Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of xtcl mutant with reduced cuticular wax accumulation Wang, Qian 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
24-ubc_2008_spring_wang_qian.pdf [ 3.93MB ]
Metadata
JSON: 24-1.0066238.json
JSON-LD: 24-1.0066238-ld.json
RDF/XML (Pretty): 24-1.0066238-rdf.xml
RDF/JSON: 24-1.0066238-rdf.json
Turtle: 24-1.0066238-turtle.txt
N-Triples: 24-1.0066238-rdf-ntriples.txt
Original Record: 24-1.0066238-source.json
Full Text
24-1.0066238-fulltext.txt
Citation
24-1.0066238.ris

Full Text

Characterization of xtcl mutant with reduced cuticular wax accumulation  by  Qian Wang  B.Sc. East China University of Science and Technology, 2004  A thesis submitted in partial fulfillment of the requirements for the degree of  Master of Science  in  The Faculty of Graduate Studies (Botany)  The University of British Columbia December 2007 Qian Wang, 2007  ABSTRACT  Cuticular wax is a component of the plant cuticle, the lipid barrier which covers the surface of above ground primary plant organs and plays important protective roles. The isolation of wax deficient mutants from Arabidopsis and other plants resulted in identification and isolation of genes required for wax deposition, and broadened our knowledge of this process in plants. To identify additional components involved in cuticular wax production, I investigated the role of the XTC1 gene, defective in the xtcl (extra cotyledon 1) mutant. This mutant was reported to have reduced levels of cuticular  wax on its inflorescence stems and accumulate a large number of oil bodies in the primordia of its extra cotyledons. Stem wax extraction and gas chromatography analysis showed that the total xtcl stem wax is decreased 3-fold in comparison to the wild type, and that all wax components were reduced to a similar extent. Compositional analyses of leaf and seed fatty acids demonstrated that saturated fatty acid content was decreased by around 55%, and unsaturated fatty acid content was approximately 20% lower in xtcl mutants. A detailed examination of xtcl seeds revealed seed deformities, altered seed coat permeability and defective seed mucilage extrusion. Positional cloning of the XTC1 gene resulted in the discovery that it is identical to FATB, an already characterized gene known to encode the fatty acid thioesterase B. The FATB enzyme releases saturated free fatty acids (C16:0 and C18:0) from ACP in the plastid and allows their export across the plastid envelope. Analysis of FATB gene expression pattern showed that FATB is transcribed ubiquitously in all tissues and in different development stages. It is therefore not surprising that FATB disruption results in multiple lipid associated phenotypes, including decreased cuticular wax amounts and altered fatty acid compositions of leaves and seeds. Additional phenotypes caused by mutations in FATB that affect embryo and seed development and lead to appearance of extra cotyledons, altered permeability of the seed coat and defective seed mucilage extrusion are difficult to explain at present.  TABLE OF CONTENTS ABSTRACT ^  ii  TABLE OF CONTENTS ^  iii  LIST OF TABLES ^  vi  LIST OF FIGURES ^  viii  ABBREVIATIONS ^  ix  ACKNOWLEDGEMENTS ^  xi  CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW^  1  1.1 The plant cuticle and cuticular wax ^  1  1.2 Cuticular wax biosynthesis ^  2  1.2.1 De novo fatty acid biosynthesis ^  2  1.2.2 Fatty acid elongation ^  4  1.2.3 Biosynthesis of wax components ^  6  1.2.4 Wax secretion ^  9  1.3 Thesis objectives ^  10  CHAPTER 2: MATERIALS AND METHODS ^  13  2.1 Plant material and growth conditions ^  13  2.1.1 Arabidopsis thaliana ecotypes and mutant lines ^  13  2.1.2 Arabidopsis thaliana nomenclature ^  13  2.1.3 Arabidopsis thaliana growth ^  13  2.1.4 Arabidopsis thaliana transformation ^  .. 14  2.2 Fatty acid analysis ^  15  2.2.1 Preparation of fatty acid methyl esters (FAMEs) ^  .15  2.2.1.1 Preparation of FAMEs from seed ^  15  2.2.1.2 Preparation of FAMEs from leaves ^  16  2.2.2 Gas chromatographic analysis of FAMEs ^  16  2.3 Wax extraction and analysis ^  17  2.3.1 Wax extraction ^  17  2.3.2 Gas chromatographic analysis of wax ^  17 iii  2.3.3 Scanning electron microscopy ^  18  2.4 Seed permeability and mucilage analyses ^  18  2.4.1 Tetrazolium red staining ^  18  2.4.2 Ruthenium red staining ^  18  2.5 Positional cloning ^  19  2.5.1 xtcl mapping ^  19  2.5.2 Identification of the XTC1 gene ^  20  2.5.3 Salk T-DNA insertion line analysis ^  24  2.5.4 Complementation test ^  . 24  2.6 Gene expression analysis ^  25  2.6.1^RT-PCR analysis ^  25  2.6.2 GUS analysis ^  26  2.6.2.1 XTC1 promoter::GUS construct preparation ^  26  2.6.2.2 Isolation of transgenic plants ^  27  2.6.2.3 GUS activity assays ^ 2.7 Analysis of cell morphology by transmission electron microscopy  ..27 ^27  CHAPTER 3 RESULTS ^  29  3.1 Phenotypic characterization of the xtcl mutant ^  29  3.1.1 Biochemical and morphological analysis of cuticular wax on xtcl stems....29 3.1.2 Fatty acid compositions of leaves and seeds in xtcl mutant ^  .31  3.1.3 Seed morphology, permeability and mucilage accumulation ^  33  3.2 Positional cloning of XTC1 ^  36  3.2.1 xtcl mapping ^  35  3.2.2 Identification of XTC1 gene ^  35  3.2.3 Salk T-DNA insertional allele analysis ^  38  3.2.4 xtcl and sa1k020856 are allelic to fatb^  39  3.3 FATB gene expression analysis ^  41  3.3.1 RT-PCR analysis of FATB expression ^  41  3.3.2 Expression of FATB promoter-GUS fusion in transgenic Arabidopsis  42  3.4 Examination of the fatb cell morphology ^  43 iv  CHAPTER 4 DISCUSSION ^  45  4.1 FATB plays a role in lipid metabolism ^  45  4.2 FatB mutation causes extra cotyledons ^  48  4.3 FATB disruption results in seed deformity, altered seed coat permeability and reduced mucilage extrusion ^  49  4.4 Conclusions ^  50  LITERATURE CITED ^  51  LIST OF TABLES Table 2.1. Arabidopsis thaliana standard nomenclature ^  13  Table 2.2. AT medium composition ^  14  Table 2.3. Markers used to fine-map XTC1 ^  21  Table 2.4 Extraction buffer composition and protocol for making 400 ml of solution ^ 22 Table 2.5. Primers used for sequencing the FATB gene in wild type and xtcl ^ 22 Table 3.1. Fatty acid composition of wild type (Ler) and xtcl leaves ^ 32 Table 3.2. Fatty acid composition of wild type (Ler) and xtcl seeds ^ 32 Table 3.3. Complementation crosses performed between the wild type and fatb mutant  lines. The right column shows the phenotype of the F1 progeny of each cross ^ 40  vi  LIST OF FIGURES Figure 1.1. Generic representation of a transverse view of wax secreting epidermal  cells ^  1  Figure 1.2. Overview of fatty acid synthesis ^  3  Figure 1.3. Acyltransferase transfers the fatty acid from the ACP directly to the  glycerol-3-phosphate in the plastids ^  4  Figure 1.4. Thioesterase releases free fatty acids from ACP ^  4  Figure 1.5. Proposed wax biosynthetic pathways in Arabidopsis ^ 8 Figure 1.6. The phenotypes of wild type and xtcl seedlings 2 weeks after germination  ^  11  Figure 1.7. Electron micrographs of wild type cotyledon and a wild type first leaf  primordium and the first leaf primordial of xtcl seedlings 2 days after imbibition ^  11  Figure 1.8. Influorescence stems of xtcl mutant have wax-deficient phenotype ^ 12 Figure 2.1. Diagram of the T-DNA construct containing the FATB coding region used to  transform Arabidopsis to check whether FATB can rescue the xtcl mutant phenotype ^  24  Figure 2.2. Diagram of the T-DNA construct containing the XTC/ promoter-GUS gene  fusion used to transform Arabidopsis to evaluate the tissue specificity of XTC/ expression ^  26  Figure 3.1. Total wax loads on stems of wild type and xtcl Arabidopsis plants ^ 29 Figure 3.2. Cuticular wax composition on stems of Ler wild type and xtcl Arabidopsis  plants ^  30  Figure 3.3. Epicuticular wax crystal density is lower on xtcl stems in comparison to the  wild type ^  31  Figure 3.4. Wild type Arabidopsis seeds and deformed seeds from xtcl mutant ^ 33 Figure 3.5. Tetrazolium salt staining of Ler wild type and xtcl seeds ^ 34 Figure 3.6. Imbibed Ler wild type and xtcl seeds stained with 0.2% ruthenium red ^ 35 Figure 3.7. Mapping of xtcl at the top of chromosome 1 ^  36 vii  Figure 3.8. Intron-exon structure of the At1g08510 gene and DNA sequence alignment of xtcl and FATB genes and the predicted sequence of their gene products ^ 37  Figure 3.9. Phenotypes of 5-week-old Ler wild type, xtcl and xtcl-WT plants ^ 38 Figure 3.10. DNA sequence alignment of SALK_020856 and FATB genes indicating that the location of T-DNA is 1817 by away from the predicted translation start site ^ 39 Figure 3.11. The fatb mutant seeds show increased seed coat permeability ^ 40 Figure 3.12. The seeds of fatb mutants are defective in mucilage extrusion ^ 41 Figure 3.13. Structure of the FATB gene and transcript levels in fatb mutant lines ^ 42 Figure 3.14. Expression patterns of FATB detected in FATB promoter:GUS lines ^43 Figure 3.15. Electron micrographs of chloroplasts from 4-week-old rosette leaves ^ 44 Figure 4.1. FATB function is required for fatty acid elongation and wax synthesis ^ 45 Figure 4.2. FATB plays a role in lipid metabolism in the plastid and the ER ^ 47  VI"  ABBREVIATIONS 35S^Cauliflower mosaic virus 35S (strong constitutive) promoter as^amino acid ACBP^acyl-CoA binding protein ACP^acyl carrier protein BLAST^Basic Local Alignment Search Tool by^DNA base pair CaMV35S Cauliflower mosaic virus 35S (strong constitutive) promoter CAPS^cleaved amplified polymorphic sequence cDNA^copy DNA (reverse-transcribed from RNA) C29; C18, etc. hydrocarbons and derivatives with the specified number of carbon atoms  cer^eceriferum (waxless) mutant, and corresponding genes and proteins Col^Arabidopsis, Columbia ecotype DNA^deoxyribonucleic acid ECR^enoyl-CoA reductase ER^endoplasmic reticulum FAE^fatty acid elongase FAS^fatty acid synthetase GAPC^glyceraldehydes-3-phosphate dehydrogenase C (cytosolic form) GC^gas chromatography GC-MS^gas chromatography-mass spectrometry GFP^green fluorescence protein GUS^p-glucuronidase h^hour(s) HCD^p-hydroxyl-acyl-CoA dehydratase kb^kilo bases (1000 base pairs) KCS^3-ketoacyl-CoA synthase KCR^p-ketoacyl-CoA reductase LB^Luria-Bertani bacterial growth medium formulation Ler^Arabidopsis, Landsberg erecta ecotype ix  LTP^lipid transfer proteins mRNA^messenger RNA NCBI^National Center for Biotechnology Information; http://www.ncbi.nlm.nih.qov/ ORF^open reading frame PCR^polymerase chain reaction RNA^ribonucleic acid RT-PCR^reverse-transcriptase PCR s^second(s) SEM^scanning electron microscopy SSLP^simple sequence length polymorphism TAE^Tris acetate EDTA buffer TAIR^The Arabidopsis Information Resource; http://Arabidopsis.org/ TE^Tris EDTA buffer Tris^2-amino-2-hydroxymethy1-1,3-propanediol UTR^untranslated region VLCFA^very long chain fatty acid WT^wild-type X-gluc^5-bromo-4-chloro-3-indolyI-13-D-glucuronide  ACKNOWLEDGEMENTS I would like to express my deep and sincere gratitude to my supervisor Dr. Ljerka Kunst, whose understanding and personal guidance have provided a good basis for the present thesis. I thank my committee members Dr, George Haughn, Dr. Lacey Samuels and Dr. Xin Li for regular feedback into my research progress. I also would like to say a big "thank-you" to past and present members of the Dr. Kunst and Dr. Haughn's lab for helpful discussions and protocols. I am grateful to Botany office and technical staff for their help to keep the research moving. I owe my sincere gratitude to the financial support given by Dr. Ljerka Kunst through research assistantships, the Botany Department through teaching assistantships, and UBC for tuition scholarships and a University Graduate Fellowship. Lastly, and most importantly, I wish to thank my parents, Baochun Wang and Lifang Bo, for their love and support.  xi  Chapter 1: Introduction and literature review 1.1 The plant cuticle and cuticular wax The surface of the above ground primary plant organs is covered by a lipid barrier called the cuticle. The plant cuticle consists of cutin and cuticular wax (Figure 1.1). Cutin is the major component of the cuticle. It is a lipid polyester composed of oxygenated C16 and C18 fatty acids cross-linked by ester bonds, which forms a network (Kurdyukov et al., 2006). This cutin network is both embedded and covered with cuticular wax. The amorphous lipids surrounding the cutin, are called intracuticular waxes. The lipids on the cuticle surface forming the crystals or smooth film are referred to as epicuticular waxes. The architecture of crystals can sometimes be correlated to the chemical composition of the wax, and can also be modified by environmental factors (Wettestein-Knowles, 1995).  