Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Biological studies of organellar (Na⁺,K⁺)/H⁺ exchanger NHE7 Lin, Paulo J. C. 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_spring_lin_paulo_jc.pdf [ 10.35MB ]
Metadata
JSON: 24-1.0066263.json
JSON-LD: 24-1.0066263-ld.json
RDF/XML (Pretty): 24-1.0066263-rdf.xml
RDF/JSON: 24-1.0066263-rdf.json
Turtle: 24-1.0066263-turtle.txt
N-Triples: 24-1.0066263-rdf-ntriples.txt
Original Record: 24-1.0066263-source.json
Full Text
24-1.0066263-fulltext.txt
Citation
24-1.0066263.ris

Full Text

BIOLOGICAL STUDIES OF ORGANELLAR (Na t , 10/11 + EXCHANGER NHE7 by Paulo JC Lin  B.Sc., The University of British Columbia, 2002  A THESIS SUBMI'T'TED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in  THE FACULTY OF GRADUATE STUDIES (Biochemistry and Molecular Biology)  The University of British Columbia December 2007 © Paulo JC Lin, 2007  Abstract  Cellular pH homeostasis plays crucial roles in cellular functions, and it is now widely recognized that Ne/H + exchangers are among the most prominent players in this process. Although recently described mammalian Near exchanger NHE7 has attracted much attention, its biological functions remain largely unknown. Most proteins exist as protein complexes in the cell and elicit their unique functions in collaboration with their binding partners. Therefore, identification and characterization of binding proteins will often unveil unexpected functions of the protein of interest. To begin to elucidate biological roles of the novel class of Ne/E1 + exchanger NHE7, yeast two-hybrid screening was conducted and several binding candidates were identified. Among these candidates, I show that Secretory Carrier Membrane Proteins (SCAMPs) are novel NHE7 binding proteins and that SCAMPs regulate endocytic trafficking of NHE7 from the recycling endosomes to the trans-Golgi network (TGN). In agreement with this finding, I found that NHE7 can also be targeted to the plasma membrane and then internalized. Caveolins, structural proteins for caveolae, were identified as NHE7-binding proteins and it was initially hypothesized that caveolins might regulate NHE7-internalization. Interestingly, caveolins bound to NHE7 through a novel binding domain and facilitated its association to caveolae/lipid rafts, but did not affect NHE7-internalization. I also show that SCAMP2 associates with the heterotrimeric G protein 13 subunit (G(3) and regulates the ERK1/2 signaling. Moreover, NHE7 was found to associate with both SCAMP2 and GP in the cell, suggesting that ERK1/2 signaling mediated by the SCAMP2-GP complex might regulate NHE7.  ii  Table of Contents Abstract ^  ii  Table of Contents ^  iii  List of Table ^  vi  List of Figures ^  vii  Abbreviations ^ Acknowledgements ^  xii  Co-Authorship Statement ^  xiii  Chapter 1: Introduction ^ 1 1.1 Importance of pH homeostasis and diseases ^ 1 1.2 Componenets of pH regulation ^ 2 1.3 NHE overview^ 2 1.3.1 Plasma membrane type NHEs ^ 6 1.3.2 Organellar membrane type NHEs ^ 11 1.4 Organellar pH ^ 13 1.5 Mechanism of organellar pH regulation ^ 14 1.6 Yeast and plant NHE7 homologues regulate organellar pH ^17 1.7 Proposed model ^ 17 1.8 Protein trafficking^ 20 1.8.1 Endocytosis ^ 22 1.8.2 Exocytosis^ 24 1.9 Objective of this thesis ^ 26 References ^ 29 Chapter 2 — Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na + ,10/H + exchanger NHE7 ^44 2.1 Introduction ^ 44 2.2 Materials and methods ^ 47 2.3 Results ^ 47 2.3.1 Identification of SCAMPs as NHE7 interacting proteins ^47 2.3.2 Identification of NHE7-binding domain in SCAMPs ^53 2.3.3 Endogenous SCAMPs bind and colocalize with NHE7 ^56 2.3.4 NHE7 and SCAMPs associate with TGN and recycling endosomes ^ 58 2.3.5 Overexpression of SCAMP2/A184-208 causes redistribution of NHE7 ^ 63 2.3.6 Overexpression of SCAMP2/A184-208 causes  iii  dispersion of full-length SCAMP2 ^ 66 2.3.7 GFP-fusion of SCAMP2 TM2-TM3 associates with NHE7 ^69 2.3.8 NHE7 C-terminal construct partly accumulates in perinuclear regions with SCAMP2^ 72 2.4 Discussion^ 74 References ^ 79 Chapter 3 - Caveolins bind to (Na + , IC")/11+ exchanger NHE7 by a novel binding module ^ 85 3.1 Introduction ^ 85 3.2 Results ^ 87 3.2.1 Cytosolic C-terminus of NHE7 binds to Cavl ^87 3.2.2 The C-MAD domain of Cavl, not the CSD domain, is responsible for NHE7-binding ^ 89 3.2.3 NHE7 partly associates with caveolae/lipid rafts ^92 3.2.4 Cavl wild type and dominant-negative mutants associate with NHE7 in cultured cells ^ 94 3.2.5 Expression of caveolin dominant-negative mutants dissociates NHE7 from caveolae/lipid rafts ^ 97 3.2.6 NHE7 is internalized in a clathrin-dependent and caveolin-independent manner ^ 100 3.3 Discussion^ 105 References ^ 109 Chapter 4 — Implications of SCAMP2 in GP signaling and regulation of ERK1/2 activation ^ 113 4.1 Introduction ^ 113 4.2 Results ^ 115 4.2.1 SCAMP2 interacts with GP ^ 115 4.2.2 GP binds to SCAMP2 via WD1-2 and WD6-7 ^117 4.2.3 Identification of the GP-binding domain of SCAMP2 ^120 4.2.4 A membrane permeable peptide corresponding to the GP-binding domain of SCAMP2 specifically downregulates GP-activated ERK1/2 phosphorylation ^ 122 4.2.5 SCAMP2 gene knock-down specifically suppresses GP-mediated ERK1/2 activation ^ 126 4.3 Discussion^ 130 References ^ 134 Chapter 5 — Discussion and conclusion ^ 139 5.1 Summary ^ 139 5.2 Caveats of the thesis and suggested supplementary experiments ^ 140 5.3 Future directions ^ 148 5.4 NHE7 and disease ^ 152 References ^ 156  iv  Appendix 1 - Materials and methods ^ 164 A1.1 Peptides and antibodies ^ 164 A1.2 Molecular cloning^ 165 A1.3 Expression and purification of GST fusion proteins ^ 175 A1.4 Glutathione S-transferase (GST) pull-down ^ 176 A1.5 Preparation of immunoaffinity column ^ 177 A1.6 Polyclonal antibody production in rabbits ^ 178 A1.7 Affinity purification of polyclonal antibody ^ 178 A1.8 Preabsorption experiments ^ 179 A1.9 Cell culture ^ 179 A1.10 Transfection and electroporation ^ 180 A1.11 Co-immunoprecipitation ^ 181 A1.12 Organellar immunoprecipitation ^ 182 A1.13 Immunofluorescence microscopy ^ 182 A1.14 Isolation of membrane fractions ^ 183 A1.15 Sucrose equilibrium density centrifugation ^ 184 A1.16 Flotation assay ^ 184 A1.17 Cell surface biotinylation and internalization ^ 185 A1.18 Membrane depolarization induced secretion assay ^ 187 A1.19 86 R13 + uptake assay ^ 187 A1.20 ERK1/2 activity assay ^ 188 Appendix 2 — Supplementary Figures ^  190  Appendix 3 — Publications Arising From Graduate Work ^200 Appendix 4 — Biohazard Approval Certificate ^  201  References ^  202  v  List of Tables  Table 1 — Mammalian expression constructs ^  167  Table 2 — GST fusion constructs ^  171  Table 3 — NHE7 and SCAMP siRNA constructs ^  175  vi  List of Figures  Fig. 1-1. Schematic representation of NHEs predicted by hydropathy plots ^ Fig. 1-2. Organellar pH homeostasis ^  5 16  Fig. 1-3. Proposed pH regulation mechanism in acidic organelles ^ 19 Fig.1-4. Protein trafficking ^  21  Fig. 2-1. SCAMPs interact with NHE7 ^  49  Fig. 2-2. Identification of SCAMP2 binding domain within NHE7 ^ 52 Fig. 2-3. Co-immunoprecipitation of SCAMP2 myc deletion mutants and NHE7HA ^  54  Fig. 2-4. Dose-dependent binding of SCAMP2[201-215] to NHE7 ^55 Fig. 2-5. Endogenous SCAMPs bind and largely colocalize with NHE7 ^  57  Fig. 2-6. NHE7 and SCAMPs co-fractionate by sucrose equilibrium density centrifugation ^  59  Fig. 2-7. NHE7 and SCAMPs colocalize with syntaxin 6 and transferrin receptor ^  61  Fig. 2-8. Expression of SCAMP2/A184-208 shows scattered vesicular appearance with NHE7 and full-length SCAMP ^  64  Fig. 2-9. SCAMP2/A184-208 colocalizes with the transferrin receptor at the peripheral region of cells ^  68  Fig. 2-10. The TM2-TM3 region is sufficient for NHE7 interaction ^71 Fig. 2-11. NHE7 C-terminus partially colocalizes with full-length SCAMP2 ^  73  Fig. 2-12. Proposed model showing that targeting of NHE7 from the recycling endosome to the TGN is facilitated by binding to SCAMPs ^76  vii  Fig. 3-1. The cytosolic C-terminus of NHE7 directly binds to caveolin 1 (Cav 1) ^  88  Fig. 3-2. NHE7 directly binds to amino acids 128-154 of Cav 1 ^90 Fig. 3-3. NHE7 associates with caveolae/lipid raft fractions by flotation assays ^  93  Fig. 3-4. Wild type and dominant-negative Cav 1 associate with NHE7 ^  96  Fig. 3-5. Expression of Cav 1 S80E or P132L dissociates NHE7 from caveolae/lipid rafts ^  98  Fig. 3-6. NHE7 is targeted to the cell surface and then internalized by a clathrin-dependent and caveolae-independent mechanism ^ 103 Fig. 3-7. A proposed model showing that caveolae/lipid rafts provide a signaling platform for NHE7 on the cell surface ^  108  Fig. 4-1. GP associates with SCAMP2 ^  116  Fig. 4-2. SCAMP2 binds to WD 1, 2, 6 and 7 of GP ^ 118 Fig. 4-3. Gi3 binds to SCAMP2[117-134] ^  121  Fig. 4-4. GPy dependent phosphorylation of ERK1/2 is downregulated by myristoylated SC2[117-134] ^  124  Fig. 4-5. SCAMP2 knock down downregulates phosphorylation of ERK1/2 when MCF-7 cells are treated with myrSIRK peptide ^ 128 Fig. 5-1. Intracellular targeting of NHE7 ^  140  Suppl. Fig. 1-1. Wild type and dominant-negative Cav 1 associate with NHE7 ^  190  Suppl. Fig. 1-2. Cavl S80E shows limited localization at the ER ^ 191 Suppl. Fig. 1-3. Cav3 also binds to NHE7 ^  192  Suppl. Fig. 1-4. NHE7 associates with GP ^  193  Suppl. Fig. 1-5. NHE7 is N-glysosylated ^  194  Suppl. Fig. 1-6. Characterization of anti-NHE7 antibody ^ 195 viii  Suppl. Fig. 1-7. Characterization of PC12 cells stably co-expressing CgBHA and NHE71D4 or NHE7 siRNA ^  196  Suppl. Fig. 1-8. Characterization of PC12/CgBHA + NHE71 D4 cells ^ 198 Suppl. Fig. 1-9. Role of NHE7 in CgB secretion ^  ix  199  Abbreviations Abbreviation^  aMEM^ ALS^ APP^ BBS^ BSA^ BACE^ Cg^ CLS V^ CS V^ cDNA^ Cav^ CHC^ CHO^ C1C^ C-MAD^ Coll'^ CSD^ Cterm^ DMEM^ DNA^ EE^ ER^ ERK^ GDP^ GFP^ GPCR^ GST^ GTP^ HA^ HeBS^ IgG^ ISG^ JNK^ kDa^ Lys^ MAPK^ M13CD^ MBP^ MBS^ mRNA^ MSG^ Myr^  Name  Alpha Minimum Essential Medium Amyotrophic Lateral Sclerosis Amyloid Precursor Protein BES Buffered Solution Bovine Serum Albumin Beta-site APP Cleaving Enzyme Chromogranin Constitutive-Like Secretory Vesicle Constitutive Secretory Vesicle Complementary DNA Caveolin Clathrin Heavy Chain Chinese Hamster Ovary Chloride Channel C-terminal Membrane Attachment Domain Co-Immunoprecipitation Caveolin Scaffolding Domain C-Terminal Extension Dulbecco Modified Eagle's Minimum Essential Medium Deoxyribonucleic Acid Early Endosome Endoplasmic Reticulum Extracellular Signal Regulated Kinase Guanosine-5'-diphosphate Green Fluorescent Protein G-Protein Coupled Receptor Glutathione S-Transferase Guanosine-5'-triphosphate Hemagglutinin HEPES Buffered Solution Immunoglobulin G Immature Secretory Granule C-Jun N-Terminal Kinase kiloDalton Lysate Mitogen Activated Protein Kinase Methyl-0-c yclodextrin Maltose Binding Protein Mes Buffered Solution Messenger RNA Mature Secretory Granule Myristoylated  x  Na-VI-I+ Exchanger Nonidet P-40 Asn-Pro-Phe Proline rich motif Phosphate Buffered Saline PBS containing 1 mM MgC12 and 0.1 mM CaC12 (pH 8.0) 0.1% Triton X-100 in PBS PBS-TX^ Pheochromocytoma 12 PC 12^ Polymerase Chain Reaction PCR^ Phosphoinositide 3-Kinase PI3-kinase^ Phosphatidylinositol (4,5) biphosphate PI(4,5)P^ Protein Kinase D PKD^ Phospholipase C PLC^ Plasma Membrane PM^ PrP c^Cellular Prion Protein prpsc^ Infectious Scrapie form Prion Protein Polyvinylidene Difluoride PVDF^ Recycling Endosome RE^ Ribonucleic Acid RNA^ Reverse Transcriptase PCR RT-PCR^ Short Interfering RNA siRNA^ Soluble NSF Attachment Receptor SNARE^ Secretory Carrier Membrane Protein SCAMP (SC)^ Sodium Dodecyl Sulphate SDS^ SDS - Polyacrylamide Gel Electrophoresis SDS-PAGE^ Superoxide Dismutase SOD^ Syntaxin Stx^ Tris Buffered Saline TBS^ TfR^ Transferrin Receptor trans-Golgi network TGN^ Transmembrane TM^ Vacuolar H + -ATPase V-ATPase^ NHE^ NP40^ NPF^ P rich motif^ PBS^ PBSCM^  xi  Acknowledgements I would like to start by thanking Dr. Masayuki Numata for his guidance and  support over the past 5 years. I have learnt immensely and this has been an indescribable journey. I wish that the laboratory will continue on succeeding and growing. I would also like to thank my committee members Dr. Robert S. Molday and Dr. Michel Roberge for their advice, generosity and helping the Numata lab with equipment, reagents and their expertise. I would like to take some time to thank my mom, my dad and both of my sisters Jenny and Jia Ty. They have been such a great support and loving family that I would not be who I am today without them. The past 4 years have been filled with a lot of sorrow and difficulties but brighter days are ahead. We have finally succeeded. Last but not least I need to thank my high school friends (JC, PD, BL and XL — listed alphabetically) for their support and keeping me sane. Regardless of my achievements they still treated me like the same Paulo that I was.  xii  Co-Authorship Statement Chapter 2 contains portions from a manuscript published in the Journal of Cell Science [Lin P.J., Williams W.P., Luu Y., Molday R.S., Orlowski J., and Numata M.  Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7. J Cell Sci. 2005 May 1;118(Pt 9):1885-97]. Both Dr. Robert S. Molday and Dr. John Orlowski are collaborators that provided the rho 1D4 antibody and NHE7 constructs respectively. The NHE7 constructs were cloned by Dr. Masayuki Numata as a postdoctorate in Dr. John Orlowski's laboratory. In order to identify NHE7 binding partners, Dr. Masayuki Numata performed yeast two-hybrid screening with the C-terminus of NHE7. All the microscopic analysis, binding assays and sucrose density gradient were performed by myself except for parts of the coimmunoprecipitation of SCAMP2 deletion mutants with NHE7 (Yvonne Luu) and subcellular fractionation of SCAMP-GFP constructs (Dr. Warren P. Williams). The manuscript was prepared by myself and Dr. Numata. Chapter 3 contains portions from a manuscript published in Cell Signaling [Lin P.J., Williams W.P., Kobiljski J. and Numata M. Caveolins bind to (Na+, K+)/H+ exchanger NHE7 by a novel binding module. Cell Signal. 2007 May;19(5):978-88.]. Cloning of GST-Cav 1 constructs and GST Pull-down using these constructs were performed by Dr. Warren P. Williams and Jasmina Kobiljski. I designed and completed the remaining experiments which resulted in 6 of the 7 figures. The manuscript was prepared by myself and Dr. Numata.  Chapter 4 of this dissertation describes work that will be part of a manuscript in the future. Experiments were solely carried out by myself. The initial manuscript was prepared by myself and Dr. Numata.  xiv  Chapter 1: Introduction 1.1 Importance of pH homeostasis and diseases A cell is the basic unit of life. It consists of a lipid bilayer enclosing organic material necessary to ensure growth and propagation. In order for a cell to live, it is adept to sustain and respond to minor changes intracellularly or extracellularly to maintain homeostasis. Any deviation from homeostatic conditions can be detrimentuous and induce various cellular responses ranging from cell transformation to apoptosis, therefore, tight regulation is crucial. Various diseases have been linked with homeostatic imbalance, therefore, highly regulated mechanisms in processes such as osmotic pressure, salt concentration, and pH are in place to provide stable growth conditions. pH regulation is a common theme observed in the simplest life form to complex multicellular organism. The plasma membrane is the main structural constituent that encloses the cell. It can detect chemical messengers such as growth factors and hormones, attach to other cells and anchor to extracellular matrix/surface. However, the most important function of the plasma membrane is to serve as a selective barrier, regulating which molecules enter or exit the cell. As a selective barrier, cytosolic pH regulation is mediated by the uptake and extrusion of protons in order to maintain neutral pH at steady state. Various diseases have been linked to key molecules in pH regulation. Carbonic anhydrase IX has been associated to lung cancer (Kim et al., 2004), mutations and knock out mice studies of Chloride Channels C1C have implicated different C1C isoforms to cystic fibrosis, Dent's disease, Banner's disease III, myotonia congenital disease and osteoporosis (Foskett, 1998; Nilius and Droogmans, 2003; Piwon et al., 2000), and  1  mutations to different isoforms of bicarbonate transporters in human have been associated with spherocytosis or distal renal tubular acidosis, anemia, hypokalemia, hypercalciuria, nephrocalcinosis, nephrolithiasis generalized seizures, short stature, basal ganglia calcification, mental retardation, cataracts, band keratopathy, distal and proximal retal tubular acidosis, hypokalemia and hypertension (Pushkin and Kurtz, 2006). Also, knock out studies of bicarbonate transporters in mice resulted in growth retardation, achlorhydria, edentulous, abnormal spermatogenesis, embryonically lethal, retinal degeneration, and mild auditory impairment (Pushkin and Kurtz, 2006). Thus, pH homeostasis is crucial and any deviation from optimal pH condition can contribute to severe cell defects and diseases. 1.2 Components of pH regulation  The main components of cytosolic pH regulation are: Na + dependent C1711CO3 exchanger, C171-1CO3 exchanger, Na ±/HCO3 - co-transporter and Na+/H + exchanger (NHE) (Orlowski and Grinstein, 2004). However, the focus of this introduction will encircle the mammalian family of Na±/H+ exchangers. 1.3 NHE overview  Na+/H + exchange activity has been found in diverse organisms ranging from bacteria to yeast, nematodes, plants and mammals, and plays crucial roles in sustaining normal cellular functions (reviewed by Orlowski and Grinstein, 2004; Brett et al., 2005a). Breakthrough studies by Pouyssegur and colleagues first showed that growth factor actions control the maintained intracellular pH (Pouyssegur et al., 1982; L'Allemain et al., 1984). Later, it was shown that Chinese hamster fibroblast mutants lacking Na +/H + exchange activity did not survive acidic environments (Pouyssegur et al., 1984),  2  indicating its importance in intracellular pH maintenance. The original concept for the mammalian Na +/H + exchange was to extrude W from the cytosol using the Na + concentration gradient across the plasma membrane in an electroneutral manner. This is in contrast with the electrogenic nature of bacterial Na +/H + antiporters (Padan et al., 2001). NHEs are also important for cellular volume regulation and re-absorption of NaC1 across the renal and gastrointestinal epithelium (Vallon et al., 2000; Maher et al., 1996). While this basic concept is still valid, characterization of newly identified NHE6-9 has added new information on NHE functions (see below). NHEs are integral membrane proteins. Hydropathy plots have predicted that NHEs contain 12 putative a-helical transmembrane spanning regions and a C- terminal cytosolic extension (Fig. 1-1). To date nine mammalian NHE isoforms have been identified (Sardet et al., 1988; Tse et al., 1992; Orlowski et al., 1992; Klanke et al., 1995; Numata et al., 1998; Numata and Orlowski, 2001, Goyal et al., 2003; Nakamura et al., 2005). While the amino acid sequence for the N-terminal transmembrane domains is highly conserved among different NHE isoforms, their C-terminal cytosolic extensions share much less homology, which may account for some of the observed isoform specific regulation (Sardet et al., 1990; Ammar et al., 2006). Classical NHEs (NHE1-5) are mostly functional on the plasma membrane and were originally designated as "plasma membrane type" NHEs (Orlowski and Grinstein, 2004). However, more recent studies have indicated that the plasma membrane type NHEs are not present exclusively in the plasma membrane. For example, NHE3 and NHE5 are associated with recycling endosomes (reviewed in Orlowski and Grinstein, 2007) and NHE4 may be active in zymogen granules (Anderie et al., 1998). Thus, although "plasma membrane type" and  3  "organellar membrane type" are commonly used to describe NHE1-5 and NHE6-9 respectively (Orlowski and Grinstein, 2007), it is important to emphasize that this terminology does not necessarily reflect the intracellular localization of each isoform. Nevertheless, it is clear that the two groups of mammalian NHEs possess distinct structural and functional characteristics, and so I will use the "plasma membrane" and "organellar" terminologies in the following sections.  4  H+  Fig. 1-1. Schematic representation of NHEs predicted by hydropathy plots.  5  1.3.1 Plasma membrane type NHEs NHE1  An amiloride-sensitive Na ±/H + exchange activity, first studied in fibroblasts (Pouyssegur et al., 1982; Paris and Pouyssegur, 1983), is responsible for intracellular pH regulation (L'Allemain et al., 1984; Pouyssegur et al., 1984). The responsible gene was later cloned and termed NHE1 (Sardet et al., 1988; Mattei et al., 1988). NHE1 is ubiquitously expressed in most mammalian cells and plays a pivotal role in cellular pH regulation and cell volume homeostasis (Pouyssegur et al., 1984; Sardet et al., 1988; Bianchini et al., 1995). NHE 1 transporter activity is regulated by protein-protein interaction through the cytoplasmic C-terminal tail as well as phosphorylation. Some molecules that regulate NHE1 include MAPK such as ERK1/2 and p38 (Luo et al., 2007; Kusuhara et al., 1998), GPCRs (Magro et al., 2007; Avkiran and Haworth, 2003), growth factors (Bianchini et al., 1997; Phan et al., 1997; Sardet et al., 1991), p9ORSK (Phan et al., 1997; Takahashi et al., 1997), p16OROCK (Hooley et al., 1996; Tominiga et al., 1998), NIK (Yan et al., 2001a), CaMKII (Fliegel et al., 1992), PKC (Sauvage et al., 2000), and protein phosphatase 1 and 2A (Misik et al., 2005; Snabaitis et al., 2006). Structural studies of NHE1 also helped in understanding the function and regulation of NHE1 (Fliegel, 2005). NHE1 is made up of 12 transmembrane spanning segments with cytosolic N- and Ctermini (Wakabayashi et al., 2000). The cytosolic loops between TM4-5 and TM9-10 can bury into the lipid bilayer. The TM4 was identified to mediate Na + binding as well as inhibitor resistance (Counillon et al., 1993; Counillon et al., 1997; Touret et al., 2001). Transporter activity was highly dependent on Pro 167 and 168 of TM4 as well as G1u262  6  and Asp267 of TM7 (Slepkov et al., 2004; Murtazina et al., 2001), and amiloride sensitivity was shown to be dependent on His349 of TM9 (Wang et al., 1995). The pH sensing is mediated through G1y455 of TM9 and Arg440 which resides in the intracellular loop between TM9 and -10 (Wakabayashi et al., 2003). Specific residues along NHE1 can also mediate protein targeting such as Tyr454 and Arg458 which are needed for cell surface targeting (Wakabayashi et al., 2000). Since NHE1 is expressed in most mammalian cells, it was initially suspected that NHE1 plays a housekeeping role. However, NHE1 turned out not to be essential for maintaining life, as spontaneous mutant mice (Cox et al., 1997) as well as knock out mice (Bell et al., 1999) survive until at least 2 weeks after birth. Interestingly, however, NHE1-deficient mice showed neurological abnormalities such as slow-wave epilepsy and ataxia (Bell et al., 1999; Cox et al., 1997). These results suggest that other molecules compensate NHE1 functions in NHE1 knockout mice and that the NHE1 activity may be particularly important for brain functions. NHE1 's involvement in pathological processes such as ischemia and reperfusion syndrome (Jung et al., 2007; Luo et al., 2007; Moor et al., 2001; Karmazyn et al., 2001), cardiac hypertrophy (Ennis et al., 2003; Karmazyn et al., 2003; Kusumoto et al., 2001), and cancer progression (Reshkin et al., 2000; Lagana et al., 2000; Bourguignon et al., 2004; Cardone et al., 2005; Stock et al., 2005) has been suggested. NHE2 and NHE3  Plasma membrane NHEs other than NHE1 have tissue-specific expression, and NHE2-4 are predominantly expressed in kidney and gastrointestinal systems (Tse et al., 1992; Orlowski et al., 1992). NHE2 was first cloned from rabbit ileum villus cell and 7  transcripts were detected in brain and colon, however, more abundantly detected in the adrenal gland, ileum and in both the cortex and medulla of kidney (Tse et al., 1991). Other reports also showed expression of NHE2 in the stomach, intestinal tract, skeletal muscle, uterus, testis, heart and lung (Malakooti et al., 1999; Orlowski and Grinstein, 2004; Malo and Friegel, 2006). NHE2 resides in the apical membrane of epithelia of the intestinal tract, kidney, skeletal muscle and testis (Malakooti et al., 1999) which overlaps with NHE3 expression. NHE2 and -3 have been suggested to play a role in Na + reabsorption from the apical side of the polarized epithelial cells (Malakooti et al., 1999; Vallon et al., 2000; Maher et al., 1996). The activity of NHE2 has been correlated with its transcription. PMA can increase NHE2 activity (Nath et al., 1999), however, this is accomplished through Egr-1 in C2BBe 1 cells derived from colonil epithelial cells (Malakooti et al., 2005). EGF also upregulates NHE2 activity by increasing NHE2 expression in rat intestinal epithelial cells (Xu et al., 2001). Compared to NHE1, NHE2 is not well characterized, however, gene knock out of NHE2 has provided important physiological information. In NHE2 knock out mice, the parietal and zymogenic cells underwent degeneration resulting in decreased parotid gland fluid secretion, therefore, implicating NHE2 in the long term survival of parietal cells (Schultheis et al., 1998; Malo and Fliegel, 2006; Orlowski and Grinstein, 2004). NHE3 was first cloned from rat and NHE3 transcripts were only detected in the colon, small intestine, kidney and stomach (Orlowski et al., 1992). Reports later showed expression of NHE3 in gall bladder and brain (Bazzini et al., 2001; Xue et al., 2003). NHE3 is a crucial isoform in kidney and intestine (Nakamura et al., 1999). In the kidney,  8  NHE3 is found in the apical membrane of the proximal tubule and thick ascending limb (Amemiya et al., 1995). It has been shown that its principal role in the proximal tubule is for Na + and fluid absorption (Vallon et al., 2000; Orlowski and Grinstein 2004). Meanwhile, in the intestine NHE3 plays an important role in Na + reabsorption in the ileum upon meal stimulation (Maher et al., 1996). The transporter activity of NHE3 can be regulated by osmolarity (Good et al., 2000), transcriptional regulation (Doble et al., 2000; Yun et al., 2002), phosphorylation of the C-terminal tail by PKA (Cabado et al., 1996; Kurashima et al., 1997) or internalization of the transporter by clathrin mediated endocytosis (Chow et al., 1999; Gekle et al., 2001; Gekle et al., 2002). Other proteins that mediate NHE3 regulation include NHERF1 and -2 (Lamprecht et al., 1998; Wade et al., 2001; Yun et al., 2002), CHP (Pang et al., 2001), megalin (Biemesderfer et al., 1999) and dipeptidyl peptidase IV (Girardi et al., 2001; Girardi et al., 2004). The physiological relevance of NHE3 was validated through NHE3 knock out mice experiments. The NHE3 knock out mice showed slight diarrhea and alkalinization of the intestine, mild acidosis, compromised fluid reabsorption, elevated serum aldosterone and higher renin mRNA expression (Ledoussal et al., 2001; Schultheis et al., 1998). NHE4  Along with NHE3, NHE4 was cloned from rat and transcripts were detected in small intestine, colon, kidney, brain, uterus and skeletal muscle, however, it was most abundantly detected in the stomach (Orlowski et al., 1992; Wang et al., 2003). NHE4 distributed to the basolateral membrane of the stomach, kidney and epithelial cells  9  (Pizzonia et al., 1998), in addition, NHE4 was also detected in zymogen granules isolated from rat pancreas (Anderie et al., 1998). Initial studies showed that NHE4 behaved quite differently from the existing NHEs (NHE1-3) and was poorly affected by pH gradient alone (Bookstein et al., 1996). Bookstein and colleagues showed that NHE4 activity was only stimulated when pH gradient is established by acid loading in conjunction with hyperosmolar-induced cell shrinkage (Bookstein et al., 1996). Unlike NHE1-3, the main function of NHE4 may be related to volume homeostasis (Bookstein et al., 1996; Bachmann et al., 1998; PetiPeterdi et al., 2000). NHE4 was also able to exchange a K + with an fr (Chambrey et al., 1997). However, none of previous studies showed physiological relevance of NHE4. Recently, studies performed on NHE4-null mutant (NHE4 -- ) mice showed that NHE4 played a crucial role in parietal cells (Gawenis et al., 2005). These NHE4-null mutant mice showed reduced number of parietal cells, loss of mature chief cells and increased necrotic and apoptotic cells resulting in disruption of proper gastric acid secretion (Gawenis et al., 2005). Observed phenotypes inclined the authors to suggest the importance of NHE4 in the development of secretory membrane and parietal cell maturation and/or differentiation (Gawenis et al., 2005). NHE5  NHE5 is a plasmalemmal NHE that showed highest expression in brain, testis, spleen, and skeletal muscle (Klanke et al., 1995). Functional studies of the brain enriched human NHE5 (Baird et al,. 1999, Attaphitaya et al., 1999) in AP-1 cells, devoid of any NHE, showed that NHE5 followed a first order dependence on the intracellular H + concentration, required ATP, was inhibited by the classical NHE inhibitor amiloride as  10  well as other compounds, and exchanged a Li + with an H + (Szab6 et al., 2000). In addition, Attaphitaya and colleagues showed that rat NHE5 activity was comparable to human NHE5 and that it was suppressed upon activation of PKC and PKA (Attaphitaya et al., 2001). NHE5 activity was also reported to be directly regulated by RACK-1 and the association of NHE5 with RACK-1, paxillin, vinculin and integrin suggested a potential role of NHE5 in ion homeostasis at the focal adhesions sites (Onishi et al., 2007). NHE5 was also detected in intracellular compartments corresponding to recycling endosomes (Szaszi et al., 2002). This localization was dependent on the PI3K activity since wortmannin treatment reduced the plasmalemmal activity of NHE5, reduced the association of NHE5 with recycling endosomes and increased the juxtanuclear accumulation (Szaszi et al., 2002). The internalization of NHE5 was clathrin and betaarrestin 2 dependent (Szaszi et al., 2002; SzabO et al., 2005). 1.3.2 Organellar membrane type NHEs NHE6, -8 and -9 NHE6-9 have been designated as "organellar membrane type" NHEs because of their predominant localization to intracellular organellar membranes in resting cells (Orlowski and Grinstein, 2007; Brett et al., 2005a). NHE6 was first shown to be associated with mitochondria in transfected HeLa cells (Numata et al., 1998), however, it was also reported that NHE6 can be localized to the plasma membrane (Miyazaki et al., 2001; Brett et al., 2002), recycling endosomes (Brett et al., 2002; Nakamura et al., 2005), ER and secretory vesicles (Miyazaki et al., 2001). NHE8 is associated to mid- and transGolgi while NHE9 was localized to late recycling endosomes (Nakamura et al., 2005).  11  Little is known regarding these novel NHEs. NHE6 was predominantly expressed in brain, skeletal muscle and heart (Numata et al., 1998). NHE6 can associate to Angiotensin II receptor subtype AT2 upon receptor stimulation (Pulakat et al., 2005), and the authors suggested that this interaction can mediate further NHE6 transporter regulation. NHE6 may also play a role in the vesicular trafficking of ICAM-1 targeted nanocarriers in endothelial cells (Muro et al., 2006). NHE8 is expressed ubiquituously, however, higher NHE8 expression is detected in the kidney, testis, skeletal muscle and liver (Goyal et al., 2003; Xu et al., 2005). The Na±/11 + exchange has been shown in NHE8 incorporated liposomes (Nakamura et al., 2005) and in suppression of apical NHE8 by siRNA in NRK cells (Zhang et al., 2007). Most of the studies performed on NHE8 are based on localization of NHE8 to the apical surface of proximal tubule of kidney (Goyal et al., 2003; Goyal et al., 2005; Becker et al., 2007; Zhang et al., 2007), and intestinal epithelial cells (Xu et al., 2005). Overall, these studies suggested that NHE8 localizes to the apical side of polarized cells and it may play a role in sodium intake. NHE9 is expressed at similar levels in all tissues (Nakamura et al., 2005), however, further knowledge regarding NHE9 is lacking. NHE9 shares 55% and 57% identity to NHE6 and NHE7 respectively (Nakamura et al., 2005), therefore, understanding both NHE6 and -7 can provide some clues to NHE9 regulation. NHE7  NHE7 was the first mammalian organellar membrane type NHE whose organellar transporter (H + -gradient dependent Na t , K + influx) activity was determined (Numata and Orlowski, 2001). NHE7 was identified as a unique NHE because of its predominant  12  trans-Golgi network (TGN) localization in resting cells and its unique transport action  that transports either Na + or K+ in exchange for H + (Numata and Orlowski, 2001). Unlike plasma membrane type NHEs, NHE7 is also insensitive to amiloride while quinine and benzamil inhibit the transporter activity (Numata and Orlowski, 2001). By northern/dot blots, NHE7 mRNA expression was observed in all tissues examined with the highest expression in brain, muscle and secretory organs such as pancreas (Numata and Orlowski, 2001). NHE7 is evolutionarily highly conserved from yeast Sacchramyces cerevisiae to mammals, and S. cerevisiae mutants lacking the functional NHE7  homologue exhibit a deficit in vesicular trafficking (Bowers et al., 2000). Indeed, NHE7 appears to be more evolutionarily conserved than NHE1 as exemplified by the fact that S. cerevisiae does not have an NHE1-homologue. These findings together suggest that  NHE7 may exert biological effects that are commonly observed in different organisms, and therefore, the focus of my thesis is the characterization of NHE7. Our research group has developed useful reagents for NHE7 in the past years, such as antibodies, overexpressing cell lines and plasmid-based siRNAs which will be used to characterize NHE7. 1.4 Organellar pH The pH in the lumen of each intracellular compartment varies from neutral to acidic pH. The unique pH environment observed in different organelles allow for specific biochemical function. In mitochondria, electrons are transferred from NADH + through the components of the electron transport chain which then induces extrusion of the protons into the intermembrane space by fl + pumps. This established gradient is then used as the driving force for ATP production by the ATP synthase complex. The  13  measured pH in the matrix of mitochondria in HeLa cells and cardiomyocytes was between 7.8 to 7.9 (Llopis et al., 1998). In the endoplasmic reticulum, newly synthesized proteins are translocated from the cytosol into the lumen. The lumen of the ER has a pH of 7.2 (Paroutis et al., 2004), however, as synthesized proteins exit the ER they are exposed to more acidic conditions starting at pH 6.7 at the cis Golgi, then 6.45 at medial Golgi to pH of 6.0 at the trans Golgi (Fig. 1-2) (Paroutis et al., 2004; Demaurex, 2002). As proteins targeted for secretion exit the trans-Golgi network, further acidification by V-ATPase pumps reduce the pH in these organelles from 5.7 to 5.2 (Paroutis et al., 2004; Demaurex, 2002). Likewise, internalized molecules also face gradual lumenal acidification as early endosomes pH 6.3 mature into late endosome pH 6.0 and become lysosomes pH 5.5 (Fig. 1-2) (Paroutis et al., 2004; Demaurex, 2002). This progressive acidification aids in sorting of receptor from ligand, as well as in the breakdown of internalized molecules by proteases in the lysosomes. Membrane proteins that re-enter the cells via the early endosome/recycling endosomal pathway undergo a pH shift of 6.3 to 6.5 (Paroutis et al., 2004). pH regulation in organelles are crucial since alkalination of the mitochondria has been linked to cytosol acidification and mitochondria-induced apoptosis (Matsuyama et al., 2000), disruption of V-ATPase activity which alkalinizes acidic organelles interferes with endocytosis and secretion pathways (Schindler et al., 1996; Dettmer et al., 2006), and genetic studies linked V-ATPases in C. elegans to acidification of the cytosol and promotion of neurodegeneration (Syntichaki et al., 2005). 1.5 Mechanism of organellar pH regulation  A "pump and leak" model has been proposed for acidic organellar pH regulation. The acidic organellar pH environment is primarily generated by the V-ATPase proton  14  pump (Wu et al., 2000; Demaurex, 2002; Paroutis et al., 2004) and counter ion is mostly provided by the function of organellar chloride channels C1C (Picollo and Pusch, 2005; Stobrawa et al., 2001; Jentsch et al., 2005; Gunther et al., 1998). Organellar pH would become 3 if V-ATPase pumps reached chemical equilibrium, but the actual pH is between 5 and 7 (Fig. 1-2) (Demaurex, 2002). This discrepancy suggests the presence of a "leak" pathway which assist in dissipating the established electrical potential of VATPase (Demaurex, 2002; Paroutis et al., 2004). Thus the "pump and leak" model claims that V-ATPases acidify organelles and at steady state the rate of H ± intake is balanced by an equivalent proton efflux through a predicted proton leak pathway (Demaurex, 2002).  15  Secretory pathway 0^0  Endocytic pathway  6 VO  o 14gLik-ited 0 Constitutive^cl 0 pattroiayo_ .  _0  _pathway  61--•  0c  Secr&tory granules c''156-.)  2  ^  E..2  ^  5.6  ^  5.7  pH  Fig. 1-2. Organellar pH homeostasis. Organellar pH is tightly regulated along secretory and endocytic pathways. A progressive acidification occurs along the secretory and endocytic pathways. (This illustration is from Paroutis et al., 2004 used with permission of The American Physiological Society)  16  1.6 Yeast and plant NHE7 homologues regulate organellar pH Yeast NHX1 is the ortholog of mammalian NHE7. Yeast cells lacking Nhxlp show missorting and secretion of vacuolar protease carboxypeptidase Y (Bowers et al., 2000). Furthermore, in these specific strains, it was also reported that markers for late Golgi, prevacuole and lysosome were relocated to aberrant structures next to the vacuole (Bowers et al., 2000). Nhxlp was shown to transport either Na + or K+ in exchange for H + across the late endosomal membrane, maintain pH homeostasis in late endosomal compartments, and control vesicular trafficking (Nass and Rao, 1998; Brett et al., 2005b). Plant homologues of NHE7 (NHXs) are also found intracellularly and regulate salt tolerance (Blumwald and Poole, 1985; Blumwald and Poole, 1987; Xia et al., 2002; Yokoi et al., 2002; Qiu et al., 2004; Pardo et al., 2006). These have been classified as Class I and II. Class I NHXs are "vacuolar type" that transports either Na + or K+ in exchange of H + serving to accumulate Na + and K+ in vacuoles and provide osmolarity and turgor regulation (Pardo et al., 2006). Class II NHXs are associated with endosomes and preferentially exchange K + with fl + suggesting that the selectivity serves to regulate pH in these compartments (Pardo et al., 2006). pH regulation of organellar compartments by NHX is important in plants. For example, abrogation of the Ipomoea nil NHX1 gene by a transposable element resulted in abrogation of vacuolar pH shift and flower color transition (Yoshida et a., 2005; Pardo et al., 2006). Thus, organellar pH regulation in yeast and plants is mediated by cation-proton exchangers. 