UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Early interaction between pseudomonas aeruginosa and polarized human bronchial epithelial cells Lo, Andy 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_spring_lo_andy.pdf [ 42.51MB ]
Metadata
JSON: 24-1.0066264.json
JSON-LD: 24-1.0066264-ld.json
RDF/XML (Pretty): 24-1.0066264-rdf.xml
RDF/JSON: 24-1.0066264-rdf.json
Turtle: 24-1.0066264-turtle.txt
N-Triples: 24-1.0066264-rdf-ntriples.txt
Original Record: 24-1.0066264-source.json
Full Text
24-1.0066264-fulltext.txt
Citation
24-1.0066264.ris

Full Text

EARLY INTERACTION BETWEEN PSEUDOMONAS AERUGINOSA AND POLARIZED HUMAN BRONCHIAL EPITHELIAL CELLS  by ANDY LO B.Sc., University of British Columbia, 2002  A THESIS SUBMITED IN PARTIAL FUFFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES  (Microbiology and Immunology)  UNIVERSITY OF BRITISH COLUMBIA January 2008 ©Andy Lo, 2008  Abstract  Pseudomonas is the most common cause of chronic lung infections leading to death in cystic fibrosis patients. While chronic infection is extremely difficult to eradicate, the initial bacterialhost interactions prior to biofilm formation and establishment of chronic infections represents an attractive therapeutic target. It is clear that interaction between pathogens and the host is a very complex process and successful adaptation requires tight control of virulence factor expression. The aim of this project was to look for early changes in P. aeruginosa global gene expression in response to attachment to epithelial cells. P. aeruginosa PA01 was incubated with polarized HBE cells at a MOI of 100 for 4 hours and bacteria attached to epithelial cells (interacting) were collected separately from those in the supernatant (non-interacting). To minimize media effects observed by others, iron and phosphate were supplemented at appropriate levels to avoid expression changes due to limitation of these nutrients, as confirmed in our microarray experiments. Analysis of 3 independent experiments demonstrated that 766 genes were up or down regulated by more than 1.5 fold during attachment. Among these, 371 genes, including ion, oprC, as well as 3 genes in quorum-sensing systems and 9 genes involved in the pmrAB and phoPQ two-component regulatory systems were found to be induced in the interacting bacteria. On the other hand, 395 genes, including oprG outer membrane porin and pscP involved in type III secretion system were down regulated. To understand the roles of these differentially  expressed genes, a cytotoxicity (LDH release) assay was performed and demonstrated that oprG and ion mutants were less capable than the wild type of killing HBE epithelial cells. These findings suggest that, under these interaction assay conditions, regulation of the expression of certain virulence factors provides a potential advantage for successful adaptation. In addition, a mutant lacking a filamentous hemagglutinin like protein was found to be less cytotoxic to HBE  ii  cells and also deficient in A549 epithelial cell binding, indicating that this probable non-pilin adhesin has multiple functions in P. aeruginosa.  iii  Table of Contents Abstract^  ii  Table of Contents ^  iv  List of Tables ^  vi  List of Figures ^  vii  List of Abbreviations ^  viii  1. Introduction ^  1  1.1 Pseudomonas aeruginosa ^  1  1.2 P. aeruginosa in respiratory infection ^  1  1.3 Initial bacterial-host interaction ^  2  1.3.1 Airway epithelium as the first line of defense ^ 1.3.2 P. aeruginosa in initial interaction: Attachment and motility ^ 1.4 Additional virulence factors in P. aeruginosa ^ 1.4.1 Type III secretion systems ^ 1.4.2 Quorum-sensing systems ^ 1.4.3 Iron acquisition ^  3 3 5 5 6 8  1.5 Differential expression of virulence factors for successful adaptation ^  8  1.6 Rationale and experimental goals ^  9  2. Materials and Methods ^  11  2.1 Bacterial strains and growth conditions ^  11  2.2 Cell culture ^  11  2.3 Interaction assay with polarized HBE cells ^  12  2.4 RNA isolation and purification ^  12  2.5 DNA Microarray ^  13  2.6 Real-time PCR ^  14  2.7 Cytotoxicity assay ^  15  2.8 Adhesion assay ^  16  3. Results ^ 3.1 Early changes in global gene expression ^  17 17  3.1.1^Introduction ^ 17 3.1.2 Eukaryotic RNA contamination removal and total RNA amplification ^ 17 3.1.3 Total RNA microarray ^ 20 3.1.4 Prokaryotic rRNA contamination removal and mRNA amplification ^ 21 3.1.5 mRNA Microarray ^ 22 3.1.6 Discovery of additional differentially expressed genes ^ 24 3.2 Cytotoxicity studies ^  26  iv  3.3 Preliminary non-pilin adhesion screening ^ 4. Discussion ^ 4.1 Interaction assay: bacteria collection and RNA processing ^  27 30 30  4.2 Comparison between mRNA and total RNA microarray experiment ^ 32 4.3 Discussion of microarray and Real-time PCR results ^  33  4.4 Genes differentially expressed: Functional correlation ^  35  4.4.1 Up regulation of two-component regulatory systems ^ 4.4.2 Regulation of Type III secretion system, pilus and flagella ^ 4.4.3 Upregulation of Lon Protease ^ 4.4.4 Regulation of outer membrane proteins OprG and OprC ^ 4.4.5 Regulation of quorum-sensing systems ^  35 36 38 39 40  4.5 Comparison to previous bacterial-host interaction studies ^  42  4.6 Regulation of genes involved in cytotoxicity ^  43  4.7 Non-pilin adhesins screening: fluctuations and inconsistency ^  44  4.8 Future areas for study ^  46  4.9 Conclusion ^  47  References ^  50  List of Tables  Table 1. Primer sequences used in this study. ^  15  Table 2. Comparison of mRNA microarray result and total RNA microarray result ^ 23 Table 3. Confirmation of differentially expressed genes using real-time PCR ^  24  Table 4. Discovery of two-component regulatory systems up regulation ^  25  Table 5. Mutants selected for prelimin. ary non-pilin adhesin screening ^  28  Supplementary Table S-1. Genes up-regulated in interacting bacteria ^  58  Supplementary Table S-2. Genes down-regulated in interacting bacteria ^  68  vi  List of Figures Figure 1. Reduction of eukaryotic RNA contamination by RLT-pretreatment ^  18  Figure 2. Elimination of eukaryotic RNA contamination using MICROBEnrich kit. ^ 19 Figure 3. Removal of prokaryotic rRNA contamination using the MICROBExpress kit. ^ 21 Figure 4. mRNA amplification using the MessageAmp II-Bacteria RNA amplification kit after MICROBExpress kit removal of prokaryotic rRNA contamination ^  22  Figure 5. Assessment of cytotoxicity induced by P. aeruginosa at MOI of 50 in HBE cells. ^ 27 Figure 6. Preliminary screening of bacteria adhesion to the A549 human epithelial cell line. ^ 29 Figure 7. Schematic illustration of sample collection in the interaction assay ^  32  vii  List of Abbreviations AIDS^acquired immune deficiency syndrome ATCC^American Type Culture Collection CF^cystic fibrosis CFTR^cystic fibrosis transmembrane conductance regulator DMEM^Dulbecco's Modified Eagle Medium DNA^deoxyribonucleic acid FBS^fetal bovine serum HBE^human bronchial epithelial IL-^interleukin LDH^lactate dehydrogenase LP S^lipopolysaccharide MIC^minimum inhibitory concentration MEM^minimum essential medium MOI^multiplicity of infection NF-KB^nuclear factor KB PBS^phosphate buffered saline RNA^ribonucleic acid RT-PCR^real-time polymerase chain reaction QS^Quorum-sensing T3SS^type III secretion system  viii  1. Introduction 1.1 Pseudomonas aeruginosa P. aeruginosa is a ubiquitous Gram-negative bacterium. Since approximately 10% of genes  encoded by its genome are involved in metabolism (107), P. aeruginosa can grow under both aerobic and anaerobic conditions, and can also utilize many different energy sources such as sugars, amino acids, alcohols, amines, small aromatic compounds, fatty acids, dicarboxylic acids and other organic acids (106). P. aeruginosa also demonstrates high intrinsic resistance to a range of antimicrobial agents (43). While the major element underlying this resistance is its low membrane permeability, which is significantly lower than that of E. coli (75), multidrug efflux systems further enhance the resistance by reversing uptake and thus preventing drug access to bacterial targets (100). In addition, P. aeruginosa is renowned for its possession of an impressive array of virulence factors including pilus, flagella, exotoxins, and type III secretion systems that allows the bacteria to compete to other organisms for survival (95). As a result, P. aeruginosa can colonize and successfully adapt to many different environments.  1.2 P. aeruginosa in respiratory infection As an opportunistic human pathogen, P. aeruginosa is capable of infecting immunocompromised individuals such as victims suffering from trauma or severe burns as well as patients with diseases including cancer, diabetes, AIDS, and cystic fibrosis (2, 8, 28, 105). P. aeruginosa can cause acute infections in patients with damaged airways by colonizing the injured respiratory tract, breaking down lung defenses and entering the bloodstream (95). Such infections can often lead to acute pneumonia and sepsis, resulting in rapid death of patients within hours or days (95).  1  P. aeruginosa is also the most common cause of chronic lung infections leading to death in cystic fibrosis patients (1). P. aeruginosa pathogenesis in chronic lung infection could be divided into four stages (88). In brief, (a) when P. aeruginosa first enter CF lungs, the bacteria often exhibit a non-mucoid phenotype and resemble motile environmental isolates. (b) Following the initial bacterial-host interaction and colonization, microcolonies are formed. (c) As the number of bacteria and cell density increases, quorum-sensing systems become activated and induce the expression of genes involved in biofilm formation (19, 49). (d) Over the course of infection and as the biofilm matures, gene mutations accumulate and bacteria exhibiting increased antibiotic resistance and reduced immunostimulatory potential are selected (102, 103). P. aeruginosa in mature biofilms is persistent and can live in the host for decades. In this chronic form of infection, although P. aeruginosa is usually found to be less cytotoxic than in acute infections, the bacteria are extremely difficult to eradicate in part due to their conversion to the biofilm state (39, 102). In addition, P. aeruginosa chronic infection in CF leads to not only degeneration in respiratory functions but often is life threatening (54, 86).  1.3 Initial bacterial-host interaction It is clear that acute infections in immunocompromised individuals and chronic infections in CF patients are both devastating, so a preventive measure avoiding infection is of great interest. Understanding the initial bacterial-host interaction prior to establishment of infection would therefore allow potential therapeutic development to clear P. aeruginosa at an early stage of pathogenesis.  2  1.3.1 Airway epithelium as the first line of defense The airway epithelium represents the first line of protection in respiratory infections and is the location where initial bacterial-host interaction takes place. Providing both mechanical and immunological defences (26, 48, 123), the surface of the airways is lined with a layer of highly differentiated polarized epithelial cells covered with airway surface liquid (ASL) and mucous sceretions. In healthy individuals, potential pathogens inhaled into the lung are trapped by this viscous layer and cleared from the lung by mucociliary movement. Tight junctions between cells enhance the mechanical defences by forming a physical barrier that prevents microbial invasion. In addition, airway epithelial cells also participate in the lung innate immunity. For instance, recognition of microbial antigens by Toll-like receptors on epithelial cells can induce production of pro-inflammatory molecules including adhesion molecules, enzyme, cytokines, and chemokines through the Nuclear factor KB (NF-x13) signalling pathways (16, 47). Airway epithelial cells can also produce lysozyme, lactoferrin, as well as host defence (antimicrobial) peptides such as human P-defensins and cathelicidin LL-37 as additional defence mechanisms.  1.3.2 P. aeruginosa in initial interaction: Attachment and motility As airway epithelium is the first barrier in host defences, bacterial attachment to airway epithelial cells is often considered the initial step in pathogenesis. In P. aeruginosa, the type IV pilus is an important adhesin in epithelial cell attachment (27, 119). As pili recognize and bind to asialo-GM1 on host epithelial cells that are abundant in the CF lung epithelium (96), type IV mediated attachment is considered especially important in CF pathogenesis. Other than pili, flagella have also been shown to be an important factor in epithelial attachment. The flagella cap protein FliD can bind to respiratory mucins as well as Muc 1 mucin on epithelial cells (9, 61). Mutants lacking these adhesins demonstrate reduced virulence in model lung infections (33, 3  110).  Despite their prominent role in attachment, pili and flagella are not the sole adhesins in P. aeruginosa since mutants lacking both pili and flagella are still able to adhere to epithelial cells, albeit somewhat less effectively. Indeed, a variety of outer surface-associated structures involved in adherence have been described, including proteins of 75, 62, 89, 38, 28, 18 and 12 kDa (21), fibronectin-binding proteins of 70, 60, 48 and 36 kDa (89) or 50 kDa (92), and mucus binding proteins of 48, 46, 28 and 25 kDa (15). However, the identities of these adhesins remain uncertain. Identifying these non-pilin adhesins would therefore provide novel therapeutic targets to inhibit bacterial attachment to epithelial cells.  Motility is likely another important virulence determinant during initial bacterial-host interaction as it is required for mobilization to the site of infection and for colonization on the host surface.  P. aeruginosa has three different types of motilities including twitching on solid surface, swimming in aqueous environments and swarming on semisolid (viscous) media (44, 55, 68). Since twitching and swimming are mediated by type IV pili and flagella, respectively, these two motilities are probably involved in the initial bacterial-host interaction. However, the requirement of swarming to this early stage of pathogenesis is unclear.  Expression of pili and flagella is , on one hand, essential as these appendages promote attachment, motility, and colonization; however, the presence of these virulence factors might also provoke immune responses and result in bacterial clearance. For example, attachment of type IV pilus to asialo-GM1 activates pro-inflammatory signalling through Toll-like receptor 2 (TLR2) pathway leading to activation of NF-KB and IL-8 production (104). Therefore, 4  expression of virulence factors acts as a double-edged sword in bacterial-host interaction.  1.4 Additional virulence factors in P. aeruginosa In this report, initial interaction is defined as the initial attachment and early colonization preceding the establishment of acute and chronic infections. While bacterial attachment to epithelial cells and motility are believed to be important factors for this early stage of pathogenesis, it is possible that additional virulence factors might also participate to allow, for example, the bacteria to circumvent the host immune response. Unfortunately, information about the factors involved in initial interactions with epithelial cells is limited. In the following sections, a number of virulence factors including cytotoxic effectors, quorum-sensing systems, and iron acquisition are reviewed as they may have an active role in the initial interaction.  1.4.1 Type III secretion systems It has been demonstrated that attachment of bacteria to epithelial cells can activate the type III secretion system of Yesinia and Shigella (50, 71, 93). Although such connections are not as well defined in P. aeruginosa (113), there is a possibility that the type III secretion system in P. aeruginosa might be induced upon epithelial cells contact and hence participate in these initial interactions.  Conserved among a number of Gram-negative pathogens, the type III secretion system (T3SS) is a complex secretion machinery with a syringe-like apparatus that injects effector proteins, such as ExoS, ExoT, ExoU and ExoY (in P. aeruginosa), directly inside the cytosol of the target cells in a contact-dependent manner (74). It has been strongly implicated that expression of the type 5  III secretion system and the effector proteins is important for P. aeruginosa to cause severe disease and mortality in respiratory infections (45, 94). In addition, the T3SS also seems to have an important role in corneal infection since the regulator exsA, and effectors exoT and exoU were found necessary to cause disease (57).  Expression of effector proteins varies among P. aeruginosa strains and clinical isolates. Once inside the target eukaryotic cells, effector proteins can often cause cytotoxicity and interfere with the host cell signal transduction system. For instance, ExoS and ExoT, possessing both Rhodependent GTPase and ADP-ribosyltransferase activities, can alter the host cell physiology by causing disruption of actin filaments (36, 82), thus inhibiting tissue regeneration (11) and inducing apoptosis (53). In addition, these effector proteins were also found to be capable of reducing DNA synthesis, eliminating cell adhesion, and inducing microvillus effacement (78). ExoU, on the other hand, acts as a phospholipase and exerts its cytotoxic effect on host cells by destroying host cytoplasmic membranes (97). Although ExoU is expressed in only 10% of strains isolated from CF patients (22), the presence of ExoU is usually associated with increased virulence and a higher mortality rate in both corneal infection and acute respiratory tract infection (6, 34, 46, 101). Another T3SS effector in P. aeruginosa is ExoY that contributes to bacterial invasion by causing actin depolymerization of epithelial cells (20).  1.4.2 Quorum-sensing systems During initial interaction, P. aeruginosa attaches to and colonizes epithelial cells. Increases in the number of bacteria and the cell density on the epithelial cell surface during this initial attachment may activate quorum-sensing systems. Therefore, it is possible that quorum-sensing may also participate in the early interaction and contribute to the adaptation process. 6  In P. aeruginosa, two quorum-sensing systems, LasRI and Rh1RI, allow bacteria to communicate with each other and coordinate expression of specific genes as a group (114). Normally, P. aeruginosa produces and exports a basal level of autoinducers N-(3-oxo-dodecanoy1)homoserine lactone (3-oxo-C 12-HSL) and N-butanoyl-homoserine lactone (C4-HSL) to the surrounding medium (81). As cell density increases, these HSLs accumulate and are taken up by bacteria where they bind to their cognate transcriptional regulators LasR and Rh1R, not only inducing their own biogenesis but also regulating transcription of over 300 genes in the bacteria (99, 116).  