Figure removed for copyright reasons. Original source is Kunst,L., and Samuels, A.L. (2003). Biosynthesis and secretion of plant cuticular wax. Progress in Lipid Research 42, 51-80. (Page 44, Fig.1) Figure 1.1. Generic representation of a transverse view of wax secreting epidermal cells, showing the components of the cuticle, cell wall domains, and the nonphotosynthetic epidermal cell (Kunst and Samuels, 2003).  Cuticular wax plays a number of important roles in a plant's life. It prevents non-stomatal water loss, protects plants against ultraviolet radiation (Reicosky and Hanover, 1978) and, by reducing water retention on the surface of the plant, affects deposition of dust, pollen and air pollutants (Kerstiens, 1996; Barthlott and Neinhuis, 1997). Surface wax is also involved in plant defense against bacterial and fungal pathogens (Jenks et al., 1994) and in plant-insect interactions (Eigenbrode and Espelie, 1995). Chemically, cuticular wax is a mixture of lipid components of the cuticle, which can be extracted with organic solvents. It is predominantly comprised of very long chain aliphatic lipids, but it also includes triterpenoids and minor secondary metabolites,  such as sterols and flavonoids. Research in our lab focuses on the aliphatic, very long-chain components of cuticular wax. They include aldehydes, primary and secondary alcohols, alkanes, ketones and esters, which are all derived from saturated very-long-chain fatty acids. Generally for each wax component a series of homologs increasing in length by 2 carbons is present in plant cuticles, dominated by either even or odd members. Chain lengths from 20 to 34 carbon atoms are most frequently encountered (Kunst and Samuels, 2003). The composition and quantity of cuticular wax can vary widely not only from one species to another, but also from one organ, tissue or even cell type to another on a single plant (Wettestein-Knowles, 1995).  1.2 Cuticular wax biosynthesis 1.2.1 De novo fatty acid biosynthesis  Fatty acid biosynthesis in plants takes place within plastids, organelles widely thought to have originated from a photosynthetic bacterial symbiont. It is therefore not surprising that the fatty acid metabolism in plants closely resembles that of bacteria, but is fundamentally different from that of animals and fungi, which produce fatty acids in the cytosol (Somerville et al., 2000). The simplest description of the plastidial pathway of fatty acid biosynthesis is that it consists of two enzyme systems: the acetyl-CoA carboxylase (ACCase) and the fatty acid synthase (FAS). ACCase catalyzes malonyl-CoA formation from acetyl-CoA, which represents the first committed step in fatty acid production. FAS catalyzes a repeated series of reactions (Figure 1.2): a condensation of acyl-ACP with malonyl-ACP, a reduction of 3-ketoacyl-ACP, a dehydration, and a reduction of the double bond. Each cycle of FAS reactions results in two carbons being incorporated into the acyl chain attached to the acyl carrier protein (ACP). FAS will not be terminated until the number of carbons in the acyl chain reaches 16 or 18 (Somerville et al., 2000). In plants, the individual enzymes of the FAS are soluble proteins located in the stroma of plastids, and each protein catalyzes a single FAS reaction. In contrast to plants, in animals, fungi and some bacteria, FAS is comprised of large 2  multifunctional subunits catalyzing several different FAS reactions. These subunits are associated into complex which is located in the cytosol (Ohlrogge and Browse, 1995). The condensation reaction of the fatty acid synthesis pathway is catalyzed by a 3-ketoacyl-ACP synthase (KAS), commonly called the condensing enzyme. All plants examined to date contain three KAS isoenzymes: KAS I , KAS II , and KASIII, distinguished by substrate specificity (Somerville et al., 2000). KASIII catalyzes the first condensation of acetyl-CoA and malonyl-ACP to form a four-carbon product (Jaworski et al., 1989). KAS I is responsible for producing chain lengths from six to sixteen carbons. Finally the elongation from 16 carbons to 18 carbons requires KAS II (Ohlrogge and Browse, 1995). Additional enzymes of the FAS, 3-ketoacyl-ACP reductase, 3-hydroxyacyl-ACP dehydratase and enoyl-ACP reductase have been identified and characterized from several plants. Both reductases have at least two kinds of isoforms (Somerville et al., 2000).  Figure removed for copyright reasons. Original source is Ohlrogge, J., and Browse, J. (1995). Lipid Biosynthesis. Plant Cell 7, 957-970. (Page 961, Figure 3) Figure 1.2. Overview of fatty acid synthesis (Ohlrogge and Browse, 1995).  Fatty acid biosynthesis is terminated when the acyl group is removed from the ACP. There are two ways to release the generated fatty acid chain: one involving an acyltransferase and the other a thioesterase. The enzyme determines whether the fatty acid will leave the plastid or be used for lipid synthesis within the plastid. Acyl-transferase moves the fatty acid from the ACP directly to the glycerol-3-phosphate in the plastids (Figure 1.3) (Somerville et al., 2000). Alternatively, the fatty acid to be exported from the plastid is released from ACP by a thioesterase (Figure 1.4). Two types of thioesterases occur in plants. The major class, designated FATA, is active mostly with 18:1 °9 -ACP. The second class, called FATB, prefers shorter chain (C10-C16) and saturated acyl-ACP substrates (Somerville et al., 2000). An acyl-CoA synthetase (ACS) converts the free fatty acid to an acyl-CoA (Ohlrogge and Browse, 1995). Nine long-chain acyl-CoA synthetase (LACS) genes exist in 3  Arabidopsis that participate in fatty acid and glycerolipid metabolism (Shockey et al., 2002). Within this gene family, the protein encoded by LACS9 was localized in the outer membrane of plastid envelope by transient expression of a LACS9-green fluorescence protein fusion (Schnurr et al., 2002). However, where in the plastid the free fatty acids are released from the ACP by a FAT enzyme and how these fatty acids are transported to LACS9 in outer membrane of the plastid envelope remains unknown.  Plastid  A lc p•  acyltransferase  glycerolipid  fatty acid  Figure 1.3. Acyltransferase transfers the fatty acid from the ACP directly to the glycerol-3-phosphate in the plastids.  0  0 11  c  1\0_  H2 O  R S—ACP Acyl-ACP  Thioestera se  ACP^ SH ACP  Fatty acid  Figure 1.4. Thioesterase releases free fatty acids from ACP.  1.2.2 Fatty acid elongation  Fatty acid elongation is the extension of the ubiquitously present  C16  and Cig fatty 4  acids made in plastids to very long chain fatty acids (VLCFAs: C20-C34). VLCFAs are precursors for the production of cuticular wax, suberin, seed storage triacylglycerols (TAGs) and sphingolipids in plants. Fatty acid elongation is catalyzed by an enzyme complex known as fatty acid elongase (FAE) (Wettestein-Knowles, 1982) which is bound to the ER. Similar to FAS, four catalytic steps occur in order to add two carbons to the acyl chains: condensation between an acyl-CoA and malonyl-CoA, followed by a 3-keto reduction, dehydration and an enoyl reduction (Fehling and Mukherjee, 1991). However, there are notable differences between FAS and FAE. First, fatty acid elongation does not occur with a fatty acyl chain attached to ACP, but on a CoA-esterified fatty acyl substrate. Second, malonyl-CoA serves as a two-carbon donor, rather than malonyl-ACP (Agrawal et al., 1984; Agrawal and Stumpf, 1985). Third, FAE is catalyzed by ER membrane-associated enzymes, while FAS is catalyzed by stromal soluble enzymes (Cassagne and Lessire, 1978; Whitfield et al., 1993). Extensive mutant screens for changes in VLCFA content in Arabidopsis seeds resulted in isolation of mutants with a lesion in the gene called FATTY ACID ELONGATION1 (FAE1). Biochemical analysis of the mutant (Kunst et al., 1992) and isolation and characterization of the FAE1 gene (James and Dooner, 1990; Millar and Kunst, 1997) demonstrated that FAE1 gene encodes a 3-ketoacyl-CoA synthetase. The search for sequences with high similarity to FAE1 in an Arabidopsis EST database led to the isolation and characterization of two additional condensing enzymes: KCS1 (Todd et al., 1999) and CER6 (Millar et al., 1999; Fiebig et al., 2000). In addition, FDH gene, whose sequence is also highly similar to FAE1, was isolated by transposon tagging (Yephremov et al., 1999). KCS1 or FDH mutants do not exhibit glossy stem phenotypes, suggesting that stem wax is not severely reduced. By contrast, plants lacking the CER6 activity have dramatically reduced stem wax loads and are conditionally male sterile. KCS1 and FDH cannot rescue the wax deficient phenotype and male sterility in CER6 mutants, indicating that the function of these condensing enzymes does not overlap in the shoot and anther with CER6. CER60 enzyme, with high homology to CER6, does not appear to be involved in the synthesis of fatty acids 5  in stems and anthers either or may be expressed at a low level in mature Arabidopsis (Fiebig et al., 2000; Hooker et al., 2002). Thus, it appears that CER6 is the major condensing enzyme involved in stem wax and pollen coat lipid biosynthesis in Arabidopsis. There are a total of 21 putative KCSs annotated in the Arabidopsis genome, but the roles of the remaining sequences have not been determined. In Arabidopsis, KCR1 (At1g67730) and KCR2 (At1g24470) were identified as putative homologs of Ybr159w encoding the 3-ketoacyl-CoA reductase activity of VLCFA synthesis in Saccharomyces cerevisiae (Han et al., 2002; Dunn et al., 2004). Heterologous expression of the KCR1 in yeast complements the ybr159w mutantion, demonstrating that it has 3-ketoacyl-CoA reductase activity (Han et al., 2002). Similarly, the At3g55360Arabidopsis gene was identified as an enoyl-CoA reductase candidate based on its similarity to the S. cerevisiae TSC13 gene encoding an enoyl-CoA reductase which catalyzes the last step of FAE (Kohlwein et al., 2001; Gable et al., 2004). Heterologous expression of the At3g55360 in yeast functionally complements the phenotypes of tsc13 mutants that are deficient in enoyl-CoA reductase activity (Gable et al., 2004). An Arabidopsis mutant with a lesion in the At3g55360 gene (called cer10) has a reduced stem cuticular wax load, altered VLCFA composition in seed  TAGs and sphingolipids, exhibits abnormalities in the endocytic membrane transport and the size of aerial organs (Zheng et al., 2005). No FAE dehydratase has been identified so far in plants. However, Phsp1 protein has recently been shown to be a FAE dehydratase in Saccharomyces cerevisiae (Denic and Weissman, 2007). This information should help in the identification of the plant enzyme.  1.2.3 Biosynthesis of wax components  VLCFA products of FAE generated in the epidermis are used for the synthesis of wax components. In most plants, including Arabidopsis, two major wax biosynthetic pathways have been proposed: an acyl reduction pathway, which produces primary alcohols and esters, and a decarbonylation pathway, which produces aldehydes, alkanes, secondary alcohols and ketones (Figure 1.5) (Kunst and Samuels, 2003). Kolattukudy et al. (1997) purified and characterized an alcohol-generating 6  reductase activity and an aldehyde-generating reductase activity from pea leaves (Vioque and Kolattukudy, 1997). An alcohol forming fatty acyl-coenzyme A reductase (FAR) was later purified from developing jojoba embryos and cDNA encoding this enzyme was cloned (Metz et al., 2000). The pea and the jojoba alcohol-forming reductases are both integral membrane proteins, proposed to be associated with the ER (Vioque and Kolattukudy, 1997; Metz et al., 2000). FAR-related sequences have been found in corn, rice, cotton and B. napus, suggesting that it is ubiquitous in plants (Kunst and Samuels, 2003). In Arabidopsis cer4 mutant, GC and GC-MS results revealed that, compared to the wild type, primary alcohols and esters are significantly decreased, suggesting that the CER4 gene product is involved in the formation of primary alcohols (Jenks et al., 1995). Further genetic, molecular and chemical characterization of the cer4 mutant, the CER4 gene and the CER4 protein demonstrated that CER4 functions as a FAR in wax biosynthesis (Rowland et al., 2006). The final step in the acyl reduction pathway is the synthesis of wax esters catalyzed by a wax synthase (WS). A WS has been isolated and characterized from developing jojoba embryos (Lardizabal et al., 2000). The jojoba WS had seven to nine predicted transmembrane domains, suggesting that it was a membrane-bound protein. The WS sequence has significant homology with twelve Arabidopsis open reading frames of unknown functions (Lardizabal et al., 2000; Kunst and Samuels, 2003). In addition, A. clacoaceticus WS/DGAT has similarity with ten Arabidopsis sequences (WSD family) (Kalscheuer and Steinbuchel, 2003). WSD10 (At5g37300) has been characterized to catalyze ester formation in Arabidopsis stems (Wu and Kunst, unpublished data).  