1.7 Proposed model Molecules responsible for the leak pathway in the "pump and leak" model have not been identified (Fig. 1-3A). Certain isoforms of C1C (C1C 3-7) are intracellular and  17  some of these isoforms, C1C4 and -5, mediate Cl7H + antiport instead of serving as chloride channels (Picollo and Pusch, 2005; Strobrawa et al., 2001). The role of organellar C1Cs have been proposed in organellar pH regulation (Jentsch et al., 2005; Gunther et al., 1998). The emergence of organellar NHEs (NHE6-9) with each isoform distributing to different organelles with minor overlap suggests that differenct NHEs may regulate pH in distinct intracellular compartments (Numata and Orlowski, 2001; Nakamura et al., 2005). My hypothesis is that NHE7 serves as a leak pathway that relieves the acidic organellar environment by using Na + and K+ chemical gradients across the organellar membranes (Fig. 1-3B). Reminiscent of the plasma membrane type NHEs, the action and distribution of NHE7 may be tightly regulated by protein-protein interactions through the cytosolic C-terminal tail. NHE7 has been shown to associate to TGN and acidic organelles (Numata and Orlowski, 2001; Lin et al., 2005, Lin et al., 2007). The TGN is the sorting center, it would be plausible that NHE7 may serve to regulate pH in both endocytic and exocytic pathways.  18  A.^  B.  K+/ Na+ Cl H+ HI  4  V-ATPase  )  4 411r-ATPase  H+  H+  Fig. 1-3. Proposed pH regulation mechanism in acidic organelles. (A) Acidification of organelles is mediated by V-ATPase pumps (Demaurex, 2002). Organellar C1Cs provide counter ions and regulate pH in these compartments (Picollo and Pusch, 2005; Strobawa et al., 2001; Jentsch et al., 2005; Gunther et al., 1998). Other membrane proteins that extrude H ± which contribute to the tight pH regulation remain uncharacterized. (B) NHE7 is proposed to exchange KiNa+ with fr which counteracts the effect of V-ATPase and maintains pH at specific level under steady state.  19  1.8 Protein trafficking  Molecules can move in and out of the cells. These movements are restricted by the plasma membrane. Small molecules like 02 or CO2 can move readily across the membrane by diffusion, however, charged ions which are impermeable to membranes enter and exit the cell by mediated transport (pumps, channels or transporters). The transport of bigger molecules like nutrients, peptides and lipids are limited but dynamic. Two trafficking pathways exist in cells: exocytosis and endocytosis (Fig. 1-4). Newly synthesized proteins and lipids that are targeted to the plasma membrane follow the exocytotic pathway. Toxic waste or proteins targeted for degradation are also trafficked along the secretory pathway. Conversely, extracellular molecules such as solutes, nutrients and signaling molecules are internalized by endocytosis. The intricate trafficking of particles is tightly regulated and any missorting and mistargeting can lead to detrimental consequences. Disturbance of the pH in the acidic organelles or the cytosol can inhibit both endocytosis and secretion (Schindler et al., 1996). As I proposed earlier, the role of NHE7 in organellar pH regulation may be important along the endocytic and/or exocytic pathways.  20  Endocytosis Late Endosomes Early^1 -41ft,^ Endosomes  Lysosomes  0 s■ 5a  / 6  0  (  11  Plasma Membrane  Recycling° ■,I,, 5b^Endosomes 0  Constitutive Secretion  2  TGN  • 0 ....., II^ • 4  4.1118ft*  Regulated Secretion  3  •  MSGs  • •• •• • • •• • • ••^• ••  Fig. 1-4 Protein trafficking. Newly synthesized proteins and membrane are targeted from the TGN to the cell surface through exocytosis or secretion. Solutes, stimulants and nutrients enter the cell through endocytosis via early endosomes (1). Receptors and other membrane proteins can be recycled from the early endosomes back to the plasma membrane (5a) or the TGN (5b). Molecules in endosomes targeted for degradation undergo maturation into late endosomes (6) and become lysosomes (7). In constitutive secretion (2), molecules exit the TGN and are trafficked right away to the plasma membrane. In regulated secretion molecules are segregated to ISGs (immature secretory granules) (3) which undergo maturation into MSGs (mature secretory granules) and remain stored in the cytosol (4) until stimulation.  21  1.8.1 Endocytosis  Cells interact with their surrounding and other cells and sense extracellular changes through membrane proteins like receptors, transporters and channels scattered on the plasma membrane. Channels and transporters can only allow very small particles to enter the cell which limits the uptake of molecules from the extracellular matrix. In order for cells to proliferate and respond to external stimuli, uptake of nutrients, other smaller solutes and ligands, that cannot pass the lipid bilayer through channels or transporters, must be internalized. Internalization of extracellular molecules can be mediated through nonselective or receptor-mediated endocytosis. Two mechanisms are in place for nonselective internalization of extracellular particles: pinocytosis (fluid endocytosis) and phagocytosis. Pinocytosis consists of invagination of the membrane and internalization of extracellular fluid and solutes. Phagocytosis consists of internalization of large particles by extension of the plasma membrane around the particle. The internalized vesicle is called phagosome. This type of endocytosis is only observed in specialized cells such as macrophages. The role of receptor/ligand internalization is to regulate signaling initiated by ligand/receptor binding. The mechanism of receptor-mediated endocytosis consists of binding of an extracellular ligand to the receptor which then leads to invagination of the membrane that buds into a transport vesicle. The endocytosed receptor/ligand follows a highly regulated pathway (Fig. 1.4). In brief, the endocytosed particles enter the cell in a compartment known as early endosomes (1). Early endosomes can be classified into two categories: sorting endosomes and recycling endosomes. Not all the constituents in early endosomes follow the same fate. Some are sorted into the degradative pathway of the  22  lysosomes while others are recycled back to the plasma membrane (5a) or thru a retrograde pathway back to TGN (5b) awaiting for further targeting. Constituents that remain in the early endosomes fuse with vesicles derived from the TGN which results in the formation of late endosomes (6) and eventually lysosomes (7). Receptor-mediated internalization was first determined to be dependent on clathrin coated pits pathway. Clathrin and adaptor proteins are recruited to the plasma membrane which forms a clathrin coated pit (Higgins and McMahon, 2002; Conner and Schmid, 2003). However, clathrin independent internalization mechanisms have been reported since internalization is still observed when mutations were introduced to crucial proteins in clathrin dependent endocytosis (van der Bliek et al., 1993; Benmerah et al., 1999; Ford et al., 2001). In a review by Felberbaum-Corti and colleagues, they describe the internalization of TGFI3 through either clathrin or caveolae dependent pathways (Felberbaum-Corti et al., 2003). Furthermore, internalization of TGFP through a specific pathway dictated whether TGFI3 would trigger further signaling events in the endosomes or follow a degradative pathway (Felbrbaum-Corti et al., 2003). This suggests that differential internalization mediates protein fate. Some components of the clathrin and caveolae/lipid raft associated dependent are shared (Lamaze et al., 2001; Nabi and Le, 2003). The main difference between both pathways is that pharmacological treatment to extract or solubilize cholesterol (a main constituent of lipid raft) disrupts lipid raft dependent endocytosis more readily (Sharma et al., 2004; Wolf et al., 1998). Clathrin and caveolae/lipid raft independent internalization has also been reported. This is termed macropinocytosis and consists of internalization of  23  plasma membrane with larger quantities of fluid through membrane ruffling by extensive actin rearrangement (Kirkham and Parton, 2005; Nichols, 2003).  1.8.2 Exocytosis Exocytosis comprises of two pathways: constitutive and regulated secretion. Cells divide, grow and age, therefore, structural components must be synthesized to accommodate size changes and protein turnover. Thus in all cells, constitutive secretion is in place to allow newly synthesized proteins and lipids to be targeted to the plasma membrane. Within a multicellular organism, cells communicate. In complex organisms like mammals, two communication systems are present: the nervous system and endocrine system. Both of these systems rely on the storage of vesicles containing signaling molecules awaiting stimulus for secretion, described as regulated secretion. The contents stored inside these vesicles depend on the cell type. The vesicular contents in cells in the nervous system include: neurotransmitters such as acetylcholine, biogenic amines, amino acids or neuropeptides, while in the endocrine system, hormones (amine, peptide or steroid) are the prevalent cargo. Regulated secretion is also observed in exocrine cells. In both secretory pathways, constitutive (2) and regulated (3), proteins and membrane are sorted in the TGN and diverge into their respective pathway. In regulated secretion, proteins are first sorted to immature secretory granules (3). These granules undergo maturation by homotypic fusion with other ISGs and missorted proteins are sorted out of the ISGs by budding (Tooze et al., 2001). Mature secretory granules (4) are stored in the cytosol until stimulus. ISGs can be stimulated for secretion, therefore, regulated secretion is not dependent on granule maturation (Tooze et al., 1991).  24  Maturation steps, however, ensure that MSGs do not undergo homotypic fusion. SNAREs and syntaxin 6 are removed from ISGs, therefore, it has been suggested that absence of the SNAREs and syntaxin 6 in MSGs may result in the loss of fusogenic properties (Burgoyne and Morgan, 2003). Protein sorting along the regulated secretion pathway still remains elusive. Thus far it has been demonstrated that protein aggregation at the TGN helps in the sorting and biogenesis of ISGs (Kim et al., 2001; Huh et al., 2003). Furthermore studies on chromogranins, well characterized markers of regulated secretion, showed that these proteins aggregate (Chanat and Huttner, 1991), help in biogenesis of ISGs in nonsecretory cells upon exogenous expression (Huh et al., 2003), and that downregulation of Chromogranin A results in decreased number of secretory granules (Kim et al., 2001). The aggregation of protein sorted to the regulated secretion is dependent on millimolar concentration of Ca 2+ and acidic conditions (Chanat and Huttner, 1991). These were confirmed by in cell studies showing correlation between elevated Ca 2+ concentration with stimulated secretion (Mahapatra et al., 2004) or pharmacological treatment to disrupt vesicular pH using bafilomycin to deactivate V-ATPase which showed missorting of proteins (Taupenot et al., 2005). Two theories have been proposed regarding sorting of proteins along the regulated secretion pathway. The theories proposed were "sort-forentry" and "sort-by-retention" (Aryan and Castle, 1998). In sort-for-entry, it was suggested that proteins are sorted in the TGN into ISGs because the proteins have a specific sequence that allows them to associate to a receptor, membrane or other proteins targeted toward the ISG formation. In sort-by-retention, proteins are segregated and sorted into ISG without any discrepancies. As the granule matures, only proteins that are  25  targeted to follow the regulated secretion are retained, thus the ISGs serve as the site for protein sorting. Proteins that are not secreted along the regulated secretory pathway are budded off through constitutive-like vesicles and secreted out. Both theories complement one another since one particular theory of protein sorting is not prevalent (Aryan and Castle, 1998). Even the same protein is sorted differently in different cell lines. For example, Chromogranin A sorting along the regulated secretory pathway varies in different cell lines. In PC 12, studies of deletion mutants of Chromogranin A showed that the disulfide bonds along the N-terminus is crucial for ISG segregation, however, in GH4C1 cells, it was the C-terminus that was important in regulated secretion targeting (Cowley et al., 2000). 1.9 Objective of this thesis  Currently, only limited information regarding the mammalian organellar NHE7 is available. The goal of this dissertation is to begin to understand the mechanism for its intracellular targeting, cellular localization, regulation and its physiological relevance. One of the hallmarks of NHEs is the highly regulated nature of transporter activity (Orlowski and Grinstein, 2004). Hence, understanding molecular mechanisms of how the dormant NHE is activated by various factors under physiological and pathological conditions is crucial to gain insights into its biological roles. Protein-protein interactions through the cytoplasmic C-terminus as well as phosphorylation in the cytosolic domain serve as important regulatory mechanisms for the plasma membrane type NHEs (Orlowski and Grinstein, 2004). Therefore, taking similar approaches used to characterize plasma membrane type NHEs will enable the characterization of NHE7.  26  In Chapter 2, I describe the identification of Secretory Carrier Membrane Proteins (SCAMPs) as NHE7 binding proteins. SCAMPs have been suggested to be involved with vesicular trafficking (both endocytosis and secretion) (Fernadez-Chacon et al., 2000; Fernadez-Chacon et al., 1999; Liu et al., 2002; Guo et al., 2002). The study presented in this chapter was the first indication that SCAMPs directly bind to other integral membrane proteins and regulate their intracellular targeting. Since organellar pH regulation by NHE7 might control intracellular targeting of other proteins, the SCAMPNHE7 interaction may prove to be a key molecular complex that governs vesicular trafficking and possibly MAPK signaling cascades (see discussion in Chapter 4). This work was published in the Journal of Cell Science (Lin et al., 2005). The C-terminus of all NHEs share little homology and it has been shown that protein-protein association to this C-terminal extension mediate isoform specific regulation (Orlowski and Grinstein, 2004). In Chapter 3, the sequence of the NHE7 Cterminal tail was analyzed for putative protein binding domains. Upon analysis of the sequence, it was observed that amino acids 596-604 encompassed a putative Cav 1 binding domain. Cav 1 is the crucial building block of caveolae and it is associated to multiple signaling complexes (Head and Insel, 2007). Here, I show that NHE7 is targeted to the plasma membrane and that caveolins direct NHE7 to caveolae/lipid raft membrane fractions (published in Cellular Signalling (Lin et al., 2007)). Recent studies have suggested that SCAMPs form macromolecular complexes with different signaling molecules (Ellena et al., 2004; Liu et al., 2005). In Chapter 4, I present a novel interaction between SCAMPs and heterotrimeric G protein f3 subunit. Interestingly, treatment by the membrane permeable SCAMP2 peptide corresponding to  27  the GP-binding domain or gene silencing of SCAMP2 (but not SCAMP 1) by siRNA suppressed GP-induced ERK1/2 activation. This chapter introduces a new model proposing that the NHE7-SCAMP complex serves as a signaling complex. Also, a certain type of secretion is tightly regulated by luminal calcium concentration and pH. This secretion pathway is called "regulated secretion", which is responsible for some neuropeptide release in neurons (Borgonovo et al., 1998; Glombik and Gerdes, 2000). In Chapter 5, I briefly discuss evidence suggesting that NHE7 function is involved with regulated secretion.  28  References Amemiya, M., Loffing, J., Liitscher, M., Kaissling, B., Alpern, R.J. and Moe, O.W. (1995). Expression of NHE-3 in the apical membrane of rat renal proximal tubule and thick ascending limb. Kidney Mt. 48, 1206-1215. Ammar, Y.B., Takeda, S., Hisamitsu, T., Mori, H. and Wakabayashi, S. (2006). Crystal structure of CHP2 complexed with NHE 1-cytosolic region and an implication for pH regulation. EMBO J. 25, 2315-2325. Anderie, I., Blum, R., Haase, W., Grinstein, S. and Thevenod, F. (1998). Expression of NHE1 and NHE4 in rat pancreatic zymogen granule membranes. Biochem Biophys Res Commun. 246, 330-336. Aryan, P. and Castle, D. (1998). Sorting and storage during secretory granule biogenesis: looking backward and looking forward. Biochem. J. 332, 593-610. Attaphitaya, S., Park, K. and Melvin, J.E. (1999). Molecular cloning and functional expression of a rat Na+/H+ exchanger (NHE5) highly expressed in brain. J Biol Chem. 274, 4383-4388. Attaphitaya, S., Nehrke, K. and Melvin, J.E. (2001). Acute inhibition of brain-specific Na(+)/H(+) exchanger isoform 5 by protein kinases A and C and cell shrinkage. Am J Physiol Cell Physiol. 281, C1146-C1157. Avkiran, M. and Haworth, R.S. (2003). Regulatory effects of G protein-coupled receptors on cardiac sarcolemmal Na+/H+ exchanger activity: signalling and significance. Cardiovasc Res. 57, 942-952. Review. Bachmann, 0., Sonnentag, T., Siegel, W.K., Lamprecht, G., Weichert, A., Gregor, M. and Seidler, U. (1998) Different acid secretagogues activate different Na+/H+ exchanger isoforms in rabbit parietal cells. Am J Physiol. 275, G1085-G1093. Baird, N.R., Orlowski, J., SzabO, E.Z., Zaun, H.C., Schultheis, P.J., Menon, A.G. and Shull, G.E. (1999). Molecular cloning, genomic organization, and functional expression of Na+/H+ exchanger isoform 5 (NHE5) from human brain. J Biol Chem. 274, 4377-4382. Bazzini, C., Botta, G., Meyer, G., Baroni, M.D. and Pauhnichl, M. (2001). The presence of NHE1 and NHE3 Na+-H+ exchangers and an apical cAMP-independent Clchannel indicate that both absorptive and secretory functions are present in calf gall bladder epithelium. Exp Physiol. 86, 571-583.  29  Becker, A.M., Zhang, J., Goyal, S., Dwarakanath, V., Aronson, P.S., Moe, O.W. and Baum, M. (2007). Ontogeny of NHE8 in the rat proximal tubule. Am J Physiol Renal Physiol. 293, F255-F261. Bell, S.M., Schreiner, C.M., Schultheis, P.J., Miller, M.L., Evans, R.L., Vorhees, C.V., Shull, G.E. and Scott, W.J. (1999). Targeted disruption of the murine Nhel locus induces ataxia, growth retardation, and seizures. Am J Physiol. 276, C788-C795. Benmerah, A., Bayrou, M., Cerf-Bensussan, N. and Dautry-Varsat, A. (1999). Inhibition of clathrin-coated pit assembly by an Eps15 mutant. J Cell Sci. 112, 13031311.  Bianchini, L., Kapus, A., Lukacs, G., Wasan, S., Wakabayashi, S., Pouyssegur, J., Yu, F.H., Orlowski, J. and Grinstein, S. (1995). Responsiveness of mutants of NHE1 isoform of Na+/H+ antiport to osmotic stress. Am J Physiol. 269, C998-C 1007. Bianchini, L., L'Allemain, G. and Pouyssegur, J. (1997). The p42/p44 mitogenactivated protein kinase cascade is determinant in mediating activation of the Na+/H+ exchanger (NHE1 isoform) in response to growth factors. J Biol Chem. 272, 271-279.  Biemesderfer, D., Nagy, T., DeGray, B. and Aronson, P.S. (1999). Specific association of megalin and the Na+/H+ exchanger isoform NHE3 in the proximal tubule. J Biol Chem. 274, 17518-17524.  Blumwald, E. and Poole, R.J. (1985). Na/H Antiport in Isolated Tonoplast Vesicles from Storage Tissue of Beta vulgaris. Plant Physiol. 78, 163-167. Blumwald, E. and Poole, R.J. (1987). Salt Tolerance in Suspension Cultures of Sugar Beet : Induction of Na/H Antiport Activity at the Tonoplast by Growth in Salt. Plant Physiol. 83, 884-887. Bookstein, C., Musch, M.W., DePaoli, A., Xie, Y., Rabenau, K., Villereal, M., Rao, M.C. and Chang, E.B. (1996). Characterization of the rat Na+/H+ exchanger isoform NHE4 and localization in rat hippocampus. Am J Physiol. 271, C1629-C1638. Borgonovo, B., Racchetti, G., Malosio, M., Benfante, R., Podini, P., Rosa, P. and Meldolesi, J. (1998). Neurosecretion competence, an independently regulated trait of the neurosecretory cell phenotype. J Biol Chem. 273, 34683-34686. Bourguignon, L.Y., Singleton, P.A., Diedrich, F., Stern, R. and Gilad, E. (2004). CD44 interaction with Na+-H+ exchanger (NHE1) creates acidic microenvironments leading to hyaluronidase-2 and cathepsin B activation and breast tumor cell invasion. J Biol Chem. 279, 26991-27007.  Bowers, K., Levi, B. P., Patel, F. I. and Stevens, T. H. (2000). The sodium/proton  30  exchanger Nhx 1p is required for endosomal protein trafficking in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 11, 4277-4294. Brett, C.L., Wei, Y., Donowitz, M. and Rao, R. (2002). Human Na(+)/H(+) exchanger isoform 6 is found in recycling endosomes of cells, not in mitochondria. Am J Physiol Cell Physiol. 282, C1031-C1041. Brett, C.L., Donowitz, M. and Rao, R. (2005a). Evolutionary origins of eukaryotic sodium/proton exchangers. Am J Physiol Cell Physiol. 288, C223-C239. Review. Brett, C.L., Tukaye, D.N., Mukherjee, S. and Rao, R. (2005b). The yeast endosomal Na+K+/H+ exchanger Nhx 1 regulates cellular pH to control vesicle trafficking. Mol Biol Cell. 16, 1396-1405. Burgoyne, R.D. and Morgan, A. (2003). Secretory granule exocytosis. Physiol Rev. 83, 581-632. Review. Cabado, A.G., Yu, F.H., Kapus, A., Lukacs, G., Grinstein, S. and Orlowski, J. (1996). Distinct structural domains confer cAMP sensitivity and ATP dependence to the Na+/H+ exchanger NHE3 isoform. J Biol Chem. 271, 3590-3599. Cardone, R.A., Casavola, V. and Reshkin, S.J. (2005). The role of disturbed pH dynamics and the Na+/H+ exchanger in metastasis. Nat Rev Cancer. 5, 786-795. Review. Chambrey, R., Achard, J.M. and Warnock, D.G. (1997). Heterologous expression of rat NHE4: a highly amiloride-resistant Na+/H+ exchanger isoform. Am J Physiol. 272, C90-C98. Chanat, E. and Huttner, W. B. (1991). Milieu-induced, selective aggregation of regulated secretory proteins in the trans-Golgi network../. Cell Biol. 115, 1505-1519. Chow, C.W., Khurana, S., Woodside, M., Grinstein, S. and Orlowski, J. (1999). The epithelial Na(+)/H(+) exchanger, NHE3, is internalized through a clathrin-mediated pathway. J Biol Chem. 274, 37551-37558. Conner, S.D. and Schmid, S.L. (2003). Differential requirements for AP-2 in clathrinmediated endocytosis. J Cell Biol. 162, 773-779. Counillon, L., Franchi, A. and Pouyssegur, J. (1993). A point mutation of the Na+/H+ exchanger gene (NHE 1) and amplification of the mutated allele confer amiloride resistance upon chronic acidosis. Proc Natl Acad Sci U S A. 90, 4508-4512. Counillon, L. Noel, J., Reithmeier, R.A. and Pouyssegur, J. (1997). Random mutagenesis reveals a novel site involved in inhibitor interaction within the fourth transmembrane segment of the Na+/H+ exchanger-1. Biochemistry. 36, 2951-2959.  31  Cox, G.A., Lutz, C.M., Yang, C.L., Biemesderfer, D., Bronson, R.T., Fu, A., Aronson, P.S., Noebels, J.L. and Frankel, W.N. (1997). Sodium/hydrogen exchanger gene defect in slow-wave epilepsy mutant mice. Cell. 91, 139-148. Cowley, D.J., Moore, Y.R., Darling, D.S., Joyce, P.B. and Gorr, S.U. (2000). N- and C-terminal domains direct cell type-specific sorting of chromogranin A to secretory granules. J Biol Chem. 275, 7743-7448. Demaurex, N. (2002). pH Homeostasis of cellular organelles. News Physiol Sci. 17, 1-5. Review.  Dettmer, J., Hong-Hermesdorf, A., Stierhof, Y.D. and Schumacher, K. (2006). Vacuolar H+-ATPase activity is required for endocytic and secretory trafficking in Arabidopsis. Plant Cell. 18, 715-730.  Doble, M.A., Tola, V.B., Cima, R.R., Zinner, M.J., Klein, M.A. and Soybel, D.I. (2000). Luminal osmolarity downregulates gene expression of Na+/H+ exchanger (NHE3) in rat colon mucosa. J Gastrointest Surg. 4, 531-535.  Ellena, J.F., Moulthrop, J., Wu, J., Rauch, M., Jaysinghne, S., Castle, J.D. and Cafiso, D.S. (2004). Membrane position of a basic aromatic peptide that sequesters phosphatidylinositol 4,5 bisphosphate determined by site-directed spin labeling and highresolution NMR. Biophys J. 87, 3221-3233.  Ennis, I.L., Escudero, E.M., Console, G.M., Camihort, G., Dumm, C.G., Seidler, R.W., Camilion de Hurtado, M.C. and Cingolani, H.E. (2003). Regression of isoproterenol-induced cardiac hypertrophy by Na+/H+ exchanger inhibition. Hypertension. 41, 1324-1329.  Felberbaum-Corti, M., Van Der Goot, F.G. and Gruenberg J. (2003). Sliding doors: clathrin-coated pits or caveolae? Nat Cell Biol. 5, 382-384. Review. Fernandez-Chacon, R., Alvarez de Toledo, G., Hammer, R. E. and Sudhof, T. C. (1999). Analysis of SCAMPI function in secretory vesicle exocytosis by means of gene targeting in mice. J. Biol. Chem. 274, 32551-32554.  Fernandez-Chacon, R., Achiriloaie, M., Janz, R., Albanesi, J. P. and Sudhof, T. C. (2000). SCAMP1 function in endocytosis. J. Biol. Chem. 275, 12752-12756. Fliegel, L., Walsh, M.P., Singh, D., Wong, C. and Barr, A. (1992). Phosphorylation of the C-terminal domain of the Na+/H+ exchanger by Ca2+/calmodulin-dependent protein kinase II. Biochem J. 282, 139-145.  Fliegel, L. (2005). The Na+/H+ exchanger isoform 1. Int. J. Biochem. Cell Biol. 37, 3337.  32  Ford, M.G., Pearse, B.M., Higgins, M.K., Vallis, Y., Owen, D.J., Gibson, A., Hopkins, C.R., Evans, P.R. and McMahon, H.T. (2001). Simultaneous binding of Ptdlns(4,5)P2 and clathrin by AP180 in the nucleation of clathrin lattices on membranes. Science. 291, 1051-1055. Foskett, J.K. (1998). C1C and CFTR chloride channel gating. Annu Rev Physiol. 60, 689717. Gawenis, L.R., Greeb, J.M., Prasad, V., Grisham, C., Sanford, L.P., Doetschman, T., Andringa, A., Miller, M.L. and Shull, G.E. (2005). Impaired gastric acid secretion in mice with a targeted disruption of the NHE4 Na+/H+ exchanger. J Biol Chem. 280, 12781-12789. Gekle, M., Freudinger, R. and Mildenberger, S. (2001). Inhibition of Na+-H+ exchanger-3 interferes with apical receptor-mediated endocytosis via vesicle fusion. J Physiol. 531, 619-629. Gekle, M., Serrano, O.K., Drumm, K., Mildenberger, S., Freudinger, R., Gassner, B., Jansen, H.W. and Christensen, E.I. (2002). NHE3 serves as a molecular tool for cAMP-mediated regulation of receptor-mediated endocytosis. Am J Physiol Renal Physiol. 283, F549-F558. Girardi, A.C., Degray, B.C., Nagy, T., Biemesderfer, D. and Aronson, P.S. (2001). Association of Na(+)-H(+) exchanger isoform NHE3 and dipeptidyl peptidase IV in the renal proximal tubule. J Biol Chem. 276, 46671-46677. Girardi, A.C., Knauf, F., Demuth, H.U. and Aronson, P.S. (2004). Role of dipeptidyl peptidase IV in regulating activity of Na+/H+ exchanger isoform NHE3 in proximal tubule cells. Am J Physiol Cell Physiol. 287, C1238-C1245. Glombik, M.M. and Gerdes, H.H. (2000). Signal-mediated sorting of neuropeptides and prohormones: secretory granule biogenesis revisited. Biochimie. 82, 315-326. Review. Good, D.W., Di Mari, J.F. and Watts, B.A. 3rd. (2000). Hyposmolality stimulates Na(+)/H(+) exchange and HCO(3)(-) absorption in thick ascending limb via PI 3-kinase. Am J Physiol Cell Physiol. 279, C1443-C1454. Goyal, S., Vanden Heuvel, G. and Aronson, P.S. (2003). Renal expression of novel Na+/H+ exchanger isoform NHE8. Am J Physiol Renal Physiol. 284, F467-F473. Goyal, S., Mentone, S. and Aronson, P.S. (2005). Immunolocalization of NHE8 in rat kidney. Am J Physiol Renal Physiol. 288, F530-F538.  33  Gunther, W., Luchow, A., Cluzeaud, F., Vandewalle, A. and Jentsch, T.J. (1998).  C1C-5, the chloride channel mutated in Dent's disease, colocalizes with the proton pump in endocytotically active kidney cells. Proc Natl Acad Sci U S A. 95, 8075-8080. Guo, Z., Liu, L., Cafiso, D. and Castle, D. (2002). Perturbation of a very late step of  regulated exocytosis by a secretory carrier membrane protein (SCAMP2)-derived peptide. J. Biol. Chem. 277, 35357-35363.  Head, B.P. and Insel, P.A.(2007). Do caveolins regulate cells by actions outside of caveolae? Trends Cell Biol. 17, 51-57. Higgins, M.K. and McMahon, H.T. (2002). Snap-shots of clathrin-mediated endocytosis. Trends Biochem Sci. 27, 257-263. Review. Hooley, R., Yu, C.Y., Symons, M. and Barber, D.L. (1996). G alpha 13 stimulates Na+-H+ exchange through distinct Cdc42-dependent and RhoA-dependent pathways. J Biol Chem. 271, 6152-6158. Huh, Y.H., Jeon, S.H. and Yoo, S.H. (2003). Chromogranin B-induced secretory granule biogenesis: comparison with the similar role of chromogranin A. J Biol Chem. 278, 40581-40589. Jentsch, T.J., Neagoe, I. and Scheel, 0. (2005). CLC chloride channels and transporters. Curr Opin Neurobiol. 15, 319-325. Review. Jung, Y.W., Choi, I.J. and Kwon, T.H. (2007). Altered expression of sodium transporters in ischemic penumbra after focal cerebral ischemia in rats. Neurosci Res. 59,  152-159.  Karmazyn, M., Sostaric, J.V. and Gan, X.T. (2001). The myocardial Na+/H+ exchanger: a potential therapeutic target for the prevention of myocardial ischaemic and reperfusion injury and attenuation of postinfarction heart failure. Drugs. 61, 375-389. Review. Karmazyn, M., Liu, Q., Gan, X.T., Brix, B.J. and Fliegel, L. (2003). Aldosterone increases NHE-1 expression and induces NHE-1-dependent hypertrophy in neonatal rat ventricular myocytes. Hypertension. 42, 1171-1176. Kim, T., Tao-Cheng, J.H., Eiden, L.E. and Loh, Y.P. (2001). Chromogranin A, an "on/off" switch controlling dense-core secretory granule biogenesis. Cell. 106, 499-509. Kim, S.J., Rabbani, Z.N., Vollmer, R.T., Schreiber, E.G., Oosterwijk, E., Dewhirst, M.W., Vujaskovic, Z. and Kelley M.J. (2004). Carbonic anhydrase IX in early-stage non-small cell lung cancer. Clin Cancer Res. 10, 7925-7933.  34  Kirkham, M. and Parton, R.G. (2005). Clathrin-independent endocytosis: new insights into caveolae and non-caveolar lipid raft carriers. Biochim Biophys Acta. 1746, 349-363. Review. Klanke, C.A., Su, Y.R., Callen, D.F., Wang, Z., Meneton, P., Baird, N., Kandasamy, R.A., Orlowski, J., Otterud, B.E., Leppert, M., et al. (1995). Molecular cloning and physical and genetic mapping of a novel human Na+/H+ exchanger (NHE5/SLC9A5) to chromosome 16q22.1. Genomics. 25, 615-622. Kurashima, K., Yu, F.H., Cabado, A.G., SzabO, E.Z., Grinstein, S. and Orlowski, J. (1997). Identification of sites required for down-regulation of Na+/H+ exchanger NHE3 activity by cAMP-dependent protein kinase. phosphorylation-dependent and independent mechanisms. J Biol Chem. 272, 28672-28679. Kusuhara, M., Takahashi, E., Peterson, T.E., Abe, J., Ishida, M., Han, J., Ulevitch, R. and Berk, B.C. (1998). p38 Kinase is a negative regulator of angiotensin II signal transduction in vascular smooth muscle cells: effects on Na+/H+ exchange and ERK1/2. Circ Res. 83, 824-831. Kusumoto, K., Haist, J.V. and Karmazyn, M. (2001). Na(+)/H(+) exchange inhibition reduces hypertrophy and heart failure after myocardial infarction in rats. Am J Physiol Heart Circ Physiol. 280, H738-H745. L'Allemain, G., Paris, S. and Pouyssegur, J. (1984). Growth factor action and intracellular pH regulation in fibroblasts. Evidence for a major role of the Na+/H+ antiport. J Biol Chem. 259, 5809-5815. Lagana, A., Vadnais, J., Le, P.U., Nguyen, T.N., Laprade, R., Nabi, I.R. and No0, J. (2000). Regulation of the formation of tumor cell pseudopodia by the Na(+)/H(+) exchanger NHE1. J Cell Sci. 113, 3649-3662. Lamaze, C., Dujeancourt, A., Baba, T., Lo, C.G., Benmerah, A. and Dautry-Varsat, A. (2001). Interleukin 2 receptors and detergent-resistant membrane domains define a clathrin-independent endocytic pathway. Mol Cell. 7, 661-671. Lamprecht, G., Weinman, E.J. and Yun, C.H. (1998). The role of NHERF and E3KARP in the cAMP-mediated inhibition of NHE3. J Biol Chem. 273, 29972-29978. Ledoussal, C., Woo, A.L., Miller, M.L. and Shull, G.E. (2001). Loss of the NHE2 Na(+)/H(+) exchanger has no apparent effect on diarrheal state of NHE3-deficient mice. Am J Physiol Gastrointest Liver Physiol. 281, G1385-G1396. Lin, P.J., Williams, W.P., Luu, Y., Molday, R.S., Orlowski, J. and Numata M. (2005). Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7. J Cell Sci. 118, 1885-1897.  35  Lin, P.J., Williams, W.P., Kobiljski, J. and Numata, M. (2007). Caveolins bind to (Na+, K+)/H+ exchanger NHE7 by a novel binding module. Cell Signal. 19, 978-988. Liu, L., Guo, Z., Tieu, Q., Castle, A. and Castle, D. (2002). Role of secretory carrier membrane protein SCAMP2 in granule exocytosis. Mol Biol Cell. 13, 4266-4278. Liu, L., Liao, H., Castle, A., Zhang, J., Casanova, J., SzabO, G. and Castle, D. (2005). SCAMP2 interacts with Arf6 and phospholipase D I and links their function to exocytotic fusion pore formation in PC12 cells. Mol Biol Cell. 16, 4463-4472. Llopis, J., McCaffery, J.M., Miyawaki, A., Farquhar, M.G. and Tsien, R.Y. (1998).  Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins. Proc Nall Acad Sci U S A. 95, 6803-6808. Luo, J., Kintner, D.B., Shull, G.E. and Sun, D. (2007). ERK1/2-p9ORSK-mediated phosphorylation of Na+/H+ exchanger isoform 1. A role in ischemic neuronal death. J Biol Chem. 282, 28274-28284. Magro, F., Fraga, S. and Soares-da-Silva, P. (2007). Short-term effect on intestinal  epithelial Na(+)/H(+) exchanger by Gi(alphal,2)-coupled 5-HT(1A) and G(q/11)-coupled 5-HT(2) receptors. Life Sci. 81, 560-569. Mahapatra, N.R., Mahata, M., Hazra, P.P., McDonough, P.M., O'Connor, D.T. and Mahata, S.K. (2004). A dynamic pool of calcium in catecholamine storage vesicles.  Exploration in living cells by a novel vesicle-targeted chromogranin A-aequorin chimeric photoprotein. J Biol Chem. 279, 51107-51121. Maher, M.M., Gontarek, J.D., Jimenez, R.E., Donowitz, M. and Yeo, C.J. (1996). Role of brush border Na+/H+ exchange in canine ileal absorption. Dig Dis Sci. 41, 651659. Malakooti, J., Dandal, R.Y., Schmidt, L., Layden, T.J., Dudeja, P.K. and Ramaswamy, K. (1999). Molecular cloning, tissue distribution, and functional expression of the human Na(+)/H(+) exchanger NHE2. Am J Physiol. 277, G383-G390. Malakooti, J., Sandoval, R., Memark, V.C., Dudeja, P.K. and Ramaswamy, K.  (2005). Zinc finger transcription factor Egr-1 is involved in stimulation of NHE2 gene expression by phorbol 12-myristate 13-acetate. Am J Physiol Gastrointest Liver Physiol. 289, G653-G663. Mato, M.E. and Fliegel, L. (2006). Physiological role and regulation of the Na+/H+ exchanger. Can J Physiol Pharmacol. 84, 1081-1095. Review. Matsuyama, S., Llopis, J., Deveraux, Q.L., Tsien, R.Y. and Reed, J.C. (2000).  Changes in intramitochondrial and cytosolic pH: early events that modulate caspase activation during apoptosis. Nat Cell Biol. 2, 318-325. 36  Mattei, M.G., Sardet, C., Franchi, A. and Pouyssegur, J. (1988). The human amiloride-sensitive Na+/H+ antiporter: localization to chromosome 1 by in situ hybridization. Cytogenet Cell Genet. 48, 6-8.  Misik, A.J., Perreault, K., Holmes, C.F. and Fliegel, L. (2005). Protein phosphatase regulation of Na+/H+ exchanger isoform I. Biochemistry. 44, 5842-5852. Miyazaki, E., Sakaguchi, M., Wakabayashi, S., Shigekawa, M. and Mihara, K. (2001). NHE6 protein possesses a signal peptide destined for endoplasmic reticulum membrane and localizes in secretory organelles of the cell. J Biol Chem. 276, 4922149227.  Moor, A.N., Gan, X.T., Karmazyn, M. and Fliegel, L. (2001). Activation of Na+/H+ exchanger-directed protein kinases in the ischemic and ischemic-reperfused rat myocardium. J Biol Chem. 276, 16113-16122.  Muro, S., Mateescu, M., Gajewski, C., Robinson, M., Muzykantov, V.R. and Koval, M. (2006). Control of intracellular trafficking of ICAM-1-targeted nanocarriers by endothelial Na+/H+ exchanger proteins. Am J Physiol Lung Cell Mol Physiol. 290, L809L817.  Murtazina, R., Booth, B.J., Bullis, B.L., Singh, D.N. and Fliegel, L. (2001). Functional analysis of polar amino-acid residues in membrane associated regions of the NHE 1 isoform of the mammalian Na+/H+ exchanger. Eur J Biochem. 268, 4674-4685.  Nabi, I.R. and Le, P.U. (2003). Caveolae/raft-dependent endocytosis. J Cell Biol. 161, 673-677. Review.  Nakamura, S., Amlal, H., Schultheis, P.J., Galla, J.H., Shull, G.E. and Soleimani, M. (1999). HCO-3 reabsorption in renal collecting duct of NHE-3-deficient mouse: a compensatory response. Am J Physiol. 276, F914-F921.  Nakamura, N., Tanaka, S., Teko, Y., Mitsui, K. and Kanazawa, H. (2005). Four Na+/H+ exchanger isoforms are distributed to Golgi and post-Golgi compartments and are involved in organelle pH regulation. J Biol Chem. 280, 1561-1572.  Nass, R. and Rao, R. (1998). Novel localization of a Na+/H+ exchanger in a late endosomal compartment of yeast. Implications for vacuole biogenesis. J Biol Chem. 273, 21054-21060. Nath, S.K., Kambadur, R., Yun, C.H., Donowitz, M. and Tse, C.M. (1999). NHE2 contains subdomains in the COOH terminus for growth factor and protein kinase regulation. Am J Physiol. 276, C873-C882.  37  Nichols, B. (2003). Caveosomes and endocytosis of lipid rafts. J Cell Sci. 116, 47074714.  Nilius, B. and Droogmans, G. (2003). Amazing chloride channels: an overview. Acta Physiol Scand. 177, 119-147. Review. Numata, M., Petrecca, K., Lake, N. and Orlowski, J. (1998). Identification of a mitochondrial Na+/H+ exchanger. J. Biol. Chem. 273, 6951-6959. Numata, M. and Orlowski, J. (2001). Molecular cloning and characterization of a novel (Na+,K+)/H+ exchanger localized to the trans-Golgi network. J. Biol. Chem. 276, 1738717394.  Onishi, I., Lin, P.J., Diering, G.H., Williams, W.P. and Numata, M. (2007). RACK1 associates with NHE5 in focal adhesions and positively regulates the transporter activity. Cell Signal. 19, 194-203. Orlowski, J., Kandasamy, R.A. and Shull, G.E. (1992). Molecular cloning of putative members of the Na/H exchanger gene family. cDNA cloning, deduced amino acid sequence, and mRNA tissue expression of the rat Na/H exchanger NHE-1 and two structurally related proteins. J Biol Chem. 267, 9331-9339. Orlowski, J. and Grinstein, S. (2004). Diversity of the mammalian sodium/proton exchanger SLC9 gene family. PflUgers Arch. 447, 549-565. Orlowski, J. and Grinstein, S. (2007). Emerging roles of alkali cation/proton exchangers in organellar homeostasis. Curr Opin Cell Biol. 19, 483-492. Padan, E., Venturi, M., Gerchman, Y. and Dover, N. (2001). Na(+)/H(+) antiporters. Biochim Biophys Acta. 1505, 144-157. Review. Pang, T., Su, X., Wakabayashi, S. and Shigekawa, M. (2001). Calcineurin homologous protein as an essential cofactor for Na+/H+ exchangers. J Biol Chem. 276, 17367-17372. Pardo, J.M., Cubero, B., Leidi, E.O. and Quintero, F.J. (2006). Alkali cation exchangers: roles in cellular homeostasis and stress tolerance. J Exp Bot. 57, 1181-1199. Review. Paris, S. and Pouyssegur, J. (1983). Biochemical characterization of the amiloridesensitive Na+/H+ antiport in Chinese hamster lung fibroblasts. J Biol Chem. 258, 35033508.  Paroutis, P., Touret, N. and Grinstein, S. (2004). The pH of the secretory pathway: measurement, determinants, and regulation. Physiology (Bethesda). 19, 207-215. Review. 38  Peti-Peterdi, J., Chambrey, R., Bebok, Z., Biemesderfer, D., St John, P.L., Abrahamson, D.R., Warnock, D.G. and Bell, P.D. (2000). Macula densa Na(+)/H(+) exchange activities mediated by apical NHE2 and basolateral NHE4 isoforms. Am J Physiol Renal Physiol. 278, F452-F463. Phan, V.N., Kusuhara, M., Lucchesi, P.A. and Berk, B.C. (1997). A 90-kD Na(+)-H+ exchanger kinase has increased activity in spontaneously hypertensive rat vascular smooth muscle cells. Hypertension. 29, 1265-1272. Picollo, A. and Pusch, M. (2005). Chloride/proton antiporter activity of mammalian CLC proteins C1C-4 and C1C-5. Nature. 436, 420-423. Piwon, N., Gunther, W., Schwake, M., Bosl, M.R. and Jentsch, T.J. (2002). C1C-5 Cl- channel disruption impairs endocytosis in a mouse model for Dent's disease. Nature. 408, 369-373. Pizzonia, J.H., Biemesderfer, D., Abu-Alfa, A.K., Wu, M.S., Exner, M., Isenring, P., Igarashi, P. and Aronson, P.S. (1998). Immunochemical characterization of Na+/H+ exchanger isoform NHE4. Am J Physiol. 