Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A molecular approach to study the monoterpene-induced response in Arabidopsis thaliana Godard, Kimberley-Ann 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2008_spring_godard_kimberleyann.pdf [ 6.88MB ]
Metadata
JSON: 24-1.0066209.json
JSON-LD: 24-1.0066209-ld.json
RDF/XML (Pretty): 24-1.0066209-rdf.xml
RDF/JSON: 24-1.0066209-rdf.json
Turtle: 24-1.0066209-turtle.txt
N-Triples: 24-1.0066209-rdf-ntriples.txt
Original Record: 24-1.0066209-source.json
Full Text
24-1.0066209-fulltext.txt
Citation
24-1.0066209.ris

Full Text

A MOLECULAR APPROACH TO STUDY THE MONOTERPENE-INDUCED RESPONSE IN ARABIDOPSIS THALIANA by  KIMBERLEY-ANN GODARD B.Sc., The University of Ottawa, 2000  A thesis submitted in partial fulfillment of the requirements for the degree of  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (BOTANY)  THE UNIVERSITY OF BRITISH COLUMBIA DECEMBER 2007  © KIMBERLEY-ANN GODARD, 2007  ABSTRACT:  A wound- and insect-inducible expression system for transgenic plants was developed. Specifically, I demonstrate wound- and insect-inducible, localized gene expression driven by the potato proteinase inhibitor II (pinII)-promoter in transformed Arabidopsis, tobacco and white spruce. As reporter and target genes driven by the pinII-promoter, I used the GUS gene and a terpenoid synthase gene, respectively. In addition, I found that the pinII-promoter drives trichome-specific, systemically-induced gene expression in tobacco and Arabidopsis. Finally, I demonstrate that the pinII– promoter, when transformed into Arabidopsis, is extremely sensitive to subtle, lowimpact stress treatment. This latter finding prompted me to use, in the second part of my thesis, the pinIIpromoter in conjunction with GUS reporter gene expression to test if intact Arabidopsis plants can respond to exposure to monoterpene volatiles. My experiments using the pinII–promoter GUS reporter system clearly established that Arabidopsis plants respond to the exposure of the monoterpene volatiles tested.  It is thought that  monoterpenes and other volatiles can act as airborne signals between plants under stress or between distant parts of the same plant. At the outset of my thesis research, and to some extent still today, the concept of plant-plant signalling with volatiles has been met with scepticism. After establishing that Arabidopsis plants do respond in a laboratory setting to certain monoterpene volatiles, I further tested the extent of the response at the transcriptome level using a 30 K microarray platform.  The gene  expression analysis revealed several hundred transcripts that respond with a change of abundance in response to treatment of intact Arabidopsis plants with the monoterpenes ocimene or myrcene. Many of these transcripts were annotated as stress and defense genes including genes involved in octadecanoid signaling. Real-time PCR analyses of octadecanoid mutants confirmed a role for octadecanoid signaling in the response to the monoterpene ocimene. In addition, treatment with ocimene or myrcene caused increased levels of methyl jasmonate (MeJA) in Arabidopsis rosette leaves. However, plants treated with monoterpene prior to wounding or feeding by cabbage looper did not reveal any significant priming effect for these pre-treatments.  ii  TABLE OF CONTENTS: ABSTRACT …………………………………………………………………………………………… ii TABLE OF CONTENTS …………………………………………………………………………….. iii LIST OF TABLES ……………………………………………………………………………………. iv LIST OF FIGURES….………………………………………………………………………………… v LIST OF ABBREVIATIONS………….…………………………………………………………….. vii CO-AUTHORSHIP STATEMENT ……………………………………………………… …….. viii CHAPTER 1 GENERAL INTRODUCTION …………………………………………………….… 1.1 BIOCHEMISTRY OF TERPENOIDS ……………………………………………….. 1.2 BIOLOGY OF TERPENOIDS ……………………………………………………….. 1.3 PLANT RESPONSE TO STRESS ………………………………………………….. 1.4 TERPENIODS AS VOLATILE SIGNALS IN PLANT-INSECT DEFENCE ………. 1.5 HISTORY OF THE PROJECT ……………………………………………………….. 1.6 OBJECTIVES ………………………………………………………………………….. 1.7 LITERATURE CITED ………...…………………………………………………………  1 2 5 6 14 17 18 19  CHAPTER 2 – TESTING OF A HETEROLOGOUS, WOUND- AND INSECTINDUCIBLE PROMOTER FOR FUNCTIONAL GENOMICS STUDIES: 2.1 INTRODUCTION ……………………………………………………………………… 2.2 MATERIALS AND METHODS ………………………………………………………. 2.3 RESULTS ……………………………………………………………………………… 2.4 DISCUSSION …………………………………………………………………………. 2.5 ACKNOWLEDGEMENTS ……………………………………………………………. 2.6 LITERATURE CITED ………..………………………………………………………..  27 30 36 48 49 52  CHAPTER 3 – MONOTERPENE INDUCED RESPONSES IN ARABIDOPSIS THALIANA: 3.1 INTRODUCTION ………………………………………………………………………. 57 3.2 MATERIALS AND METHODS ………………………………………………………… 59 3.3 RESULTS ……………………………………………………………………………….. 66 3.4 DISCUSSION ………………………………………………………………………….. 85 3.5 ACKNOWLEDGEMENTS …………………………………………………………….. 87 3.6 LITERATURE CITED …..………………………………………………………… . .. 88 CHAPTER 4 – DISCUSSION: …………………………………………………………………….. 92 4.1 PINII::GUS-ENGINEERED ARABIDOPSIS AS A SCREENING SYSTEM ……… 93 4.2 MONOTERPENE-INDUCED RESPONSES IN ARABIDOPSIS ………………… 94 4.2.1 THE OCTADECANOID PATHWAY IS INVOLVED IN THE RESPONSE OF ARABIDOPSIS TO MONOTERPENE VOLATILES ……….. 94 4.2.1 MONOTERPENES AS POSSIBLE SIGNALS IN PLANTS …………….. 95 4.2.3 MONOTERPENES AS POSSIBLE PRIMING SIGNALS ………………. 96 4.2.4 DETECTION OF AIRBORNE MONOTERPENES ……………………… 97 4.2.5 NEW MOLECULAR TARGETS: ………………………………………….. 99 4.3 FUTURE RESEARCH ……………………………………………………………… . 101 LITERATURE CITED ………………………………………………………………………………. 103 APPENDIX ………………………………………………………………………………………….. 108  iii  LIST OF TABLES TABLE 2.1: HYGROMYCIN RESISTANT AND SUSCEPTIBLE PLANTS (PINII::GUS)……. 39 TABLE 2.2: HYGROMYCIN RESISTANT AND SUSCEPTIBLE PLANTS (PINII::EαBIS) …. 40 TABLE 3.1. COMMON GENES IN THE MONOTERPENE INDUCED RESPONSE ………. 72 TABLE 3.2: MONOTERPENE-INDUCED CHANGE, OCTADECANOID PATHWAY ………. 78 TABLE 3.3: PUTATIVE JASMONIC ACID METHYL TRANSFERASE ………………………. 79 TABLE 3.4: RT-PCR VALIDATION ………………………………………………………………. 80 TABLE 4.1: LOCUS AND DESCRIPTION OF TRANSCRIPTION FACTORS ………………. 100 TABLE S1: PRIMERS USED FOR RT-PCR …………………………………………………… 108 TABLE S2: LOCUS, GENE MODEL AND DESCRIPTION OF FIGURE 3 ………………….. 113  iv  LIST OF FIGURES:  FIGURE 1.1  EXAMPLES OF TERPENES …………………………………………………….  2  FIGURE 1.2. THE TERPENOID PATHWAY IN PLANTS ……………………………………..  4  FIGURE 2.1: WIRE CAGE DESIGN ……………………………………………………………. 36 FIGURE 2.2: GENE CONSTRUCT (PINII::GUS; PINII::EαBIS) …………………………….. 38 FIGURE 2.3.: PINII-DEPENDENT GUS EXPRESSION - LOCAL ……………………………. 41 FIGURE 2.4: PINII-DEPENDENT GUS EXPRESSION – SYSTEMIC ……………………… 42 FIGURE 2.5: PINII-DEPENDENT GUS EXPRESSION – LOW STRESS …………………... 42 FIGURE 2.6: REVERSE TRANSCRIPTASE -PCR ANALYSIS ……………………………… 43 FIGURE 2.7: REAL TIME –PCR ANALYSIS …………………………………………………… 44 FIGURE 2.8: E-α-BISABOLENE EMMISSION IN A. THALIANA ……………………………. 46 FIGURE 2.9: E-α-BISABOLENE EMMISSION IN TOBACCO ……………………………….. 47 FIGURE 2.10: E-α-BISABOLENE EMMISSION IN SPRUCE …………………………………. 48 FIGURE 3.1: MONOTERPENES INDUCED PINII PROMOTER ACTIVITY …………………. 68 FIGURE 3.2: EXPERIMENTAL SET UP ………………………………………………………… 68 FIGURE 3.3: EXPERIMENTAL DESIGN ……………………………………………………….. 69 FIGURE 3.4: TRANSCRIPTOME PROFILING …………………………………………………. 70 FIGURE 3.5: VENN DIAGRAMS …………………………………………………………………. 71 FIGURE 3.6: RELATIVE ABUNDANCE - GO CATEGORIES …………………………………. 74 FIGURE 3.7: TRANSCRIPTION FACTOR EXPRESSION PROFILE ……………………….. 76 FIGURE 3.8: STRESS RELATED TRANSCRIPTS …………………………………………….. 78 FIGURE 3.9: OCTADECANOID PATHWAY MEASURED BY RT-PCR ……………………… 79 FIGURE 3.10: LEVELS OF MEJA AND JA ……………………………………………………… 81 FIGURE 3.11: MUTANT ANALYSIS ……………………………………………………………… 82 FIGURE 3.12: PRIMING EXPERIMENT ………………………………………………………… 84 FIGURE 4.1: RECOVERY ASSAY ………………………………………………………………. 98  v  FIGURE 4.2: TRANSCRIPTION FACTORS UNIQUE TO RESPONSE …………………….. 100 FIGURE S1: QUALITY CONTROL SCATTER PLOTS ………………………………………. 109 SUPPLEMENTAL INFORMATION 1: SCRIPT ………………………………………………. 116  vi  LIST OF ABBREVIATIONS: AOC:  Allene oxyde cyclase mutant  COI1:  Coronatine insensitive mutant 1  D:  Days  DMAPP:  Dimethylallyl diphosphate  (E)-"-Bis:  (E)-"-Bisabolene  ETR2:  Ethylene response 2 mutant  FC:  Fold change  FPP:  Farnesyl diphosphate  GC:  Gas chromatography  GGPP:  Geranylgeranyl diphosphate  GPP:  Geranyl diphosphate  HR:  Hours  IPP:  Isopentenyl diphosphate  JA:  Jasmonic acid  JMT:  Jasmonic acid methyl-transferase  MEJA:  Methyl jasmonate  MEP:  Methylerythritol phosphate pathway  MS:  Mass Spectrometry  PCR:  Polymerase chain reaction  PDF:  Plant defensin-fusion protein  PINII:  Proteinase inhibitor class II  R:  Resistant  RACE:  Rapid amplification of cDNA ends  S:  Susceptible  TPS:  Terpene synthase  TRD:  Traumatic resin duct  VSP:  Vegetative storage protein  vii  Co-Authorship Statement Chapter 2 The characterization of the pinII promoter presented in chapter two (Godard et al., 2007) was exclusively done by the author, except for the spruce transformation (Dr. Armand Séguin and Caroline Levasseur) and for help in the tobacco transformation (the pinII::(E)-"-Bis plants, Dr. Ashley Byun McKay). Drs. Jörg Bohlmann and Aine Plant were supervisors. Jörg Bohlmann also helped in writing the manuscript published.  Chapter 3 The study of the monoterpene-induced response in A. thaliana was almost exclusively done by the author. Array normalization algorithms and statistics pertaining to the raw data were designed by Rick White. Natalia Kolosova did some RNA extractions. JA levels and a second measurement of MeJA levels were contracted to an outside laboratory (Dr. Sue Abrams – Agriculture Canada). Dr. Jörg Bohlmann was a supervisor and helped in writing the manuscript submitted.  viii  CHAPTER 1 GENERAL INTRODUCTION Plants have evolved various defence strategies against herbivores and pathogens. Successful plant defence is largely based on physical barriers and chemical protection (Baldwin and Karban 1997; Walling 2000; Dicke and Van Loon 2000; Harborne et al., 2001; Keeling and Bohlmann 2006a). Plant produced specialized chemicals (also referred to as secondary metabolites) can act on various levels of defence. For example, some compounds can repel a wide range of organisms or may be toxic (Harborne, 2001); others have the property of attracting predators or parasitoids of herbivores as an indirect means of defence (Dicke and Van Loon 2000, Kessler and Baldwin 2001), while certain metabolites are thought to act as signals between plants (Baldwin et al., 2006; Dicke and Bruin, 2001; Bruin and Dicke, 2001). Plants produce defence chemicals either constitutively, or in response to certain triggers (Harborne et al., 2001; Keeling and Bohlmann 2006a). The regulation of induced defences requires the ability to detect an attack, an injury or a potential threat. This type of response typically involves intricate signalling networks that control gene expression and modulate an appropriate response. The largest group of natural compounds found in plants are terpenoids (Croteau et al., 2000; Harborne et al., 2001). Terpenoids are a large class of naturally occuring organic compounds derived from five-carbon isoprene units. Many plants emit terpenoid volatiles following feeding by arthropods (e.g. Arimura et al., 2004, Miller et al., 2005; Paré and Tumlinson, 1999; Pichersky and Gershenzon, 2002; Takabayashi and Dicke, 1996). These terpenoids can be involved in the attraction of predators or parasitoids or in inter- and intra-plant signalling. This thesis investigates the potential role of monoterpenoids as plant signals and specifically the potential of terpenoids to 1  induce a molecular response in plants. First, I developed a screening system by engineering Arabidosis thaliana (Arabidopsis), tobacco and spruce with a stressinducible promoter and the GUS reporter gene (uidA gene, Jefferson 1987). Then, using the engineered Arabidopsis plants, the effects of various monoterpenoid volatiles on Arabidopsis were assessed. Subsequently, I used wild-type and mutant Arabidopsis plants to analyze the monoterpenoid-induced response at the transcriptome and metabolite level. As a general overview of the topics discussed in this thesis, this introduction will cover the biochemistry of volatile terpenoids, the biology of volatile terpenoids, plant response to stress, as well as terpenoids as volatile signals in plant defence.  