Figure removed for copyright reasons. Original source is Millar, A.A., Clemens, S., Zachgo, S., Giblin, E.M., Taylor, D.C., and Kunst, L. (1999). CUT1, an Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme. Plant Cell 11, 825-838. (Page 826, Figure 3) Figure 1.5. Proposed wax biosynthetic pathways in Arabidopsis (Millar et al., 1999) 7  In the decarbonylation pathway, the first step has been proposed to be the synthesis of aldehydes. Although aldehyde-generating reductase has been purified and characterized in pea leaves (Vioque and Kolattukudy, 1997), a gene encoding this enzyme has not been isolated. Decarbonylase from a higher plant Pisum sativum has also been solubilized, purified and partially characterized (Schneider-Belhaddad and Kolattukudy, 2000), but a plant decarbonylase gene has not been identified. In Arabidopsis, several mutants affecting the levels of the decarbonylation pathway products have been characterized. For example, cell mutants are blocked in the conversion of stem wax aldehydes to alkanes and they also lack the secondary alcohols and ketones (Jenks et al., 1995). CER1 has been cloned and encodes an integral membrane protein, which contains an iron binding motif, but its precise function remains unclear (Aarts et al., 1995). Characterization of the wax2 mutant and cloning of the WAX2 gene revealed that WAX2 protein has 32% identity to CER1. The leaves and stems of wax2 mutants lack aldehydes, alkanes, secondary alcohols and ketones, and have increased levels of acids, primary alcohols and esters, but the precise metabolic role of WAX2 has not been determined (Chen et al., 2003). The Arabidopsis CER3 gene was originally reported to correspond to At5g02310 encoding an E3 ubiquitin ligase (Hannoufa et al., 1996), but a recent study showed that CER3 gene is allelic to WAX2/YRE/FLP1 (At5g57800) instead (Rowland et al., 2007). A reverse genetic approach was used for the identification of a cytochrome P450 enzyme involved in mid-chain alkane hydroxylation in Arabidopsis to produce secondary alcohols and ketones (Greer et al., 2007). T-DNA insertional mutant alleles in the At1g57750 gene (MAH1) resulted in decreased levels of secondary alcohols and ketones in the stem wax. In addition, overexpression of MAH1 driven by 35S promoter resulted in ectopic accumulation of secondary alcohols and ketones in Arabidopsis leaf wax, where only traces of these compounds were found in wild type. These data imply that MAH1 catalyzes the final two steps of decarbonylation pathway to produce secondary alcohols and ketones from alkanes.  8  1.2.4 Wax secretion  Aliphatic VLCFAs and VLCFA-derived wax components are hydrophobic molecules and there is currently very little information about their transport from their site of synthesis in the ER to the plant cuticle. In mammalian cells, fatty acid-binding proteins (FABPs) are involved in the intracellular fatty acid transport (Storch and Thumser, 2000). However, homologs of FABP have not been found in the S. cerevisiae or the Arabidopsis genomes (Kunst and Samuels, 2003). A possible alternative to FABPs for binding VLCFA wax precursors are acyl CoA binding proteins (ACBP), but the role of ACBPs in binding VLCFA-CoA precursors for wax synthesis or wax synthesis products has not been experimentally verified (Kunst and Samuels, 2003). There are two proposed models describing how VLCFAs or wax components may be moved from the ER to the plasma membrane: 1. direct transfer from the ER to the plasma membrane. and 2. vesicular traffic from the ER to the Golgi and finally to the PM (Kunst and Samuels, 2003). Once the wax components reach the plasma membrane, they must be extracted from the membrane bilayer and moved into the aqueous apoplast. Analysis of the cer5 mutant of Arabidopsis and cloning of the CER5 gene demonstrated that an ABC (ATP-binding cassette) transporter encoded by the CER5 gene (All g51500) is involved in wax export. Cer5 mutants have reduced stem cuticular wax loads and accumulate abnormal deposits of cuticular wax in the cytoplasm of wax-secreting cells. GFP-CER5 fusion proteins are localized to the plasma membrane of epidermal cells (Pighin et al., 2004). In addition, a recent study showed that another ABC transporter, WBC11, is also required for wax transport through the plasma membrane in Arabidopsis (Bird et al., 2007). Finally, how do wax components move through hydrophilic cell wall to cuticle? Again two hypotheses have been proposed: 1. wax components travel in the hydrophobic cavity of lipid transfer proteins (LTPs), or 2. cell wall proteins or polysaccharides may create a hydrophobic "passage " to facilitate wax components to pass (Kunst and Samuels, 2003). However, neither one of these hypotheses has been tested experimentally. Once wax components get to the cuticle layer, they presumably spontaneously organize themselves into crystalline and amorphous zones (Merk et al., 9  1998).  1.3 Thesis objectives The group of Scott Poethig at the University of Pennsylvania mutated Landsberg erecta (Ler) seeds by diepoxybutane and obtained an extra cotyledon 1 (xtcl) mutant  (Conway and Poethig, 1997). In this mutant, leaves that are partially transformed into cotyledons (extra cotyledons) can be readily distinguished and are located in the position of the first two leaves. These extra cotyledons are smaller than normal cotyledons and often irregular in shape, but they resemble cotyledons in that they have few or no trichomes and have a simple venation pattern similar to that of cotyledons (Figure 1.6).  Figure removed for copyright reasons. Original source is Conway, L.J., and Poethig, R.S. (1997). Mutations of Arabidopsis thaliana that transform leaves into cotyledons. P Natl Acad Sci USA 94, 10209-10214. (Page 10210, Fig.1.) Figure 1.6. The phenotypes of (a) wild type and (b) xtcl seedlings 2 weeks after germination (Conway and Poethig, 1997).  Moreover, immature primordia of extra cotyledons (examined 2 days after imbibition) possess a large number of starch grains, protein bodies and lipid bodies-storage products that are normally found in cotyledons, but not in leaves (Figure 1.7). It has been suggested that the transformation of leaves into cotyledons in these mutants might result from the precocious production of leaf primordia during embryogenesis.  Figure removed for copyright reasons. Original source is Conway, L.J., and Poethig, R.S. (1997). Mutations of Arabidopsis thaliana that transform leaves into cotyledons. P Natl Acad Sci USA 94, 10209-10214. (Page 10210, Fig.3.) Figure 1.7. Electron micrographs of (a) wild-type cotyledon and (b) a wild type first leaf primordium and (c) the first leaf primordial of xtcl seedlings 2 days after imbibition (Conway and Poethig, 1997).  10  Xtcl mutation has pleiotropic effects on shoot development after germination, so  that the rosette and the inflorescence stems of xtcl plants are smaller than in wild type plants. In addition, and of most interest to me, the inflorescence stems of the xtcl mutants have reduced epicuticular wax as evidenced by their glossy stem phenotype (Figure 1.8).  Figure 1.8. Influorescence stems of xtcl mutant have a wax - deficient phenotype.  xtcl line also has a number of defects in flower development. In particular, xtcl  causes flower buds to open prematurely, sometimes produces an increase in carpel number, and reduces female fertility (Conway and Poethig, 1997). In summary, two phenotypes exhibited by xtcl mutant, including wax-deficient stems and a large number of lipid bodies accumulated in the cells of extra cotyledons, make this mutant interesting to me. Based on these phenotypes I hypothesize that XTC1 is involved in lipid metabolism, and/or more specifically wax biosynthesis or wax  transport to the cuticle.  The objectives of my M.Sc. project are to: (1) Phenotypically characterize the xtcl mutant; (2) Clone the gene identified by mutation in the xtcl mutant; (3) Characterize the XTC1 expression and properties of the predicted XTC1  polypeptide.  The significance of my M.Sc. project is to provide new insights into the mechanism of 11  cuticular wax biosynthesis and/or secretion through characterization of xtcl wax-deficient mutant.  12  Chapter 2 Materials and Methods 2.1 Plant material and growth conditions 2.1.1 Arabidopsis thaliana ecotypes and mutant lines  Arabidopsis thaliana ecotypes Columbia-0 (Col) and Landsberg erecta (Ler) were  used as wild type for expression studies and as controls for mutants and transgenics, according to their genetic backgrounds. xtcl was given to us by Dr. Scott Poethig (Department of Biology, University of Pennsylvania). The SALK T-DNA insertion lines were obtained from the Arabidopsis Biological Resource Center (ABRC, Columbus, OH). fatb-ko was a gift from Dr. John Ohlrogge (Plant Biology Department, Michigan State University).  2.1.2 Arabidopsis thaliana nomenclature  Standard nomenclature for Arabidopsis thaliana used throughout this thesis is shown in Table 2.1. Genes are indicated by italicized symbols; the corresponding proteins are indicated by non-italicized symbols. Wild type alleles are indicated by capitalized symbols while mutant alleles are indicated by lower-case symbols. Mutant phenotypes are indicated by initial capital letter and non-italicized symbols.  STYLE  EXAMPLE  Wild type alleles  all capitals, italicized  XTC1  mutant alleles  lower-case, italicized  xtcl  mutant phenotypes  initial capitals, non-italicized  Xtcl  proteins  all capitals, non-italicized  XTC 1  Table 2.1. Arabidopsis thaliana standard nomenclature.  2.1.3 Arabidopsis thaliana growth  Seeds of Arabidopsis thaliana were stratified for 3 days at 4 °C on AT-agar medium ((Somerville and Ogren, 1982); composition given in Table 2.2), then  13  germinated at 20 °C for 7-10 days. After germination seedlings are transplanted into soil (Sunshine mix 5, SunGro Horticulture, Seba Beach, AB) in 12 cm plastic pots. Before planting, soil was saturated with tap water and water was added to pots from the base whenever they became dry. 80 mL of liquid AT medium was added to the top of each pot before transplanting. After transplanting, pots are covered with plastic wrap (Resinite, AEP Canada Inc., Westhill, ON) for 5 days and the plastic was slit with a razor blade, and then removed 2 days later. Plants were generally grown at a density of 12-15 per pot, and were grown in continuous light (90-120 gin/m 2 sec PAR) at 20 °C.  Macronutrient KNO3  Concentration (mM) 5  KH2PO4  2.5  MgSO4  2  Ca(NO3)2  2  FeEDTA  0.05  Micronutrient  Concentration (RM)  H 3 B 03  70  Mtr4H20  14  CuS O4  0.5  ZnSO4"7H20  1  NaMo042H20  0.2  NaC1  10  CoC126H20  0.01  Table 2.2. AT medium composition (pH adjusted to 5.7; 7g/L agar added. Hygromycin (25 ug/mL) added after autoclaving and cooling to 55 °C)  2.1.4 Arabidopsis thaliana transformation  Plants were transformed using the Agrobacterium-mediated floral spray method  14  (Chung et al., 2000) . Six-week-old, vigorous, bolting plants with some siliques were sprayed. Single colonies of Agrobacterium tumefaciens containing the binary vector with a T-DNA construct to be inserted into plants were grown in 5 mL LB (Luria-Bertani) with appropriate antibiotics at 30 °C overnight. 2 mL of overnight culture were then used to innoculate 250 mL of LB broth in 1 L flasks. These cultures were incubated on shakers at room temperature for approximately 24 h. The Agrobacterium cultures were spun down for 10 minutes at room temperature at 8000 rpm in a Beckmann J2-21 centrifuge with a JA 14 rotor, to pellet the cells. The supernatant was removed and the cells were resuspended and washed in 100 mL of 5% sucrose. The cells were spun down again for 5 minutes at 8000 rpm. The supernatant was discarded and the cells were resuspended in 200 mL of 5% sucrose. 80 pl of Silwet L-77 (Lehle seeds, Round Rock, TX) was added. The Agrobacterium suspension was transferred to a plastic bottle with a manual soft pump nozzle and was liberally sprayed on plants. After transformation, the plants were placed into a plastic flat covered with a plastic bag for 24 hours to maintain the humidity. The next day, the flat was uncovered, and returned to normal growth conditions where plants completed their seed development. T i seeds harvested from primary transformed plants (To) were germinated on AT-agar plates containing 25 pg/ml hygromycin (Invitrogen). Hygromycin-resistant seedlings were transferred to soil and grown under normal conditions.  2.2 Fatty acid analyses 2.2.1 Preparation of fatty acid methyl esters (FAMEs) 2.2.1.1 Preparation of FAMEs from seed  Preparation of FAMEs from seed was carried out according to the protocol of Li et al (Li et al., 2006). 