu RT, Gage FH, Evans RM (2004) Expression and function of orphan nuclear receptor TLX in adult neural stem cells. Nature 427: 78-83 Shifman S, Bronstein M, Sternfeld M, Pisante-Shalom A, Lev-Lehman E, Weizman A, Reznik I, Spivak B, Grisaru N, Karp L, Schiffer R, Kotler M, Strous RD, Swartz-Vanetik M, Knobler HY, Shinar E, Beckmann JS, Yakir B, Risch N, Zak NB, Darvasi A (2002) A highly significant association between a COMT haplotype and schizophrenia. Am J Hum Genet 71: 1296-302 Sicinski P, Donaher JL, Parker SB, Li T, Fazeli A, Gardner H, Haslam SZ, Bronson RT, Elledge SJ, Weinberg RA (1995) Cyclin Dl provides a link between development and oncogenesis in the retina and breast. Cell 82: 621-30 Simpson EM, Linder CC, Sargent EE, Davisson MT, Mobraaten LE, Sharp JJ (1997) Genetic variation among 129 substrains and its importance for targeted mutagenesis in mice. Nat Genet 16: 19-27 Singer-Sam J, Chapman V, LeBon JM, Riggs AD (1992) Parental imprinting studied by allelespecific primer extension after PCR: paternal X chromosome-linked genes are transcribed  193  prior to preferential paternal X chromosome inactivation. Proc Natl Acad Sci U S A 89: 10469-73 Sinnett D, Beaulieu P, Belanger H, Lefebvre JF, Langlois S, Theberge MC, Drouin S, Zotti C, Hudson TJ, Labuda D (2006) Detection and characterization of DNA variants in the promoter regions of hundreds of human disease candidate genes. Genomics 87: 704-10 Sisodiya SM, Free SL, Williamson KA, Mitchell TN, Willis C, Stevens JM, Kendall BE, Shorvon SD, Hanson IM, Moore AT, van Heyningen V (2001) PAX6 haploinsufficiency causes cerebral malformation and olfactory dysfunction in humans. Nat Genet 28: 214-6 Sklar P, Gabriel SB, McInnis MG, Bennett P, Lim YM, Tsan G, Schaffner S, Kirov G, Jones I, Owen M, Craddock N, DePaulo JR, Lander ES (2002) Family-based association study of 76 candidate genes in bipolar disorder: BDNF is a potential risk locus. Brain-derived neutrophic factor. Mol Psychiatry 7: 579-93 Sluyter F, Arseneault L, Moffitt TE, Veenema AH, de Boer S, Koolhaas JM (2003) Toward an animal model for antisocial behavior: parallels between mice and humans. Behav Genet 33: 563-74 Smith KM, Bauer L, Fischer M, Barkley R, Navia BA (2005) Identification and characterization of human NR4A2 polymorphisms in attention deficit hyperactivity disorder. Am J Med Genet B Neuropsychiatr Genet 133: 57-63 Smithies 0 (2001) Forty years with homologous recombination. Nat Med 7: 1083-6 Soderstrom H, Hultin L, Tullberg M, Wikkelso C, Ekholm S, Forsman A (2002) Reduced frontotemporal perfusion in psychopathic personality. Psychiatry Res 114: 81-94  194  Staal WG, Hulshoff Pol HE, Schnack HG, Hoogendoorn ML, Jellema K, Kahn RS (2000) Structural brain abnormalities in patients with schizophrenia and their healthy siblings. Am J Psychiatry 157: 416-21 Stefansson H, Sarginson J, Kong A, Yates P, Steinthorsdottir V, Gudfinnsson E, Gunnarsdottir S, Walker N, Petursson H, Crombie C, Ingason A, Gulcher JR, Stefansson K, St Clair D (2003) Association of neuregulin 1 with schizophrenia confirmed in a Scottish population. Am J Hum Genet 72: 83-7 Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjornsdottir S, Sigmundsson T, Ghosh S, Brynjolfsson