BIOCHEMISTRY OF VOLATILE TERPENOIDS  Several classes of terpenoids have volatile characteristics at ambient temperatures and pressures. These include hemiterpenes with structures of five carbon atoms, monoterpenes with structures of ten carbon atoms, and sesquiterpenes with structures of fifteen carbon atoms (Figure 1.1). Although terpenoids are produced from only four linear isoprenoid substrates (dimethylallyl diphosphate (DMAPP), geranyl  Figure 1.1: Examples of terpenoids used in this thesis  2  diphosphate (GPP), farnesyl diphosphate (FPP), geranyl geranyl diphosphate (GGPP)), approximately thirty thousand terpenoids have been characterized to date (Croteau et al., 2000; Lange et al., 2000), and likely represent an incomplete inventory of the richness of this family of compounds. All terpenoids share isopentenyl diphosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP) as precursors, and are grouped into classes based on the number of five carbon units they contain (Croteau et al., 2000; Lange et al., 2000). IPP and DMAPP are formed in the cytosol and plastids where they are generated by two independent pathways (Eisenreich et al., 1998; Aharoni et al., 2005). The mevalonate pathway is responsible for the formation of the C-5 precursors in the cytosol, while the methylerythritol phosphate (MEP) pathway generates these molecules in the plastids. The C-5 building blocks are then processed by prenyltransferases, which condense one molecule of DMAPP with one, two or three molecules of IPP to generate the 10carbon molecule geranyl diphosphate (GPP), the 15-carbon molecule farnesyl diphosphate (FPP), or the 20-carbon molecule geranylgeranyl diphosphate (GGPP) respectively (Figure 1.2). There is also some evidence that transport of precursors and intermediates may occur between the plastid and cytosol, and this exchange of intermediates may represent a mechanism to regulate pathway flux (Bick and Lange, 2003, Dudereva et al., 2005). The enzymes responsible for the formation of terpenes, known as terpene synthases (TPS), use the four above mentioned prenyl diphosphate substrates. Isoprene synthase uses DMAPP, monoterpene synthases use GPP, sesquiterpene synthases use FPP, while diterpene synthases use GGPP to generate core terpenoid skeletons (Bohlmann et al., 1998a; Davis and Croteau 2000). TPS can have a single product, while many TPS enzymes are promiscuous and can lead to the formation 3  CYTOPLASM PLASTID  Methylerythritol Phosphate Pathway  IPP  1X IPP  GPP  DMAPP 3X IPP  Diterpenes  GGPP GGPP  Isoprene  Carotenoids  Mevalonate Pathway  IPP  Monoterpenes  DMAPP FPP  DMAPP  Sesquiterpenes FPP  2X IPP Sterols  Figure 1.2: Scheme of Terpenoid Biosynthesis in the Plant Cell. IPP: Isopentenyl diphosphate, DMAPP: Dimethylallyl diphosphate, GPP: Geranyl diphosphate, GGPP: Geranyl Geranyl diphosphate, FPP: Farnesyl diphosphate.  of many products such as the "-humulene synthase from grand fir producing 52 different sesquiterpene products (Steele et al., 1998). The terpene molecules formed by TPS can then be subject to various redox and transferase reactions that give rise to the many thousands of terpenoid metabolites (Bohlmann et al. 1998a; Davis and Croteau, 2000; Keeling and Bohlmann, 2006a). This allows compounds originating from only a few precursors to cover a remarkable array of chemical diversity and potential biological activity. 4  BIOLOGY OF TERPENOIDS  Terpenoids are the largest group of specialized metabolites found in plants and likely cover a large array of biological functions (Croteau et al., 2000; Harborne 2001). While some terpenoids participate in primary plant processes including the phytol side chain of chlorophyll, carotenoid pigments, phytosterols in cellular membranes, side chain of ubiquinones, and plant growth regulators such as gibberellic acid, absicic acid and other cytokinins, most terpenoid compounds are classified as secondary metabolites (Aharoni et al., 2005; Croteau et al., 2000).  Secondary metabolite  terpenoids are thought to have functions in biological contexts such as plant defence and plant communication (Harborne 2001; Pichersky et al., 2006). Terpenoids either exist as preformed compounds, or are produced after insect attack, wounding, fungal inoculation or artificial elicitation such as MeJA treatment (e.g. Arimura et al., 2000; Chappel and Nable, 1987; Fäldt et al., 2003; Martin et al. 2003). Examples of defence functions include the roles played by antimicrobial terpenoids compounds to defend plants against fungi, by antifeedant compounds to prevent herbivory and by allelopathic inhibitors that inhibit growth of other plant species (Greenhagen and Chappell 2001; Harborne 2001). Terpenoids also participate in the formation of floral and fruit volatiles that are involved in pollination biology and fruit dispersal (Dudareva et al., 2004; Harborne et al., 2001; Pichersky and Gershenzon 2002). Plants have also been shown to use volatile terpenoids as an indirect means of defence. The emission of a wide range of terpenoids from wounded vegetative tissues has been shown to attract insects that benefit the plant. In such instances, beneficial insects typically target herbivores grazing on the emitting plant (Bruin et al., 1992; Harborne 2001; Hines 2006; Pichersky 5  and Gershenzon 2002). Some volatile terpenoids also appear to have signalling functions between plants (plant-plant or inter-plant) and will be discussed later in this introduction and in chapter 4.  PLANT RESPONSE TO INSECT STRESS  As sessile organisms, plants have evolved diverse mechanisms to defend themselves against chewing, sucking or otherwise destructive insects. Plant response to insect attack is largely modulated by complex signaling cascades activated by the introduction of herbivore-specific elicitors into the feeding induced wound or oviposition site. These elicitors trigger defense responses that can be initiated by the interaction with receptors. An activation of secondary messengers that transmit the signals into the cell then leads to gene expression and biochemical changes (Sudha and Ravishankar, 2002). Examples of induced changes include the production and accumulation of antidigestive proteins, toxic alkaloids, C6 aldehydes and terpenoids (Harborne, 2001). The terpenoids emitted upon insect stress are used in Chapter 3 to induce a plant response. Changes in plant biochemistry can be general or very targeted to specific threats (Harborne 2001). The specificity with which plants are able to mount defences is surprising and not fully understood. The targeted response to biotic stresses likely involves the regulation and intricate crosstalk occurring between stress hormone pathways such as ethylene, jasmonic acid (JA), and salicylic acid (SA). These signaling molecules are introduced below.  6  JASMONIC ACID: Jasmonic acid is a multipurpose hormone responsible for plant development and reproduction, leaf senescence, regulation of cellular redox, and plant herbivory defense (Creelman and Mulpuri, 2002). This review will only focus on JA in plant defense. Although most work in plant defense involves JA, other metabolites stemming from the same pathway such as methyl jasmonate (MeJA) and 12-oxophytodienoic acid (OPDA) have also been shown to have defensive properties. These will be collectively referred to as jasmonates. Jasmonates are linolenic acid derived phytohormones (reviewed in Schaller et al., 2005) (Figure 1.3). Linolenic acid is found in plant membranes where they are esterified into glycerolipids and phospholipids. Chloroplast membranes are especially rich in linolenic acid (Creelman and Mulpuri, 2002). It is thought that wounding (Farmer and Ryan 1992), or other types of membrane disruptions (Almeras et al., 2003 and Chapters 3 and 4 of this thesis), may result in the activation of phospholipases that release linolenic acid from the membranes. But with the exception of DAD1 (defender against apoptic death 1), no lipases nor any mechanisms or signals that trigger lipase activation under different conditions are known (Schaller et al., 2005). Linolenic acid is first oxygenated by a lipoxygenase to produce 13(S)-Hydroperoxy linolenic acid (Vick and Zimmerman 1984). 13(S)-hydroperoxy linolenic acid is cyclized to OPDA by the consecutive action of allene oxide synthase (AOS) and allene oxide cyclase (AOC). The AOC catalyzed reaction yields the cis(+)-OPDA, which is essential to the formation of the biologically active metabolites (Schaller et al., 2005). OPDA is further metabolized to 3-oxo-2-pentenyl-cyclopent-1-octanoic acid (OPC-8:0) by the OPC-8:0 CoA Ligase1 (OPCL1) (Koo et al., 2006). OPC-8:0 is further reduced to JA by three cycles of β-oxidation (Vick and Zimmerman, 1984). Although JA and MeJA can exist in 7  four different stereoisomers, only the (+)-7-iso- and (―)-JA and MeJA isomers are biologically active (Creelman and Mullet, 1997; Creelman and Mulpuri, 2002). It is thought that jasmonates interact with receptors to activate pathways initiating a response. But to date no such receptor has been uncovered.  Figure 1.3. The octadecanoid pathway. Representation of the currently accepted linear pathway. Substrates are indicated in black while enzymes are indicated in maroon. LA: linolenic acid; 13-HPOT : 13(S)-hydroperoxy linolenic acid; cis-(+)OPDA: 12-oxophytodienoic acid; OPC8:0: 3-oxo-2pentenyl-cyclopent-1-octanoic acid; JA: jasmonic acid; MeJA: methyl jasmonate; LOX2: lipoxygenase 2; AOS: allene oxide synthase; AOC: allene oxide cyclase; OPR3: OPDA reductase 3; OPCL1: OPC-8:0 CoA Ligase1; JMT: JA methyl transferase  Jasmonates act as master signals for a multitude of plant stress responses. JA levels in unwounded plants vary within species. An increase in JA can be triggered by a variety of elicitors including wounding (reviewed in Howe 2005), insect attack (reviewed in Halitschke and Baldwin, 2005), systemin (Ryan 1992, reviewed in Howe 2005), cell wall derived oligogalacturonides (Ryan 1992), insect fatty amino-acid conjugates (Halitschke et al., 2001), C6 aldehydes (Engelberth et al., 2004) and by exogenous application of jasmonates (Baldwin 1998; Creelman and Mullet, 1997; Halitschke and Baldwin, 2005). My study, showing the ability of monoterpene volatiles to induce the  8  octadecanoid pathway (chapter 3 of this thesis) may represent another mechanism to induce the ocatadecanoid cascade. Jasmonates play a key role in the wound-, insect-, fungus- and some environment-induced responses (Howe, 2005; Halitsche and Baldwin, 2005; Schaller et al., 2005). Activation of the octadecanoid pathway leads to a large scale change in gene expression (Devoto and Turner, 2003). This can result in the production of, for example, proteinase inhibitors (reviewed in Howe 2005) and antimicrobial phytoalexins (reviewed in Pozo et al., 2005), secondary metabolites such as terpenoids, flavonoids, alkaloids, and phenylpropanoids (Baldwin 1998; Creelman and Mullet, 1997; Halitschke and Baldwin, 2005), and has been linked to induced resistance against insect and abiotic stresses (McConn et al., 1997). JA and MeJA have been shown to have a different effect than OPDA on gene regulation in Arabidopsis (Stintzi et al., 2001) and volatile emission in lima bean (Koch et al., 1999) indicating several response modulators within the octadecanoid pathway. Local treatment with JA or MeJA that elicit both a local and systemic response (Howe, 2005) have often been used in research to mimic insect stress (e.g. Huber et al., 2005; Martin et al., 2003; Miller et al., 2005). Although genes responsible for JA recognition do not seem necessary for the production of the systemic signal, JA synthesis is essential (Li et al., 2002). This implies that JA or a related compound act as the transmissible signal (Li et al., 2002; Howe 2005). MeJA has been suggested as the long-distance signal through volatile dispersal (Seo et al., 2006; Baldwin et al., 2006, Farmer and Ryan, 1990; Farmer 2001). If accurate, the enzyme responsible for the conversion of JA to MeJA (the JA methyl transferase) may play an important regulatory role in some defence responses. This is supported by some data presented in chapter 3 of this thesis. 