For instance, activation of quorum-sensing systems enhances the expression of various components in the Type II secretion system, including LasAB elastase, exotoxin A, as well as xcpP and xcpR encoding the secretory pathways (116), suggesting that the Type II secretion system might also participate in initial interactions. Unlike the contact-dependent cytotoxicity provided by the T3SS, Type II effector proteins are secreted to the extracellular space and can act remotely from the site of infection. An example of a virulence factor secreted by the Type II secretion system is protease IV, which is considered an important virulence factor in corneal infections (30). Acting as a serine protease to degrade immunoglobulins, complement components, fibrinogen, and plasminogen (29), protease IV also participates in respiratory infections by disrupting the host surfactant mediated defence mechanisms (65). Elastase, another major virulence factor in acute infections, is secreted by the Type II secretion system. This protease can rupture respiratory epithelium and disrupt the integrity of human lung tissue (10, 38). Lastly, Exotoxin A, a potent toxin capable of inhibiting protein synthesis and causing cell  7  death (117), has been shown to be an important virulence factor in corneal infections as mutants lacking this protein are more susceptible to host clearance (84).  In addition to cell density dependent regulation, the activity of quorum-sensing systems is affected by factors such as sigma factor RpoS (98), global regulator GacA (90) and Vfr (5), LuxR-type regulator QscR (18) and VqsR (51), as well as quorum-sensing inhibitor RsaL (23). Furthermore, quorum-sensing systems are often considered important factors in bacterial-host interactions, as mutant lacking these systems show reduced virulence (58, 80, 120).  1.4.3 Iron acquisition Iron is an essential nutrient for both P. aeruginosa and the human host. Although iron is abundant in nature, the availability of assimilatable iron is limited under most physiological conditions (13). It has been shown that during bacterial-host interaction, the availability of iron is usually scarce as iron is actively sequestered and tightly bound by the host factors such as transferrin and lactoferrin (4). To adapt to the host environment, P. aeruginosa produce siderophores, including pyoverdine and pyochelin, to compete with transferrin for iron acquisition (121). Therefore, it is likely that iron acquisition genes are also important virulence factors for successful adaptation during initial bacterial-host interaction.  1.5 Differential expression of virulence factors for successful adaptation Although P. aeruginosa possesses a large number of virulence factors, they are not simply constitutively expressed but are tightly regulated in different situations. In fact, differential expression of these factors is critical as it allows the bacteria to exhibit optimized phenotypes to 8  adapt to different host environments. For example, while the T3SS is important for environmental survival and acute infection, its expression is significantly repressed in chronic infection (102, 103). Similarly, the highly immunogenic flagella, although essential for initial attachment, is suppressed after the colonization step (64, 118). The loss of these immunostimulatory factors in chronic infection reduces host defence responses and therefore contributes to the persistence of chronic infections. It is also interesting to note that, although Exotoxin A is highly expressed in CF lungs, it often contains mutations and shows reduced cytotoxicity in chronic infection (37), reiterating the importance of virulence regulation during bacterial-host interaction.  1.6 Rationale and experimental goals While we know that the bacterial factors involved in motility and attachment are essential in the early stages of P. aeruginosa-host interaction, information regarding the contributions of additional virulence factors remain limited. Two research groups have recently performed microarray experiments trying to examine genes differentially expressed in early bacterial-host interaction (17, 35); however, their findings are somewhat controversial as both studies suffered from certain technical limitations, especially regarding sample collection, RNA contamination, as well as possible medium effects (see Discussion 4.1).  The aim of this study was to identify genes that are essential for initial bacterial-host interactions. To accurately assess the transcriptional profile of P. aeruginosa interacting with epithelial cells, an interaction assay that minimized bias in sample collection was performed. Differential lysis and a number of commercially available kits were employed to remove contamination from RNA samples, and sufficient amounts of bacterial mRNA for microarray experiment were 9  obtained by amplification. Real-time PCR was used to confirm differentially expressed genes identified by microarray studies. To understand the involvement of these genes in damage of epithelial cells, I conducted a time course cytotoxicity assay measuring LDH release induced by P. aeruginosa mutants. Since bacterial attachment is an important factor in initial bacterial-host  interaction, a non-pilin adhesin screening was also performed. Mutants selected from our mutant library were screened for deficiency in A549 epithelial cell attachment. These experiments thus were designed to contribute to a better understanding in the P. aeruginosa early pathogenesis in respiratory tract.  10  2. Materials and Methods 2.1 Bacterial strains and growth conditions P. aeruginosa strains in the PAO1 mini-Tn5 lux (59) and PA14 MrT7 (60) mutant libraries were used in this study. Overnight cultures were inoculated (1:10) in BM2-succinate minimal medium and grown until mid-log phase at 37 ° C for the experiments in this project. For bacterial selections, 100 pg/m1 tetracycline and 50 µg/ml gentamicin were used.  2.2 Cell culture Immortalized human bronchial epithelial cell line 16HBE4o-, a gift from Dr. D. Gruenert (University of California, San Francisco, CA), was cultured in Minimum Essential Medium (MEM) with Earle's salts (Technologies Invitrogen, ON), supplemented with 10% heatinactivated fetal bovine serum (FBS) (Technologies Invitrogen, ON) and 2mM L-glutamine (Technologies Invitrogen, ON). HBE cells with a passage number between 5 to 12 were used in this project and the cells were to routinely cultured to 85-90% confluency in 100% humidity and 5% CO2 at 37 °C.  When indicated, HBE cells were polarized in Corning 6-well Transwell plates (PET Membrane Clear Inserts, 0.4 ptM pore size; Corning, Acton, MA). Approximately 1x10 5 cells in a total of 1.5 ml of MEM supplemented with 10% FBS, 2mM L-glutamine and 1% penicillin/streptomycin (Technologies Invitrogen, ON) were seeded into each Transwell insert. Medium in the insert and the chamber were changed every other day until the HBE cells were polarized after 10-14 days. Cell polarization was monitored by measuring the transepithelial cell resistance with a Milicell electrical resistance system. (Millipore, MA). 11  Cells of the human tumorgenic alveolar epithelial cell line A549, obtained from the American Type Culture Collection (ATCC, VA), were routinely cultured in DMEM (Dulbecco's Modified Eagle Medium) supplemented with 10% heat-inactivated FBS and 2mM L-glutamine (Life Technologies Invitrogen, ON) to 85-90% confluence in 100% humidity and 5% CO2 at 37 ° C. A549 cells with a passage number between 9 to 12 were used in this project.  2.3 Interaction assay with polarized HBE cells P. aeruginosa PAO1 cells grown to the mid-logarithmic phase of growth in BM2-succinate minimal medium were added in triplicate to polarized HBE cells on the apical surface at a multiplicity of infections (MOI) of 100. Based on possible medium effects observed by Schurr and colleagues, 4 mM phosphate, 20 mM FeSO4, and 1 mM sodium citrate were supplemented into the assay medium (MEM containing 2 mM L-glutamine) to avoid iron and phosphate limitation. After 4 hours of incubation, non-interacting bacteria were collected in the supernatant and the polarized HBE monolayers were then washed three times with 2 ml of PBS to remove remaining non-associating bacteria. Bacteria attached to HBE cells were then collected by adding 0.5 mL of RLT lysing buffer. Both interacting bacteria and non-interacting bacteria collected were further processed and purified for microarray experiments and real-time PCR verification.  2.4 RNA isolation and purification Total RNA was isolated using the Qiagen RNeasy Mini kit (Qiagen, MD) and residual genomic DNA was removed using the DNA-free kit (Ambion Inc., TX). Total RNA was further purified 12  using the Ambion MICROBEnrich kit and MICROBExpress kit (Ambion Inc., TX) to remove mammalian RNA contamination and bacterial ribosomal RNA contamination, respectively. Purified prokaryotic mRNA was used as template for a) reverse transcription real-time PCR and b) amplification using Ambion MessageAmp-II Bacterial kit (Ambion Inc., TX) for microarray experiment. RNA samples were stored at -80 ° C with 0.2 U/111 of SUPERase-In RNase inhibitor (Ambion Inc., TX). Integrity of RNA was monitored using the Agilent 2100 Bioanalyzer (Agilent Technologies) and quantity of RNA was measured using the Nanodrop ND-1000 Spectrophotometer (Nanodrop Technologies).  2.5 DNA Microarray To synthesize cDNA for the array experiment, 20 [ig of amplified mRNA was first annealed to 750 ng of random hexamers (NS) 5 (Alpha-DNA, Montreal) for 70 ° C for 10 min and 25 ° C for 10 min. Reaction mixture containing 1,500 U Superscript reverse transcriptase II (Invitrogen Co.), lx Superscript reverse transcriptase II buffer, 3mM amino-allyl dUTP (Ambion, Inc.), 100mM DTT, 10mM (each) dATP, dCTP, and dGTP (Invitrogen Co.), and 20 U SUPERase-In (Ambion, Inc.) was added and incubated for 37 ° C for 1 hr, 42 ° C for 3 hr and 72 ° C for 10min. Residual RNA was hydrolyzed by alkaline treatment and the cDNA product was then neutralized. P.  aeruginosa PAO1 microarray slides were provided by The Institute for Genomic Research (TIGR) Pathogenic Functional Genomics Resource Center (http:/pfgrc.tigr.org/) . cDNA labeling, purification, and hybridization were performed according to TIGR "microbial RNA aminoallyl labeling" protocol (pfgrc.tigr.org/protocols/M007.pdf) and "hybridization of labeled DNA probes" protocol (pfgrc.tigr.org/protocols/M008.pdf) . In brief, treated cDNA and control cDNA were labeled with cyanine-5 and cyanine-3 (GE Healthcare, Canada), respectively and hybridized to the array slides for 18 h in a solution containing 50% formamide, 5x SSC, 0.1% 13  sodium dodecyl sulphate, and 0.6 µg/µl salmon sperm DNA at 42 ° C at 100% humidity. Slides were then washed, dried and scanned using a ScanArray Express scanner and software (Packard BioScience BioChip Technologies). The intensity of hybridization was quantified using ImaGene 6.0 Standard Edition software (BioDiscovery, Inc., EI Segundo, CA). Identity and fold change of differentially expressed genes were determined using the ArrayPipe FPMI version 1.398 protocol (http ://koch. path° genomic s. ca/cgi-bin/pub/arraypipe. pl ) .  2.6 Real-time PCR To synthesize cDNA template for real-time PCR experiments, 1µg of mRNA was mixed with 750 ng of random primers (Invitrogen), heated for 10 min at 70 ° C and incubated for a further 10 min at 25 ° C. The mixture was then added to 0.5 mM dNTPs, 500 U SuperRNase (Ambion), 10 mM DTT and 10,000 U SuperScriptll (Invitrogen). After incubating the reaction mixture at 37  ° C for 1 h and 42 ° C for 2 h, RNA was destroyed by alkaline treatment and the cDNA template was neutralized. Real-time PCR was carried out in 1 x SYBR Green PCR master Mix (Applied Biosystems) mixed with 1 pl and 200nM of forward and reverse primers using a ABI Prism 7000 system (Applied Biosystems). All reactions were normalized to the rpsL gene encoding the 30S ribosomal protein S12. RT-PCR primers used in this study were synthesized by A1phaDNA (Montreal, QC, Canada) and are listed in Table 1.  14  Table 1. Primer sequences used in this study. PA 0221 0921 1079 1179 1180 1343 1559 1695 1701 1713 1721 1724 1803 2664 3620 3790 3805 4067 4086 4552 4776 4777 4781 4782 5117  Gene Aminotransferase phoPQ regulated flgD phoP phoQ phoPQ regulated pmrAB regulated pscP T3SS related exsA pscH pscK ion fhP mutS oprC pilF oprG cupB1 pilW pmrA pmrB pmrAB regulated pmrAB regulated typA  Forward Sequence (5' — 3') Reverse Sequence (3' — 5') GCTGGAACAACTGCCGTACT TAGATCGCGTGGCTGTAGTG (69) (69) ATGAGCATCGATAACGTCAG AGCAGCTTGAGGAATTCGTC GAATACCTCATGCGGCATCA CGGGATAGAGCTGTTCCATCA CGCGGCAACGAATTCC ACGTCGAACACGAAGAACTCCT (69) (69) (69) (69) AGCTGAACGCCGTGGATAC TTCGAAGGCGATCTGCTG CAGCAAACCTTTCTCCTCCA ACTCCAGGTCGAGTTTGTGG ATGCAAGGAGCCAAATCTCT CATATACGCCCTCTTCCTTG CGAATACCTGGCGCAACTG TGTCGAGCATGCCGTTGA CATCCACGAGTCGCACCTAC GCAGTCCAATTCCAGTTGCT CGGCGACAAGCAAATCCT ATGCGGTACAGGCCATCTTC ATTTCTACCGCACCATGCTC AGTTCCTGCAACTGGTCGAT CGACCTCTCCCAGCACAC GCGTCCTCGTAGAACAGCTC GCCGCTTTCAGCTTCGAC TCCTGGTGCTGTGAGTGTTC GACGAGCGGAGATCAGAATC CGAGGCCAAGCTGGATATAG AAGTCCTGGCTTACCGCTTC AGCTTGATGTCGGAACTGCT CGCCGATCCCGAAGAAAT CGCTACCCAGTTTGACGTTGA GCCTGTCCATGATCGAACTA GTAGTTGCGCTTGTTGTCCA AATACTGCTGGCCGAGGAC AGGTCGAACTCGTCGGTGAC CATCGACGGCTTCCAGATC CAGCGGGAACAGCGAGTAG (69) (69) (69) (69) GGAAAGCGAGCGGGTGAT GTGTTCTTCGCCAGGATGGT  2.7 Cytotoxicity assay Human bronchial epithelial cells 16HBE14o" were seeded in 24 well plates (Sarstedt, Newton, USA) at a density of 5x10 4 cells per well and grown to a confluent monolayer for approximately 48 hours at 37 ° C in 5% CO2 in MEM supplemented with FBS and 2 mM L-glutamine. P. aeruginosa PAO1 grown to mid-log phase were added to the HBE cells at a MOI of 50 in triplicate and incubated for 4, 7, and 9 h. Supernatants collected at each time point were centrifuged at 10,000 x g for 2 min and were stored at 4 °C for up to 24 hours. The level of lactate dehydrogenase activity (LDH) in each sample was assayed in triplicate using the colorimetric Cytotoxicity Detection Kit (Roche, Mannheim, Germany). HBE cells treated with 15  1% Triton X-100 (Sigma, Canada) served as a positive control for maximum LDH release and HBE cells without treatment served as a negative control.  2.8^Adhesion assay A549 cells were seeded in 6 well plates at a density of 1.5x10 5 and grown in DMEM containing both 2mM of L-glutamine and 10% FBS to a confluent monolayer for approximately 48 hours at 37 ° C in 5% CO 2 . Immediately before the adhesion assay, confluent A549 cells were washed once with PBS and the medium was replaced with assay medium (DMEM containing Lglutamine). P. aeruginosa grown to mid-log phase was added to A549 cells at an MOI of 100 and incubated for 1 hour. Adhering bacteria were released from the monolayer by the addition of Triton X-100 and were enumerated by serial dilution and plate counting.  16  3. Results 3.1^Early changes in global gene expression 3.1.1 Introduction Although an array of virulence factors have been characterized in P. aeruginosa, their expression and contribution to host cell interaction and invasion during the initial stages of pathogenesis remains unclear. To assist in the evaluation of these factors, and specifically the gene responses accompanying bacterial interaction with epithelial cells, I utilized global gene expression analysis by microarray. An interaction assay was performed with modifications specifically designed to avoid responses to nutrient insufficiencies and interference by mammalian RNA contamination. I also developed an RNA isolation, purification and amplification workflow that permitted preparation of enriched prokaryotic mRNA for the microarray experiment and realtime PCR confirmation experiment to investigate the effect of epithelial cell attachment on P.  aeruginosa PA01 gene expression.  3.1.2 Eukaryotic RNA contamination removal and total RNA amplification To reduce eukaryotic RNA contamination in the interacting bacteria, I adopted the RLTpretreatment preferential lysis procedure, which has been shown to have negligible interference with E. coli microarray experiments (25). Lanes 1 and 4 in Figure 1 represent RNA isolated from  HBE cells alone and P. aeruginosa alone, respectively. Lane 2 shows RNA isolated without RLT-pretreatment and indicates a significant amount of 28S and 18S eukaryotic RNA contamination in the RNA sample. In contrast, lane 3 shows a significant reduction in mammalian RNA contamination after RLT-pretreatment. 17  Since RLT alone effectively lysed HBE cells but not the gram-negative P. aeruginosa, the differential lysis plus the subsequent centrifugation step successfully retained intact bacteria in the sample while reducing the collection of eukaryotic RNA leaking out from the disrupted HBE cells in the final RNA sample. 1  ^  2^3^4  Figure 1. Reduction of eukaryotic RNA contamination by RLT-pretreatment. RNA samples were analyzed using a 1.5% agarose gel run at 150 volts for 30 min. RNA were isolated from a mixture of P. aeruginosa and HBE cells before (lane 2) and after (lane 3) RLTpretreatment. RNA isolated from HBE cells alone (lane 1) and P. aeruginosa alone (lane 4) were used as reference.  To further purify the RNA sample, the MICROBEnrich kit was employed to capture human mRNA and rRNA by hybridization. The residual 28S eukaryotic rRNA found in the sample treated with the RLT differential lysis was completely eliminated in the RNA samples after the MICROBEnrich treatment (Figure 2). The purity of prokaryotic RNA was verified by the lack of eukaryotic rRNA bands. The quality of the prokaryotic RNA was subsequently confirmed by the rRNA band ratio > 1.7.  18  Figure 2. Elimination of eukaryotic RNA contamination using MICROBEnrich kit. RNA sample treated with MICROBEnrich kit was analyzed using Agilent Bioanalyzer 2100. Since each Transwell provided only 0.5 gg of RNA but approximately 12 to 15 pg of prokaryotic total RNA was required for a single microarray experiment, attempts were made to improve the yield. At first, six-well Transwell plates (insert membrane growth area size = 4.67 cm 2 ) were replaced with 100mm Transwell dishes (insert size of 44 cm 2 ), so that more bacteria could be added to a larger surface area of polarized HBE cells without altering the multiplicity of infection (MOI). However the monolayers of polarized HBE on the Transwell dishes were more fragile and failed to tolerate the bacterial infections and extensive washes during sample collection. Another attempt to improve the yield was made by increasing the scale of the experiment and collecting RNA from 24 Transwells. However, the RNA isolated was found to be significantly degraded (rRNA ratio < 1.4; data not shown) probably due to the length of the experiment and bacterial RNA instability.  In the end it was decided to maintain the original scale of the interaction assay and employ RNA amplification to prepare sufficient RNA for the microarray experiment. A bacterial RNA amplification protocol developed by The Institute of Genomic Research (TIGR) was tried. Unfortunately, the desired amplification could not be achieved since the TIGR protocol was not sufficiently optimized for efficient bacterial RNA amplification (data not shown). Therefore the 19  Ambion MessageAmp bacteria II amplification kit was chosen. This commercial amplification kit provided very consistent and successful RNA amplification (approximately 600 to 1000 fold). The average size of the amplified total RNA was found to be around 900nt (data not shown), matching the anticipated size as suggested by the kit manufacturer.  