J, Gunnarsdottir S, Ivarsson 0, Chou TT, Hjaltason 0, Birgisdottir B, Jonsson H, Gudnadottir VG, Gudmundsdottir E, Bjornsson A, Ingvarsson B, Ingason A, Sigfusson S, Hardardottir H, Harvey RP, Lai D, Zhou M, Brunner D, Mutel V, Gonzalo A, Lemke G, Sainz J, Johannesson G, Andresson T, Gudbjartsson D, Manolescu A, Frigge ML, Gurney ME, Kong A, Gulcher JR, Petursson H, Stefansson K (2002) Neuregulin 1 and susceptibility to schizophrenia. Am J Hum Genet 71: 877-92 Stefansson H, Steinthorsdottir V, Thorgeirsson TE, Gulcher JR, Stefansson K (2004) Neuregulin 1 and schizophrenia. Ann Med 36: 62-71 Stenman J, Yu RT, Evans RM, Campbell K (2003) Tlx and Pax6 co-operate genetically to establish the pallio-subpallial boundary in the embryonic mouse telencephalon. Development 130: 1113-22 Stenman JM, Wang B, Campbell K (2003) Tlx controls proliferation and patterning of lateral telencephalic progenitor domains. J Neurosci 23: 10568-76  195  Stephens JC, Schneider JA, Tanguay DA, Choi J, Acharya T, Stanley SE, Jiang R, Messer CJ, Chew A, Han JH, Duan J, Carr JL, Lee MS, Koshy B, Kumar AM, Zhang G, Newell WR, Windemuth A, Xu C, Kalbfleisch TS, Shaner SL, Arnold K, Schulz V, Drysdale CM, Nandabalan K, Judson RS, Ruano G, Vovis GF (2001) Haplotype variation and linkage disequilibrium in 313 human genes. Science 293: 489-93 Stern CD (2005) Neural induction: old problem, new findings, yet more questions. Development 132: 2007-21 Stober G, Syagailo YV, Okladnova 0, Jungkunz G, Knapp M, Beckmann H, Lesch KP (1999) Functional PAX-6 gene-linked polymorphic region: potential association with paranoid schizophrenia. Biol Psychiatry 45: 1585-91 Stoltenberg SF, Burmeister M (2000) Recent progress in psychiatric genetics-some hope but no hype. Hum Mol Genet 9: 927-35 Stone JR, Wray GA (2001) Rapid evolution of cis-regulatory sequences via local point mutations. Mol Biol Evol 18: 1764-70 Strakowski SM, Delbello MP, Adler CM (2005) The functional neuroanatomy of bipolar disorder: a review of neuroimaging findings. Mol Psychiatry 10: 105-16 Stranger BE, Forrest MS, Clark AG, Minichiello MJ, Deutsch S, Lyle R, Hunt S, Kahl B, Antonarakis SE, Tavare S, Deloukas P, Dermitzakis ET (2005) Genome-wide associations of gene expression variation in humans. PLoS Genet 1: e78 Straub RE, Jiang Y, MacLean CJ, Ma Y, Webb BT, Myakishev MV, Harris-Kerr C, Wormley B, Sadek H, Kadambi B, Cesare AJ, Gibberman A, Wang X, O'Neill FA, Walsh D, Kendler  196  KS (2002) Genetic variation in the 6p22.3 gene DTNBP1, the human ortholog of the mouse dysbindin gene, is associated with schizophrenia. Am J Hum Genet 71: 337-48 Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T, Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL, Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P, Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH, Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW, Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW, Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U, Smailus DE, Schnerch A, Schein JE, Jones SJ, Marra MA (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci U S A 99: 16899-903 Stringer CB, Andrews P (1988) Genetic and fossil evidence for the origin of modern humans. Science 239: 1263-8 Strous