275, F510-F517. Pouyssegur, J., Chambard, J.C., Franchi, A., Paris, S. and Van ObberghenSchilling, E. (1982). Growth factor activation of an amiloride-sensitive Na+/H+ exchange system in quiescent fibroblasts: coupling to ribosomal protein S6 phosphorylation. Proc Nall Acad Sci U S A. 79, 3935-3939. Pouyssegur, J., Sardet, C., Franchi, A., L'Allemain, G. and Paris, S. (1984). A specific mutation abolishing Na+/H+ antiport activity in hamster fibroblasts precludes growth at neutral and acidic pH. Proc Nall Acad Sci U S A. 81, 4833-4837. Pulakat, L., Cooper, S., Knowle, D., Mandavia, C., Bruhl, S., Hetrick, M. and Gavini, N. (2005). Ligand-dependent complex formation between the Angiotensin II receptor subtype AT2 and Na+/H+ exchanger NHE6 in mammalian cells. Peptides. 26, 863-873. Pushkin, A. and Kurtz, I. (2006). SLC4 base (HCO3 -, CO3 2-) transporters: classification, function, structure, genetic diseases, and knockout models. Am J Physiol Renal Physiol. 290, F580-F599. Review. Qiu, Q.S., Guo, Y., Quintero, F.J., Pardo, J.M., Schumaker, K.S. and Zhu, J.K. (2004). Regulation of vacuolar Na+/H+ exchange in Arabidopsis thaliana by the saltoverly-sensitive (SOS) pathway. J Biol Chem. 279, 207-125. Reshkin, S.J., Bellizzi, A., Caldeira, S., Albarani, V., Malanchi, I., Poignee, M., Alunni-Fabbroni, M., Casavola, V. and Tommasino, M. (2000). Na+/H+ exchangerdependent intracellular alkalinization is an early event in malignant transformation and  39  plays an essential role in the development of subsequent transformation-associated phenotypes. FASEB J. 14, 2185-2197.  Sardet, C., Franchi, A. and Pouyssegur, J. (1988). Molecular cloning of the growthfactor-activatable human Na+/H+ antiporter. Cold Spring Harb Symp Quant Biol. 53, 1011-1018. Sardet, C., Counillon, L., Franchi, A. and Pouyssegur, J. (1990). Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD. Science. 247, 723-726. Sardet, C., Fafournoux, P. and Pouyssegur, J. (1991). Alpha-thrombin, epidermal growth factor, and okadaic acid activate the Na+/H+ exchanger, NHE-1, by phosphorylating a set of common sites. J Biol Chem. 266, 19166-19171. Sauvage, M., Maziere, P., Fathallah, H. and Giraud, F. (2000). Insulin stimulates NHE1 activity by sequential activation of phosphatidylinositol 3-kinase and protein kinase C zeta in human erythrocytes. Eur J Biochem. 267, 955-962. Schindler, M., Grabski, S., Hoff, E. and Simon, S.M. (1996). Defective pH regulation of acidic compartments in human breast cancer cells (MCF-7) is normalized in adriamycin-resistant cells (MCF-7adr). Biochemistry. 35, 2811-2817. Schultheis, P.J., Clarke, L.L., Meneton, P., Miller, M.L., Soleimani, M., Gawenis, L.R., Riddle, T.M., Duffy, J.J., Doetschman, T., Wang, T., Giebisch, G., Aronson, P.S., Lorenz, J.N. and Shull, G.E. (1998). Renal and intestinal absorptive defects in mice lacking the NHE3 Na+/H+ exchanger. Nat Genet. 19, 282-285. Sharma, D.K., Brown, J.C., Choudhury, A., Peterson, T.E., Holicky, E., Marks, D.L., Simari, R., Parton, R.G. and Pagano, R.E. (2004). Selective stimulation of caveolar endocytosis by glycosphingolipids and cholesterol. Mol Biol Cell. 15, 31143122. Slepkov, E.R., Chow, S., Lemieux, M.J. and Fliegel, L. (2004). Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1. Biochem J. 379, 31-38. Snabaitis, A.K., D'Mello, R., Dashnyam, S. and Avkiran, M. (2006). A novel role for protein phosphatase 2A in receptor-mediated regulation of the cardiac sarcolemmal Na+/H+ exchanger NHE 1. J Biol Chem. 281, 20252-20262. Stobrawa, S.M., Breiderhoff, T., Takamori, S., Engel, D., Schweizer, M., Zdebik, A.A., Bosl, M.R., Ruether, K., Jahn, H., Draguhn, A., Jahn, R. and Jentsch, T.J. (2001). Disruption of C1C-3, a chloride channel expressed on synaptic vesicles, leads to a loss of the hippocampus. Neuron. 29, 185-196.  40  Stock, C., Gassner, B., Hauck, C.R., Arnold, H., Mally, S., Eble, J.A., Dieterich, P. and Schwab, A. (2005). Migration of human melanoma cells depends on extracellular pH and Na+/H+ exchange. J Physiol. 567, 225-238. Syntichaki, P., Samara, C. and Tavernarakis, N. (2005). The vacuolar H+ -ATPase mediates intracellular acidification required for neurodegeneration in C. elegans. Curr Biol. 15, 1249-1254. SzabO, E.Z., Numata, M., Shull, G.E. and Orlowski, J. (2000). Kinetic and pharmacological properties of human brain Na(+)/H(+) exchanger isoform 5 stably expressed in Chinese hamster ovary cells. J Biol Chem. 275, 6302-6307. SzabO, E.Z., Numata, M., Lukashova, V., Iannuzzi, P. and Orlowski, J. (2005). betaArrestins bind and decrease cell-surface abundance of the Na+/H+ exchanger NHE5 isoform. Proc Natl Acad Sci U S A. 102, 2790-2795. Szaszi, K., Paulsen, A., SzabO, E. Z., Numata, M., Grinstein, S. and Orlowski, J. (2002). Clathrin-mediated endocytosis and recycling of the neuron-specific Na+/H+ exchanger NHE5 isoform. Regulation by phosphatidylinositol 3'-kinase and the actin cytoskeleton. J. Biol. Chem. 277, 42623-42632. Takahashi, E., Abe, J. and Berk, B.C. (1997). Angiotensin II stimulates p90rsk in vascular smooth muscle cells. A potential Na(+)-H+ exchanger kinase. Circ Res. 81, 268273. Taupenot, L., Harper, K. L. and O'Connor, D. T. (2005). Role of H+-ATPasemediated acidification in sorting and release of the regulated secretory protein chromogranin A: evidence for a vesiculogenic function. J. Biol. Chem. 280, 3885-3897. Tominaga, T., Ishizaki, T., Narumiya, S. and Barber, D.L. (1998). p16OROCK mediates RhoA activation of Na-H exchange. EMBO J. 17, 4712-4722. Tooze, S.A., Flatmark, T., Tooze, J. and Huttner, W.B. (1991). Characterization of the immature secretory granule, an intermediate in granule biogenesis. J Cell Biol. 115, 1491-1503. Tooze, S. A., Martens, G. J. and Huttner, W. B. (2001). Secretory granule biogenesis: rafting to the SNARE. Trends Cell Biol. 11, 116-122. Touret, N., Poujeol, P. and Counillon, L. (2001). Second-site revertants of a lowsodium-affinity mutant of the Na+/H+ exchanger reveal the participation of TM4 into a highly constrained sodium-binding site. Biochemistry. 40, 5095-5101. Tse, C.M., Ma, A.I., Yang, V.W., Watson, A.J., Levine, S., Montrose, M.H., Potter, J., Sardet, C., Pouyssegur, J. and Donowitz, M. (1991). Molecular cloning and  41  expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger. EMBO J. 10, 1957-1967. Tse, C.M., Brant, S.R., Walker, M.S., Pouyssegur, J. and Donowitz, M. (1992). Cloning and sequencing of a rabbit cDNA encoding an intestinal and kidney-specific Na+/H+ exchanger isoform (NHE-3). J Biol Chem. 267, 9340-9346. Vallon, V., Schwark, J.R., Richter, K. and Hropot, M. (2000). Role of Na(+)/H(+) exchanger NHE3 in nephron function: micropuncture studies with S3226, an inhibitor of NHE3. Am J Physiol Renal Physiol. 278, F375-F379. van der Bliek, A.M., Redelmeier, T.E., Damke, H., Tisdale, E.J., Meyerowitz, E.M. and Schmid, S.L. (1993). Mutations in human dynamin block an intermediate stage in coated vesicle formation. J Cell Biol. 122, 553-563. Wade, J.B., Welling, P.A., Donowitz, M., Shenolikar, S. and Weinman, E.J. (2001). Differential renal distribution of NHERF isoforms and their colocalization with NHE3, ezrin, and ROMK. Am J Physiol Cell Physiol. 280, C192-C198. Wakabayashi, S., Pang, T., Su, X. and Shigekawa, M. (2000). A novel topology model of the human Na(+)/H(+) exchanger isoform 1. J Biol Chem. 275, 7942-7949. Wakabayashi, S., Hisamitsu, T., Pang, T. and Shigekawa, M. (2003). Kinetic dissection of two distinct proton binding sites in Na+/H+ exchangers by measurement of reverse mode reaction. J Biol Chem. 278, 43580-43585. Wang, D., Balkovetz, D.F. and Warnock, D.G. (1995). Mutational analysis of transmembrane histidines in the amiloride-sensitive Na+/H+ exchanger. Am J Physiol. 269, C392-C402. Wang, X.F., Yu, M.K., Lam, S.Y., Leung, K.M., Jiang, J.L., Leung, P.S., Ko, W.H., Leung, P.Y., Chew, S.B., Liu, C.Q., Tse, C.M. and Chan, H.C. (2003). Expression, immunolocalization, and functional activity of Na+/H+ exchanger isoforms in mouse endometrial epithelium. Biol Reprod. 68, 302-308. Wolf, A.A., Jobling, M.G., Wimer-Mackin, S., Ferguson-Maltzman, M., Madara, J.L., Holmes, R.K. and Lencer, W.I. (1998). Ganglioside structure dictates signal transduction by cholera toxin and association with caveolae-like membrane domains in polarized epithelia. J Cell Biol. 141, 917-927. Wu, M.M., Llopis, J., Adams, S., McCaffery, J.M., Kulomaa, M.S., Machen, T.E., Moore, H.P. and Tsien, R.Y. (2000). Organelle pH studies using targeted avidin and fluorescein-biotin. Chem Biol. 7, 197-209.  42  Xia, T., Apse, M.P., Aharon, G.S. and Blumwald, E. (2002). Identification and characterization of a NaCl-inducible vacuolar Na+/H+ antiporter in Beta vulgaris. Physiol Plant. 116, 206-212.  Xu, H., Collins, J.F., Bai, L., Kiela, P.R., Lynch, R.M. and Ghishan, F.K. (2001). Epidermal growth factor regulation of rat NHE2 gene expression. Am J Physiol Cell Physiol. 281, C504-0513. Xu, H., Chen, R. and Ghishan, F.K. (2005). Subcloning, localization, and expression of the rat intestinal sodium-hydrogen exchanger isoform 8. Am J Physiol Gastrointest Liver Physiol. 289, G36-G41.  Xue, J., Douglas, R.M., Zhou, D., Lim, J.Y., Boron, W.F. and Haddad, G.G. (2003). Expression of Na+/H+ and HCO3- -dependent transporters in Na+/H+ exchanger isoform 1 null mutant mouse brain. Neuroscience. 122, 37-46.  Yan, W., Nehrke, K., Choi, J. and Barber, D.L. (2001a). The Nck-interacting kinase (NIK) phosphorylates the Na+-H+ exchanger NHE1 and regulates NHE1 activation by platelet-derived growth factor. J Biol Chem. 276, 31349-31356.  Yokoi, S., Quintero, F. J., Cubero, B., Ruiz, M. T., Bressan, R. A., Hasegawa, P. M. and Pardo, J. M. (2002). Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant J. 30, 529-539. Yoshida, K., Kawachi, M., Mori, M., Maeshima, M., Kondo, M., Nishimura, M. and Kondo, T. (2005). The involvement of tonoplast proton pumps and Na+(K+)/H+ exchangers in the change of petal color during flower opening of Morning Glory, Ipomoea tricolor cv. Heavenly Blue. Plant Cell Physiol. 46, 407-415.  Yun, C.C., Chen, Y. and Lang, F. (2002). Glucocorticoid activation of Na(+)/H(+) exchanger isoform 3 revisited. The roles of SGK1 and NHERF2. J Biol Chem. 277, 76767683.  Zhang, J., Bobulescu, LA., Goyal, S., Aronson, P.S., Baum, M.G. and Moe, O.W. (2007). Characterization of Na+/H+ exchanger NHE8 in cultured renal epithelial cells. Am J Physiol Renal Physiol. 293, F761-F766.  43  Chapter 2 — Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na + ,10/H + exchanger NHE7 1 2.1 Introduction  The pH of organelles along the secretory and endocytic pathways is acidic and largely determined by the balance between the active accumulation of fr driven by the vacuolar H + -ATPase (V-ATPase) (Nelson, 2003; Nishi and Forgac, 2002) and by the efflux of H + through ill-defined pathways (Grabe and Oster, 2001; Schapiro and Grinstein, 2000; Wu et al., 2001). In addition, counterion conductances of members of the C1C Cr channel family also contribute significantly to organellar acidification (Jentsch et al., 2002). Fine control of organellar pH is crucial for the execution of various physiological/pathological processes such as regulated receptor-ligand interactions (Dautry-Varsat et al., 1983), endocytosis (Aniento et al., 1996; Chapman and Munro, 1994; Maranda et al., 2001; Mellman et al., 1986), post-translational processing and sorting of newly synthesized proteins (Chanat and Huttner, 1991; Halban and Irminger, 1994), release of proteins from eosinophilic granules (Kurashima et al., 1996) and entry of some viruses during infection (Durrer et al., 1996; Huber et al., 2001; Mothes et al., 2000). It has also been suggested that elevation of organellar pH causes apoptosis (Akifusa et al., 1998; Ohta et al., 1998), and that irradiation may trigger the formation of acidic organelles that can protect cancer cells from cell death (Paglin et al., 2001). A role for Na+/H + exchangers (NHEs) in organellar function has only recently been appreciated. At least nine isoforms have been identified in mammals that are expressed  ' A version of this chapter has been published. Lin, P.J., Williams, W.P., Luu, Y., Molday, R.S., Orlowski, J. and Numata, M. (2005). Secretory  carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7. Journal of Cell Sciencei. 118(Pt 9), 1885-1897.  44  in a tissue-specific manner and are differentially sorted to discrete membrane locations (de Silva et al., 2003; Orlowski and Grinstein, 2004). NHE1 to NHE5 are resident and functional in the plasma membrane, and hence are commonly referred to as "plasma membrane type" isoforms. However, isoforms such as NHE3 (D'Souza et al., 1998) and NHE5 (Szaszi et al., 2002) are not restricted to the cell surface and can internalize into a recycling endosomal pool where they modulate the luminal pH of that compartment and potentially serve as a reservoir of functional transporters. By comparison, NHE6 to NHE9 are more structurally divergent and appear to accumulate primarily in intracellular compartments (Orlowski and Grinstein, 2004). For instance, NHE7 localizes predominantly to the TGN and to a lesser extent in post-Golgi vesicles (Numata and Orlowski, 2001). More significantly, NHE7 is distinguished from plasma membrane type NHEs by its ability to transport either Na + or K+ in a H + gradient-dependent manner, and hence was proposed as a contributing factor in organellar pH and possibly volume homeostasis. Isoforms such as NHE7 are evolutionary conserved from yeast to man (Apse et al., 1999; Giannakou and Dow, 2001; Nass et al., 1997; Nehrke and Melvin, 2002; Venema et al., 2002; Yokoi et al., 2002), and yeast mutants devoid of a functional vacuolar NHE ortholog show impaired endosomal protein trafficking (Bowers et al., 2000). Thus, multiple organelle-type NHEs may regulate acidification of organelles, which is an important determinant for protein sorting along the exocytic and endocytic pathways in eukaryotes. Recent studies of plasma membrane type NHEs have begun to identify various interacting proteins and cofactors, including kinases, phosphoinositides, scaffolding proteins and cytoskeletal elements, which modulate their transport activities (Fliegel,  45  2005; Noel and Pouyssegur, 1995; Orlowski and Grinstein, 2004; Putney et al., 2002). In contrast, the regulation of organellar membrane type NHEs is largely unknown. To gain insight into factors that govern the targeting and regulation of NHE7, a human brain cDNA library was previously screened using yeast two-hybrid methodology to identify potential interacting proteins and Secretory CArrier Membrane Protein 2 (SCAMP2) was identified. SCAMPs are a family of post-Golgi (Brand and Castle, 1993; Brand et al., 1991) and Golgi (Bell et al., 2001) membrane proteins composed of four transmembrane segments flanked by N- and C-terminal cytoplasmic extensions. Five isoforms have been isolated from mammals and they have been implicated in both exocytosis (FernandezChacon et al., 1999; Guo et al., 2002; Liu et al., 2002) and endocytosis (FernandezChacon et al., 2000). Although SCAMPs have been implicated in vesicular trafficking, there is no evidence showing that SCAMPs can directly target other proteins to specific intracellular compartments. In this chapter, it is shown that the cytoplasmic loop between transmembrane segments TM2 and TM3 of SCAMP2 confers binding to NHE7, and that overexpression of dominant-negative mutants of SCAMP2 caused NHE7 to redistribute preferentially to scattered peripheral recycling endosomes rather than concentrate perinuclearly at the TGN. These data implicate SCAMPs as important elements in the trafficking of NHE7 between the TGN and associated recycling vesicles.  46  2.2 Materials and methods To avoid redundancy, Material and methods of chapters 2 to 5 were combined and detailed in Appendix 1. 2.3 Results 2.3.1 Identification of SCAMPs as NHE7 interacting proteins To identify novel NHE7 interacting proteins, a human brain cDNA library was subjected to yeast two-hybrid screening using part of the C-terminal tail of NHE7 (residues 615-725) as bait. Out of 2 x 10 6 independent clones screened, approximately 300 positive clones were obtained, of which 100 were sequenced. One clone encoding full-length SCAMP2 was isolated as a candidate binding protein of NHE7 (Fig. 2-1A). To investigate whether NHE7 and SCAMP2 interact in cultured cells, CHO cells were transiently co-transfected with mammalian expression vectors containing HA-tagged NHE7 and myc-tagged SCAMP2. NHE7 was immunoprecipitated with an anti-HA antibody from cell lysates and bound SCAMP2 was detected by western blotting using an anti-myc antibody. A 38 kDa band was detected in the immunoprecipitated sample obtained from CHO cells co-transfected with NHE7HA and SCAMP2 myc (Fig. 2-1B). In a reciprocal experiment, NHE7HA was shown to bind to immunoprecipitated SCAMP2  myc  (data not shown). A control sample immunoprecipitated with pre-immune serum did not yield the corresponding band. Immunoprecipitated NHE6HA, a closely related isoform with -70% amino acid identity to NHE7 (Numata and Orlowski, 2001), did not show a detectable level of bound SCAMP2 myc , further supporting the specificity of NHE7SCAMP2 binding. In mammals, five SCAMP isoforms (SCAMP1-5) have been identified (Fernandez-  47  Chacon and Sudhof, 2000; Singleton et al., 1997). Of these, SCAMP]. and SCAMPS are major SCAMP isoforms found in the brain where NHE7 is also highly expressed. SCAMPI and SCAMP2 represent longer isoforms whereas SCAMPS lacks a part of the N-terminal cytoplasmic extension (Fig. 2-1A). In order to determine whether other SCAMP isoforms also interact with NHE7, full-length cDNAs encoding SCAMPI and SCAMPS were cloned by RT-PCR using random-primed first-strand cDNAs synthesized from brain mRNA as a template. The myc-tagged SCAMPs were simultaneously transfected with NHE7HA into CHO cells. Cell lysates were immunoprecipitated with an anti-HA antibody and bound SCAMP protein was detected by western blotting using an anti-myc antibody. A specific 36 kDa band corresponding to SCAMPI was detected in the immunoprecipitated samples with anti-HA, but not pre-immune serum (Fig. 2-1B). Likewise, a distinct 29 kDa band corresponding to SCAMPS appeared only in the cell lysate immunoprecipitated with anti-HA antibody. A fainter band 25 kDa in size was observed both in the samples immunoprecipitated with anti-HA and pre-immune serum (asterisk in Fig. 2-1B), which probably represents non-specific binding of the antibody. The association of SCAMPI and SCAMPS with NHE7 was also investigated by in vitro assays. A GST-fusion protein containing the C-terminal tail of NHE7 (GSTNHE7[542-725]) was expressed in Escherichia coli and purified with glutathione beads. The immobilized GST and GST-fusion proteins were incubated separately with PC12 whole-cell lysates and the glutathione beads were subsequently washed with 0.5% NP40 containing PBS to remove unbound proteins and facilitate detection of bound SCAMPI and SCAMPS. Western blotting revealed binding of both SCAMPI and SCAMPS to the GST-NHE7 fusion protein, but not to GST alone (Fig. 2-1C).  48  ^ ^  A.  ^  NPF repeat^P rich TM1^TM2 TM3^TM4  SCAMPI  II^I  SCAMP2  U^I  1^  SCAMPS  Conserved  B. NHE6HA IP  NHE7HA ^ IP WB: myc  Lys HA con  Lys HA con SCAMP2myc^41104M14  _ 38 kD  ^38 kD  SCAMPImyc ♦ titoollikk^- 36 kD  SCAMPSmyc^  11114111. ^- 29 kl)  C. A,•■  f1.;^  1-^44, <tf CPS re^ .2' 2'P \._ ^ 2 42^co^Q 42 0) 4.' C2^3^.4' 0 C.,  ^0  ^4  (t^ #^ ^ .r" k.4-3°^k„  Pull down^Pull down -  -  fifffr - 36 kD^4108r^29 k0  49  Fig. 2-1. SCAMPs interact with NHE7. (A) Schematic representation of SCAMPI, -2 and -5 showing the Asn-Pro-Phe (NPF) repeat and a highly conserved region (underlined) containing a Pro-rich (P rich) motif and four transmembrane (TM) segments. (B) CHO cells were transiently transfected with HA-tagged NHE7 or NHE6 and myc-tagged SCAMPI, -2 or -5. Cells were lysed in 0.5% NP40/PBS for 30 minutes on ice and lysates were cleared for 20 minutes at 16,000 g at 4°C. Cell lysates (Lys) were then immunoprecipitated with mouse anti-HA antibody (HA) or pre-immune serum (con) and bound SCAMPs were detected on western blots probed with rabbit anti-myc antibody. 5% of the total lysate was loaded. (C) GST and GST fused with NHE7 C-terminal tail (GST-NHE7[542-725]) were expressed in E. coli and purified by incubation with glutathione-conjugated sepharose beads. Two micrograms of immobilized GST or GSTNHE7 C-terminal fusion protein was incubated with PC12 cell lysate, and any SCAMPs bound to the GST fusion protein were detected by western blotting. Blots shown are representative of 3 independent experiments.  50  To delineate the region of interaction between SCAMP2 and NHE7, GST pulldown assays were conducted using GST fusion proteins constructed from different segments of the C-terminal tail of NHE7. 35 S-labeled SCAMP2 showed specific association with GST-NHE7[542-725], GST-NHE7[615-725], and GST-NHE7[542-665], but not with GST-NHE7[666-725], GST-NHE7[542-614], or GST alone (Fig. 2-2). Densitometric analysis from 3 independent experiments showed that GST-NHE7[542725] showed the strongest association to 35 S-labeled SCAMP2 while GST-NHE7[615725] and GST-NHE7[542-665] showed 68% and 77% association relative to full length NHE7 C-terminus, respectively. These results suggest that the SCAMP2 binding domain lies between residues 615 and 665 of NHE7, which lies within the C-terminal domain used as the bait for yeast two-hybrid screening, further supporting the specificity of the binding, however under physiological conditions the entire C-terminal domain might be necessary for SCAMP2-NHE7 interaction.  51  Pull down -  —  SCAMP2 binding  38 kD  NHE7 C-terminus 542  725  1.00 725  615 0.68 ± 0.07 666  542  725  614  665  542 0.77 ± 0.09  Fig. 2-2. Identification of the SCAMP2 binding domain within NHE7. GST alone and GST fused to various segments of NHE7 (residues 542-725, 615-725, 666-725, 542-614 and 542-665) were purified by glutathione-sepharose beads and subjected to GST pulldown. The radiolabeled SCAMP2 protein was incubated with 2µ.g purified GST or GST fusion proteins immobilized on glutathione sepharose beads. After extensive washing, bound SCAMP2 was eluted with SDS sample buffer, resolved by SDS-PAGE, and visualized using a Phosphorimager. Blot shown is representative of 3 independent experiments. Densitometric values are expressed as relative intensity to GSTNHE7[542-725] ± standard deviations obtained from 3 independent experiments.  52  2.3.2 Identification of NHE7-binding domain in SCAMPs To delineate the NHE7-binding domain within SCAMP2, CHO cells were transiently co-transfected with various myc-tagged SCAMP2 deletion mutants and HAtagged full-length NHE7, immunoprecipitated with an anti-HA antibody, and bound SCAMP deletion mutants were detected in western blotting with an anti-myc antibody. The internal deletion mutant lacking the TM2 domain and part of the cytoplasmic loop (184-208) exhibited a significantly weaker interaction (Fig. 2-3) when compared with other deletion mutants and the full-length protein (Fig. 2-1B), implicating this domain in NHE7 binding. This region contains two transmembrane domains (TM2 and TM3) and a cytoplasmic loop (Fig. 2-4A) (Hubbard et al., 2000). As the bait used for our yeast twohybrid screen corresponds to part of the C-terminal tail of NHE7 that is predicted to be cytoplasmic (Numata and Orlowski, 2001), we hypothesized that the minimum NHE7binding domain of SCAMP2 resides in the intracellular loop between the TM2 and TM3. A GST fusion protein comprising the TM2-TM3 loop was expressed, purified and immobilized to glutathione-sepharose beads. This was incubated with in vitro transcribed/translated 35 S-labeled NHE7 C-terminus and the bound NHE7 was then 35 S-labeled NHE7 C-terminus associated with visualized by phosphorimaging, revealing 35  the TM2-TM3 loop (Fig. 2-4B). The intensity of the NHE7 band increased proportionally with increasing amounts of GST-SCAMP[201-215]. Together, these results suggest that the TM2-TM3 loop specifically binds to the C-terminal tail of NHE7 by direct protein-protein interaction.  53  174 184 .........  151 208  M -130  M 51-174  IP SCAM P2myc Lys HA con NHE7HA  A184-208 IP  IP  Lys HA con  Lys HA con  261  283  A261-283 IP Lys HA con COM  Lys HA con  Lys HA con  4011.010.  Fig. 2-3. Co-immunoprecipitation of SCAMP2 my , deletion mutants and NHE7HA. CHO cells were transiently co-transfected with myc-tagged SCAMP2 deletion mutants as illustrated above the blots, and HA-tagged NHE7. Pre-cleared lysates (Lys) were immunoprecipitated with an anti-HA antibody (HA) or mouse pre-immune serum (con) and bound SCAMP2 was detected on western blot by an anti-myc antibody. 5% of the lysate was run for each sample. Blots shown are representative of 3 independent experiments. [Contributed by Yvonne Luu]  54  A.  B.^  GST-SCAMP2 [201-215]  Input GST 4.0^0.25 0.5^1.0^2.0^4.0 1.1g  81 kD Coomassie Staining  42 — 31  ammst mow 4111111, 41001  Fig. 2-4. Dose-dependent binding of SCAMP2[201-215] to NHE7. (A) Predicted membrane topology of SCAMP2. (B) Increasing amounts of GST-SCAMP2[201-215] immobilized to glutathione beads were incubated with radiolabeled NHE7 C-teiminus and the bound NHE7 was visualized using a Phosphorlmager. Four microgram of GST was used as a control. Blot and Coomassie blue stained gel shown are representative of 3 independent experiments.  55  2.3.3 Endogenous SCAMPs bind and colocalize with NHE7  Heterologous expression of certain proteins may cause non-specific aggregation with other proteins owing to overexpression. To minimize this possibility, we next tested whether endogenous SCAMPs and NHE7 interact in cultured cells. Because of the unavailability of antibodies recognizing endogenous NHE7, we stably expressed a 1D4tagged version of NHE7 in neuroendocrine PC12 cells (NHE71D4/PC12), which endogenously express SCAMPI, -2 and -5. A clone with a moderate expression level of NHE7  ]  D4  was selected for further characterization. Cell lysates were incubated with 1D4  antibody-coupled sepharose beads and the immune complexes were eluted with SDS sample buffer. The co-eluted SCAMPs were detected on western blots probed with endogenous anti-SCAMP1 and anti-SCAMP2 antibodies. Immunoprecipitated samples from NHE71 D4/PC12 cells, but not from control PC12 cells, contained proteins of approximately 36 kDa and 38 kDa, corresponding to SCAMP1 and SCAMP2 (Fig. 25A). Western blots probed with the anti-SCAMPS antibody yielded high background signals, which made interpretation of the results difficult. Therefore, membrane-enriched fractions were prepared and used instead of whole cell lysates for the coimmunoprecipitation experiments. Immunoprecipitated samples from NHE71D4/PC12 cells exhibited a specific 29 kDa band corresponding to SCAMPS, suggesting that endogenous SCAMPS also interacts with NHE7. The association of NHE71D4 with endogenous SCAMPs was further examined in intact PC 12 cells by immunofluorescence confocal microscopy. NHE7 (red) largely colocalized with SCAMPI, -2, and -5 (green), the majority of which accumulated in a juxtanuclear compartment (Fig. 2-5B).  56  A.  PC12 NHE7/PC12 Lys IP Lys IP SCAMP1^  SCAMP2  — 36 kD  paigio^ow.^— 38 kD  SCAMP5^AMMO 29 kD  B.  SCAMP^NHE7  ^  Merged  SCAMP1 NHE7  SCAMP2 NHE7  SCAMP5 NHE7  Fig. 2-5. Endogenous SCAMPs bind and largely colocalize with NHE7. (A) Control PC12 cells (PC12) or PC12 cells stably expressing 1D4-tagged NHE7 (NHE7m4/PC12) were immunoprecipitated (IP) with the 1D4 antibody conjugated to sepharose beads. Coimmunoprecipitated SCAMPI, 2, or 5 was detected by western blot probed with antiSCAMP antibodies. Blots shown are representative of 3 independent experiments. (B) Fixed NHE71D4/PC12 cells on glass coverslips were double stained with anti-SCAMP1, SCAMP2 or SCAMPS rabbit antibody with anti-1D4 mouse antibody. SCAMPI (a), SCAMP2 (d) and SCAMP5 (g) were visualized with Alexa 488-conjugated goat antirabbit IgG (green) and the corresponding NHE7 by Alexa 568-conjugated anti-mouse IgG (red fluorescence) (b, e and h respectively). Yellow signals in merged images (c, f and i respectively) correspond to colocalized proteins. Bar, 10 [tm.  57  2.3.4 NHE7 and SCAMPS associate with TGN and recycling endosomes To define the membrane compartmentalization of NHE7 and SCAMPs, PC12 cell homogenates were layered on sucrose gradients and centrifuged to separate the various organelles according to their buoyant densities (Xu et al., 1997; Yan et al., 2001b). Following centrifugation, fractions were taken from the top of the gradients and an equal volume of each fraction was resolved by SDS-PAGE and analyzed by western blot. NHE7 was detected in fractions 6-11, with major accumulation in fractions 7-9, whereas SCAMPI, -2 and -5 showed a slightly broader, but overlapping, distribution that peaked between fractions 5-9 (Fig. 2-6). This pattern is largely consistent with their distribution in intact cells as visualized by immunofluorescence confocal microscopy (Fig. 2-5B). To establish the identity of the membrane fractions, the samples were probed with a series of organellar markers. The distribution of the TGN marker syntaxin 6 (Bock et al., 1997) and various recycling vesicle markers, such as the transferrin receptor, Rab 11 (Ullrich et al., 1996), and syntaxin 13 (Prekeris et al., 1998), most closely matched the pattern of NHE7 and the SCAMPs. Likewise, synaptophysin, a marker for synaptic vesicles/synaptic-like microvesicles (Thomas-Reetz and De Camilli, 1994), also showed close association with NHE7 and the SCAMPs, especially SCAMPI and SCAMPS, which are highly enriched in synaptic vesicles (Brand et al., 1991; Fernandez-Chacon and Sudhof, 2000). In contrast, markers for the cis-Golgi (13-COP), endoplasmic reticulum (PDI) and early endosomes (EEA1) showed little overlap with NHE7 or the SCAMPs.  58  Top  NHE7  1^2 3 4^5 6^7 8^9 10 11 12 13 14 15 Bottom  WO OP  *AP  SCAMPI  IOW  SCAMP2  41011.101.11114111110 . 41.10 OM&  SCAMP5  GM130  Stx 6 Sb<13  -• erne Vag Ogg g..-• oproolp 0000  40  .**  eurell1/101 fittia — — 44140 400. --, **at ono 411110 *NM es.  Rab11  TfR  6-COP  Syp  PDI  EEA1  Fig. 2-6. NHE7 and SCAMPs co-fractionate by sucrose equilibrium density centrifugation. Homogenate was prepared from PC12 cells stably transfected with 1D4tagged NHE7 and analyzed by sucrose equilibrium density centrifugation. Fifteen fractions were taken from the top and an equal volume of each fraction was analyzed on a western blot probed with anti-1D4 and different antibodies that recognize endogenous proteins. The following organellar markers were used: GM130 (cis/medial-Golgi), syntaxin 6 (Stx6; TGN/TGN-derived vesicles), syntaxin 13 (Stx13; recycling endosome), Rab 11 (recycling endosome), transferrin receptor (TfR; recycling endosome), B-COP (cis-Golgi), synaptophysin (Syp; synaptic-like microvesicles), PDI (ER) and EEA1 (early endosomes). Note that NHE7 and SCAMPs showed similar peaks in fractions 7, 8 and 9, but SCAMPs have broader distribution (fractions 5 and 6). In SCAMP2, a less prominent 35 kDa band (labeled with asterisks) was observed in addition to the expected 38 kDa band. This minor band probably represents a non-specific reaction, but could also reflect a proteolytically cleaved form. Blots shown are representative of 3 independent experiments. 59  To visualize the subcellular distribution of the NHE7-SCAMP complexes more precisely, immunofluorescence studies were conducted using recognized markers for the TGN (syntaxin 6, Stx6) and recycling endosomes (transferrin receptor, TfR). Heterologously expressed NHE7 myc closely colocalized with Stx6 (Fig. 2-7A), consistent with earlier findings that NHE7„, y, localizes predominantly to the TGN (Numata and Orlowski, 2001). The signal for NHE7, nye also overlapped that of TfR in the recycling endosomal compartment, although the morphology of the latter was more compact than the distribution of NHE7 (Fig. 2-7B). These data are consistent with the distribution of NHE7 to both the TGN and adjacent recycling vesicles. Likewise, the signals for SCAMPs closely overlapped those of Stx6, but significant portions also colocalized with the TfR. More careful inspection of the signals for the SCAMPs indicated that they are distributed more widely than NHE7, Stx6, or TfR, consistent with previous reports that the SCAMPs are present in a broader range of organelles including the Golgi, post-Golgi recycling pathways, secretory granules and the plasma membrane (Bell et al., 2001; Fernandez-Chacon and Sudhof, 2000; Wu and Castle, 1997).  60  A.^Stx 6  NHE7  SCAMP1  SCAMP2  SCAMP5  B.^Tf R  NHE7  SCAMP1  Ell  SCAMP2  SCAMP5  61  •  Fig. 2-7. NHE7 and SCAMPs colocalize with syntaxin 6 and transferrin receptor. Endogenous SCAMPI, -2, and -5 were visualized in PC12 cells using anti-SCAMP polyclonal rabbit antibodies. To determine intracellular localization of NHE7, PC12 cells were transiently transfected with myc-tagged NHE7 and an anti-myc polyclonal rabbit antibody was utilized. Anti-syntaxin 6 (TGN marker) and transferrin receptor (recycling endosomal marker) monoclonal mouse antibodies were used as organellar markers. NHE7 or SCAMPs were visualized with Alexa 488-conjugated goat anti-rabbit IgG (green) and syntaxin 6 or transferrin receptor was visualized with Alexa 568-conjugated anti-mouse IgG (red). NHE7 exhibited the best colocalization with syntaxin 6, whereas partial colocalization with transferrin receptor was also observed. SCAMPs showed close association with both syntaxin 6 and transferrin receptor, suggesting a more widespread distribution.  62  2.3.5 Overexpression of SCAMP2/A184-208 causes redistribution of NHE7 Both GST pull-down and co-immunoprecipitation experiments indicate that the TM2-TM3 loop of SCAMP2 is important for binding to NHE7. Although SCAMPs have been suggested to be involved with vesicular trafficking, there are no reports showing that SCAMPs directly influence the sorting of specific vesicle-associated proteins. Hence, SCAMPs are hypothesized to modulate the steady-state accumulation of NHE7 in the TGN by binding to NHE7 through the TM2-TM3 region. To address this possibility, CHO cells were co-transfected with NHE7m4 and either full-length SCAMP2,,, y, or an internal deletion mutant of SCAMP2 myc lacking this region (SCAMP2/A184-208) and their relative distributions visualized by immunofluorescence confocal microscopy. The majority of full-length SCAMP2„, y, tightly colocalized with NHE7 in a compact juxtanuclear structure (Fig. 2-8A). In contrast, the SCAMP2/A184-208 mutant displayed more scattered staining. Moreover, the NHE7 1D4 signal also showed a more dispersed vesicular appearance that closely, but not completely, overlapped that of SCAMP2/A184208.  63  A.  NHE7  B.  SCAMP2  SCAN/VA151-174  „or  SCAMP2  SCAMP26218-242  SCAMP2HA SCAMP2HA 1184-208myc^151-174myc  C.  IP^IP Lys HA con Lys HA con WB: myc  64  Fig. 2-8. Expression of SCAMP2/A184-208 shows scattered vesicular appearance with NHE7 and full-length SCAMP2. (A) CHO cells were transfected with myc-tagged X184208 or full-length SCAMP2 and 1D4-tagged NHE7 (NHE7) and viewed by immunofluorescence microscopy. SCAMP2/A184-208 had a more scattered vesicular distribution than full-length wild-type SCAMP2. Co-transfected NHE7 was redistributed to scattered vesicular structures mostly in the same compartment as SCAMP2/A184-208. (B) CHO cells were simultaneously transfected with myc-tagged SCAMP2 deletion mutants and full-length HA-tagged SCAMP2, and their intracellular localization was visualized by immunofluorescence confocal microscopy. Expression of SCAMP2/A184208, but not other mutants, redistributed full-length SCAMP2 to the same scattered vesicular structure. (C) CHO cells were transiently co-transfected with full-length HAtagged SCAMP2 and myc-tagged SCAMP2/A184-208 or SCAMP2/A151-174. Cell lysates (Lys) were immunoprecipitated with a mouse anti-HA antibody (HA) or preimmune serum (con) and co-precipitated SCAMP2/A184-208 and SCAMP2/A151-174 were detected in a western blot by rabbit anti-myc antibody. Five percent of total cell lysate was loaded. Bar, 10 tim.  65  2.3.6 Overexpression of SCAMP2/A184-208 causes dispersion of full-length SCAMP2  SCAMPs are expressed ubiquitously in most eukaryotic cells and can form homoor heteromultimeric structures with different isoforms (Wu and Castle, 1997). It was speculated that SCAMP2/A184-208 might form a complex with endogenously expressed SCAMPs and act as a dominant-negative mutant, which could account for the impaired distribution of NHE7. If this were the case, overexpression of this mutant should also disturb wild-type SCAMPs. To test this possibility, CHO cells were co-transfected with various deletion mutants of myc-tagged SCAMP2 (A151-174, A184-208 or A218-242) and full-length HA-tagged SCAMP2 (SCAMP2HA), and their intracellular localizations were visualized by dual-labeled immunofluorescence confocal microscopy. Full-length SCAMP2H A alone exhibited a perinuclear distribution that was identical to exogenous SCAMP2 myc or endogenous SCAMP2 (data not shown). However, SCAMP2HA exhibited a more scattered vesicular appearance when co-expressed with SCAMP2/A184-208, but not with other deletion mutants lacking either TM1 (A151-174) or TM3 (A218-242) (Fig. 2-8B). Moreover, myc-tagged SCAMP2/A184-208 was co-immunoprecipitated with full-length SCAMP2HA with similar affinity as SCAMP2/A151-174 in transiently cotransfected CHO cells (Fig. 2-8C), suggesting a physical interaction between SCAMP2/A184-208 and full-length SCAMP2 in the cell. The scattered vesicular localization of SCAMP2/A184-208 largely coincided with the recycling endosomal marker TfR (Fig. 2-9A) in the peripheral region of the cell. Thus, residues 184-208 may play a role in directing SCAMPs from peripheral recycling endosomes to the TGN. Next, the influence of expression of SCAMP2/A184-208 on the intracellular localization of  66  other organellar markers, such as Stx6 to the TGN, and GM130 to the Golgi apparatus, was determined. There was no noticeable alteration in Stx6 or GM130 localization under the experimental conditions used, suggesting the specificity of this effect (Fig. 2-9B). However, the involvement of SCAMPs in targeting other TGN resident or cell surface proteins cannot be excluded. These possibilities will need to be tested in the future.  67  A.  B.  SCAM P2A184-208  Fig. 2-9. SCAMP2/A184-208 colocalizes with the transferrin receptor at the peripheral region of cells. PC12 cells were transiently transfected with myc-tagged SCAMP2/A184208 and its intracellular localization was analyzed by double-labeled immunofluorescence confocal microscopy with different organellar markers. (A) SCAMP2/A184-208 (green) colocalized with transferrin receptor (TfR, red) at the peripheral region of cells. (B) Neither syntaxin 6 (Stx6, red) nor GM130 (red) showed significant association with SCAMP2/A184-208 (green). Note that the expression of SCAMP2/A184-208 did not appreciably alter localization of these markers (see Fig. 2-4). Bar, 10 !Rm.  68  2.3.7 GFP-fusion of SCAMP2 TM2-TM3 associates with NHE7 To address whether the TM2-TM3 region (G181-G246) of SCAMP2 is sufficient for both binding and targeting of NHE7 to the TGN, NHE7HA was co-transfected with either GFP or a GFP-tagged TM2-TM3 construct of SCAMP2 (GFP-TM2-3) into CHO cells. The resulting cell lysate was incubated with an anti-HA antibody and any bound GFP or GFP-TM2-3 in the immunoprecipitated fraction was detected by western blotting using an anti-GFP antibody. GFP-TM2-3, but not GFP, was co-immunoprecipitated with HA-tagged NHE7 (Fig. 2-10A). GST pull-down assays further demonstrated direct association of in vitro transcribed/translated 35 S-labeled GFP-TM2-3 protein to the GSTNHE7 C-terminal fusion protein (Fig. 2-10B). These findings are consistent with the GST pull-down of in vitro translated NHE7 C-terminus and the GST-tagged SCAMP2 TM2-TM3 loop (Fig. 2-4). Thus, the TM2-TM3 region is sufficient for binding to NHE7. To demonstrate their association in the cell visually, CHO cells transiently cotransfected with NHE7HA and GFP-TM2-3 were analyzed by immunofluorescence confocal microscopy. Both green (GFP-TM2-3) and red (NHE7HA) fluorescent signals showed considerable overlap in fine vesicular structures (Fig. 2-10C), whereas untagged GFP was uniformly distributed throughout the cell. To further demonstrate the effect of GFP-TM2-3 on the membrane distribution of NHE7 in other cell types, 293-T cells were transiently transfected with GFP alone or GFP-TM2-3 and either NHE7HA or SCAMP2 myc , and the resulting cell lysates were fractioned by sucrose equilibrium density centrifugation. The homogenate obtained from GFP-transfected cells showed predominant accumulation of GFP in the upper (light density) fractions, whereas GFPTM2-3 showed enrichment in the lower denser fractions with a major peak in fractions 7  69  and 8 and a minor peak in fractions 12 and 13 (Fig. 2-10D). This biphasic distribution pattern overlaps considerably those of transiently transfected NHE7HA and SCAMP2 myc , which both showed a broader distribution than cells lacking GFP-TM2-3 (compare with Fig. 2-6). These results are consistent with the notion that the TM2-3 region of SCAMPs is sufficient for binding to NHE7 and, when overexpressed, can act as a dominant negative that partially impairs the normal predominant accumulation of NHE7 in the TGN.  70  ,-S\ ,„0  «.