3.1.3 Total RNA microarray  Total RNA microarray were performed to examine the transcriptome profile of P. aeruginosa during bacterial-host interaction compared to non-interacting bacteria, using samples collected from five biological repeats (independent experiments performed on separate days). Analyses of the microarray slides indicated that 88 genes were differentially expressed with a fold change above 1.5 (Data not shown). Among these, 45 genes were found to be down regulated and 43 genes were found to be up regulated. Ten genes (rpoD, tolQ, flgD, fleS, lasR, exsD, pilA, pilR, typA, and cycB) were selected for real-time PCR confirmation but their expression was not found  to be significantly different under the selected conditions. One possible explanation for the failure of real-time PCR confirmation was the potential problem of interference by other RNA species. Since bacterial ribosomal RNA was the major species found in the total RNA sample prior to amplification, it was concluded that the concentration of rRNA was further enriched by amplification and become more dominant in the sample, interfering with subsequent microarray analysis. It seems possible that the amplified rRNA could significantly influence the hybridization of the minority yet critical mRNA molecules to the array slides. To tackle this problem, I included an additional step to remove the prokaryotic rRNA contamination.  20  3.1.4 Prokaryotic rRNA contamination removal and mRNA amplification A MICROBExpress kit with a Pseudomonas module, developed by Ambion, was employed to remove P. aeruginosa ribosomal RNA contamination (Figure 2). A significant amount of the rRNA in the sample was removed by the MICROBExpress treatment (Figure 3).  38  Figure 3. Removal of prokaryotic rRNA contamination using the MICROSExpress kit. RNA sample treated with MICROBExpress kit was analyzed using Agilent Bioanalyzer 2100. The purified mRNA was then amplified (1000x fold) using MessageAmp kit for microarray experiment. The shape of the size distribution curve of the amplified mRNA (Figure 4) matches the expected profile suggested by the amplification kit protocol.  After rRNA removal amplification of the residual RNA sample gave a broad band that was more typical of mRNA. It is worth noting that both interacting and control non-interacting samples were subjected to the same treatments.  21  fl  te e  Figure 4. mRNA amplification using the MessageAmp II-Bacteria RNA amplification kit after MICROBExpress kit removal of prokaryotic rRNA contamination. mRNA amplified with MessageAmp II-Bacteria RNA amplification kit was analyzed using Agilent Bioanalyzer 2100.  3.1.5 mRNA Microarray RNA samples collected from three independent interaction assays were isolated and processed for mRNA microarray experiments as described in Materials and Methods. A total of 766 genes were found to be significantly differentially expressed (p<0.05 by Student's t-test) with a fold change greater than 1.5 upon epithelial cell interaction, when compared to non-interacting bacteria (Supplementary table 1 and 2). Among these genes, 215 genes exhibited fold changes greater than 2.0.  Results obtained from the mRNA microarray and total RNA microarray are compared in Table 2. The number of genes identified by the microarray using enriched mRNA was substantially greater than that identified by the total RNA microarray suggesting a more efficient mRNA hybridization after rRNA contamination removal.  22  Table 2. Comparison of mRNA microarray result and total RNA microarray result  Fold change > 2.0 Fold change > 1.5  Up-regulation Down-regulation Up-regulation Down-regulation  mRNA microarray (3 slides) 102 113 371 395  Total RNA microarray (5 slides) 25 30 45 43  For confirmation, 14 genes identified only in the mRNA-enriched microarray and 1 gene (typA) identified in both microarray experiments were selected and tested using real-time PCR. Of the 14 genes identified only in the mRNA-enriched microarray, 10 were successfully confirmed (Table 3), verifying their differential expression during the initial interaction assay. On the other hand, the change in typA expression, that was found to be 1.7 fold down regulated in the mRNAenriched and 1.6 fold down regulated in the total RNA array, was determined to be not significant (i.e. fold change below 1.5) using the more accurate method of Real-time PCR. Three additional type III secretion system genes that were not observed to be differentially regulated on the microarrays were also tested using Real-time PCR. However, none of these additional T3SS genes showed any significant fold change, confirming these negative microarray results (Table 3).  23  Table 3. Confirmation of differentially expressed genes using real-time PCR  4776 4552 3805 3790 4067 1430 1431 3476 2664 0221 3006 3620  Gene Name pmrA pilW pilF oprC oprG lasR rsaL rhll fhp psrA mutS  5117  typA  1695 1701 1713 1721 1724  pscP exsA pscH pscK  PA number  Description  mRNA array  RT-PCR  TCR response regulator Pilus biogenesis Pilus biogenesis Outer membrane porin Outer membrane porin QS transcriptional regulator QS inhibitor QS autoinducer synthesis Flavohemoglobin Aminotransferase Transcriptional regulator DNA repair system Regulatory protein (swarming motility) T3SS biogenesis T3SS biogenesis T3SS regulatory protein T3SS biogenesis T3SS biogenesis  1.6 2.4 -2.0 4.3 -5.8 1.5 3.1 1.8 -3.2 10.9 -1.8 -1.9  4.4 3.9 N/S 51.4 -8.7 3.4 3.3 4.2 -49.2 1.8 N/S N/S  -1.7  N/S  -2.2 -1.9 N/S N/S N/S  -1.9 N/S N/S N/S N/S  N/S indicates not significant as the fold change detected was below 1.5 fold change.  3.1.6 Discovery of additional differentially expressed genes Fifteen additional genes absent from the mRNA microarray results were also selected for study using Real-time PCR. Two of these genes (Ion and cupB1) were selected based on the interests of our laboratory and a third gene ( f IgD) was selected because it was identified in the total RNA microarray (8.0 fold up regulated) but not the mRNA microarray. In addition, due to the confirmation of pmrA and oprH as being up regulated in the initial real-time PCR experiment (Table 3) and our interest in the two-component regulatory systems in general, 10 additional genes related to the PhoPQ and PmrAB systems were selected and tested using real-time PCR.  24  Table 4. Discovery of two-component regulatory systems up regulation  PA number  Gene Name  1079  flgD  Description  RN mrra ay A N/S  Flagella biogenesis ATP-dependent protease 1803 ion (involved in motility, biofilm N/S formation, antibiotic resistance) 4086 cupB1 Potential adhesin N/S phoPQ regulated outer membrane 1178 oprH 1.5 protein 1179 phoP TCR response regulator N/S 1180 phoQ TCR sensor kinase N/S 4776 pmrA TCR response regulator 1.6 4777 pmrB TCR sensor kinase N/S pmrAB regulated gene 0921 N/S (hypothetical protein) pmrAB regulated gene 1343 N/S (hypothetical protein) pmrAB regulated gene 1559 N/S (hypothetical protein) pmrAB & phoPQ regulated 3552 pmrB N/S (LPS modification) pmrAB regulated gene 4359 feoA N/S (ferrous iron uptake) pmrAB regulated gene 4781 N/S (uncharacterized response regulator) pmrAB regulated gene 4782 N/S (hypothetical) N/S indicates not significant as the fold change detected was below 1 5 fold change  RT-PCR 1.7 3.3 N/S 4.7 5.0 3.7 4.4 6.3 3.9 5.1 4.0 4.9 N/S 3.6 2.0  Using real-time PCR, Ion was found up regulated in the interacting bacteria by 3.3 fold (Table 4). A moderate induction with a fold change of 1.7 fold was found for the flgD gene and no significant regulation could be measured for the cupBl gene. Although all the 10 additional twocomponent regulatory genes selected were not identified by the microarray experiments, almost all of them except one (feoA) were found to be differentially expressed in the interacting bacteria. The apparent discrepancy in microarray and RT-PCR is further discussed in section 4.3.  25  3.2 Cytotoxicity studies  A cytotoxicity study was carried out to further examine epithelial cell killing and damage induced by P. aeruginosa. Selected genes identified in the initial interaction assay (flgD, typA, ion, oprG, fhp and oprC) as well as genes of interest to our laboratory (fha and psrA) were screened for deficiency in cytotoxicity. Although some of the genes listed have well characterized functions, for instance, the importance of pilus and flagella in attachment and motility (68, 111), the requirement of ion protease in motility and biofilm formation (67), as well as the involvement of two-component regulatory systems pmrAB and phoPQ in peptide resistance in low Mg 2+ condition (69, 70), these genes were tested in the cytotoxicity assay to determine if they have an additional potential role in epithelial cell damage during early interaction.  Cytotoxicity induced by P. aeruginosa was measured as a function of LDH release caused by epithelial cell lysis. All mutants showed similar cytotoxicity levels when compared to the wild type after 4 hours of incubation revealing that, under these assay conditions, the effect of the cytotoxicity deficiency is not observed until a later stage of the interaction. Mutants, including fha, flgD, ion and oprG, were all found less effective in HBE cells damaging after 7.0 hours (Figure 5).  26  Figure 5. Assessment of cytotoxicity induced by P. aeruginosa at MOI of 50 in JIBE cells. Mutants in the indicated genes were incubated with monolayer of HBE cells at a MOI of 50 for 4, 7 and 9 hours at 37 °C. Supernatant was collected at each time point and cytotoxicity was assessed by measuring the release of cytosolic lactate dehydrogenase. Results are expressed as mean values of %LDH released compared to TX 100 treated control ± standard deviation of three independent experiments. Student's t-test analyses were used to compare %LDH release induced by the mutant to that induced by wild type bacteria. * denote p-value < 0.05.  3.3 Preliminary non-pilin adhesion screening Attachment to epithelial cells, usually considered the first step in pathogenesis, is one of the most important requirements in establishment of bacterial infections. In P. aeruginosa, while pilus is the major adhesion factor contributing to epithelial cell attachment, there is evidence suggesting the presence of a number of non-pilin adhesins, albeit their specific roles and/or identities remain unclear (15, 21, 89, 92). The objective of this study was to identify non-pilin adhesins by screening mini-Tn5 lux mutants for deficiency in attachment to A549 human epithelial cells. Twelve mutants were selected from our mini-Tn5 lux mutant library for the adhesion assay (Table 5) based on homology to known adhesins (PA0041, PA0222, PA0413, PA0690 , PA3707, PA4086, PA4541 and PA5498) and/ or possession of type I or II export signal (PA0041, 27  PA0046, PA0222, PA0690, PA3064, PA4086, PA5033, PA5191 and PA5498) as non-pilin adhesins could be surface proteins or exported proteins. A number of mutants with pilus deficiency were tested to serve as a positive control and pilYl was selected as it provided more consistent trend of attachment deficiency in the pilot experiments. PilY1 shares C-terminal homology to the Pi1C2 protein of Neisseria gonorrhoeae and is believed to be a fimbrial tipassociated adhesin (7). It has also been shown that pilYl mutant has significant deficiency in both twitching and swarming motility (79). In addition, mutant in flgL, which has been shown to be essential for both swarming and swimming motility (79), was also tested to determine the role of flagella in epithelial cells binding. Hypothetical protein PA5273 was chosen randomly from the genome to serve as a negative control of the experiment.  Table 5. Mutants selected for preliminary non-pilin adhesin screening PA number  Gene  0041  fha  0046  Hypothetical  0222  Hypothetical  0413  chpA  0690  Hypothetical  1087 3064 3707 4086  flgL pelA wspB cupB1  4541  Hypothetical  4554 5033 5191 5273  pilY1 Hypothetical Hypothetical Hypothetical  5498  Hypothetical  Note 43% similar to regions of filamentous hemagglutinin [B. pertussis]; Type I export signal predicted Type II (lipoprotein) export signal predicted 50% similar to putative mannopine-binding periplasmic protein MotA [A. tumefaciens]; Type I export signal predicted 99% similar to pilL [P. aeruginosa] 38% similar to high-molecular-weight surface-exposed protein [Haemophilus influenzae]; Type I export signal predicted Flagella hook-associated protein Type I export signal predicted 50% similar to pill [P. aeruginosa] Probable fimbrial subunit; Type I export signal predicted 38% similar to high-molecular-weight surface-exposed protein HMW1 [H influenzae] Type IV pilus biogenesis protein Type I export signal predicted Type I export signal predicted Unknown 59% similar to putative adhesin ZnuA [E. coli]; Type I export signal predicted  28  Figure 6. Preliminary screening of bacteria adhesion to the A549 human epithelial cell line. Mutants in the indicated genes were incubated with monolayers of A549 at a MOI of 100 for 1 hour at 37 ° C. The monolayer was then washed 3 times with DMEM. Bacteria were recovered by addition of 0.1% Triton X100 and enumerated by serial dilution and plate counting. Representative experiments are shown. Results are expressed as mean values of number recovered per A549 cells ± standard deviation. Student's t-test was performed to compare the number of mutant cells recovered to the number of wild-type recovered. * denotes p-value < 0.05.  A number of probable non-pilin adhesins were identified. Mutants lacking PA0690, PA0222, PA0041, PA0046 and PA4541 were all found to be less capable of binding to A549 epithelial cells (Figure 6). In addition, the participation of flagella in epithelial cell adhesion was also confirmed. However, these data were considered preliminary due to certain technical difficulties (see Discussion section 4.7)  29  4. Discussion 4.1^Interaction assay: bacteria collection and RNA processing As mentioned in the introduction, two groups have previously investigated the transcriptome profile of P. aeruginosa interacting with epithelial cells, but both studies had certain limitations created by experimental design. When Frisk et al. and colleagues (35) studied the interaction between P. aeruginosa and primary normal human airway epithelial (PNHAE) cells, they extracted a mixture of mammalian and bacterial RNA in their sample for use in their microarray experiments. Thus instead of eliminating mammalian RNA contamination to avoid binding competition, they hybridized a sample containing only PNHAE RNA to the Pseudomonas array chip to permit baseline subtraction. This procedure would likely be problematic because of the intrinsic limitations of accuracy of microarrays, and the fact that the majority of RNA in the interacting bacterial sample was in fact mammalian RNA. The presence of a large amount of mammalian RNA contamination could interfere with the bacterial RNA hybridization by competing with probes on the Pseudomonas array slide and also by potentially binding to the bacteria RNA. In addition, the results of this study were considered controversial because eight genes involved in iron acquisition were found to be repressed 4 hours post-infection. To explain their observations, the authors suggested that P. aeruginosa was able to acquire an ample amount of iron from the epithelial cells during infection. This finding and explanation contradicted a substantial amount of previous data demonstrating that iron is limiting during bacterial-host interaction (41, 72, 109). Although it was not possible to pinpoint the exact source of any potential error, it was believed that the repression of iron acquisition genes observed was not a direct result of epithelial interactions but potentially an artifact of their experimental procedure possibly due to medium effects. To provide a more representative analysis of epithelial interactions, I decided to (a) remove all mammalian RNA contamination in my array experiment 30  to eliminate interference in the microarray hybridization step and (b) to supplement the assay medium to eliminate possible nutrient depletion, such that my experiments would highlight the regulation of gene expression that resulted directly from bacterial-host interaction.  The second published investigation of the effect of epithelial cells on the P. aeruginosa transcriptome expression was by the Greenberg group (17). While the main objective of their project was to examine the differences in gene expression profile upon epithelial cell interaction when comparing a wildtype P. aeruginosa and a Type 3 secretion system mutant, they also compared the gene expression profile of the wild type strain interacting with epithelial cells to the same strain grown overnight in nutrient rich medium. These researchers minimized mammalian RNA contamination by washing the interacting bacteria off the epithelial surface. However the bacterial populations compared were far from ideal as the growth conditions and medium of the two populations compared were quite different.  Therefore, in order to accurately investigate the influence of bacterial-host interaction on bacterial gene expression, I set up my experiments in such a way that both interacting and noninteracting bacteria were collected and compared from the same Transwell in which the bottom of the well was covered with a monolayer of polarized HBE cells (Figure 7). After 4 hours of infection at a MOI of 100, the supernatant layer was collected as the control non-interacting bacteria and, after washing off any bacteria weakly associating with the HBE cells, the strongly attached bacteria remaining at the bottom, together with the mammalian cells, were collected as the interacting bacteria. By doing this, I collected more comparable interacting and noninteracting bacteria that had been exposed to the same culture conditions.  31  Since a mixture of bacteria and mammalian cells were collected together in the interacting bacteria sample, attempts were made to remove the mammalian RNA contamination to avoid interference in the microarray hybridization. To enrich bacterial RNA from the mixture of RNA sample, an RLT-pretreatment differential lysis step was adopted to remove part of the mammalian RNA contamination (25). The remaining mammalian RNA contamination was further eliminated using the Ambion MICROBEnrich kit. Next, prokaryotic ribosomal RNA was removed using the Ambion MICROBExpress kit. Enhanced mRNA were then used as template for a) reverse transcription and real-time PCR analysis, and b) amplification using the Ambion MessageAmp II-bacteria kit for microarray experiment.  HI 03  Non-interactirig Bacteria  Figure 7. Schematic illustration of sample collection in the interaction assay.  4.2 Comparison between mRNA and total RNA microarray experiment Although the exact cause was not known, we believed that the limited success of the total RNA microarray is contributed by the presence of a large amount of amplified rRNA in the sample. In fact, removing rRNA from the total RNA before amplification allowed a more accurate and sensitive mRNA microarray experiment. While only 88 genes were identified in the total RNA to have fold change larger than 1.5 (Table 2), 766 genes were found in the mRNA microarray. A 32  closer inspection of the two results showed that 25 out of 88 genes (i.e. 28%) identified in the total RNA were also present in the mRNA microarray analysis. All except for one (PA4545) of these 25 genes were found to demonstrate regulation in the same direction (up- or down regulation) in the array experiments. The common gene list included mostly hypothetical proteins, as well as typA, rpoD, trpG, efp, rpsP, rpmJ, rplV, comL and rpoZ. Only one of the twenty-five genes common to both lists was tested (typA) using the more sensitive and accurate Real-time PCR, and the differential expression could not be confirmed. There is no evidence indicating any major difference between the two microarray experiments, except that the mRNA microarray showed greater sensitivity.  