RD, Nolan KA, Lapidus R, Diaz L, Saito T, Lachman HM (2003) Aggressive behavior in schizophrenia is associated with the low enzyme activity COMT polymorphism: a replication study. Am J Med Genet B Neuropsychiatr Genet 120: 29-34  197  Studer M, Filosa A, Rubenstein JL (2005) The nuclear receptor COUP-TFI represses differentiation of Cajal-Retzius cells. Brain Res Bull 66: 394-401 Sur M, Rubenstein JL (2005) Patterning and plasticity of the cerebral cortex. Science 310: 80510 Swanson JW, Holzer CE, 3rd, Ganju VK, Jono RT (1990) Violence and psychiatric disorder in the community: evidence from the Epidemiologic Catchment Area surveys. Hosp Community Psychiatry 41: 761-70 Swayze VW, 2nd, Andreasen NC, Ehrhardt JC, Yuh WT, Alliger RJ, Cohen GA (1990) Developmental abnormalities of the corpus callosum in schizophrenia. Arch Neurol 47: 805-8 Tabares-Seisdedos R, Escamez T, Martinez-Gimenez JA, Balanza V, Salazar J, Selva G, Rubio C, Vieta E, Geijo-Barrientos E, Martinez-Aran A, Reiner 0, Martinez S (2006) Variations in genes regulating neuronal migration predict reduced prefrontal cognition in schizophrenia and bipolar subjects from mediterranean Spain: a preliminary study. Neuroscience 139: 1289-300 Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-95 Tamminga CA, Holcomb HH (2005) Phenotype of schizophrenia: a review and formulation. Mol Psychiatry 10: 27-39 Tanapat P, Hastings NB, Reeves AJ, Gould E (1999) Estrogen stimulates a transient increase in the number of new neurons in the dentate gyms of the adult female rat. J Neurosci 19: 5792-801  198  Tanteles GA, Kurup B, Rauch A, Splitt MP (2006) Microcephaly, lissencephaly, Hirschsprung disease and tetralogy of Fallot: a new syndrome? Clin Dysmorphol 15: 107-10 Theuns J, Brouwers N, Engelborghs S, Sleegers K, Bogaerts V, Corsmit E, De Pooter T, van Duijn CM, De Deyn PP, Van Broeckhoven C (2006) Promoter mutations that increase amyloid precursor-protein expression are associated with Alzheimer disease. Am J Hum Genet 78: 936-46 Thomas KR, Capecchi MR (1990) Targeted disruption of the murine int-1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature 346: 847-50 Tishkoff SA, Verrelli BC (2003) Patterns of human genetic diversity: implications for human evolutionary history and disease. Annu Rev Genomics Hum Genet 4: 293-340 Tivol EA, Shalish C, Schuback DE, Hsu YP, Breakefield X0 (1996) Mutational analysis of the human MAOA gene. Am J Med Genet 67: 92-7 Toyo-Oka K, Sasaki S, Yano Y, Mori D, Kobayashi T, Toyoshima YY, Tokuoka SM, Ishii S, Shimizu T, Muramatsu M, Hiraiwa N, Yoshiki A, Wynshaw-Boris A, Hirotsune S (2005) Recruitment of katanin p60 by phosphorylated NDEL1, an LIS1 interacting protein, is essential for mitotic cell division and neuronal migration. Hum Mol Genet 14: 3113-28 Turecki G (2005) Dissecting the suicide phenotype: the role of impulsive-aggressive behaviours. J Psychiatry Neurosci 30: 398-408 Turecki G, Zhu Z, Tzenova J, Lesage A, Seguin M, Tousignant M, Chawky N, Vanier C, Lipp 0, Alda M, Joober R, Benkelfat C, Rouleau GA (2001) TPH and suicidal behavior: a study in suicide completers. Mol Psychiatry 6: 98-102  199  Turetsky BI, Moberg PJ, Owzar K, Johnson SC, Doty RL, Gur RE (2003) Physiologic impairment