9  ETHYLENE Ethylene is a highly volatile gaseous hormone with a wide-range of functions including regulation of germination, cell elongation, senescence, abscission, defence against pathogens and abiotic stress response (Chen et al., 2005). For purposes of this introduction, the role of ethylene in plant defense will be described. Ethylene bursts can be induced by a variety of stresses, including wounding, ozone, microbial pathogen and insect attack, as well as by treatment of plant with elicitor molecules (Holopainen, 2004; von Dahl et al., 2007; von Dahl and Baldwin, 2007, Zhao et al., 2005). Although the octadecanoid pathway (e.g. JA production) also regulates similar, and in some instances the same stresses, ethylene does not normally induce secondary metabolite production (Zhao et al., 2005). Ethylene is derived from the amino acid methionine (figure 1.4). First, methionine is converted to S-adenyl-methionine (AdoMet) by an AdoMet synthetase (Schaller and Kieber, 2002). Then, AdoMet is converted to 1-aminocyclopropane-1carboxylic acid (ACC) by ACC synthase. This is thought to be the first committed and rate limiting step in ethylene biosynthesis (Tian and Lu, 2006). ACC is then oxidized into ethylene by ACC oxidase. This last enzyme has been shown to have an important role in ethylene biosynthesis during conditions of high ethylene production (Schaller and Kieber, 2002) Many parts of the ethylene signal transduction pathway have been uncovered through genetic dissection. It is thought that ethylene diffuses across the plasma membrane into the cytosol, where several of the ethylene receptors are located on the endoplasmic reticulum (Stepanova and Alonso, 2005). Binding of ethylene inactivates  10  Figure 1.4. The ethylene pathway. Representation of the currently accepted linear pathway. Substrates are indicated in black while enzymes are indicated in maroon. MET: Methionine, ADOMET: S-adenyl-methionine, ACC: 1-aminocyclopropane-1carboxylic acid  the receptors, which in turn inactivates the mitogen-activated protein kinase kinase kinase (MAPKKK) CTR1. CTR1 likely functions through a mitogen-activated kinase kinase (MAPKK) and mitogen activated kinase (MAPK) yet to be identified (Tian and Lu, 2006). As a result EIN2 is activated and a transcriptional cascade involving the EIN3/EIL and ERF transcription factors is initiated (Schaller and Kieber 2002) A plant produced burst of ethylene is an early response to the perception of pathogen attack (van Loon et al., 2006) and the wound stress (O’Donnell et al., 1996), and is associated with the induction of a defense response. In general, ethylene contributes to resistance against necrotrophic, but not biotrophic pathogens (van Loon et al., 2006). This resistance is the result of ethylene induced pathogenesis-related proteins and through the stimulation of the phenylpropanoid pathway which can strengthen cell walls (van Loon et al., 2006).  SALICYLIC ACID SA quickly accumulates at the site of infection during pathogen attack and plant hypersensitive response (Alvarez, 2000; Sudha and Ravishankar, 2002). The 11  hypersensitive response is a result of pathogen infection and includes programmed cell death resulting in the formation of lesions surrounding the infection site. SA also spreads to other parts of the plant to induce a wide range of defence responses including changes in ion transport, stomatal closure, growth rates, rates of photosynthesis, flower development, and secondary metabolite production (Alvarez, 2000, Wiermer et al., 2005). Several SA derivatives exist including salicylate-glycosides and methyl-salicylate (Alvarez, 2000; Sudha and Ravishankar, 2002). Plants with elevated levels of SA show increased resistance to pathogens (Alvarez, 2000, Sudha and Ravishankar, 2002). It is thought that the plant response to SA is mediated by the activation of PR genes. Constitutive expression of PR genes occasionally shows spontaneous hypersensitive-like lesions (Alvarez, 2000, Sudha and Ravishankar, 2002). Salicylic acid is derived from chorismic acid from the shikimate pathway (figure 1.5) (Charturvedi and Shah, 2007). Two mechanisms are possible. In a first scenario, chorismic acid is hydroxylated to isochorismic acid.  The isochorismic acid is then  converted to salicylic acid by a pyruvate lyase. In a second mechanism, chorismic acid is converted to phenylalanine. Phenyalanine is subsequently deaminated by phenylalanine ammonia lyase to yield cinnamic acid. Cinnamic acid is then either converted to benzoic acid, which is then hydroxylated by benzoic acid 2-hydroxylase. Cinnamic acid may also be converted to o-coumaric acid leading to salicylic acid formation.  CROSSTALK BETWEEN HORMONES: Hormone signaling involved in defence pathways are connected in complex regulatory networks. Regulation typically involves two or more pathways, which 12  Figure 1.5. The salicylic acid pathway. Representation of the currently accepted linear pathway. Substrates are indicated in black while enzymes are indicated in maroon. ICS: isochorismate synthase, IPL: isochorismate puryvate lyase, PAL : phenylalanine amonia lyase, BA2H : benzoic acid 2hydroxylase  collectively mediate the response. Such coordination is referred to as cross-talk. The use of multiple signaling pathways is an important mechanism that enables plants to activate different sets of genes temporally and spatially in different situations against a wide variety of stresses (Zhao et al., 2005). This extensive cross-talk allows the plant a specific response to a specific ennemy. JA is often involved in cross-talk. For example, JA signaling can lead to ethylene production in some plants, while ethylene has also been shown to stimulate JA production in other plants (e.g. tomato and Arabidopsis) (Zhao et al., 2005). In most cases, JA and ethylene cooperatively regulate defence responses. However, ethylene and MeJA can also antagonize each other and stimulate different sets of defence genes (Lorenzo and Solano, 2005). JA and SA have also been shown to co-regulate responses. SA and related compounds are potent inhibitors of JA biosynthesis and secondary metabolite production (Lorenzo and Solano, 2005; Zhao et al., 2005). Antagonistic interactions between ABA and JA have been shown to modulate pathogen defence, while synergies between ABA and JA have been demonstrated to modulate the response to wounding (Lorenzo and Solano, 2005). 13  These synergistic or antagonistic interactions likely occur through the activity of transcription factors. The importance of transcription factors in different stresses (such as wounding, drought, cold, pathogen/fungal elicitor, high-salt, and hormones) has been shown (Chen and Zhu, 2004; Eulgem et al., 2000; Maleck et al., 2000; Denekamp and Smeekens, 2003). For example, different members of the AP2, WRKY and Myb transcription factor families have been correlated with responses involved with wounding, SA, JA, ethylene, and pathogen induction  (Maleck et al., 2000). Also,  WRKY70, a transcription factor involved in both the SA- and JA-mediated expression profile, acts as an activator of SA-induced genes and a repressor of JA-responsive genes (Li et al., 2004).  TERPENOIDS AS VOLATILE SIGNALS IN PLANT-INSECT DEFENCE  Volatile terpenoids are often emitted by plants following herbivory stress and have been documented in many species (e.g. Arimura et al., 2004, Miller et al., 2005; Paré and Tumlinson, 1999; Pichersky and Gershenzon, 2002; Takabayashi and Dicke, 1996). These compounds often act as attractants or repellents to certain arthropods, and are thought to have important functions in plant-herbivore-predator signalling. Such signalling is crucial to certain tritrophic or multitrophic interactions, and involves perception of and response to plant volatiles by a parasitoid of the feeding insect. This form of multitrophic defence has been reported in many plant species (e.g. Arimura et al 2000; Bruin et al 1992; De Moares et al., 1998; Hilker et al 2002; Kessler and Baldwin, 2001; Thaler, 1999) and is thought to be the product of plant/insect coevolution (Baldwin et al. 2006; Bruin and Dicke 2001; Dicke and Bruin 2001).  14  The notion that plants could also cue in on plant-released volatiles has been entertained for over 20 years and has been recently reviewed (Baldwin et al., 2006; Bruin and Dicke 2001; Dicke and Bruin 2001; Gerhenzon, 2007). The first reports of the phenomenon claimed that trees surrounding infested plants had an increased resistance to subsequent insect attack (Baldwin and Schultz, 1983; Rhoades, 1983). Since then, a fair number of studies measuring the validity of plant-plant communication have been reported. Although the vast majority of studies show a response in neighbouring plants, plant-plant communication is still a controversial concept. Scepticisim is due to lack of reproducibility in the field and owing to artificial systems used in laboratory studies. In the last two years, convincing evidence to support inter-plant and within-plant signalling has been published (Heil and Bueno 2007, Kishimoto et al., 2006b; Paschold et al., 2006; Runyon et al., 2006). For example, Heil and Bueno showed that insectinduced volatiles emitted from lima bean (Phaseolus lunatus) plants could prime distal parts of the same plants against future insect attack. Also, Runyon et al. clearly demonstrated that the parasitic dodder plant (Cuscuta pentagona) detects terpenoid volatiles emitted from tomato plants as biologically active signals for successful host targeting. Another group, Kishimoto et al. (2005; 2006b), showed that exposure of Arabidopsis to the monoterpene allo-ocimene caused increased abundance of a few gene transcripts and increased plant resistance against the pathogen Botrytis cinerea. For plant-plant communication to occur, four basic steps are required. First, a plant must release a volatile signal. This may occur in response to an insect attack or wounding. Second, the signal must reach a neighbouring receiver plant. Third, there must be perception of the signal by a receiver plant. Fourth, the perceived signal must lead to a response in a neighbouring plant. Most research efforts have used the 15  complete volatile bouquet (referred to in this thesis as VOC for volatile organic compounds) emitted by the infested plant; while a few studies have narrowed the possible signal down to a few compounds. These latter include methyl jasmonate (MeJA) (Birkett et al., 2000; Karban et al., 2000), methyl salicylate (Shualev et al., 1997) and C6 volatiles (Engelberth et al., 2004; Kost and Heil 2006; Paschold et al., 2006). Other compounds tested have been volatile terpenoids (Arimura et al., 2000; Kishimoto et al., 2005, 2006; Paschold et al., 2006; Rai et al., 2003). Various strategies have been used to determine the plant response to volatiles from another plant. Most groups have used measurement of insect feeding, plant direct defences such as toxin accumulation, and plant transcript levels of select genes to score defence activation in receiver plants. A plant’s ability to receive a signal from a neighbouring infested plant is thought to have evolved as an advantageous edge gained from an “informed” plant competing for the same resources (Baldwin et al. 2006; Bruin and Dicke 2001; Dicke and Bruin 2001). Much of the early reservations in this field arose from the label of “talking plants” as opposed to the more probable “listening plants”. This phenomenon is now more accepted, but is lacking some detailed molecular characterization. This thesis studies the effect of monoterpene-volatiles on Arabidopsis thaliana.  16  1.2 HISTORY OF THE PROJECT  The work presented in this thesis was done in a laboratory which has focused much of its research activity on terpenoid based defences in plants with a major emphasis on terpenoid synthases (TPS) in conifers. Fittingly, my initial project plan was to engineer spruce with a heterologous TPS gene under the control of an inducible promoter to generate plants with novel, insect-induced profiles of sesquiterpenoid volatile emission. The TPS used in this attempt was a sesquiterpene synthase, (E)-αbisabolene synthase from grand fir (Abies grandis), and the promoter used was the wound- and insect-inducible pinII-promoter from potato. To extend this project to angiosperms, I used the same construct to transform Arabidopsis, tobacco and poplar. Unfortunately, and for reasons that are still not entirely clear, I obtained only very low if any reproducible emission of (E)-α-bisabolene in the transgenic plants and some of these findings are discussed in chapter 2 and in the closing chapter of my thesis. However, in the course of the characterization of transgenic plants I made the unexpected observation that the pinII-promoter responds to very subtle and low impact stress treatments in Arabidopsis. This observation as well as unsatisfying results from several attempts to engineer terpenoid emissions in plants, lead me to shift the focus of my thesis.  