^AN:' ..-,, ,Q^cp c„co  IP: NHE7HA  ,-„  GFP^GFP-TM2-3  ^'  ^\  (  Lys IP Lys IP WB: GFP  ^-<^•.\  Pull down —32 kD  —32 kD  C. NHE7HA  N  iouccx..  Top^  D.  Bottom  1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 GFP-TM2-3 GFP SCAMP2myc NHE7HA  1011111.11.111111011..00.1.1.  MP ID IP^Ow Ili  Fig. 2-10. The TM2-TM3 region is sufficient for NHE7 interaction. (A) CHO cells were transiently co-transfected with HA-tagged NHE7 and GFP-tagged SCAMP2 TM2-TM3 (GFP-TM2-3) or GFP control. Cell lysates (Lys) were immunoprecipitated with anti-HA antibody (IP) and bound GFP fusion proteins were analyzed on western blot. (B) Purified GST fusion protein of NHE7 C-terminus or GST was incubated with radiolabeled GFPTM2-3 and bound protein was detected using a Phosphorlmager. (C) CHO cells were simultaneously transfected with GFP-TM2-3 or GFP alone and NHE7 HA and their intracellular localization was visualized by green and red fluorescence, respectively. (D) Homogenate isolated after transient transfection with GFP-TM2-3, GFP, SCAMP2 myc or NHE7 H A was analyzed by sucrose equilibrium density centrifugation. Bar, 10 [im. Blots shown are representative of 3 independent experiments. [Part D was contributed by Warren P. Williams]  71  23.8 NHE7 C-terminal construct partly accumulates in perinuclear regions with SCAMP2 To examine further the structural determinants underlying the association of NHE7 and SCAMP2 in intact cells, it was then proposed that the cytoplasmic C-terminus of NHE7 was sufficient to target the transporter to SCAMP-containing membranes. To test this hypothesis, CHO cells were co-transfected with an HA-tagged NHE7 C-terminal construct (G525-A725) and full-length SCAMP2 myc or SCAMP2,,, y,/A184-208. Although the NHE7 C-terminal construct was diffusely detected throughout the cytosol when overexpressed, the majority of the protein was concentrated in the juxtanuclear region when expressed in moderate levels (Fig. 2-11). Substantial colocalization between the NHE7 C-terminus and the full-length SCAMP2 was observed. In contrast, the NHE7 Cterminal construct showed more limited colocalization with SCAMP2/A184-208. These results further support the notion that the cytoplasmic C-terminal domain of NHE7 plays a pivotal role in protein-protein interactions with SCAMPs.  72  Fig. 2-11. NHE7 C-terminus partially colocalizes with full-length SCAMP2. CHO cells were co-transfected with myc-tagged SCAMP2 (full-length or A184-208) and HA-tagged NHE7 C-terminus (G525-A725) and their localizations in the cell were visualized by immunofluorescence microscopy. NHE7 C-terminus showed significant colocalization with full-length SCAMP2, but only limited association with SCAMP2/A184-208. Representative cells with low-to-moderate expression levels are shown. Bar, 10 [im  73  2.4 Discussion NHE7 is a unique (Na t , 10/H t exchanger isoform that accumulates predominantly in the TGN and to a lesser extent in post-Golgi vesicles where it is thought to play a significant role in organellar pH and volume homeostasis (Numata and Orlowski, 2001). This study has identified SCAMPs as binding partners of NHE7, and implicates them in the shuttling/retrieval of NHE7 from peripheral recycling endosomes to the TGN. In many cell types, the TGN and recycling endosomes are located in close apposition in the perinuclear region. Many TGN-resident membrane proteins can dynamically cycle to and from the cell surface via endosomes, although the molecular mechanisms underlying this phenomenon are not fully understood. Recent studies have identified several proteins involved in the trafficking of vesicles from the recycling endosomal compartment to the TGN, including certain SNARE complexes and Rab GTPases (Lu et al., 2004; Mallard et al., 2002; Tai et al., 2004; Wilcke et al., 2000). The presence of SCAMPs in the TGN, recycling endosomes, and at the cell surface has also implicated them in the trafficking of vesicles along this pathway. More recently, it was proposed that the recycling endosome might also serve as an intermediate between the TGN and the plasma membrane along the biosynthetic pathway (Ang et al., 2004). These findings suggest that the TGN and recycling endosomal compartments are coupled both spatially and functionally. SCAMPI, -2, and -5 colocalize with NHE7 in the TGN and post-Golgi vesicles of intact cells. By biochemical assays, the highly conserved TM2-TM3 region of SCAMP2 was identified as a critical domain required for binding to NHE7 in vitro and in intact cells. A deletion mutant of SCAMP2 lacking this segment (SCAMP2/A184-208) was  74  unable to associate directly with NHE7 and accumulated preferentially in peripheral vesicles that stained positively for TfR, a recognized marker of recycling endosomes. Strikingly, overexpression of SCAMP2/A184-208 also caused a significant fraction of NHE7 to accumulate in peripheral endosomes rather than the TGN despite its inability to bind NHE7. Similarly, a sizeable portion of wild-type SCAMP2 redistributed to the peripheral recycling endosomal compartment. As SCAMPs form homo- and heteromultimeric complexes amongst themselves (Wu and Castle, 1997), these data are best explained by the ability of SCAMP2/0184-208 to form complexes with wild-type SCAMPs, but act in a dominant-negative manner to disrupt their proper sorting function, thereby leading to a common redistribution of mutant and wild-type SCAMP2 as well as NHE7. Consistent with this hypothesis, myc-tagged SCAMP2/0184-208 was efficiently co-immunoprecipitated with full-length SCAMP2H A in transiently transfected CHO cells. Importantly, the effect of overexpression of SCAMP2/A184-208 on redistribution of NHE7 and SCAMP2 was specific, in as much as other TGN-resident proteins such as Stx6 were unaffected. These data are complemented by other analyses showing that expression of a GFP-tagged TM2-TM3 construct of SCAMP2, which in this case binds to NHE7, but also causes the mistargeting of this transporter. Based on these findings, the following model (Fig. 2-12) was proposed where endogenously expressed SCAMPs facilitate the retrieval of NHE7 from recycling endosomes to the TGN; and heterologously expressed SCAMP2/0184-208 causes either structural alterations of endogenous SCAMPs or inhibits oligomer formation between intact SCAMPs, which impairs the targeting capability of endogenous SCAMPs.  75  PM  I  SCAMPs1  TGN 41—►  0 0 /  EE  ^RE (juxtanuclear)?  C^ Fig. 2-12. Proposed model showing that targeting of NHE7 from the recycling endosome to the TGN is facilitated by binding to SCAMPs. Expression of the SCAMP2/A184-208 mutant blocks the normal targeting by interfering with full-length SCAMP, whereas GFP-tagged SCAMP2 TM2-TM3 (GFP-TM2-3) blocks normal targeting of NHE7 by competitive inhibition with endogenous SCAMPs. EE, early endosome; RE, recycling endosome; PM, plasma membrane; TGN, trans-Golgi network.  76  The binding module between SCAMPs and NHE7 appears to be complex. Although SCAMPs bind directly to the C-terminal tail of NHE7, it was also observed that deletion mutants of NHE7 lacking the C-terminal tail can associate with SCAMPs by coimmunoprecipitation (data not shown). The binding between C-terminal deletion mutants of NHE7 and SCAMPs may be mediated by indirect interactions, such as the formation of oligomers between the mutant NHE7 and endogenously expressed wild-type NHE7. This is possible because the plasmalemmal NHEs are known to form homodimers (Fafournoux et al., 1994) and presumably this tertiary structure is conserved in the organellar NHEs. Alternatively, other domains within the transmembranous region of NHE7 may also contribute to interactions with the SCAMPs. Nevertheless, the Cterminal tail of NHE7 seems to play an important role in this protein-protein interaction. Heterologous expression of the NHE7 C-terminal tail lacking the N-terminal transmembrane domains colocalized, at least in part, with concomitantly expressed fulllength SCAMP2 or endogenous SCAMPs, but not with the M84-208 mutant determined by immunofluorescence microscopy. It is still not clear whether a single motif or two independent, but closely apposing, domains are responsible for NHE7 binding and Golgi targeting. Creation and characterization of substitution mutants in this region will be required to answer this question. SCAMPs 1-3 have an extended cytoplasmic N-terminal domain containing protein interaction motifs, whereas SCAMP4 and SCAMPS lack a major part of the N-terminus (including the NPF repeat). The binding affinity of SCAMPS to NHE7 appears to be weaker than that of SCAMP 1 or SCAMP2. Although the in vitro and in vivo binding assays indicated that the TM2-TM3 loop is the predominant binding domain, the N-  77  terminal cytoplasmic extension may have additional function in protein-protein interaction (e.g. stabilizing the protein interaction). It is of note that overexpression of a deletion mutant of SCAMPI lacking the N-terminal domain potently inhibited transferrin uptake by endocytosis (Fernandez-Chacon et al., 2000). Longer isoforms and shorter isoforms of SCAMPs may bind differently to NHE7 and regulate such biological functions. SCAMPs are also suggested to transduce various signals by tyrosine phosphorylation and through protein interactions (Fernandez-Chacon et al., 2000; Wu and Castle, 1998). Thus, it is possible that SCAMPs tether NHE7 to signaling molecules and control its transporter function. To explore this possibility, we carried out yeast twohybrid screening by using the N-terminal cytosolic extension of SCAMP2 as a bait and found that the heterotrimeric GP protein associated with both NHE7 and SCAMP2. Characterization of the SCAMP2/GP complex is described in Chapter 4.  78  References Akifusa, S., Ohguchi, M., Koseki, T., Nara, K., Semba, I., Yamato, K., Okahashi, N., Merino, R., Nunez, G., Hanada, N. et al. (1998). Increase in Bcl-2 level promoted by  CD40 ligation correlates with inhibition of B cell apoptosis induced by vacuolar type H(+)-ATPase inhibitor. Exp. Cell Res. 238, 82-89.  Ang, A.L., Taguchi, T., Francis, S., Folsch, H., Murrells, L.J., Pypaert, M., Warren, G. and Mellman, I. (2004). Recycling endosomes can serve as intermediates during transport from the Golgi to the plasma membrane of MDCK cells. J. Cell Biol. 167, 531-  543.  Aniento, F., Gu, F., Parton, R. G. and Gruenberg, J. (1996). An endosomal beta COP  is involved in the pH-dependent formation of transport vesicles destined for late endosomes. J. Cell Biol. 133, 29-41.  Apse, M. P., Aharon, G. S., Snedden, W. A. and Blumwald, E. (1999). Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285,  1256-1258.  Bell, A. W., Ward, M. A., Blackstock, W. P., Freeman, H. N., Choudhary, J. S., Lewis, A. P., Chotai, D., Fazel, A., Gushue, J. N., Paiement, J. et al. (2001). Proteomics characterization of abundant Golgi membrane proteins. J. Biol. Chem. 276,  5152-5165.  Bock, J. B., Klumperman, J., Davanger, S. and Scheller, R. H. (1997). Syntaxin 6 functions in trans-Golgi network vesicle trafficking. Mol. Biol. Cell. 8, 1261-1271. Bowers, K., Levi, B. P., Patel, F. I. and Stevens, T. H. (2000). The sodium/proton  exchanger Nhxlp is required for endosomal protein trafficking in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 11, 4277-4294.  Brand, S.H., Laurie, S.M., Mixon, M.B. and Castle, J.D. (1991). Secretory carrier  membrane proteins 31-35 define a common protein composition among secretory carrier membranes. J Biol Chem. 266, 18949-18957. Brand, S. H. and Castle, J. D. (1993). SCAMP 37, a new marker within the general cell surface recycling system. EMBO J. 12, 3753-3761. Chanat, E. and Huttner, W. B. (1991). Milieu-induced, selective aggregation of regulated secretory proteins in the trans-Golgi network. J. Cell Biol. 115, 1505-1519. Chapman, R. E. and Munro, S. (1994). Retrieval of TGN proteins from the cell surface requires endosomal acidification. EMBO J. 13, 2305-2312. D'Souza, S., Garcia-Cabado, A., Yu, F., Teter, K., Lukacs, G., Skorecki, K., Moore,  79  H. P., Orlowski, J. and Grinstein, S. (1998). The epithelial sodium-hydrogen antiporter Na+/H+ exchanger 3 accumulates and is functional in recycling endosomes. J. Biol. Chem. 273, 2035-2043. Dautry-Varsat, A., Ciechanover, A. and Lodish, H. F. (1983). pH and the recycling of transferrin during receptor-mediated endocytosis. Proc. Nall Acad. Sci. USA 80, 22582262. de Silva, M. G., Elliott, K., Dahl, H. H., Fitzpatrick, E., Wilcox, S., Delatycki, M., Williamson, R., Efron, D., Lynch, M. and Forrest, S. (2003). Disruption of a novel member of a sodium/hydrogen exchanger family and DOCK3 is associated with an attention deficit hyperactivity disorder-like phenotype. J. Med. Genet. 40, 733-740. Durrer, P., Galli, C., Hoenke, S., Corti, C., Gluck, R., Vorherr, T. and Brunner, J. (1996). H+-induced membrane insertion of influenza virus hemagglutinin involves the HA2 amino-terminal fusion peptide but not the coiled coil region. J. Biol. Chem. 271, 13417-13421. Fafournoux, P., Noel, J. and Pouyssegur, J. (1994). Evidence that Na+/H+ exchanger isoforms NHE1 and NHE3 exist as stable dimers in membranes with a high degree of specificity for homodimers. J. Biol. Chem. 269, 2589-2596. Fernandez-Chacon, R., Alvarez de Toledo, G., Hammer, R. E. and Sudhof, T. C. (1999). Analysis of SCAMPI function in secretory vesicle exocytosis by means of gene targeting in mice. J. Biol. Chem. 274, 32551-32554. Fernandez-Chacon, R. and Sudhof, T. C. (2000). Novel SCAMPs lacking NPF repeats: ubiquitous and synaptic vesicle-specific forms implicate SCAMPs in multiple membranetrafficking functions. J. Neurosci. 20, 7941-7950. Fernandez-Chacon, R., Achiriloaie, M., Janz, R., Albanesi, J. P. and Sudhof, T. C. (2000). SCAMP1 function in endocytosis. J. Biol. Chem. 275, 12752-12756. Fliegel, L. (2005). The Na+/H+ exchanger isoform 1. Int. J. Biochem. Cell Biol. 37, 3337. Giannakou, M. E. and Dow, J. A. (2001). Characterization of the Drosophila melanogaster alkali-metal/proton exchanger (NHE) gene family. J. Exp. Biol. 204, 37033716. Grabe, M. and Oster, G. (2001). Regulation of organelle acidity. J. Gen. Physiol. 117, 329-344. Guo, Z., Liu, L., Cafiso, D. and Castle, D. (2002). Perturbation of a very late step of regulated exocytosis by a secretory carrier membrane protein (SCAMP2)-derived peptide. J. Biol. Chem. 277, 35357-35363.  80  Halban, P. A. and Irminger, J. C. (1994). Sorting and processing of secretory proteins.  Biochem. J. 299, 1-18.  Hubbard, C., Singleton, D., Rauch, M., Jayasinghe, S., Cafiso, D. and Castle, D. (2000). The secretory carrier membrane protein family: structure and membrane topology. Mol. Biol. Cell 11, 2933-2947. Huber, M., Brabec, M., Bayer, N., Blaas, D. and Fuchs, R. (2001). Elevated endosomal pH in HeLa cells overexpressing mutant dynamin can affect infection by pHsensitive viruses. Traffic 2, 727-736. Jentsch, T. J., Stein, V., Weinreich, F. and Zdebik, A. A. (2002). Molecular structure and physiological function of chloride channels. Physiol. Rev. 82, 503-568. Kurashima, K., Numata, M., Yachie, A., Sai, Y., Ishizaka, N., Fujimura, M., Matsuda, T. and Ohkuma, S. (1996). The role of vacuolar H(+)-ATPase in the control of intragranular pH and exocytosis in eosinophils. Lab. Invest. 75, 689-698. Liu, L., Guo, Z., Tieu, Q., Castle, A. and Castle, D. (2002). Role of secretory carrier membrane protein SCAMP2 in granule exocytosis. Mol Biol Cell. 13, 4266-4278. Lu, L., Tai, G. and Hong, W. (2004). Autoantigen Golgin-97, an effector of Arll GTPase, participates in traffic from the endosome to the trans-golgi network. Mol. Biol. Cell 15, 4426-4443. Mallard, F., Tang, B. L., Galli, T., Tenza, D., Saint-Pol, A., Yue, X., Antony, C., Hong, W., Goud, B. and Johannes, L. (2002). Early/recycling endosomes-to-TGN transport involves two SNARE complexes and a Rab6 isoform. J. Cell Biol. 156, 653664. Maranda, B., Brown, D., Bourgoin, S., Casanova, J. E., Vinay, P., Ausiello, D. A. and Marshansky, V. (2001). Intra-endosomal pH-sensitive recruitment of the Arfnucleotide exchange factor ARNO and Arf6 from cytoplasm to proximal tubule endosomes. J. Biol. Chem. 276, 18540-18550. Mellman, I., Fuchs, R. and Helenius, A. (1986). Acidification of the endocytic and exocytic pathways. Annu. Rev. Biochem. 55, 663-700. Mothes, W., Boerger, A. L., Narayan, S., Cunningham, J. M. and Young, J. A. (2000). Retroviral entry mediated by receptor priming and low pH triggering of an envelope glycoprotein. Cell 103, 679-689. Nass, R., Cunningham, K. W. and Rao, R. (1997). Intracellular sequestration of sodium by a novel Na+/H+ exchanger in yeast is enhanced by mutations in the plasma membrane H+-ATPase. Insights into mechanisms of sodium tolerance. J. Biol. Chem. 81  272, 26145-26152. Nehrke, K. and Melvin, J. E. (2002). The NHX family of Na+-H+ exchangers in Caenorhabditis elegans. J. Biol. Chem. 277, 29036-29044. Nelson, N. (2003). A journey from mammals to yeast with vacuolar H+-ATPase (VATPase). J. Bioenerg. Biomembr. 35, 281-289. Nishi, T. and Forgac, M. (2002). The vacuolar (H+)-ATPases—nature's most versatile proton pumps. Nat. Rev. Mol. Cell Biol. 3, 94-103. Noel, J. and Pouyssegur, J. (1995). Hormonal regulation, pharmacology, and membrane sorting of vertebrate Na+/H+ exchanger isoforms. Am. J. Physiol. 268, C283-C296. Numata, M., Petrecca, K., Lake, N. and Orlowski, J. (1998). Identification of a mitochondrial Na+/H+ exchanger. J. Biol. Chem. 273, 6951-6959. Numata, M. and Orlowski, J. (2001). Molecular cloning and characterization of a novel (Na+,K+)/H+ exchanger localized to the trans-Golgi network. J. Biol. Chem. 276, 1738717394.  Ohta, T., Arakawa, H., Futagami, F., Fushida, S., Kitagawa, H., Kayahara, M., Nagakawa, T., Miwa, K., Kurashima, K., Numata, M. et al. (1998). Bafilomycin Al induces apoptosis in the human pancreatic cancer cell line Capan-1. J. Pathol. 185, 324330.  Orlowski, J. and Grinstein, S. (2004). Diversity of the mammalian sodium/proton exchanger SLC9 gene family. Pfliigers Arch. 447, 549-565. Paglin, S., Hollister, T., Delohery, T., Hackett, N., McMahill, M., Sphicas, E., Domingo, D. and Yahalom, J. (2001). A novel response of cancer cells to radiation involves autophagy and formation of acidic vesicles. Cancer Res. 61, 439-444. Prekeris, R., Klumperman, J., Chen, Y. A. and Scheller, R. H. (1998). Syntaxin 13 mediates cycling of plasma membrane proteins via tubulovesicular recycling endosomes. J. Cell Biol. 143, 957-971.  Putney, L. K., Denker, S. P. and Barber, D. L. (2002). The changing face of the Na+/H+ exchanger, NHE1: structure, regulation, and cellular actions. Annu. Rev. Pharmacol. Toxicol. 42, 527-552.  Schapiro, F. B. and Grinstein, S. (2000). Determinants of the pH of the Golgi complex. J. Biol. Chem. 275, 21025-32102.  82  Singleton, D.R., Wu, T.T. and Castle, J.D. (1997). Three mammalian SCAMPs (secretory carrier membrane proteins) are highly related products of distinct genes having similar subcellular distributions. J Cell Sci. 110, 2099-2107.  Szaszi, K., Paulsen, A., SzabO, E. Z., Numata, M., Grinstein, S. and Orlowski, J. (2002). Clathrin-mediated endocytosis and recycling of the neuron-specific Na+/H+ exchanger NHE5 isoform. Regulation by phosphatidylinositol 3'-kinase and the actin cytoskeleton. J. Biol. Chem. 277, 42623-42632.  Tai, G., Lu, L., Wang, T. L., Tang, B. L., Goud, B., Johannes, L. and Hong, W. (2004). Participation of the syntaxin 5/Ykt6/GS28/GS 15 SNARE complex in transport from the early/recycling endosome to the trans-Golgi network. Mol. Biol. Cell 15, 40114022.  Thomas-Reetz, A. C. and de Camilli, P. (1994). A role for synaptic vesicles in nonneuronal cells: clues from pancreatic beta cells and from chromaffin cells. FASEB J. 8, 209-216. Ullrich, 0., Reinsch, S., Urbe, S., Zerial, M. and Parton, R. G. (1996). Rabll regulates recycling through the pericentriolar recycling endosome. J. Cell Biol. 135, 913924.  Venema, K., Quintero, F. J., Pardo, J. M. and Donaire, J. P. (2002). The arabidopsis Na+/H+ exchanger AtNHX1 catalyzes low affinity Na+ and K+ transport in reconstituted liposomes. J. Biol. Chem. 277, 2413-2418.  Viala, E. and Pouyssegur, J. (2004). Regulation of tumor cell motility by ERK mitogenactivated protein kinases. Ann N Y Acad Sci. 1030, 208-218. Review. Wilcke, M., Johannes, L., Galli, T., Mayau, V., Goud, B. and Salamero, J. (2000). Rab 11 regulates the compartmentalization of early endosomes required for efficient transport from early endosomes to the trans-golgi network. J. Cell Biol. 151, 1207-1220.  Wu, M.M., Grabe, M., Adams, S., Tsien, R. Y., Moore, H. P. and Machen, T. E. (2001). Mechanisms of pH regulation in the regulated secretory pathway. J. Biol. Chem.  276, 33027-33035.  Wu, T. T. and Castle, J. D. (1997). Evidence for colocalization and interaction between 37 and 39 kDa isoforms of secretory carrier membrane proteins (SCAMPs). J. Cell Sci. 110, 1533-1541.  Wu, T. T. and Castle, J. D. (1998). Tyrosine phosphorylation of selected secretory carrier membrane proteins, SCAMP1 and SCAMP3, and association with the EGF receptor. Mol. Biol. Cell 9, 1661-1674. Xu, H., Sweeney, D., Wang, R., Thinakaran, G., Lo, A. C., Sisodia, S. S., Greengard,  83  P. and Gandy, S. (1997). Generation of Alzheimer beta-amyloid protein in the transGolgi network in the apparent absence of vesicle formation. Proc. Natl Acad. Sci. USA 94, 3748-3752. Yan, R., Han, P., Miao, H., Greengard, P. and Xu, H. (2001b). The transmembrane  domain of the Alzheimer's beta-secretase (BACE 1) determines its late Golgi localization and access to beta-amyloid precursor protein (APP) substrate. J. Biol. Chem. 276, 3678836796. Yokoi, S., Quintero, F. J., Cubero, B., Ruiz, M. T., Bressan, R. A., Hasegawa, P. M. and Pardo, J. M. (2002). Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant J. 30, 529-539.  84  Chapter 3 - Caveolins bind to (Na + , K+ )/I1 + exchanger NHE7 by a novel binding module 2 3.1 Introduction In Chapter 2, it was shown that SCAMP2 plays a role in targeting of NHE7 to the TGN however little is known regarding NHE7. The homologues of NHE7 in plants play an important role in salt tolerance (Apse et al., 1996; Venema et al., 2002; Yokoi et al., 2002; Nass et al., 1997), and in protein targeting along secretory and endocytic pathways in the yeast, S. cerevisiae (Bowers et al., 2000). Although, NHE7 is expressed ubiquitously, higher expression is observed in specialized secretory cells (Numata and Orlowski, 2001). Thus, NHE7 may play a housekeeping as well as a specialized role in certain cells. NHEs contain highly conserved N-terminal hydrophobic transmembrane domains and a more diverse isoform-specific C-terminal cytosolic extension. Whereas the N-terminal hydrophobic domains exhibit ion translocation function, the cytosolic Cterminus plays an isoform-specific regulatory role through protein—protein interactions and post-translational modifications (Orlowski and Grinstein, 2004). By inspecting the amino acid sequence of the cytosolic C-terminus of NHE7, a putative caveolin-binding motif was detected: 596WIFRLWYSF6o4. Caveolins are membrane proteins that play a crucial role in formation and maintenance of caveolae, flask-shaped invaginations on the plasma membrane enriched in cholesterol and sphingolipids (Cohen et al., 2004). Among three highly conserved mammalian caveolins (Cav 1, Cav2 and Cav3), Cav 1 and Cav2 are ubiquitously expressed and they form hetero-oligomer complexes, whereas Cav3 is predominantly A version of this chapter has been published Lin, P.J., Williams, W.P., Kobiljski, J. and Numata, M. (2007). Caveolins bind to (Na+, K+)/H+ exchanger NHE7 by a novel binding module. Cellular Signalling. 19(5):978-88. 2  85  found in skeletal and cardiac muscle cells. In addition to their well-defined role as structural proteins for caveolae, caveolins elicit a number of other cellular processes such as endocytosis (Pelkmans and Helenius, 2003; Nichols, 2003; Nabi and Le, 2003; Cheng et al., 2006; Kirkham and Parton, 2005), and cholesterol homeostasis (Fielding and Fielding, 2001). Caveolins also play important roles in signal transduction by binding to a number of different signaling molecules (van Deurs et al., 2003; Simons and Toomre, 2000; Saltiel and Pessin, 2003). The majority of the caveolin binding proteins contain a consensus sequence (DX(I)XXXX0:1) or (I)XXXXOXX(I) (where (I) is an aromatic amino acid and X is any amino acid) that binds to the Caveolin Scaffolding Domain (CSD: amino acids 82-101) (Cohen et al., 2004). In this chapter I show that caveolins directly bind to the C-terminus of NHE7, but 596WIFRLWYSF604 of NHE7 is not required for the caveolin—NHE7 interaction. Unlike most caveolin-binding proteins, the NHE7-binding domain of Cav 1 resides in residues 128-154, but not in the CSD. By flotation assay, it was determined that NHE7 is partly associated with caveolae/lipid rafts and that caveolins facilitate association of NHE7 to caveolae/lipid rafts. A small population of NHE7 is also targeted to the plasma membrane and internalized by a clathrin-dependent and caveolae-independent mechanism. Thus, caveolins may provide a compartmentalized membrane fraction enriched with NHE7 and mediate localized ion homeostasis.  86  3.2 Results 3.2.1 Cytosolic C-terminus of NHE7 binds to Cavl  Most of the caveolin-binding proteins have a consensus sequence OX(DXXXX(1) or (1)XXXX0XX(1) (where (I) is an aromatic amino acid and X is any amino acid) that binds to caveolin 1 (Cav 1) residues 82-101. The region between amino acids 82 and 101 in Cav 1, which coincides with the N-terminal side of the membrane insertion region, is defined as the Caveolin Scaffolding Domain (CSD) (Cohen et al., 2004). By inspecting the amino acid sequence of the C-terminal tail of NHE7, a putative consensus sequence was found for caveolin-binding (596WIFRLWYSF604, Fig. 3-1A) and it was postulated that NHE7 might bind to caveolins through this domain. Glutathione S-transferase (GST) pull-down experiments were used to test this hypothesis. The cytosolic C-terminus of NHE7[542-725] or the same region lacking the putative consensus motif for caveolinbinding NHE7[542-725(A596-604)] was fused with the N-terminal GST-tag, expressed in E. coli and purified by affinity purification with glutathione conjugated sepharose beads. The immobilized GST fusion protein was incubated with CHO cell lysates and bound Cav 1 was detected by western blot. Cav 1 bound efficiently to GST-NHE7[542725], but not to GST, suggesting that the C-terminal extension of NHE7 directly binds to Cavl (Fig. 3-1B). Unexpectedly, Cavl was also readily detectable in complex with GSTNHE7[542-725(A596-604)], indicating that the 596WIFRLWYSF604 motif of NHE7 is not necessary for caveolin-binding. Densitometric analyses showed that 0.23% and 0.21% of the total Cav 1 protein bound to GST-NHE7[5425-725] and NHE7[542-725(A596-604)], respectively.  87  Extracellu lar/lumina I A.  B.  U) C, Input^Pull down Cavl  111111  Fig. 3-1. The cytosolic C-terminus of NHE7 directly binds to caveolin 1 (Cav 1). (A) A proposed model for NHE7 membrane topology. (B) The cytosolic C-terminus of NHE7[542-725] or the same region lacking the putative motif for caveolin-binding NHE7[542-725(A596-604)] was fused with the N-terminal GST-tag, expressed in E. coli and affinity purified with glutathione conjugated sepharose beads. Two micrograms of immobilized GST or the GST fusion protein was incubated with 400 jag of the cell lysate isolated from CHO cells. After extensive washing, bound Cav I was eluted and analyzed in SDS-PAGE and western blot. Five percent volume of the lysate was resolved as control (Input). A set of representative results of the three independent experiments is shown.  88  3.2.2 The C-MAD domain of Cavl, not the CSD domain, is responsible for NHE7binding To define the NHE7-binding domain of Cav 1 , GST fusion proteins containing different segments of Cavl were incubated with radiolabeled NHE7 C-terminal domain and their interaction was evaluated by Phosphorlmager. As illustrated in Fig. 3-2A and B, the minimum NHE7-binding domain was mapped to a region of Cav 1 between amino acids 128 and 154. This region is closely associated with the C-terminal Membrane Attachment Domain (C-MAD) and not with the Caveolin Scaffolding Domain (CSD) (Fig. 3-2C). C-MAD has been implicated in Golgi-targeting, but not as a typical protein— protein interaction domain (Cohen et al., 2004). These results, together with the fact that the amino acids 596WIFRLWYSF604 of NHE7 are not required for the caveolin-binding, suggest that the NHE7—Cavl interaction is mediated by a novel binding-module.  89  •  cr)  cC  A.  U) co CD^qe CO op CO CO N . CO c0 Re CV N- 1%.  I-6  33 ° co co Co co co 0 o o 0 0  00 4 CO CM et 0  -5^> > > > > > > > » Cl)^ccl^co^co^co^co^cu^co^Cu^co E C3  c.) c.) c.) V C.) C.) C.) 0 0 C.)  NH E7 525-725 B.  Cay1:  ^  Binding  1-80:^1-108:^-  108-178:^+++ 108-169:^++ 108-154: 108-144: 108-128: 128-178:^+++ 144-178:^108-178A154-169: +++ CSD  Cavl  I  C-MAD  128-154: NHE7 binding domain C.  ^  TMD Extracellular / luminal  cytosolic 71.  CSD  82  150  C-terminal  C-MAD (NHE7 binding domain) N-terminal  90  Fig. 3-2. NHE7 binds directly to amino acids 128-154 of Cavl. (A) GST alone and GST fusion proteins containing different segments of Cav 1 (residues 1-80, 1-108, 108-178, 108-169, 108-154, 108-144, 108-128, 128-178, 144-178 and 108-178 A154-169) were expressed in E. coli, purified by glutathione-sepharose beads and subjected to GST pulldown. The radiolabeled NHE7 525-725 protein was incubated with 2 lig of purified GST or GST fusion proteins immobilized on glutathione-sepharose beads. After extensive washing, bound NHE7 was eluted with SDS sample buffer and resolved in SDS-PAGE. The signal was visualized by PhosphorImager. Five percent volume of the radiolabeled NHE7 525-725 protein was resolved as control (Input). (B) Schematic diagram of GST fusion proteins and a summary of the binding strength for each construct. (C) Schematic diagram showing the binding region of NHE7 in Cavl. [Part A was contributed by Jasmina Kobiljski and Warren P. Williams]  91  3.2.3 NHE7 partly associates with caveolae/lipid rafts  Because caveolae are enriched with cholesterol and sphingolipids, they form a liquid order phase. Accordingly, caveolae-associated proteins can be equilibrated to lower density in a sucrose density gradient after extraction with mild detergents (flotation assay). This biochemical assay separates both caveolar proteins and non-caveolar lipid raft proteins, but does not distinguish these two populations. In the following, caveolar and non-caveolar lipid raft proteins are referred to as "caveolae/lipid raft-proteins" in a broader context. Chinese hamster ovary (CHO) cells were transiently transfected with HA-tagged NHE7, lysed with Brij 58, a mild nonionic detergent, and the cleared lysate was placed at the bottom of the 5-40% discontinuous sucrose density gradient. After ultracentrifugation, 12 fractions were collected from the top of the gradient and equal volume aliquots were resolved in SDS-PAGE followed by western blot. NHE7 was detected broadly throughout fractions 3 to 9, whereas endogenous Cavl was largely found in the lower density (upper) fractions (Fig. 3-3). Clathrin heavy chain (CHC), a marker for non-caveolae/lipid raft, was exclusively found in higher-density (bottom) fractions. Saponin solubilizes cholesterol and effectively disrupts caveolae/lipid rafts (Simons and Toomre, 2000; Taylor et al., 2002, Roper et al., 2000; Chamberlain et al., 2001). When the homogenate was pretreated with saponin, the signal in the lower density (upper) fractions was no longer detectable and most of NHE7 was associated with higher density (bottom) fractions 7-10 (Fig. 3-3). Similarly, when cells were preincubated with a cholesterol depriving drug methyl-13-cyclodextrin (Mf3CD), NHE7 was largely detected in the higher density fractions 7-11, suggesting that NHE7 is partly associated with caveoale/lipid rafts.  92  Bottom  Top^  1 2 3 4 5 6 7 8 9 10 11 12  Saponin^Mf3CD  " " al «elks NHETI D4  b.* 611 ;1111% 4  Cavl CHC^  ma.4■416. —  Sucrose 5%^30%^40%  Fig. 3-3. NHE7 associates with caveolae/lipid raft fractions by flotation assays. A cell lysate was prepared from CHO cells transfected with 1D4-tagged NHE7 and sucrose was added to a final concentration of 40% in 1 x MBS. The lysate was then placed at the bottom of a centrifuge tube and overlayed with 30% and 5% sucrose in 1 x MBS. The gradient was centrifuged and an equal volume of fractions was collected from the top of the centrifuge tube. The presence of NHE7, Cav 1, and clathrin heavy chain (CHC) in each fraction was detected by western blot (flotation assay). CHC was used as a noncaveolae/lipid raft marker. In some experiments, cells were pre-treated with 20 mM methyl 13-cyclodextrin (M(3CD) or cell lysates were incubated with 0.5% saponin on ice as described in "Appendix 1 — Materials and methods". Proteins equilibrated to the lower-density fractions (fractions 2-4) were defined as caveolae/lipid raft-associated proteins. A set of representative results of the two independent experiments is shown.  93  3.2.4 Cavl wild type and dominant-negative mutants associate with NHE7 in cultured cells  Phosphorylation of Ser 80 causes intracellular retention of Cav 1, and likely prevents the normal caveolar structure and function on the cell surface (Schlegel et al., 2001). Cav 1 S80E (Ser 80 --> Glu) mutant that mimics the phosphorylated status of the serine, disrupts caveolar organization and thereby serves as a dominant-negative mutant. This mutant was previously used to characterize the caveolin-dependent endocytosis of the glucose transporter GLUT4 (Shigematsu et al., 2003). Cav 1 P132L (132 Pro -+ Leu) is another dominant-negative mutant, which was detected in up to 16% of human breast cancer patients (Hayashi et al., 2001). Heterologous expression of Cav 1 P132L triggers misfolding/mistargeting of endogenous Cavl (Lee et al., 2002). To investigate the role of caveolins in caveolae/lipid raft association of NHE7, the interaction of NHE7 with caveolins (wild type (WT), S80E and P132L) was examined in cultured cells by coimmunoprecipitation. MCF-7, a human breast cancer cell line, was reported to have only limited endogenous caveolin expression (Fiucci et al., 2002). To minimize overexpression problems, an MCF-7 cell line stably expressing 1D4-tagged NHE7 at intermediate level (NHE7 1 D4/MCF-7 cells) was generated, and used for the coimmunoprecipitation and co-localization experiments. NHE71D4/MCF-7 cells were transfected with myc-tagged Cav 1 constructs by electroporation, and cell lysates were incubated with either pre-immune serum (Con) or rabbit polyclonal anti-myc antibody followed by protein-A sepharose beads. NHE7 bound to the immune complex was detected by western blot with the anti-1D4 antibody. NHE7 was detected in the immune complex with myc-tagged Cavl when lysates were incubated with anti-myc antibody, but  94  not in samples treated with pre-immune serum (Fig. 3-4A top panel). Re-probing the same blot with mouse monoclonal anti-myc antibody showed that Cav 1 WT, S80E and P132L were present in the immune complex (Fig. 3-4A bottom). When cells were transfected with the empty vector, NHE7 was not co-immunoprecipitated with anti-myc antibody, further suggesting the specificity of the protein interaction. HA-tagged NHE7 was also co-immunoprecipitated with myc-tagged Cav 1 proteins in CHO cells (Suppl. Fig. 1-1). Next, Cavl WT, S80E or P132L was transfected in NHE71D4/MCF-7 cells and their intracellular localization was analyzed by immunofluorescence microscopy. NHE71D4 colocalized with myc-tagged Cav 1 WT, S80E and P132L predominantly in perinuclear structures (Fig. 3-4B). Double-labeled immunofluorescence microscopy showed the association of NHE7 with a trans-Golgi network (TGN) marker TGN46 (Fig. 3-4C), consistent with previous findings (Numata and Orlowski, 2001; Lin et al., 2005). Likewise, the majority of the perinuclear signal found in the myc-tagged Cav 1 overlapped with TGN46 (Fig. 3-4D), in agreement with the previous studies suggesting that WT (Dupree et al., 1993; Scheiffele et al., 1998) and P132L Cavl associate with the TGN (Lee et al., 2002). Although S80E Cav 1 was reported to be mistargeted to the endoplasmic reticulum (ER) when expressed in COS-7 cells (Schlegel et al., 2001), major accumulation of this mutant in the ER was not detected in our studies (Suppl. Fig. 1-2). The difference between our studies and in previous ones was probably caused by different experimental conditions or cell lines. In addition to the TGN-association, Cavl also showed more scattered cellular distribution, which may reflect cell-surface caveolae as well as endosomal compartments (Nichols, 2003; Kirkham and Parton, 2005; Perlkmanns et al., 2004; Damm et al., 2005).  95  A^Cav1WT Cav1S60E Cav1P132L^pcDNA3  NHE7,-,  IP^IP^IP^IP  TGN46^Merge  Lys Con myc Lys Con myc Lys Con myc Lys Con myc  B  ^  Cav1„,,  ^NHE7,a4^Merge^  D  ^  Cav1„,^TGN46  ^  Merge  Fig. 3-4. Wild type and dominant-negative Cav1 associate with NHE7. (A) Myc-tagged Cav 1 (WT, S80E or P132L) or the empty vector pcDNA3 was expressed in NHE7 1D4/MCF-7 cells by electroporation and cell lysates were isolated. The same amount of lysate (400 lig) was immunoprecipitated with pre-immune serum (Con) or rabbit polyclonal anti-myc antibody, and bound NHE7 was analyzed by SDS-PAGE and western blot with anti-1D4 antibody (top panel). The same blot was re-probed with mouse monoclonal anti-myc antibody (bottom panel). Twenty micrograms of lysate was resolved as loading control (Lys). A set of representative results of the three independent experiments is shown. (B) NHE71D4/MCF-7 cells expressing myc-tagged Cav 1 wild type (WT), S80E or P132L were subjected to double-labeled immunofluorescence confocal microscopy. Cavl (WT, S80E or P132L: green) and NHE7 (red) were visualized by antimyc antibody and anti-1D4 antibody respectively. (C) and (D) Intracellular localization of NHE7 (C) or Cavl (WT, S80E and P132L) (D) was compared with that of a transGolgi network (TGN) marker TGN46 in NHE71 D4/MCF-7 cells transfected with myctagged Cavl. Bars, 10 i_tm.  96  3.2.5 Expression of caveolin dominant-negative mutants dissociates NHE7 from caveolae/lipid rafts The effect of the dominant-negative Cav 1 mutants on caveolae/lipid raftassociation of NHE7 was investigated. CHO cells were co-transfected with myc-tagged Cav 1 (WT or mutants) and HA-tagged NHE7, and the association of NHE7 with caveolae/lipid rafts was evaluated by flotation assays. Heterologously expressed Cav 1 WT showed a major accumulation to the lower-density caveolae/lipid raft fraction (fractions 3 and 4), while both 880E and P132L mutants were largely associated in higher-density non-caveolae/lipid raft fractions (Fig. 3-5A). NHE7 was detected in both lower-density caveolae/lipid raft fractions (fractions 3 and 4) and higher density noncaveolae/lipid raft fractions (fractions 6-9) when cells were transfected with Cav 1 WT (Fig. 3-5B and D, Cav1WTniyc + NHE7HA). In contrast, when cells were transfected with Cav 1 880E or P132L, NHE7 showed a predominant accumulation to the noncaveolae/lipid raft fractions (fractions 6-8) (Fig. 3-5B and D, CavlS80Ernyc + NHE7HA, Cav1P132Lrnyc + NHE7HA). This effect was similar to saponin or methyl P-cyclodextrin treatment (Fig. 3-3). These results suggest that caveolins are important for targeting NHE7 to caveolae/lipid rafts. The in vitro binding experiments implicated that the Cterminal extension of NHE7 binds to Cav 1 (Fig. 3-1B). To test the involvement of the Cterminal extension of NHE7 with the caveolae/lipid raft-association, an NHE7 deletion mutant lacking most part of the C-terminal extension (NHE7ACterm HA or NHE7A539725 HA ) was expressed in CHO cells, and cell lysates were analyzed by flotation assays. As shown in Fig. 3-5C and D, the signal corresponding to this mutant was predominantly detected in non-caveolae/lipid raft fractions 5-11.  