2.5 mg dry seed was weighed per sample. The seed were transferred into 1cm x 10 cm glass tube with Teflon screw cap. 1 ml of freshly prepared 5% (v/v) sulfuric acid in methanol was added to each sample, followed by 25 pl of 0.2%  15  (w/v) butylated hydroxy toluene in methanol in 75 pl toluene with 12.5 pg triheptadecanoin (1,2,3-Triheptadecanoylglycerol) (Larodan Fine Chemical AB, Sweden) as internal standard. Samples were vortexed for 30 seconds and heated at 90 °C for 1.5 hours. During the heat-extraction, samples were vortexed for appromixately 15 seconds every 20 minutes. Samples were then cooled on ice and 1.5 ml of 0.9% NaCI (w/v) in water was then added and 2 ml hexane were added. FAMEs were extracted into hexane by vortexing followed by centrifugation for 5 minutes at 2500 rpm to separate the phases. If necessary, the upper organic phases were pooled, transferred into new 1 cm X 10 cm glass tubes and dried under N2. FAMEs were dissolved in 50 pl hexane and transferred to a GC vial.  2.2.1.2 Preparation of FAMEs from leaves  0.1 g rosette leaves were transferred into 1 cm x 10 cm glass tube with Teflon screw caps and 1 ml of 1 N methanolic-HCI was added. 300 pl toluene with 6.25 pg triheptadecanoin was added to each sample as internal standard. Samples were vortexed for 30 seconds and heated at 80 °C for 1-2 hours. During the heat-extraction, samples were vortexed for appromixately 15 seconds every 20 minutes. Samples were then cooled down on ice, and 0.5 ml 0.9% NaCI (w/v) and 1 ml hexane were added. The samples were vortexed vigorously and 350 pl hexane (the top phase) was drawn and transferred to a GC vial. The samples were dried under N2, resuspended in 30 pl hexane, and transferred into the conical glass inserts. The glass inserts containing FAMEs were placed into GC vials. The vials were capped and loaded on the GC.  2.2.2 Gas chromatographic analysis of FAMEs  FAMEs were separated using a 30 m x 0.25 mm DB-23 capillary column and helium as the carrying gas in a Hewlett Packard 6890 gas chromatograph, and detected by flame ionization detector under the following conditions: injector temperature, 280 °C; detector temperature, 300 °C; program: 180 °C for 1 min followed by an increase at 4 °C/min to 240 °C which was maintained for a further 3 min; column flow, 7.4 ml/min at a split vent ratio of 10:1. FAMEs were identified by comparison with 16  the retention times of reference standards, or confirmed by GC-MS (gas chromatography-mass spectrometry) analysis of representative samples. FAMEs were quantified by comparing the areas of major peaks with those of internal standards. The weight of FAMEs were obtained by the weight of triheptadecanoin added in the beginning as internal standard multiplied by the ratio of areas of FAMEs to the area of triheptadecanoin. Then the weight of FAMEs per unit seed weight or per unit leaf weight was calculated.  2.3 Wax extraction and analysis 2.3.1 Wax extraction  Stems of mature, senesced plants were immersed for 30 seconds in chloroform containing 5 pl of 1 pg/pl C24:0 alkane as an internal standard. The same stems were then re-extracted with pure chloroform for 30 seconds, and the two chloroform extracts containing wax were pooled, and evaporated to dryness under a stream of nitrogen. Samples were transferred to GC vials. 10 pl N,O-bis(trimethylsilyl)-trifluoroacetamide (BSTFA) and 10 pl pyridine were added and samples were heated at 70 °C for 1 hour. BSTFA reacts with OH group catalyzed by pyridine in order to protect the gas chromatography capillary column because the boiling temperatures of chemicals containing OH group are higher so that they are not easy to transfer into gas form and liquid retaining in the column is harmful for column. BSTFA and pyridine were then removed under the stream of nitrogen. 100 pl chloroform was added into wax samples and the vials were loaded on the GC.  2.3.2 Gas chromatographic analysis of wax  Wax components were separated using a 30m x 0.32mm HP-1 capillary column and helium as the carrying gas with constant flow of 2 m l/m in in an Agilent Avondale 5890N gas chromatograph, and detected by flame ionization detector. GC was carried out with temperature-programmed on-column injection at 50 °C, detector temperature at 300 °C , oven 2 min at 50 °C , raised by 40°C /min to 200 °C , held for 2 min at 200 °C , 17  raised by 3 °C /min to 320 °C and held for 30 min at 320 °C. Wax composition was determined by comparing peak retention times with those of reference standards, and by a GC-MS (gas chromatography-mass spectrometry) analysis of representative samples. Wax loads were estimated by quantifying the areas of major peaks in comparison with the internal standard. Then wax load per unit stem area was obtained using wax load over by area of stems used wax wax extraction.  2.3.3 Scanning electron microscopy  The top 2.5 cm of the stern was affixed to an aluminum stub after removal of flowers. The tissue was frozen at -180 °C for 5 minutes under vacuum. Frozen specimens were visualized with a Hitachi S4700 scanning electron microscope (Hitachi High-Technologies Canada, Toronto, Canada) at an accelerating voltage of 2-5 kV.  2.4 Seed permeability and mucilage analyses 2.4.1 Tetrazolium red staining  Arabidopsis dry seeds were incubated in an aqueous solution of 1% (w/v) tetrazolium red (2,3,5-triphenyltetrazolium) at 30 °C for 4 to 48 hours (Debeaujon et al., 2000). The stained seeds were observed and photographed using dissecting microscope (Leica DFC 350 FX, Leica Microsystems Ltd, Heerbrugg, Germany).  2.4.2 Ruthenium red staining  Arabidopsis mature seeds were immersed in water for 2 hours and then transferred into an aqueous solution of 0.01% (w/v) ruthenium red for 15 min at room temperature. Seeds were rinsed in water before imaging (Western et al., 2000). The stained seeds were observed and photographed using dissecting microscope (Leica DFC 350 FX, Leica Microsystems Ltd, Heerbrugg, Germany).  18  2.5 Positional cloning 2.5.1 xtcl mapping  An xtcl mutant (ecotype Landsberg erecta) was crossed with a wild type (ecotype Columbia) plant. F 1 plants were grown and allowed to self-pollinate. The 410 xtcl mutants, identified from approximately 1700  F2  plants, served as a mapping  population. The protocol for plant genomic DNA extraction was modified from that of Whatman FTA® (http://www.whatman.com/products) . A small leaf cut from each plant was pressed on the FTA sheet through Parafilm using a glass tube to make a print of the sample onto the FTA sheet. The sample was dried at room temperature for at least one hour. 50 pl of the FTA reagent, composed of 10 mM Tris pH7.5, 2 mM EDTA and 0.1% Tween 20 was added into PCR tubes. FTA discs measuring 1.2 mm for each sample were punched from the FTA sheet using 1.2 mm Harris Micro punch (Whatman, Inc. US), and placed in PCR tubes containing 50 pl FTA reagent. FTA reagent was then removed and the discs were rinsed twice with 200 pl TE-1 solution, composed of 10 mM pH 8.0 Tris and 0.1 mM EDTA. Following the removal of all the liquid from the PCR tubes, the DNA was ready for PCR. SSLP (Simple Sequence Length Polymorphism) or CAPS (Cleaved Amplified Polymorphic Sequence) markers were used to determine the map position of the xtcl locus. Initially, the rough map position of xtcl was established by scoring the genotype of each F2 plants from the mapping population as parental (Ler) or recombinant (heterozygote or Col). Depending on the recombination frequencies obtained with more distant markers, markers positioned closer and closer to the XTC1 locus were selected and scored. Finally, the chromosomal location of the xtcl gene was narrowed down to the 100 kb region between T27G7-3 and F22013-1 markers, for which one or three of the F2 plants had recombinant genotypes respectively. Table 2.3 shows the names and types of markers used, primer sequences and PCR conditions used for amplification, resulting fragment sizes for both ecotypes and restriction enzyme used in the case of CAPS markers. Positions and conditions for markers were obtained from 19  the TAIR website (www.arabidopsis.org ), and the markers were designed based on polymorphisms listed in the Cereon database (www.arabidopsis.org/browse/Cereon/) . F9L1 marker was obtained from Dr. Xin Li (Department of Botany, University of British Columbia). PCR reaction volume was 20 pl and 6 pM of each primer was used. The PCR protocol used was 4 minutes of denaturation at 94 °C, followed by 30 cycles of 30 s denaturation at 94 °C, 40 s annealing usually at 56 °C and 40 s externsion at 72 °C and final 5 minutes extension at 72 °C in an MJ PTC-200 thermocycler (MJ Research, Massachusetts, USA). After amplification, PCR products were separated by electrophoresis on 2%-4% agarose-TAE gels, with agarose concentrations depending on the size difference of the Ler and Col fragments. The gels were stained with ethidium bromide before viewing and image capture using an Alphalmager 1220 UV transilluminator (Alpha Innotech Corporation) digital camera.  2.5.2 Identification of the XTC1 gene  The 100 kb genomic region identified by fine-mapping contained 21 annotated genes within the 100 kb target region. The presence of a searchable database of an Arabidopsis T-DNA mutagenized population created by the SALK institute http://signal.salk.edu/cgi-bin/tdnaexpress?TDNA=S16&INTERVAL=100 made it possible to search for inserts in these 21 genes. One T-DNA insertion line for each of the 21 annotated XTC1 candidate genes was ordered from the Arabidopsis stock center. Around 50 seeds of each line were germinated on AT-agar plates, then transplanted to soil and grown to maturity to check their stem wax phenotypes. Two plants from the SALK_020856 line with a T-DNA insertion in FATB gene showed wax-deficient stem phenotype, suggesting that FATB is the gene responsible for the xtcl mutant phenotype.  20  Marker  BAC  Type  F primer  R primer  Ler  Col  fragment fragment Fl 2K11  F 1 2K11  SSLP  gaagagcctgtcaccaactacg  tcgaatctaaccaaatgtcttcagg  181  226  F9L1  F9L1  SSLP  tgtgcatggtattataggtgg  aatcgcctactatatctttcag  200  140  T23G18  T23G18  SSLP  atgagtggccaagtgttacg  caacaagaagcagtacactg  183  199  F7G19  F7G19  SSLP  ggatgcattacaagtcaacagg  cagacagaacatggatatgggt  278  322  T27G7-1  T27G7  SSLP  cttcaggcccatattcgtttg  tcttatcctttgaggctttcag  128  138  T27G7-2  T27G7  SSLP  gtgcctacaggattgatgcc  agactaagaatttcaacctgatg  233  253  T27G7-3  T27G7  SSLP  tagcttcatcgacgatgtcag  ctactatccaatcatgtgttcg  194  214  F22013-1  F22013  SSLP  catatgattactgcgatgctt  gaggataattctcgctatgc  111  117  F22013-2 F22013  CAPS  tatgacatacctaggaaacgag  gaccacatgtcacctttagga  390,180  570  Table 2.3. Markers used to fine-map XTC1 . Rsal restriction enzyme is used for CAPS marker F22013-2.  In order to test whether FATB gene was mutated in xtcl, sequence of the FATB gene in xtcl mutant was determined and compared to the wild type. To prepare genomic DNA for sequencing, a small amount of tissue was placed in a 1.5 ml microfuge tube containing liquid nitrogen. The tissue was ground to powder and 750 pl of extraction buffer (composition given in Table 2.4) was added to the microfuge tube rinsing any tissue from the pestle. The microfuge tube was vortexed to suspend the tissue in the buffer and was incubated at 65 °C for 10 minutes. 200 pl 3M/5M potassium acetate was then added the sample, vortexed briefly and placed on ice for 20 minutes. The supernatant was transferred to a fresh microfuge tube. 750 pl of isopropanol was added and the sample was mixed by inverting the tube several times to precipitate the DNA. After centrifugation for 10 minutes to pellet the DNA, the supernatant was discarded and 500 pl of 70% ethanol was added to wash the DNA. Ethanol was removed from the tube again and the DNA pellet was dried in air for 5 minutes with the tubes inverted. The DNA pellet was dissolved in 50 pl of TE and the DNA was stored at -20 °C until use. 21  Extraction buffer  400 ml  50 mM Tris-HC1, pH 8.0  20 ml  1M  10 mM EDTA, pH 8.0  8 ml  0.5 M  100mM sodium chloride  8 ml  5M  1% SDS  40 ml  ddH2O  324 ml  10%  Table 2.4. Extraction buffer composition and protocol for making 400 ml of solution.  Primers for sequencing coding regions of FATB are listed in table 2.5. The PCR protocol included a 4 min denaturation at 94 °C, followed by 30 cycles of 30 s denaturation at 94 °C, 40 s annealing at 56 °C and 45 s extension at 72 °C, and a final 5 minute extension at 72 °C. PCR products were checked by electrophoresis on 2% agarose-TAE gel to determine whether the PCR fragments of the correct size were obtained. PCR products were sent for sequencing using the di-deoxy chain termination method with BIG dye 3.0 (Applied Biosystems) and a PRISM 377 automated sequencer (Applied Biosystems; NAPS unit, Michael Smith Laboratories, UBC). The sequences obtained from the wild type and mutant DNA were aligned and compared using DNAstar software (DNASTAR Inc., Madison, USA) Primer name  Primer sequence  fatbflF  tggcagtgtctttgaacgctt  fatbf1R  ccagtgacaacaggtaaccg  fatbf2F  tatgtatgaacaagctcttatgc  fatbf2R  accaatgaatgatcagatgaaga  fatbf3F  ttggtctcatgggttagctatt  fatbf3R  gagagtcttacaagctggtca  fatbf4F  atgttcgatctggtctcactgt  fatbf4R  caagcaaggtggtagtagcag  Table 2.5. Primers used for sequencing the FATB gene in wild type and xtc/.  