The main emphasis of my thesis research became the effect of  monoterpene volatiles on Arabidopsis which was enabled, at least in part, by the use of the pinII-promoter and GUS expression system developed initially for the above mentioned genetic engineering approach.  17  1.3 OBJECTIVES  The overall goal of this work was to increase knowledge on plant defence with a focus on the role of volatile terpenoids. To achieve this goal, the thesis was developed to address two major objectives with research described in chapter 2 and chapter 3. The two major objectives were  Objective 1, to develop a simple screening system to assess the response of plants to stress (Chapter 2).  Research under this objective involved  characterization of gene expression under control of the proteinase inhibitor II (pinII) promoter from potato in Arabidopsis, tobacco and spruce.  Objective 2, to assess the response elicited by volatile monoterpenes in Arabidopsis (Chapter 3). Research under this objective involved (1) an assessment of if and which monoterpenes elicited a response in Arabidopsis plants transformed with the pinII promoter::GUS reporter system; (2) a microarray analysis of the effect of two different volatile monoterpenes on the transcriptome of Arabidopsis wild-type plants; (3) an analysis of the effect of mutants in octadecanoid signaling on the response to volatile monoterpenes in Arabidopsis; and (4) the analysis of levels of jasmonic acid and methyl jasmonate in Arabidopsis plants exposed to terpenoid volatiles.  The research completed under objective 1 has been accepted for publication (July 9, 2007) as Godard KA, Byun-McKay A, Levasseur C, Plant A, Séguin A, Bohlmann J. Testing of a heterologous, wound- and insect-inducible promoter for 18  functional genomics studies in conifer defence. Plant Cell Reports. Research completed under objective 2 has been prepared for submission to BMC Genomics with myself, Rick White and Jorg Bohlmann as authors.  1.4 LITERATURE CITED: Aharoni A, Giri AP, Deuerlein S, Griepink F, de Kogel W-J, Verstappen FWA, Verhoeven HA, Jongsma MA, Schwab W, Bouwmeester HJ (2003) Terpenoid metabolism in wild-type and transgenic Arabidopsis plants. Plant Cell 15: 2866-2884 Aharoni A, Jongsma MA, Bouwmeester HJ. (2005) Volatile science? Metabolic engineering of terpenoids in plants. TIPS 10:594602 Alvarez ME (2000) Salicylic acid in the machinery of hypersensitive cell death and disease resistance. Plant Mol Bio 44:429-441 Arimura GI, Ozawa R, Horiuchi JL, Nishioka T, Takabayashi J (2001) Plant-plant interactions mediated by volatiles emitted from plants infested by spider mites. Bioch Syst Ecol 29: 1049-1061 Arimura G, Ozawa R, Kugimiya S, Takabayashi J, Bohlmann J (2004) Herbivore-induced defense response in a model legume. Two-spotted spider mites induce emission of (E)-betaocimene and transcript accumulation of (E)-beta-ocimene synthase in Lotus japonicus. Plant Physiol 135:1976-83 Arimura GI, Ozawa R, Shimoda T, Nishioka T, Boland W, Takabayashi J (2000) Herbivoryinduced volatiles elicit defense genes in lima bean leaves. Nature 406: 512-515 Baldwin IT (1998) Jasmonate-induced responses are costly but benefit plants under attack in native populations. Proc Natl Acad Sci USA 95: 8113-8 Baldwin IT, Halitschke R, Paschold A, von Dahl CC, Preston CA (2006) Volatile Signaling in Plant-Plant Interactions: "Talking Trees" in the Genomics Era. Science 311: 812 815 Baldwin IT, Schultz JC (1983) Rapid changes in tree leaf chemistry induced by damage: evidence for communication between plants. Science 221: 277–279 Bick JA, Lange BM (2003) Metabolic cross talk between cytosolic and plastidial pathways of isoprenoid biosynthesis: unidirectional transport of intermediates across the chloroplast envelope membrane. Arch Biochem Biophys 415: 146-154 Birkett MA, Campbell CAM, Chamberlain K, Guerrieri E, Hick A, Martin JL, Matthes M, Napier JA, Pettersson J, Pickett JA, Poppy GM, Pow EM, Pye BJ, Smart LE, Wadhams GH, Wadhams LJ and CM Woodcock (2000) New roles for cis-jasmone as an insect semiochemical and in plant defense. Proc Natl Acad Sci USA 97: 9329–9334  19  Bohlmann J, Crock J, Jetter R, Croteau R (1998b) Terpenoid-based defences in conifers: cDNA cloning, characterization, and functional expression of wound-inducible (E)-α-bisabolene synthase from grand fir (Abies grandis) Proc Natl Acad Sci USA 95: 6756-6761 Bohlmann J, Martin D, Oldham N, Gershenzon J (2000) Terpenoid secondary metabolism in Arabidopsis thaliana: cDNA cloning, characterization and functional expression of a myrcene / (E)-β-ocimene synthase. Arch Biochem Biophys 375: 261-269 Bohlmann J, Meyer-Gauen G, Croteau R (1998a) Plant terpenoid synthases: Molecular biology and phylogenetic analysis. Proc Natl Acad Sci USA 95: 4126-4133 Bruin J, Dicke M (2001) Chemical information transfer between wounded and unwounded plants: backing up the future. Bioch Syst Ecol 29: 1103-1113 Bruin J, Dicke M, Sabelis MW (1992) Plants are better protected against spider mites after exposure to volatiles from infested conspecifics. Experientia 48: 525-529 Chaturvedi R, Shah J (2007) Salicylic acid in plant disease resistance. In salicyclic acid: a plant hormone. Springer Netherlands. pp 335-370. Chen YF, Etheridge N, Schaler GE (2005) Ethylene signal transduction. Ann Bot 95: 901-915 Chen WJ, Zhu T (2004) Networks of transcription factors with roles in environmental stress response. TIPS 9:591-596 Cheng AX, Lou YG, Mao YB, Lu S, Wang LG, Chen XY (2007) Plant Terpenoids: Biosynthesis and Ecological Functions. J Integ Plant Bio 49: 179-186 Christianson DW (2006) Structural biology and chemistry of the terpenoid cyclases. Chem Rev 106: 3412-3442 Creelman RA, Mullet JE (1997) Bisoynthesis and action of jasmonates in plants. Ann Rev of Plant Phys Plant Mol Biol 48: 355-381 Creelman RA and Mulpuri R (2002) The oxylipin pathway in Arabidopsis. . In CR Somerville, EM Meyerowitz, eds, The Arabidopsis Book. American Society of Plant Biologists, Rockville USA, www.aspb.org/publications/arabidopsis Croteau R, Kutchan T, Lewis N (2000) Natural products (secondary metabolism). In Buchanan, W Gruissem, RL Jones, eds, Biochemistry and Molecular Biology of Plants. American Society of Plant Biologists, Rockville, pp 1250-1318 Croteau R, Ketchum REB, Long RM, Kaspera R, Wildung MR (2006) Taxol biosynthesis and molecular genetics. Phytochem Rev 5: 75–97 Davis EM, Croteau R (2000) Cyclization Enzymes in the Biosynthesis of Monoterpenes, Sesquiterpenes, and Diterpenes. In FJ Leeper, JC Vederas, eds, Topics in current chemistry. Springer Berlin, Heidelberg, pp 53-95 De Moraes CM, Lewis WJ, Paré PW, Alborn HT, Tumlinson JT (1998) Herbivore-infested plants selectively attract parasitoids. Nature 393: 570-573  20  De Moraes CM, Mescher MC, Tumlinson JH (2001) Caterpillar-induced nocturnal plant volatiles repel conspecific females. Nature 410: 577-579 Denekamp M, Smeekens SC (2003) Integration of wounding and osmotic stress signals determines the expression of the AtMYB102 transcription factor gene. Plant Physiol 132:1415– 1423 Devoto A, Turner JG (2005). Jasmonate-regulated Arabidopsis stress signalling network. Phys Plant 123:161-172 Dicke M, Agrawal AA, Bruin J (2003) Plants talk, but are they deaf? Trends in Plant Science 8: 403-405 Dicke M, Bruin J (2001) Chemical information transfer between plants: back to the future. Bioch Syst Ecol 29: 981-994 Dicke M, Gols R, Ludeking D, Posthumus MA (1999) Jasmonic acid and herbivory differentially induce carnivore-attracting plant volatiles in lima bean plants. J Chem Ecol 25:1907-1922 Dicke M, Van Beek TA, Posthumus MA, Ben Dom N, Van Bokhoven H, De Groot AE (1990) Isolation and identification of volatile kairomone that affects acarine predatorprey interactions Involvement of host plant in its production. J Chem Ecol 16: 381-396 Dicke M, Van Loon JJA (2000) Multitrophic effects of herbivore-induced plant volatiles in an evolutionary context. Entomol Exp Appl 97: 237-249 Dudareva N, Andersson S, Orlova I, Gatto N, Reichelt M, Rhodes M, Boland W, Gershenzon J (2005) The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers. Proc Natl Acad Sci USA 102: 933-938 Dudareva N, Pichersky E, Gershenzon J (2006) Biochemistry of plant volatiles. Plant Physiol 135: 1893-1902 Eisenreich W, Schwarz M, Cartayrade A, Arigoni D, Zenk MH, Bacher A (1998) The deoxyxylulose phosphate pathway of terpenoid biosynthesis in plants and microorganisms. Chem Biol 5: R221-R233 Ellis C, Turner JG (2001) The arabidopsis mutant cev1 has constitutively active jasmonate and ethylene signal pathways and enhances resistance to pathogens. Plant Cell 13:1025- 1033 Engelberth J, Alborn HT, Schmelz EA, Tumlinson JH (2004) Airborne signals prime plants against insect herbivore attack. Proc Natl Acad Sci USA 101: 1781-1785 Fäldt J, Arimura GI, Gershenzon J, Takabayashi J, Bohlmann J (2003) Functional identification of AtTPS03 as (E)-β-myrcene synthase: a new monoterpene synthase catalyzing jasmonate- and wound-induced volatile formation in Arabidopsis thaliana. Planta 216: 745-751 Farmer E (2001) Surface-to-air signals. Nature 411:854-856 Farmer E, Ryan C (1990) Interplant Communication: Airborne Methyl Jasmonate Induces Synthesis of Proteinase Inhibitors in Plant Leaves. Proc Natl Acad Sci USA 87: 7713-7716  21  Gang D (2005) Evolution of flavors and scents. Ann Rev Plant Biol 56: 301–325 Gershenzon J (2007) Plant volatiles carry both public and private messages. Proc Natl Acad Sci USA 104: 5257-5258 Godard KA, Byun-McKay A, Levaseur C, Plant A, Séguin A, Bohlmann J (2007) Testing of a heterologous, wound- and insect- inducible promoter for functional genomics studies in conifer defense. Plant Cell Rep. on line Greenhagen B, Chappell J (2001) Molecular scaffolds for chemical wizardry: Learning nature's rules for terpene cyclases. Proc Natl Acad Sci USA 98: 13479-13481 Halitschke R, Baldwin IT (2005) Jasmonate and related compounds in plant–insect interactions. J Plant Growth Reg 23: 238–245 Halitschke R., Schittko U, Pohnert G, Boland W, Baldwin IT (2001) Molecular Interactions between the Specialist Herbivore Manduca sexta (Lepidoptera, Sphingidae) and Its Natural Host Nicotiana attenuata. III. Fatty Acid-Amino Acid Conjugates in Herbivore Oral Secretions Are Necessary and Sufficient for Herbivore-Specific Plant Responses. Plant Physiol 125: 711717 Harborne, JB (2001) Twenty-five years of chemical ecology. Nat Prod Rep 18: 361-379 Heil M, Bueno JCS (2007) Within-plant signaling by volatiles leads to induction and priming of an indirect plant defense in nature. Proc Natl Acad Sci USA 104: 5467-5472 Heil M; Kost C (2006): Priming of indirect defences. Ecol Let 9: 813-817 Hilker M, Kobs C, Varma M, Schrank K (2002) Insect egg deposition induces Pinus sylvestris to attract egg parasitoids. J Exp Biol 205: 455-461 Hines PJ (2006) The Invisible Bouquet. Science 311: 803 Holopainen JK (2004) Multiple functions of inducible plant volatiles. Trends Plant Sci 9:529– 533 Howe G (2005) Jasmonates as signals in the wound response. J Plant Growth Regul 23:233237 Huber DP, Philippe RN, Madilao LL, Sturrock RN, Bohlmann J (2005) Changes in anatomy and terpene chemistry in roots of Douglas-fir seedlings following treatment with methyl jasmonate. Tree Physiol 25:1075-83 Karban R (2001) Communication between sagebrush and wild tobacco in the field. Bioch System and Ecol 29: 995-1005 Karban R, Baldwin IT, Baxter KJ, Laue G, Felton GW (2000) Communication between plants: Induced resistance in wild tobacco plants following clipping of neighbouring sagebrush. Oecologia 125: 66-71 Karban R, Maron J, Felton GW, Ervin G, Eichenseer H (2003) Herbivore damage to sagebrush induces resistance in wild tobacco: evidence for eavesdropping between plants. Oikos 100: 325-332  22  Karban R, Shiojiri K, Huntzinger M, McCall AC (2006) Damage-induced resistance in sagebrush. Volatiles are key to intra and interplant communication. Ecology 87: 922-930 Keeling CI, Bohlmann J (2006a) Genes, enzymes and chemicals of terpenoid diversity in the constitutive and induced defence of conifers against insects and pathogens. New Phytol. 