97  A.^ Top^  Bottom  1 2 3 4 5 6 7 8 9 10 11 12  Cavl WT myc Cavl S80E myc Cavl P132L my, Sucrose  5%^30%^40%  Top^  B.  Bottom  1 2 3 4 5 6 7 8 9 10 11 12^Transfection I  NHE7 HA  .N  to  ION^Cavl WT myc + NHE7 HA  ir^  111^Cavl S80E myc + NHE7 HA  OHO^Cavl P132L myc + NHE7 HA  Sucrose  5%^30%^40%  Bottom Top^ 1 2 3 4 5 6 7 8 9 10 11 12  C.  NHE7ACterm HA  Sucrose  5%^30%^40%  98  D.  Fraction  I^I  Cavl WT myc + NHE7 HA Cavl S80E my , + NHE7 HA  {l  Cavl P132t.. my, + NHE7 HA NHE7ACterm HA  Fig. 3-5. Expression of Cavl S80E or P132L dissociates NHE7 from caveolae/lipid rafts. CHO cells were co-transfected with HA-tagged NHE7 and myc-tagged Cavl (WT, S80E or P132L), and the cell lysate was subjected to flotation assays. Twelve fractions were taken from the top of the centrifugation tube and analyzed by SDS-PAGE and western blot probed with anti-myc (A) or anti-HA antibody (B). (C) NHE7 deletion mutant lacking the C-terminal extension (NHE7 ACterm HA ) was expressed in CHO cells and its association to the caveolae/lipid raft fraction was assessed by flotation assays. (D) The intensity of each band was measured by densitometry and the relative intensity was calculated. Data are expressed as mean percents +/— standard deviations obtained from three independent experiments.  99  3.2.6 NHE7 is internalized in a clathrin-dependent and caveolin-independent manner Many of the TGN-resident integral membrane proteins are once delivered to the plasma membrane and subsequently internalized to endosomes (Gu et al., 2001). Currently, however, it is not known whether NHE7 is targeted to the plasma membrane and possibly endocytosed. This question was addressed by cell-surface biotinylation and internalization experiments. NHE71D4/MCF-7 cells were incubated with EZ-Link NHSSS-biotin (disulfide-cleavable biotin), surface-labeled proteins were isolated by incubation with streptavidin-beads and NHE7 was detected in western blot. To evaluate endocytosis, cells were subjected to chase-incubation during which time surface proteins may be internalized, and then treated with membrane impermeable cleavage buffer. Internalized NHE7 that was protected from the cleavage buffer was isolated by streptavidin-beads and analyzed in SDS-PAGE and western blot. In untreated NHE7 1D4/MCF-7 cells (Fig. 3-6B and C control) or empty vector-transfected cells (Fig. 3-6A pcDNA3), biotinylated NHE7 was readily detectable on the cell surface (biotinylated NHE7, chasing 0 minutes, — cleavage). Dissociation of biotin from NHE7 by cleavage buffer diminished the signal to an almost undetectable level (Fig. 3-6A—C, biotinylated NHE7, chasing 0 minutes, + cleavage). In contrast, after chasing for 15 minutes, significant amount of biotinylated NHE7 was protected from cleavage buffer due to its internalization (Fig. 3-6, biotinylated NHE7, chasing 15 minutes). These results indicate that NHE7 is first targeted to the cell surface and then endocytosed to intracellular compartments.  100  Caveolins stabilize caveolae at the plasma membrane and regulate the clathrinindependent and cholesterol-sensitive endocytosis (Nabi and Le, 2003). Expression of the Cav 1 S80E dominant-negative mutant was reported to decrease glucose transporter GLUT4-endocytosis (Shigematsu et al., 2003). To test possible involvements of Cav 1 in NHE7-endocytosis, NHE71D4/MCF-7 cells were transiently transfected with Cavl WT or dominant-negative constructs by electroporation. Approximately 70% of the cells expressed Cav 1 as assessed by immunofluorescence microscopy, and protein expression levels of the three different constructs (WT, S80E and P132L) were equivalent as determined by western blot (data not shown). After transient transfection of the empty vector (pcDNA3), Cav 1 WT, S80E or P132L, approximately 25-30% of NHE7 on the cell-surface was endocytosed in all samples after a 15-minute chasing incubation (Fig. 36A). This suggests that forced expression of Cav 1 wild type or dominant-negative mutants does not affect endocytosis of NHE7. NHE71134/MCF-7 cells were then treated with methyl f3-cyclodextrin (M(3CD) and the effect of cholesterol-deprivation on NHE7internalization was investigated. After chasing incubation, NHE7 was as efficiently internalized in Mf3CD-treated cells as compared with untreated control cells (Fig. 3-6B). Taken together, these results suggest that NHE7 is internalized from the cell-surface by a caveolae-independent mechanism, such as the clathrin-dependent pathway. Next, it was investigated whether NHE7 is internalized via a clathrin-dependent pathway by using a pharmacological approach. Incubation in hypertonic medium removes membraneassociated clathrin lattices and results in disappearance of clathrin-coated vesicles (Hansen et al., 1993; Heuser and Anderson, 1989). As shown in Fig. 3-6C, preincubation with sucrose hypertonic media blocked NHE7-internalization efficiently,  101  whereas control samples treated with serum-free media exhibited intact internalization. Acidification of the cytosol by acetic acid treatment interferes with budding of clathrincoated vesicles from the plasma membrane and TGN. Thus, this maneuver perturbs clathrin-dependent endocytosis by a different mechanism from hypertonic treatment (Hansen et al., 1993). As illustrated in Fig. 3-6D, pre-treatment of the cell with acetic acid also inhibited the NHE7-internalization efficiently, while NHE7-internalization in control cells treated with buffer alone was not affected. Collectively, these results suggest that NHE7 is internalized via a clathrin-dependent and caveolae-independent mechanism.  102  A.^  Biotinylated^Lysate NHE71 D4^NHE71 D4  Cav1 m yc  0 15^0 15^0 15  Chasing (min): Cleavage:  -^-  pcDNA3  se P1  Cav1 WT  04  Cav1 S80E  IS *4  Cav1 P132L  • III .4  B. Control ^ 0 15 0 15 MOCD  Chasing (min): Cleavage:  -^-^-  Biotinylated^SP^A  WB: NHE7 1 D4  Lysate^impoto„, 0* C.  Sucrose Control Chasing (min): 0^15^0^15 Cleavage:^- + - + - + - + Biotinylated ---• O. Lysate  D.  64 w ern  84  41.0.6.000.06/1  WB: NHE7 1 D4  Acetic acid Control Chasing (min): 0^15^0^15 Cleavage:^- + - + - + - + Biotinylated--* el Lysate^goo gm gm gm mg 111)  103  WB: NHE7ID4  Fig. 3-6. NHE7 is targeted to the cell surface and then internalized by a clathrindependent and caveolae-independent mechanism. (A) NHE71D4/MCF-7 cells were electroporated with empty vector (pcDNA3), myc-tagged Cav 1 WT, S80E or P132L. NHE7 was labeled with membrane impermeable EZ-Link Sulfo-NHS-SS-Biotin from extracellularly at 4 °C and left untreated (cleavage —) or incubated with cleavage buffer (cleavage +). Some samples were subjected to chasing-incubation with pre-warmed media for 15 minutes at 37 °C. Five percent of the lysate volume from each sample was analyzed in SDS-PAGE and western blot with anti-1D4 and myc antibodies to monitor the expression level of NHE7 and Cav 1 (Lysate). (B) NHE71D4/MCF-7 cells were pretreated with serum-free media containing 20 mM methyl f3-cyclodextrin (M(3CD), or serum-free media alone (Control) for 30 minutes at 37 °C. After a quick rinse, cellsurface targeting and internalization of NHE7 was analyzed as above. Five percent of each sample volume was analyzed by SDS-PAGE and western blot (Lysate). (C) NHE71D4/MCF-7 cells were pre-incubated with either serum-free media containing 0.45 M sucrose or serum-free media (Control), and cell surface targeting and internalization of NHE7 were analyzed. (D) NHE71D4/MCF-7 cells were pre-incubated with or without 10 mM acetic acid as described under "Appendix 1 — Materials and methods". Subsequently, cell surface biotinylation and internalization experiments were conducted as above. Blots shown are representative of 3 independent experiments.  104  3.3 Discussion NHE7 is a unique (Na + , K+ )/H + exchanger that can transport either Na + or K + in exchange for H. Since heterologously expressed NHE7 predominantly associates with the trans-Golgi network (TGN) and endosomes at steady state, a model has been proposed in which NHE7 controls mildly acidic luminal pH of these organelles (Numata and Orlowski, 2001). In the present study, I showed that caveolins directly bind to the cytosolic C-terminus of NHE7. In vitro protein binding assays demonstrated that NHE7 interacts with the C-terminal Membrane Attachment Domain (C-MAD• amino acids 128154) of Cav 1 , but not to the Caveolin Scaffolding Domain (CSD: amino acids 82-101) that accounts for the majority of protein—protein interactions to caveolins (Cohen et al., 2004). Accordingly, although 596WIFRLWYSF604 in the cytosolic C-terminus of NHE7 matches the CSD-binding motif (I)XXXX(I)XX(I) (where is an aromatic amino acid and X is any amino acid), 596WIFRLWYSF604 is not required for Cavl-binding. Thus, the NHE7-Cav 1 interaction likely represents a novel mode of caveolin-binding. The amino acid sequence for the NHE7-binding domain of Cav 1 is fairly conserved in Cav3 (Suppl. Fig. 1-3A), and HA-tagged Cav3 was co-immunoprecipitated with myc-tagged NHE7 when concomitantly expressed in CHO cells (Suppl. Fig. 1-3B). This is potentially of physiological relevance, as both NHE7 and Cav3 are highly expressed in skeletal muscle. In the previous chapter, it was shown that SCAMPs bind to NHE7 and regulate its targeting from recycling endosomes to the TGN, which suggested that NHE7 is first targeted to the plasma membrane and then internalized (Lin et al., 2005). In the present study, it was demonstrated by cell surface biotinylation and internalization assays that NHE7 indeed follows this pathway. By flotation assays, it was shown that NHE7 is  105  associated with both caveolae/lipid rafts and non-caveolae/lipid raft. It was initially hypothesized that caveolins might control the internalization of NHE7 by direct interaction. However, cholesterol disrupting drugs and caveolin dominant-negative mutants did not affect internalization of NHE7. In contrast, pharmacological treatment that disrupts clathrin-coats efficiently blocked endocytosis of NHE7, suggesting that NHE7 is internalized through a clathrin-dependent and caveolin-independent pathway. These findings further suggest that caveolae/lipid rafts may provide a platform for NHE7 on the plasma membrane, while NHE7 in the non-caveolae/lipid raft fraction is rapidly internalized (Fig. 3-7). Numata and Orlowski previously found that NHE7 has a higher affinity for K+ than Na+ , and proposed that NHE7 does not exhibit a typical Na ±/H + exchange activity on the plasma membrane (Numata and Orlowski, 2001). Na + -K+ ATPase binds to caveolins through the CSD (Wang et al., 2004), while NHE7 binds to caveolins via the C-MAD. Thus, it is tempting to speculate that caveolins tether NHE7 and NatK ± ATPase in close vicinity by simultaneous binding, and that NHE7 and Nat K+ ATPase collaboratively control focal cytosolic pH and K + homeostasis. In recent years, accumulating evidence has suggested that ion pumps and transporters act as signal transducers independent of the ion translocation activity. For example, Na+ -K+ ATPase bridges the regulatory subunit of PI3-kinase and annexin A2, and controls the local activity of PI3-kinase in lamellipodia (Barwe et al., 2005). Na + -K+ ATPase also forms a complex with inositol 1,4,5-triphosphate receptors (Zhang et al., 2006) and phospholipase C (Yuan et al., 2005), which may coordinate calcium signaling in caveolae/lipid rafts. Likewise, NHE1, a ubiquitously expressed NHE, plays a role in scaffolding signaling molecules to the actin cytoskeleton in addition to its ion transporter  106  functions (Baumgartner et al., 2004). Even though it is not known whether the proposed model applies to other NHE isoforms, it is interesting to hypothesize that the NHE7caveolin composes a high-order signaling complex. Caveolins are found in multiple intracellular compartments, such as the Golgi apparatus (Luetterforst et al., 1999; Smart et al., 1994; Mora et al., 1999), TGN (Dupree et al., 1993; Kurzchalia et al., 1994), endosomes (Nichols, 2002; Le and Nabi, 2003) and secretory granules (Schlegel et al., 2001; Li et al., 2001) in addition to caveolae on the cell surface. In contrast to the well-characterized roles of caveolins as structural components of caveolae, caveolins' function in intracellular organelles is not fully elucidated. Initially, it was postulated that caveolins might regulate NHE7-activity in the TGN and endosomes. Cholesterol deprivation or dominant-negative caveolins did not affect NHE7 activity in intracellular compartments measured by organellar radioisotope tracer influx assays (data not shown). Thus, it seems unlikely that caveolins play a major regulatory role in NHE7-activity in the TGN and endosomes. However, the possibility that caveolins regulate NHE7-activity in a relatively small organelle or a sub-population of certain organelles cannot be excluded. The caveosome is an intracellular Cav 1containing endocytic organelle, and its luminal pH is kept neutral, whereas the luminal pH of most of other endosomes is acidic (Pelkmans et al., 2001). The molecular mechanism of caveosomal pH regulation and its implication in organellar biogenesis/maintenance are not understood. It would be interesting to investigate the potential involvement of NHE7 in these processes in future studies.  107  Non-caveolae/lipid raft  Caveolae/lipid rafts NHE7  NHE7  I-►  PM X Hypertonic shock  v./ Cytosolic acidification 0 EE  0  /  RE  NHE7 SCAMPs  NHE7 Caveolin TGN  0  ^  (  )  Fig. 3-7. A proposed model showing that caveolae/lipid rafts provide a signaling platform for NHE7 on the cell surface.  108  References Apse, M. P., Aharon, G. S., Snedden, W. A. and Blumwald, E. (1999). Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285,  1256-1258.  Barwe, S.P., Anilkumar, G., Moon, S.Y., Zheng, Y., Whitelegge, J.P., Rajasekaran, S.A. and Rajasekaran, A.K. (2005). Novel role for Na,K-ATPase in phosphatidylinositol 3-kinase signaling and suppression of cell motility. Mol Biol Cell. 16, 1082-1094. Baumgartner, M., Patel, H. and Barber, D.L. (2004). Na(+)/H(+) exchanger NHE1 as plasma membrane scaffold in the assembly of signaling complexes. Am J Physiol Cell Physiol. 287, C844-C850. Bowers, K., Levi, B. P., Patel, F. I. and Stevens, T. H. (2000). The sodium/proton  exchanger Nhx 1p is required for endosomal protein trafficking in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 11, 4277-4294.  Chamberlain, L.H., Burgoyne, R.D. and Gould, G.W. (2001). SNARE proteins are highly enriched in lipid rafts in PC12 cells: implications for the spatial control of exocytosis. Proc Natl Acad Sci USA. 98, 5619-5624. Cheng, Z.J., Singh, R.D., Marks D.L. and Pagano R.E. (2006). Membrane microdomains, caveolae, and caveolar endocytosis of sphingolipids. Mol Membr Biol. 23, 101-110. Review. Cohen, A.W., Hnasko, R., Schubert, W. and Lisanti, M.P. (2004). Role of caveolae and caveolins in health and disease. Physiol Rev. 84, 1341-1379. Damm, E.M., Pelkmans, L., Kartenbeck, J., Mezzacasa, A., Kurzchalia, T. and Helenius, A. (2005). Clathrin- and caveolin-l-independent endocytosis: entry of simian virus 40 into cells devoid of caveolae. J Cell Biol. 168, 477-488. Dupree, P., Parton, R.G., Raposo, G., Kurzchalia, T.V. and Simons, K. (1993). Caveolae and sorting in the trans-Golgi network of epithelial cells. EMBO J. 12, 1597-  1605.  Fielding, C.J. and Fielding, P.E. (2001). Caveolae and intracellular trafficking‘of cholesterol. Adv Drug Deliv Rev. 49, 251-264. Review. Fiucci, G., Ravid, D., Reich, R. and Liscovitch, M. (2002). Caveolin-1 inhibits anchorage-independent growth, anoikis and invasiveness in MCF-7 human breast cancer cells. Oncogene. 21, 2365-2375. Gu, F., Crump, C.M. and Thomas, G. (2001). Trans-Golgi network sorting. Cell Mol  109  Life Sci. 58, 1067-1084. Review.  Hansen, S.H., Sandvig, K. and van Deurs, B. (1993). Clathrin and HA2 adaptors: effects of potassium depletion, hypertonic medium, and cytosol acidification. J Cell Biol. 121,61-72. Hayashi, K., Matsuda, S., Machida, K., Yamamoto, T., Fukuda, Y., Nimura, Y., Hayakawa, T. and Hamaguchi, M. (2001). Invasion activating caveolin-1 mutation in human scirrhous breast cancers. Cancer Res. 61, 2361-2364. Heuser, J.E. and Anderson, R.G. (1989). Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. J Cell Biol. 108, 389-400. Kirkham, M. and Parton, R.G. (2005). Clathrin-independent endocytosis: new insights into caveolae and non-caveolar lipid raft carriers. Biochim Biophys Acta. 1746, 349-363. Review. Kurzchalia, T.V., Dupree, P. and Monier, S. (1994). VIP21-Caveolin, a protein of the trans-Golgi network and caveolae. FEBS Lett. 346, 88-91. Le, P.U. and Nabi, I.R. (2003). Distinct caveolae-mediated endocytic pathways target the Golgi apparatus and the endoplasmic reticulum. J Cell Sci. 116, 1059-1071. Lee, H., Park, D.S., Razani, B., Russell, R.G., Pestell, R.G. and Lisanti, M.P. (2002). Caveolin-1 mutations (P132L and null) and the pathogenesis of breast cancer: caveolin-1 (P132L) behaves in a dominant-negative manner and caveolin-1 (-/-) null mice show mammary epithelial cell hyperplasia. Am J Pathol. 161, 1357-1369. Li, W.P., Liu, P., Pilcher, B.K. and Anderson, R.G. (2001). Cell-specific targeting of caveolin-1 to caveolae, secretory vesicles, cytoplasm or mitochondria. J Cell Sci. 114, 1397-1408. Lin, P.J., Williams, W.P., Luu, Y., Molday, R.S., Orlowski, J. and Numata M. (2005). Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7. J Cell Sci. 118, 1885-1897. Luetterforst, R., Stang, E., Zorzi, N., Carozzi, A., Way, M. and Parton, R.G. (1999). Molecular characterization of caveolin association with the Golgi complex: identification of a cis-Golgi targeting domain in the caveolin molecule. J Cell Biol. 145, 1443-1459. Mora, R., Bonilha, V.L., Marmorstein, A., Scherer, P.E., Brown, D., Lisanti, M.P. and Rodriguez-Boulan, E. (1999). Caveolin-2 localizes to the golgi complex but redistributes to plasma membrane, caveolae, and rafts when co-expressed with caveolin1. J Biol Chem. 274, 25708-25717. Nabi, I.R. and Le, P.U. (2003). Caveolae/raft-dependent endocytosis. J Cell Biol. 161,  110  673-677. Review. Nass, R., Cunningham, K. W. and Rao, R. (1997). Intracellular sequestration of sodium by a novel Na+/H+ exchanger in yeast is enhanced by mutations in the plasma membrane H+-ATPase. Insights into mechanisms of sodium tolerance. J. Biol. Chem. 272, 26145-26152. Nichols, B. (2003). Caveosomes and endocytosis of lipid rafts. J Cell Sci. 116, 47074714. Nichols, B.J. (2002). A distinct class of endosome mediates clathrin-independent endocytosis to the Golgi complex. Nat Cell Biol.4, 374-378. Numata, M. and Orlowski, J. (2001). Molecular cloning and characterization of a novel (Na+,K+)/H+ exchanger localized to the trans-Golgi network. J. Biol. Chem. 276, 1738717394. Orlowski, J. and Grinstein, S. (2004). Diversity of the mammalian sodium/proton exchanger SLC9 gene family. Pfliigers Arch. 447, 549-565. Pelkmans, L., Kartenbeck ,J. and Helenius, A. (2001). Caveolar endocytosis of simian virus 40 reveals a new two-step vesicular-transport pathway to the ER. Nat Cell Biol. 3, 473-483. Pelkmans, L. and Helenius, A. (2003). Insider information: what viruses tell us about endocytosis. Curr Opin Cell Biol. 15, 414-422. Review. Pelkmans, L., Burli, T., Zerial, M., and Helenius, A. (2004). Caveolin-stabilized membrane domains as multifunctional transport and sorting devices in endocytic membrane traffic. Cell. 118, 767-780. Roper, K., Corbeil, D. and Huttner, W.B. (2000). Retention of prominin in microvilli reveals distinct cholesterol-based lipid micro-domains in the apical plasma membrane. Nat Cell Biol. 2, 582-592. Saltiel, A.R. and Pessin, J.E. (2003). Insulin signaling in microdomains of the plasma membrane. Traffic. 4, 711-716. Review. Scheiffele, P., Verkade, P., Fra, A.M., Virta, H., Simons, K. and Ikonen, E. (1998). Caveolin-1 and -2 in the exocytic pathway of MDCK cells. J Cell Biol. 140, 795-806. Schlegel, A., Aryan, P. and Lisanti, M.P. (2001). Caveolin-1 binding to endoplasmic reticulum membranes and entry into the regulated secretory pathway are regulated by serine phosphorylation. Protein sorting at the level of the endoplasmic reticulum. J Biol Chem. 276, 4398-4408.  111  Shigematsu, S., Watson, R.T., Khan, A.H. and Pessin, J.E. (2003). The adipocyte  plasma membrane caveolin functional/structural organization is necessary for the efficient endocytosis of GLUT4. J Biol Chem. 278, 10683-10690.  Simons, K. and Toomre, D. (2000). Lipid rafts and signal transduction. Nat Rev Mol Cell Biol. 1, 31-39. Review. Smart, E.J., Ying, Y.S., Conrad, P.A. and Anderson, R.G. (1994). Caveolin moves from caveolae to the Golgi apparatus in response to cholesterol oxidation. J Cell Biol. 127, 1185-1197. Taylor, C.M., Coetzee, T. and Pfeiffer, S.E. (2002). Detergent-insoluble glycosphingolipid/cholesterol microdomains of the myelin membrane. J Neurochem. 81, 993-1004. van Deurs, B., Roepstorff, K., Hommelgaard, A.M. and Sandvig, K. (2003). Caveolae: anchored, multifunctional platforms in the lipid ocean. Trends Cell Biol. 13, 92-100. Review. Venema, K., Quintero, F. J., Pardo, J. M. and Donaire, J. P. (2002). The arabidopsis  Na+/H+ exchanger AtNHX1 catalyzes low affinity Na+ and K+ transport in reconstituted liposomes. J. Biol. Chem. 277, 2413-2418. Wang, H., Haas, M., Liang, M., Cai, T., Tian, J., Li, S. and Xie, Z. (2004). Ouabain assembles signaling cascades through the caveolar Na+/K+-ATPase. J Biol Chem. 279,  17250-17259.  Yokoi, S., Quintero, F. J., Cubero, B., Ruiz, M. T., Bressan, R. A., Hasegawa, P. M. and Pardo, J. M. (2002). Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant J. 30, 529-539. Yuan, Z., Cai, T., Tian, J., Ivanov, A.V., Giovannucci, D.R. and Xie, A. (2005). Na/K-ATPase tethers phospholipase C and 1P3 receptor into a calcium-regulatory complex. Mol Biol Cell. 16, 4034-4045. Zhang, Z., Malmersjo, S., Li, J., Ando, H., Aizman, 0., Uhlen, P., Mikoshiba, K. and Aperia, A. (2006). Distinct role of the N-terminal tail of the Na,K-ATPase catalytic subunit as a signal transducer. J Biol Chem. 281, 21954-21962.  112  Chapter 4 — Implications of SCAMP2 in GO signaling and regulation of ERK1/2 activation 4.1 Introduction Secretory Carrier Membrane Proteins (SCAMPs) are a family of integral membrane proteins with four transmembrane segments, and N- and C-terminal cytosolic extensions. SCAMPs are evolutionarily highly conserved from C. elegans to mammals, and five isoforms (SCAMP1-5) have been identified from mammals (Brand et al., 1991; Singleton et al., 1997; Fernadez-Chacon and Sudhof, 2000). Previous work has suggested their involvement in endocytosis and secretion (Lam et al., 2007; FernadezChacon et al.; 2000, Fernadez-Chacon et al., 1999; Liu et al., 2002; Guo et al., 2002). The role of SCAMP2 in late stages of membrane fusion during exocytosis has been extensively studied (Liu et al., 2005; Liu et al., 2002; Guo et al., 2002) and its association with phosphatidylinositol 4,5-biphosphate at the plasma membrane (Ellena et al., 2004). Furthermore, SCAMPs have been shown to associate with components of the SNARE complex like SNAP-23 and syntaxin 4 (Guo et al., 2002), and serve as a platform for ARF6/PLD/ARNO (Liu et al., 2005), consistent with the proposed role of SCAMP2 in membrane fusion events. The specific mechanism underlying these observations, however, remains undefined. In addition to the NPF repeat, we found putative proteinprotein interaction motifs such as coiled-coil and Pro-rich domains, in the cytosolic Nterminal extension of SCAMPs, and postulated that SCAMPs might serve as scaffold proteins. To test this possibility, we performed yeast-two hybrid screening and identified Gr3 subunits of the heterotrimeric G-protein complex as SCAMP-interacting proteins.  113  Heterotrimeric G-proteins are composed of Ga, 13 and y subunits. Ligand binding to a G-protein coupled receptor (GPCR) causes a conformational change in the GPCR, and leads to the conversion of GDP-bound Ga subunits to GTP-bound form (Hamm and Gilchrist, 1996). The GTP-bound Ga subunit dissociates from the Gr3y complex and conveys signaling to downstream effectors that regulate various physiological processes such as endocytosis, exocytosis, cell proliferation and cell motility (Daaka et al., 1997; Schulz et al., 2002; Chen et al., 2005; Blackmer et al., 2005; Wang et al., 2002; Jin et al., 2000; Zeng et al., 2002). In this chapter, I identify Gr3 as a novel SCAMP2 binding protein. Furthermore, treatment with the membrane permeable peptide corresponding to the G13 binding domain of SCAMP2 or gene knockdown of SCAMP2 by siRNA inhibited ERK1/2 signaling downstream of GI3y, suggesting a potential role of SCAMP2 in this signaling pathway.  114  4.2 Results 4.2.1 SCAMP2 interacts with Gll  In search for novel SCAMP2 binding proteins, a human embryonic brain cDNA library was screened by yeast two-hybrid using SCAMP2 [G84-Y154] as bait. Out of 2 x 10 6 clones screened, one full-length G131 and one partial GP2 clone covering the first 510 nucleotides were identified. To examine the SCAMP2-G13 interaction in cells, myctagged SCAMP2 and HA-tagged GP1 were transiently co-transfected into Chinese hamster ovary (CHO) cells, and their interaction was assessed by coimmunoprecipitation. G131 was chosen for further characterization in this study, as this isoform is the most ubiquitously expressed [3 subunit (Schwindinger and Robishaw, 2001). When GPHA was immunoprecipitated by using anti-HA antibody SCAMP2m yc was detected in the immune complex by western blotting using anti-myc antibody (Fig. 4-1A top panel). Conversely, when SCAMPZ nyc was immunoprecipitated with anti-myc antibody, GPHA was also detectable by western blotting using anti-HA antibody (Fig. 41 A bottom panel). Similarly, when CHO cells were singly transfected with myc-tagged SCAMP2 and endogenous GP was immunoprecipitated, myc-tagged SCAMP2 was readily detectable in the immune complex, further supporting the significance of SCAMP2- GP interaction in the cell (Fig. 4-1B).  115  A. IP GOHA  Lys Con IP ^  4000 WB: amyc  IP SC2 myc^4400006 WB: aHA ,  B. Lys Con IP IP Gp^  IMO,^vow,  WB: amyc  Fig. 4-1.^associates with SCAMP2. (A) CHO cells were transiently co-transfected with HA-tagged GP and myc-tagged SCAMP2. The same amount of lysate was immunoprecipitated with pre-immune serum (Con) or anti-HA antibody. Immunoprecipitated samples were separated by SDS-PAGE and bound SCAMP2 myc was detected by western blotting with rabbit polyclonal anti-myc antibody (top panel). Conversely, GPHA co-immunoprecipitated with pre-immune serum (Con) or anti-myc antibody was detected by western blotting with mouse monoclonal anti-HA antibody (bottom panel). (B) CHO cells were singly transfected with myc-tagged SCAMP2. Cell lysates were prepared for immunoprecipitation with rabbit polyclonal anti G(3 antibody and co-immunoprecipitated SCAMP2 myc was detected by western blotting with mouse monoclonal anti-myc antibody. Blots shown are representative of 3 independent experiments. -  116  4.2.2 Gr3 binds to SCAMP2 via WD1-2 and WD6-7 GST pull-down was employed to elucidate the in vitro protein interaction between GP and SCAMP2. GP is composed of seven WD40 domains that fold together into a propeller like structure with seven blades (Wall et al., 1995; Sondek et al., 1996). Such structure can serve as protein binding domains for different proteins and play a role as scaffolding signaling molecules (Chen et al., 2004; Dell et al., 2002). GST fusion proteins constructed from different segments of GP demonstrated in Fig. 4-2B were immobilized to glutathione sepharose, incubated with in vitro transcribed/translated  35 S  labeled SCAMP2„, y,., and bound SCAMP2 was detected by PhosphorImager. As shown in Fig. 4-2A, SCAMP2 bound to GST-Gf3[WD1-2], GST-GP[WD5-6] and GSTG13[WD6-7] with respective mean intensitites of 55, 80 and 100, whereas SCAMP2 did not bind to GST-GP[WD3-4] and GST-GP[WD4-5] or the GST control. These results suggest that the SCAMP2-binding domain lies in the WD1-2 and WD6-7 of GI3, as summarized in Fig. 4-2B and C. Previous crystallographic studies show that GP folds into a propeller like structure in which WD1 is adjacent to WD7 (Fig. 4-2C) (Wall et al., 1995; Sondek et al., 1996). In Fig. 4-2C I used the coordinates entered into the RCSB Protein Data Bank by Sondek and colleagues (Sondek et al., 1996) to show the predicted SCAMP2-interacting surface. As a summary of Fig. 4-2A, the interacting domains WD1, 2, 6 and 7 are depicted as blue ribbons and non-interacting domains WD3, 4 and 5 are illustrated in green. The red helices correspond to Gy. SCAMP2 and Gy2 do not interact (data not shown) however Gy associates with GP (Wall et al., 1995; Sondek et al., 1996).  117  A.  GST-G(3 CY^1^II)CD M 4 6  ^  Ni  co  a CO CI 0 0 0 0 ^c^CD _ SC 2 m y c 41""  ■•=411111,  ....1.0•0100  B.  Intensity/Binding WD1-2 WD3-4 WD4-5 WD5-6 WD6-7  55 ± 6  80 ± 3 100 ± 7  C.  SC2 interacting^Non interacting ^ surface surface 118  Gy  Fig. 4-2. SCAMP2 binds to WD 1, 2, 6 and 7 of GP. (A) Two micrograms of GST alone or GST fusion proteins of GP was immobilized to glutathione sepharose and then incubated with in vitro transcribed/translated 35 S-labeled SCAMP2 mye protein (SC2 myc ). After extensive washing, radiolabeled SCAMP2 was eluted and resolved in SDS-PAGE and blotted to a PVDF membrane. The signal was visualized by PhosphorImager. (B) Schematic representation of SCAMP2-binding domain in GP. (C) The model was constructed from coordinates deposited in the RCSB Protein Data Bank (Sondek et al., 1996) using DeepView/Swiss-PdbViewer v3.7 developed by Nicolas Guex, Manuel Peitsch, Torsten Schwede and Alexandre Diemand (http://www.expasy.org/spdbv) . Blue surfaces indicate SCAMP2 (SC2) interacting domains and green surfaces indicate non SCAMP2 interacting domains. Gy is represented in red. Blot shown is representative of 3 independent experiments. Densitometric values are expressed as mean intensity ± standard deviations obtained from 3 independent experiments.  119  4.2.3 Identification of the GP-binding domain of SCAMP2 Next, GST fusion proteins of different segments of the N-terminus tail of SCAMP2[1-154] (Fig. 4-3B) was used for GST pull-down assay to delineate the interacting domain(s) of SCAMP2 to G. GST-SC2[1-154], GST-SC2[45-154], GSTSC2[75-154] and GST-SC2[75-134] showed binding to in vitro transcribed/translated 35  S-G13 with their respective relative intensities to GST-SC2[1-154] of 100%, 58%, 46%  and 45%, while GST alone, GST-SC2[1-88], GST-SC2[45-88] and GST-SC2[75-117] did not show detectable G13 binding (Fig. 4-3A). All the GST fusion proteins of SCAMP2 that encompasse amino acids 75-134 showed binding to GO. Since GSTSC2[75-117] showed no detectable binding to GP the amino acids 117-134 of SCAMP2 likely represent the minimum binding domain to GP (Fig. 4-3B).  120  A.  GST-SC2  3 3 0: ^3 a? L;^ri; 1^Ti; CD^.4.-ti^v-^Nr^ti^r■ 02  G PHA 'IP' 41•1100 B.  Relative Binding To 1-154  SC2: 1-154: 1-88: 75-154: 45-88: 45-154: 75-117: 75-134:  1.00  0.58 ± 0.16 0.46 ± 0.12 0.45 ± 0.08  Minimum Binding Domain  Fig. 4-3. GP binds to SCAMP2[117-134]. (A) Two micrograms of GST alone or GST fusion proteins containing different segments of N-terminus of SCAMP2 (SC2) were incubated with 35 S-labeled GPH A protein. Bound GP protein was detected by Phosphorlmager. (B) Schematic representation of GP-binding domain in SCAMP2. Blot shown is representative of 3 independent experiments. Densitometric values are expressed as relative intensity to GST-SC2[1-154] ± standard deviations obtained from 3 independent experiments  121  4.2.4 A membrane permeable peptide corresponding to the G13-binding domain of SCAMP2 specifically downregulates GO-activated ERK1/2 phosphorylation Upon binding of a ligand to a GPCR, a Ga subunit dissociates from the Gf37 complex and transmits signaling to downstream targets. In addition to this well characterized pathway, the GM complex also regulates effectors such as MAP kinase ,  (MAPK) (Clapham and Neer, 1997). The Grry binding peptide "SIRK" identified by phage display dissociates G137 from Ga independently of nucleotide exchange activity, and activates MAPK signaling in the absence of receptor activation (Smrcka and Scott, 2002; Goubaeva et al., 2003). N-terminally myristoylated SIRK (myrSIRK) and a human immunodeficiency virus TAT-modified peptide (TAT-SIRK) were shown to be equally membrane permeant, and both peptides efficiently activated MAPK signaling. Thus, myrSIRK treatment of cells activates GM without stimulating Ga (Goubaeva et al., ,  2003). Although the underlying mechanism is unknown, myristoylation makes peptides membrane-permeable and this strategy is widely used to analyze various signaling pathways such as PKC (Sasaki et al., 2002; Ikenoya et al., 2002; Robinson, 1991) and CaM kinase (Gardner et al., 2007; Paes-de-Carvalho et al., 2005). To investigate a potential involvement of SCAMP in G(37-signaling, Extracellular Signal Regulated Kinase (ERK) 1/2 signaling was characterized in myrSIRK-activated MCF-7 cells by measuring phosphorylated ERK1/2 (also called p42/44). We hypothesized that SCAMP synthetic peptides corresponding to the G(37 binding domain might influence the Gh—activated MAPK signaling cascade. To test this possibility, serum-starved MCF-7 cells were stimulated with myrSIRK and the effect of myristoylated peptide for SCAMP2[117-134] (SC2 myr[117-134]), myristoylated peptide 122  for SCAMP 1 [117-134] (SC1 myr[117-134]) and myrScrambled peptides (Fig. 4-4A) on ERK1/2 (p42/44) activation was assessed by phospho-ERK specific antibody. Phosphorylated ERK1/2 was significantly increased after 5 minutes incubation with 10 tM myrSIRK and decreased after 10-20 minutes in the presence (Fig. 4-4B) or absence (data not shown) of myrScrambled peptide. In contrast, when myrSIRK activated MCF-7 cells were treated with 10 tM SC2 myr[117-134], the phosphorylation of ERK1/2 was reduced compared to myrScrambled treatment (Fig. 4-4B). Similarly, phosphorylation of ERK1/2 by myrSIRK was efficiently inhibited in MCF-7 cells by membrane permeable SC2 [117-134] peptide fused with antennapedia peptide (Duchardt et al., 2007), further suggesting the importance of SCAMP2 in MAPK signal transduction (data not shown). By reprobing the same blot with anti ERK1/2 antibody, total ERK1/2 protein expression level was shown to be unaltered. Re-probing with 13-tubulin further confirmed comparable loading.  123  A. SC2 myr[117-134]^Myr - QNNWPPLPSWCPVKPCFY SC1 myr[117-134]^Myr - KNNWPPLPSNFPVGPCFY B. myrSIRK +^myrSIRK +^myrSIRK + myrScrambled ^SC2 myr[117-134] ^SC1 myr[117-134] Minutes:  0^5^10 20^0 5 10 20 0 5 10^20  Phospho ERK1/2 ERK1/2  manceld110  p-tubulin  iiimr411111411111111  ammo 1111111► 4111.  MOW  C. NS  100  I NS  E  • 0  I 50  NS  NS 1^I  I  NS I  NS^  -a- I  - I ^ 0^5 10^20 Minutes ^  myrSIRK + myrScrambled  ^ myrSIRK + SC2 myr[117-134] myrSIRK + SC1 myr[117-134]  124  I  Fig. 4-4. G(37 dependent phosphorylation of ERK1/2 is downregulated by myristoylated SC2[117-134]. (A) Sequence of myristoylated peptides of SCAMP2[117-134] (SC2 myr[117-134]) and SCAMP 1 [117-134] (SC1 myr[117-134]). Identical amino acids between SCAMP2 and SCAMPI are labeled with red. (B) 1.2 x 10 5 MCF-7 cells were serum starved for 24 hour prior to peptide treatment for indicated times. Isolated cell lysates were quantitated by Biorad Protein Assay and 2.5 .tg of protein was subjected to SDS-PAGE and western blotting. Phosphorylated ERK1/2 was detected by rabbit polyclonal anti-phospho ERK1/2 antibody. Same blot was re-probed with anti-ERK1/2 antibody and anti f3 tubulin antibody. Blots shown are representative of 3 independent experiments. (C) ERK1/2 phosphorylation is expressed as mean densitometric values ± standard deviations obtained from 3 independent experiments. Densitometric values were subjected to paired Student's t test. Asterisks indicate significant differences (*: p<0.05, **: p<0.005). NS, no significant difference. -  —  125  In contrast, 10 iiM SC1 myr[117-134] did not affect myrSIRK-stimulated ERK1/2 phosphorylation as compared with myrScrambled control (Fig. 4-4B). Densitometric analysis of the phospho-ERK1/2 and the reprobed ERK1/2 blots showed that SC2 myr[117-134] decreased the phosphorylated population of ERK1/2 by approximately 60%, whereas SC1 myr[117-134] had little obvious effect (Fig. 4-4C). These results indicate that slight differences in amino acid sequence in the GP-binding domain were sufficient to convey the SCAMP2 specific effect on G(37-stimulated ERK1/2 activation. Guo and colleagues showed that 2 residue differences in the Epeptide segment between SCAMPI and SCAMP2 were sufficient to invoke SCAMP2 specific late-acting inhibition of exocytosis (Guo et al., 2002). Thus, although very similar in primary amino acid sequence, SCAMPI and SCAMP2 may play distinct roles in different signaling pathways. 4.2.5 SCAMP2 gene knock-down specifically suppresses GO-mediated ERK1/2 activation  To further examine the role of SCAMP2 in GP—mediated ERK activation, we next carried out gene knockdown by using plasmid-based siRNA. The siRNA constructs for SCAMP2, SCAMPI and Scrambled control (Fig. 4-5A) were transfected into MCF-7 cells by two consecutive electroporations with a 24-hour interval. Under these conditions, approximately 50-70% of transfection efficiency was obtained as judged by GFP reporter expression by fluorescence microscopy (data not shown). Transfection of the SCAMPI siRNA construct (SC1RNAi) decreased SCAMPI expression approximately by 80% without affecting SCAMP2-expression (Fig. 4-5B top panel),  126  while SCAMP2 siRNA expression (SC2RNAi) reduced the SCAMP2 expression by —55% (Fig. 4-5B bottom panel) in densitometric analysis of the western blot signal. Transfected MCF-7 cells were treated with myrSIRK peptide and the phosphorylated ERK1/2 was examined in western blot (Fig. 4-5C). When SCAMP2 siRNA was expressed, myrSIRK showed only 50% increase in ERK1/2 phosphorylation compared to the signal in control cells transfected with Scrambled siRNA construct (Fig. 4-5C). In constrast, myrSIRK peptide did not induce a significant change in ERK1/2 phosphorylation relative to the control when SCAMP]. protein expression was suppressed (Fig. 4-5C left). When the blot was stripped and reprobed with anti-ERK1/2 antibody, no difference in their expression was observed (data not shown).  