22  Wild type FATB gene was also transformed into the xtcl mutant to check whether it could rescue the xtcl phenotype. FATB coding region was amplified by PCR using genomic Arabidopsis DNA as a template with the oligonucleotide primers 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGTGGCCACCTCTGCTAC-3' and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACGGTGCAGTTCC CCAAGTT-3' and high fidelity PCR enzyme mix (Fermentas). After checking the size of the PCR fragment by electrophoresis on 2% agarose-TAE gel, the PCR product was purified using PureLink TM PCR Purification Kit (Invitrogen). Gateway technology-containing 35S promoter involving a BP reaction and an LR reaction was used to prepare the FATBT-DNA construct. 7 pl of the PCR product (> 10 ng/pl), 1 pl of donor vector pMD400 (150 ng/pl) and 2 pl of BP clonase TM enzyme mix were added to a 1.5 ml microcentrifuge tube at room temperature. The sample was mixed well by vortexing twice and microcentrifuged. The reaction was incubated at 25 °C overnight. In order to terminate the reaction 1pl of the Proteinase K solution was added to the sample and the sample was incubated at 37 °C for 10 minutes. For transformation of E. cofi 5 pl of BP reaction was added to Subcloning Efficiency TM DH5a Competent Cells  (Invitrogen) and was mixed gently. The tube was incubated on ice for 30 minutes. Cells were then heat shocked for 20 seconds in a 37 °C water bath without shaking. After heat shock the tubes were placed on ice for 2 minutes. 300-400 pl of LB medium was added to each tube and incubated at 37 °C for 1-4 hours with shaking at 225 rpm. The transformation mix was then spread on LB plates with antibiotics and the plates were incubated overnight at 37 °C. The colonies were checked by colony PCR, and those containing inserts of appropriate size were grown in liquid LB with antibiotics overnight at 37 °C. Plasmids were extracted using GeneJET TM Plasm id Miniprep Kit (Fermentas). LR reaction was performed by mixing 7 pl of entry clone of BP reaction (50-150 ng), 1 pl of destination vector pMDC32 (150 ng/pl) and 2 pl of LR Clonase TM II enzyme mix, and incubation at 25 °C overnight. The reaction was terminated by adding 1 pl of the Proteinase K solution and incubation at 37 °C for 10 minutes. Transformation of LR reaction into Subcloning Efficiency TM DH5a Competent Cells and Extraction of plasm ids using GeneJET TM Plasmid Miniprep Kit were preformed as described before. 23  The 35S promoter::FATB construct (Figure 2.1) was introduced into Agrobacteria, which were then used to transform Arabidopsis. The seeds of the plants receiving the 35S promoter:: FATB construct were identified on the AT-agar plates due to their resistance to hygromycin (25 pM/m1). Hygromycin resistant seedlings looked normal, while non-resistant ones appeared smaller and had very short roots. The hygromycin resistant seedlings were transferred into soil and wax load on their stems was examined in comparison with the wild type.  1111-  2 X 35S  ^N  os  Figure 2.1. Diagram of the T-DNA construct containing the FATB coding region used to transform Arabidopsis to check whether FATB can rescue the xtcl mutant phenotype.  2.5.3 Salk T-DNA insertion line analysis  To confirm the presence of the T-DNA insert in the Salk line, PCR was used to amplify a fragment including the T-DNA and flanking genomic sequence. To do this, genomic DNA was extracted using Whatman FTA® described before, and it served as template for amplification. The primers used were a T-DNA left border specific primer (5'-AGTTGCAGCAAGCGGTCCACGC-3') and a genomic DNA primer specific to FATB (5'-CGTGCTTGTTTAGCTGGAAAC-3'). Cycling conditions for the PCR reaction  were: an initial denaturation at 94 °C for 4 minutes, followed by 30 cycles of 94 °C, 30 s; 55 °C, 40 s; 72 °C 1.5 min; and a final extension at 72 °C for 10 minutes. The reaction was carried out in an MJ PTC-200 thermocycler. PCR products were sent for sequencing using the di-deoxy chain termination method with BIG dye 3.0 (Applied Biosystems) and a PRISM 377 automated sequencer (Applied Biosystems; NAPS unit, Biotech lab, UBC).  2.5.4 Complementation test  Complementation test was carried out in order to check whether xtcl was allelic to fatb-ko and sa1k020856 mutant lines. For each flower to be crossed on the female 24  parent, the sepals, petals and anthers were carefully removed, but the carpel was left intact. An open flower from the male parent was then selected, and held near the base with the forceps. The convex surface of the anthers was brushed against the stigmatic surface of the exposed carpel on the female parent. The crosses were labeled and allowed to grow to obtain mature seeds. The stem wax-deficient phenotype was scored by comparison with wild type stems.  2.6 Gene expression analysis 2.6.1 RT-PCR analysis Total RNA was extracted using Rneasy R Plant Mini Kit (Qiagen Inc.) according to the manufacturer's protocol. 100 mg of young rosette leaves were weighed and ground thoroughly with a mortar and pestle in liquid nitrogen. 450 pl of Buffer RLT (Rneasy Lysis Buffer) containing 13-mercaptoethanol was added to the tissue powder and was vortexed vigorously. The lysate was pipetted directly onto a QlAshredder spin column and was centrifuged for 2 minutes at maximum speed. The supernatant was carefully transferred to a new microfuge tube. 0.5 volume (usually 225 pl) ethanol (96-100%) was added to the cleared lysate and was mixed immediately by pipetting. The sample was applied to an Rneasy mini column and centrifuged for 15 s at >10000 rpm. After the flow-through was discarded, 700 pl of Buffer RW1 was added to the RNeasy colum, centrifuged for 15 s at >10,000 rpm, and the flow-through was discarded. 500 pl Buffer RPE was added into the RNeasy column and centrifuged for 15 s at >10,000 rpm to wash the column twice. The RNeasy column was transferred to a new 1.5 ml collection tube and 30-50 pl of RNeasy-free water was pipetted onto the RNeasy silica-gel membrane and centrifuged for 1 min at >10,000 rpm to elute RNA. Total RNA was used for cDNA synthesis by SuperScript polymerase (Invitrogen Life Technologies) following the manufacturer's protocol. 2 ug of total RNA, 2 ul of 30 pM oligo dT, 1p1 of 10mM dNTPs and 8 pl of ddH2O were mixed and incubated for 5 minutes at 65 °C. The sample was transferred to ice immediately and spun briefly. 4 pl of SxFirst strand Buffer, 2 pl of 0.1 M DTT, 1 pl of SuperScript polymerase II and 1 pl 25  ddH2O were added to the reaction, and incubated at 42 °C for 50 minutes. The sample was then transferred to 70 °C for 15 minutes. Finaly 1 pl of RNAase H was added and the sample was placed at 37 °C for 20 minutes in order to terminate the reaction. Gene specific and intron spanning primers were designed to be able to differentiate the product generated from cDNA from any product obtained from contaminating genomic DNA. The pair of primers was fatbrtf (5'-AGGTTCGAGGGGAAATAGAGC-3') and fatbrtr (5'-CGATATCGCAACCCGTAACTG-3'). PCR conditions used were as follows: initial denaturation for 4 minutes at 94 °C, followed by 24 cycles of 30 s denaturation at 94 °C, 40 s annealing at 58 °C and 40 s extension at 72 °C, and a final 5 min extension at 72 °C. The PCR products were seperated by electrophoresis in a 1.2°A, agarose-TAE gel. Gels were stained with ethidium bromide and visualized and photographed using Alphalmager 1220 UV transilluminator and digital camera.  2.6.2 GUS analysis 2.6.2.1 XTC1 promoter::GUS construct preparation  The 2037 nucleotides immediately upstream of the FATB coding region were amplified by PCR from genomic Arabidopsis DNA using the oligonucleotide primers 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTAGACGTATGCTAAGCATGCT -3' and 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGACGAGGAGATGAA GCGCTCA -3' and high fidelity PCR enzyme mix (Fermentas). After checking the size of the PCR fragment by electrophoresis on a 1.2% agarose-TAE gel, the PCR product was purified using PureLink TM PCR Purification Kit (Invitrogen). The XTC1 promoter::GUS construct was prepared using the Gateway cloning strategy described earlier (Figure 2.2), and was then used to transform Arabidopsis.  —  IIIII  —  Nos T  -11111H111  Figure 2.2. Diagram of the T-DNA construct containing the XTC1 promoter-GUS gene fusion used to transform Arabidopsis to evaluate the tissue specificity of XTC1 expression.  26  2.6.2.2 Isolation of transgenic plants  The seeds of the plants transfomed with the XTC1 promoter::GUS construct were harvested and planted on the AT-agar plates containing hygromycin antibiotics (25 uM/m1). The hygromycin resistant seedlings were transferred into soil and GUS activity was examined in various tissues.  2.6.2.3 GUS activity assays  Tissues of XTClpromoter::GUS transgenic Arabidopsis plants were incubated in GUS assay buffer containing 100 mM NaH2PO4, 10 mM Na2EDTA, 0.5 mM K ferrocyanide, 0.5mM K ferricyanide, 0.1% Triton X-100 and 1 mM 5-bromo-4-chloro-3-indoly1-0-D-glucuronide (X-gluc) at 37 °C for 0.5 hours to overnight. The reaction was stopped by removal of the assay buffer and the addition of 70% ethanol. Samples were cleared by incubation in 70% ethanol overnight at 4 °C. Pictures were taken by using dissecting microscope (Leica DFC 350 FX, Leica Microsystems Ltd, Heerbrugg, Germany). In order to check GUS activity in embryos, a few additional procedures had to be carried out after X-GLUC staining and 70% ethanol clearing. Ovules were mounted in 8:1:2 chloral hydrate:glycerol:water on a microscope slide with a cover slip and left for a period of 1 to 16 hours, depending on the result of the dehydration. Embryos were removed from the ovules by applying pressure on the cover slip. Staining patterns were analyzed with an Optiphot-2 microscope (Nikon Corp., Tokyo, Japan) using DIC optics.  2.7 Analysis of cell morphology by transmission electron microscopy  Rosette leaves and stems from 3-week-old wild type and xtcl mutant plants were fixed for 2 hours at room temperature in 2% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.2, followed by a secondary fixation in 1% osmium tetroxide in the same buffer for 1 hour. After this double fixation, samples are dehydrated in a graded series of ethanol: 30%, 50%, 70%, 80%, 90%, 100%, 10 minutes per change at room temperature on a rotary shaker. Then the tissue was infiltrated with 1/3 Spurr's 27  resin (1 part resin: 2 parts 100% ethanol) for 1 hour at room temperature and with 2/3 Spurr's resin (2 parts resin: 1 part 100% ethanol) for 2 hours at room temperature and two changes of 100% Spurr's resin, for 2 hours and overnight at room temperature. The sample was embedded in fresh Spurr's resin and polymerized for 6 to 8 hours at 70 °C. After polymerization, thin sections (-70 to 90 nm) were cut using an ultramicrotome and stained with uranyl acetate and lead citrate prior to examination in a Hitachi H7600 transmission electron microscope equipped with a CCD camera (Hamamatsu, ORCA).  28  Chapter 3: Results 3.1 Phenotypic characterization of the xtcl mutant 3.1.1 Biochemical and morphological analysis of cuticular wax on xtcl stems  As described in Chapter 1, Conway and Poethig have reported that xtcl stems have a bright green, glossy appearance under high light intensity, in contrast to the glaucous appearance of the WT stems (Conway and Poethig, 1997). Wax extraction followed by GC-FID analysis shows that total stem wax load of xtcl is three fold lower compared to that of the wild type (Figure 3.1). This includes all the wax components present on influorescence stems, produced by both the acyl reduction pathway and the decarbonylation pathway. For example, C29 alkane, C29 ketone and C29 secondary alcohol, the major products of decarbonylation pathway, and C28 primary alcohol of the acyl reduction pathway, are decreased dramatically. In contrast to the total wax load, wax composition of the xtcl mutant is not different from the WT (Figure 3.2).  25 20 cl 15 10  3  ■ LerWT ^ xtcl  5  0  Figure 3.1. Total wax loads on stems of wild type and xtcl Arabidopsis plants. Each bar represents the mean of five independent analyses of wax extracts from five pooled individuals. Error bars indicate standard deviations.  29  9. 0 8. 0 7. 0  ■ LerWT  5. 