170: 657–675 Keeling CI, Bohlmann J (2006b) Diterpene resin acids in conifers. Phytochem 67: 2415-2423 Kessler A, Baldwin IT (2001) Defensive function of herbivore-induced plant volatile emissions in nature. Science 291: 2141-2144 Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2006a) Analysis of defense responses activated by volatile allo-ocimene treatment in Arabidopsis thaliana. Phytochem 67: 1520-1529 Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2006b) Components of C6-aldehydeinduced resistance in Arabidopsis thaliana against a necrotrophic fungal pathogen, Botrytis cinerea. Plant Science 170: 715-723 Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2005) Volatile C6-aldehydes and Alloocimene Activate Defense Genes and Induce Resistance against Botrytis cinerea in Arabidopsis thaliana. Plant and Cell Phys 46:1093-1102 Koo AJK, Chung HS, Kobayashi Y, Howe GA (2006) Identification of a Peroxisomal Acylactivating Enzyme Involved in the Biosynthesis of Jasmonic Acid in Arabidopsis J Biol Chem 281: 33511-33520 Koch T, Krumm T, Jung V, Engelberth J, Boland W (1999) Differential Induction of Plant Volatile Biosynthesis in the Lima Bean by Early and Late Intermediates of the OctadecanoidSignaling Pathway. Plant Physiol 121: 153-162 Kost C, Heil M (2006) Herbivore-induced plant volatiles induce an indirect defence in neighbouring plants. J Ecol 94: 619-628 Kunkel BN, Brooks DM (2002) Crosstalk between signaling pathways in pathogen defense. Curr Opin Plant Biol 5:325–331 Lange BM, Rujan T, Martin W, Croteau R (2000) Isoprenoid biosynthesis: The evolution of two ancient and distinct pathways across genomes. Proc Natl Acad Sci USA 97: 13172-13177 Laurie-Berry N, Joardar V, Street IH, Kunkel BN (2006) The Arabidopsis thaliana JASMONATE INSENSITIVE 1 gene is required for suppression of salicylic acid-dependent defenses during infection by Pseudomonas syringae.. Mol Plant Micr Int 19: 789-800 Li C, Williams MM, Loh Y-T, Lee GI, Howe GA (2002) Resistance of cultivated tomato to cell content-feeding herbivores is regulated by the octadecanoid-signaling pathway. Plant Physiol 130: 494-503 Li L, Li C, Lee GI, Howe GA (2002) Distinct roles for jasmonate synthesis and action in the systemic wound response of tomato. Proc Natl Acad Sci USA 99: 6416-6421  23  Li J, Brader G, Palva ET (2004) The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. Plant Cell 16: 319–331 Lorenzo O, Chico JM, Sanchez-Serrano JJ, Solano R (2004) JASMONATE-INSENSITIVE1 encodes a myc transcription factor essential to discriminate between different jasmonateregulated defense responses in arabidopsis. Plant Cell 16:1938-1950 Lorenzo O, Piqueras R, Sanchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE FACTOR1 Integrates Signals from Ethylene and Jasmonate Pathways in Plant Defense. Plant Cell 15: 165-178 Lorenzo O, Solano R (2005) Molecular players regulating the jasmonate signalling network. Curr Op Plant Bio 8: 532-540 Maleck K, Levine A, Eulgem T, Morgen A, Schmid J, Lawton K (2000) The transcriptome of Arabidopsis thaliana during systemic acquired resistance, Nat Gen 26: 403–410 Martin DM, Fäldt J, Bohlmann J (2004) Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily. Plant Physiol 135:1908-27 McConn, M., R. A. Creelman, E. Bell, J. E. Mullet, and J. Browse (1997). Jasmonate is essential for insect defense in Arabidopsis. Proc Natl Acad Sci USA 94: 5473-5477 Miller B, Madilao LL, Ralph S, Bohlmann J (2005) Insect-induced conifer defense. White pine weevil and methyl jasmonate induce traumatic resinosis, de novo formed volatile emissions, and accumulation of terpenoid synthase and putative octadecanoid pathway transcripts in Sitka spruce. Plant Physiol 137: 369-82 Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-specific interactions between salicylate and jasmonate signalling include synergy, antagonism, and oxidative stress leading to cell death. Plant Phys 140:249-262 Ninkovic V, Olsson U, Petterson J (2002) Mixing barley cultivars affects aphid host plant acceptance in field experiments. Ent Exp App 102: 177-182 Oudejans AMC, Bruin J (1995) Does spider-mite damage induce information transfer between plants of different species? Med Fac Landbouww Univ Gent 59: 733–739 Paré PW, Tumlinson JH (1999) Plant volatiles as a defense against insect herbivores. Plant Physiol 121: 325-331 Paschold A, Halitschke R, Baldwin IT (2006) Using ‘mute’ plants to translate volatile signals. Plant Journal 45: 275-291 Penninckx IAMA, Thomma BPHJ, Buchala A, Metraux JP, Broekaert WF (1998) Concomitant Activation of Jasmonate and Ethylene Response Pathways Is Required for Induction of a Plant Defensin Gene in Arabidopsis Plant Cell 10: 2103-2114 Pichersky E, Gershenzon J (2002) The formation and function of plant volatiles: perfumes for pollinator attraction and defense. Curr Opin Plant Biol 5: 237-243  24  Pichersky E, Noel JP, Dudareva N (2006) Biosynthesis of plant volatiles: Nature’s diversity and ingenuity. Science 311: 808-811 Pozo MJ, van Loon LC, Pieterse CMJ (2005) Jasmonates – Signals in plant-microbe interactions. J Plant Growth Regul 23:211-222 Rai VK, Gupta SC, Singh B (2003) Volatile monoterpenes from Prinsepia utilis L. leaves inhibit stomatal opening in Vicia faba L. Biologia Plantarum 46:121-124 Rasmann S, Kollner TG, Degenhardt J, Toepfer S, Kuhlmann U, Gershenzon J, Turlings TCJ (2005) Recruitment of entomopathogenic nematodes by insect-damaged maize roots. Nature 434: 732-737 Reddy GVP, Guerrero A (2004) Interactions of insect pheromones and plant semiochemicals. TIPS 9: 253-261 Rhoades DF (1983) Responses of alder and willow to attack by tent caterpillars and webworms - evidence for pheromonal sensitivity of willows. ACS Symposium Series 208: 55– 68 Runyon JB, Mescher MC, De Moraes CM (2006) Volatile chemical cues guide host location and host selection by parasitic plants. Science 313: 1964-1967 Schaller F, Schaller A, Stintzi A (2005) Biosynthesis and metabolism of jasmonates. J Plant Growth Regul 23: 179-199 Seo S, Seto H, Koshino H, Yoshida S, Ohashi Y. (2003) A Diterpene as an Endogenous Signal for the Activation of Defense Responses to Infection with Tobacco mosaic virus and Wounding in Tobacco. Plant Cell 15: 863 - 873 Schaller EG, Kieber JJ (2002) Ethylene. In CR Somerville, EM Meyerowitz, eds, The Arabidopsis Book. American Society of Plant Biologists, Rockville USA, www.aspb.org/publications/arabidopsis Shulaev V, Silverman P, Raskin I (1997) Airborne signalling by methyl salicylate in plant pathogen resistance. Nature 385: 718–721 Shiojiri K, Kishimoto K, Ozawa R, Kugimiya S, Urashimo S, Arimura G, Horiuchi J, Nishioka T, Matsui K, Takabayashi J (2006) Changing green leaf volatile biosynthesis in plants: An approach for improving plant resistance against both herbivores and pathogens. Proc Natl Acad Sci USA 103: 16672-16676 Steele CL, Katoh S, Bohlmann J, Croteau R (1998) Regulation of oleoresinosis in grand fir (Abies grandis). Differential transcriptional control of monoterpene, sesquiterpene, and diterpene synthase genes in response to wounding. Plant Physiol 116: 1497-1504 Stepanova AN, Alonso JM (2005) Arabidopsis Ethylene Signaling Pathway. Science: 1-4 Stintzi A, Weber H, Reymond P, Browse J, Farmer EE (2001) Plant defense in the absence of jasmonic acid: The role of cyclopentenones. Proc Natl Acad Sci USA 98: 12837-12842 Sudha G, Ravishankar GA (2002) Involvement and interaction of various signaling compounds on the plant metabolic events during defense response, resistance to stress  25  factors, formation of secondary metabolites and their molecular aspects. Plant Cell Tissue and Org Cul 71: 181-212 Takabayashi J, Dicke M (1996) Plant-carnivore mutualism through herbivore-induced carnivore attractants. Trends Plant Sci 1: 109-113 Thaler JS (1999) Jasmonate-inducible plant defenses cause increased parasitism of herbivores. Nature 399: 686-688 Tian Y, Lu XY (2006) The molecular mechanism of ethylene signal transduction. South African J of Bot 72:487-491 Trapp SC, Croteau R (2001) Genomic Organization of Plant Terpene Synthases and Molecular Evolutionary Implications. Genetics 158: 811-832 van Loon LC, Geraats BPJ, Linthorst JM (2006) Ethylene as a modulator of disease resistance in plants. TIPS 11:184-191 van Poecke RMP, Posthumus MA, Dicke M (2001) Herbivore-Induced Volatile Production By Arabidopsis thaliana Leads To Attraction Of The Parasitoid Cotesia rubecula: Chemical, Behavioral, And Gene-Expression Analysis. J Chem Ecol 27: 1911-1928 Vick BA, Zimmerman DC (1984) Biosynthesis of Jasmonic Acid by Several Plant Species. Plant Physiol 75: 458-461 Vick BA, Zimmerman DC (1987) Pathways of Fatty Acid Hydroperoxide Metabolism in Spinach Leaf Chloroplasts. Plant Physiol 85: 1073-1078 von Dahl CC, Baldwin IT (2007) Deciphering the Role of Ethylene in Plant–Herbivore Interactions. J Plant Growth Reg. online preview von Dahl CC, Winz RA, Halitschke R, Kuhnemann F, Gase K, Baldwin IT (2007) Tuning the herbivore-induced ethylene burst: the role of transcript accumulation and ethylene perception in Nicotiana attenuata. Plant J 51: 293-307 Wiermer M, Feys BJ, Parker JE (2005) Plant immunity: the EDS1 regulatory node. Curr Op in Plant Bio 8:383-389 Zhao J, Davis LC, Verpoorte R (2005) Elicitor signal transduction leading to production of plant secondary metabolites. Biotech Adv 23: 283-333 Zeringue H (1987) Changes in cotton leaf chemistry induced by volatile elicitors. Phytochem 26:1357-1360  26  CHAPTER 2 TESTING  OF  A  HETEROLOGOUS,  WOUND-  AND  INSECT-INDUCIBLE  PROMOTER FOR FUNCTIONAL GENOMICS STUDIES1  Characterization of the potato pinII promoter in Arabidopsis, tobacco and spruce.  2.1 INTRODUCTION  As some of the longest living and tallest organisms on earth, conifer trees are targets for many potential pests and pathogens. Specialist herbivores such as certain bark beetles, weevils, or budworms and a suite of fungal pathogens are some of the most serious forest health threats, devastating millions of hectares of conifer forests annually (Government of British Columbia, 2005). However, conifers appear to be resistant against most generalist herbivores probably due to the trees’ extensive secondary metabolism and physical and biochemical constitutive or inducible defences (Huber et al., 2004; Franceschi et al, 2005; Keeling and Bohlmann, 2006a; Keeling and Bohlmann 2006b). In an ongoing large-scale “Forest Health Genomics” program (Ralph et al., 2006a) and in targeted molecular cloning (e.g. Martin et al., 2004; Miller et al., 2005; Huber et al., 2005b; Ro et al., 2005; Ro et al., 2006), a large number of conifer defence genes in species of spruce, loblolly pine (Pinus taeda), and Douglas fir have been identified. For many of these genes, as well as for several defence signalling genes (i.e. octadecanoid and ethylene signalling), transcript profiles of insect-, wound1  A version of this chapter has been published. Godard KA, Byun-McKay A, Levaseur C, Plant A, Séguin and Bohlmann J (2007) Testing of a heterologous, wound- and insect- inducible promoter for functional genomics studies in conifer defense. Plant Cell Reports. . 26: 2083-2090.  27  or elicitor-induced gene expression in spruce have been established (Miller et al., 2005; Ralph et al., 2006b, Ralph et al., 2007). Strategies for further characterization of defence genes will rely on a combination of several different approaches, two of which are biochemical in vitro protein  characterization  and  functional  gene  testing  in  vivo.  Biochemical  characterization of gene function has been demonstrated with expression in E. coli or yeast (Saccharomyces cerevisiae) and subsequent testing of heterologously expressed proteins (e.g., Bohlmann et al., 1997; Martin et al., 2004; Ro et al., 2005). This approach has been successfully applied for characterization of conifer defence genes of oleoresin formation, specifically terpenoid synthases (TPS) and a cytochrome P450 dependent monooxygenase for diterpenoid resin acid formation. In contrast, to the best of my knowledge, functional in vivo testing of conifer defence genes by transformation into a homologous or heterologous plant system has not yet been reported. Such a strategy will be necessary for functional testing of defence genes under biologically relevant scenarios, including testing of gene functions during a plantherbivore or plant-pathogen interaction. Because many conifer defence-related genes appear to be inducible by insect attack or mechanical wounding (e.g. Miller et al., 2005; Keeling and Bohlmann, 2006a; Ralph et al., 2006a; Ralph et al., 2006b) and since induced plant defences can be costly (Baldwin, 1998), establishing a biologically relevant functional genomics system requires gene expression under the control of a wound- or insect-inducible promoter. Most conifer transformation systems described to date use either 35S- or ubiquitin-promoters for constitutive expression (e.g. Noël et al., 2005; Haggmann et al., 1997). In addition, Levée and Séguin (2001) reported UVinducible expression of the phenylalanine ammonia lyase (PAL) promoter in pine; Tang et al. (2005) reported on a glucocorticoid-inducible gene expression system in pine; 28  and Wagner et al. (2005) on heat induction of the ubiquitin promoter in pine. However, I am not aware of insect or wound-inducible promoters that have been established for transformation in conifers. The proteinase inhibitor II (pinII) protein occurs in many Solanaceae plants, including tomato (Gustafson and Ryan, 1976), potato (Bryant et al., 1976), and tobacco (Pearce et al., 1993). PinII is a serine proteinase inhibitor with trypsin and chymotrypsin inhibitory activities and likely plays a role in preventing complete digestion of plant material in insect pests (Bryant et al., 1976). An observation of the wound-inducible expression of pinII protein has lead to the isolation and characterization of the potato pinII promoter (Thornburg et al., 1987).  