of olfactory stimulus processing in schizophrenia. Biol Psychiatry 53: 403-11 Turetsky BI, Moberg PJ, Yousem DM, Doty RL, Arnold SE, Gur RE (2000) Reduced olfactory bulb volume in patients with schizophrenia. Am J Psychiatry 157: 828-30 Uemura A, Kusuhara S, Wiegand SJ, Yu RT, Nishikawa S (2006) Tlx acts as a proangiogenic switch by regulating extracellular assembly of fibronectin matrices in retinal astrocytes. J Clin Invest 116: 369-77 Valverde 0, Mantamadiotis T, Torrecilla M, Ugedo L, Pineda J, Bleckmann S, Gass P, Kretz 0, Mitchell JM, Schutz G, Maldonado R (2004) Modulation of anxiety-like behavior and morphine dependence in CREB-deficient mice. Neuropsychopharmacology 29: 1122-33 van Beveren NJ, van der Spelt JJ, de Haan L, Fekkes D (2006) Schizophrenia-associated neural growth factors in peripheral blood. A review. Eur Neuropsychopharmacol Vanyukov MM, Moss HB, Yu LM, Deka R (1995) A dinucleotide repeat polymorphism at the gene for monoamine oxidase A and measures of aggressiveness. Psychiatry Res 59: 3541 Vasiliev GV, Merkulov VM, Kobzev VF, Merkulova TI, Ponomarenko MP, Kolchanov NA (1999) Point mutations within 663-666 by of intron 6 of the human TDO2 gene, associated with a number of psychiatric disorders, damage the YY-1 transcription factor binding site. FEBS Lett 462: 85-8 Velakoulis D, Pantelis C, McGorry PD, Dudgeon P, Brewer W, Cook M, Desmond P, Bridle N, Tierney P, Murrie V, Singh B, Copolov D (1999) Hippocampal volume in first-episode  200  psychoses and chronic schizophrenia: a high-resolution magnetic resonance imaging study. Arch Gen Psychiatry 56: 133-41 Vervoort VS, Viljoen D, Smart R, Suthers G, DuPont BR, Abbott A, Schwartz CE (2002) Sorting nexin 3 (SNX3) is disrupted in a patient with a translocation t(6;13)(q21;q12) and microcephaly, microphthalmia, ectrodactyly, prognathism (MMEP) phenotype. J Med Genet 39: 893-9 Volavka J, Bilder R, Nolan K (2004) Catecholamines and Aggression: The Role of COMT and MAO Polymorphisms. Ann N Y Acad Sci 1036: 393-8 Wang L, Andersson S, Warner M, Gustafsson JA (2001) Morphological abnormalities in the brains of estrogen receptor beta knockout mice. Proc Natl Acad Sci U S A 98: 2792-6 Wang YQ, Su B (2004) Molecular evolution of microcephalin, a gene determining human brain size. Hum Mol Genet 13: 1131-7 Wang Z, Benoit G, Liu J, Prasad S, Aarnisalo P, Liu X, Xu H, Walker NP, Perlmann T (2003) Structure and function of Nurrl identifies a class of ligand-independent nuclear receptors. Nature 423: 555-60 Warkany J (1981) Microcephaly. In: Warkany J LR, Cohen, MM (ed)) Mental retardation and congenital malformations of the central nervous system. Year Book Medical, Chicago and London, pp 13-40 Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, Antonarakis SE, Attwood J, Baertsch R, Bailey J, Barlow K, Beck S, Berry E, Birren B, Bloom T, Bork P, Botcherby M, Bray N, Brent MR, Brown DG, Brown SD, Bult C, Burton J, Butler J, Campbell RD, Carninci P,  201  Cawley S, Chiaromonte F, Chinwalla AT, Church DM, Clamp M, Clee C, Collins FS, Cook LL, Copley RR, Coulson A, Couronne 0, Cuff J, Curwen V, Cutts T, Daly M, David R, Davies J, Delehaunty KD, Den J, Dermitzakis ET, Dewey C, Dickens NJ, Diekhans M, Dodge S, Dubchak