4.3 Discussion of microarray and Real-time PCR results In the interaction assay, 15 genes were selected from the mRNA microarray result for real-time PCR confirmation (Table 3). Among these genes, 8 of them (pilW, pilF, oprC, oprG, rsaL, fhp, pscP and aminotransferase) showed regulation of greater than two-fold differences in microarray and 7 of these were successfully confirmed using Real-time PCR (87.5% confirmation rate). Most of the genes that failed Real-time PCR confirmation were the ones with a fold change of less than 2.0 in the microarray. Since a fold change of 2.0 is usually considered the cut off point for array analysis, the testing of these genes was pushing the limit of microarray technology. Nonetheless, it should be noted that although pmrA was also found to have a fold change of less than 2.0 by microarray, it was successfully confirmed using real-time PCR. As a result, at least for the 15 genes tested in this project, while a cut off of 2.0 fold change is effective in eliminating many false positive results, this value might fail to report differentially expressed genes such as pmrA in this case.  33  The confirmation of pmrA and oprH induction ultimately led to the discovery of 8 additional differentially expressed genes in the PhoPQ and PmrAB two-component regulatory systems. Since all of these 8 genes were absent in the microarray experiment, the rate of false negatives, at the first glance, is almost alarming. One possible explanation for this high rate of the false negatives is that insufficient repeats of the mRNA microarray were performed. As a result, genes showing no variation in expression level in any one of the triplicate experiments might have a dominated the statistical analysis and such a gene would be more likely to be discarded from the resulting gene list. Therefore, repeating the experiment two more times might have allowed the microarray to identify more genes, especially those showing stronger variations among the original three biological repeats. In addition, basal gene expression levels could also affect the sensitivity of microarray. Genes with low expression levels would exhibit lower mRNA copy numbers in the sample and therefore might not be as readily detected by the microarray due to reduced hybridization to the array slides. In contrast, real-time PCR has a much higher sensitivity and specificity for these same genes, since custom designed primers are used to amplify the mRNA for more accurate and responsive detection. Therefore, another possible explanation for the high rate of false negatives observed could be due to low gene expression levels. Quantification of these genes is required to verify this speculation. Finally, the discrepancy between the microarray result and the RT-PCR confirmation might be accounted for by the potential bias introduced through RNA amplification. However, since most of the genes exhibiting strong fold change in the array (amplified mRNA) could be confirmed by the realtime PCR (original non-amplified mRNA), the amplification step was justified as a sufficient amount of mRNA to perform microarrays would not be available without the magnification.  34  Since three independent biological repeats were tested and all of them showed very similar expression profiles, and because ten related genes belonging to the same two-component regulatory systems were all found to be up-regulated, I have confidence in the results obtained in these initial bacterial-host interaction studies.  4.4 Genes differentially expressed: Functional correlation A number of genes, including components of the PhoPQ and PmrAB two-component regulatory systems, lon protease, pilW and flgD involved in pilus and flagella biogenesis, pscP involved in the Type III secretion system, and outer membrane proteins oprC and oprG as well as rh1I, lasR and rsaL from the quorum-sensing system were all found differentially expression during bacterial-host interaction. Some of these genes were also found to be involved in HBE cytotoxicity. The potential functional correlations of these genes are discussed in this section.  4.4.1 Up regulation of two-component regulatory systems The PhoPQ and PmrAB two-component regulatory systems in P. aeruginosa have previously been shown to be involved in cationic antimicrobial peptide and polymyxin B resistance induced by Mg2+ limitation (40, 62, 63, 70). In addition, the expression of pmrAB, but not phoPQ, is activated by a range of cationic peptides, such as polymyxins B and E, cattle indolicidin and LL37 (70). Although only a modest subset of genes differentially expressed in Mg  2+  limitation are  regulated by PhoP or PmrA, these two systems have regulatory effects on an array of genes, including regulation of oprH-phoP-phoQ, pmrHFIJKLM-ugd operon, PA0921 and PA 1343 by the PhoPQ system, as well as regulation of PA1559-1560, PA4782-4781,feoAB, PA4773-4775pmrAB and pmrHFIJKLM-ugd operons by the PmrAB system (69). In particular, pmrH, which is 35  regulated by both PmrAB and PhoPQ two-component regulatory systems, was found up regulated during epithelial cell interaction. Since the pmrH ugd operon encodes genes -  responsible for adding aminoarabinose to Lipid A on the LPS (73), a modification that occurs in P. aeruginosa isolated from chronic infection in CF lungs (32), the induction of this operon during interaction with epithelial cells indicates that these LPS modification may occur at an early stage of pathogenesis and consequently protect bacteria from peptides in the host environment prior to biofilm formation. On the other hand, feoA was the only tested gene that is regulated by these two-component regulatory systems that showed no significant differential expression during initial bacterial-host interaction. It is possible that the expression of feoA, which is involved in ferrous iron uptake (66), was suppressed as a sufficient amount of iron was made available through iron supplementation of the interaction assay medium.  In this study, we observed the up-regulation of both the PmrAB and PhoPQ two-component regulatory systems during initial bacterial-host interaction. Induction of these two systems might allow the bacteria to become more resistance to antimicrobial peptides including LL-37 and (3defensin produced by the innate immune system. In addition, induction of the pmrH gene would lead to LPS modifications that might have an impact during initial bacterial-host interaction. For example Lipid A modification impacts on recognition by Toll-like receptor 4 (31). Together, the bacteria would be more prepared to evade the host immune response.  4.4.2 Regulation of Type III secretion system, pilus and flagella In this study, differential expression of pilus, flagella and the T3SS system were indicated. Genes involved in pilus (pilW) and flagella (figD) biogenesis were found upregulated by 2.4 and 1.7 fold, respectively (Table 3). PilW is an ancillary protein with pre-pilin like leader sequences 36  (other examples are PilE, PilV, Pi1X, FimT, and FimU) and is required to construct a functional pilus as mutants lacking the pilW gene are phage resistant and twitching deficient (52, 68). On the other hand, flgD is also essential for flagella functions since P. aeruginosa mutants lacking flgD showed a reduction in swimming and swarming motility (79). In fact, it has been shown that in Salmonella, a flgD mutant fails to form functional flagella, since the hook of the flagella cannot be assembled correctly (77). The increased induction of pilus and flagella described here provide supporting evidence that these two systems are important factors in initial interaction possibly by mediating motility and/or attachment. It is interesting to note that out of 37 genes previously found to be required for swarming motility (79), 4 genes were examined in this study for their differential expression in the interacting bacteria. Among them, three (Ion, flgD and rhll) were found upregulated and one gene (typA) was not differentially expressed. Although the data presented in this study may hint a possible role of swarming motility in initial bacterial-host interaction, the association is far from conclusive and further investigations are required.  On the other hand, although it has been proposed that attachment to eukaryotic cells may provide a sufficient signal to activate T3SS (113), my microarray experiment and real-time PCR confirmation demonstrated that pscP was repressed and hence T3SS might not be important during the initial bacterial-host interaction. A region of pscP shares 38% sequence identity with yscP, an important T3SS regulatory factor in Yesinia. YscP acts as a molecular ruler and monitors the length of the T3SS needle (3). When a certain length is achieved, YscP interacts with YscU and switches the substrate specificity from needle subunits (YscF) to Yesinia outer membrane proteins (Yop). Mutants in yscP cannot control the length of the T3SS needles and fail to secret Yops. Therefore, reduced expression of pscP during initial bacterial-host interaction might render the bacteria less cytotoxic as less effector proteins could be exported. However, 37  since exsA and other genes involved in T3SS were not repressed, there was no apparent global regulation of T3SS and it is not possible to judge the impact of such a subtle change in pscP expression on production of the Type III secretion apparatus and Type III effectors during this initial stage of pathogenesis.  It should be noted that, since only isolated genes, instead of complete operons, involved in pilus and flagella biogenesis and the T3SS have been tested for differential expression, further investigations are required to confirm the regulation of these three systems.  4.4.3 Upregulation of Lon Protease Lon is an ATP-dependent protease that is important for cellular functioning by maintaining protein quality control (112). Our laboratory has recently demonstrated that Lon in P. aeruginosa is involved antibiotic resistance as a ion mutant was found more susceptible to ciprofloxacin and expression of ion was induced in the presence of sub-inhibitory ciprofloxacin concentrations (14). In another microarray experiment, Ion was found to be upregulated when bacteria were exposed to sub MIC aminoglycosides (67). Aside from the involvement of protein quality control and antibiotic resistance, ion is also involved in motility and biofilm formation, as P. aeruginosa mutants lacking ion were found to be deficient in swimming, swarming and twitching motility as well as having a reduced capacity to develop biofilms (67).  In this project, Lon protease was found to be upregulated in the bacteria interacting with epithetical cells (Table 4). It is possible that, during initial bacterial-host interaction, the induction of expression of ion reflects the importance of motility in attachment and localization. The contribution of the lon induction to biofilm formation and antibiotic resistance at this early 38  stage of bacterial-host interaction is unclear as biofilms are usually developed after initial colonization and neither ciprofloxacin nor aminoglycosides are present naturally in the assay system. On the other hand, since a tighter regulation of virulence factor expression is critical for successful adaptation to epithelial cell interactions, and Lon is responsible for controlling certain short-lived regulatory proteins that are involved in virulence genes expression (91, 108), another possible benefit of Lon protease induction is therefore modulation of virulence gene expression. It is clear that Lon has multiple roles in pathogenesis and represents a novel therapeutic target in the early bacterial-host interactions.  4.4.4 Regulation of outer membrane proteins OprG and OprC Previously, since OprG was induced when P. aeruginosa is grown in low iron conditions, it has been suggested to be involved in low-affinity iron uptake (15). In fact, expression of OprG could be affected by a large array of conditions including growth phase, growth temperature, Mg 2+ deficiency, presence of certain carbon sources as well as certain lipopolysaccharide alterations (76) . In addition, OprG has also been proposed to be involved in quinolone uptake and susceptibility (85, 115). The current project has provided new insights in characterizing the functions of the OprG porin. Firstly, as a modest deficiency in damaging HBE cells was found for the oprG mutant (Figure 5), OprG seems to be somehow associated with enhancing cytotoxicity, although the mechanism of action remains unknown. In addition, as well as the modest role in enhancing cytotoxicity, it is clear that the presence of epithelial cells also has a regulatory effect on the expression of OprG. OprG is repressed in bacteria interacting with epithelial cells (Table 3), which may be required to suppress its negative effect on bacterial-host interaction. Thus like the T3SS, OprG is an example of down regulation of a gene involved in cytotoxicity, supporting the idea that cytotoxicity might not be desirable the early stages of 39  bacterial-host interaction. Further investigation is required to explore the function of OprG and the mechanism of OprG related cytotoxicity.  OprC, on the other hand, has been described as a channel-forming protein that shows zincbinding specificity. Expression of OprC is repressed under anaerobic condition and regulated by exogenous Cu 2+ concentration (42, 122). Therefore, the substantial upregulation of OprC (51fold; Table 3) observed in this study reflects a possible adaptation to changes in metabolism during epithelial interaction.  4.4.5 Regulation of quorum sensing systems -  As mentioned in the introduction, quorum-sensing systems are important for cell-to-cell communication when cell density is high. Activation of QS systems can regulate expression of a number of virulence factors. In this study, rhlI from the Rh1RI system and the lasR from the LasRI system were found to be upregulated during epithelial cell interaction. This activation is unlikely to have occurred just because of increased cell density of the interacting bacteria as it did not occur in non-interacting bacteria. However in the interaction assay, although only a smaller portion of bacteria was interacting with the epithelial cells, these were confined to the bottom of the Transwell; and it is possible that these interacting bacteria had a higher cell density compared to the non-interacting bacteria. This change in cell density could enrich the local concentration of HSL and contribute to the quorum-sensing system activation. Conversely there are many global regulators that control quorum sensing which has been observed even in logarithmic phase bacteria and upregulatioon of these systems might have been in response to other signals.  40  Another gene rsaL involved in quorum sensing was also confirmed to be upregulated in the interaction assay. RsaL is believed to be a negative inhibitor of the LasRI system as overexpression of RsaL leads to dramatic reduction of 3-oxo-C 12 -HSL (23) and mutants lacking RsaL show significant induction in HSL production (87). It has been shown that RsaL inhibits the LasRI system by competing to LasR for binding to the las] promoter (87). Therefore, the .  induction of rsaL in the interaction assay might actually antagonize the activity of the LasRI system. In particular, elevated level of RsaL ensures individual bacterium only produces a basal level of Iasi so that autoinducer threshold could only be met when a large number of bacteria each producing a small amount of 3-oxo-C 1 2-HSL gather together. This mechanism can ensure cell-to-cell communication and avoid false LasRI activation due to hyper-expression of 3-oxoC12-HSL in a small number of bacteria.  The situation might be different for the Rh1RI systems. LasR bound to HSL can induce expression of Rh1R thus placing the LasRI system hierarchically above the Rh1RI system (83). Although the activity of LasRI might be partially suppressed, this antagonistic effect would not extend to the Rh1RI system as Rh1I gene was found to be upregulated in the interaction assay. It has been suggested that LasRI is more important for cell-to-cell communication during the initial phase of biofilm development when there are a larger number of cells, while the activity of Rh1RI system is more important when the cell density is relatively lower (24). During the initial interaction and under the assay conditions utilized here, it is reasonable to propose that the Rh1RI system may have a more prominent role as the number of bacteria in this situation would be lower than found in microcolonies immediately before biofilm formation. Induction of the rhll and rsaL genes provide supporting evidence for the potential importance of rhll during initial interaction and are consistent with a lesser importance of the LasRI system. Nonetheless, a closer 41  inspection of the microarray results revealed no significant induction of genes known to be controlled by the Rh1RI system suggesting that either the microarray is not sensitive enough to detect these genes or there might be additional factors delaying or impacting on Rh1RI activity. Further experimentation is required to understand the role and functions of the Rh1RI system during the initial bacterial-host interaction.  4.5 Comparison to previous bacterial host interaction studies -  When I first began working on this bacterial-host interaction studies, one clear objective was to eliminate the possible medium effect observed by Schurr and colleagues. Although the exact cause is unknown, there are a few possible reasons to account for their observations, including potential medium effects and/or technical errors such as the interference with hybridization caused by mammalian RNA contamination in the microarray experiment. My goal was to set up an interaction assay and microarray experiment that would highlight the effects of epithelial cell interaction. To do so, I specifically 1) supplemented the assay medium with iron to avoid possible nutrient depletion, 2) used non-interacting bacteria, grown in the same medium, as the control population and 3) developed a protocol that would allow us to prepare enriched Pseudomonas mRNA from a mixture of bacteria and mammalian cells.  While Frisk et al. (35) indicated that there was a significant repression of iron acquisition when they compared RNA isolated from a mixture of bacteria and epithelial cells to RNA isolated from bacteria alone, Chugani and Greenberg (17) obtained the opposite results as they found that iron acquisition genes were induced in the bacteria interacting with epithelial cells when compared to bacteria grown in overnight culture. In contrast, my study suggests that iron acquisition is not significantly regulated by interaction with epithelial cells per se (or affected to 42  the same extent in interacting and non-interacting cells). Comparisons between these findings clearly indicate that the gene expression pattern is sensitive to assay conditions. It should be noted that, although the current study successfully avoided the probable medium effect as observed by Frisk et al. (35), as iron is an essential nutrient and its availability can significant impact the bacterial physiology, the addition of iron to the assay medium could itself introduce changes in the bacteria (12, 56, 109).  