127  A. C-G  A - LI G- C U A c C A A -U U U-  G C LI A C-G G- C C-G 5-2” C  u- A u A  Y -A A-U  U-A  d-1 ., -C -6 U A- 6 U- A  C-6 0-C  A-  ^ d  U Liu  A A^  w  C  C-C  0--C  o  ^ ^ SCRAMBLED ^ SC1 ^ SC2 RNAI RNAI RNAI  B.  WI*  a SC1 WO ems  Relative to Scrambled RNAi 1.00^0.22 1.01 ENS 111111110. *ago  C.  ^  • T's re  a actin ow.  NS  -  50%  0% ^  Scrambled  SC2 RNAI  RNAI myrSIRK Treatment  128  a SC2  1.00^1.15 0.45  150%  c 100%  ,  SC1 RNAI  a actin  Fig. 4-5. SCAMP2 knock down downregulates phosphorylation of ERK1/2 when MCF-7 cells are treated with myrSIRK peptide. (A) Schematic representation of siRNA used to knockdown SCAMPI (SC1 RNAi) and -2 (SC2 RNAi), and Scrambled control (Scrambled RNAi). (B) MCF-7 cells were electroporated with constructs shown in Figure 5A cloned in pRNAT/U6 vector. Seventy-two hours after electroporation, cells were subjected to lysis and equal amounts of protein (0.625 iug) was separated by SDSPAGE and analyzed by western blot with anti-SCAMP1 (SC1) or SCAMP2 (SC2) antibodies. SCAMP expression was determined by densitometry and normalized with actin. Blots were also stripped and re-probed with anti-actin rabbit polyclonal antibody. (C) MCF-7 cells were electroporated with specific SCAMP knock down constructs and treated with 10 i_tM myrSIRK peptide for 5 minutes and phosphorylated ERK1/2 were analyzed by densitometry. The data are presented as mean values +/- standard deviations of 6 independent experiments. Asterisks indicate significant differences (*: p<0.001). NS, no significant difference.  129  4.3 Discussion Secretory Carrier Membrane Proteins (SCAMPs) have been recognized as integral membrane proteins that regulate both secretion and endocytosis. SCAMPs possess four transmembrane domains and N- and C-terminal cytosolic extensions, and the N-terminal extension contains several putative protein-protein interaction motifs including Asn-Pro-Phe (NPF) repeats, calcium binding domain, a leucine zipper, two zinc fingers, Pro-rich domain, and coiled-coil domain (Brand and Castle, 1993, FernandezChacon and Sudhof, 2000, Hubbard et al., 2000). While several proteins such as intersectin and gamma synergin have been identified to associate with the NPF-repeat (Fernandez-Chacon and Sudhof, 2000), SCAMPs' role as signaling scaffold has not been explored. In this chaper, I have shown that the Pro-rich SCAMP2[117-134] domain serves as protein interaction domain for heterotrimeric G protein 13 subunits (G(3). This is the first report showing that the Pro-rich domain in the N-terminal cytosolic domain of SCAMPs indeed serves as a protein-protein interaction domain. Reciprocal in vitro protein binding assays revealed that SCAMP2 interacts with WD1, 2, 6, and 7 of GI31 that are located on the same surface of GP (Fig. 4-2 and -3). Since SCAMPs cycle among different organelles including the Golgi apparatus, TGN, secretory granules, endosomes, and the plasma membrane, SCAMPs may attract GP signaling complex to specific cellular compartments. The amino acid sequence of SCAMP2[117-134] is highly similar among all mammalian SCAMP isoforms, and Pro residues in this region is commonly observed in all SCAMPs. In accordance, our preliminary data suggests that SCAMPI also binds to G. In this context, it is interesting to note that inhibition of SCAMP2 (but not SCAMPI) by membrane—permeable blocking peptides or siRNA  130  specifically affected myrSIRK activated GP-mediated ERK1/2 phosphorylation. Since GP-binding is not SCAMP2-specific, it is most probable that other mechanisms such as distinct intracellular localization allow SCAMP2-specific modulation in GP-mediate MAPK signaling. It has been suggested that different SCAMP isoforms show slightly different intracellular localizations and dynamics (Castle and Castle, 2005; Liu et al., 2002; Guo et al., 2002). Interestingly, heterotrimeric G protein subunits were shown to rapidly shuttle between the plasma membrane and endomembranes (Chisari et al., 2007), but the underlying molecular mechanism is not understood. Endomembranes such as Golgi- and endosomal membranes have attracted much attention as important locations for compartmentalized signaling (Mor and Philips, 2006). Thus, it is an intriguing possibility that intracellular localization and targeting of SCAMP2 may determine compartmentalized GP-mediated MAPK signaling. Different SCAMPs are known to form homo- and hetero-oligomers (Wu and Castle, 1997), and this may add another layer of regulatory mechanisms for SCAMP2-specific effects. GPy association with Ga constitutes the well-characterized heterotrimeric Gprotein complex which is coupled to GPCRs. Only recently Gliey has been appreciated as an independent entity of the heterotrimeric G-protein other than serving as a negative regulator of Ga upon receptor stimulation (Goubaeva et al., 2003; Scott et al., 2001). With the identification of accessory proteins, receptor independent activation of GPy has become a topic of extensive research (for review Sato et al., 2006). In this chapter, I have shown SCAMP2 as a putative accessory protein for GPy and modulates the MAPK signaling cascade. GPy can activate ERK1/2 through three separate pathways: PLC, PI3K or Ras dependent pathways (Goldsmith and Dhanasekaran, 2007) and it will be 131  important in future studies to define which pathway is involved downstream of GPy and upstream of ERK1/2. Although myrSIRK activated other MAPKs such as p38 and JNK in RASM cells (Goubaeva et al., 2003), we were unable to observe these results in our experimental system (data not shown). We postulate that the myrSIRK's effect on p38 and JNK is cell type specific. It has been previously shown that stimulation of the classical MAPK (p38, JNK and ERK) by various pharmacological treaments is cell type specific and their response was different among the three cell lines A431, HeLa and MCF-7 (Boldt et al., 2002). Furthermore, specific activation of p38 by vitronectin/alpha(v) integrin ligation was only seen in MDA-231 cells and not in MCF-7 cells (Chen et al., 2001). Thus, it is possible that SCAMP2 influences GP-activated p38 and JNK signaling cascades in other cell types. As described in Chapter 2, SCAMPs were shown to bind to NHE7 in the TGN and endosomes (Lin et al., 2005) and preliminary experiments suggested that NHE7 associates with GP (Suppl. Fig. 1-4), forming a ternary NHE7-GP-SCAMPs complex in the cell. Strikingly, we recently found that NHE7-overexpression in rat neuroendocrine PC12 cells causes Golgi fragmentation at the electron microscopic level (unpublished observations). Thus, excessive NHE7-action appears to disturb structural integrity of the Golgi apparatus by uncoordinated organellar volume and/or ion homeostasis. We propose a model that the GP-SCAMP2 complex activates ERK1/2, which phosphorylates and activates NHE7 in the Golgi/TGN complex, and regulates the organellar integrity. A splicing variant of ERK1 (ERK1c) was recently shown to regulate the Golgi fragmentation during mitosis (Shaul and Seger, 2006). It has been suggested that Golgi fragmentation regulates not only organellar inheritance, but also mitotic entrance  132  (Colanzi and Corda, 2007). We are about to start the experiments to test whether ERK1c can phosphorylate NHE7 and whether NHE7-phosphorylation can trigger Golgi fragmentation and mitosis. Gf3y has been also suggested to regulate the organization of the Golgi apparatus by activating protein kinase D (PKD) (Jamora et al., 1999), but the downstream targets and PKD substrates responsible for Golgi fragmentation are not known (Ghanekar and Lowe, 2005). Thus, it is also possible that the SCAMP-GPy complex activates PKD, which phosphorylates NHE7 and Golgi fragmentation. It was shown that both NHE1 and NHE3 activities are regulated by MAPKs (Bianchini et al., 1997; Khaled et al., 2001; Liu and Gesek, 2001; Tsuganezawa et al., 2002). Investigation on regulation of NHE7 transporter activity by MAPK may serve as an initial step to understand potential involvement of NHE7 in organellar integrity and mitosis.  133  References Bianchini, L., L'Allemain, G. and Pouyssegur, J. (1997). The p42/p44 mitogenactivated protein kinase cascade is determinant in mediating activation of the Na+/H+ exchanger (NHE1 isoform) in response to growth factors. J Biol Chem. 272, 271-279. Blackmer, T., Larsen, E.C., Bartleson, C., Kowalchyk, J.A., Yoon, E.J., Preininger, A.M., Alford, S., Hamm, H.E. and Martin, T.F. (2005). G protein betagamma directly regulates SNARE protein fusion machinery for secretory granule exocytosis. Nat Neurosci. 8, 421-425. Boldt, S., Weidle, U.H. and Kolch, W. (2002). The role of MAPK pathways in the action of chemotherapeutic drugs. Carcinogenesis. 23, 1831-1838. Brand, S.H., Laurie, S.M., Mixon, M.B. and Castle, J.D. (1991). Secretory carrier membrane proteins 31-35 define a common protein composition among secretory carrier membranes. J Biol Chem. 266, 18949-18957. Brand, S. H. and Castle, J. D. (1993). SCAMP 37, a new marker within the general cell surface recycling system. EMBO J. 12, 3753-3761. Castle, A. and Castle, D. (2005). Ubiquitously expressed secretory carrier membrane proteins (SCAMPs) 1-4 mark different pathways and exhibit limited constitutive trafficking to and from the cell surface. J Cell Sci. 118, 3769-3780. Chen, J., Baskerville, C., Han, Q., Pan, Z.K. and Huang, S. (2001). Alpha(v) integrin, p38 mitogen-activated protein kinase, and urokinase plasminogen activator are functionally linked in invasive breast cancer cells. JBiol Chem. 276, 47901-47905. Chen, S., Dell, E.J., Lin, F., Sai, J. and Hamm, H.E. (2004). RACK1 regulates specific functions of Gbetagamma. JBiol Chem. 279, 17861-17868. Chen, S., Lin, F. and Hamm, H.E. (2005). RACK1 binds to a signal transfer region of G betagamma and inhibits phospholipase C beta2 activation. J Biol Chem. 280, 3344533452. Chisari, M., Saini, D.K., Kalyanaraman, V. and Gautam, N. (2007). Shuttling of G protein subunits between the plasma membrane and intracellular membranes. J Biol Chem. 282, 24092-24098. Clapham, D.E. and Neer, E.J. (1997). G protein beta gamma subunits. Annu Rev Pharmacol Toxicol. 37, 167-203. Review. Colanzi, A. and Corda, D. (2007). Mitosis controls the Golgi and the Golgi controls mitosis. Curr Opin Cell Biol. 19, 386-393.  134  Daaka, Y., Pitcher, J.A., Richardson, M., Stoffel, R.H., Robishaw, J.D. and Lefkowitz, R.J. (1997). Receptor and G betagamma isoform-specific interactions with G protein-coupled receptor kinases. Proc Natl Acad Sci U S A. 94, 2180-2185. Dell, E.J., Connor, J., Chen, S., Stebbins, E.G., Skiba, N.P., Mochly-Rosen, D. and Hamm, H.E. (2002). The betagamma subunit of heterotrimeric G proteins interacts with RACK1 and two other WD repeat proteins. J Biol Chem. 277, 49888-49895. Duchardt, F., Fotin-Mleczek, M., Schwarz, H., Fischer, R. and Brock, R. (2007). A comprehensive model for the cellular uptake of cationic cell-penetrating peptides. Traffic. 8, 848-866. Ellena, J.F., Moulthrop, J., Wu, J., Rauch, M., Jaysinghne, S., Castle, J.D. and Cafiso, D.S. (2004). Membrane position of a basic aromatic peptide that sequesters phosphatidylinositol 4,5 bisphosphate determined by site-directed spin labeling and highresolution NMR. Biophys J. 87, 3221-3233. Fernandez-Chacon, R. and Sudhof, T. C. (2000). Novel SCAMPs lacking NPF repeats: ubiquitous and synaptic vesicle-specific forms implicate SCAMPs in multiple membranetrafficking functions. J. Neurosci. 20, 7941-7950. Fernandez-Chacon, R., Alvarez de Toledo, G., Hammer, R. E. and Sudhof, T. C. (1999). Analysis of SCAMPI function in secretory vesicle exocytosis by means of gene targeting in mice. J. Biol. Chem. 274, 32551-32554. Fernandez-Chacon, R., Achiriloaie, M., Janz, R., Albanesi, J. P. and Sudhof, T. C. (2000). SCAMPI function in endocytosis. J. Biol. Chem. 275, 12752-12756. Gardner, A.J., Knott, J.G., Jones, K.T. and Evans, J.P. (2007). CaMKII can participate in but is not sufficient for the establishment of the membrane block to polyspermy in mouse eggs. J Cell Physiol. 212, 275-280. Ghanekar, Y. and Lowe, M. (2005). Protein kinase D: activation for Golgi carrier formation. Trends Cell Biol. 15, 511-514. Goldsmith, Z.G. and Dhanasekaran, D.N. (2007). G protein regulation of MAPK networks. Oncogene. 26, 3122-3142. Review. Goubaeva, F., Ghosh, M., Malik, S., Yang, J., Hinkle, P.M., Griendling, K.K., Neubig, R.R. and Smrcka, A.V. (2003). Stimulation of cellular signaling and G protein subunit dissociation by G protein betagamma subunit-binding peptides. J Biol Chem. 278, 19634-19641. Guo, Z., Liu, L., Cafiso, D. and Castle, D. (2002). Perturbation of a very late step of regulated exocytosis by a secretory carrier membrane protein (SCAMP2)-derived peptide. J. Biol. Chem. 277, 35357-35363. 135  Hamm, H.E. and Gilchrist, A. (1996). Heterotrimeric G proteins. Curr Opin Cell Biol. 8, 189-196. Hubbard, C., Singleton, D., Rauch, M., Jayasinghe, S., Cafiso, D. and Castle, D.  (2000). The secretory carrier membrane protein family: structure and membrane topology. Mol. Biol. Cell 11, 2933-2947.  Ikenoya, M., Hidaka, H., Hosoya, T., Suzuki, M., Yamamoto, N. and Sasaki, Y.  (2002). Inhibition of rho-kinase-induced myristoylated alanine-rich C kinase substrate (MARCKS) phosphorylation in human neuronal cells by H-1152, a novel and specific Rho-kinase inhibitor. J Neurochem. 81, 9-16. Jamora, C., Yamanouye, N., Van Lint, J., Laudenslager, J., Vandenheede, J.R., Faulkner, D.J. and Malhotra, V. (1999). Gbetagamma-mediated regulation of Golgi organization is through the direct activation of protein kinase D. Cell. 98, 59-68. Jin, T., Zhang, N., Long, Y., Parent, C.A. and Devreotes, P.N. (2000). Localization of the G protein betagamma complex in living cells during chemotaxis. Science. 287, 1034-  1036.  Khaled, A.R., Moor, A.N., Li, A., Kim, K., Ferris, D.K., Muegge, K., Fisher, R.J., Fliegel, L. and Durum, S.K. (2001). Trophic factor withdrawal: p38 mitogen-activated protein kinase activates NHE1, which induces intracellular alkalinization. Mol Cell Biol. 21, 7545-7557. Lam, S.K., Siu, C.L., Hillmer, S., Jang, S., An, G., Robinson, D.G. and Jiang L.  (2007). Rice SCAMPI defines clathrin-coated, trans-golgi-located tubular-vesicular structures as an early endosome in tobacco BY-2 cells. Plant Cell. 19, 296-319.  Lin, P.J., Williams, W.P., Luu, Y., Molday, R.S., Orlowski, J. and Numata M.  (2005). Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)IH+ exchanger NHE7. J Cell Sci. 118, 1885-1897. Liu, F. and Gesek, F.A. (2001). alpha(1)-Adrenergic receptors activate NHE1 and NHE3 through distinct signaling pathways in epithelial cells. Am J Physiol Renal Physiol. 280, F415-F425. Liu, L., Guo, Z., Tieu, Q., Castle, A. and Castle, D. (2002). Role of secretory carrier membrane protein SCAMP2 in granule exocytosis. Mol Biol Cell. 13, 4266-4278. Liu, L., Liao, H., Castle, A., Zhang, J., Casanova, J., SzabO, G. and Castle, D. (2005). SCAMP2 interacts with Arf6 and phospholipase D1 and links their function to exocytotic fusion pore formation in PC 12 cells. Mol Biol Cell. 16, 4463-4472.  136  Mor. A and Philips, M.R. (2006) Compartmentalized Ras/MAPK signaling.  Annu Rev Immunol. 24, 771-800. Review.  Paes-de-Carvalho, R., Dias, B.V., Martins, R.A., Pereira, M.R., Portugal, C.C. and Lanfredi, C. (2005). Activation of glutamate receptors promotes a calcium-dependent and transporter-mediated release of purines in cultured avian retinal cells: possible involvement of calcium/calmodulin-dependent protein kinase II. Neurochem Int. 46, 441451. Robinson, P.J. (1991). The role of protein kinase C and its neuronal substrates dephosphin, B-50, and MARCKS in neurotransmitter release. Mol Neurobiol. 5, 87-130. Review. Sasaki, Y., Suzuki, M. and Hidaka, H. (2002). The novel and specific Rho-kinase inhibitor (S)-(+)-2-methy1-1-[(4-methy1-5-isoquinoline)sulfony1]-homopiperazine as a probing molecule for Rho-kinase-involved pathway. Pharmacol Ther. 93, 225-232. Review. Sato, M., Blumer, J.B., Simon, V. and Lanier, S.M. (2006). Accessory proteins for G proteins: partners in signaling. Annu Rev Pharmacol Toxicol. 46, 151-187. Review. Schulz, R., Wehmeyer, A. and Schulz, K. (2002). Visualizing preference of G proteincoupled receptor kinase 3 for the process of kappa-opioid receptor sequestration. Mol Pharmacol. 61, 1444-1452. Schwindinger, W.F. and Robishaw, J.D. (2001)Heterotrimeric G-protein betagammadimers in growth and differentiation. Oncogene. 20, 1653-1660. Review. Scott, J.K., Huang, S.F., Gangadhar, B.P., Samoriski, G.M., Clapp, P., Gross, R.A., Taussig, R. and Smrcka, A.V. (2001). Evidence that a protein-protein interaction 'hot spot' on heterotrimeric G protein betagamma subunits is used for recognition of a subclass of effectors. EMBO J. 20, 767-776. Shaul, Y.D. and Seger, R. (2006). ERK1c regulates Golgi fragmentation during mitosis.  J Cell Biol. 172, 885-897.  Singleton, D.R., Wu, T.T. and Castle, J.D. (1997). Three mammalian SCAMPs (secretory carrier membrane proteins) are highly related products of distinct genes having similar subcellular distributions. J Cell Sci. 110, 2099-2107. Smrcka, A.V. and Scott, J.K. (2002). Discovery of ligands for beta gamma subunits from phage-displayed peptide libraries. Methods Enzymol. 344, 557-576. Sondek, J., Bohm, A., Lambright, D.G., Hamm, H.E. and Sigler, P.B. (1996). Crystal structure of a G-protein beta gamma dimer at 2.1A resolution. Nature. 379, 369-374.  137  Tsuganezawa, H., Sato, S., Yamaji, Y., Preisig, P.A., Moe, O.W. and Alpern, R.J. (2002). Role of c-SRC and ERK in acid-induced activation of NHE3. Kidney Int. 62, 4150. Wall, M.A., Coleman, D.E., Lee, E., Iniguez-Lluhi, J.A., Posner, B.A., Gilman, A.G. and Sprang, S.R. (1995). The structure of the G protein heterotrimer Gi alpha 1 beta 1 gamma 2. Cell. 83, 1047-1058. Wang, H., Ubl, J.J., Stricker, R. and Reiser, G. (2002). Thrombin (PAR-1)-induced proliferation in astrocytes via MAPK involves multiple signaling pathways. Am J Physiol Cell Physiol. 283, C1351-C1364. Wu, T. T. and Castle, J. D. (1997). Evidence for colocalization and interaction between 37 and 39 kDa isoforms of secretory carrier membrane proteins (SCAMPs). J. Cell Sci. 110, 1533-1541. Zeng, H., Zhao, D. and Mukhopadhyay, D. (2002). 'CDR stimulates endothelial cell migration through heterotrimeric G protein Gq/11-mediated activation of a small GTPase RhoA. J Biol Chem. 277, 46791-46798.  138  Chapter 5 — Discussion and conclusion 5.1 Summary The studies presented in this dissertation aimed at providing a better understanding of the targeting, regulation and potential physiological implications of the mammalian organellar NHE7 (Lin et al., 2005; Lin et al., 2007; Lin and Numata unpublished observations Chapter 4). One of the most novel findings was that NHE7 can be targeted to the plasma membrane (Fig. 5-1A and B), although it was initially identified and characterized as an organelle-membrane type NHE. NHE7 associates with caveolae and other lipid rafts on the cell surface (Fig. 5-1C), but it dissociates from caveolae/lipid rafts and is internalized by a clathrin-dependent pathway (Fig. 5-1D) (Lin et al., 2007). During endocytosis, NHE7 is redirected from recycling endosomes to the trans-Golgi network (TGN) by SCAMP2 interaction (Fig. 5-1E) (Lin et al., 2005). I have further shown that SCAMP2 associates with Gi3 and regulates ERK1/2 activation (Chapter 4). I recently found that NHE7, SCAMP2 and Gi3 can form a ternary complex in the cell (Suppl. Fig. 1-4 and Fig. 4-1), raising the interesting possibility that the SCAMP2-G0 complex may regulate NHE7 activity. In addition to the established role of MAPK as an NHE-regulator (Bianchini et al., 1997; Khaled et al., 2001; Liu and Gesek, 2001; Tsuganezawa et al., 2002), it has been suggested that NHEs might activate the MAPK signaling cascade (Pedersen et al., 2007). Future characterization of NHE7 might reveal an unexpected role for NHE7 in MAPK signaling.  139  •  •• Me• •• • •• • •  C Non-caveolae/lipid raft  Caveolae/lipid rafts NHE7  RIMMUMMIMEMMINIMMUM t  111.0.  NHE7  Nolt■imum Hypertonic shock  D NHE7  X^Cytosolic acidification ie. NHE7 internalized via clathrin dependent pathway  0  NHE7  NHE7 SCAMP24184-208 SCAMP2  Fig. 5-1. Intracellular targeting of NHE7. NHE7 is endocytosed to recycling endosomes by a clathrin-dependent mechanism and retrieved back to the TGN by SCAMP interaction. NHE7 exits the TGN through regulated secretory granules. MSG — Mature secretory granule, ISG — Immature secretory granule, CSV — Constitutive secretory vesicle, CLSV — Constitutive-like secretory vesicle, TGN — trans-Golgi network, RE — Recycling endosome, EE — Early endosome. 5.2 Caveats of the thesis and suggested supplementary experiments The work performed in this dissertation contributed new knowledge to NHE7 targeting and regulation, however, it must be acknowledged that limitation exists and that supplementary experiments will help to validate the claims presented above. This section will focus to review the data and discuss the caveats that require further attention. NHE7—SCAMP2 interaction In Chapter 2, SCAMP2 associated with NHE7 and played an important role in NHE7 intracellular trafficking. The identification of the interacting domains was mediated by co-immunoprecipitation and GST-pull down experiments. Using the GSTpull down experiment, it was identified that the region 615 to 665 of the C-terminal  140  domain of NHE7 showed its importance in interaction, however, as quantitated in Fig. 22 it is observed that the entire C-terminal domain showed a stronger association to SCAMP2 in comparison to shorter NHE7 C-terminus variants (GST-NHE7[615-725] and GST-NHE7[542-665]). To confirm the importance of the region 615-665, alanine scanning of this region or a deletion mutant lacking 615-665 should be employed. Expressed and purified GST-fusion proteins of NHE7 C-terminus mutants would be tested for SCAMP2 association by GST-pull down. With the alanine scanning methodology, we can pinpoint the specific residues that contribute to SCAMP2 binding. However, this must be carefully examined since GST-pull down is an in vitro binding assay. It must be taken into consideration that by using an in vitro binding assay, we are assisting interaction by bringing proteins that may not be spacially or temporarily expressed together, therefore, this interaction should be tested in a physiological setting. Once the specific mutants that show reduced binding using alanine scanning I would suggest to express them in cells and test for interaction by co-immunoprecipitation. The TM2-TM3 cytosolic loop which associates with NHE7 must also be validated. SCAMP2 mutants were designed to lack parts of the transmembrane spanning regions as well as cytosolic loops that connect neighboring transmembrane spanning regions. Even though these mutants were expressed, and associated and colocalized with exogeneously expressed wild type SCAMPs, there is a possibility that the specific mutation may have caused a change in protein structure and/or topology. A change in topology for the SCAMP2/A184-208 mutant may have abrogated NHE7 binding, therefore, topological analysis of this specific mutant is crucial to determine the importance of this region in NHE7 targeting. Data suggests that the residues 201 to 208  141  of SCAMP2 serve as the minimum binding domain to NHE7. To delineate the importance of this region in NHE7 binding and targeting, it is necessary to use point mutations. Guo and colleagues showed that specific mutations in the E-peptide region of SCAMP2 significantly abrogated the effect of this peptide in exocytosis (Guo et al., 2002), therefore, it is possible that specific residues may affect NHE7 targeting. Potentially, if the same residues that affect late stages of exocytosis also contribute to NHE7 binding or targeting, this may implicate NHE7's function in secretion via SCAMP interaction. Another aspect that must be covered is analysis and interpretation of the microscopic images. Although we show that NHE7 and SCAMP2 colocalize to juxtanuclear regions of the cell identified as TGN it is also possible that this colocalization may also occur at the Golgi and recycling endosomes since these organelles are difficult to distinguish accurately. A crucial limiting factor of confocal microscopy is resolution (Rezai, 2003). Although, sensitivity and resolution in confocal microscopes are rendered better than epifluorescence microscopes, the resolution of confocal microscopes is still limited to 0.1 microns which make distinguishing many intracellular compartments difficult (Rezai, 2003). Even if two proteins are present at distinct compartment that are within proximity of one another, this may seem as one compartment and lead to misinterpretation. In Chapter 2, we describe the association of NHE7 and wild type SCAMPs in compact juxtanuclear structure which is quite distinct and apparent, however, SCAMP2/0184-208 redistributed both wild type SCAMP2 and NHE7 into scattered peripheral compartments (Fig. 2-8) identified to colocalize, to some extent, with TfR (Fig. 2-9). The colocalization interpretation is purely qualitative thus  142  quantifying the colocalization between the proteins in question would be helpful to determine the overall effect of the SCAMP2/A184-208 mutant. Overall, the data presented in Chapter 2 suggests that SCAMP2 may play a role in NHE7 targeting, however, additional experiments are required to strengthen the claim that SCAMP2 regulates NHE7 targeting from recycling endosomes to TGN. Overexpression of SCAMP2/A184-208 functions in a dominant negative manner that alters wild type SCAMP2 and NHE7 distribution. Other unexpected functions of this dominant mutant may exist such as mistargeting other proteins or destabilizing specific organellar compartments, even though Stx6 and GM130 distribution was not affected (Fig. 2-9). To determine the precise role of SCAMP2 in NHE7 regulation I would propose to study the loss of SCAMP2 function by siRNA. Knock down of the SCAMP2 gene may provide information related to the physiological function of SCAMP2 which remains elusive. However, the loss of SCAMP2 may be compensated by other SCAMP isoforms since SCAMPI knock out mice showed no discernable phenotype (FernandezChacon et al., 1999). SCAMPs also form homo- and hetero dimmers thus knocking multiple SCAMP isoforms in the same cell may be required to dissect the role of SCAMP2 in NHE7 targeting. NHE7-Cavl interaction  The focus of Chapter 3 was to study the interaction of NHE7 to Cavl. It was concluded by biochemical means that NHE7 associated with caveolae/lipid rafts through Cav 1 interaction. Even though separating microdomains enriched with cholesterol and sphingolipids by sucrose density centrifugation is an established protocol (Li et al.,  143  2003), further verification of NHE7 association to caveolae/lipid raft by electron microscopy would be necessary to confirm such claim (Le et al., 2002). In the flotation assays, NHE7 was resolved into two distinct bands (approximately 80 and 95 kDa) when analyzed by western blotting (Fig. 3-3 and Fig. 3-5B). This discrepancy in size was suggested to be a post-translational modification. In yeast, Nhx 1p (human counterpart of NHE7) is an N-linked glycoprotein (Wells and Rao, 2001) thus we looked to test whether NHE7 was glycosylated. Upon treating CHO cell lysate expressing NHE71D4 with PNGaseF, which removes N-linked glycosylation by deamination of asparagine, it was observed that exogenously NHE71D4 no longer resolved into 2 distinct bands, only the 80 kDa NHE7 was detected (Suppl. Fig. 1-5A). Furthermore, growing CHO cells exogeneously expressing NHE71D4 in complete growth media supplemented with tunicamycin, which inhibits N-linked glycosylation at the ER, only yielded the 80 kDa band (Suppl. Fig. 1-5B bottom), while in the absence of tunicamycin, NHE7 resolved into 80 and 95 kDa bands (Suppl. Fig. 1-5B top). These experiments suggest that NHE7 undergoes an N-linked glycosylation at the ER however this post-translational modification was not required for caveolae/lipid raft association since unglycosylated NHE7 still associated to caveolae/lipid raft fractions 3 and 4 (Suppl. Fig. 1-5B bottom). This was the first evidence ever shown that NHE7 is glycosylated, however, the function of this glycosylation in NHE7 still remains to be determined. Both NHE1 and NHE3 are also glycoprotein (Counillon et al., 1994; CoupayeGerard et al., 1996; Orlowski and Grinstein, 2004; Bizal et al., 1996; Soleimani et al., 1996). Glycosylation of NHE1 has mediated basolateral membrane targeting in A6 cells (Coupaye-Gerard et al., 1996) and glycosylation of NHE3 regulates targeting and  144  transporter activity in cultured renal proximal tubule cells (Soleimani et al., 1996). To understand the role of glycosylation in NHE7, I would propose to first determine the glycosylation site. Upon this identification, point mutants would be constructed and used in organellar uptake assay to determine transporter activity or biosynthetic pulse chase experiments to determine NHE7 intracellular targeting (Numata and Orlowski, 2001; Coupaye-Gerard et al., 1996). Glycosylated NHE1 and NHE3 are functional on the plasma membrane (Counillon et al., 1994; Bizal et al., 1996; Soleimani et al., 1996), however, the transporter activity of NHE7 on the plasma membrane is not known. Here, I would suggest establishing NHE7 and NHE7 mutants lacking glycosylation sites in cells lacking NHE activity (eg. AP-1 or PS-120 cells) and test for Na+/H + exchange (Onishi et al., 2007). These experiments would serve to address the transporter activity of NHE7 on the plasma membane as well as plasma membrane targeting. While closely examining the flotation profile of NHE7, it was observed that glycosylated NHE7 associated more readily to caveolae/lipid raft fractions while unglycosylated NHE7 associated to non-floating fractions (Fig. 3-3 and Fig. 3-5). Since caveolae/lipid rafts are localized predominantly to the plasma membrane, it would be intuitive to expect that glycosylated NHE7 in the plasma membrane associates to caveolae/lipid rafts. However, colocalization of NHE7 with Cav 1 in the TGN was evident thus it must also be taken into consideration that NHE7 present in caveolae/lipid rafts can occur in membranes other than the plasma membrane. To address this question I would propose to separate organelles by sucrose gradient centrifugation followed by caveolae/lipid raft extraction and flotation assay to test NHE7's presence in caveolae/lipid rafts. If NHE7 association with Cav 1 does not target NHE7 to  145  caveolae/lipid rafts in the TGN, it is possible that this association may have other functions such as formation of scaffolding complexes or protein targeting/sorting (Head and Insel, 2007). GO - SCAMP2 interaction  In Chapter 4, I looked to explore the potential role of SCAMP2 as a regulator of GP• by using SCAMP2 inhibitor peptide (SC2-myr[117-134]) to disrupt GP-SCAMP2 interaction or by knocking down SCAMP2 expression. It was observed that these two approaches resulted in similar effects in respect to ERK1/2 phosphorylation, however, it was not shown that G13-SCAMP2 interaction was indeed disrupted. Here, I would propose to use competitive binding assays to test the binding efficiency between GPSCAMP2 in the presence of the inhibitor peptide. Likewise, it would be convincing to show reduced GP-SCAMP2 association upon gene knock down. The association of GPSCAMP2 has yet to be identified under physiological conditions. Thus, these are immediate future directions that should be addressed. It must be taken into consideration that claiming SCAMP2 as a direct regulator of GP signaling as an overstatement, however, with additional experiments this statement will surely be warranted. The scope of the studies was very limited since I was only testing the effect of SCAMP2 upon GPy activation by myrSIRK treatment. As shown by Goubaeva and collegues, myrSIRK was specific to GP signaling as Ga signaling pathways were not activated (Goubaeva et al., 2003). We suggested that SCAMP2 regulates GP signaling, therefore, upon disruption GP-SCAMP2 interaction the ERK1/2 phosphorylation was downregulated. It is possible that SCAMP2 inhibitor peptide may be interfering with the association of myrSIRK with GP directly thus reducing ERK1/2  146  activation. To test this, crude lysate in the presence of SC24117-134] peptide can be passed through an affinity column consisting of SIRK peptide. As control, SCRAMBLE peptide will replace SC24117-134] peptide. If the SCAMP2 inhibitor peptide interferes with direct binding between G[3 and SIRK then reduced GP will be bound to the column and eluted. However, knock down of SCAMP2 gene expression showed that ERK1/2 stimulation was also reduced suggesting that SC2-myr[117-134] was not interfering with myrSIRK mediated GP dissociation. Instead, SCAMP2 may bind directly to GP and act as a scaffolding protein or it may associate and regulate downstream effectors of GP prior to ERK1/2 activation. To dissect the mechanism in which SCAMP2 regulates G13 signaling, it would be necessary to map the pathway in which SCAMP2 serves as a component. This can be achieved by analyzing the kinectome upon treating cells with myrSIRK and SC2-myr[117-134] or treating SC2 RNAi cells with myrSIRK. The identification of different signaling mediators affected by SC2-myr[117-134] or SC2 RNAi in comparison to the SCRAMBLE controls will then provide a mechanism and stronger evidence to support the role of SCAMP2 in GP related signaling. GP activates various signaling pathways. A predicted hypothesis is that SCAMP2-GPy interaction may not be only limited to provide efficient ERK1/2 activation but abrogation of this interaction may have other downstream effects in other signaling pathways. GPy interacts and activates with PLC. Upon disruption of this interaction by mutagenesis analysis or inhibitory peptide treatment, it was shown that PLCP2 binding to GP) sits in an equilibrium between inhibitory and stimulatory position of GPy with an ,  overall stimulatory result (Bonacci et al., 2005). Since SCAMP2 binds to Gf3y along the propeller region, it is tempting to speculate that this interaction may assist in  147  shifting/displacing PLC binding from stimulatory region to the inhibitory region and induce PLC downregulation. It has been previously shown that SCAMP2 Epeptide suppresses the hydrolysis of PI(4,5)P2 by PLCI3 and PLCS1 (Ellena et al., 2004). This suppression may be due to interaction of SCAMP2 Epeptide to the PLC substrate PI(4,5)P as previously suggested, however, it is also possible that SCAMP2 interaction with Gfry may deter 037-PLC interaction therefore SCAMP2 may provide dual modes of PLC regulation. SCAMP2 may also function to inhibit PLC function by direct binding to PLC. Further work to outline the relationship between SCAMP2 and PLC is needed to understand the role of SCAMP2 in the regulation of PLC.  5.3 Future directions The organellar cation tracer influx assay using permeabilized cells has provided much information on the basic NHE7 transporter activity (Numata and Orlowski, 2001). However, we cannot exclude the possibility that this assay picks up secondary ion fluxes caused by NHE7-overexpression or suppression. Therefore, it is important to establish an in vitro assay that detects only direct action of NHE7. A liposome-based in vitro reconstitution system was successfully used to measure plant NHX1 (Venema et al., 2002) and mammalian NHE8 activities (Nakamura et al., 2005). By using similar approaches, we may be able to determine more directly the role of interacting proteins in regulating NHE7 activity. Caveolins have been suggested to play important roles in both endocytosis (Pelkmans and Helenius, 2003; Nichols, 2003; Nabi and Le, 2003; Cheng et al., 2006; Kirkham and Parton, 2005) and exocytosis (Cavallo-Medved et al., 2005; Mora et al., 1999; Parolini et al., 1999). In Chapter 3, we focused our attention on the role of Cavl in  148  NHE7 endocytosis, but have not investigated its role on cell-surface targeting (exocytosis) of NHE7. Since the involvement of Cav 1 in cell-surface targeting of some membrane proteins such as Cav2 (Cavallo-Medved et al., 2005; Mora et al., 1999), cathepsin B and pro-uPA (Parolini et al., 1999) has been suggested, it will be important to test a role of Cavl in the targeting of NHE7 to the plasma membrane. Cavl is functional in the plasma membrane as a scaffolding protein as it associates with signaling molecules such as GPCRs, receptor tyrosine kinases and ion channels (reviewed in Head and Insel, 2007). Heterotrimeric G-proteins were known to associate with caveolae/lipid rafts (Foster et al., 2003; Okamoto et al., 1998; Galbiati et al., 2001; Shaul and Anderson, 1998; Oh and Schnitzer, 2001.), and our preliminary results suggested that the G13 protein binds to both SCAMP2 and NHE7 (Suppl. Fig. 1-4 and Fig. 4-1). Therefore it will be interesting to determine whether the NHE7-SCAMP2-G(3 complex in caveolae/lipid rafts serves as a signaling module. NHE1 also binds to Cav 1 and acts as a scaffolding protein in caveolae (reviewed in Baumgartner et al., 2004), raising an interesting possibility that NHE7 and NHE 1 may make a high order protein complex in the caveolae/lipid raft. In Chapter 2, I characterized the role of SCAMP2 binding on the NHE7-endocytic pathway from recycling endosomes to the TGN. Since SCAMP2 plays an important role in late stage membrane fusion events during exocytosis (Liu et al., 2002; Guo et al., 2002) and SCAMP! was initially detected in membranes of secretory granules (Brand et al., 1991), it would be interesting to investigate the role of SCAMPs in targeting NHE7 in secretion pathways. S. cerevisiae NHX], the yeast orthologue of mammalian NHE7, exhibited very similar (Na t , 10/11 + exchange activity as NHE7 and S. cerevisiae mutants lacking NHX 1 activity showed impaired vesicular trafficking with significant structural  149  disturbance of the prevacuole (yeast counterpart to the late endosome) (Bowers et al., 2000; Brett et al., 2005b), suggesting a role for NHE7 in secretion in mammalian cells. Two classical pathways of secretion have been identified in eukaryotes, constitutive and regulated secretion (Thiele and Huttner, 1998; Aryan and Castle, 1998). Constitutive secretion occurs in all cell types allowing fast transport of proteins from the TGN to plasma membrane. Regulated secretion is most commonly found in secretory cells (e.g., neurons, exo- and endocrine cells) where proteins are targeted from the TGN to specialized electron-dense vesicles and stored until cells receive stimuli, such as high Cal* and IC' (Specht et al., 2003; Nakatsuka et al., 2001). Perturbation of acidic organellar pH by V-ATPase inhibition abrogated Chromogranin A (CgA) secretion (Taupenot et al., 2005), suggesting that acidic organellar pH is another important factor for regulated secretion. I initiated preliminary experiments to examine the possible involvement of NHE7 in regulated secretion. Cell lines and antibody were generated to this goal (Suppl. Fig. 16). Rat pheochromocytoma PC12 cells were used because they have both constitutive and regulated secretion pathways and they are widely used as a model to study the secretion pathways (Schreiber et al., 2004; Attiah et al., 2003). To determine the involvement of NHE7 in the regulated secretion, PC 12 cells stably co-expressing HAtagged Chromogranin B (CgB), a widely-used marker for regulated secretion (Malosio et al., 2004), and either NHE71D4 or an NHE7 knock down siRNA construct were established (Suppl. Fig. 1-7 and Suppl. Fig. 1-8). Immunofluorescnece microscopy (Suppl. Fig. 1-8A), sucrose density centrifugation (Suppl. Fig. 1-8B), and immunoaffinity purification of organelles (Suppl. Fig. 1-8C) showed association of NHE7 and  150  CgB. When regulated secretion in these cells was stimulated by KC1, PC12/CgBHA cells stably expressing NHE71D4 (PC12/CgBH A + NHE71D4) exhibited two-fold more CgB secretion than PC12/CgBHA cells (Suppl. Fig. 1-9). However, interestingly, one of the NHE7 siRNA constructs had no significant effect on CgB secretion (Suppl. Fig. 1-9). I am currently testing the effect of other NHE7 siRNA constructs. It is possible that overexpression of NHE7 has significant impact on regulated secretion, while compensatory mechanisms masked the effect of NHE7 knockdown. It is also possible that residual NHE7 expression in siRNA cells was sufficient for the stimulus-induced CgB secretion. This preliminary data is contradictory to existing studies that show elevated organellar pH, caused by V-ATPase inhibition (Taupenot et al., 2005) or weak base treatment (Carnell and Moore, 1994), blocks regulated secretion. The function of NHE7 is to exchange a Na + or K+ in exchange of an H + to alkalinize luminal pH, however, this has not been proven in mammalian cells. It is expected that NHE7 overexpression would contribute to a higher observed pH, subsequently blocking regulated secretion since 86 Rb + uptake assay showed elevated 86 Rb + entrapment in the lumen (Suppl. Fig. 1-7D). The possible explanation to increased secretion in PC12/CgBHA + NHE71D4 cells is the potential role of NHE7 as a scaffolding protein. NHE1 also serves to recruit adhesion molecules (Denker and Barber, 2002; Denker et al., 2000), therefore, it is likely that NHE7 may have additional roles similar to other NHE isoforms. NHE7 associates to GP and GP has been previously shown to recruit PLCP3, and PKD to the Golgi resulting in membrane fission at the TGN (Diaz Ariel, 2007). The increased expression of NHE7 may result in increased GP recruitment which induces increase in secretion. Our collaborator in Spain (Gustavo Egea) has also shared  151  unpublished EM images of fragmented Golgi structure in NHE71  D4/PC  12 suggesting the  role of NHE7 in regulating the integrity of organellar structure. Whether NHE7 recruits other proteins to the TGN or whether Golgi fragmentation directs increased secretion upon stimulation still remains to be determined. As an initial step toward understanding the potential role of NHE7 as a scaffolding protein in the TGN, I would propose to isolate the TGN by sucrose density centrifugation, purify NHE7 interacting proteins and identify these proteins by mass spectroscopy with the presence or absence of stimulation (membrane depolarization). 