0 ct 4.0  ^ xtcl  I) 0  0.0 C30  C24 C26 C28 C30^C40 C42 C44 C46  Fatty Primary alcohols acids  Esters  C28 C30^C27 C29 C31^C29^C29  Aldehydes^Alkali(  Secondar Ketone alcohols  Figure 3.2. Cuticular wax composition on stems of Ler wild type and xtcl Arabidopsis plants. Each bar represents the amount of a specific wax constituent, labeled on the x-axis by a chemical class and a carbon chain length. Each value is the mean of five independent analyses of wax extracts from five pooled individuals. Error bars indicate standard deviations.  The influorescence stems of xtcl look glossy, suggesting that the density and/or the shape of epicuticular wax crystals are changed by mutation. I therefore examined wax crystals on the xtcl and wild type stems by cryo-scanning electron microscopy. Vertical rods, tubes, longitudinal bundles of rodlets, horizontal, reticulate platelets exist on the surface of wild type stems. However, xtcl stems are almost devoid of crystals, with only some plates present on the relatively smooth surface (Figure 3.3).  30  1500 X magnification  5000 X magnification  Le riNT  ^  xtc I  Figure 3.3. Epicuticular wax crystal density is lower on xtcl stems in comparison to the wild type.  3.1.2 Fatty acid compositions of leaves and seeds in xtcl mutant  Levels of all the wax components in xtcl mutant are significantly decreased, suggesting that the content or composition of fatty acid precursors could be changed. Therefore, I determined fatty acid compositions of leaves and seeds by GC analysis after their conversion to fatty acid methyl esters. As shown in Table 3.1, the levels of fatty acids in xtcl leaves are lower than the wild type, except 18:1 fatty acid. The total amount of saturated fatty acids (16:0 and 18:0) providing substrates for fatty acid elongation are especially low, reaching only 58% of wild type levels, while the total content of unsaturated fatty acids in xtcl leaves is reduced by 24% in comparison to wild type.  31  Fatty acid  LerWT(.tg/g)  xtc/(gg/g)  16:0  138.17 ±7. 77  85.74 ±3. 13  16:3  29.99 ±0. 06  23.64 ±1. 28  18:0  10.42 ±0. 39  4.31 +0. 53  18:1  16.59 ±0. 21  27.02 +1. 32  18:2  84.74 ±2. 26  71.73 ±5. 95  18:3  164.92 ± 8. 43  102.85 ± 15. 66  Table 3.1. Fatty acid composition of wild type (Ler) and xtcl leaves from three-week-old plants.  The data from the seed fatty acid compositional analysis of xtcl are shown in table 3.2. Levels of all fatty acid compositions are reduced compared with those of wild type. Similar to the leaf, the total saturated fatty acid and unsaturated fatty acid amount are reduced by 55% and 20% respectively, in xtcl seeds.  Fatty acid  LerWT(%)  xtcl (%)  16:0 18:0  4.34 +O. 98 1.99 +O. 45  1.50 +O. 41 1.11 +O. 30  18:1  12.38 ±3. 18  11.31 ±2. 65  18:2  17.16 ±4. 09  14.31 ±4. 03  18:3  12.43 ±2. 87  8.68 ±2. 49  20:0  1.15 +0. 27  0.73 ±0. 19  20:1  13.58 ±3. 79  10.49 ±2. 69  20:2  0.99 +0. 22  0.64 ±0. 18  22:0  0.26 ±0. 06  0.14 ±0. 04  22:1  1.06 ±0. 27  0.92 ±0. 26  Table 3.2. Fatty acid composition of wild type (Ler) and xtcl seeds.  Taken together, my results demonstrate that there is a major reduction in fatty acid content in leaves and seeds of xtcl mutant, and that xtcl mutation has a more 32  significant effect on saturated fatty acid content than unsaturated fatty acid content.  3.1.3 Seed morphology, permeability and mucilage accumulation  In Arabidopsis seeds, embryo and endosperm accumulate fatty acids predominately in storage triacylglycerols, but fatty acids are also major components of cutin and suberin in the seed coat (Molina et al., 2006). Altered fatty acid composition of xtcl seeds promoted me to investigate whether seed morphology, permeability and seed coat mucilage accumulation are changed in the xtcl mutant. Mature xtcl mutant seeds displayed a range of deformity in seed morphology (Figure 3.4), possibly caused by defects in seed or embryo development. For example, it has been previously established that the globular-to-heart transition is delayed in xtcl embryos(Conway and Poethig, 1997).  Ler-WT  ^  XtC1  Figure 3.4. Wild type Arabidopsis seeds and deformed seeds from xtcl mutant.  Tetrazolium red, a cationic dye, is used to test permeability properties of seed coat. Tetrazolium red is normally excluded by the Arabidopsis seed coat but is reduced to red products by NADPH-dependent reductases after entering the embryo (Debeaujon, 2000). After staining for 24 hours, xtcl embryos were coloured bright red, whereas the 33  wild type embryos were not. Thus, the xtcl seed coat appears to be more permeable to tetrazolium red than wild type seed coat (Figure 3.5.).  Le1WT  ^  xtc  Figure 3.5. Tetrazolium salt staining of Ler wild type and )(to/ seeds.  Mucilage in the seed coat is principally composed of rhamnogalacturonan I polysaccharide (Western et al., 2000). In Arabidopsis mature seeds, mucilage is present in a dehydrated form within each epidermal cell. Once in contact with water, seeds release mucilage from the seed coat epidermis that expands to form a viscous coating over the seed. Mucilage can be visualized by staining with ruthenium red, which binds to negatively charged biopolymers such as pectin and DNA (Hanke, 1975; Koornneef, 1981). Observation of imbibed xtcl seeds using ruthenium red indicated that they were deficient in mucilage extrusion when in contact with water. It was not determined whether xtcl mutant produces less mucilage or if the seed is not capable of releasing mucilage without further morphological inspection. It is safe to conclude that XTC1 mutation leads to a defect in seed mucilage extrusion.  34  Lei VVT  ^  xtrl  Figure 3.6. Imbibed Ler wild type and xtcl seeds stained with 0.2% ruthenium red.  3.2 Positional cloning of XTC1 3.2.1 xtcl mapping  To generate the mapping population, I crossed the xtcl line in the Landsberg erecta background with the wild type of the Columbia ecotype. The xtcl mutants  identified in the F2 generation serve as my mapping population. I isolated DNA from 410 mutant F2 plants, and fine-mapped the xtcl mutation by scoring the population for recombination events between the mutant phenotype and the parental Ler or recombinant Col forms of SSLP or CAPS markers. Markers used for rough and fine mapping are indicated on the chromosome with the number of recombinants below shown in Figure 3.7. I narrowed down the location of XTC1 gene to a region of chromosome 1 spanning 100 kb, which includes 21 open reading frames annotated in the Arabidopsis genome database (Figure 3.7).  3.2.2 Identification of the XTC1 gene  To identify the XTC1 gene, I selected one T-DNA insertional mutant for each of the 21 open reading frames that fall within the 100 kb region of interest, and obtained the 35  ^  seed from the Salk Institute for Genome Analysis Laboratory. Of the 21 T-DNA mutant lines examined, only SALK_020856 with the T-DNA insertion into At1g08510 shows a wax-deficient phenotype, suggesting that At1g08510 may be XTC1.  F12K11^  F9L1  Chr.1  I  I .. ♦^ T23G18^F7G19 . .. /  I^ . J^l  2.02^, - ,^ . ,^ . ,-- T27G7-1^F22013-1^NN  1  J^1. ^I  200kb %  1100kb  3.10 MB 35kb  2.57 „--'2.63^2.7e -- • ^2.85 MB 10kb =  T27 r7  I^  F22Q13  T27G7-1^T27G7-2^T27G7-3^F22013-2^F22013-1 3^2^1^ 0 3 I I . .^ It . t ...^ I  At1g08510  14:KICIDEDM t>n t>= <=1"0 <1  - -4 6  -  *  —  )  —  10kb  Figure 3.7. Mapping of xtcl at the top of chromosome 1. Markers used for rough and fine mapping are indicated with the number of recombinants underneath. Open reading frames between the final markers T27G7-3 and F22013-1 were sequenced and a deletion identified in At1g08510 (indicated by *).  At1g08510 is comprised of 5 exons and 5 introns and encodes fatty acyl-ACP  thioesterase B (FATB) involved in releasing predominately saturated fatty acid (C16:0; C18:0) from the acyl carrier protein (ACP) in the plastid (Bonaventure et al., 2003). To 36  examine the sequence of the At1g08510 gene in Ler wild type and xtcl mutant I extracted genomic DNA from these two plants and used them as templates to PCR-amplify this gene for sequencing. A comparison of the At1g08510 sequence between Ler wild type and xtcl mutant revealed a 14 by deletion at the end of the first exon of the mutated gene (Figure 3.8 B). This deletion results in a premature stop codon in the predicted FATB mRNA in the xtcl mutant (Figure 3.8 C).  Start  Stop 5  250bp  B  N  F S I R S Y E I G AD•R  FATB PAT TTTT CTATTAGGICATAT GAAATAGOTOCT GATC GC 1109 xtc 7 AATITTTCTATTAGOT ^ OCTGATCOC 1095 N  FSIRC- ^  stop  Figure 3.8. (A) Intron-exon structure of the At1g08510 gene. The mutation in xtcl (*) lies close to the stop codon in exon 1. (B) DNA sequence alignment of xtcl and FATB genes and the predicted sequence of their gene products indicating that the 14 by deletion in At1g08510 in xtcl mutant results in a stop codon.  In order to further verify whether the mutation in At1g08510 (FATB) causes the xtcl mutant phenotype, I transformed wild type At1g08510 (FATB) gene into the xtcl  line to try to rescue its phenotype. The genomic fragment used to complement the xtcl mutant included a 1.9 kb coding sequence comprised of 5 exons and 5 introns driven by 35S over expression promoter. I obtained eight hygromycin-resistant seedlings. The stems of all hygromycin-resistant plants called xtcl-WT exhibited glaucous wild type-like phenotype, instead of glossy wax-deficient mutant phenotype. In addition, other xtcl-associated phenotypes were also complemented, for example dwarf size of the plant (Figure 3.3). The total stem wax load of the rescued mutant detected by 37  GC-FID was 26.27 pg/cm 2 , much higher than the 5.98 pg/cm 2 measured for the mutant, and even higher than the Ler WT which accumulated 18.71 pg/cm 2 , perhaps because I used the CaMV 35S promoter in the complementation experiment. Taken together, my squencing and complementation data indicate XTC1 corresponds to At1g08510  (FATB).  Figure 3.9. Phenotypes of 5-week-old Ler wild type (left), xtcl (middle) and xtcl WT (right) plants. -  3.2.3 Salk T-DNA insertional allele analysis  To further characterize the T-DNA mutant SALK_020856, it was necessary to determine the exact site of the T-DNA insertion within the FATB gene. According to the information from SIGnAL "T-DNA Express" Arabidopsis mapping tool, the location of 38  T-DNA in the SALK_020856 line is in the fourth exon. However, the SIGaAL information about the location of inserted T-DNA is sometimes not correct. To verify the reported T-DNA insertional site and to ensure that the wax-deficient phenotype of SALK_020856 was indeed caused by the T-DNA insertion in FATB gene. I extracted the genomic DNA from this mutant, and used it as template for PCR-amplification of FATB for sequencing. The location of T-DNA is 1817 by away from the predicted  translation start site, close to the end of the fifth exon, based on a comparison with Ler wild type FATB gene sequence (Figure 3.10)  FATB GAACAGAGTOGA(;TAGTAA 1829 sALK 0208;6 GAArAi; A 1 4 '1 At 'AITk ^1:429 Figure 3.10. DNA sequence alignment of SALK_020856 and FATB genes indicating that the location of T-DNA is 1817 by away from the predicted translation start site. T-DNA sequence is underlined.  3.2.4 xtcl and sa1k020856 are allelic to fatb  So far my work has demonstrated that xtcl and SALK_ 020856 both have mutations in the At1g08510 gene, xtcl has a 14 by deletion at the end of first exon, and SALK_020856 has a T-DNA insertion at the end of the fifth exon. At1g08510 gene encodes the FATB protein, and an Arabidopsis mutant called fatb with a T-DNA insertion in the third intron of the FATB gene has been identified (Bonaventure et al., 2003). To confirm that xtcl and SALK _ 020856 are allelic to fatb, I performed a genetic complementation test by carrying out a series of crosses were carried out listed in table 3.3. In each case the F 1 generation from a cross between two mutants exhibits a wax-deficient phenotype, while the F1 from the crosses between mutant lines and wild type shows a wild type phenotype. The results of genetic complementation test indicate that xtcl and salk020856 are alleles of fatb. Therefore, we designate fatb as  fatb-1, xtcl as fatb-2, sa1k020856 as fatb-3.  39  Cross  Phenotype  fatb X xtcl  Mutant  xtcl X fatb  Mutant  sa1k020856 X xtcl  Mutant  xtcl X sa1k020856  Mutant  Col-WT X sa/k020856  Wild type  Col-WT X xtcl  Wild type  Ler-WT X xtcl  Wild type  Table 3.3. Complementation crosses performed between the wild type and fatb mutant lines. The right column shows the phenotype of the F1 progeny of each cross.  All fatb alleles had extra cotyledons, wax-deficient influorescence stems, altered fatty acid compositions in leaves and seeds, deformed seed, increased seed permeability and reduced seed mucilage extrusion. Based on my analyses of all the  fatb alleles, it appears that fatb-2 and fatb-3 have more severe phenotypes than fatb-1 (Figures 3.11 and 3.12). 4  II  OOP 41)40. L erWT  1  ^Et.  ^  fatb-2  fatb-3^fatb- I  Figure 3.11. The fatb mutant seeds show increased seed coat permeability.  40  LerWT  ColVVT  ^  fetb-3  fatb-2  fatb-1  Figure 3.12 The seeds of fatb mutants are defective in mucilage extrusion.  3.3 FATB gene expression analysis 3.3.1 RT-PCR analysis of FATB expression  RNA isolated from young leaves of wild type, fatb-2 and fatb-3 was reverse-transcribed to generate cDNA templates for PCR amplification in order to examine steady-state transcript levels of FATB gene in different fatb mutants. As is shown in Figure 3.13. FATB transcript levels in fatb-2 and fatb-3 are significantly reduced, but are not completely absent. Similarly, FATB transcript level has been reported to be >150-fold lower in fatb-1 than in wild type tissue as detected by real time PCR (Bonaventure et al., 2003).  41  A  St an^fath-2  Stop  250bp  filth 3 -  B^Ler WT fatb-2^CoIWT fatk3 FATB  GAPC  Figure 3.13. Structure of the FATB gene and transcript levels in fatb mutant lines. (A) Exon-intron structure of FATB gene. * shows 14 by deletion in fatb-2; red arrow shows T-DNA insertion site in fatb-3 and two black arrows show the positions of primer used in RT-PCR. (B) Semiquantative RT-PCR of steady-state FATB mRNA in fatb-2 and fatb-3 mutants compared to the corresponding wild-type ecotypes. Expression of GAPC was used as a loading control for the corresponding lanes above. RNA was isolated from young leaves.  3.3.2 Expression of FATB promoter-GUS fusions in transgenic Arabidopsis  To investigate the tissue specificity and timing of expression of the FATB gene, FATB promoter was fused with 0 -glucuronidase (GUS) reporter gene, and was used to transform Arabidopsis. Tissue samples of three independent transgenic Arabidopsis lines were stained for GUS activity. Figure 3.14. shows the expression patterns of FATB detected in FATB promoter:GUS lines. In seedlings, GUS activity was found in leaves, hypocotyls and roots. GUS activity was also detected ubiquitously in mature plants, including rosette leaves, cauline leaves and stems, flowers and siliques. In floral organs, FATB is expressed in sepals, stamens and carpels. FATB expression could be detected as early as globular stage of embryo development in the embryo and suspensor. In addition, FATB is also highly expressed in the subepidermal layer of the seed coat and around the micropile where lipid products like suberin are found.  42  —2  Figure 3.14. Expression patterns of FATB detected in FATB promoter:GUS lines. Stained tissues expressing the FATB promoter:GUS reporter gene: whole seedlings (A); rosette leaves (B); cauline leaves and stems (C); flower (D); developing seed (E): embryo (arrow 1), suspensor (arrow 2), subepidermal layer of the seed coat (arrow 3) and micopile (arrow 4).  3.4 Examination of the fatb cell morphology According to the published report describing the analyses of the fatb-2 (xtcl) mutant (Conway and Poethig, 1997), the first leaf primordia ("extra cotyledons") in this line accumulate a large number of oil bodies in the cytoplasm. In addition, the fatb-2 mutant has numerous plastoglobules in the chloroplasts of extra cotyledons. These data imply that extra cotyledons have the properties of cotyledons rather than properties of true leaves. I have not investigated the fatb-2 extra cotyledons by transmission electron microscopy, but instead examined the rosette leaves of this mutant. However, leaf cells did not show any pronounced changes in chloroplast morphology, or oil body accumulation in the cytoplasm (Figure 3.15).  43  Figure 3.15. Electron micrographs of chloroplasts from 4-week-old rosette leaves of wild type (left) and the xtcl mutant (right).  44  Chapter 4: Discussion and conclusions The interesting phenotypes of the xtcl mutant that originally attracted me to study this line were wax-deficient inflorescence stems combined with large numbers of oil bodies present in the primordial of extra cotyledons (Conway and Poethig, 1997). Both of these phenotypes were suggestive of defects in lipid metabolism, and specifically wax biosynthesis or secretion. In order to further investigate the lipid-related phenotypes caused by the xtcl mutation, I analyzed cuticular wax composition and load on the xtcl stem, and examined fatty acid compositions in leaves and seeds. In addition, I also investigated xtcl seed morphology, seed coat permeability and seed mucilage extrusion. After phenotypic characterization of the xtcl mutant, I isolated the XTC1 gene by positional cloning and found out that it was identical to FATB, an already known gene encoding a plastid enzyme fatty acyl-ACP thioesterase B.  4.1 FATB plays a role in lipid metabolism  FATB is an enzyme involved in cleaving the fatty acyl-ACP thioester bond, thereby releasing a fatty acid from ACP for export from the plastid (Fig. 4.1) (Bonaventure et al., 2003). FATB disruption specifically affects saturated fatty acid (C16:0 and C18:0) release, which is required for transport across the plastid envelope, and consequently extraplastidial lipid metabolism.  7:\ittlieqs . 1113  nttIliin .mc  17c11 Wal I  Figure 4.1. FATB function is required for fatty acid elongation and wax synthesis.  45  For example, reduced export of saturated acyl groups from the plastid to the ER elongation sites, would be expected to result in decreased levels of VLCFA wax precursors, and consequently diminished wax biosynthesis. Published fatb-1 analysis data (Bonaventure et al., 2003) and my fatb-2 (xtcl) results (Figure 3.1) confirm that this is indeed the case. In addition, wax compositional analysis (Figure 3.2) demonstrates that levels of each component of the fatb-2 (xtcl) stem wax are significantly decreased compared with the wild type. Because of the central role of FATB in providing saturated acyl groups for extraplastidial lipid biosynthesis, I also determined the fatty acid compositions of leaves and seeds in fatb-2 (xtcl) and fatb-3 (sa1k020856). My results indicate that FATB disruption leads to alterations in fatty acid compositions of leaves and seeds  (Tables 3.1 and 3.2), in agreement with the data published for the fatb-1 (fatb-ko) allele (Bonaventure et al., 2003). Specifically, the content of 16:0 and 18:0 fatty acids is decreased by around 50% in the all fatb alleles. Since there are no other apparent homologues of FATB in the Arabidopsis genome (Bonaventure et al., 2003), it is surprising that a loss of FATB function does not result in complete absence of saturated fatty acids outside of the plastid. In other words, how can plants survive without a functional FATB thioesterase? Some possible explanations for this finding are discussed below. First, de novo fatty acid synthesis can also occur in plant mitochondria (Wada et al., 1997). Although this is considered a minor pathway, it may be able to compensate for low 16:0 levels in fatb mutants. Second, even though it shows a clear preference for unsaturated fatty acids (Dormann et al., 1995; Voelker et al., 1997; Salas and Ohlrogge, 2002), fatty acyl-ACP thioesterase A (FATA) may also be capable of 16:0 acyl group export from the plastid when critical for plant survival, because it shows some activity with saturated fatty acids (C16:0 and C18:0) in vitro. Third, saturated C16 and C18 acyl groups may be translocated from the plastid to the ER bound to lipids via plastid-ER associated membrane (PLAM) connections recently described by Andersson et al (Andersson et al., 2007). Fourth, we cannot  46  elongation to C22:1 and incorporated into the TAGs in the oil bodies.  4.2 FatB mutation causes extra cotyledons Positional cloning results revealed that XTC1 is identical to FATB, so it is necessary to explain how FATB disruption may result in the extra cotyledon phenotype. In the original paper describing the xtcl mutant (Conway and Poethig, 1997), the authors claimed that extra cotyledons are caused by abnormal embryo development. They found that xtcl delayed the morphogenesis of the embryo proper at globular-to-heart transition, but permitted the shoot apex development to an unusually advanced stage late in embryogenesis. They speculated that XTC1 may play regulatory roles in embryogenesis (Conway and Poethig, 1997) and that a mutation in this gene may cause embryo abnormalities. Actually, there are reports of abnormal embryogenesis caused by mutations in genes that also control lipid metabolism. For example, transcription factors LEC1 (LEAFY COTYLEDON 1), LEC2 (LEAFY COTYLEDON 2) and FUS3 (FUSCA 3) are involved in control of Arabidopsis seed oil biosynthesis as well as regulation of embryo development. The lecl, fus3, and lec2 mutations cause partial transformation of cotyledons to leaf-like organs by unknown mechanisms (Keith et al., 1994; Meinke et al., 1994; West et al., 1994). However, in these mutants, abnormal embryo development is caused by defects in transcriptional regulation, which also affected lipid metabolism. While here we show that abnormal embryo development displayed by  fatb-2 is triggered by FATB disruption through unknown mechanisms. Even though it may be possible, it is very hard to make bridges between fatb mutations and abnormal embryogenesis in that there are many possibilities. Some explanations of how the FATB disruption may affect abnormal embryo development are listed below. (1) Defective embryo development may be caused by alternation in membrane compositions and properties because altered fatty acid compositions and lower amounts of saturated fatty acids available in fatb alleles. (2) FATB disruption may affect some lipid signals possibly playing regulatory roles in embryo development. (3)  48  Palmitoylation acting as posttranslational modification plays important roles in secretion, localization and function of proteins. It is possible that a 50% decrease in 16:0 levels caused by FATB disruption affects the palmitoylation processes.  4.3 FATB disruption results in seed deformity, altered seed coat permeability and reduced mucilage extrusion All fatb alleles exhibit seed deformities, perhaps be caused by abnormal embryo development (Bonaventure et al., 2003) . In addition to seed malformation, another phenotype shared by the fatb lines, and revealed only by my analyses of these mutants, is altered seed coat permeability, (Figure. 4.3). Seed coat permeability depends on deposition of cutin and suberin, the two major types seed coat lipid polyesters (Molina et al., 2006). Because FATB function is required for the synthesis of polyester precursors such as cutin and suberin (Bonaventure et al., 2004), it is reasonable to expect that mutations in this gene would affect cutin and suberin composition, and therefore also the seed coat permeability. Another phenotype detected in fatb mutant lines is reduced mucilage extrusion when seeds are immersed in water (Fig. 4.4). It is hard to predict if fatb mutants are defective in mucilage extrusion or produce less mucilage without further anatomical investigation of mucilage accumulation and cell structure in different seed developmental stages after seed sectioning. It is possible that normal amount of mucilage is present in the seed coat but cannot be released because the structure of seed coat is changed. Alternatively, there may be much less mucilage produced in fatb mutants than in the wild type. It may be that aberrant embryogenesis disrupted seed mucilage biosynthesis, or may have delayed seed mucilage deposition. It is also possible that FATB plays a regulatory role in mucilage production and/or modification of mucilage by post-translational modification of some enzymes through palmitoylation. However, it has not been experimentally tested whether FATB disruption might have an impact on palmitoylation.  49  4.4. Conclusions The most significant finding of my research presented in this thesis is that XTC1 gene is identical to FATB, making links between a thioesterase enzyme involved in fatty acid metabolism with embryogenesis. My work also contributed information about two novel seed phenotypes shared by all fatb alleles, seed coat permeability and defective mucilage extrusion from the seed coat in contact with water. These phenotypes indicate that, in addition to embryogenesis, FATB is also required for normal seed coat development. Finally, using the FATB promoter::GUS fusion constructs in transgenic plants, I have shown that FATB is expressed ubiquitously in all plant tissues throughout the plant's life, indicating that FATB activity is important in virtually all aspects of plant lipid metabolism.  