4.6 Regulation of genes involved in cytotoxicity. A number of genes identified in the mRNA microarray were further characterized for their involvement in cytotoxicity (Figure 5). Among them, 3 genes (oprG, flgD and ion) were found to have a positive influence in damage of HBE cells based on the suppressive effects of mutants in these genes. It is clear that genes involved in cytotoxicity could be either repressed (oprG) or induced (flgD and ion) in the interacting bacteria suggesting that there is no simple theme in the regulation of these genes during initial bacterial-host interaction. In other words, genes involved in HBE cell damage might not be only regulated for their ability to promote cytotoxicity but might also be affected by other factors.  P. aeruginosa Fha (PA0041), which shares 43% similarity to region of filamentous hemagglutinin in B. pertussis, was involved in both A549 epithelial cell attachment (Figure 6) and HBE cells damage (Figure 5). The reduced cytotoxicity might be a direct result of the reduced numbers of mutant bacteria attaching to the epithelial cells. The reduction of cytotoxicity induced by the flagella mutant (flgD) and the Lon mutant might also be explained similarly as a flagella mutant (figL) was also found to be less capable of epithelial cell attachment. One interesting observation in the cytotoxicity assay was the identification of a 43  modest deficiency in the oprG outer membrane protein mutant, as its involvement in cytotoxicity has not been suggested.  An elevated level of cytotoxicity might not be desirable during the very initial stage of bacterialhost interaction as the resultant triggering of a host immune response would impact on the success of colonization and thus impact on early adaptation. Therefore, based on this speculation, it is possible that, even though the induction of flgD and ion expression would inevitably increase epithelial cell damage and hence incite host immune response, these two genes were upregulated regardless because of their significance in bacterial-host interaction. Thus the induction of flgD would promote more efficient motility and/or attachment while ion induction would promote enhanced motility and subsequently biofilm formation as well as improved protein expression accuracy. All these functions are important factors for successful adaptation as they allow the bacteria to colonize lung epithelial cell surfaces and develop into infections. Further experiments are required to confirm these speculations.  4.7 Non pilin adhesins screening: fluctuations and inconsistency -  It should be noted that the non-pilin adhesin screening reported here suffered from certain technical difficulties and inconsistencies. First, the adhesion assay protocol contained many variables especially in steps such as washing, bacteria re-suspension and serial dilution. Since only a small portion of bacteria, even for the wild type strain, remained attached to the A549 monolayer at the end of the experiment, the differences observed in attachment between bacterial strains tended to be relatively modest compared to the experimental error. Therefore although many experiments were performed, only representative experiments that provided consistent trends are reported in this thesis, and a more reproducible procedure is required to verify these 44  results. Thus these non-pilin adhesion studies are included in this thesis as a record of preliminary results.  A number of probable non-pilin adhesins were identified in this study and one of the important discoveries is the identification of the fha gene. Filamentous hemagglutinin is a major adhesin in B. pertussis. It is required for the bacteria to colonize lower respiratory tract and is important for biofilm formation. In the current study, fha in P. aeruginosa was found to be important for both cytotoxicity in HBE cells and attachment to A549 epithelial cells. Due to the well known role of pilus in adherence (mediating about 50% of attachment to host cells), and to highlight the impact of PA0041 fha on attachment to A549 cells, a PA0041 pilus double mutant was made using PO4 phages. Unfortunately, the assessment of this double mutant in binding deficiency suffered from stronger than usual variation among the 5 experiments performed and a conclusion could not be made until more screening assays are performed. Aside from the filamentous hemagglutinin, another larger outer membrane protein PA0690 (hypothetical protein 38% similar to high molecular weight surface exposed protein in H. influenzae) was also found less capable of binding to A549 epithelial cells.  In this non-pilin adhesin screening, twelve mutants were selected: five of them (PA0041, PA0222, PA0690, PA4086 and PA5498) have both adhesion-like export signal and sequence homology to known adhesins (category 1), four of them (PA0046, PA3064, PA5033 and PA5191) possess adhesion-like export signal alone (category 2), and three of them (PA0413, PA3707 and PA4541) have sequence homology to known adhesins alone (category 3). In category 1, all mutants except PA4086 showed various amount of binding deficiency; this high confirmation rate (80%) justifies the selection criteria. On the other hand, only PA0046 and 45  PA4541 were found deficient in A549 attachment in the other two groups of mutants, making the confirmation rate 25% in category 2 and 33% in category 3.  Since a number of possible adhesins were identified in this project, using more sensitive measurement techniques and constructing a library of non-pilin mutants with defective pilus using PO4 phage selection would allow a more accurate assessment of the role of these factors in epithelial cells attachment. In addition, performing multiple knockouts on a pilus negative strain to create a library of mutants that express single non-pilin adhesins would highlight the binding capacity of each non-pilin adhesin and allow more accurate assessment.  4.8 Future areas for study Although the effect of epithelial cells on the expression profile of P. aeruginosa has been examined in this project and a number of genes were identified as important for initial bacterialhost interaction, the function and benefit of these differential expressions remain largely unclear. Adhesion and cytotoxicity assays might provide additional information about these genes. In addition, although the current study suggests that the expression of pilus (pilW), flagella (figD) and the Type III secretion system (pscP) may be regulated in the interacting bacteria, electron microscopy should be employed to examine the effect of these mutations on the biogenesis and expression of the corresponding systems. Bacteria could also be recovered immediately after the interaction assay to test for changes in phenotypes such as resistance to antimicrobial peptide (mediated by PhoPQ & PmrAB induction) and to ciprofloxacin (mediated by Lon) to confirm the induction of these systems; although it should be noted that recovering the bacteria without introducing changes might be a challenge as detergent is required to release the bacteria from epithelial attachment. Provided a lux transcriptional fusion mutant is present and the lux 46  expression is strong, mutants in the identified genes could be used in an interaction assay and the expression of the gene could be monitored in real time by measurement of luminescence, providing additional supporting evidence for the differential expression. Furthermore, since a working protocol has been successfully developed in this project to study initial bacterial-host interaction between P. aeruginosa PAO1 wild type strain and polarized HBE cell line, interactions between clinical isolates and physiological cells (for instance CF primary epithelial cells) could be studied using this procedure to assess genes important for the early stages of pathogenesis in a more clinically relevant setting. Finally, for genes upregulated in the interacting bacteria, especially ion which seems to have multiple roles in P. aeruginosa pathogenesis, animal model studies of survival rate and infection establishment could be designed to test for their significance in successful adaptation to the host environment.  4.9 Conclusion Differential expression of virulence factors contributes significantly to successful P. aeruginosa adaptation. In the case of acute and chronic lung infections, a subset of genes responsible for cytotoxicity and persistence are tightly regulated so that the bacteria can adapt to the unique challenges in each environment. In this thesis project, the interaction between P. aeruginosa and human bronchial epithelial cells was studied using a variety of techniques. In particular, the effect of epithelial cells on the P. aeruginosa transcriptome profile was studied using microarray experiments, and the involvement of differentially-expressed genes in epithelial cell damage was further characterized using a cytotoxicity assay. In addition, a non-pilin adhesin screening was also carried out to identify factors important for epithelial cell attachment during this early stage of pathogenesis.  47  A number of genes, including ion protease, oprC outer membrane protein, lasI, rsaL and rhlI in quorum-sensing system, as well as a subset of genes in the pmrAB and phoPQ two-component regulatory systems were found to be significantly induced in the bacteria interacting with epithelial cells, revealing the potential importance of these genes in successful adaptation to the host environment. In contrast, oprG outer membrane protein was found to be down-regulated indicating that its expression might be less critical during this stage of pathogenesis. While the function of OprG still remains unclear, the cytotoxicity study performed in this project has provided new insight as a mutant in OprG was found less capable of mediating HBE cell damage. Genes in the pilus, flagella, and the Type III secretion systems were also found regulated; however, since only a single gene was confirmed in each system, further experiments are required to conclude the differential expression of these systems in the interacting bacteria. In addition quorum-sensing systems were found to be upregulated in the interacting bacteria; however, the regulatory effects of these systems on QS controlled factors might not be significant at this stage due to the lack of induction in Rh1RI-regulated genes in the microarray as well as the fact that LasRI system was potentially antagonized by the induction of inhibitory protein RsaL.  Another significant observation in this project was the involvement of Lon protease in cytotoxicity and its induction in P. aeruginosa interacting with epithelial cells. Since Ion has previously been documented to be essential for motility and biofilm formation, it is now clear that this gene has a very important role in pathogenesis and has an impact on most of the life cycle of P. aeruginosa in the human lung. Therefore, this protein could represent be a novel target for therapeutic development.  48  Initial bacterial-host interaction is a complex process. In this study, it was clear that a large number of genes in the bacteria must be tightly controlled in order to regulate attachment, motility, and cytotoxicity as well as resistance to the host immune response, all of which are important factors for the bacteria to colonize epithelial cells while maintaining a low immunostimulatory profile. Therefore, the results presented in the current study not only have the potential to define novel mechanisms of interaction with host cells that impact on Pseudomonas pathogenesis, but may also provide novel targets for future therapeutic development that could effectively prevent the life-threatening Pseudomonas infection in CF patients.  49  References  1.  2005. Cystic Fibrosis Foundation Patient Registry Annual Data Report 2005. Bethesda, Maryland: Cystic Fibrosis Foundation. 2. Afessa, B., and B. Green. 2000. Bacterial pneumonia in hospitalized patients with HIV infection: the Pulmonary Complications, ICU Support, and Prognostic Factors of Hospitalized Patients with HIV (PIP) Study. Chest 117:1017-22. 3. Agrain, C., I. Callebaut, L. Journet, I. Sorg, C. Paroz, L. J. Mota, and G. R. Cornelis. 2005. Characterization of a Type III secretion substrate specificity switch (T3S4) domain in YscP from Yersinia enterocolitica. Mol Microbiol 56:54-67. Aisen, P., and I. Listowsky. 1980. Iron transport and storage proteins. Annu Rev 4. Biochem 49:357-93. 5. Albus, A. M., E. C. Pesci, L. J. Runyen-Janecky, S. E. West, and B. H. Iglewski. 1997. Vfr controls quorum sensing in Pseudomonas aeruginosa. J Bacteriol 179:3928-35. 6. Allewelt, M., F. T. Coleman, M. Grout, G. P. Priebe, and G. B. Pier. 2000. Acquisition of expression of the Pseudomonas aeruginosa ExoU cytotoxin leads to increased bacterial virulence in a murine model of acute pneumonia and systemic spread. Infect Immun 68:3998-4004. Alm, R. A., J. P. Hallinan, A. A. Watson, and J. S. Mattick. 1996. Fimbrial biogenesis 7. genes of Pseudomonas aeruginosa: pilW and pilX increase the similarity of type 4 fimbriae to the GSP protein-secretion systems and pilYl encodes a gonococcal Pi1C homologue. Mol Microbiol 22:161-73. 8. Armour, A. D., H. A. Shankowsky, T. Swanson, J. Lee, and E. E. Tredget. 2007. The impact of nosocomially-acquired resistant Pseudomonas aeruginosa infection in a burn unit. The Journal of trauma 63:164-71. Arora, S. K., N. Dasgupta, S. Lory, and R. Ramphal. 2000. Identification of two 9. distinct types of flagellar cap proteins, FliD, in Pseudomonas aeruginosa. Infect Immun 68:1474-9. Azghani, A. 0., E. J. Miller, and B. T. Peterson. 2000. Virulence factors from 10. Pseudomonas aeruginosa increase lung epithelial permeability. Lung 178:261-9. Barbieri, J. T. 2000. Pseudomonas aeruginosa exoenzyme S, a bifunctional type-III 11. secreted cytotoxin. Int J Med Microbiol 290:381-7. Berlutti, F., C. Morea, A. Battistoni, S. Sarli, P. Cipriani, F. Superti, M. G. 12. Ammendolia, and P. Valenti. 2005. Iron availability influences aggregation, biofilm, adhesion and invasion of Pseudomonas aeruginosa and Burkholderia cenocepacia. Int J Immunopathol Pharmaco118:661-70. 13. Braun, J., and J. Sieper. 1999. [25 years HLA B27--report on the "B27 and Beyond" NIH Conference]. Zeitschrift fur Rheumatologie 58:104-8. Brazas, M. D., E. B. Breidenstein, J. Overhage, and R. E. Hancock. 2007. Role of 14. Lon, an ATP-dependent protease homolog, in resistance of Pseudomonas aeruginosa to ciprofloxacin. Antimicrob Agents Chemother. 15.^Carnoy, C., A. Scharfman, E. Van Brussel, G. Lamblin, R. Ramphal, and P. Roussel. 1994. Pseudomonas aeruginosa outer membrane adhesins for human respiratory mucus glycoproteins. Infect Immun 62:1896-900. 50  Christman, J. W., R. T. Sadikot, and T. S. Blackwell. 2000. The role of nuclear factorkappa B in pulmonary diseases. Chest 117:1482-7. 17. Chugani, S., and E. P. Greenberg. 2007. The influence of human respiratory epithelia on Pseudomonas aeruginosa gene expression. Microb Pathog 42:29-35. 18. Chugani, S. A., M. Whiteley, K. M. Lee, D. D'Argenio, C. Manoil, and E. P. Greenberg. 2001. QscR, a modulator of quorum-sensing signal synthesis and virulence in Pseudomonas aeruginosa. Proc Natl Acad Sci USA 98:2752-7. 19. Costerton, J. W., P. S. Stewart, and E. P. Greenberg. 1999. Bacterial biofilms: a common cause of persistent infections. Science 284:1318-22. 20. Cowell, B. A., D. J. Evans, and S. M. Fleiszig. 2005. Actin cytoskeleton disruption by ExoY and its effects on Pseudomonas aeruginosa invasion. FEMS Microbiol Lett 250:716. 21. Cowell, B. A., M. D. Willcox, B. Herbert, and R. P. Schneider. 1999. Effect of nutrient limitation on adhesion characteristics of Pseudomonas aeruginosa. J Appl Microbiol 86:944-54. 22. Dacheux, D., B. Toussaint, M. Richard, G. Brochier, J. Croize, and I. Attree. 2000. Pseudomonas aeruginosa cystic fibrosis isolates induce rapid, type III secretiondependent, but ExoU-independent, oncosis of macrophages and polymorphonuclear neutrophils. Infect Immun 68:2916-24. 23. de Kievit, T., P. C. Seed, J. Nezezon, L. Passador, and B. H. Iglewski. 1999. RsaL, a novel repressor of virulence gene expression in Pseudomonas aeruginosa. J Bacteriol 181:2175-84. 24. de Kievit, T. R., R. Gillis, S. Marx, C. Brown, and B. H. Iglewski. 2001. Quorumsensing genes in Pseudomonas aeruginosa biofilms: their role and expression patterns. Appl Environ Microbiol 67:1865-73. Di Cello, F., Y. Xie, M. Paul-Satyaseela, and K. S. Kim. 2005. Approaches to bacterial 25. RNA isolation and purification for microarray analysis of Escherichia coli K1 interaction with human brain microvascular endothelial cells. J Clin Microbiol 43:4197-9. 26. Diamond, G., D. Legarda, and L. K. Ryan. 2000. The innate immune response of the respiratory epithelium. Immunol Rev 173:27-38. 27. Doig, P., T. Todd, P. A. Sastry, K. K. Lee, R. S. Hodges, W. Paranchych, and R. T. Irvin. 1988. Role of pili in adhesion of Pseudomonas aeruginosa to human respiratory epithelial cells. Infect Immun 56:1641-6. 28. Driscoll, J. A., S. L. Brody, and M. H. Kollef. 2007. The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections. Drugs 67:351-68. 29. Engel, L. S., J. M. Hill, A. R. Caballero, L. C. Green, and R. J. O'Callaghan. 1998. Protease IV, a unique extracellular protease and virulence factor from Pseudomonas aeruginosa. J Biol Chem 273:16792-7. Engel, L. S., J. A. Hobden, J. M. Moreau, M. C. Callegan, J. M. Hill, and R. J. 30. O'Callaghan. 1997. Pseudomonas deficient in protease IV has significantly reduced corneal virulence. Invest Ophthalmol Vis Sci 38:1535-42. Ernst, R. K., A. M. Hajjar, J. H. Tsai, S. M. Moskowitz, C. B. Wilson, and S. I. 31. Miller. 2003. Pseudomonas aeruginosa lipid A diversity and its recognition by Toll-like receptor 4. J Endotoxin Res 9:395-400. 32.^Ernst, R. K., E. C. Yi, L. Guo, K. B. Lim, J. L. Burns, M. Hackett, and S. I. Miller. 1999. Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa. Science 286:1561-5. 16.  51  33.  Feldman, M., R. Bryan, S. Rajan, L. Scheffler, S. Brunnert, H. Tang, and A. Prince. 1998. Role of flagella in pathogenesis of Pseudomonas aeruginosa pulmonary infection. Infect Immun 66:43-51. 34. Finck-Barbancon, V., J. Goranson, L. Zhu, T. Sawa, J. P. Wiener-Kronish, S. M. Fleiszig, C. Wu, L. Mende-Mueller, and D. W. Frank. 1997. ExoU expression by Pseudomonas aeruginosa correlates with acute cytotoxicity and epithelial injury. Mol Microbiol 25:547-57. 35. Frisk, A., J. R. Schurr, G. Wang, D. C. Bertucci, L. Marrero, S. H. Hwang, D. J. Hassett, and M. J. Schurr. 2004. Transcriptome analysis of Pseudomonas aeruginosa after interaction with human airway epithelial cells. Infect Immun 72:5433-8. 36. Frithz-Lindsten, E., Y. Du, R. Rosqvist, and A. Forsberg. 1997. Intracellular targeting of exoenzyme S of Pseudomonas aeruginosa via type III-dependent translocation induces phagocytosis resistance, cytotoxicity and disruption of actin microfilaments. Mol Microbiol 25:1125-39. 37. Gallant, C. V., T. L. Raivio, J. C. Olson, D. E. Woods, and D. G. Storey. 2000. Pseudomonas aeruginosa cystic fibrosis clinical isolates produce exotoxin A with altered ADP-ribosyltransferase activity and cytotoxicity. Microbiology (Reading, Engl) 146 ( Pt 8):1891-9. 38. Galloway, D. R. 1991. Pseudomonas aeruginosa elastase and elastolysis revisited: recent developments. Mol Microbiol 5:2315-21. 39. Goodman, A. L., B. Kulasekara, A. Rietsch, D. Boyd, R. S. Smith, and S. Lory. 2004. A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev Cell 7:745-54. 