5.4 NHE7 and disease  Many diseases have been associated with NHEs. NHE 1-deficient mice showed selective neuronal death in the cerebellum and the brainstem accompanied with slow wave epilepsy (Cox et al., 1997) suggesting the importance of pH regulation in neurons. Since NHE7 shows higher expression in some parts of the brain (Numata and Orlowski, 2001) and NHE7 appears to be more abundantly expressed in neurons than in glial cells in mouse brain (unpublished observations), NHE7 might be involved with specific brain functions. As discussed above, NHE7 may regulate organellar pH and vesicular trafficking along the secretory pathways, and uncontrolled NHE7 activity may induce protein mistargeting (e.g., neuropeptide release and synaptic transmission). The effect of protein mistargeting has been well documented in neurons. For example: protein sorting of amyloid precursor protein APP as well as beta-site APP cleaving enzyme BACE which are the key molecules in Alzheimer's disease have been linked to problematic protein sorting (De Strooper et al., 1995; Tienari et al., 1996; Capell et al., 2002; Small and Gandy, 2006); disruption of lipid rafts or mistargeting of NPC1/NPC2 can promote  152  certain forms of Niemann-Pick Disease (Ledesma et al., 1998; Blom et al., 2003); and in prion diseases it has been suggested that protein trafficking and conformational conversion of prion protein from cellular prion protein PrP c to infectious Scrapie form prion protein PrP se are dependent on lipid raft association (reviewed in Taylor and Hooper, 2006; Pinheiro, 2006). It was also reported that chromogranins interact with mutant forms of superoxide dismutase SOD1 that are linked to amyotrophic lateral sclerosis (ALS), but not wild type SOD1 (Urushitani et al., 2006). Further investigation on the involvement of NHE7 in different protein targeting pathways in neurons including regulated secretion pathways might shed light on new pathological mechanisms of neurodegenerative diseases. Early research suggested the importance of Na ±/H+ exchange in tumour growth and cancer (Lagarde and Pouyssegur, 1986; Rotin et al., 1989). NHE1 is implicated in cell adhesion, invasion and transformation (Reshkin et al., 2000, Lagana et al., 2000, Bourguignon et al., 2004, Cardone et al., 2005, Stock et al., 2005), and NHE3 in cell invasion of prostate cancer cell line (Gonzalez-Gronow et al., 2005). Also, as noted by Harguindey and colleagues "cancer cells have an acid-base disturbance that is completely different than observed in normal tissues and that increases in correspondence with increasing neoplastic state" (Harguindey et al., 2005). Since NHE7 is also found in the plasma membrane (Lin et al., 2007), mistargeting of NHE7 may contribute to an interstitial acid microenvironment that is linked to an intracellular alkalosis which drives important neoplastic phenotype (Harguindey et al., 2005). Cav 1 may be involved in tumorigenesis (Williams and Lisanti, 2005), and the P132L mutation in Cavl is observed in 16% of breast cancer cells (Hayashi et al., 2001; Lee et al., 2002). Since this specific  153  mutation perturbs proper caveolae formation/targeting (Lee et al., 2002) and NHE7 association with caveolae (Lin et al., 2007), it would be intriguing to propose that NHE7 mistargeting by Cavl may also contribute to cancer. Preliminary observations by our group showed that PC12 cells stably expressing NHE7, but not cells stably expressing NHE5 or NHE6, showed altered cell-cell adhesion and migration phenotypes (unpublished). Furthermore, we observed that PC12 cells stably expressing NHE7 survived longer than wild-type PC12 cells in the absence of serum (unpublished), implying a potential role of NHE7 in suppressing cell death. These preliminary findings suggest that overactive NHE7 may influence in tumorigenesis and invasion. This possibility is especially interesting in light of the fact that NHE7 forms a ternary complex with SCAMP2 and G137 and regulates MAPK signaling cascades, which has been linked to cancer metastasis (Reddy et al., 2003; Huang et al., 2004; Kohno and Pouyssegur, 2006; Viala and Pouyssegur, 2004) Finally, although I showed in Chapter 3 that Cav 1 interacts with NHE7 in a heterologous expression system, I was unable to detect endogenous NHE7-Cav 1 interaction in the cell. We postulate that this is due to the imbalanced protein expression levels of NHE7 and Cav 1 in the same cell. Both Cav 1 and Cav3 share high residue similarities along the NHE7 binding domain (Suppl. Fig. 1-3A). By co-expressing differently tagged NHE7 and either Cav 1 or Cav3, we found that Cav3 also binds to NHE7 and that Cav3 might have higher affinity for NHE7 (Lin et al., 2007 and Suppl. Fig. 1-3B). Northern blots showed relatively higher expression of NHE7 in skeletal muscle (Numata and Orlowski, 2001), pointing to a potential physiological role of the NHE7-Cav3 complex in skeletal muscles. Mutations in the Cav3 gene lead to Rippling  154  Muscle Disease and a form of Limb-Girdle Muscular Dystrophy (Hnasko and Lisanti, 2003), and the sarcolemma in these patients cannot repair physical damage caused by muscle contraction (Hernandez-Deviez et al., 2006; Jaiswal et al., 2007). A link between specialized secretion mechanisms and membrane repair in muscles has been suggested (Han and Campbell, 2007). Currently, experiments are ongoing in our laboratory to test the possible role of the NHE7-Cav3 complex in membrane repair and muscle differentiation by using dominant-negative disease associated Cav3 and mouse myoblast C2C12 cell line.  155  References Aryan, P. and Castle, D. (1998). Sorting and storage during secretory granule biogenesis: looking backward and looking forward. Biochem. J. 332, 593-610. Attiah, D.G., Kopher, R.A. and Desai, T.A. (2003). Characterization of PC12 cell proliferation and differentiation-stimulated by ECM adhesion proteins and neurotrophic factors. J Mater Sci Mater Med. 14, 1005-1009.  Baumgartner, M., Patel, H. and Barber, D.L. (2004). Na(+)/H(+) exchanger NHE1 as plasma membrane scaffold in the assembly of signaling complexes. Am J Physiol Cell Physiol. 287, C844-C850.  Bianchini, L., L'Allemain, G. and Pouyssegur, J. (1997). The p42/p44 mitogenactivated protein kinase cascade is determinant in mediating activation of the Na+/H+ exchanger (NHE1 isoform) in response to growth factors. J Biol Chem. 272, 271-279.  Bizal, G.L., Howard, R.L., Bookstein, C., Rao, M.C., Chang, E.B. and Soleimani, M. (1996). Glycosylation of the Na+/H+ exchanger isoform NHE-3 is species specific. J Lab Clin Med. 128, 304-312. Blom, T.S., Linder, M.D., Snow, K., Pihko, H., Hess, M.W., Jokitalo, E., Veckman, V., Syvanen, A.C. and Ikonen, E. (2003). Defective endocytic trafficking of NPC1 and NPC2 underlying infantile Niemann-Pick type C disease. Hum Mol Genet. 12, 257-272. Bonacci, T.M., Ghosh, M., Malik, S. and Smrcka, A.V. (2005). Regulatory interactions between the amino terminus of G-protein betagamma subunits and the catalytic domain of phospholipase Cbeta2. J Biol Chem. 280, 10174-10181.  Bourguignon, L.Y., Singleton, P.A., Diedrich, F., Stern, R. and Gilad, E. (2004). CD44 interaction with Na+-H+ exchanger (NHE 1) creates acidic microenvironments leading to hyaluronidase-2 and cathepsin B activation and breast tumor cell invasion. J Biol Chem. 279, 26991-27007.  Bowers, K., Levi, B. P., Patel, F. I. and Stevens, T. H. (2000). The sodium/proton exchanger Nhxlp is required for endosomal protein trafficking in the yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 11, 4277-4294.  Brand, S.H., Laurie, S.M., Mixon, M.B. and Castle, J.D. (1991). Secretory carrier membrane proteins 31-35 define a common protein composition among secretory carrier membranes. J Biol Chem. 266, 18949-18957.  Brett, C.L., Tukaye, D.N., Mukherjee, S. and Rao, R. (2005b). The yeast endosomal Na+K+/H+ exchanger Nhx 1 regulates cellular pH to control vesicle trafficking. Mol Biol Cell. 16, 1396-1405.  156  Capell, A., Meyn, L., Fluhrer, R., Teplow, D.B., Walter, J. and Haass, C. (2002). Apical sorting of beta-secretase limits amyloid beta-peptide production. J Biol Chem. 277, 5637-5643. Cardone, R.A., Casavola, V. and Reshkin, S.J. (2005). The role of disturbed pH dynamics and the Na+/H+ exchanger in metastasis. Nat Rev Cancer. 5, 786-795. Review. Carnell, L. and Moore, H.P. (1994). Transport via the regulated secretory pathway in semi-intact PC12 cells: role of intra-cisternal calcium and pH in the transport and sorting of secretogranin II. J Cell Biol. 127, 693-705. Castle, A. and Castle, D. (2005). Ubiquitously expressed secretory carrier membrane proteins (SCAMPS) 1-4 mark different pathways and exhibit limited constitutive trafficking to and from the cell surface. J Cell Sci. 118, 3769-3780. Cavallo-Medved, D., Mai, J., Dosescu, J., Sameni, M. and Sloane, B.F. (2005). Caveolin-1 mediates the expression and localization of cathepsin B, pro-urokinase plasminogen activator and their cell-surface receptors in human colorectal carcinoma cells. J Cell Sci. 118, 1493-1503. Cheng, Z.J., Singh, R.D., Marks D.L. and Pagano R.E. (2006). Membrane microdomains, caveolae, and caveolar endocytosis of sphingolipids. Mol Membr Biol. 23, 101-110. Review. Counillon, L., Pouyssegur, J. and Reithmeier, R.A. (1994). The Na+/H+ exchanger NHE-1 possesses N- and 0-linked glycosylation restricted to the first N-terminal extracellular domain. Biochemistry. 33, 10463-10469. Coupaye-Gerard, B., Bookstein, C., Duncan, P., Chen, X.Y., Smith, P.R., Musch, M., Ernst, S.A., Chang, E.B. and Kleyman, T.R. (1996). Biosynthesis and cell surface delivery of the NHE1 isoform of Na+/H+ exchanger in A6 cells. Am J Physiol. 271, C1639-C1645. Cox, G.A., Lutz, C.M., Yang, C.L., Biemesderfer, D., Bronson, R.T., Fu, A., Aronson, P.S., Noebels, J.L. and Frankel, W.N. (1997). Sodium/hydrogen exchanger gene defect in slow-wave epilepsy mutant mice. Cell. 91, 139-148. De Strooper, B., Craessaerts, K., Dewachter, I., Moechars, D., Greenberg, B., Van Leuven, F. and Van den Berghe, H. (1995). Basolateral secretion of amyloid precursor protein in Madin-Darby canine kidney cells is disturbed by alterations of intracellular pH and by introducing a mutation associated with familial Alzheimer's disease. J Biol Chem. 270, 4058-4065.  157  Denker, S.P., Huang, D.C., Orlowski, J., Furthmayr, H. and Barber, D.L. (2000). Direct binding of the Na--H exchanger NHE1 to ERM proteins regulates the cortical cytoskeleton and cell shape independently of H(+) translocation. Mol Cell. 6, 1425-1436. Denker, S.P. and Barber, D.L. (2002). Cell migration requires both ion translocation and cytoskeletal anchoring by the Na-H exchanger NHE1. J Cell Biol. 159, 1087-1096. Diaz Ariel, A.M. (2007). Phospholipase C beta3 is a key component in the Gbetagamma/PKCeta/PKD-mediated regulation of trans-Golgi network to plasma membrane transport. Biochem .1. 406, 157-165. Ellena, J.F., Moulthrop, J., Wu, J., Rauch, M., Jaysinghne, S., Castle, J.D. and Cafiso, D.S. (2004). Membrane position of a basic aromatic peptide that sequesters phosphatidylinositol 4,5 bisphosphate determined by site-directed spin labeling and highresolution NMR. Biophys J. 87, 3221-3233. Fernandez-Chacon, R., Alvarez de Toledo, G., Hammer, R. E. and Sudhof, T. C. (1999). Analysis of SCAMPI function in secretory vesicle exocytosis by means of gene targeting in mice. J. Biol. Chem. 274, 32551-32554. Foster, L.J., De Hoog, C.L. and Mann, M. (2003). Unbiased quantitative proteomics of lipid rafts reveals high specificity for signaling factors. Proc Natl Acad Sci U S A. 100, 5813-5818. Galbiati, F., Razani, B. and Lisanti, M.P. (2001). Emerging themes in lipid rafts and caveolae. Cell. 106, 403-411. Review. Gonzalez-Gronow, M., Misra, U.K., Gawdi, G. and Pizzo, S.V. (2005). Association of plasminogen with dipeptidyl peptidase IV and Na+/H+ exchanger isoform NHE3 regulates invasion of human 1-LN prostate tumor cells. J Biol Chem. 280, 27173-27178. Goubaeva, F., Ghosh, M., Malik, S., Yang, J., Hinkle, P.M., Griendling, K.K., Neubig, R.R. and Smrcka, A.V. (2003). Stimulation of cellular signaling and G protein subunit dissociation by G protein betagamma subunit-binding peptides. J Biol Chem. 278, 19634-19641. Guo, Z., Liu, L., Cafiso, D. and Castle, D. (2002). Perturbation of a very late step of regulated exocytosis by a secretory carrier membrane protein (SCAMP2)-derived peptide. J. Biol. Chem. 277, 35357-35363. Han, R. and Campbell, K.P. (2007). Dysferlin and muscle membrane repair. Curr Opin Cell Biol. 19, 409-416. Harguindey, S., Orive, G., Luis Pedraz, J., Paradiso, A. and Reshkin, S.J. (2005). The role of pH dynamics and the Na+/H+ antiporter in the etiopathogenesis and treatment of cancer. Two faces of the same coin--one single nature. Biochim Biophys Acta. 1756, 1158  24. Review. Hayashi, K., Matsuda, S., Machida, K., Yamamoto, T., Fukuda, Y., Nimura, Y., Hayakawa, T. and Hamaguchi, M. (2001). Invasion activating caveolin-1 mutation in human scirrhous breast cancers. Cancer Res. 61, 2361-2364. Head, B.P. and Insel, P.A.(2007). Do caveolins regulate cells by actions outside of caveolae? Trends Cell Biol. 17, 51-57. Hernandez-Deviez, DJ., Martin, S., Laval, S.H., Lo, H.P., Cooper, S.T., North, K.N., Bushby, K. and Parton, R.G. (2006). Aberrant dysferlin trafficking in cells lacking caveolin or expressing dystrophy mutants of caveolin-3. Hum Mol Genet. 15, 129-142. Hnasko, R. and Lisanti, M.P. (2003). The biology of caveolae: lessons from caveolin knockout mice and implications for human disease. Mol Interv. 3, 445-464. Review. Huang, C., Jacobson, K. and Schaller, M.D. (2004). MAP kinases and cell migration. J Cell Sci. 117, 4619-4628. Review. Jaiswal, J.K., Marlow, G., Summerill, G., Mahjneh, I., Mueller, S., Hill, M., Miyake, K., Haase, H., Anderson, L.V., Richard, I., Kiuru-Enari, S., McNeil, P.L., Simon, S.M. and Bashir, R. (2007). Patients with a non-dysferlin Miyoshi myopathy have a novel membrane repair defect. Traffic. 8, 77-88. Khaled, A.R., Moor, A.N., Li, A., Kim, K., Ferris, D.K., Muegge, K., Fisher, R.J., Fliegel, L. and Durum, S.K. (2001). Trophic factor withdrawal: p38 mitogen-activated protein kinase activates NHE1, which induces intracellular alkalinization. Mol Cell Biol. 21, 7545-7557. Kirkham, M. and Parton, R.G. (2005). Clathrin-independent endocytosis: new insights into caveolae and non-caveolar lipid raft carriers. Biochim Biophys Acta. 1746, 349-363. Review. Kohno, M. and Pouyssegur, J. (2006). Targeting the ERK signaling pathway in cancer therapy. Ann Med. 38, 200-211. Review. Lagana, A., Vadnais, J., Le, P.U., Nguyen, T.N., Laprade, R., Nabi, I.R. and Noel, J. (2000). Regulation of the formation of tumor cell pseudopodia by the Na(+)/H(+) exchanger NHEl. J Cell Sci. 113, 3649-3662. Lagarde, A.E. and Pouyssegur, J.M. (1986). The Na+:H+ antiport in cancer. Cancer  Biochem Biophys. 9, 1-14.  Le, P.U., Guay, G., Altschuler, Y. and Nabi, I.R. (2002). Caveolin-1 is a negative regulator of caveolae-mediated endocytosis to the endoplasmic reticulum. J Biol Chem. 277, 3371-3379.  159  Ledesma, M.D., Simons, K. and Dotti, C.G. (1998). Neuronal polarity: essential role of protein-lipid complexes in axonal sorting. Proc Natl Acad Sci U S A. 95, 3966-3971. Lee, H., Park, D.S., Razani, B., Russell, R.G., Pestell, R.G. and Lisanti, M.P. (2002). Caveolin-1 mutations (P132L and null) and the pathogenesis of breast cancer: caveolin-1 (P132L) behaves in a dominant-negative manner and caveolin-1 (-/-) null mice show mammary epithelial cell hyperplasia. Am J Pathol. 161, 1357-1369. Li, H., Ayer, L.M., Lytton, J. and Deans, J.P. (2003). Store-operated cation entry mediated by CD20 in membrane rafts. J Biol Chem. 278, 42427-42434. Lin, P.J., Williams, W.P., Luu, Y., Molday, R.S., Orlowski, J. and Numata M. (2005). Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7. J Cell Sci. 118, 1885-1897. Lin, P.J., Williams, W.P., Kobiljski, J. and Numata, M. (2007). Caveolins bind to (Na+, K+)/H+ exchanger NHE7 by a novel binding module. Cell Signal. 19, 978-988. Liu, F. and Gesek, F.A. (2001). alpha(1)-Adrenergic receptors activate NHE 1 and NHE3 through distinct signaling pathways in epithelial cells. Am J Physiol Renal Physiol. 280, F415-F425. Liu, L., Guo, Z., Tieu, Q., Castle, A. and Castle, D. (2002). Role of secretory carrier membrane protein SCAMP2 in granule exocytosis. Mol Biol Cell. 13, 4266-4278. Malosio, M.L., Giordano, T., Laslop, A. and Meldolesi, J. (2004). Dense-core granules: a specific hallmark of the neuronal/neurosecretory cell phenotype. J Cell Sci. 117, 743-749. Mora, R., Bonilha, V.L., Marmorstein, A., Scherer, P.E., Brown, D., Lisanti, M.P. and Rodriguez-Boulan, E. (1999). Caveolin-2 localizes to the golgi complex but redistributes to plasma membrane, caveolae, and rafts when co-expressed with caveolin1. J Biol Chem. 274, 25708-25717. Nabi, I.R. and Le, P.U. (2003). Caveolae/raft-dependent endocytosis. J Cell Biol. 161, 673-677. Review. Nakamura, N., Tanaka, S., Teko, Y., Mitsui, K. and Kanazawa, H. (2005). Four Na+/H+ exchanger isoforms are distributed to Golgi and post-Golgi compartments and are involved in organelle pH regulation. J Biol Chem. 280, 1561-1572. Nakatsuka, S., Hayashi, M., Muroyama, A., Otsuka, M., Kozaki, S., Yamada, H. and Moriyama, Y. (2001). D-Aspartate is stored in secretory granules and released through a Ca(2+)-dependent pathway in a subset of rat pheochromocytoma PC12 cells. J Biol Chem. 276, 26589-26596.  160  Nichols, B. (2003). Caveosomes and endocytosis of lipid rafts. J Cell Sci. 116, 47074714.  Numata, M. and Orlowski, J. (2001). Molecular cloning and characterization of a novel (Na+,K+)/H+ exchanger localized to the trans-Golgi network. J. Biol. Chem. 276, 1738717394.  Numata, M., Petrecca, K., Lake, N. and Orlowski, J. (1998). Identification of a mitochondrial Na+/H+ exchanger. J. Biol. Chem. 273, 6951-6959. Oh, P. and Schnitzer, J.E. (2001). Segregation of heterotrimeric G proteins in cell surface microdomains. G(q) binds caveolin to concentrate in caveolae, whereas G(i) and G(s) target lipid rafts by default. Mol Biol Cell. 12, 685-698.  Okamoto, T., Schlegel, A., Scherer, P.E. and Lisanti, M.P. (1998). Caveolins, a family of scaffolding proteins for organizing "preassembled signaling complexes" at the plasma membrane. J Biol Chem. 273, 5419-22. Review.  Onishi, I., Lin, P.J., Diering, G.H., Williams, W.P. and Numata, M. (2007). RACK1 associates with NHE5 in focal adhesions and positively regulates the transporter activity. Cell Signal. 19, 194-203.  Orlowski, J. and Grinstein, S. (2004). Diversity of the mammalian sodium/proton exchanger SLC9 gene family. I'lltigers Arch. 447, 549-565. Parolini, I., Sargiacomo, M., Galbiati, F., Rizzo, G., Grignani, F., Engelman, J.A., Okamoto, T., Ikezu, T., Scherer, P.E., Mora, R., Rodriguez-Boulan, E., Peschle, C. and Lisanti, M.P. (1999). Expression of caveolin-1 is required for the transport of caveolin-2 to the plasma membrane. Retention of caveolin-2 at the level of the golgi complex. J Biol Chem. 274, 25718-25725.  Pedersen, S.F., Darborg, B.V., Rentsch, M.L. and Rasmussen, M. (2007). Regulation of mitogen-activated protein kinase pathways by the plasma membrane Na+/H+ exchanger, NHE1. Arch Biochem Biophys. 462, 195-201. Pelkmans, L. and Helenius, A. (2003). Insider information: what viruses tell us about endocytosis. Curr Opin Cell Biol. 15, 414-422. Review. Pelkmans, L., Burli, T., Zerial, M., and Helenius, A. (2004). Caveolin-stabilized membrane domains as multifunctional transport and sorting devices in endocytic membrane traffic. Cell. 118, 767-780.  Pinheiro, T.J. (2006). The role of rafts in the fibrillization and aggregation of prions. Chem Phys Lipids. 141, 66-71. Review.  161  Reddy, K.B., Nabha, S.M. and Atanaskova, N. (2003). Role of MAP kinase in tumor progression and invasion. Cancer Metastasis Rev. 22, 395-403. Review. Reshkin, S.J., Bellizzi, A., Caldeira, S., Albarani, V., Malanchi, I., Poignee, M., Alunni-Fabbroni, M., Casavola, V. and Tommasino, M. (2000). Na+/H+ exchangerdependent intracellular alkalinization is an early event in malignant transformation and plays an essential role in the development of subsequent transformation-associated phenotypes. FASEB J. 14, 2185-2197.  Rezai, N. (2003). Taking the confusion out of confocal microscopy. BioTeach J. 1, 7580.  Rotin, D., Steele-Norwood, D., Grinstein, S. and Tannock, I. (1989). Requirement of the Na+/H+ exchanger for tumor growth. Cancer Res. 49, 205-211. Schreiber, R.C., Boeshore, K.L., Laube, G., Veh, R.W. and Zigmond, R.E. (2004). Polyamines increase in sympathetic neurons and non-neuronal cells after axotomy and enhance neurite outgrowth in nerve growth factor-primed PC 12 cells. Neuroscience. 128, 741-749.  Shaul, P.W. and Anderson, R.G. (1998). Role of plasmalemmal caveolae in signal transduction. Am J Physiol. 275, L843-L851. Review. Small, S.A. and Gandy, S. (2006). Sorting through the cell biology of Alzheimer's disease: intracellular pathways to pathogenesis. Neuron. 52, 15-31. Review. Soleimani, M., Singh, G., Bookstein, C., Rao, M.C., Chang, E.B. and Dominguez, J.H. (1996). Inhibition of glycosylation decreases Na+/H+ exchange activity, blocks NHE-3 transport to the membrane, and increases NHE-3 mRNA expression in LLC-PK1 cells. J Lab Clin Med. 127, 565-573.  Specht, H., Peterziel, H., Bajohrs, M., Gerdes, H.H., Krieglstein, K. and Unsicker, K. (2003). Transforming growth factor beta2 is released from PC 12 cells via the regulated pathway of secretion. Mol Cell Neurosci. 22, 75-86. Stock, C., Gassner, B., Hauck, C.R., Arnold, H., Mally, S., Eble, J.A., Dieterich, P. and Schwab, A. (2005). Migration of human melanoma cells depends on extracellular pH and Na+/H+ exchange. J Physiol. 567, 225-238. Taupenot, L., Harper, K. L. and O'Connor, D. T. (2005). Role of H+-ATPasemediated acidification in sorting and release of the regulated secretory protein chromogranin A: evidence for a vesiculogenic function. J. Biol. Chem. 280, 3885-3897.  Taylor, D.R. and Hooper, N.M. (2006). The prion protein and lipid rafts. Mol Membr Biol. 23, 89-99. Review.  162  Thiele, C. and Huttner, W.B. (1998). Protein and lipid sorting from the trans-Golgi network to secretory granules-recent developments. Semin Cell Dev Biol. 9, 511-516. Review.  Tienari, P.J., De Strooper, B., Ikonen, E., Simons, M., Weidemann, A., Czech, C., Hartmann, T., Ida, N,. Multhaup, G., Masters, C.L., Van Leuven, F., Beyreuther, K. and Dotti, C.G. (1996). The beta-amyloid domain is essential for axonal sorting of amyloid precursor protein. EMBO J. 15, 5218-5229. Tsuganezawa, H., Sato, S., Yamaji, Y., Preisig, P.A., Moe, O.W. and Alpern, R.J. (2002). Role of c-SRC and ERK in acid-induced activation of NHE3. Kidney Int. 62, 4150.  Urushitani, M., Sik, A., Sakurai, T., Nukina, N., Takahashi, R. and Julien, J.P. (2006). Chromogranin-mediated secretion of mutant superoxide dismutase proteins linked to amyotrophic latefal sclerosis. Nat Neurosci. 9, 108-118.  Venema, K., Quintero, F. J., Pardo, J. M. and Donaire, J. P. (2002). The arabidopsis Na+/H+ exchanger AtNHX1 catalyzes low affinity Na+ and K+ transport in reconstituted liposomes. J. Biol. Chem. 277, 2413-2418.  Viala, E. and Pouyssegur, J. (2004). Regulation of tumor cell motility by ERK mitogenactivated protein kinases. Ann N Y Acad Sci. 1030, 208-218. Review. Wells, K.M. and Rao, R. (2001). The yeast Na+/H+ exchanger Nhx 1 is an N-linked glycoprotein. Topological implications. J. Biol. Chem. 276, 3401-3407. Williams, T.M. and Lisanti, M.P. (2005).Caveolin-1 in oncogenic transformation, cancer, and metastasis. Am J Physiol Cell Physiol. 288, C494-0506. Review.  163  Appendix 1 - Materials and methods A1.1 Peptides and antibodies  N-terminally myristoylated peptides encoding SIRK (SIRKALNILGYPDYD), SCAMP2 amino acids 117-134 (QNNWPPLPSWCPVKPCFY), SCAMPI amino acids 117-134 (KNNWPPLPSNFPVGPCFY) and Scrambled (PYWPGFVPNCPFLNPNS) were purchased from the NAPS Peptide Synthesis Unit (Vancouver, BC) and PepMetric Technologies (Vancouver, BC). Mouse monoclonal anti-HA antibody (HA. 11 clone 16B25) was obtained from Covance (Richmond, CA). Rabbit polyclonal anti-myc (A14, sc-789), rabbit polyclonal anti-G(3, rabbit polyclonal anti-p38 and rabbit polyclonal anti-JNK2 antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal anti-HA and anti-actin, and mouse monoclonal anti 13-COP (clone maD) and anti-13—tubulin III antibodies were obtained from Sigma (Oakville, ON, Canada). Rabbit polyclonal antiGFP (ab290) antibody was obtained from Abcam (Cambridge, MA). Rabbit polyclonal antibodies against SCAMPI, -2 and -5, and Cav 1 were purchased from Affinity BioReagents (Golden, CO); mouse monoclonal antibodies against syntaxin 13 and PDI were purchased from StressGen (Victoria, BC, Canada); mouse monoclonal anti-GM130, EEA1, syntaxin 6 and Rab 1 1 antibodies were purchased from BD Biosciences (Mississauga, ON, Canada). Mouse monoclonal anti-synaptophysin (SY38) was from Chemicon (Temecula, CA). Sheep polyclonal anti-TGN 46 antibody was obtained from Serotec (Kidlington, Oxford UK). Mouse monoclonal anti-transferrin receptor antibody was from Zymed Laboratories (South San Francisco, CA). Rabbit polyclonal antiERK1/2 phospho antibody, anti-p38 phospho antibody and anti-JNK phospho antibody  164  were obtained from BioSource (Camarillo, CA). Rabbit polyclonal anti-ERK1/2 was obtained from Cell Signalling (Danvers, MA). HRP-conjugated goat anti-mouse and anti-rabbit IgG were purchased from Jackson Immuno Research Laboratories (West Grove, PA). Alexa 568-conjugated goat anti-mouse IgG, Alexa-488-conjugated goat anti rabbit IgG and Alexa-488-conjugated goat anti sheep antibodies were obtained from Molecular Probes/Invitrogen. The purified mouse monoclonal antibody rho 1D4 against a nine amino acid TETSQVAPA C-terminal epitope (Hodges et al., 1988; MacKenzie and Molday, 1982) was obtained from National Cell Culture Center (Minneapolis, MN). Production of polyclonal antibody against C-terminus of human NHE7 is described below. A1.2 Molecular cloning Yeast two-hybrid screening  Yeast two-hybrid screening was carried out as described previously (Gietz et al., 1997). The PCR fragment corresponding to H615-A725 (C-terminal end) of human NHE7 or G84-Y154 of human SCAMP2 was ligated into the pAS2-1 vector (BD Biosciences, Mississauga, ON, Canada) in-frame with the GAL4 1-147 DNA binding domain (NHE7 [629-725]/pAS 2-1 or S CAMP2 [84-154]/pAS 2-1). Saccharomyces cerevisiae strain AH109 (MATa, trp1-901, leu2-3, 112, ura3-52, his3 -200, gal4A, ga180A, LYS2::GALl uAs -GAL1 TATA MEL1 TATA laCZ) -  -  HISS,  GAL2uAs-GAL2TATA-ADE2, ura3::MEL1  UAS  -  was co-transformed with NHE7[629-725]/pAS2-1 or SCAMP2[84-  154]/pAS2-1, carrying the Trp gene and the GAL4 DNA binding domain and a human brain cDNA library cloned into the pACT2 vector (BD Biosciences), carrying the LEU2 gene and the GAL4-[768-881] activation domain using modified lithium acetate method  165  (Gietz and Schiestl, 1991). Over 2 x 10 6 clones were screened on the synthetic complete (SC) media containing 0.67% bacto-yeast nitrogen base without amino acids (DIFCO laboratories, Detroit, MI), 2% glucose, 1.5% bacto-agar and 0.2% Leu - , Trp- , His Ade drop-out mix and subjected to 13 galactosidase filter assay. Library-derived cDNA clones -  in pAC2-1 coding for putative NHE7 or SCAMP2 interacting proteins were rescued from yeast cells and directly transformed into DH5a cells. The identities of the clones were determined and compared against the National Center for Biotechnology Information (NCBI) database using the BLAST search program.  Mammalian expression contructs Primers were ordered from Sigma-Aldrich or Invitrogen. The PCR primers used in this study are listed in Table 1. Purified PCR products and vectors were digested with appropriate restriction enzymes, ligated and transformed using standard molecular biological technique (Sambrook and Russell, 2001), and the sequence was verified by thermal cycler sequencing (NAPS, UBC). The Cav 1 point mutations were introduced in the myc-tagged Cav 1 by use of quick-change mutagenesis kit (Stratagene) with the primers listed in Tablel. Full length cDNA encoding GP and chromogranin B were purchased from ATCC. Full length cDNA of NHE7, SCAMPI, -2 and -5 were cloned using the methodology as described previously (Numata et al 1998). In brief, first-strand cDNA was synthesized from human brain total RNA by the use of random primers, and subjected to PCR. Specific primers with restriction sites were designed to amplify gene of interest. The PCR fragments were verified by restriction digests and subjected to a second round of PCR to introduce a myc- or an HA-tag at the extreme C-terminus. C-terminally myc-  166  tagged human Cav 1 (Cav 1 inyc ) and HA-tagged mouse Cav3 (Cav3HA) were generous gifts of Dr. Stephen Robbins (University of Calgary).  Table 1 — Mammalian expression constructs — List of primers used for PCR  amplification. Underline — Restriction site Construct NHE71 D4  Primer Designation MN32 Forward MN162 Reverse  NHE7 myc  MN32 Forward J0654  NHE7ACTermHA [1-538]  MN32 Forward MN146 Reverse  NHE7CtermH A [525-725]  MN129 Forward MN25 Reverse  Sequence CCC AAG CTT GGG ACC ATG GAG CCT GGT GAC GC TCT AGA TTA GGC AGG CGC CAC TTG GCT GGT CTC TGT AGC ATT ATC TTC CAG GGG AAA C CCC AAG CTT GGG ACC ATG GAG CCT GGT GAC GGC TCT AGA TTA CAG GTC TTC TTC AGA GAT CAG TTT CTG TTC CCC AGC AU ATC TTC CAG GGG AAA CAC TAG G CCC AAG MT GGG ACC ATG GAG CCT GGT GAC GCT CTA GAT TAG GAT GCA TAG TCC GGG ACG TCA TAG GGA TAG ACG CCA ACT CTG ATG TTA AGC C CCC AAG MT GCC ACC ATG GGA GGA GGC ACG ACA CCC ATG CCC TCT AGA TCA GGA TGC ATA GTC CGG GAC GTC ATA GGG ATA GCC AGC ATT ATC 'FTC CAG GGG AAA CAC 167  Restriction site  Vector  HindIII  pCDNA3/ Neo+  Xb a I  HindIII  pCMV  XbaI  HindIII  pCDNA3/ Neo+  XbaI  HindIII  XbaI  pCMV  Construct SCAMP2 myc  Primer Designation MN52 Forward MN 102 Reverse  SCAMP2HA  MN52 Forward MN213 Reverse  SCAMPI myc  MN217 Forward MN218 Reverse  SCAMP5myc  MN219 Forward MN220 Reverse  SCAMP2m yc 01-130  MN 176 Forward MN102 Reverse  Sequence  Restriction site CCC AAG CTT GCC HindIII ACC ATG TGG GCT TTC GAC ACC AAC CC GCT CTA GAT TAG XbaI TTC AGA TCC TCC TCG CTA ATG AGT TTC TGC TCC CCA TTC CCC TGG AAG GCT CCT TGG CCC AAG CTT GCC HindIII ACC ATG TGG GCT TTC GAC ACC AAC CC GCT CTA GAT TAA XbaI GCG TAG TCA GGC ACG TCG TAG GGG TAA TTC CCC TGG AAG GCT CCT TG GG GGT ACC ACC ATG Kpnl TCG GAT TTC GAC AGT AAC CC CCG CTC GAG TTA XhoI GAG GTC CTC CTC GGA GAT GAG CTT CTG CTC AAT CTG GTT ACC CTT GAA AGC ATT CTG CG GGA TCC ACC ATG BamHI GCA GAG AAA GTG AAC AAC T TC GCT CTA GAG GTC XbaI CTC CTC GGA GAT GAG CTT CTG CTC CAT CTC ATT GGA GTA CGT GTA ATT GG CCC AAG CTT GCC HindlII ACC ATG GGG CCC TGC TTC TAT CAG GAT TTC TCC GCT CTA GAT TAG XbaI TTC AGA TCC TCC TCG CTA ATG AGT TTC TGC TCC CCA TTC CCC TGG AAG GCT CCT TGG 168  Vector pCMV  PCMV  PCMV  PCMV  pCMV  Construct SCAMP2 myc A151-174  Primer Designation MN 201 Forward MN 202 Reverse  SCAMP2 myc 0184-208  MN 203 Forward MN 204 Reverse  SCAMP2myc A216-242  MN 205 Forward MN 206 Reverse  SCAMP2m yc 0261-283  MN 207 Forward MN 208 Reverse  SCAMP2„, y, 0283-329  MN52 Forward MN 209 Reverse  Restriction Vector site GAC TAC CAG CGG N-Terminus pCMV ATA TGC AAG TCG see MN52 GGC AAC AGC TCC AAG GG CCC TTG GAG CTG C-Terminus TTG CCC GAC TTG see MN102 CAT ATC CGC TGG TAG TC CAA CAG CTC CAA N-Terminus pCMV GGG AGT GGA CGC see MN52 CTT TAG GTC CGA CAA CTC TTT C GAA AGA GTT GTC C-Terminus GGA CCT AAA GGC see MN102 GTC CAC TCC CTT GGA GCT GTT G GGT CCG ACA ACT N-Terminus pCMV CTT TCA GCG GGG see MN52 ACA GCG GTT GGA TTG C GCA ATC CAA CCG C-Terminus CTG TCC CCG CTG see MN102 AAA GAG TTG TCG GAC C GTC TAC ACT GGA N-Terminus pCMV TAA TCA TTC CCA see MN52 GCG GGT GCA CTC CCT CTA C GTA GAG GGA GTG C-Terminus CAC CCG CTG GGA see MN102 ATG T'TA TCC AGT GTA GAC CCC AAG CTT GCC HindIII pCMV ACC ATG TGG GCT TTC GAC ACC AAC CC GCT CTA GAG GTC Xbal CTC CTC GGA GAT GAG CTT CTG CTC TCG GTA GAG GGA GTG CAC CC Sequence  169  Construct SCAMP2 GFP-TM2-3  Cavl myc  Cavl. ye 580E  Cav 1 myc P132L  GPHA  Primer Sequence Designation MN 221 GGC ATG GAC GAG Forward CTG TAC AAG GGA GTG GAC TTT GGC CTC TCC MN 222 GGA GAG GCC AAA Reverse GTC CAC TCC CTT GTA CAG CTC GTC CAT GCC MN405 CG GGA TCC GCC ACC Forward ATG TCT GGG GGC AAA TAC GTA G MN406 GGA ATT CAC AGA Reverse TCC TCT TCT GAG ATG AG MN401 GCA GAA CCA GAA Forward GGG ACA CAC GAG TTT GAC GGC ATT TGG AAG GC MN402 GCC TTC CAA ATG Reverse CCG TCA AAC TCG TGT GTC CCT TCT GGT TCT GC MN403 CTG CAC ATC TGG Forward GCA GIT GTA CTC TGC ATT AAG AGC TTC CTG ATT GAG MN404 CTC AAT CAG GAA Reverse GCT CTT AAT GCA GAG TAC AAC TGC CCA GAT GTG CAG MN283 CCC AAG CTT GCC Forward ACC ATG GGG TAC CCC TAC GAC GTG CCT GAC TAC GCT AGT GAG CTG GAG CAA CTG AG MN267 CAT CCA GGA AGC Reverse GGC AAC ACG ACA GG  170  Restriction site  Vector pEGFP  BamHI  pCDNA3/ Neo+  EcoRI  N-Terminus see MN405  pCDNA3/ Neo +  C-Terminus see MN406 N-Terminus see MN405  pCDNA3/ Neo +  C-Terminus see MN406 HinclIII  pCDNA3/ Hyg+  Primer Sequence Designation CCC AAG CTT GCC ChromograninB H A MN474 Forward ACC ATG CAG CCA (CgBHA) ACG CTG CTT CTC GCT CTA GAT TAA MN475 Reverse GCG TAG TCA GGC ACG TCG TAG GGG TAG CCC CM' TGG CTG AAT 'FTC TC Construct  Restriction site HindIII  Vector pCDNA3/ Hyg+  XbaI  Bacterial expression constructs To produce Glutathione S-Transferase (GST) fusion proteins, PCR fragments, using primers listed in Table 2, corresponding to different regions of SCAMP2, NHE7, Cav 1 and GIES were inserted into the pGEX-2T bacterial expression vector (Amersham Pharmacia Biotech) in-frame with the N-terminal GST tag. NHE7[542-725] PCR fragment was also inserted into pMAL vector in-frame with the N-terminal Maltose Binding Protein (MBP) tag.  Table 2 – GST fusion constructs - List of primers used for PCR amplification Underline – Restriction sites Construct NHE7 [542-725] NHE7 [615-725] NHE7 [666-725]  Primer Designation J0578 Forward MN 160 Reverse MN304 Forward MN 160 Reverse J0849 Forward MN 160 Reverse  Restriction site CGC GGA TCC CTT ACC ATC AGA BamHI GTT GGC GTC GAG GG AAT TCA AGC ATT ATC TTC EcoRI CAG GGG CGC GGA TCC CAC AGT GGT CCC BamHI CCA CTA ACC ACC GG AAT TCA AGC ATT ATC TTC EcoRI CAG GGG CGG GAT CCG GGG ACA GCA AGT BamHI AGG TCG GG AAT TCA AGC ATT ATC TTC EcoRI CAG GGG Sequence 5' — 3'  171  Construct NHE7 [542-614] NHE7 [542-665] SCAMP 2 [201-215]  Primer Designation J0578 Forward J0579 Reverse J0578 Forward MN305 Reverse MN228 Forward MN229 Reverse  NHE7 [542-725] A596-604 Cavl [1-80] Cavl [1-108] Cavl [108-178] Cavl [108-169] Cavl [108-154]  MN566 Forward MN567 Reverse MN397 Forward MN400 Reverse MN397 Forward MN399 MN427 Forward MN398 Reverse MN427 Forward MN441 Reverse MN427 Forward MN440 Reverse  Sequence 5' — 3'  Restriction site CGC GGA TCC CU ACC ATC AGA BamHI GTT GGC GTC GAG CCG GAA TTC TCA TGT GAG GAT EcoRI GGG CTT CAG GTA AU GTG CGC GGA TCC CU ACC ATC AGA BamHI GTT GGC GTC GAG GGA AU CAGTAG GTC AAT GTC EcoRI AGG TCG GAT CCT GTT GGT ACC GAC CCA BamHI TCT ATA AGG CCT TTA GGT CCG corresponding ACA ACT CU AAG (annealed with cut MN229 and ligated to pGEX2T) AAT TCT TAA GAG TTG TCG GAC EcoRI CTA AAG GCC TTA TAG ATG GGT corresponding CGG TAC CAA CAG (annealed with cut MN228 and ligated to pGEX2T CGG ACA AAA CAG GAG AGC N-terminus GCA GAT CAC AAT TAC CTG AAG see J0578 CCC GGG CTT CAG GTA ATT GTG ATC C-terminus TGC GCT CTC CTG UT TGT CCG see CGG GAT CCG GGG GCA AAT ACG BamHI TAG ACT CG GGA AU CAA CTG TGT GTC CCT EcoRI TCT GGT TC CGG GAT CCG GGG GCA AAT ACG BamHI TAG ACT CG GGA ATT CAG CCA AAG AGG GCA EcoRI GAC AGC CGG GAT CCG GCA TCC CGA TGG BamHI CAC TCA TC GGA AU CAT ATT TCT TIC TGC EcoRI AAG TTG ATG CG CGG GAT CCG GCA TCC CGA TGG BamHI CAC TCA TC GGA AU CGA TAT CAA TTG CTG EcoRI AAT AU TTC CC CGG GAT CCG GCA TCC CGA TGG BamHI CAC TCA TC GGA AU CGA TAT CAG TCA CAG EcoRI ACG TGG ACG  172  Construct Cavl [108-144] Cavl [108-128] Cavl [128-178] Cavl [144-178] Cavl [108-178] A154-169  GO[WD1-2]  GP [WD3-4]  Gr3[WD4-5]  Gr3[WD 5-6]  GO[WD 6-7]  Primer Designation MN427 Forward MN439 Reverse MN427 Forward MN438 Reverse MN467 Forward MN398 Reverse MN468 Forward MN398 Reverse MN427 Forward  Restriction site CGG GAT CCG GCA TCC CGA TGG BamHI CAC TCA TC GGA ATT CGA TAT CAG ATG CAC EcoRI TGA ATC TCA ATC AG CGG GAT CCG GCA TCC CGA TGG BamHI CAC TCA TC GGA ATT CGA TAT CAC CAG ATG EcoRI TGC AGG AAA GAG AG CGG GAT CCG CAG TTG TAC CAT BamHI GCA TTA AGA GC GGA ATT CAT ATT TCT TTC TGC EcoRI AAG TTG ATG CG CGG GAT CCA GCC GTG TCT ATT BamHI CCA TCT ACG TC GGA ATT CAT ATT TCT TTC TGC EcoRI AAG TTG ATG CG CGG GAT CCG GCA TCC CGA TGG BamHI CAC TCA TC  MN469 Reverse  GGA ATT CAT ATT TCT TTC TGC AAG TTG ATG CGG ACA CAG ACG GTG TGG ACG TAG ATG G CGG GAT CCA GTG AGC TGG AGC AAC TGA G GGA ATT CAG CAG CTC CCG GCT GAC CCT G CGG GAT CCA GGG TCA GCC GGG AGC TGC C GGA ATT CAG TCC CAC AGC TTG ATA GAG G CGG GAT CCA CCA CCT GTG CCC TG GGG AC GGA ATT CAG TCG AAG AGG CGG CAC GTG G CGG GAT CCG CCT CTA TCA AGC TGT GGG AC GGA ATT CAA TCC CAG ATG 'FIG CAG TTG AAG TC CGG GAT CCG CCA CGT GCC GCC TCT TCG AC GGA ATT CAG TTC CAG ATC TTG AGG AAG G  MN377 Forward MN380 Reverse MN381 Forward MN382 Reverse MN383 Forward MN384 Reverse MN385 Forward MN386 Reverse MN387 Forward MN388 Reverse  Sequence 5' — 3'  173  EcoRI  BamHI EcoRI  BamHI EcoRI  BamHI EcoRI BamHI EcoRI BamHI EcoRI  Construct SCAMP2 [1-154] SCAMP2 [1-88] SCAMP2 [75-154] SCAMP2 [45-88] SCAMP2 [45-154] SCAMP2 [75-117] SCAMP2 [75-134]  Primer Designation MN 122 Forward MN127 Reverse MN122 Forward MN 126 Reverse MN123 Forward MN 127 Reverse Mn232 Forward MN 126 Reverse MN232 Forward MN 127 Reverse MN123 Forward MN324 Reverse MN123 Forward MN326 Reverse  Sequence 5' — 3'  Restriction site GA AGA TCT ATG TCG GCT TTC BgM GAC ACC AAC CC TCC CCC GGG GTA GAG CAT CTT Smal GCA TAT CCG GA AGA TCT ATG TCG GCT TTC Bg111 GAC ACC AAC CC TCC CCC GGG CTG CCG GAG CAG Smal GCC TGC CTG GA AGA TCT CAG GCC GTG GTG BgM TCT GCA GCC TCC CCC GGG GTA GAG CAT CTT Smal GCA TAT CCG CGG GAT CCG CAG CGA CAA CAG BamHI TTC CTG TC TCC CCC GGG CTG CCG GAG CAG Smal GCC TGC CTG CGG GAT CCG CAG CGA CAA CAG BamHI TTC CTG TC TCC CCC GGG GTA GAG CAT CTT Smal GCA TAT CCG GA AGA TCT CAG GCC GTG GTG Bg111 TCT GCA GCC GGA ATT CCT GTC TCA CAT GCA EcoRI AGT TGG C GA AGA TCT CAG GCC GTG GTG Bgal TCT GCA GCC GGA ATT CAT AGA AGC AGG GCT EcoRI TCA CAG G  Plasmid-based siRNA knock down contructs Complementary synthetic oligonucleotides (Listed in Table 3) were annealed and ligated into the IMGENEX siRNA expression vector IMG-800 (San Diego, CA) or the siRNA expression vector GenScript-pRNAT/U6 (Piscataway, NJ). An internal EcoRV restriction site (shown in italic bold) was designed into the oligonucleotides for restriction test digest. NHE7 or SCAMP sequences were underlined. NHE7 siRNA constructs were transfected into PC12/CgB HA by calcium phosphate transfection to generate stable cell  174  lines with NHE7 suppression. SCAMP siRNA constructs were used for electroporation into MCF-7 to analyze the role of SCAMP in ERK1/2 phosphorylation.  