The potato pinII promoter was shown to  function in transgenic potato (Thornburg et al., 1987), tobacco (Kim et al., 2000), poplar (Klopfenstein et al., 1991) and birch (Keinonnen-Mettala, 1998). Inducibility of the pinII promoter in response to mechanical wounding, insect feeding or methyl jasmonate was shown in green tissues while constitutive expression of the promoter was also recognized in the flowers and tubers of potato (Thornburg et al., 1987) and in the flowers of tobacco (Kim et al., 2000). This wound- and insect-inducible promoter was chosen for this study. The expression of a sesquiTPS-gene under the control of the pinII promoter was also tested in Arabidopsis, tobacco and spruce. (E)-α-bisabolene synthase, is one of several known wound-inducible sesquiterpenoid synthases in conifers (Bohlmann et al., 1998a, Martin et al., 2004). Bisabolenes are commonly emitted from species of spruce in response to simulated insect attack (Martin et al., 2003; Miller et al., 2005). (E)-αbisabolene has been characterized as an insect juvenile hormone mimic (Bowers et al., 1966). (E)-α-Bisabolene can serve as a precursor in the biosynthesis of todomatuic acid, an insect juvenile hormone III analogue (Bohlmann et al., 1998a) and was shown 29  to interfere with the hormonal control of insect reproduction and development (Bowers et al., 1976). The (E)-α-bisabolene synthase gene was selected for this study because of its interesting function in plant-insect defence and its potential applications. Here, I report the use of the potato proteinase inhibitor II (pinII)-promoter to drive insect- and wound inducible GUS-reporter or TPS-gene expression in white spruce (Picea glauca). By testing the same promoter in Arabidopsis thaliana and tobacco (Nicotiana tabacum), I also found induced systemic GUS expression in a cell-specific manner in trichomes.  2.2 MATERIALS AND METHODS  Transformation constructs. Gene expression cassettes containing the potato pinII promoter (Thornburg et al., 1987), followed by the GUS coding sequences, and Nos terminator sequence were cloned between the KpnI and BamHI restriction sites of the pC1300 binary plasmid vector (CAMBIA, Camberra, Australia). The following primers were used for PCR amplification and introduction of restriction sites: For the pinII promoter (forward XbaI-primer 5’-GATCTCTAGATCGACCCAATTCAAAGAACTT-3’ and reverse BamHI-primer: GATCGGATCCACTGCCTCTTTTTCTTTTAAT); for the GUS  coding  region  GAAGTTCATTTCATTTGGATCCGACAC-3’;  (forward reverse  BamHI-primer HindIII-primer  5’5’-  GACGAAGCTTCGCCAGGAGAGTTGTTG-3’); for the Nos terminator sequence (forward HindIII-primer 5’-CCAAATGTTTGAACGATCTGCAAGCTTG-3’ and reverse XhoI-primer 5’-GATCTGGATCCATAGATGACAC-3). Plasmids used as templates for PCR amplification were: pRT24 containing the potato pinII-promoter (Thornburg et al., 1987) provided by Dr. Robert Thornburg (Iowa State University, USA); pBNOS2 30  containing the NOS-terminator, provided by Dr. Peta Bonham-Smith (University of Saskatchewan), and pBT10-GUS containing GUS from our in-house plasmid collections. Final construct containing pinII/GUS/Nos in pC1300 was transformed into chemically competent Agrobacterium tumefaciens GV3101 cells provided by Dr. Carl Douglas (University of British Columbia, Vancouver, Canada) and selected on LB medium containing rifampicin (BioWorld, Dublin, USA) (25 mg/L), gentamycin (25 mg/L) (Fisher Scientific, Ottawa, Canada), and hygromycin (50mg/L) (BioWorld). Gene expression cassettes containing the potato pinII promoter (Thornburg et al., 1987), followed by the (E)-α-bisabolene synthase (Bohlmann et al., 1998), and Nos terminator sequence were cloned between the KpnI and BamHI restriction sites of the pC1300 binary plasmid vector (CAMBIA, Camberra, Australia). For the (E)-αbisabolene synthase coding region sticky end PCR (Zeng et al., 1998) was used to introduce  restriction  sites  (nested  forward  BamHI-primers  5’-  GGATCCGTACGACGATGACGATAAG-3’ and 5’-CGTACGACGATGACGATAAG-3’; and nested reverse HindIII-primers 5’-AAGCTTGATCGTTGAGCTCGCCC-3’ and 5’TGATCGTTGAGCTCGCCC-3’). The coding sequence was isolated from the pGAG1 containing the grand fir (E)-α-bisabolene synthase cDNA. The final construct containing pinII/(E)-α-bis/Nos  in  pC1300  was  transformed  into  chemically  competent  Agrobacterium tumefaciens GV3101 cells provided by Dr. Carl Douglas (University of British Columbia, Vancouver, Canada) as indicated above.  Plant transformation, growth conditions, and treatments. Arabidopsis thaliana (Col-0) plants were transformed using the floral dip method (Clough and Bent, 1998) and the homozygous T3 lines selected Arabidopsis plants were grown with 16h / 8h light / dark cycle at 80 micromoles/m2/s light intensity, 21ºC, 80% relative humidity. 31  Nicotiana  tabacum  transformation  cv.  (Ausubel  W39 et  was  al.,  transformed  2000)  and  following  homozygous  standard T3  lines  leaf  disc  selected.  Transformation of white spruce (Pinus glauca) embryogenic tissue cultures and regeneration of seedlings from somatic embryos was done according to the protocol described in Klimaszewska et al. (2004). Spruce seedlings were transferred from tissue culture to soil [3:1 (v:v) peat : vermiculite, with dolomite (2.4 g/L) and micronutrients (475 mg/L, Micromax)]. Fertilizer was applied to a final concentration of 200 ppm N (3.6 g/L) with Osmocoat 20-8-20 fertilizer (Scotts, Marysville, USA). Tobacco and spruce seedlings were grown in a glasshouse without additional light at 18-22°C and 25-85% humidity. After three months of transfer to soil, spruce seedlings were maintained outdoors. For mechanical wounding treatments, leaves or needles were gently pressed between forceps. Insect feeding by fungus gnats was the result of an unintended infestation. Insect feeding by the white pine weevil (Pissobi strobi) was achieved by placing two weevils on seedling trees for 24 hours as described in Miller et al. (2005)  GUS Assays. GUS staining assays were performed as described by Jefferson (1987) using leaves and shoots detached from treated plants. The tissue softening heptane step was skipped as it activated the pinII promoter. Destaining with ethanol was not done in tobacco as it did not improve resolution. Digital images were obtained using a Sony DSC-F707 Digital Still Camera with a Carl Zeiss Vario Sonar 10X Precision Digital Zoom lens.  Reverse Transcriptase- PCR transcript analysis. RNA was isolated from Arabidopsis and tobacco plants using Trizol reagent (Invitrogen; Burlington, Canada) following the manufacturer’s protocol with a second chloroform extraction. RNA was 32  precipitated using 0.5 volume of isopropanol and 0.5 volume of 0.8M Na3-Citrate. RNA was isolated from spruce seedlings using the protocol described in Kolosova et al. (2004) adjusted to approximately 1g fresh weight tissue. RNA quality was assessed following separation in an agarose gel and spectrophotometrically. Amounts of 1µg of RNA were treated with 1unit of DNAse (Invitrogen) and converted to cDNA using 200 units of Superscript II (Invitrogen) following the manufacturer’s protocol. PCR reactions were performed in a final volume of 20µl with 1µL of the cDNA synthesis reaction as template using either Taq polymerase (New England Biolabs, Ipswich, USA) or Jumpstart (Sigma-Aldrich, Oakville, Canada) and a temperature program of 94°C for 5min followed by 46 cycles of 94°C for 30sec, 53°C for 30sec, 72°C for 40 sec in a PTC-100 Programmable Thermal Cycler (MJ Research, Waltham, USA). The primers used for PCR amplification were 5’-CAGACTTTGAGATCATATTTCCTTCTC-3’ and 5’TATTCCCTCTAAAGAATACAACAATGG-3’ CGATGAAGCTCAATCCAAACGA-3’ spruce elongation factor 5 (IF5); and  synthase;  5’-  5’-CAGAGTCGAGCACAATACCG-3’  for  5’-CTTCTTCGACAAGGCCTAAG-3’ and  5’-  and  for  (E)-α-bisabolene  TCTTCTCCTCCTCCTCAGTG-3’ for histone 1 from Arabidopsis and tobacco. PCR products were visualised on a 1% agarose gel using either ethidium bromide or SYBR Gold stains (Invitrogen).  Real Time-PCR transcript analysis. Transgenic plants harbouring the pinII::E-α-bis constructs were used for both treatment and controls. RNA was isolated as described above. For cDNA synthesis, 2.0 :g of RNA was treated with 1 unit of DNAse I (Invitrogen) in a final volume of 10 :L at room temperature for 15 min, followed by addition of 1 :L of 25mM EDTA and incubation for 10 min at 65°C, and further addition  33  of 1 :L 10mM oligo dT, 1 :L 10mM dNTPs and 1 :L water and additional incubation for 5 min at 65°C. Reactions were placed on ice and spun down at 3000 rpm in a QuickSpin minifuge (Labnet Internationals, Windsor UK). 5X RT buffer, 2 :l 0.1 M DTT and 200 units SUPERSCRIPT II RT were added to a final 20 :L volume.  The  reaction was incubated for 1h at 42°C. The resulting cDNA was diluted 10-fold with Invitrogen distilled and autoclaved water. RT-PCR was conducted using Qiagen QuantiTect SYBR Green Mastermix (Mississauga, Canada) in final reaction volumes of 20 :l as described in the manufacturer’s protocol. Actin 1 (arabidopsis) [5’ CGATGAAGCTCAATCCAAACGA 3’ and 5’ CAGAGTCGAGCACAATACCG 3’] and elongation  factor  5  (spruce)  [5’  GTGCCATCTTCACACAACTGC  3’  AND  CAGATTCAGTCAGCAGGCTAAC 3’] were used to normalize expression data between samples.  The  primers  used  to  measure  transgene  abundance  were  5’  CTGCTGTATCAAAGGTTTCC 3’ and GCGCGTTCTCTGTAACTAG 3’. PCR conditions were as follow: An initial denaturation at 95°C for 15 min, 35 cycles at 95°C for 30 sec, 60°C for 30 sec, and 72°C for 25 sec followed by a fluorescence reading were performed. After a final incubation at 72°C for 5 min, a melting curve was generated ranging from 95 to 52°C. Threshold cycles (CT) were adjusted manually. In all RT-PCR experiments, transcript levels were measured with two independent biological replicates, and each biological replicate was analyzed in three technical replicates.  Volatile Screening. Volatiles were trapped as illustrated (Fig. 2.1) using LOOK turkey bags for 2 to 24 hrs, and volatiles were collected by SPME using a 100um polydimethylsiloxane fiber (gauge 24). Volatiles were desorbed by heat at 220°C for 5min and separated on an Agilent 6890 Series GC System coupled to an Agilent 5973 34  Network Mass Selective Detector. Sesquiterpenes were separated on a HP-5 capillary column (0.25mm i.d. x 30 m with 25µm film) (Agilent Technologies) with an initial temperature of 40˚C (2 min hold), which was then increased 3˚C per minute up to 140˚C, followed by a 20˚C ramp until 300˚C (10 min hold) using Select Ion Mass Spectrometry (SIMS) with the following selected mass ions: 94, 109, 121, 161, 189 and 204 Compounds were identified using Agilent Technologies software and Wiley 126 MS-library, as well as by comparing retention time with the product of E. coli expressed (E)-α-bisabolene synthase  Generation of (E)-α-bisabolene standard. Bacterial strain E. coli BL21-CodonPlus (DE3) containing plasmid pET101/ (E)-α-bisabolene was grown at 37°C in 100 mL of Luria-Bertani broth supplemented with 20 µg mL—1 ampicillin (Amp) to A600 = 0.5. The culture was transferred to 20°C for 30 min and was then induced with 1 mM isopropylthio-β-galactoside and left to grow overnight. Cells were harvested by centrifugation, and were resuspended and disrupted in 1 mL of monoterpene synthase buffer (25 mM HEPES, pH 7.2, 100 mM KCl, 10 mM MnCl2, 10% [v/v] glycerol, and 5 mM DTT) by sonication (Branson Sonifier 250; AmTech, Shelton, CT) at 5W for 10 s. Lysates were cleared by centrifugation and 164 µM GPP (Echelon Research Laboratories, Salt Lake City, UT) were added to the extract and overlaid with 1 mL of pentane. Assay mixtures were then incubated at 30°C for 2 h. Products were collected with three consecutive pentane extractions (3 x 1 mL) and were combined over water. The pentane fractions were concentrated under nitrogen.  