40. Groisman, E. A. 2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J Bacteriol 183:1835-42. 41. Haas, B., J. Kraut, J. Marks, S. C. Zanker, and D. Castignetti. 1991. Siderophore presence in sputa of cystic fibrosis patients. Infect Immun 59:3997-4000. Hancock, R. E., and F. S. Brinkman. 2002. Function of pseudomonas porins in uptake 42. and efflux. Annu Rev Microbiol 56:17-38. Hancock, R. E., and D. P. Speert. 2000. Antibiotic resistance in Pseudomonas 43. aeruginosa: mechanisms and impact on treatment. Drug Resist Updat 3:247-255. 44. Harwood, C. S., K. Fosnaugh, and M. Dispensa. 1989. Flagellation of Pseudomonas putida and analysis of its motile behavior. J Bacteriol 171:4063-6. Hauser, A. R., E. Cobb, M. Bodi, D. Mariscal, J. Valles, J. N. Engel, and J. Rello. 45. 2002. Type III protein secretion is associated with poor clinical outcomes in patients with ventilator-associated pneumonia caused by Pseudomonas aeruginosa. Crit Care Med 30:521-8. 46. Hauser, A. R., P. J. Kang, and J. N. Engel. 1998. PepA, a secreted protein of Pseudomonas aeruginosa, is necessary for cytotoxicity and virulence. Mol Microbiol 27:807-18. Hayden, M. S., and S. Ghosh. 2004. Signaling to NF-kappaB. Genes Dev 18:2195-224. 47. 48. Hippenstiel, S., B. Opitz, B. Schmeck, and N. Suttorp. 2006. Lung epithelium as a sentinel and effector system in pneumonia--molecular mechanisms of pathogen recognition and signal transduction. Respir Res 7:97. 49.^Hoiby, N., H. Krogh Johansen, C. Moser, Z. Song, 0. Ciofu, and A. Kharazmi. 2001. Pseudomonas aeruginosa and the in vitro and in vivo biofilm mode of growth. Microbes Infect 3:23-35. 52  Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62:379-433. 51. Juhas, M., L. Wiehlmann, B. Huber, D. Jordan, J. Lauber, P. Salunkhe, A. S. Limpert, F. von GOtz, I. Steinmetz, L. Eberl, and B. Tiimmler. 2004. Global regulation of quorum sensing and virulence by VqsR in Pseudomonas aeruginosa. Microbiology (Reading, Engl) 150:831-41. 52. Kang, P. J., A. R. Hauser, G. Apodaca, S. M. Fleiszig, J. Wiener-Kronish, K. Mostov, and J. N. Engel. 1997. Identification of Pseudomonas aeruginosa genes required for epithelial cell injury. Mol Microbiol 24:1249-62. 53. Kaufman, M. R., J. Jia, L. Zeng, U. Ha, M. Chow, and S. Jin. 2000. Pseudomonas aeruginosa mediated apoptosis requires the ADP-ribosylating activity of exoS. Microbiology (Reading, Engl) 146 ( Pt 10):2531-41. 54. Khan, T. Z., J. S. Wagener, T. Bost, J. Martinez, F. J. Accurso, and D. W. Riches. 1995. Early pulmonary inflammation in infants with cystic fibrosis. Am J Respir Crit Care Med 151:1075-82. 55. Kohler, T., L. K. Curty, F. Barja, C. van Delden, and J. C. Pechêre. 2000. Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J Bacteriol 182:5990-6. 56. Lamont, I. L., P. A. Beare, U. Ochsner, A. I. Vasil, and M. L. Vasil. 2002. Siderophore-mediated signaling regulates virulence factor production in Pseudomonasaeruginosa. Proc Natl Acad Sci USA 99:7072-7. 57. Lee, E. J., B. A. Cowell, D. J. Evans, and S. M. Fleiszig. 2003. Contribution of ExsAregulated factors to corneal infection by cytotoxic and invasive Pseudomonas aeruginosa in a murine scarification model. Invest Ophthalmol Vis Sci 44:3892-8. 58. Lesprit, P., F. Faurisson, 0. Join-Lambert, F. Roudot-Thoraval, M. Foglino, C. Vissuzaine, and C. Carbon. 2003. Role of the quorum-sensing system in experimental pneumonia due to Pseudomonas aeruginosa in rats. Am J Respir Crit Care Med 167:1478-82. 59. Lewenza, S., R. K. False', G. Winsor, W. J. Gooderham, J. B. McPhee, F. S. Brinkman, and R. E. Hancock. 2005. Construction of a mini-Tn5-luxCDABE mutant library in Pseudomonas aeruginosa PAO1: a tool for identifying differentially regulated genes. Genome Res 15:583-9. 60. Liberati, N. T., J. M. Urbach, S. Miyata, D. G. Lee, E. Drenkard, G. Wu, J. Villanueva, T. Wei, and F. M. Ausubel. 2006. An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc Natl Acad Sci USA 103:2833-8. 61. Lillehoj, E. P., B. T. Kim, and K. C. Kim. 2002. Identification of Pseudomonas aeruginosa flagellin as an adhesin for Muc 1 mucin. Am J Physiol Lung Cell Mol Physiol 282:L751-6. 62. Macfarlane, E. L., A. Kwasnicka, and R. E. Hancock. 2000. Role of Pseudomonas aeruginosa PhoP-phoQ in resistance to antimicrobial cationic peptides and aminoglycosides. Microbiology (Reading, Engl) 146 ( Pt 10):2543-54. 63. Macfarlane, E. L., A. Kwasnicka, M. M. Ochs, and R. E. Hancock. 1999. PhoP-PhoQ homologues in Pseudomonas aeruginosa regulate expression of the outer-membrane protein OprH and polymyxin B resistance. Mol Microbiol 34:305-16. 64.^Mahenthiralingam, E., M. E. Campbell, and D. P. Speert. 1994. Nonmotility and phagocytic resistance of Pseudomonas aeruginosa isolates from chronically colonized patients with cystic fibrosis. Infect Immun 62:596-605. 50.  53  65.  66.  67.  68. 69.  70.  71.  72. 73.  74. 75. 76.  77.  78.  79.  80.  Malloy, J. L., R. A. Veldhuizen, B. A. Thibodeaux, R. J. O'Callaghan, and J. R. Wright. 2005. Pseudomonas aeruginosa protease IV degrades surfactant proteins and inhibits surfactant host defense and biophysical functions. Am J Physiol Lung Cell Mol Physiol 288:L409-18. Marlovits, T. C., W. Haase, C. Herrmann, S. G. Aller, and V. M. Unger. 2002. The membrane protein FeoB contains an intramolecular G protein essential for Fe(II) uptake in bacteria. Proc Natl Acad Sci USA 99:16243-8. Marr, A. K., J. Overhage, M. Bains, and R. E. Hancock. 2007. The Lon protease of Pseudomonas aeruginosa is induced by aminoglycosides and is involved in biofilm formation and motility. Microbiology 153:474-82. Mattick, J. S. 2002. Type IV pili and twitching motility. Annu Rev Microbiol 56:289314. McPhee, J. B., M. Bains, G. Winsor, S. Lewenza, A. Kwasnicka, M. D. Brazas, F. S. Brinkman, and R. E. Hancock. 2006. Contribution of the PhoP-PhoQ and PmrA-PmrB two-component regulatory systems to Mg2+-induced gene regulation in Pseudomonas aeruginosa. J Bacteriol 188:3995-4006. McPhee, J. B., S. Lewenza, and R. E. Hancock. 2003. Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin B and cationic antimicrobial peptides in Pseudomonas aeruginosa. Mol Microbiol 50:205-17. Menard, R., P. Sansonetti, and C. Parsot. 1994. The secretion of the Shigella flexneri Ipa invasins is activated by epithelial cells and controlled by IpaB and IpaD. EMBO J 13:5293-302. Meyer, J. M., A. Neely, A. Stintzi, C. Georges, and I. A. Holder. 1996. Pyoverdin is essential for virulence of Pseudomonas aeruginosa. Infect Immun 64:518-23. Moskowitz, S. M., R. K. Ernst, and S. I. Miller. 2004. PmrAB, a two-component regulatory system of Pseudomonas aeruginosa that modulates resistance to cationic antimicrobial peptides and addition of aminoarabinose to lipid A. J Bacteriol 186:575-9. Mota, L. J., and G. R. Cornelis. 2005. The bacterial injection kit: type III secretion systems. Ann Med 37:234-49. Nicas, T. I., and R. E. Hancock. 1983. Pseudomonas aeruginosa outer membrane permeability: isolation of a porin protein F-deficient mutant. J Bacteriol 153:281-5. Nikaido, H. 1996. Outer membrane. In Escherichia coli and Salmonella typhimurium, Cellular and Molecular Biology (Neidhardt F. C., Ed.), pp. 29-47. American Society for Microbiology, Washington, DC. Ohnishi, K., Y. Ohto, S. Aizawa, R. M. Macnab, and T. lino. 1994. FlgD is a scaffolding protein needed for flagellar hook assembly in Salmonella typhimurium. J Bacteriol 176:2272-81. Olson, J. C., J. E. Fraylick, E. M. McGuffie, K. M. Dolan, T. L. Yahr, D. W. Frank, and T. S. Vincent. 1999. Interruption of multiple cellular processes in HT-29 epithelial cells by Pseudomonas aeruginosa exoenzyme S. Infect Immun 67:2847-54. Overhage, J., S. Lewenza, A. K. Marr, and R. E. Hancock. 2007. Identification of genes involved in swarming motility using a Pseudomonas aeruginosa PAO1 mini-Tn5lux mutant library. J Bacteriol 189:2164-9. Pearson, J. P., M. Feldman, B. H. Iglewski, and A. Prince. 2000. Pseudomonas aeruginosa cell-to-cell signaling is required for virulence in a model of acute pulmonary infection. Infect Immun 68:4331-4. 54  Pearson, J. P., C. van Delden, and B. H. Iglewski. 1999. Active efflux and diffusion are involved in transport of Pseudomonas aeruginosa cell-to-cell signals. J Bacteriol 181:1203-10. Pederson, K. J., A. J. Vallis, K. Aktories, D. W. Frank, and J. T. Barbieri. 1999. The 82. amino-terminal domain of Pseudomonas aeruginosa ExoS disrupts actin filaments via small-molecular-weight GTP-binding proteins. Mol Microbiol 32:393-401. Pesci, E. C., J. P. Pearson, P. C. Seed, and B. H. Iglewski. 1997. Regulation of las and 83. rhl quorum sensing in Pseudomonas aeruginosa. J Bacteriol 179:3127-32. Pillar, C. M., and J. A. Hobden. 2002. Pseudomonas aeruginosa exotoxin A and 84. keratitis in mice. Invest Ophthalmol Vis Sci 43:1437-44. 85. Plesiat, P., and H. Nikaido. 1992. Outer membranes of gram-negative bacteria are permeable to steroid probes. Mol Microbiol 6:1323-33. 86. Rabin, H. R., S. M. Butler, M. E. Wohl, D. E. Geller, A. A. Colin, D. V. Schidlow, C. A. Johnson, M. W. Konstan, W. E. Regelmann, and E. S. o. C. Fibrosis. 2004. Pulmonary exacerbations in cystic fibrosis. Pediatr Pulmonol 37:400-6. 87. Rampioni, G., I. Bertani, E. Zennaro, F. Polticelli, V. Venturi, and L. Leoni. 2006. The quorum-sensing negative regulator RsaL of Pseudomonas aeruginosa binds to the lasI promoter. J Bacteriol 188:815-9. 88. Ramsey, D. M., and D. J. Wozniak. 2005. Understanding the control of Pseudomonas aeruginosa alginate synthesis and the prospects for management of chronic infections in cystic fibrosis. Mol Microbiol 56:309-22. 89. Rebiêre-Huet, J., P. Di Martino, 0. Gallet, and C. Hulen. 1999. [Interactions of the Pseudomonas aeruginosa outer membrane proteins with plasma fibronectins. Bacterial adhesin investigation]. C R Acad Sci III, Sci Vie 322:1071-80. Reimmann, C., M. Beyeler, A. Latifi, H. Winteler, M. Foglino, A. Lazdunski, and D. 90. Haas. 1997. The global activator GacA of Pseudomonas aeruginosa PAO positively controls the production of the autoinducer N-butyryl-homoserine lactone and the formation of the virulence factors pyocyanin, cyanide, and lipase. Mol Microbiol 24:30919. Robertson, G. T., M. E. Kovach, C. A. Allen, T. A. Ficht, and R. M. Roop. 2000. The 91. Brucella abortus Lon functions as a generalized stress response protease and is required for wild-type virulence in BALB/c mice. Mol Microbiol 35:577-88. Roger, P., E. Puchelle, 0. Bajolet-Laudinat, J. M. Tournier, C. Debordeaux, M. C. 92. Plotkowski, J. H. Cohen, D. Sheppard, and S. de Bentzmann. 1999. Fibronectin and alpha5betal integrin mediate binding of Pseudomonas aeruginosa to repairing airway epithelium. Eur Respir J 13:1301-9. Rosqvist, R., K. E. Magnusson, and H. Wolf-Watz. 1994. Target cell contact triggers 93. expression and polarized transfer of Yersinia YopE cytotoxin into mammalian cells. EMBO J 13:964-72. Roy-Burman, A., R. H. Savel, S. Racine, B. L. Swanson, N. S. Revadigar, J. 94. Fujimoto, T. Sawa, D. W. Frank, and J. P. Wiener-Kronish. 2001. Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J Infect Dis 183:1767-74. 95.^Sadikot, R. T., T. S. Blackwell, J. W. Christman, and A. S. Prince. 2005. Pathogenhost interactions in Pseudomonas aeruginosa pneumonia. Am J Respir Crit Care Med 171:1209-23. 81.  55  96.  97.  98. 99.  100.  101. 102.  103.  104.  105. 106. 107.  108.  109.  110. 111.  Saiman, L., and A. Prince. 1993. Pseudomonas aeruginosa pili bind to asialoGM1 which is increased on the surface of cystic fibrosis epithelial cells. J Clin Invest 92:187580. Sato, H., J. B. Feix, C. J. Hillard, and D. W. Frank. 2005. Characterization of phospholipase activity of the Pseudomonas aeruginosa type III cytotoxin, ExoU. J Bacteriol 187:1192-5. Schuster, M., A. C. Hawkins, C. S. Harwood, and E. P. Greenberg. 2004. The Pseudomonas aeruginosa RpoS regulon and its relationship to quorum sensing. Mol Microbiol 51:973-85. Schuster, M., C. P. Lostroh, T. Ogi, and E. P. Greenberg. 2003. Identification, timing, and signal specificity of Pseudomonas aeruginosa quorum-controlled genes: a transcriptome analysis. J Bacteriol 185:2066-79. Schweizer, H. P. 2003. Efflux as a mechanism of resistance to antimicrobials in Pseudomonas aeruginosa and related bacteria: unanswered questions. Genet Mol Res 2:48-62. Shaver, C. M., and A. R. Hauser. 2004. Relative contributions of Pseudomonas aeruginosa ExoU, ExoS, and ExoT to virulence in the lung. Infect Immun 72:6969-77. Smith, E. E., D. G. Buckley, Z. Wu, C. Saenphimmachak, L. R. Hoffman, D. A. D'Argenio, S. I. Miller, B. W. Ramsey, D. P. Speert, S. M. Moskowitz, J. L. Burns, R. Kaul, and M. V. Olson. 2006. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci USA 103:8487-92. Son, M. S., W. J. Matthews, Y. Kang, D. T. Nguyen, and T. T. Hoang. 2007. In vivo evidence of Pseudomonas aeruginosa nutrient acquisition and pathogenesis in the cystic fibrosis lung. Infect Immun. Soong, G., B. Reddy, S. Sokol, R. Adamo, and A. Prince. 2004. TLR2 is mobilized into an apical lipid raft receptor complex to signal infection in airway epithelial cells. J Clin Invest 113:1482-9. Speert, D. P. 2002. Molecular epidemiology of Pseudomonas aeruginosa. Front Biosci 7:e354-61. Stanier, R. Y., N. J. Palleroni, and M. Doudoroff. 1966. The aerobic pseudomonads: a taxonomic study. J Gen Microbiol 43:159-271. Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. 0. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-64. Summers, M. L., L. M. Botero, S. C. Busse, and T. R. McDermott. 2000. The ++Sinorhizobium meliloti lon protease is involved in regulating exopolysaccharide synthesis and is required for nodulation of alfalfa. J Bacteriol 182:2551-8. Takase, H., H. Nitanai, K. Hoshino, and T. Otani. 2000. Impact of siderophore production on Pseudomonas aeruginosa infections in immunosuppressed mice. Infect Immun 68:1834-9. Tang, H., M. Kays, and A. Prince. 1995. Role of Pseudomonas aeruginosa pili in acute pulmonary infection. Infect Immun 63:1278-85. Toutain, C. M., M. E. Zegans, and G. A. O'Toole. 2005. Evidence for two flagellar stators and their role in the motility of Pseudomonas aeruginosa. J Bacteriol 187:771-7. 56  112. 113.  114. 115.  116.  117. 118.  119.  120.  121. 122.  123.  Tsilibaris, V., G. Maenhaut-Michel, and L. Van Melderen. 2006. Biological roles of the Lon ATP-dependent protease. Res Microbiol 157:701-13. Vallis, A. J., T. L. Yahr, J. T. Barbieri, and D. W. Frank. 1999. Regulation of ExoS production and secretion by Pseudomonas aeruginosa in response to tissue culture conditions. Infect Immun 67:914-20. van Delden, C., and B. H. Iglewski. 1998. Cell-to-cell signaling and Pseudomonas aeruginosa infections. Emerging Infect Dis 4:551-60. Vuorio, R., and M. Vaara. 1992. The lipid A biosynthesis mutation 1pxA2 of Escherichia coli results in drastic antibiotic supersusceptibility. Antimicrob Agents Chemother 36:826-9. Wagner, V. E., D. Bushnell, L. Passador, A. I. Brooks, and B. H. Iglewski. 2003. Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons: effects of growth phase and environment. J Bacteriol 185:2080-95. Wick, M. J., A. N. Hamood, and B. H. Iglewski. 1990. Analysis of the structurefunction relationship of Pseudomonas aeruginosa exotoxin A. Mol Microbiol 4:527-35. Wolfgang, M. C., J. Jyot, A. L. Goodman, R. Ramphal, and S. Lory. 2004. Pseudomonas aeruginosa regulates flagellin expression as part of a global response to airway fluid from cystic fibrosis patients. Proc Natl Acad Sci USA 101:6664-8. Woods, D. E., D. C. Straus, W. G. Johanson, V. K. Berry, and J. A. Bass. 1980. Role of pili in adherence of Pseudomonas aeruginosa to mammalian buccal epithelial cells. Infect Immun 29:1146-51. Wu, H., Z. Song, M. Givskov, G. Doring, D. Worlitzsch, K. Mathee, J. Rygaard, and N. Hoiby. 2001. Pseudomonas aeruginosa mutations in lasl and rhlI quorum sensing systems result in milder chronic lung infection. Microbiology (Reading, Engl) 147:110513 Xiao, R., and W. S. Kisaalita. 1997. Iron acquisition from transferrin and lactoferrin by Pseudomonas aeruginosa pyoverdin. Microbiology (Reading, Engl) 143 ( Pt 7):2509-15. Yoneyama, H., and T. Nakae. 1996. Protein C (OprC) of the outer membrane of Pseudomonas aeruginosa is a copper-regulated channel protein. Microbiology (Reading, Engl) 142 ( Pt 8):2137-44. Zhang, P., W. R. Summer, G. J. Bagby, and S. Nelson. 2000. Innate immunity and pulmonary host defense. Immunol Rev 173:39-51.  57  Supplementary Table S-1. Genes up-regulated in interacting bacteria. PA number PA0022 PA0026 PA0033  Gene Name plcB  PA0034 PA0035 PA0036 PA0040 PA0053 PA0054 PA0055 PA0080 PA0107 PA0115 PA0122 PA0142 PA0154 PA0208 PA0221 PA0249 PA0259  trpA trp8  pcaG mdcA  PA0260 PA0264 PA0266 PA0296 PA0297 PA0298 PA0299 PA0301 PA0307 PA0311  gabT  spuA spuB spuC spuE  PA0313 PA0422 PA0433 PA0435 PA0446 PA0450 PA0482 PA0495 PA0497 PA0498  glcB  Description ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Two-component regulatory systems ; Transcriptional regulators ; Amino acid biosynthesis and metabolism ; Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Energy metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes ; Carbon compound catabolism ; Carbon compound catabolism ; Putative enzymes ; Putative enzymes ; Hypothetical, unclassified, unknown ;^Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;^Amino acid biosynthesis and metabolism ; Carbon compound catabolism ; Central intermediary metabolism ; Putative enzymes ; Amino acid biosynthesis and metabolism ; Putative enzymes ; Putative enzymes ; Transport of small molecules ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ;^Carbon compound catabolism ; Central intermediary metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown  Fold change 1.5 2.1 2.7  0.017 7.79E-05 0.0002  2.8  1.53E-05  4.8 1.7 1.5 1.8 1.9 1.6 1.7 1.6 4.4 2.3 1.6 1.6 2.5 10.9 1.6 1.9  1.50E-06 0.0016 0.0014 0.0001 0.0002 0.0002 0.0007 0.0009 1.08E-05 0.0117 0.0075 0.0002 1.29E-05 1.32E-08 0.0023 0.0036  2.1  0.0003  3.8  5.91E-06  1.5  0.0032  2.4 2.5 2.7 1.9 1.7 1.7 2.3  0.001 0.0004 7.86E-06 3.58E-05 0.0004 0.0001 7.82E-06  1.6  0.0114  2.0 2.2 2.2 1.9  0.0013 2.17E-05 1.23E-05 3.95E-05  1.7  0.003  1.9  0.0004  1.5 1.6 1.6  0.003 0.0203 0.0007  P-value  58  PA number  Gene Name  Description  ;^Chaperones & heat shock proteins ; Motility & Attachment PA0558 ; Hypothetical, unclassified, unknown PA0560 ; Hypothetical, unclassified, unknown PA0561 ; Hypothetical, unclassified, unknown PA0566 ; Hypothetical, unclassified, unknown ; Translation, post-translational modification, PA0580 gcp degradation PA0620 ^ ; Related to phage, transposon, or plasmid PA0643 ; Related to phage, transposon, or plasmid PA0644 ; Related to phage, transposon, or plasmid PA0645 ; Related to phage, transposon, or plasmid ; Amino acid biosynthesis and metabolism ; PA0649 trpG Biosynthesis of cofactors, prosthetic groups and carriers ; Energy metabolism PA0651 trpC Amino acid biosynthesis and metabolism ; Membrane proteins PA0661 ;^Transport of small molecules ; Hypothetical, PA0689 unclassified, unknown PA0712 ; Hypothetical, unclassified, unknown ;^Related to phage, transposon, or plasmid ; PA0719 Hypothetical, unclassified, unknown PA0729 ; Hypothetical, unclassified, unknown PA0730 ; Putative enzymes PA0740 ; Putative enzymes PA0744 ; Putative enzymes PA0745 ; Putative enzymes ; Transport of small molecules ; Membrane PA0755 proteins ;^Biosynthesis of cofactors, prosthetic groups PA0761 nad8 and carriers ; Amino acid biosynthesis and metabolism PA0791 ; Transcriptional