50  Literature cited Aarts, M.G., Keijzer, C.J., Stiekema, W.J., and Pereira, A. (1995). Molecular characterization of the  CER1 gene of arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell 7, 2115-2127. Agrawal, V.P., and Stumpf, P.K. (1985). Characterization and Solubilization of an Acyl Chain Elongation System in Microsomes of Leek Epidermal-Cells. Arch Biochem Biophys 240, 154-165. Agrawal, V.P., Lessire, R., and Stumpf, P.K. (1984). Biosynthesis of Very Long-Chain Fatty-Acids in Microsomes from Epidermal-Cells of Allium-Porrum L. Arch Biochem Biophys 230, 580-589. Barthlott, W., and Neinhuis, C. (1997). Purity of the sacred lotus, or escape from contamination in biological surfaces. Planta 202, 1-8. Bird, D., Beisson, F., Brigham, A., Shin, J., Greer, S., Jetter, R., Kunst, L., Wu, X.W., Yephremov, A., and Samuels, L. (2007). Characterization of Arabidopsis ABCG11/WBC11, an ATP binding cassette (ABC) transporter that is required for cuticular lipid secretion. Plant J 52, 485-498. Bonaventure, G., Salas, J.J., Pollard, M.R., and Ohlrogge, J.B. (2003). Disruption of the FATB gene in Arabidopsis demonstrates an essential role of saturated fatty acids in plant growth. Plant Cell 15, 1020-1033. Cassagne, C., and Lessire, R. (1978). Biosynthesis of Saturated Very Long-Chain Fatty-Acids by Purified Membrane-Fractions from Leek Epidermal-Cells. Arch Biochem Biophys 191, 146-152. Casson, S.A., and Lindsey, K. (2006). The turnip mutant of arabidopsis reveals that LEAFY COTYLEDON1 expression mediates the effects of auxin and sugars to promote embryonic cell identity. Plant Physiology 142, 526-541. Chen, X., Goodwin, S.M., Boroff, V.L., Liu, X., and Jenks, M.A. (2003). Cloning and characterization of the WAX2 gene of Arabidopsis involved in cuticle membrane and wax production. Plant Cell 15, 1170-1185. Chung, M., Chen, M., and Pan, S. (2000). Floral spray transformation can effeciently generate Arabidopsis transgenic plants. Transgenic Research 9, 471-476. Conway, L.J., and Poethig, R.S. (1997). Mutations of Arabidopsis thaliana that transform leaves into cotyledons. P Natl Acad Sci USA 94, 10209-10214. Debeaujon, I., Leon-Kloosterziel, K.M., and Koornneef, M. (2000). Influence of the testa on seed dormancy, germination, and longevity in Arabidopsis. Plant Physiology 122, 403-413. Debeaujon, I., Leon-Kloosterziel, K.M., and Koornneef, M. (2000). Influence of the testa on seed dormancy, germination, and longevity in Arabidopsis. Plant Physiology 122, 403-414. Denic, V., and Weissman, J.S. (2007). A molecular caliper mechanism for determining very long-chain fatty acid length. Cell 130, 663-677. Dormann, P., Voelker, T.A., and Ohlrogge, J.B. (1995). Cloning and Expression in Escherichia-Coli of a Novel Thioesterase from Arabidopsis-Thaliana Specific for Long-Chain Acyl-Acyl Carrier Proteins. Arch Biochem Biophys 316, 612-618. Dunn, T.M., Lynch, D.V., Michaelson, L.V., and Napier, J.A. (2004). A post-genomic approach to understanding sphingolipid metabolism in Arabidopsis thaliana. Ann Bot-London 93, 51  483-497. Eigenbrode, S.D., and Espelie, K.E. (1995). Effects of Plant Epicuticular Lipids on Insect Herbivores. Annual Review of Entomology 40, 171-194. Fehling, E., and Mukherjee, K.D. (1991). Acyl-Coa Elongase from a Higher-Plant (Lunaria-Annua) Metabolic Intermediates of Very-Long-Chain Acyl-Coa Products and Substrate-Specificity. Biochimica Et Biophysica Acta 1082, 239-246. Fiebig, A., Mayfield, J.A., Miley, N.L., Chau, S., Fischer, R.L., and Preuss, D. (2000). Alterations in CER6, a gene identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems. Plant Cell 12, 2001-2008. Gable, K., Garton, S., Napier, J.A., and Dunn, T.M. (2004). Functional characterization of the Arabidopsis thaliana orthologue of Tsc l3p, the enoyl reductase of the yeast microsomal fatty acid elongating system. Journal of Experimental Botany 55, 543-545. Greer, S., Wen, M., Bird, D., Wu, X.M., Samuels, L., Kunst, L., and Jetter, R. (2007). The cytochrome p450 enzyme CYP96A15 is the midchain alkane hydroxylase responsible for formation of secondary alcohols and ketones in stem cuticular wax of arabidopsis. Plant Physiology 145, 653-667. Han, G.S., Gable, K., Kohlwein, S.D., Beaudoin, F., Napier, J.A., and Dunn, T.M. (2002). The Saccharomyces cerevisiae YBR159w gene encodes the 3-ketoreductase of the microsomal fatty acid elongase. J Biol Chem 277, 35440-35449. Hanke, D.E., and Northcote, D.H. (1975). Molecular visualization of pectin and DNA by ruthenium red. Biopolymers 14, 1-17. Hannoufa, A., Negruk, V., Eisner, G., and Lemieux, B. (1996). The CER3 gene of Arabidopsis thaliana is expressed in leaves, stems, roots, flowers and apical meristems. Plant J 10, 459-467. Hooker, T.S., Millar, A.A., and Kunst, L. (2002). Significance of the expression of the CER6 condensing enzyme for cuticular wax production in Arabidopsis. Plant Physiology 129, 1568-1580. James, D.W., and Dooner, H.K. (1990). Isolation of Ems-Induced Mutants in Arabidopsis Altered in Seed Fatty-Acid Composition. Theoretical and Applied Genetics 80, 241-245. Jaworski, J.G., Clough, R.C., and Barnum, S.R. (1989). A Cerulenin Insensitive Short Chain 3-Ketoacyl-Acyl Carrier Protein Synthase in Spinacia-Oleracea Leaves. Plant Physiology 90, 41-44. Jenks, M.A., Tuttle, H.A., Eigenbrode, S.D., and Feldmann, K.A. (1995). Leaf Epicuticular Waxes of the Eceriferum Mutants in Arabidopsis. Plant Physiology 108, 369-377. Jenks, M.A., Joly, R.J., Peters, P.J., Rich, P.J., Axtell, J.D., and Ashworth, E.N. (1994). Chemically-Induced Cuticle Mutation Affecting Epidermal Conductance to Water-Vapor and Disease Susceptibility in Sorghum-Bicolor (L) Moench. Plant Physiology 105, 1239-1245. Kalscheuer, R., and Steinbuchel, A. (2003). A novel bifunctional wax ester synthase/acyl-CoA : diacylglycerol acyltransferase mediates wax ester and triacylglycerol biosynthesis in Acinetobacter calcoaceticus ADP1. J Biol Chem 278, 8075-8082. Keith, K., Kraml, M., Dengler, N.G., and Mccourt, P. (1994). Fusca3 - a Heterochronic Mutation Affecting Late Embryo Development in Arabidopsis. Plant Cell 6, 589-600. Kerstiens, G. (1996). Signalling across the divide: A wider perspective of cuticular structure-function relationships. Trends in Plant Science 1, 125-129. 52  Kohlwein, S.D., Eder, S., Oh, C.S., Martin, C.E., Gable, K., Bacikova, D., and Dunn, T. (2001).  Tscl3p is required for fatty acid elongation and localizes to a novel structure at the nuclear-vacuolar interface in Saccharomyces cerevisiae. Molecular and Cellular Biology 21, 109-125. Koornneef, M. (1981). The complex syndrome of the ttg mutants. Arabidopsis Inf. Serv. 18, 45-51. Kunst, L., and Samuels, A.L. (2003). Biosynthesis and secretion of plant cuticular wax. Progress in Lipid Research 42, 51-80. Kunst, L., Taylor, D.C., and Underhill, E.W. (1992). Fatty-Acid Elongation in Developing Seeds of Arabidopsis-Thaliana. Plant Physiol Bioch 30, 425-434. Kurdyukov, S., Faust, A., Nawrath, C., Bar, S., Voisin, D., Efremova, N., Franke, R., Schreiber, L., Saedler, H., Metraux, J.P., and Yephremov, A. (2006). The epidermis-specific extracellular BODYGUARD controls cuticle development and morphogenesis in Arabidopsis. Plant Cell 18, 321-339. Lardizabal, K.D., Metz, J.C, Sakamoto, T., Hutton, W.C., Pollard, M.R., and Lassner, M.W. (2000). Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production of high levels of wax in seeds of transgenic Arabidopsis. Plant Physiology 122, 645-655. Li, Y.H., Beisson, F., Pollard, M., and Ohlrogge, J. (2006). Oil content of Arabidopsis seeds: The influence of seed anatomy, light and plant-to-plant variation. Phytochemistry 67, 904-915. Meinke, D.W., Franzmann, L.H., Nickle, T.C., and Yeung, E.C. (1994). Leafy Cotyledon Mutants of Arabidopsis. Plant Cell 6, 1049-1064. Merk, S., Blume, A., and Riederer, M. (1998). Phase behaviour and crystallinity of plant cuticular waxes studied by Fourier transform infrared spectroscopy. Planta 204, 44-53. Metz, J.G, Pollard, M.R., Anderson, L., Hayes, T.R., and Lassner, M.W. (2000). Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed. Plant Physiology 122, 635-644. Millar, A.A., and Kunst, L. (1997). Very-long-chain fatty acid biosynthesis is controlled through the expression and specificity of the condensing enzyme. Plant J 12, 121-131. Millar, A.A., Clemens, S., Zachgo, S., Giblin, E.M., Taylor, D.C., and Kunst, L. (1999). CUT1, an arabidopsis gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme. Plant Cell 11, 825-838. Molina, I., Bonaventure, G., Ohlrogge, J., and Pollard, M. (2006). The lipid polyester composition of Arabidopsis thaliana and Brassica napus seeds. Phytochemistry 67, 2597-2610. Ohlrogge, J., and Browse, J. (1995). Lipid Biosynthesis. Plant Cell 7, 957-970. Pighin, J.A., Zheng, H., Balakshin, L.J., Goodman, LP., Western, T.L., Jetter, R., Kunst, L., and Samuels, A.L. (2004). Plant cuticular lipid export requires an ABC transporter. Science 306, 702-704. Reicosky, D.A., and Hanover, J.W. (1978). Physiological-Effects of Surface Waxes .1. Light Reflectance for Glaucous and Non-Glaucous Picea-Pungens. Plant Physiology 62, 101-104. Rowland, O., Lee, R., Franke, R., Schreiber, L., and Kunst, L. (2007). The CER3 wax biosynthetic gene from Arabidopsis thaliana is allelic to WAX2/YRE/FLP1. Febs Letters 581, 3538-3544. Rowland, O., Zheng, H.Q., Hepworth, S.R., Lam, P., Jetter, R., and Kunst, L. (2006). CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiology 142, 866-877. Salas, J.J., and Ohlrogge, J.B. (2002). Characterization of substrate specificity of plant FatA and FatB 53  acyl-ACP thioesterases. Arch Biochem Biophys 403, 25-34. Schneider-Belhaddad, F., and Kolattukudy, P. (2000). Solubilization, partial purification, and characterization of a fatty aldehyde decarbonylase from a higher plant, Pisum sativum. Arch Biochem Biophys 377, 341-349. Schnurr, J.A., Shockey, J.M., de Boer, GJ., and Browse, J.A. (2002). Fatty acid export from the chloroplast. Molecular characterization of a major plastidial acyl-coenzyme A synthetase from Arabidopsis. Plant Physiology 129, 1700-1709. Shockey, J.M., Fulda, M.S., and Browse, J.A. (2002). Arabidopsis contains nine long-chain acyl-coenzyme A synthetase genes that participate in fatty acid and glycerolipid metabolism. Plant Physiology 129, 1710-1722. Somerville, C., and Ogren, W. (1982). Isolation of photorespiratory mutants in Arabidopsis. In Methods in Chloroplast Molecular Biology, N. Chua, ed (New York: RB Hallick, Elsevier,), pp. 129-139. Somerville, C., Browse, J., Jaworsky, J.G., and Ohlrogge, J.B. (2000). Lipids. In Biochemistry and Molecular Biology of Plants, B. Buchanan, W. Gruissem, and R. Jones, eds (Rockville, MD: American Society of Plant Physiologists), pp. 456-480. Storch, J., and Thumser, A.E. (2000). The fatty acid transport function of fatty acid-binding proteins. Biochim Biophys Acta 1486, 28-44. Todd, J., Post-Beittenmiller, D., and Jaworski, J.G. (1999). KCS1 encodes a fatty acid elongase 3-ketoacyl-CoA synthase affecting wax biosynthesis in Arabidopsis thaliana. Plant Journal 17, 119-130. Vioque, J., and Kolattukudy, P.E. (1997). Resolution and purification of an aldehyde-generating and an alcohol-generating fatty acyl-CoA reductase from pea leaves (Pisum sativum L). Arch Biochem Biophys 340, 64-72. Voelker, T.A., Jones, A., Crammer, A.M., Davies, H.M., and Knutzon, D.S. (1997). Broad-range and binary-range acyl-acyl-carrier-protein thioesterases suggest an alternative mechanism for medium-chain production in seeds. Plant Physiology 114, 669-677. Wada, H., Shintani, D., and Ohlrogge, J. (1997). Why do mitochondria synthesize fatty acids? Evidence for involvement in lipoic acid production. P Natl Acad Sci USA 94, 1591-1596. West, M.A.L., Yee, K.M., Danao, J., Zimmerman, J.L., Fischer, R.L., Goldberg, R.B., and Harada, J.J. (1994). Leafy Cotyledon 1 Is an Essential Regulator of Late Embryogenesis and Cotyledon Identity in Arabidopsis. Plant Cell 6, 1731-1745. Western, T.L , Skinner, DJ., and Haughn, G.W. (2000). Differentiation of mucilage secretory cells of the Arabidopsis seed coat. Plant Physiology 122, 345-355. Wettestein-Knowles, P.v. (1982). Elongase and epicuticular wax biosynthesis. Physiol Veg 20, 797-809. Wettestein-Knowles, P.v. (1995). Biosynthesis and genetics of waxes. In Waxes: Chemistry, Molecular Biology and Functions, R.J. Hamilton, ed (Dundee: The Oily Press), pp. 131-174. Whitfield, H.V., Murphy, DJ., and Hills, M.J. (1993). Subcellular-Localization of Fatty-Acid Elongase in Developing Seeds of Lunaria-Annua and Brassica-Napus. Phytochemistry 32, 255-258. Yephremov, A., Wisman, E., Huijser, P., Huijser, C., Wellesen, K., and Saedler, H. (1999). Characterization of the FIDDLEHEAD gene of Arabidopsis reveals a link between adhesion response and cell differentiation in the epidermis. Plant Cell 11, 2187-2201. 54  Zheng, H.Q., Rowland, O., and Kunst, L. (2005). Disruptions of the Arabidopsis enoyl-CoA  reductase gene reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant morphogenesis. Plant Cell 17, 1467-1481.  55  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0066238/manifest

Comment

Related Items