35  Figure 2.1: Wire cage design. Whole plants, seedlings as well as branches of mature plants can be placed inside the cage. An oven bag can then cover the cage and be tied to a seal. The plastic is easily puncturable with the SPME injector holder.  2.3 RESULTS  Transformation of white spruce, tobacco and Arabidopsis with the pinIIpromoter::GUS and pinII-promoter::(E)-α-bisabolene synthase constructs The potato pinII-promoter is known to drive wound- and insect-induced gene expression in several angiosperm species (Thornburg et al., 1987; Kim et al., 2000; Keinonen-Mëttala et al., 1998). I tested this promoter with a GUS-reporter gene for its ability to drive induced gene expression in white spruce (P. glauca), a gymnosperm tree belonging to the Pinaceae. For validation, I first tested the pinII::GUS constructs in tobacco, in which the pinII promoter has previously been characterized (Thornburg et al., 1987), and in Arabidopsis. In order to generate these plants, a gene construct bearing the pinII promoter, GUS reporter gene and nos terminator sequence was engineered into the pBluescript vector. Once validated by restriction digest, PCR and sequencing was done (data not shown), the construct was transferred to the pCAMBIA 1300 binary vector (Fig. 2.2). Following a second round of validation, the vector was introduced into Agrobacterium 36  and plants were transformed as described in the materials and methods. For Arabidopsis and tobacco, third generation homozygous lines were selected for subsequent experiments. This was not possible in white spruce because of the long generation time. Insertion of only one copy of the construct was assessed by counting the number of germinating seedlings that were resistant to antibiotic from transformed Arabidopsis and tobacco seeds (Table 2.1). The same was assessed through Southern blot in spruce (data not shown). To establish that pinII-dependent induced gene expression is also functional in driving TPS expression, Arabidopsis, tobacco and white spruce were also transformed with the grand fir (Abies grandis) (E)-α-bisabolene synthase [(E)-α-bis] full-length cDNA downstream of the pinII-promoter. (E)-α-bisabolene synthase is an inducible sesquiterpene synthase (sesqui-TPS) conifer defence gene (Bohlmann et al., 1998b). Third generation homozygous lines were selected in Arabidopsis and tobacco. Insertion of only one copy of the construct was assessed by count of antibiotic resistance in germinating plants from the seeds of the transformed Arabidopsis and tobacco (Table 2.2). First generation, single copy transformants as confirmed by Southern blot analysis were used for spruce (data not shown).  Localized wound- and insect-induced pinII-promoter activity in white spruce tobacco, and Arabidopsis. Using GUS tissue staining assays I confirmed wound-inducible pinII promoter activity in leaves of pinII::GUS-transformed tobacco (Fig. 2.3 A, B and C). Similar to the results with tobacco, leaves of pin::GUS-transformed Arabidopsis plants showed a localized GUS response induced by mechanical wounding (Fig. 2.3 D, E and F). Insect  37  Figure 2.2: Gene construct used to address inducibility of the promoter in Arabidopsis, tobacco and spruce. PIN: proteinase inhibitor II promoter from potato, NOS: nopaline synthase terminator; GUS: β-glucuronidase reporter gene, E-α-bis: (E)α-bisabolene  feeding by fungus gnats (Bradysia spp.) also induced the pinII promoter in Arabidopsis leaves in a localized fashion in close proximity to the site of injury (Fig. 2.3 G). In tobacco, the constitutive pinII-dependent GUS activity appeared to be restricted to petals of flowers (Fig. 2.3 M), while in Arabidopsis the activity seemed to be confined to the sepals (Fig. 2.3N). Using the same pinII::GUS construct, localized wound- or insectinduced promoter activity was detected in white spruce (Fig. 2.3 H-L). Specifically, I found wound-induced GUS expression in needles wounded with forceps and in stems cut with a razor blade (Fig. 2.3 J, H), whereas no GUS activity was found in nontransformed control seedlings treated in the same manner (Fig. 2.3 I). Mechanical 38  damage inflicted by the stem boring white pine weevil (Pissodes strobi Peck.) also induced the pinII-promoter, GUS staining was localized to feeding sites on stems of white spruce seedlings (Fig. 2.3 K). A similar pinII-GUS response was not observed in untransformed control seedlings (Fig. 2.3 L).  Table 2.1: Hygromycin resistant and susceptible seeds from transformed Arabidopsis and tobacco. ARABIDOPSIS  TOBACCO  LINE RESISTANT SUSCEPTIBLE RATIO  LINE RESISTANT SUSCEPTIBLE RATIO  GA1  38  11  3.5  G1  *  *  GB3  43  21  2.0  G2  58  12  4.8  GB4  *  *  G3  32  10  3.2  GF3  *  *  G4  61  19  3.2  GH1  84  11  7.6  G5  32  21  1.5  GH2  62  22  2.8  G6  *  *  GK1  58  19  3.1  G7  *  *  GK2  92  26  3.5  G9  47  17  2.8  GL4  *  *  G10  41  23  1.8  GL6  50  16  3.1  GL7  40  14  2.9  *: Counting was not done when the ratio of resistance to susceptible was obviously not near 3:1  39  Table 2.2: Hygromycin resistant and susceptible seeds from transformed Arabidopsis and tobacco. Arabidopsis  TOBACCO  LINE RESISTANT SUSCEPTIBLE  RATIO  LINE RESISTANT SUSCEPTIBLE  RATIO  EG2  71  27  2.6  8  *  *  EH3  83  10  8.3  9  63  13  4.9  EH4  73  47  1.6  11  91  29  3.1  EI3  55  29  1.9  12  48  15  3.2  EJ1  65  12  5.4  13  29  19  1.5  EK1  63  29  2.2  16  44  16  2.8  EK4  89  13  6.8  17  112  33  3.4  EK6  43  9  4.8  18  16  9  1.8  EK7  107  32  3.3  24  47  14  3.4  EK8  60  18  3.3  26  35  12  2.9  EO2  56  17  3.3  27  32  9  3.6  EO4  54  19  2.8  29  25  7  3.6  EP1  *  *  31  29  29  1.0  EP2  *  *  32  45  13  3.5  EP4  44  17  2.6  34  52  17  3.1  EQ1  59  27  2.2  38  44  4  11.0  EQ2  69  19  3.6  39  54  15  3.6  EQ4  *  *  40  29  11  2.6  EQ5  76  42  1.8  42  109  29  3.8  ER1  52  19  2.7  45  35  41  0.9  ER3  100  37  2.7  46  83  17  4.9  ER4  98  35  2.8  58  116  22  5.3  ER5  64  45  1.4  59  45  16  2.8  ER6  98  29  3.4  61  57  8  7.1  61  109  23  4.7  65  30  14  2.1  *: Counting was not done when the ratio of resistance to susceptible was obviously not near 3:1  40  Figure 2.3.: PinII-dependent GUS expression in tobacco, Arabidopsis, and white spruce. Results from GUS staining assays are shown for: (A) mechanically wounded leaf (pressed between forceps ends) of tobacco plant transformed with pinII::GUS; (B) unwounded leaf of tobacco plant transformed with pinII::GUS (C) mechanically wounded leaf of wildtype tobacco; (D) mechanically wounded leaf of Arabidopsis plant transformed with pinII::GUS; (E) unwounded leaf of Arabidopsis plant transformed with pinII::GUS; (F) mechanically wounded leaf of wildtype Arabidopsis; (G) insect-wounded leaf (feeding fungus gnats) of Arabidopsis plant transformed with pinII::GUS; (H) mechanically wounded branch with needles of white spruce seedling transformed with pinII::GUS; (I) unwounded branch with needles of white spruce seedling transformed with pinII::GUS; (J) wounded stem of white spruce seedling transformed with pinII::GUS; (K) weevil wounded stem of white spruce seedling transformed with pinII::GUS; (L) weevil wounded stem of wild-type white spruce seedling. (M) unwounded tobacco flower (N) unwounded Arabidopsis flower (blue: sepal; white; petal)  Systemically induced and trichome-specific pinII-promoter activity in tobacco and Arabidopsis. In addition to the localized pinII-promoter dependent expression of GUS at the site of mechanical wounding or insect feeding, I also observed systemically-induced GUS activity in trichomes of mechanically wounded pinII::GUS–transformed tobacco 41  and Arabidopsis plants. When leaves of pinII::GUS–transformed tobacco (Fig. 2.4 A) or Arabidopsis (Fig. 2.4 C) plants were wounded with forceps, GUS staining was detectable in trichomes of distant unwounded leaves. In contrast, no such staining was found in trichomes of non-transformed plants (Fig. 2.4 B, D). Unlike tobacco and Arabidopsis, spruce lacks trichomes and no similar cell-specific systemic response was observed at the level of intact plants. Figure 2.4: PinII-dependent GUS expression in trichomes of tobacco and Arabidopsis. Results from GUS staining assays are shown for: (A) trichome on an unwounded (systemic) leaf of a mechanically wounded tobacco plant transformed with pinII::GUS; (B) trichome on an unwounded (systemic) leaf of mechanically wounded wild-type tobacco; (C) trichome on an unwounded (systemic) leaf of mechanically wounded Arabidopsis plant transformed with pinII::GUS; (D) trichome on an unwounded (systemic) leaf of mechanically wounded wild type Arabidopsis  Low level stress induction of the pinII-promoter in Arabidopsis. It was also noticed that, in Arabidopsis, the pinII-GUS expression was triggered by low level physical impact. These included leaves in contact with soil, leaves manipulated by gentle touch, as well as impact from water droplets from a fine spray (e.g. Fig., 2.5). Such sensitivity was not evident in tobacco or spruce.  Figure 2.5: PinII-dependent GUS expression in Arabidopsis under low level stress. Example shown here depicts staining following misting of an Arabidopsis plant with water.  42  Wound-induced heterologous TPS gene expression in Arabidopsis, tobacco and spruce Following experiments using the GUS reporter gene to establish that pinIIdependent induced gene expression is functional in white spruce, Arabidopsis and tobacco, I tested if expression of a known conifer defence gene can be controlled in transgenic spruce seedlings with the pinII-promoter. For this purpose, I used a transformation construct that contained the grand fir (Abies grandis) (E)-α-bisabolene synthase [(E)-α-bis] full-length cDNA downstream of the pinII-promoter. Reverse transcription (RT)-PCR was used to assess the wound-induced TPS gene expression. In pinII::(E)-α-bis-transformed Arabidopsis plants, (E)-α-bis transcripts were not detected prior to wounding (Fig. 2.6). Time-course experiments showed rapid induction of (E)-α-bis transcript accumulation as early as one hour after wounding the leaves and the transcript level increased further up to 60 h after wounding. This result was confirmed with several independent pinII::(E)-α-bis transformed Arabidopsis lines. In tobacco, relatively low levels of (E)-α-bis transcripts were detected in leaves prior to wounding followed by an increased level of (E)-α-bis transcripts at 4 to 60 h after wounding. In white spruce, low levels of (E)-α-bis transcripts were detected in needles and stems prior to wounding followed by an increased (E)-α-bis transcript level at 2 to 60 h after wounding (Fig. 2.6). To test if the grand fir (E)-α-bis primers could detect other endogenous white spruce, tobacco or Arabidopsis TPS transcripts, I performed reverse transcriptase-PCR analyses using RNA from non-transformed wild-type (wt) plants. Using the grand fir E-α-bis primers, no transcripts were detected in any of the wt Arabidopsis, tobacco or spruce plants tested (Fig. 2.6)  43  0  1  2  4  8  16  30  transformed arabidopsis  60 hrs (E)- α-bis His  wt arabidopsis  (E)-α-bis His  transformed tobacco  (E)-α-bis His  wt tobacco  (E)-α-bis His  transformed spruce  (E)- α-bis IF5  wt spruce  (E)- α-bis IF5  Figure 2.6: Reverse transcriptase-PCR analysis of inducible (E)-αbisabolene synthase [(E)-αbis] transcript abundance in wound-treated Arabidopsis, tobacco or white spruce plants transformed with pinII::(E)α-bis. RT-PCR analysis of Arabidopsis histone 1 (His) or spruce elongation initiation factor 5 (IF5) were used as reference. Transcripts were measured over a time course of up to 60 h after wounding of plants with forceps.  