regulators PA0792 prpD Carbon compound catabolism PA0794 ; Energy metabolism ; Carbon compound catabolism ; Central PA0795 prpC intermediary metabolism ; Carbon compound catabolism ; Central prpB PA0796 intermediary metabolism ; Fatty acid and phospholipid metabolism PA0804 ; Putative enzymes PA0821 ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown PA0823 ; Hypothetical, unclassified, unknown PA0824 PA0863 ; Putative enzymes PA0865 hpd Amino acid biosynthesis and metabolism PA0870 phhC Amino acid biosynthesis and metabolism PA0871 phhB Amino acid biosynthesis and metabolism PA0874 ; Hypothetical, unclassified, unknown •^Central intermediary metabolism ; Carbon PA0887 acsA compound catabolism PA0499  ;  ;  ;  ;  ;  '  Fold change  P-value  2.1  0.0059  1.7 1.7 2.3 1.7  0.0019 0.0235 0.0003 0.001  1.5  0.0082  1.8 1.5 2.3 2.7  0.0001 0.0107 0.0001 6.41E-06  1.7  0.014  1.8 1.5  0.0002 0.0272  1.5  0.0018  1.6  0.0331  2.0  0.0076  1.5 1.5 1.6 1.9 1.5  0.0012 0.0034 0.0093 7.27E-05 0.0051  1.6  0.0011  1.6  0.0035  1.5 1.9 1.8  0.0128 0.0003 0.0007  2.0  0.0034  1.8  0.0161  2.0 3.6 1.5 2.6 2.4 3.5 1.9 2.0 1.9  3.36E-05 1.89E-05 0.0032 0.0008 1.20E-05 3.91E-05 0.0003 8.59E-05 0.0184  2.9  4.01E-06  59  PA number PA0911 PA0936 PA0959 PA0975 PA0976 PA0977 PA0979 PA0982 PA0988 PA0990 PA0995  Gene Name 1pxO2  ogt  PA1034 PA1054 PA1123 PA1150  pys2  PA1178  oprH  PA1187 PA1309 PA1313 PA1371 PA1377 PA1387 PA1430  lasR  PA1431  rsaL  PA1439 PA1503 PA1504 PA1505  moaA2  PA1507 PA1514 PA1560 PA1562 PA1565 PA1571 PA1574  acnA  PA1577 PA1580 PA1581 PA1601 PA1602  gltA sdhC  Description ; Hypothetical, unclassified, unknown Cell wall / LPS / capsule ; Putative enzymes ; Hypothetical, unclassified, unknown ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Related to phage, transposon, or plasmid ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; DNA replication, recombination, modification and repair ; Hypothetical, unclassified, unknown ;^Putative enzymes ; Membrane proteins ; Hypothetical, unclassified, unknown ;^Secreted Factors (toxins, enzymes, alginate) ; Adaptation, Protection ;^Adaptation, Protection ; Transport of small molecules ; Membrane proteins ; Putative enzymes ; Transcriptional regulators ; Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown • Transcriptional regulators ; Adaptation, Protection ;^Adaptation, Protection ;^Transcriptional regulators ; Secreted Factors (toxins, enzymes, alginate) ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators • Biosynthesis of cofactors, prosthetic groups and carriers ; Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Energy metabolism ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins Energy metabolism Energy metabolism ; Putative enzymes ; Carbon compound catabolism ;^  '  '  ;  ;  ;  Fold change 1.6 1.6 2.0 2.9 4.4 2.0 1.7 1.6 1.9 1.6  0.0005 0.0188 9.85E-05 1.04E-05 1.02E-05 8.43E-05 0.0028 0.001 0.0148 0.0013  1.5  0.007  1.5 1.6 1.6  0.0208 0.0039 0.0054  1.7  0.0023  1.5  0.0015  2.4 1.7  0.002 0.0015  1.5  0.0277  1.7 2.2 1.7  0.0235 0.0004 0.0225  1.5  0.0032  3.1  1.28E-06  1.7 1.5 1.6  0.001 0.0028 0.001  2.0  0.0001  1.6  0.0012  1.6 1.6 1.7 1.5 1.9 1.9  0.0041 0.0019 0.02 0.0011 0.0016 0.0006  2.0  2.59E-05  1.9 1.8 1.6 2.4  8.38E-05 0.0019 0.0002 8.97E-06  P-value  60  PA number PA1606 PA1623 PA1624 PA1639  Gene Name  PA1652 PA1654 PA1655 PA1661 PA1733 PA1743 PA1753 PA1811 PA1852 PA1882 PA1935 PA1940 PA1942 PA1951 PA1978 PA1999 PA2000 PA2001  atoB  PA2003 PA2008 PA2009 PA2014 PA2015 PA2016  bdhA fahA hmgA gnyB gnyD gnyR  PA2039 PA2102 PA2103 PA2118  ada  PA2128 PA2247 PA2271 PA2287 PA2291 PA2318 PA2359 PA2372 PA2422 PA2455  cupAl bkdAl  Description ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Putative enzymes ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators ;^Carbon compound catabolism ; Amino acid biosynthesis and metabolism ; Carbon compound catabolism ; Amino acid biosynthesis and metabolism ;• Fatty acid and phospholipid metabolism ; Central intermediary metabolism Carbon compound catabolism Carbon compound catabolism Carbon compound catabolism Carbon compound catabolism Carbon compound catabolism Transcriptional regulators ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Biosynthesis of cofactors, prosthetic groups and carriers • DNA replication, recombination, modification and repair ; Transcriptional regulators Motility & Attachment Amino acid biosynthesis and metabolism ; Putative enzymes ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;  ;  ;  ;  ;  ;  '  ;  ;  Fold change 1.6 2.0 1.6 2.1  P-value 0.0006 0.0018 0.0022 0.0031  1.6  0.0007  2.4 1.9 4.3 1.8 2.2 1.8 1.6 3.0  4.81E-05 5.21E-05 2.72E-06 0.0131 1.65E-05 0.0015 0.0008 1.27E-06  2.0  0.0007  1.5 1.8 2.4 1.5 1.6  0.0027 0.0005 0.0004 0.001 0.0076  2.8  1.00E-05  2.3  3.26E-05  2.6  7.23E-06  1.8 1.8 1.8 1.8 2.2 1.9  0.0001 0.0019 0.0006 0.0035 2.99E-05 0.0009  1.9  0.0016  1.9  0.0039  1.7  0.0013  3.9  3.22E-07  1.8 1.9 1.7 1.9 1.7 2.4 1.5 1.8 1.8 2.5  0.0004 4.14E-05 0.0054 0.0068 0.0146 0.0003 0.002 0.0001 0.0002 1.62E-05  61  PA number PA2456 PA2486 PA2491  Gene Name  PA2493  mexE  PA2541 PA2551 PA2552 PA2553 PA2554 PA2555 PA2586 PA2592 PA2595 PA2616  trx131  PA2623  icd  gacA  PA2666 PA2668 PA2691 PA2712 PA2746 PA2755  eco  PA2761 PA2776 PA2777 PA2791 PA2795 PA2819 PA2822 PA2824 PA2855 PA2878 PA2897 PA2919 PA2943 PA2946 PA3016 PA3038 PA3104 PA3129 PA3140  xcpP  Description ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes • Antibiotic resistance and susceptibility ; ' Transport of small molecules ; Putative enzymes ; Transcriptional regulators ; Putative enzymes ; Putative enzymes ; Putative enzymes ; Putative enzymes ; Transcriptional regulators ; Transport of small molecules ; Hypothetical, unclassified, unknown ; Nucleotide biosynthesis and metabolism ; Amino acid biosynthesis and metabolism ; Energy metabolism ; Carbon compound catabolism ; Biosynthesis of cofactors, prosthetic groups and carriers ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins • Translation, post-translational modification, ' degradation ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Two-component regulatory systems ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Amino acid biosynthesis and metabolism ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Protein secretion/export apparatus ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown  Fold change 3.8 1.5 2.0  2.48E-06 0.0121 0.0046  1.8  0.0018  1.8 2.1 1.6 2.2 1.8 5.0 1.7 1.6 2.1 1.6  0.0004 0.0004 0.002 3.91E-05 0.0003 1.64E-05 0.0004 0.0056 0.0004 0.0013  1.5  0.0078  1.5  0.0201  1.9 1.8  9.90E-05 0.0003  1.9  0.0119  1.9  0.0003  2.2  2.58E-05  1.5  0.0005  1.6  0.0045  1.7  0.0003  2.1 1.5 1.7 1.6 1.7 1.6 2.1 1.6  0.0002 0.0168 0.0003 0.0005 0.0381 0.0005 0.0016 0.002  1.6  0.0112  1.9  0.002  1.6  0.0013  1.8 3.2 1.7 2.0 1.5  0.0005 2.68E-05 0.0036 8.93E-05 0.0008  P-value  62  PA number PA3143 PA3159 PA3180 PA3182 PA3190  Gene Name  PA3192  gltR  PA3193  glk  PA3194  edd  wbpA pg/  PA3196 PA3224 PA3234 PA3235 PA3256 PA3262 PA3319 PA3325  pIcAl  PA3326 PA3348 PA3350 PA3356 PA3367 PA3422 PA3436 PA3437 PA3438  folE1  PA3439  foIX  PA3442 PA3476 PA3486 PA3487 PA3536 PA3564 PA3577 PA3581  rh/I pldA  g/pF  PA3602 PA3619 PA3622 PA3659 PA3663  rpoS  Fold change 1.8 1.6 1.7 1.5 1.9  0.0002 0.0021 0.0062 0.0166 2.71E-05  1.6  0.0033  1.9  0.0026  3.2  4.03E-06  3.1 1.7  2.56E-06 0.0065  2.2  2.14E-05  2.3  1.50E-05  1.5  0.0015  1.5  0.0018  1.7 2.2  0.0005 0.0002  2.5  1.44E-05  1.5 2.3 1.6 1.9 2.4 2.1 1.5  0.0014 1.34E-05 0.0013 7.20E-05 0.0345 3.11E-05 0.0071  '  1.8  0.0017  '  2.0  0.0019  1.7 1.8 1.5 1.7 1.6 2.3 2.0 1.6  0.0015 0.001 0.0027 0.0032 0.0033 1.01E-05 5.37E-05 0.0007  1.7  0.0003  1.5 1.9 2.2 1.6  0.0021 0.0002 0.0002 0.0003  Description ; Related to phage, transposon, or plasmid Cell wall / LPS / capsule ; Putative enzymes ; Hypothetical, unclassified, unknown Central intermediary metabolism ; Transport of small molecules ; Transcriptional regulators ; Two-component regulatory systems ; Carbon compound catabolism ; Carbon compound catabolism ; Energy metabolism • Carbon compound catabolism ; Energy metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Putative enzymes ; Chaperones & heat shock proteins ; Translation, post-translational modification, degradation Secreted Factors (toxins, enzymes, alginate) ; Hypothetical, unclassified, unknown ; Translation, post-translational modification, degradation ;^Chemotaxis ; Adaptation, Protection ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes • Biosynthesis of cofactors, prosthetic groups and carriers • Biosynthesis of cofactors, prosthetic groups and carriers ; Transport of small molecules Adaptation, Protection ; Hypothetical, unclassified, unknown Fatty acid and phospholipid metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Transport of small molecules ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown Transcriptional regulators ; Putative enzymes ; Hypothetical, unclassified, unknown ;^  ;  '  ;  ;  ;  ;  ;  P-value  63  PA number PA3688 PA3689 PA3695  Gene Name  PA3751  purT  PA3752 PA3754 PA3755 PA3756 PA3783 PA3787 PA3788 PA3790  oprC  PA3791 PA3843 PA3845 PA3864 PA3885 PA3911 PA3922 PA3923 PA3928 PA3929 PA3991 PA3992 PA4017 PA4022 PA4023 PA4035 PA4041 PA4062 PA4074 PA4079  cioB  PA4080 PA4090 PA4092 PA4108 PA4111 PA4114 PA4115 PA4116 PA4149 PA4171 PA4182 PA4183 PA4200  hpaC  Description ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Hypothetical, unclassified, unknown ;^Nucleotide biosynthesis and metabolism ; Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins Transport of small molecules ;^Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Energy metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes ; Transport of small molecules ; Hypothetical, unclassified, unknown ; Putative enzymes ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Putative enzymes ;^Transcriptional regulators ; Transport of small molecules ; Hypothetical, unclassified, unknown Carbon compound catabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;  ;  ;  Fold change 1.7 2.0 1.6  P-value 0.0003 0.0007 0.0143  1.8  0.0012  1.9 1.9 1.6 1.5 2.3 3.5  0.0006 0.0009 0.0304 0.0033 6.27E-05 0.0003  3.1  1.07E-05  4.3  1.01E-05  1.7  0.0171  2.6 1.6 2.3 1.6 1.6 3.7 2.1 2.1 2.2 1.5 1.8 1.5 4.2 2.6 1.8 6.9 2.1 1.7 1.7  5.85E-06 0.0113 0.0001 0.0014 0.0388 2.18E-06 0.0003 4.31E-05 0.0002 0.0231 0.0022 0.0114 6.07E-07 3.97E-05 0.0004 5.48E-08 5.20E-05 0.0003 0.0068  1.6  0.0015  1.8 1.5 1.7 1.5 2.0 1.7 1.6 1.5 1.7 2.1 1.5 2.7  0.0071 0.0089 0.0382 0.0099 4.98E-05 0.0037 0.0039 0.004 0.0122 0.0002 0.0018 2.08E-05  64  PA number  Gene Name  PA4289 PA4297 PA4316 PA4330 PA4336 PA4340 PA4366 PA4385 PA4386 PA4440 PA4488 PA4496  sbcB  sod8 groEL groES  PA4498 PA4520 PA4526 PA4527 PA4545 PA4552 PA4555 PA4556 PA4570 PA4590 PA4606 PA4607 PA4634 PA4635 PA4652 PA4703 PA4770 PA4776 PA4787 PA4827  pi/8 pi1C comL pilW pi/Y2 pilE pra  IldP pmrA  PA4834 PA4871 PA4895 PA4910 PA4937 PA4968 PA4971 PA4983 PA4994 PA5031  mr aspP  Description ; Transport of small molecules ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins . DNA replication, recombination, modification and repair ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Adaptation, Protection Chaperones & heat shock proteins Chaperones & heat shock proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Translation, post-translational modification, degradation ;^Chemotaxis ; Adaptation, Protection Motility & Attachment Motility & Attachment Cell wall / LPS / capsule Motility & Attachment Motility & Attachment Motility & Attachment ; Hypothetical, unclassified, unknown ;^Carbon compound catabolism ; Transport of small molecules ; Adaptation, Protection ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Transport of small molecules Two-component regulatory systems ; Transcriptional regulators ;^Putative enzymes ; Adaptation, Protection ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Membrane proteins ; Transport of small molecules Transcription, RNA processing and degradation ; Hypothetical, unclassified, unknown Energy metabolism ; Two-component regulatory systems ; Transcriptional regulators ; Putative enzymes ; Putative enzymes '  ;  ;  ;  ;  ;  ;  ;  ;  ;  ;  ;  ;  ;  Fold change  P-value  1.8  0.0002  1.5  0.0021  1.8  0.0002  2.0 1.7 1.8 1.6 1.8 1.6 1.7 1.5 1.5  0.0082 0.0003 0.0135 0.0125 0.0005 0.0001 0.0004 0.0149 0.0234  1.6  0.0018  1.5 2.2 1.6 1.7 2.4 1.8 2.0 2.0  0.0044 6.70E-05 0.0012 0.0063 5.26E-05 0.0175 0.0214 0.0023  1.8  0.0001  2.0 1.9 2.0 1.9 1.7 1.6 1.9 1.6 1.6 1.5  0.0002 0.0001 7.20E-05 8.54E-05 0.0006 0.0046 0.0002 0.0047 0.0041 0.0102  1.8  0.0002  1.8  0.002  1.6  0.0121  1.7 1.8 1.5 1.8  0.0223 8.32E-05 0.0008 0.0011  1.6  0.003  1.6 1.6  0.0016 0.0009  65  PA number PA5058 PA5066 PA5068 PA5081 PA5087 PA5089 PA5094 PA5100 PA5123  Gene Name phaC2 hisl tatA  hutU  PA5154 PA5180 PA5185 PA5186 PA5204  argA  PA5205 PA5206 PA5239  argE rho  PA5244 PA5246 PA5268  corA  PA5273 PA5282 PA5287  amtB  PA5290 PA5301 PA5312 PA5319 PA5347 PA5356 PA5362 PA5363 PA5372 PA5380 PA5381 PA5396 PA5397 PA5452 PA5474 PA5509 PA5517 PA5519  radC glcC  betA  wbpW  Description Central intermediary metabolism Amino acid biosynthesis and metabolism Protein secretion/export apparatus ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes Amino acid biosynthesis and metabolism ;^Hypothetical, unclassified, unknown ; Membrane proteins Amino acid biosynthesis and metabolism Transcription, RNA processing and degradation ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown • Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ;• Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Putative enzymes ;• DNA replication, recombination, modification and repair ; Hypothetical, unclassified, unknown Transcriptional regulators ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;• Adaptation, Protection ; Amino acid biosynthesis and metabolism ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Cell wall / LPS / capsule ; Translation, post-translational modification, degradation ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;  ;  ;  ;  ;  ;  ;  '  ;  ;  Fold change 1.9 1.5 1.6 1.6 1.7 1.7 4.9 3.3 1.7  0.0001 0.003 0.0049 0.0021 0.0007 0.0006 6.02E-05 2.33E-06 0.0018  1.8  0.0005  1.7 1.7 1.6 1.8  0.001 0.0038 0.002 0.0008  4.2  1.50E-07  1.7 1.8  9.41E-05 0.0018  1.5  0.0009  2.0  5.09E-05  1.7  0.0487  1.6  0.001  1.8  0.0005  1.7  0.0003  2.3 2.0 3.7  1.18E-05 0.0033 0.0004  1.7  0.0008  1.6 1.8 1.8 1.5  0.0007 0.0003 0.0031 0.0011  1.6  0.0207  3.1 2.5 1.7 1.6 1.6  2.84E-06 1.72E-05 0.0006 0.0334 0.0007  1.5  0.0099  1.5 1.6 1.5  0.0079 0.0015 0.011  P-value  66  PA number PA5523 PA5529 PA5544 PA5566  Gene Name  Description ; Putative enzymes ; Transport of small molecules ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown  Fold change 1.5  P-value 0.0028  1.5  0.0015  1.6  0.0088  1.7  0.0133  67  Supplementary Table S-2. Genes down-regulated in interacting bacteria. PA number  Gene Name  PA0008  glyS  PA0010  tag  PA0046 PA0047 PA0048 PA0051 PA0098 PA0128 PA0141 PA0163 PA0165  phzH  PA0185 PA0198 PA0199 PA0200 PA0201 PA0202 PA0224 PA0277 PA0278 PA0347 PA0359 PA0364  exbB1 exbD1  PA0382  micA  glpQ  PA0391 PA0402  pyrB  PA0403  pyrR  PA0408  pilG  PA0463  creB  PA0518  nirM  PA0519 PA0525 PA0526 PA0545  nirS  PA0546  metK  PA0549 PA0553  Description ;^Translation, post-translational modification, degradation ; Amino acid biosynthesis and metabolism ; DNA replication, recombination, modification and repair ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ; Transport of small molecules ; Transport of small molecules ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Fatty acid and phospholipid metabolism ; Hypothetical, unclassified, unknown ; Putative enzymes • DNA replication, recombination, modification ' and repair ; Hypothetical, unclassified, unknown ;^Nucleotide biosynthesis and metabolism ; Amino acid biosynthesis and metabolism ;^Transcriptional regulators ; Nucleotide biosynthesis and metabolism ;^Chemotaxis ;^Motility & Attachment ; Twocomponent regulatory systems • Two-component regulatory systems ; ' Transcriptional regulators • Energy metabolism ; Biosynthesis of ' cofactors, prosthetic groups and carriers ; Energy metabolism ; Energy metabolism ; Hypothetical, unclassified, unknown ; Putative enzymes • Central intermediary metabolism ; Amino acid ' biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown  Fold Change  P-value  -1.7  0.0005  -1.5  0.0099  -1.7 -2 -1.7 -1.7 -1.7 -2.7 -1.6 -1.6 -1.6  0.0003 5.57E-05 0.0003 0.0221 0.0201 0.0021 0.0129 0.0017 0.0368  -1.5  0.0011  -1.5 -1.6 -1.6 -3.4 -2.3 -1.8 -1.5 -1.9 -2 -1.6 -1.5  0.0027 0.0036 0.0003 1.22E-06 4.02E-05 0.0017 0.0007 0.008 2.96E-05 0.0009 0.0122  -1.7  0.0002  -1.5  0.0458  -1.5  0.0056  -1.5  0.0024  -1.5  0.002  -1.5  0.0101  -1.7  0.0034  -3 -2.4 -4.6 -1.7  2.43E-06 9.18E-06 0.0002 0.0019  -1.9  4.49E-05  -1.9 -2.9  0.0005 0.0003  68  PA number PA0554 PA0557 PA0576 PA0581 PA0591  Gene Name  PA0594  surA  rpoD  PA0728 PA0767  lepA  PA0768  /epB  PA0772  recO  PA0773  pdxJ  PA0798 PA0807 PA0836 PA0840 PA0842 PA0845 PA0851  pmtA  PA0890  aotM  PA0891 PA0903 PA0915 PA0916 PA0917 PA0944 PA0945 PA0964 PA0965  alaS  kup purN purM ruvC  PA1011 PA1015 PA1044 PA1050 PA1069 PA1070 PA1076 PA1103  braG  Description ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;^Adaptation, Protection ;^Chaperones & heat shock proteins ; Translation, post-translational modification, degradation ;^Related to phage, transposon, or plasmid ; Putative enzymes ;^Protein secretion/export apparatus ; Translation, post-translational modification, degradation ;^Protein secretion/export apparatus ; Translation, post-translational modification, degradation • DNA replication, recombination, modification ' and repair ; Biosynthesis of cofactors, prosthetic groups and carriers ; Fatty acid and phospholipid metabolism ; Hypothetical, unclassified, unknown ; Putative enzymes ; Putative enzymes ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Tra n sport of small molecules ; Membrane ; proteins ; Hypothetical, unclassified, unknown ;^Translation, post-translational modification, degradation ; Transcription, RNA processing and degradation ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Nucleotide biosynthesis and metabolism ; Nucleotide biosynthesis and metabolism ; Hypothetical, unclassified, unknown ;• DNA replication, recombination, modification and repair ; Hypothetical, unclassified, unknown ; Transcriptional regulators ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Hypothetical, unclassified, unknown ;^Motility & Attachment ; Cell wall / LPS / capsule  Fold Change -1.5 -1.5 -1.5 -2 -1.6  0.0022 0.0009 0.0012 3.25E-05 0.0039  -1.6  0.008  -1.6  0.0293  -2  6.27E-05  -1.8  0.0004  -1.5  0.0339  -1.5  0.0013  -1.8 -1.7 -3.8 -2.1 -2.4 -2 -1.6  0.0118 0.0208 2.08E-07 5.66E-05 0.0001 2.33E-05 0.0132  -1.7  8.65E-05  -1.8  0.0003  -1.9  4.45E-05  -1.6 -3 -1.6 -1.9 -1.6 -1.6  0.0109 9.73E-07 0.0014 9.57E-05 0.0006 0.0011  -1.5  0.0019  -1.6 -1.7  0.001 0.0007  -1.5  0.0083  -1.8 -1.7 -1.8 -1.7  0.0128 0.0012 0.0002 0.0005  -1.5  0.0346  P-value  69  PA number PA1156 PA1193 PAl227 PAl228 PAl235  Gene Name nrdA  PAl272  cobO  PA1303 PA1321 PA1340 PA1414 PA1415 PA1487 PA1545 PA1546  cyoE  hemN  PA1548 PA1553 PA1557 PA1561 PA1583 PA1634 PA1636  aer sdhA kdpB kdpD  PA1642  selD  PA1649 PA1668 PA1673 PA1674 PA1680 PA1687 