Table 3 — NHE7 and SCAMP siRNA constructs Bold face type — restriction site; Underline — target sequence Construct NHE7A  Primer 5' Xhol 5' XbaI  NHE7B  5' Xhol 5' Xbal  NHE7C  5' Xhol 5' Xbal  Sequence 5'-TCG ACG TCA CTC AGC TGT ACT CAG GAG GAA TTC GTC CTG AGT ACA GCT GAG TGA CU TTT-3' 5'-CTA GAA AAA GTC ACT CAG CTG TAC TCA GGA CGA ATT CCT CCT GAG TAC AGC TGA GTG ACG-3' 5'-TCG ACT GAC ATG CTG CGG AAG GTA ACG GAA TTC GGT TAC CTT CCG CAG CAT GTC AU 'IT1'-3' 5'-CTA GAA AAA TGA CAT GCT GCG GAA GGT AAC CGA ATT CCG TTA CCT TCC GCA GCA TGT CAG-3' 5'-TCG ACG GTG ACC TCA CCT TGA CCT ATG GAA TTC GAT AGG TCA AGG TGA GGT CAC CTT UT-3' 5'-CTA GAA AAA GGT GAC CTC ACC TTG ACC TAT CGA ATT CCA TAG GTC AAG GTG AGG TCA CCG-3'  SCAMP 5'BamHI 5'-GATCCCGTAACGACCATTAACGTGACTGTTGATAT SCRAMBLED CCGCAGTCACGTTAATGGTCGTTATTTTTTCCAAA-3' 5'HindIII 5' -AGCTTTGGAAAAAATAACGACCATTAACGTGACT GCGGATATCAACAGTCACGTTAATGGTCGTTACGG-3' SCAMP2 5'BamHI 5'-GATCCCGCAGGAACTGTTGTCGCTGCATTTGATAT RNAi CCGATGCAGCGACAACAGTTCCTGTITI'TTCCAAA-3' 5'HindIII  SCAMPI RNAi  5'-AGCTTTTGGAAAAAACAGGAACTGTTGTCGCTGCA  TCGGATATCAAATGCAGCGACAACAGTTCCTGCGG-3' 5 'BamHI  5'-GATCCCGTATAAGCTGGATGTTCCTCTGTTGGTTTG  ATATCCGACCAACAGAGGAACATCCAGCTTATA'11111 TCCAAA-3' 5 'HindIII 5'-AGCTTTTGGAAAAAATATAAGCTGGATGTTCCTCTG TTGGTCGGATATCAAACCAACAGAGGAACATCCAGCTTA TACGG-3'  A1.3 Expression and purification of GST fusion proteins pGEX-2T constructs were transformed into BL21 Escherichia coli cells or mutants strains C41 or C43 derived from BL21 which are more tolerant to hydrophobic aggregation of proteins (Miroux and Walker 1996). Protein expression was induced by incubating transformed E. coli cells with 0.2 mM isopropyl-1-thio-0-D-galactopyranoside  175  (IPTG) at 30°C for 3 hours. E. coli cells were lysed in lysis buffer containing 1% Triton X-100 and protease inhibitor cocktail (Roche Diagnostics, Laval, Canada) in PBS on ice for 30 minutes, and sonicated four times for 30 seconds with 1 minute intervals. The cell debris was removed by centrifugation for 20 minutes at 16,000 g at 4°C and GST fusion proteins were purified by incubation with reduced form glutathione sepharose beads (Amersham Pharmacia Biotech) at 4°C. Glutathione sepharose beads were extensively washed with PBS supplemented with protease inhibitor cocktail. Immobilized GSTfusion protein was subjected to GST pull down assay as described below or eluted from sepharose by incubation at room temperature with 10 mM glutathione in 50 mM TrisHC1 pH 8.0 for 10 minutes. For some experiments, eluted GST-fusion protein was used to immunize rabbits (see below A 1-6). A1.4 Glutathione S-Transferase (GST) pull-down 35  S-labeled protein was produced by in vitro transcription and translation using the  TnT-coupled reticulocyte lysate system (Promega, Madison, WI) according to the manufacturer's instructions. 35 S-labeled in vitro translated protein was centrifuged at 100,000 g for 30 minutes to eliminate insoluble materials. The supernatant (2-5 [iL) was resuspended to 300 'IL with PBS supplemented with protease inhibitor cocktail and incubated with 2 vg GST fusion protein immobilized to the reduced form glutathione sepharose beads (described above) for 90 minutes at room temperature with agitation. After 5 x 1 mL washes with 0.5% NP-40 in PBS supplemented with protease inhibitor cocktail (washing buffer) followed by 2 times incubation of GST-sepharose with washing buffer for 10 minutes at 4 °C with rotation, 35 S-labeled in vitro translated protein bound to the GST fusion protein was eluted with SDS sample buffer, resolved in SDS-PAGE and  176  blotted onto PVDF membrane followed by phosphorimaging detection. In some experiments, cell lysate was prepared by lysing CHO cells transiently transfected with myc-tagged SCAMPs or untransfected CHO cells for Cav 1 GST pull down assay. This lysate was incubated with GST fusion proteins and the bound myc-tagged SCAMPs or Cav 1 was detected on western blots with an anti-myc antibody or anti-Cav 1 antibody. The 35 S-labeled products were SCAMP2 myc , NHE7HA[525-725] an-d -(3HA. A1.5 Preparation of immunoaffinity column  Mouse monoclonal anti-rho 1D4 antibody was coupled to CNBr-activated Sepharose 2B as previously described (Oprian et al., 1987). Sixteen milligrams of purified monoclonal anti rho 1D4 antibody was dialyzed in 1 L 20 mM Borate pH 8.4 at 4 °C (dialysis buffer was replenished with fresh solution 3 times) for over 16 hours. Prior to antibody conjugation, 8 mL of pre-washed sepharose 2B (Amersham Pharmacia Biotech) was activated with 0.15 g CNBr for 30 minutes while maintaining the pH at 1011 with 0.2 N NaOH. Activated sepharose was then washed with cold 20 mM Borate pH 8.4 at least 4 times to remove unreacted CNBr. Dialyzed purified antibody was made up with 20 mM Borate pH 8.4 to 8 mL and incubated with CNBr-activated sepharose for 4 hours at 4 °C with gentle rotation. Rho 1D4 conjugated sepharose was centrifuged and further antibody/beads coupling was quenched with TBS buffer (20 mM Tris-HC1 pH 8.0, 0.15M NaC1) supplemented with 50 mM glycine. Quenching was repeated twice more. Rho 1D4 conjugated sepharose was stored in 20 mM TBS pH 8.0 (without glycine) at 1:1 bed volume:buffer volume ration supplemented with 0.01% NaN 3 .  177  A1.6 Polyclonal antibody production in rabbits  GST fusion protein of C-terminus of NHE7[542-725] was expressed in BL21 cells and purified as described above. Purified GST-NHE7[542-725] was quantitated on SDS-PAGE gel using BSA as standard control. New Zealand white female rabbit were used for rabbit polyclonal antibody production. Prior to immunization, a 3 mL bleed was taken as pre-immunized control serum. The half portion of recombinant protein (0.5 mg) was added with SDS to a final concentration of 0.1% and denatured by boiling, mixed with non-denatured recombinant protein (0.5 mg), and then mixed 1:1 volume ratio with Freud's complete adjuvant (Sigma) for the initial immunization or Freud's incomplete adjuvant for the subsequent immunizations. The mixture of denatured and non-denatured recombinant protein was used with a hope to increase the antigenicity. Immunizations were performed every 6 weeks. Test bleed was conducted 7 days after each injection and the titer of the antiserum was determined by western blot. After the forth immunization when the titer of the serum reached satisfactory level as judged by western blot (normally after the forth immunization), rabbits were sacrificed and the whole bleed was collected. Blood was allowed to clot for 60 minutes at 37 °C and placed at 4°C overnight to allow the clot to contract. The sample was then centrifuged at 8,000 g for 20 to 30 minutes at 4°C to remove any insoluble material. Isolated serum (supernatant) was stored at -80°C until further use. A1.7 Affinity purification of polyclonal antibody  One milligram of purified MBP fusion NHE7[542-725] was subjected to SDSPAGE and then immobilized to nitrocellulose membrane. MBP-NHE7[542-725] band was then stained with Ponceau S (0.2% w/v Ponceau S and 1% v/v aldehyde-free acedic  178  acid) for 10 minutes and washed 3 times with distilled water. The stained band was excised, destained with TBS buffer (500 mM NaC1, 20 mM Tris-HC1 pH 7.4 and 0.05% v/v Tween-20) and rinsed with distilled water. The excised band was cut into smaller pieces, incubated with acidic glycine buffer (100 mM glycine pH 2.5) to remove weakly attached proteins, blocked with 3% BSA in TBS buffer for 1 hour at room temperature, and incubated with 10 mL of diluted serum (2 mL serum plus 8 mL TBS buffer) overnight at 4°C. Membranes were then washed 3 times with TBS buffer and bound rabbit polyclonal anti-NHE7 antibody was eluted with 1 mL acidic glycine buffer for 10 minutes at room temperature and quickly neutralized with 1 M Tris buffer pH 8.0. The elution step was repeated twice and the recovered antibody was collected separately, and stored at -80 °C in small aliquots. A1.8 Preabsorption experiments  The immunoaffinity purified anti-NHE7 antibody was preabsorbed with recombinant NHE7[542-725] GST fusion protein immobilized to glutathione sepharose beads for 2 hours at 4 °C and used as a negative control for immunoblotting or immunofluorescence microscopy. A1.9 Cell culture  CHO cells, 293-T cells and PC12 cells were maintained in oc-MEM with 10% FBS, DMEM with 10% FBS and RPMI with 5% FBS, respectively. MCF-7 cells were cultured in DMEM/F12 containing 5% FBS and 5 gg/mL of insulin. All cell lines were grown at 37 °C with 5% CO2. Stable cells were maintained in the presence of either 200400 µg/mL G418 and/or 200 µg/mL hygromycin. Media and media supplements were purchased from Invitrogen.  179  A1.10 Transfection and electroporation  Calcium phosphate transfection Modified calcium phosphate transfection (Chen and Okayama, 1987) was used to establish stable cell lines. In brief, 2 x 10 5 cells were plated to a 60 mm culture dish the day before transfection. Twelve micrograms of plasmid DNA was diluted in 124 pL water. Forty-one microliters of 1 M CaC12 and 165 of BBS buffer (50 mM BES, 280 mM NaC1 and 1.4 mM Na2HPO4 pH 6.95) were added to diluted DNA. Mixture was then incubated at room temperature for 20 minutes. After 20 minutes, the mixture was added onto the cells and incubated at 35 ° C with 3% CO2. On the following day, cells were subcloned onto a 100 mm culture dish. After 48 hours post transfection, cells were selected with with 200-400 vg/mL G418 (Invitrogen) or 200 ttg/mL hygromycin (Invitrogen). Single colonies were isolated, amplified and screened by western blotting or immunofluorescence microscopy. Lifectamine 2000 transfection Transfection with Lipofectamine 2000 (Invitrogen) was followed as instructed by manufacturer. In brief, 2.5 to 10 x 10 5 cells were seeded to 35 mm culture dish the day prior to transfection. Four micrograms of plasmid DNA was diluted in 250 p.L serum free media while 10 pL of Lipofectamine 2000 reagent was incubated in 250 pL serum free media for five minutes. Both diluted DNA and Lipofectamine 2000 were combined and incubated at room temperature for 20 minutes. After 20 minutes, DNA/Lipofectamine 2000 mix was carefully added to cells. Experiments were performed 24 to 48 hours post transfection. Electroporation  180  Electroporation was followed as instructed by Bio-Rad with modification. MCF-7 or MCF-7 cells stably expressing 1D4-tagged NHE7 were electroporated with cDNA or siRNA constructs. Cells were trypsinized, washed once with DMEM/F12 media containing 5% FBS and then twice with ice-cold HEPES buffered saline (HeBS, Gibco/BRL).^2.5 x 10 6 cells were resuspended in 400 p.L of ice-cold HeBS supplemented with 6 mM glucose and incubated with 20 jig of cDNA or siRNA constructs on ice for 10 minutes. Cells were then electroporated by Gene Pulser Xcell (BioRad) (220V/950 µF, 4 mm cuvette). Cells were subjected to the second round of electroporation after 24 hours of the first electroporation using the same protocol. Experiments were conducted after 48 to 72 hours of the initial electroporation. A1.11 Co immunoprecipitation -  Cells were lysed in PBS supplemented with indicated detergent and protease inhibitor cocktail (Roche) on ice for 30 minutes and lysates were cleared for 20 minutes at 16,000 g at 4°C. Lysate was quantitated by Bio-Rad Protein Assay and equal amounts of total protein (indicated in Figure Legends) was incubated with antibody at 4°C for 2 hours, followed by overnight incubation with 20 [1,1 of bed volume of protein G or protein A sepharose beads (Amersham Pharmacia Biotech). Sepharose beads were extensively washed with lysis buffer and protein was eluted with SDS-Sample buffer for 30 minutes at 50 ° C. For negative control, lysate was incubated with pre-immune serum. To detect endogenous SCAMP proteins bound to NHE7, a membrane fraction was isolated as described in Section A1.14 and used for co-immunoprecipitation experiments with 1D4conjugated sepharose for 45 minutes at 4 °C.  181  A1.12 Organellar immunoprecipitation  To confirm that NHE7 and chromogranin B (CgB) are present in the same intracellular compartments, organellar immunoprecipitation was performed. The rational of this experiment was to isolate intact organelles by immunoaffinity purification using cytosolically exposed tag at the C-telininus of NHE7 after mild disruption of the plasma membrane. PC12 cells stably expressing HA-tagged chromogranin B (CgBHA) and 1D4tagged NHE7 (NHE7 1 4 ) (PC12/CgBH A + NHE71D4) or PC12 stably expressing HAtagged chromogranin B (PC12/CgBHA) were harvested and resuspended with sonication buffer (250 mM sucrose, 1 mM EDTA and 20 mM Tris-HC1 pH 7.4) supplemented with protease inhibitor cocktail. Homogenate was passed through a 26.5 G needle 10 times to disrupt the cells while maintaining the integrity of the intracellular organelles. Cell debris was removed by low speed centrifugation at 800 g for 10 minutes at 4°C, and the supernatant was incubated with 30 1.11_, of anti-1D4 antibody conjugated sepharose with rotation for 1 hour at 4 °C to immunoprecipitate vesicles that are NHE71D4 positive. Immobilized organelles were washed 7 times with PBS supplemented with protease inhibitor cocktail. Contents inside NHE71D4 positive vesicles were released by solubilizing the membrane with 20 p.L REPA buffer (1% NP-40 and 0.5% deocycholic acid in PBS supplemented with protease inhibitor cocktail) and 10 p.L was resolved by SDS PAGE and immunoblotted for CgBHA with mouse monoclonal anti-HA antibody. A1.13 Immunofluorescence microscopy Cells grown on glass coverslips were fixed with 2% paraformaldehyde in PBS for 20 minutes. Samples were permeabilized with 0.1% Triton X-100 in PBS (PBS-TX) for 15 minutes, incubated with 2% normal goat serum in PBS for blocking, followed by  182  primary antibody incubation for 1 hour. After four washes with PBS-TX, cells were incubated with 2 µg/mL Alexa 568-conjugated anti-mouse IgG and Alexa 488-conjugated anti-rabbit IgG (Invitrogen) or Alexa 488-conjugated donkey anti-sheep IgG for 45 minutes. All the antibodies were diluted in PBS. After extensive washes with PBS-TX, the coverslips were briefly rinsed with distilled water, mounted on glass slides and analyzed by confocal microscopy (Biorad MRC-600 confocal microscope). For confocal microscopy, images were collected sequentially with 60x oil immersion objective lens using either the Ar laser (488 nm) or Kr laser (568 nm) to excite the conjugated Alexa dye. A maximum Z-projection image was obtained upon inspection of colocalization in more than 10 planes. To evaluate intracellular localization of endogenous SCAMPI, -2 and -5 proteins, cells were fixed with methanol/acetone 1:1 mixture at —20°C for 20 minutes and the subsequent washes after antibody incubation were carried with PBS instead of PBS-TX. A1.14 Isolation of membrane fractions  In order to enrich membrane fractions, cells were resuspended in 1 mL of sonication buffer supplemented with protease inhibitor cocktail, and homogenized by going through a 26.5 G needle 10 times on ice. Unbroken cells were eliminated by low speed centrifugation at 800 g for 10 minutes at 4 °C. Supernatant was collected and transferred onto polycarbonate 16 x 76 mm tubes (Beckman) and subjected to centrifugation for 33 minutes at 38,000 rpm (99,000 g) at 4 °C in a Ti 70.1 rotor (Beckman). The pellet representing the membrane fraction was solubilized with PBS containing 0.5% NP-40 supplemented with protease inhibitor cocktail. Debris was cleared by centrifugation at 16,000 g for 10 minutes at 4 ° C. Supernatant was quantified  183  by Bio-Rad Protein Assay and subjected to co-immunoprecipitation analysis or subjected to SDS-PAGE and immunoblotting to analyze NHE7 knock down expression. A1.15 Sucrose equilibrium density centrifugation  Sucrose equilibrium density centrifugation was used to separate and resolve intact intracellular compartments. Sucrose equilibrium density centrifugation was conducted as described previously (Xu et al., 1997; Yan et al., 2001b) with minor modifications. Cell homogenates were prepared by mild disruption through a 26.5-gauge needle in 250 mM sucrose, 10 mM HEPES-NaOH pH 7.5, 1 mM EDTA, with protease inhibitor cocktail (Roche). After centrifugation at 800 g for 10 minutes, supernatant was applied to the top of a discontinuous sucrose gradient comprising 570 [iL of 2 M; 960 pL of 1.3 M; 960 [AL of 1.16 M; 770111_, of 0.8 M; 770 !IL of 0.5 M; and 3804 of 0.25 M sucrose prepared in 10 mM Tris-HC1 pH 7.4 in ultra clear 13 x 51 mm tubes (Beckman). Samples were centrifuged at 33,000 rpm (100,000 g) for 2.5 hours in an SW50.1 rotor (Beckman) at 4°C. Fifteen 325 [AL fractions were collected from the top of the gradient. To analyze the fractionation of certain proteins, equal volume from each fraction was resolved by SDS-PAGE and immunoblotted for the protein of interest. A1.16 Flotation assay  Caveolae/lipid raft-association was examined by sucrose flotation assays (Li et al 2003) with some modifications. Cells were suspended in THE solution (10 mM TrisHC1, 150 mM NaC1 and 1 mM EDTA) with protease inhibitor cocktail and homogenized by shearing through a 26.5 gauge needle 14 times on ice. The homogenate was spun at 800 g for 10 minutes and the supernatant was collected. The supernatant was adjusted to 1% Brij 58 in 1 x MBS (25 mM MES, 150 mM NaCl, pH 6.5) and incubated on ice for  184  30 minutes, followed by centrifugation at 16,000 g for 10 minutes to remove debris. The sample was then adjusted to 40% sucrose/1 x MBS in 1.6 mL total volume, transferred to the bottom of a 13 x 51 mm centrifuge tube (Beckman) and then overlayed with 2.4 mL 30% and then 0.8 mL 5% sucrose in MBS. The gradient was then centrifuged at 42,000 rpm (170,000 g) in a SW50.1 rotor (Beckman) for 17 hours at 4 °C followed by fractionation (from the top of the gradient) into twelve 400 p.L samples. Equal volume (4 p,L) of each fraction was resolved in SDS-PAGE, transferred to a PVDF membrane and analyzed in western blot. To disrupt caveolae/lipid raft, saponin was added to a final concentration of 0.5% to the homogenate and incubated for 30 minutes on ice, whereas the control homogenate was incubated on ice in the absence of saponin. Alternatively, cells were treated with 20 mM methyl-P-cyclodextrin (M(3CD) in serum-free a-MEM or DMEM/F12 media for 30 minutes at 37 °C prior to sonication as described previously (fiangumaran and Hoessli 1998, Francis et al 1999 and Radeva et al 2005). To inhibit Nglycosylation at the ER, cells were grown in complete growth media supplemented with 5 mg/mL tunicamycin. A1.17 Cell surface biotinylation and internalization  To evaluate NHE7 internalization mechanisms, NHE71D4/MCF-7 cells were electroporated with Cavl constructs or treated with reagents that block caveolin-mediated or clathrin-mediated endocytosis. All the biotinylation procedures were conducted at 4 °C unless otherwise indicated. After a quick rinse with ice-chilled PBS containing 1 mM MgC12 and 0.1 mM CaC12 (pH 8.0) (PBSCM), cells were incubated with 0.5 .tg/mL EZ-Link NHS-SS-biotin (Pierce) in PBSCM for 30 minutes, rinsed with PBSCM once, and free biotinylating reagent was quenched with 20 mM glycine/PBSCM  185  twice for 7 minutes each. After another quick rinse with PBSCM, cells were either subjected to 15 minutes post-incubation in pre-warmed DMEM/F12 culture media at 37 °C (+ internalization) or proceeded to the next step immediately (— internalization). Following the post-incubation, cells were quickly cooled to 4 °C by pre-chilled PBSCM to prevent endocytosis. One dish of cells was treated with cleavage buffer (50 mM glutathione, 90 mM NaC1, 1 mM MgC12, 0.1 mM CaC12, 60 mM NaOH and 0.2% BSA, pH 8.6) for 20 minutes twice. This procedure eliminates the biotinylated protein retaining on the cell surface, while internalized biotinylated proteins are protected from the cleavage. Another dish of cells was left untreated with cleavage buffer and directly processed for extraction to define total biotinylated proteins. Cells were solubilized in RIPA buffer plus protease inhibitor cocktail, centrifuged at 16,000 g for 15 minutes and the supernatant was incubated with streptavidin—agarose (Sigma) overnight to isolate biotinylated proteins. After extensive washing with RIPA buffer, samples were eluted with SDS-sample buffer for 30 minutes at 50 °C and analyzed in SDS-PAGE followed by western blot. Five percent volume of the lysate from each sample was analyzed in SDSPAGE and western blot as a control. To evaluate the involvement of caveolins in NHE7 surface targeting and internalization, cells were electroporated with myc-tagged Cav 1 constructs 18 to 24 hours prior to biotinylation experiments. To disperse clathrin lattice underlying coated pits, cells were subjected to hypertonic shock by incubation with serum-free media containing 0.45 M sucrose for 15 minutes at 37 °C (Hansen et al 1993). For cytosolic acidification, cells were treated with serum-free DMEM/F12 media containing 10 mM acetic acid and 20 mM HEPES pH 5.0 as described previously (Heuser and Anderson 1989). To disrupt caveolae/lipid rafts, cells were treated with  186  serum-free media containing 20 mM methyl-P-cyclodextrin (M(3CD) for 30 minutes at 37 °C prior to cell-surface biotinylation. A1.18 Membrane depolarization induced secretion assay  PC12/CgB H A generated stable cell lines were plated at 1.0 x 10 5 cells/well on a 6 well plate. Seeded cells were then treated with 10 mM sodium butyrate overnight prior to secretion assay as described previously (Glombik et al., 1999). Secretion assay consisted of membrane depolarization for 10 minutes with 1 mL serum free media supplemented with 55 mM KCl and 2 mM CaC12 (Kromer et al., 1998). Media was collected and then subjected to TCA precipitation. Precipitated protein was resolved in SDS-PAGE and immunoblotted for secreted CgBH A by HA antibody. Experiments were repeated at least 3 times and the intensity of each band was quantitated by densitometric analysis. A1.19 86Rb + uptake assay  Cells (3.0 x 10 5/well) were seeded to 24 well plates and used for the 86Rb + uptake assay on the following day when cells reach approximately 100% confluency. Attached cells were washed twice with K + rich buffer consisting of 140 mM KC1, 2 mM CaC12, 2 mM EGTA, 1 mM MgC12 and 20 mM Hepes pH 7.5. The plasma membrane was selectively permeabilized under mild condition with K + rich buffer supplemented with 50 µg/mL saponin for 4.5 minutes at room temperature. Under these conditions, plasma membranes were selectively permeabilized and the organellar membranes were maintained intact (Numata and Orlowski 2001). Cells were gently washed with choline chloride buffer (140 mM choline chloride, 2 mM CaC12, 1 mM EGTA, 1 mM MgC12 and 10 mM Hepes pH 8.0) twice followed by treatment of cells with choline chloride buffer supplemented with 30 mM NH 4 C1 for 5 minutes. NH4C1 was quickly washed out with  187  choline chloride buffer which acidifies intracellular organelles and provide a driving gradient for 86 Rb + uptake. Cells were immediately treated with choline chloride solution supplemented with 2 mM Mg 2± ATP, 5 p,Ci/mL 86 RbC1 and methanol (-quinine) or 1 mM quinine dissolved in methanol (+quinine) for 5 minutes at room temperature.  86Rb+  uptake was quenched by cold stop solution consisting of 140 mM NaCI, 2 mM CaC12, 1 mM MgC12 and 10 mM Hepes pH 5.5 and residual 86RbC1 was washed 3 times with cold stop solution. Cells were then solubilized with 250 of 0.5 M NaOH and neutralized with 250 pit 0.5 M HCI. Radioactive rubidium fluxed in organelles was detected by scintillation counter. Values are expressed as quinine-inhibitable influx. All the experiments were conducted 12-16 times and the results were expressed as a mean +/standard deviations. A1.20 ERK1/2 activity assay  MCF-7 cells (1.2 x 10 5 ) were seeded in 35 mm dishes, serum-starved for 24 hours, and treated with 10 11M myristoylated SIRK peptide (myrSIRK) to stimulate ERK1/2 phosphorylation. To investigate the effect of SCAMPs in ERK1/2 phosphorylation MCF-7 cells were simultaneously treated with 10 [LK myristoylated SCAMP peptides and 10 I.LM myristoylated SIRK peptide. MCF-7 cells transiently transfected with SCAMP siRNA constructs were used for some experiments. After peptide-treatment, cells were lysed with ice cold RIPA buffer supplemented with protease inhibitors and 2 jiM sodium orthovanadate. Lysed cells were then subjected to 3 x 2 seconds sonication pulses followed by 30 minutes incubation on ice. Cell debris was cleared by centrifugation at 16,000 g for 10 minutes at 4 °C. Protein concentration was quantitated with Bio-Rad Protein Assay and 2.5 ps of total protein was separated by  188  SDS-PAGE followed by immunoblotting to detect phosphorylated ERK1/2. Experiments were repeated at least 3 times and intensities of the bands were assessed by densitometry analysis.  189  Appendix 2 — Supplementary Figures Cav1 WT^Cav1 S80E^Cav1 P132L IP^IP^IP Lys Con myc Lys Con myc Lys Con myc NHE7 um  ego  is^11/  Suppl. Fig. 1-1. Wild type and dominant-negative Cav 1 associate with NHE7. Myctagged Cav 1 (WT, S80E or P132L) and 1D4-tagged NHE7 were expressed in CHO cells by transient co-transfection using Lipofectamine 2000 and cell lysates were isolated. The same amount of lysate (400 pg) was immunoprecipitated with pre-immune serum (Con) or rabbit polyclonal anti-myc antibody, and bound NHE7 was analyzed by SDS-PAGE and western blot with anti-1D4 antibody (top panel). Twenty micrograms of lysate was resolved as loading control (Lys). Blots shown are representative of 3 independent experiments.  190  Cav-1  myc  S80E  ^  PDI  ^  Merge  Suppl. Fig. 1-2. Cav 1 S80E shows limited localization at the ER. NHE7 1D4/MCF-7 cells expressing myc-tagged Cav 1S80E was subjected to double-labeled immunofluorescence confocal microscopy. Cavl, nyc S80E (green) and PDI (red) were visualized by anti-myc antibody and anti-PDI antibody respectively. Bar, 10 jam.  191  A. Caveolin 1 Caveolin 3  Caveolin 1 Caveolin 3  Caveolin 1 Caveolin 3  1^STGKY^EGHLYTVPIREQGNIYKPNNKAMAD 1^EEH ^  KEIDLVNRDPF. •KEIDLVNRDPI  SEK EAQ11  IE  ,  YRLLS• YRLLS  61^DFEDVIAE 34^ DFEDVIAEr  121 I^HIWAVVPCIKS LIEIQCI 94^•HIWAVVPCIKS LIEIQCIS^  1  m is  Q  NHE7 binding domain  B. IP  IP  Lys Con Cav3 HA^Lys Con NHE7myc NHE7„, y,^  Cav3HA  ^  a  Suppl. Fig. 1-3. Cav3 also binds to NHE7. (A) The amino acid sequences of human Cav 1 and Cav3 are aligned using the Clustal W program. The identical residues are highlighted in black and similar amino acids are highlighted in gray. The NHE7 binding domain is underlined. (B) CHO cells were transiently co-transfected with myc-tagged NHE7 and HA-tagged Cav3. Cell lysate was incubated with pre-immune serum (IP Con) or anti-HA antibody (IP Cav3H A), and bound NHE7 was detected in western blot (left panel). In a reciprocal experiment, the cell lysate was incubated with pre-immune serum (IP Con) or anti-myc antibody (NHEE7 n, y,) and bound Cav3 was analyzed in SDS-PAGE and western blot (right panel). Five percent volume of the total lysate was used as a control in both experiments (Lys). Blots shown are representative of 3 independent experiments.  192  PC12^NHE7 1 D4 /PC12 Lys^IP Lys IP IP NHELID4  ^  410.s^WB: aG13  Suppl. Fig. 1-4. NHE7 associates with G. PC12 and NHE71D4/PC12 lysates were prepared and incubated with 1D4-conjugated sepharose. Interacting molecules were eluted, separated by SDS-PAGE and immunoblotted using anti-GP antibody. Blot shown are representative of 3 independent experiments.  193  A.  4^95  kD  * 80 kD NHE7 1 D4  B.  Bottom  Top^  1 2 3 4 5 6 7 8 9 10 11 12 Lys  ^  0. 1111410  a*  60 001 1111 4►  *  Tunicamycin ing  NHE7 1 D4  Sucrose  5%  30% 40%  Suppl. Fig. 1-5. NHE7 is N-glycosylated. (A) Cell lysate isolated from CHO cells transiently transfected with 1D4-tagged NHE7 was incubated with or without PNGaseF and analyzed by western blotting. Two bands (-95 kDa band labeled with an arrow and -80 kDa band labeled with an asterisk) were observed in the control sample (Con), whereas PNGaseF treated sample showed a predominant -80 kDa single band. (B) During transfection, cells were treated with complete growth media plus (bottom panel) or minus (top panel) 5 mg/ml tunicamycin. Cell lysates were prepared with I% Brij 58 and analysed by flotation assay. Blots shown are representative of 3 independent experiments. [Part A was contributed by Warren P. Williams]  194  A. PC12  NHE71D4/PC12  Anti-NHE7  Pre-Absorbed Anti-NHE7  B.  Anti-NHE7  Pre-Absorbed Anti-NHE7  Suppl. Fig. 1-6. Characterization of anti-NHE7 antibody. (A) Affinity-purified antiNHE7 antibody was raised by using GST-fusion protein of the cytosolic C-terminal extension of human NHE7 and its cross-species reactivity was tested. PC12 and NHE7 1D4/PC12 lysates were subjected to SDS-PAGE and immunoblotted with purified anti-human NHE7 antibody (left). Pre-absorbed anti-NHE7 antibody was used as control (right). Blots shown are representative of 3 independent experiments. (B) PC12 cells were fixed onto coverslips and probed with anti-human NHE7 or with deactivated antihuman NHE7 antibodies. Cells were imaged by fluorescence microscope.  195  •  A.  i ^t  417  4%  4, -3^ 3 st- ^45^ N N Nci NCC  cr^It^x^Ic^x^x ev^ '2741 4 illr PC12^.2^CP C P C P C. P CP CP  1 1  B.  1 1  -  Anti-NHE7  55  Anti-pActin  C.  0 (5^ch^  (1,^\  `e-^ '''^:i''^0^O.^''' CP^ ' \'''^ ' \''^,^s z,c,.) cA^,eAC-1 'Z'^`e^'s^'q) <Z?^'R)^ <Z?^CP^'Cr cP^cP^cP^cP ,  PC12 Cell Lines  D. 2W •  CO  150  I  c'D 1W  ,  00  ._ 71  I  50  rX  )  0  ;‘,-^,^_ti` )7.  )e, \''^  - z '''' -g? ''' c.,s ^C.,s9 , ,  ,  PC12 Cell Lines  196  \c'  Suppl. Fig. 1-7. Characterization of PC12 cells stably co-expressing CgBHA and NHE71D4 or NHE7 siRNA. (A) PC12 cells were transfected with CgBH A in pCDNA3/Hyg + and selected with hygromycin. A clone was selected and tested for CgBHA expression by immunofluorescence microscopy with anti-HA antibody. (B) PC12/CgBHA cells were transfected with NHE71D4/pcDNANeo + or NHE7 siRNA in IMG800/Neo + (NHE7A, NHE7B or NHE7C) and selected with geneticin. Single clones were isolated and characterized. (C) Densitometry analysis of 4 independent western blots probed with antiNHE7. The results were expressed as mean ± standard deviation. (D) PC12/CgBHA cells with endogenous NHE7, stably expressing 1D4-tagged NHE7 and NHE7 knock down were tested for exchanger activity by 86Rb + uptake assay. Mean ± standard deviation of 12 independent experiments.  197  A.  Anti CgBHA  ^  -  Anti-NH E7 1D4^Merge  B. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Anti Cg BHA  gm. efiss  -  Anti-NHE7 1D4  C PC12/CgB HA  PC12/CgB HA + NHE 7 1D4  Lys^IP^Lys^IP Anti CgBHA -  Suppl. Fig. 1-8. Characterization of PC12/CgB HA NHE7 1D4 cells. (A) CgB HA and NHE7 1D4 expression in PC12/CgB H A+NHE7 1 D4 cells were visualized by fluorescent confocal microscopy. (B) Subcellular localization of CgB HA and NHE7 1D4 in PC12/CgB HA + NHE7 1D4 cells were analyzed by sucrose equilibrium density centrifugation. Fifteen 325 fractions were taken from the top of the gradient and 4 !IL were resolved by SDS-PAGE and probed for CgBHA and NHE71 D4. (C) PC12/CgBHA and PC12/CgBHA + NHE71 D 4 cells were resuspended in sonication buffer and passed through a 26.5G needle 10 times. Intact NHE7-containing organelles were incubated with 1D4conjugated sepharose for 1 hour at 4 ° C. Immobilized organelles were washed extensively with PBS and solubilized with RIPA buffer. The same amount of lysate was subjected to SDS-PAGE and western blotting to detect the associated CgB HA . Blots shown are representative of 3 independent experiments.  198  NS  3  I  0 CgBHA  CgBHA + NHE71 D4  CgBHA + 7A-A3  PC12 cell lines  Suppl. Fig. 1-9. Role of NHE7 in CgB secretion. PC12/CgBHA, PC12/CgBH A + NHE7 1 D4 and PC12/CgBH A + NHE7A-A3 were stimulated with serum free media supplemented with 55 mM KC1 and 2 mM CaC1, for 10 minutes at 37 °C with 5% CO?. Secreted CgB was assessed in slot blot by mouse monoclonal anti-HA antibody. Data are expressed as mean ± standard deviation from 3 independent experiments. NS — Not significant; (*: p<0.005).  199  Appendix 3 — Publications Arising From Graduate Work  First author publications arising from Ph.D. Studies Lin, P.J., Williams, W.P., Luu, Y., Molday, R.S., Orlowski, J. and Numata M.  (2005). Secretory carrier membrane proteins interact and regulate trafficking of the organellar (Na+,K+)/H+ exchanger NHE7. J Cell Sci. 118, 1885-1897. Lin, P.J., Williams, W.P., Kobiljski, J. and Numata, M. (2007). Caveolins bind to (Na+, K+)/H+ exchanger NHE7 by a novel binding module. Cell Signal. 19, 978-988.  Additional publications during Ph.D. studies Onishi, I., Lin, P.J., Diering, G.H., Williams, W.P. and Numata, M. (2007). RACK1  associates with NHE5 in focal adhesions and positively regulates the transporter activity. Cell Signal. 19, 194-203.  200  Appendix 4 — Biohazard Approval Certificate  The University of British Columbia  Biohazard Approval Certificate PROTOCOL NUMBER:  H05-0116  INVESTIGATOR OR COURSE DIRECTOR: DEPARTMENT:  Numata, Masayuki  Biochemistry & Molec Biology  PROJECT OR COURSE TITLE:  Mammaliam Organelle-membrane Type Na+/H+  Exchangers APPROVAL DATE:  06-08-15  APPROVED CONTAINMENT LEVEL: FUNDING AGENCY:  2  Canadian Institutes of Health Research  The Principal Investigator/Course Director is responsible for ensuring that all research or course work involving biological hazards is conducted in accordance with the Health Canada, Laboratory Biosafety Guidelines, (2nd Edition 1996). Copies of the Guidelines (1996) are available through the Biosafety Office, Department of Health, Safety and Environment, Room 50 - 2075 Wesbrook Mall, UBC, Vancouver, BC, V6T 1Z1, 822-7596, Fax: 822-6650.  • Approval of the UBC Biohazards Committee by one of: Chair, Biosafety Committee Manager, Biosafety Ethics Director, Office of Research Services This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required. A copy of this certificate must be displayed In your facility.  Office of Research Services 102, 6190 Agronomy Road, Vancouver, V6T 1Z3 Phone: 604-827-5111 FAX: 604-822-5093  201  References Chen, C. and Okayama, H. (1987). High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 2745-2752. Francis, S.A., Kelly, J.M., McCormack, J., Rogers, R.A., Lai, J., Schneeberger, E.E. and Lynch, R.D. (1999). Rapid reduction of MDCK cell cholesterol by methyl-betacyclodextrin alters steady state transepithelial electrical resistance. Eur J Cell Biol. 78, 473-484. Gietz, R. D. and Schiestl, R. H. (1991). Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier. Yeast 7, 253-263. Gietz, R. D., Triggs-Raine, B., Robbins, A., Graham, K. C. and Woods, R. A. (1997). Identification of proteins that interact with a protein of interest: applications of the yeast two-hybrid system. Mol. Cell. Biochem. 172, 67-79. Glombik, M.M., Kromer, A., Salm, T., Huttner, W.B. and Gerdes, H.H. (1999). The disulfide-bonded loop of chromogranin B mediates membrane binding and directs sorting from the trans-Golgi network to secretory granules. EMBO J. 18, 1059-1070. Hansen, S.H., Sandvig, K. and van Deurs, B. (1993). Clathrin and HA2 adaptors: effects of potassium depletion, hypertonic medium, and cytosol acidification. J Cell Biol. 121,61-72. Heuser, J.E. and Anderson, R.G. (1989). Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. J Cell Biol. 108, 389-400. Hodges, R. S., Heaton, R. J., Parker, J. M., Molday, L. and Molday, R. S. (1988). Antigen-antibody interaction. Synthetic peptides define linear antigenic determinants recognized by monoclonal antibodies directed to the cytoplasmic carboxyl terminus of rhodopsin. J. Biol. Chem. 263, 11768-11775. Ilangumaran, S. and Hoessli, D.C. (1998). Effects of cholesterol depletion by cyclodextrin on the sphingolipid microdomains of the plasma membrane. Biochem J. 335, 433-440. Kromer, A., Glombik, M.M., Huttner, W.B. and Gerdes, H.H. (1998). Essential role of the disulfide-bonded loop of chromogranin B for sorting to secretory granules is revealed by expression of a deletion mutant in the absence of endogenous granin synthesis. J Cell Biol. 140, 1331-1346. Li, H., Ayer, L.M., Lytton, J. and Deans, J.P. (2003). Store-operated cation entry mediated by CD20 in membrane rafts. J Biol Chem. 278, 42427-42434.  202  MacKenzie, D. and Molday, R. S. (1982). Organization of rhodopsin and a high molecular weight glycoprotein in rod photoreceptor disc membranes using monoclonal antibodies. J. Biol. Chem. 257, 7100-7105. Miroux, B. and Walker, J.E. (1996). Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J Mol Biol. 260, 289-298. Review. Misik, A.J., Perreault, K., Holmes, C.F. and Fliegel, L. (2005). Protein phosphatase regulation of Na+/H+ exchanger isoform I. Biochemistry. 44, 5842-5852. Numata, M. and Orlowski, J. (2001). Molecular cloning and characterization of a novel (Na+,K+)/H+ exchanger localized to the trans-Golgi network. J. Biol. Chem. 276, 1738717394. Numata, M., Petrecca, K., Lake, N. and Orlowski, J. (1998). Identification of a mitochondrial Na+/H+ exchanger. J. Biol. Chem. 273, 6951-6959. Oprian, D. D., Molday, R. S., Kaufman, R. J. and Khorana, H. G. (1987). Expression of a synthetic bovine rhodopsin gene in monkey kidney cells. Proc. Natl Acad. Sci. USA 84, 8874-8878. Radeva, G., Perabo, J. and Sharom, F.J. (2005). P-Glycoprotein is localized in intermediate-density membrane microdomains distinct from classical lipid rafts and caveolar domains FEBS J. 272, 4924-4937. Sambrook, J. and Russell, D. (2001). Molecular Cloning: A Laboratory Manual. Danvers, MA: Cold Spring Harbor Laboratory Press. Xu, H., Sweeney, D., Wang, R., Thinakaran, G., Lo, A. C., Sisodia, S. S., Greengard, P. and Gandy, S. (1997). Generation of Alzheimer beta-amyloid protein in the transGolgi network in the apparent absence of vesicle formation. Proc. Natl Acad. Sci. USA 94, 3748-3752. Yan, R., Han, P., Miao, H., Greengard, P. and Xu, H. (2001b). The transmembrane domain of the Alzheimer's beta-secretase (BACE 1) determines its late Golgi localization and access to beta-amyloid precursor protein (APP) substrate. J. Biol. Chem. 276, 3678836796.  203  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066263/manifest

Comment

Related Items