I, Dunn DM, Eddy SR, Elnitski L, Emes RD, Eswara P, Eyras E, Felsenfeld A, Fewell GA, Flicek P, Foley K, Frankel WN, Fulton LA, Fulton RS, Furey TS, Gage D, Gibbs RA, Glusman G, Gnerre S, Goldman N, Goodstadt L, Gratham D, Graves TA, Green ED, Gregory S, Guigo R, Guyer M, Hardison RC, Haussler D, Hayashizaki Y, Hillier LW, Hinrichs A, Hlavina W, Holzer T, Hsu F, Hua A, Hubbard T, Hunt A, Jackson I, Jaffe DB, Johnson LS, Jones M, Jones TA, Joy A, Kamal M, Karlsson EK, et al. (2002) Initial sequencing and comparative analysis of the mouse genome. Nature 420: 520-62 Weickert CS, Straub RE, McClintock BW, Matsumoto M, Hashimoto R, Hyde TM, Herman MM, Weinberger DR, Kleinman JE (2004) Human dysbindin (DTNBP1) gene expression in normal brain and in schizophrenic prefrontal cortex and midbrain. Arch Gen Psychiatry 61: 544-55 Weng L, Brown J, Eng C (2001) PTEN induces apoptosis and cell cycle arrest through phosphoinosito1-3-kinase/Akt-dependent and -independent pathways. Hum Mol Genet 10: 237-42 Wessely S, Castle D (1998) Mental disorder and crime. Arch Gen Psychiatry 55: 86-8 Westberg L, Melke J, Landen M, Nilsson S, Baghaei F, Rosmond R, Jansson M, Holm G, Bjorntorn P, Eriksson E (2003) Association between a dinucleotide repeat polymorphism  202  of the estrogen receptor alpha gene and personality traits in women. Mol Psychiatry 8: 118-22 Wieten W (1995) The Biological Bases of Behavior. In: Wieten W (ed)) Psychology: Themes and Variations, Third Edition. Brooks/Cole Publishing Group, Pacific Grove, pp 94-96 Williams NM, Preece A, Morris DW, Spurlock G, Bray NJ, Stephens M, Norton N, Williams H, Clement M, Dwyer S, Curran C, Wilkinson J, Moskvina V, Waddington JL, Gill M, Corvin AP, Zammit S, Kirov G, Owen MJ, O'Donovan MC (2004) Identification in 2 independent samples of a novel schizophrenia risk haplotype of the dystrobrevin binding protein gene (DTNBP1). Arch Gen Psychiatry 61: 336-44 Willner P (1997) The dopamine hypothesis of schizophrenia: current status, future prospects. Int Clin Psychopharmacol 12: 297-308 Winokur G, Tsuang MT, Crowe RR (1982) The Iowa 500: affective disorder in relatives of manic and depressed patients. Am J Psychiatry 139: 209-12 Wong MT, Fenwick PB, Lumsden J, Fenton GW, Maisey MN, Lewis P, Badawi R (1997) Positron emission tomography in male violent offenders with schizophrenia. Psychiatry Res 68: 111-23 Wood B, Collard M (1999) The human genus. Science 284: 65-71 Woods CG (2004) Human microcephaly. Curr Opin Neurobiol 14: 112-7 Woods CG, Bond J, Enard W (2005) Autosomal recessive primary microcephaly (MCPH): a review of clinical, molecular, and evolutionary findings. Am J Hum Genet 76: 717-28 Wray GA, Hahn MW, Abouheif E, Balhoff JP, Pizer M, Rockman MV, Romano LA (2003) The evolution of transcriptional regulation in eukaryotes. Mol Biol Evol 20: 1377-419  203  Wright IC, Rabe-Hesketh S, Woodruff PW, David AS, Murray RM, Bullmore ET (2000) Metaanalysis of regional brain volumes in schizophrenia. Am J Psychiatry 157: 16-25 Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M (2005) Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. Nature 434: 338-45 Yon H, Yuan W, Velculescu VE, Vogelstein B, Kinzler KW (2002) Allelic variation in human gene