PA1689 PA1695  folE2 speE pscP  PA1699 PA1701 PA1715 PA1716 PA1718 PA1726 PA1747 PA1786 PA1789 PA1790  pscB pscC pscE bglX  PA1799 PA1804  hupB  Fold Change -1.6 -1.8 -2.3 -1.6 -1.8  0.0019 0.0001 1.47E-05 0.0079 0.0153  -1.5  0.048  -1.6 -1.7 -1.6 -8 -2.7 -1.6 -3.4  0.0378 0.0176 0.0066 4.18E-08 9.21E-05 0.0248 1.53E-06  -5.1  3.37E-07  ;  -1.6 -1.8 -2.3 -1.9 -1.5 -2.1 -1.8  0.0148 0.0001 2.03E-05 8.60E-05 0.006 0.0008 0.0127  '  -1.6  0.0047  -2.2 -1.6 -1.9  2.84E-05 0.0291 0.0002  -2.2  1.41E-05  -1.5 -2.1 -1.6 -2.1  0.0011 0.0008 0.0009 0.0038  -1.7  0.0059  -1.9  0.0002  -1.6 -1.5 -1.5 -1.6 -2.4 -1.5 -1.6 -1.9  0.0056 0.0019 0.0075 0.0006 1.79E-05 0.0499 0.0003 0.0002  -2  0.0063  -1.7  0.0434  Description Nucleotide biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators • Biosynthesis of cofactors, prosthetic groups and carriers ; Putative enzymes Energy metabolism ; Transport of small molecules ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes ; Hypothetical, unclassified, unknown ;• Biosynthesis of cofactors, prosthetic groups and carriers ; Hypothetical, unclassified, unknown ; Energy metabolism ; Energy metabolism Chemotaxis ; Adaptation, Protection Energy metabolism Transport of small molecules Two-component regulatory systems • Translation, post-translational modification, degradation ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown • Biosynthesis of cofactors, prosthetic groups and carriers ; Hypothetical, unclassified, unknown Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown Protein secretion/export apparatus ;^Hypothetical, unclassified, unknown ; Protein secretion/export apparatus ;^Hypothetical, unclassified, unknown ; Protein secretion/export apparatus Protein secretion/export apparatus Protein secretion/export apparatus Protein secretion/export apparatus Carbon compound catabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Two-component regulatory systems ; Transcriptional regulators ;• DNA replication, recombination, modification and repair ;  '  ;  ;^  ;  ;  '  ;  ;  ;  ;  ;  ;  P-value  70  PA number PA1828 PA1890  Gene Name  PA1891 PA1892 PA1958 PA1960 PA1971 PA2023 PA2024 PA2036 PA2044 PA2064 PA2066  braZ ga/U  pcoB  PA2070 PA2110 PA2127 PA2136 PA2162 PA2235 PA2280 PA2353 PA2376  psIE  PA2409 PA2418 PA2446 PA2449 PA2453  gcvH2  PA2500 PA2501 PA2504 PA2505 PA2549 PA2578 PA2603 PA2630 PA2631 PA2639 PA2641 PA2653 PA2663  nuoD nuoF  Description ; Putative enzymes ; Putative enzymes ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Transport of small molecules ; Central intermediary metabolism ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Adaptation, Protection ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcriptional regulators ; Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Amino acid biosynthesis and metabolism ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Transport of small molecules ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Putative enzymes ; Putative enzymes ; Hypothetical, unclassified, unknown ; Putative enzymes ; Energy metabolism ; Energy metabolism ; Transport of small molecules ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins  Fold Change -2.3 -1.7  1.19E-05 0.0013  -1.7  0.0014  -1.6  0.0022  -2.2  0.0031  -1.5  0.0047  -1.7 -1.6 -1.6 -1.7 -1.8 -2.3 -1.7  0.0008 0.0019 0.0003 0.021 8.96E-05 8.23E-06 0.0223  -1.9  0.0074  -1.6 -1.7 -4 -1.6 -2 -1.5 -1.5 -1.7  0.0021 0.0003 6.07E-05 0.039 9.37E-05 0.0018 0.0032 0.0006  -2.2  0.003  -1.6 -2.3 -1.5 -1.6  0.016 1.14E-05 0.0092 0.0007  -3.2  6.33E-05  -3.8  2.16E-07  -1.6 -2.8  0.0067 0.0008  -1.5  0.0011  -1.8 -1.5 -1.9 -1.5 -1.7 -1.5  0.0002 0.0147 4.77E-05 0.0009 0.0003 0.0009  -1.8  0.0022  -1.5  0.044  P-value  71  PA number PA2664 PA2718 PA2753 PA2759  fhp  PA2768 PA2799 PA2807 PA2817 PA2840 PA2841 PA2847 PA2851  efp  PA2867 PA2904  Fold Change -3.1 -2 -1.8 -6.9  1.49E-05 0.0255 0.0048 6.00E-08  -1.7  0.0037  -1.7 -2.5 -1.7  0.0002 1.33E-05 0.0006  -2.1  2.48E-05  -1.5 -2.7  0.0026 0.001  -2.2  0.001  -3.3  4.84E-07  -1.9  0.0002  -1.7  0.0017  -2.4  5.19E-05  -1.5  0.0489  -2  1.96E-05  -1.9 -1.8 -1.6 -1.5 -2.2 -1.8 -1.7  4.31E-05 0.0018 0.002 0.0019 0.0002 0.0001 0.0004  -1.6  0.0082  '  -1.9  0.0069  ;  -3.1 -2 -1.8 -1.6  1.00E-05 0.007 0.0117 0.0004  -1.7  0.001  -1.6  0.0352  -1.5  0.0018  -1.9  9.11E-05  -1.5  0.0045  Gene Name  cob'  PA2911 PA2964  pabC  PA2966  acpP  PA2970  rpmF  PA2971 PA2982 PA2986 PA2996 PA2997 PA2998 PA3006  nqrD nqrC nqrB psrA  PA3011  topA  PA3014  faoA  PA3017 PA3084 PA3087 PA3107  metZ  PA3108  purF  PA3116 PA3134  gltX  PA3162  rpsA  PA3167  serC  Description Energy metabolism ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcription, RNA processing and degradation ; Putative enzymes ; Hypothetical, unclassified, unknown ; Translation, post-translational modification, degradation ;^Chemotaxis ; Adaptation, Protection • Biosynthesis of cofactors, prosthetic groups and carriers ; Transport of small molecules ; Membrane proteins ; Biosynthesis of cofactors, prosthetic groups and carriers Fatty acid and phospholipid metabolism ; Translation, post-translational modification, degradation ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Energy metabolism Energy metabolism Energy metabolism Transcriptional regulators • DNA replication, recombination, modification and repair • Fatty acid and phospholipid metabolism ; Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown Amino acid biosynthesis and metabolism ;^Nucleotide biosynthesis and metabolism ; Amino acid biosynthesis and metabolism ; Amino acid biosynthesis and metabolism ; Translation, post-translational modification, degradation ; Translation, post-translational modification, degradation ;^Biosynthesis of cofactors, prosthetic groups and carriers ; Amino acid biosynthesis and metabolism ;  '  ;  ;  ;  ;  ;  '  P-value  72  PA number  Gene Name  PA3169 PA3201 PA3206 PA3266  capB  PA3274 PA3278 PA3285 PA3308  hepA  PA3309 PA3310 PA3336 PA3337  rfaD  PA3340 PA3343 PA3377 PA3385 PA3453 PA3497 PA3519 PA3528  mt  PA3572 PA3573 PA3574 PA3609  potC  PA3612 PA3620  mutS  PA3628 PA3629  adhC  PA3633  ygbP  PA3635  eno  PA3636  kdsA  PA3643 PA3644  Ipx8 IpxA  Description ; Translation, post-translational modification, degradation ; Membrane proteins ; Two-component regulatory systems ;^Adaptation, Protection ; Transcriptional regulators ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Transcriptional regulators ; Transcription, RNA processing and degradation ; Hypothetical, unclassified, unknown ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Transport of small molecules ; Membrane proteins Cell wall / LPS / capsule ;^Hypothetical, unclassified, unknown ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Transport of small molecules ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcription, RNA processing and degradation ; DNA replication, recombination, modification and repair ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Adaptation, Protection ; Transcriptional regulators • Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown • DNA replication, recombination, modification ' and repair ; Putative enzymes Central intermediary metabolism ; Biosynthesis of cofactors, prosthetic groups and carriers ; Carbon compound catabolism ; Energy metabolism ; Translation, post-translational modification, degradation • Cell wall / LPS / capsule ; Carbon compound catabolism Cell wall / LPS / capsule Cell wall / LPS / capsule ;  '  ;  '  ;  ;  Fold Change  P-value  -1.5  0.0013  -1.7 -3  0.0009 0.0005  -1.8  0.0114  -1.5  0.0202  -5.8  1.72E-08  -1.6  0.0057  -2.7  2.02E-05  -4.9  3.99E-07  -2.1  0.0002  -4.2  2.69E-07  -2.7  3.27E-05  -1.5  0.0054  -1.5  0.0086  -3.8  0.0295  -1.8 -1.8 -1.8 -2.1  8.15E-05 0.0018 0.0002 0.0039  -1.5  0.0009  -1.7  0.0006  -2  0.0002  -4.6  1.76E-06  -1.6  0.0072  -1.7  0.0045  -1.9  4.50E-05  -3.4 -2.6  3.60E-06 2.59E-06  -1.5  0.0376  -1.8  5.55E-05  -1.6  0.0007  -1.5 -1.6  0.0025 0.0119  73  PA number PA3646  Gene Name IpxD  PA3648 PA3651  cdsA  PA3653  fir  PA3654 PA3685  pyrH  PA3692 PA3700  lysS  PA3715 PA3718 PA3725  red  PA3742  rpIS  PA3743  trmD  PA3744  rimM  PA3745  rpsP  PA3763  purL  PA3769  guaA  PA3803 PA3804  gcpE  PA3805  pilF  PA3806 PA3823  tgt  PA3826 PA3827 PA3838 PA3861  rhl  PA3872 PA3880  nail  PA3901  fecA  PA3907 PA3908 PA3913  Description ; Cell wall / LPS / capsule ; Transport of small molecules ; Membrane proteins ; Fatty acid and phospholipid metabolism • Translation, post-translational modification, ' degradation ; Nucleotide biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ;^Translation, post-translational modification, degradation ; Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins '• DNA replication, recombination, modification and repair Translation, post-translational modification, ; degradation • Transcription, RNA processing and ' degradation • Transcription, RNA processing and ' degradation ;^Translation, post-translational modification, degradation ; DNA replication, recombination, modification and repair ; Nucleotide biosynthesis and metabolism • Nucleotide biosynthesis and metabolism ; ' Amino acid biosynthesis and metabolism ; Putative enzymes ; Hypothetical, unclassified, unknown ;^Motility & Attachment ; Protein secretion/export apparatus ; Hypothetical, unclassified, unknown ;^Translation, post-translational modification, degradation ; Transcription, RNA processing and degradation ;^Hypothetical, unclassified, unknown ; Membrane proteins ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Transport of small molecules • Transcription, RNA processing and ' degradation ; Energy metabolism ; Hypothetical, unclassified, unknown • Transport of small molecules ; Membrane ' proteins ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Putative enzymes  Fold Change -1.7  P-value 0.0023  -1.6  0.0011  -1.8  0.0007  -1.7  0.0013  -2.2 -1.5  0.0012 0.0029  -1.8  0.0478  -2.7  0.0002  -2.2  2.93E-05  -1.6  0.0332  -1.6  0.0019  -2  0.0001  -2.2  0.0006  -1.6  0.0003  -1.9  0.0001  -1.6  0.0054  -1.6  0.0017  -1.5 -1.6  0.0028 0.0015  -1.9  0.0078  -1.8  8.97E-05  -1.8  0.0002  -1.8  0.0004  -1.7  0.0004  -1.6  0.002  -2  6.49E-05  -3 -2.1  0.0005 0.0003  -1.5  0.0058  -2.2 -1.6 -1.6  0.0039 0.0008 0.0383  74  PA number  Gene Name  PA3915  moaBl  PA3934 PA4007  proA  PA4049 PA4051  thiL  PA4052  nusB  PA4067 PA4127 PA4128 PA4129 PA4130 PA4134 PA4135  oprG hpcG  PA4143 PA4153 PA4155 PA4234  uvrA  PA4235  bfrA  PA4236  katA  PA4242  rpmJ  PA4245  rpmD  PA4247  rpIR  PA4258  rpIV  PA4259  rpsS  PA4260  rpIB  PA4261  rpIW  PA4262  rpID  PA4264  rpsJ  PA4279 PA4333 PA4334  Description • Biosynthesis of cofactors, prosthetic groups ' and carriers ;^Hypothetical, unclassified, unknown ; Membrane proteins ;^Biosynthesis of cofactors, prosthetic groups and carriers ; Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown • Biosynthesis of cofactors, prosthetic groups ' and carriers • Transcription, RNA processing and ' degradation ; Membrane proteins ; Carbon compound catabolism ; Putative enzymes ; Hypothetical, unclassified, unknown ; Central intermediary metabolism ; Hypothetical, unclassified, unknown ; Transcriptional regulators ;^Membrane proteins ; Transport of small molecules ; Protein secretion/export apparatus ; Carbon compound catabolism ; Hypothetical, unclassified, unknown • DNA replication, recombination, modification ' and repair • Adaptation, Protection ; Transport of small ' molecules ; Adaptation, Protection • Translation, post-translational modification, ' degradation ; Translation, post-translational modification, degradation ; Translation, post-translational modification, degradation ; Translation, post-translational modification, degradation ; Translation, post-translational modification, degradation Translation, post-translational modification, ; degradation • Translation, post-translational modification, ' degradation ;^Translation, post-translational modification, degradation ; Transcription, RNA processing and degradation ;^Translation, post-translational modification, degradation ; Transcription, RNA processing and degradation ; Hypothetical, unclassified, unknown ; Energy metabolism ; Transport of small molecules ; Membrane proteins  Fold Change  P-value  -1.8  0.0138  -1.5  0.0019  -1.8  0.0006  -1.6  0.0171  -1.6  0.0005  -1.7  0.0003  -5.7 -3 -1.6 -3.2 -2.1 -1.5 -4  2.47E-08 1.25E-06 0.0004 4.26E-06 3.22E-05 0.0013 1.93E-06  -3  0.0006  -2.2 -1.6  0.0004 0.0301  -1.7  0.0014  -2.3  0.0002  -1.9  0.0054  -1.6  0.0074  -2.1  0.0004  -1.7  0.0005  -1.5  0.0052  -1.5  0.0023  -1.7  0.0034  -1.8  0.0209  -1.7  0.0004  -1.6  0.0016  -1.6 -1.6  0.0014 0.0002  -1.6  0.0032 75  PA number PA4345 PA4348 PA4350 PA4351 PA4352 PA4429 PA4430 PA4431  Gene Name  PA4432  rpsI  PA4449 PA4450 PA4479 PA4480 PA4481  hisG murA mreD mreC mreB  PA4484  gatB  PA4490 PA4519 PA4530 PA4543 PA4563 PA4571 PA4577 PA4588 PA4602 PA4603 PA4610 PA4611 PA4623 PA4630 PA4637 PA4644 PA4645 PA4646 PA4647  rpsT  gdhA g/yA3  upp uraA  PA4648 PA4664  hemK  PA4665  prfA  PA4672 PA4678  riml  PA4686 PA4728  folK  Fold Change -1.9 -3.4 -2.1 -2.3 -2.8 -1.9 -2 -1.5  0.0102 1.33E-06 0.0006 1.78E-05 7.44E-06 0.0012 0.0001 0.0005  -1.5  0.002  -1.5 -1.5 -2.9 -2.8 -1.5  0.0023 0.0029 1.72E-06 0.001 0.0176  -1.6  0.002  -1.5 -1.5 -1.6 -1.8  0.01 0.002 0.005 8.64E-05  -2.1  0.0026  ;  -1.6 -5.1 -1.8 -1.6 -1.9 -2.4 -3 -1.5 -1.7 -1.5 -2.5 -4.2 -1.7  0.0006 3.98E-08 0.0002 0.0005 0.0082 2.34E-05 1.27E-05 0.002 0.0002 0.0012 5.80E-06 2.61E-05 0.0002  '  -1.9  0.0087  -2.5  0.0001  -2.6  0.0001  -1.8  0.0011  -1.7  0.0028  -1.6  0.0028  -1.5  0.0017  -1.7  0.0002  Description ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Fatty acid and phospholipid metabolism ; Hypothetical, unclassified, unknown ; Energy metabolism ; Energy metabolism ; Putative enzymes ; Translation, post-translational modification, degradation Amino acid biosynthesis and metabolism Cell wall / LPS / capsule Cell division ; Cell wall / LPS / capsule Cell division ; Cell wall / LPS / capsule Cell division ; Cell wall / LPS / capsule ; Translation, post-translational modification, degradation ; Hypothetical, unclassified, unknown ; Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown • Translation, post-translational modification, degradation ; Central intermediary metabolism ; Energy metabolism ; Hypothetical, unclassified, unknown Amino acid biosynthesis and metabolism Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Nucleotide biosynthesis and metabolism Nucleotide biosynthesis and metabolism • Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown • Biosynthesis of cofactors, prosthetic groups and carriers ; Translation, post-translational modification, degradation ; Translation, post-translational modification, degradation • Translation, post-translational modification, degradation ; Hypothetical, unclassified, unknown • Biosynthesis of cofactors, prosthetic groups and carriers ;  ;  ;^  ;^  ;^  '  ;  ;  '  '  '  P-value  76  PA number  Gene Name  PA4740  pnp  PA4769 PA4839 PA4840  speA  PA4843 PA4851 PA4852 PA4853  fig  PA4877 PA4897 PA4918 PA4924 PA4928 PA4931  dnaB  PA4935  rpsF  PA4960 PA5004 PA5005 PA5020 PA5034  hemE  PA5046 PA5048 PA5051  argS  PA5110  fbp  PA5113 PA5117  typA  PA5118  thiI  PA5131 PA5139 PA5146 PA5156  pgm  PA5170  arcD  PA5171 PA5172  arcA arcB  PA5192  pckA  PA5207  Fold Change  P-value  -1.6  0.0259  -1.8 -1.7 -1.9  7.23E-05 0.0015 5.30E-05  -1.8  0.0003  -1.6 -1.6  0.0209 0.0021  -2.7  0.0005  -1.7 -1.6 -1.8 -1.8 -1.5  0.0009 0.0258 0.0038 0.0001 0.0008  -1.5  0.0179  -1.9  0.0005  -1.8 -1.6 -1.5 -1.6  0.0121 0.0005 0.003 0.0008  -1.5  0.0406  -1.5 -1.6  0.0009 0.001  -1.8  0.0002  -2.1  5.53E-05  -1.6  0.0211  ;  -1.6  0.0015  '  -1.7  0.0014  -1.6 -1.7 -1.5 -1.5  0.0004 0.0007 0.0051 0.0323  -4  1.27E-07  -5.9 -2.3  2.39E-07 0.0002  -1.5  0.0008  -2.3  0.0001  Description ; Transcription, RNA processing and degradation ; Transcriptional regulators Amino acid biosynthesis and metabolism ; Hypothetical, unclassified, unknown ; Two-component regulatory systems ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ;^DNA replication, recombination, modification and repair ;^Transcription, RNA processing and degradation ; Transcriptional regulators ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Membrane proteins ; Hypothetical, unclassified, unknown ;• DNA replication, recombination, modification and repair ; Translation, post-translational modification, degradation ; Amino acid biosynthesis and metabolism ; Putative enzymes ; Putative enzymes ; Putative enzymes • Biosynthesis of cofactors, prosthetic groups and carriers ; Central intermediary metabolism ; Putative enzymes ; Translation, post-translational modification, degradation Carbon compound catabolism ; Central intermediary metabolism ;^Hypothetical, unclassified, unknown ; Membrane proteins Adaptation, Protection • Biosynthesis of cofactors, prosthetic groups and carriers Carbon compound catabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Amino acid biosynthesis and metabolism ; Transport of small molecules ; Membrane proteins Amino acid biosynthesis and metabolism Amino acid biosynthesis and metabolism ; Energy metabolism ; Carbon compound catabolism ; Transport of small molecules ; Membrane proteins ;  '  ;  ;  ;  ;  77  PA number PA5208  Gene Name  PA5215  gcvT1  PA5232 PA5286 PA5337  rpoZ  PA5338  spoT  PA5408 PA5425  purK  PA5427  adhA  PA5429  aspA  PA5440 PA5468 PA5469 PA5470 PA5472 PA5475 PA5479  gltP  PA5480 PA5484 PA5494 PA5504 PA5510 PA5513 PA5556 PA5558 PA5559 PA5560 PA5564  atpA atpF atpE atpB gidB  PA5568 PA5569  mpA  PA5570  rpmH  Fold Change -3.6  2.17E-06  -1.6  0.0006  -2.6 -2.2  0.0004 0.0034  -1.7  0.0005  -1.6  0.0073  -1.7 -1.7  0.0002 0.0003  -1.7  0.0005  -1.5  0.001  -1.7  0.0016  -1.5  0.0045  -2  9.34E-05  -2.5  4.93E-06  -2.1 -1.8  6.83E-05 0.0003  -1.6  0.0001  -4.4 -1.5 -1.6  7.38E-08 0.0009 0.0003  -1.7  0.0015  -1.8  0.0133  -1.5 -2 -1.7 -1.5 -1.8 -1.7  0.0087 0.0064 0.0002 0.0012 6.78E-05 0.0001  -2  0.0002  '  -1.9  7.33E-05  '  -1.6  0.0003  Description ; Hypothetical, unclassified, unknown ; Amino acid biosynthesis and metabolism ; Central intermediary metabolism ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transcription, RNA processing and degradation ;^Adaptation, Protection ; Nucleotide biosynthesis and metabolism ; Hypothetical, unclassified, unknown Nucleotide biosynthesis and metabolism • Carbon compound catabolism ; Energy metabolism Amino acid biosynthesis and metabolism ;^Putative enzymes ; Translation, posttranslational modification, degradation ; Transport of small molecules ;^Hypothetical, unclassified, unknown ; Membrane proteins ; Translation, post-translational modification, degradation ; Hypothetical, unclassified, unknown ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown ; Two-component regulatory systems ; Hypothetical, unclassified, unknown ; Transport of small molecules ; Membrane proteins ; Transport of small molecules ; Membrane proteins ; Hypothetical, unclassified, unknown Energy metabolism Energy metabolism Energy metabolism Energy metabolism Cell division ;^Hypothetical, unclassified, unknown ; Membrane proteins • Translation, post-translational modification, degradation • Translation, post-translational modification, degradation ; Central intermediary metabolism ;  '  ;  ;  ;  ;  ;  ;  P-value  78  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066264/manifest

Comment

Related Items