expression. Science 297: 1143 Yang Y, Raine A, Lencz T, Bihrle S, LaCasse L, Colletti P (2005) Volume reduction in prefrontal gray matter in unsuccessful criminal psychopaths. Biol Psychiatry 57: 1103-8 Yi S, Ellsworth DL, Li WH (2002) Slow molecular clocks in Old World monkeys, apes, and humans. Mol Biol Evol 19: 2191-8 Young KA, Berry ML, Mahaffey CL, Saionz JR, Hawes NL, Chang B, Zheng QY, Smith RS, Bronson RT, Nelson RJ, Simpson EM (2002) Fierce: a new mouse deletion of Nr2e1; violent behaviour and ocular abnormalities are background-dependent. Behav Brain Res 132: 145-58 Younossi-Hartenstein A, Green P, Liaw GJ, Rudolph K, Lengyel J, Hartenstein V (1997) Control of early neurogenesis of the Drosophila brain by the head gap genes tll, otd, ems, and btd. Dev Biol 182: 270-83 Yu RT, Chiang MY, Tanabe T, Kobayashi M, Yasuda K, Evans RM, Umesono K (2000) The orphan nuclear receptor Tlx regulates Pax2 and is essential for vision. Proc Natl Acad Sci USA 97: 2621-5  204  Yu RT, McKeown M, Evans RM, Umesono K (1994) Relationship between Drosophila gap gene tailless and a vertebrate nuclear receptor Tlx. Nature 370: 375-9 Zaboli G, Gizatullin R, Nilsonne A, Wilczek A, Jonsson EG, Ahnemark E, Asberg M, Leopardi R (2006) Tryptophan Hydroxylase-1 Gene Variants Associate with a Group of Suicidal Borderline Women. Neuropsychopharmacology Zalsman G, Frisch A, King RA, Pauls DL, Grice DE, Gelernter J, Alsobrook J, Michaelovsky E, Apter A, Tyano S, Weizman A, Leckman JF (2001) Case control and family-based studies of tryptophan hydroxylase gene A218C polymorphism and suicidality in adolescents. Am J Med Genet 105: 451-7 Zetterstrom RH, Solomin L, Jansson L, Hoffer BJ, Olson L, Perlmann T (1997) Dopamine neuron agenesis in Nurrl -deficient mice. Science 276: 248-50 Zhang CL, Zou Y, Yu RT, Gage FH, Evans RM (2006) Nuclear receptor TLX prevents retinal dystrophy and recruits the corepressor atrophinl. Genes Dev 20: 1308-20 Zhang J, Webb DM, Podlaha 0 (2002) Accelerated protein evolution and origins of humanspecific features: Foxp2 as an example. Genetics 162: 1825-35 Zhang L, Chang YH, Barker JL, Hu Q, Maric D, Li BS, Rubinow DR (2000) Testosterone and estrogen affect neuronal differentiation but not proliferation in early embryonic cortex of the rat: the possible roles of androgen and estrogen receptors. Neurosci Lett 281: 57-60 Zhang XY, Zhou DF, Zhang PY, Wei J (2000) The CCK-A receptor gene possibly associated with positive symptoms of schizophrenia. Mol Psychiatry 5: 239-40  205  Zheng H, Hasty P, Brenneman MA, Grompe M, Gibbs RA, Wilson JH, Bradley A (1991) Fidelity of targeted recombination in human fibroblasts and murine embryonic stem cells. Proc Natl Acad Sci USA 88: 8067-71 Zhou C, Qiu Y, Pereira FA, Crair MC, Tsai SY, Tsai MJ (1999) The nuclear orphan receptor COUP-TFI is required for differentiation of subplate neurons and guidance of thalamocortical axons. Neuron 24: 847-59 Zhu C, Mills KD, Ferguson DO, Lee C, Maths J, Fleming J, Gao Y, Morton CC, Alt FW (2002) Unrepaired DNA breaks in p53-deficient cells lead to oncogenic gene amplification subsequent to translocations. Cell 109: 811-21  206  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066289/manifest

Comment

Related Items