I also tested constitutive and wound-induced TPS gene expression in pinII::(E)α-bis transgenic Arabidopsis and white spruce by quantitative reverse transcription real-time (RT)-PCR analysis of (E)-α-bis transcript levels. I compared transcript levels in wounded and untreated pinII::(E)-α-bis transgenic plants. In pinII::(E)-α-bistransformed Arabidopsis plants, (E)-α-bis transcripts showed an approximately twoand four-fold increase at 2 and 8 h, respectively, after wounding (Fig. 2.7). In white spruce, (E)-α-bis transcripts were increased more than 15 and 25-fold at 2 and 8 h, respectively, after wounding (Fig. 2.7). Wound-induced heterologous (E)-α-bisabolene formation in A. thaliana, tobacco and spruce. I also measured the emission in the headspace of transformed A. thaliana, tobacco and spruce. All transgenic lines showing a single copy of the gene were screened by SPME. Most transgenic Arabidopsis, tobacco and spruce plants, but not  44  Figure 2.7. Real time-PCR analysis of wound-inducible (E)-α-bisabolene synthase transcript abundance in white spruce and Arabidopsis plants transformed with pinII::(E)α-bis. Transcripts were measured prior to wounding (at 0 hours) and at 2 and 8 hours after wounding plants with forceps. Fold change of transcript abundance was determined by comparison of transcript levels in wounded vs nonwounded pinII::(E)-α-bis transformed plants. Results are shown as mean fold change with standard error (n = 4 to 6).  all, showed some very low level emission of (E)-α-bisabolene. In contrast, none of the wild-type plants produced any detectible amounts of (E)-α-bisabolene (Figures 2.8, 2.9, 2.10). Transgenic A. thaliana released the largest amount of volatile (E)-αbisabolene ranging from 0.3 to 1 ng / g fresh weight / hr (Fig. 2.8). Tobacco emitted very little (E)-α-bisabolene with the strongest-emitting line producing 0.0004 ng to 0.003 ng / g fresh weight / hr (Fig 2.9). In transgenic spruce, the highest level of (E)-αbisabolene emission ranged from 0.04 – 0.07 ng / g fresh weight / hour (Fig 2.10).  45  Figure 2.8: (E)-α-bisabolene production in transgenic A. thaliana. A: Representative GC-MS chromatogram from SPME sampling of the volatile emission of pre-flowering WT (wild-type) and (E)-α-bis ((E)-α-bisabolene) transformed A. thaliana plants. Shown are the sesquiterpenes detected by scanning the mass ions (94, 109, 121, 161, 189 and 204). The rectangle highlights the (E)-α-bis peak B: Amount of volatile detected per gram fresh weight per hour in a 1L environment in various lines. Standard error (95%) shown.  46  Figure 2.9: (E)-α-bisabolene production in transgenic tobacco. A: Representative GC-MS chromatogram from SPME sampling of the volatile emission of pre-flowering WT (wild-type) and (E)-α-bis ((E)-α-bisabolene) transformed tobacco plants. Shown are the sesquiterpenes detected by scanning the mass ions (94, 109, 121, 161, 189 and 204). The rectangle highlights the (E)-α-bis peak B: Amount of volatile detected per gram fresh weight per hour in a 1L environment in various lines. Standard error (95%) shown.  47  Figure 2.10: (E)-α-bisabolene production in transgenic spruce. A: Representative GC:MS chromatogram from SPME sampling of the volatile emission of WT (wild-type) and (E)-α-bis ((E)-α-bisabolene) transformed spruce seedlings. Shown are the sesquiterpenes detected by scanning the mass ions (94, 109, 121, 161, 189 and 204). The rectangle highlights the (E)-α-bis peak B: Amount of volatile detected per gram fresh weight per hour in a 1L environment in various lines. Standard error (95%) shown. 2.4 DISCUSSION  The results shown in this chapter demonstrate that the potato pinII-promoter can be used to drive localized wound- or insect-induced gene expression in white spruce, a gymnosperm tree species (Fig. 2.3). This study extends the known range of heterologous activity of the inducible pinII-promoter beyond its previously reported 48  function in several angiosperm species (e.g Thornburg et al., 1987; Hollick and Gordon, 1995; Keinonen-Mettala et al., 1998). The localized wound- and insect-induced pinII activity in Arabidopsis and spruce make the pinII-promoter a useful tool for testing the biological function(s) of conifer defence genes both in an angiosperm reference system that is suitable for high-throughput transformation as well as in a conifer system suitable for biologically relevant studies with conifer pests. Results described in this chapter also demonstrate that pinII-promoter-dependent expression of the (E)-αbisabolene synthase in spruce, tobacco and Arabidopsis is possible, and provides a first proof of concept that TPS gene expression can be transformed in an inducible fashion in both angiosperm and gymnosperm plants (Fig. 2.6, 2.7). For the purpose of evaluating the biological function(s) of inducible defence genes, expression from an inducible promoter is more biologically relevant than using the constitutive 35S- or ubiquitin promoters. The latter promoters drive constitutive gene expression that is independent of external stimuli, thus creating artificially high transcript abundance for genes that are highly regulated in nature. Much of a plant’s defence transcriptome and defence metabolism (e.g. Cheong et al., 2002; Chen and Zhu, 2004; Ralph et al., 2006a; Martin et al., 2002; Martin et al., 2003; Miller et al., 2005) is both temporally and spatially restricted and associated with the downregulation of transcript abundance associated with specific primary metabolic processes (e.g. Cheong et al., 2002; Ralph et al., 2006b). This makes high-level constitutive defence gene expression undesirable since it may create major shifts in metabolism in the absence of a biotic stress. Thus, the pinII- and other inducible or tissue-specific defence gene promoters will serve as critical tools for in vivo analysis in functional genomics of plant defence.  49  A possible drawback of the pinII-promoter, at least for experiments in Arabidopsis, is that this promoter is highly sensitive and responds in Arabidopsis to minor mechanical impact. For example, I found that the impact of tiny water droplets resulting from the misting of plants was sufficient to induce GUS activity in pinII::GUS– transformed Arabidopsis plants (Fig. 2.5). However, this very high sensitivity of the pinII-promoter could also be an advantage for detecting plant responses to subtle environmental signals such as airborne chemicals (Chapter 3 of this thesis), or in experiments that involve minor physical impact (e.g. Bown et al., 2002). While the known pinII-promoter adds a relevant tool to conifer transformation studies, further screening of conifers and other plants for new insect-inducible and possibly tissuespecific promoters is warranted. Trichome-specific, systemically induced pinII-promoter activity in Arabidopsis and tobacco has, to the best of my knowledge, not previously been reported and is interesting as it provides additional opportunities to fine-tune the spatial patterns of heterologous gene expression (Fig. 2.4). For example, trichomes could provide a suitable cell target for the inducible expression of plant defence genes such as TPS. In a recent study, Kappers et al. (2006) demonstrated the metabolic engineering of constitutive terpenoid volatile emissions in Arabidopsis, providing elegant evidence for a role of such volatiles in a multi-trophic defence. Although this system was successful under controlled laboratory conditions (Kappers et al., 2005), applications of engineered volatile emissions in the field may require temporally and spatially restricted defence response to avoid a “crying wolf” effect from plants that “call for help” in the absence of attack or to avoid negative effects from a constitutive drain on the plants primary metabolism in the absence of a need for defence. The use of inducible and/or  50  cell-specific promoters could also lead to improvements of metabolic engineering of terpenoid secondary metabolites, which are often formed in specialized cells. In conclusion, this work shows that the pinII-promoter provides a valuable asset for functional genomics studies in conifers and may have broader implications for temporal and spatial fine-tuning of gene expression in plant metabolic engineering. Future testing of transformed plants responding to herbivore or pathogen challenge could complement biochemical in vitro characterization of defence genes. For example, three-year old spruce plants could be suitable for initial tests with weevils while other spruce-insect interactions can already be tested at the seedling stage (Lachance et al., 2007). Investigating the volatile emission of pinII::(E)-α-bis transgenic plants showed only very low levels of new volatiles detectable in the transgenic plants (Figure 2.8, 2.9 and 2.10).  Additional work to understand and optimize sesquiterpene volatile  production is warranted. This could include targeting the introduced sesquiterpene to the mitochondria as done by Kappers et al., (2006). The challenges of this particular volatile analysis will be discussed in Chapter 4.  2.5 ACKNOWLEDGMENTS  For the work in this specific chapter, I would also like to acknowledge Ashley Byun McKay in Aine Plant’s group at SFU for her participation in the construction of some tobacco plants, as well as Armand Séguin’s group for the transformation of spruce. Finally I would like to thank the greenhouse staff and Tristan Gillan for their help in maintaining the plants.  51  2.6 LITERATURE CITED: Ausubel FM, Brent R, Kingston RE, Moore DM, Seidman JG, Smith JA, Struhl K, Chanda VB (2000) Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., Brooklyn, New York, 3.5.3-3.5.6 Bohlmann J, Crock J, Jetter R, Croteau R (1998b) Terpenoid-based defences in conifers: cDNA cloning, characterization, and functional expression of wound-inducible (E)-α-bisabolene synthase from grand fir (Abies grandis) Proc Natl Acad Sci USA 95: 6756-6761 Bohlmann J, Martin D, Oldham N, Gershenzon J (2000) Terpenoid secondary metabolism in Arabidopsis thaliana: cDNA cloning, characterization and functional expression of a myrcene / (E)-β-ocimene synthase. Arch Biochem Biophys 375: 261-269 Bohlmann J, Meyer-Gauen G, Croteau R (1998a) Plant terpenoid synthases: Molecular biology and phylogenetic analysis. Proc Natl Acad Sci USA 95: 4126-4133 Bohlmann J, Steele CL, Croteau R (1997) Monoterpene synthases from grand fir (Abies grandis). cDNA isolation, characterization, and functional expression of myrcene synthase, (-)(4S)-limonene synthase, and (-)-(1S,5S)-pinene synthase. J Biol Chem 272: 21784-21792 Bowers WS, Fales HM, Thompson MJ, Uebel EC (1966) Juvenile Hormone: Identification of an Active Compound from Balsam Fir. Science. 154:1020-1021 Bown AW, Hall DE, MacGregor KB (2002) Insect footsteps on leaves stimulate the accumulation of 4-aminobutyrate and can be visualized through increased chlorophyll fluorescence and superoxide production. Plant Physiol 129: 1430-1434 Bryant J, Green TR, Gurusaddaiah T, Ryan CA (1976) Proteinase inhibitor II from potatoes: isolation and characterization of its promoter components. Biochem 15:3418-24 Chen WJ, Zhu T (2004) Networks of transcription factors with roles in environmental stress response. TIPS 9:591-596 Cheng AX, Lou YG, Mao YB, Lu S, Wang LG, Chen XY (2007) Plant Terpenoids: Biosynthesis and Ecological Functions. J Integ Plant Bio 49: 179-186 Cheong YH, Chang HS, Gupta R, Wang X, Zhu T, Luan S (2002) Transcriptional Profiling Reveals Novel Interactions between Wounding, Pathogen, Abiotic Stress, and Hormonal Responses in Arabidopsis. Plant Physiol 129: 661-677 Clough S, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 Franceschi VR, Krokene P, Christiansen E, Krekling T (2005) Anatomical and chemical defences of conifer bark against bark beetles and other pests. New Phytol. 167: 353-376 Galka PW, Ambrose SJ, Ross ARS, Abrams SR (2005) Syntheses of deuterated jasmonates for mass spectrometry and metabolism studies. J Label Comp Radiopharm 48: 797-809 Gang D (2005) Evolution of flavors and scents. Ann Rev Plant Biol 56: 301–325  52  Godard KA, Byun-McKay A, Levaseur C, Plant A, Séguin A, Bohlmann J (2007) Testing of a heterologous, wound- and insect- inducible promoter for functional genomics studies in conifer defense. Plant Cell Rep. on line Government of British Columbia, Canada (2005) Mountian Pine Beetle Emergency Response – Canada-B.C. Implementation Strategy. . http://www.for.gov.bc.ca/hfp/mountain_pine_beetle/MPB-Implement-Strat-Sept05.pdf Gustafson G, Ryan CA (1976) Specificity of protein turnover in tomato leaves. Accumulation of proteinase inhibitors, induced with the wound hormone, PIIF. J Biol Chem 251: 7004-7010 Haggman HM, Aronen TS, Nikkanen TO (1997) Gene transfer by particle bombardment to Norway spruce and Scots pine pollen. Can J For Res 27: 928-935 Haudenschild C, Croteau R (1998) Molecular engineering of monoterpene production. Genetic Eng. 20: 267-280 Haukioja E, Neuvonen S (1985) The relationship between size and reproductive potential in male and female Epirrita autumnata (Lep., Geometridae). Ecol Ent 10:267-270 Hines PJ (2006) The Invisible Bouquet. Science 311: 803 Hollick JB, Gordon MP (1995) Transgenic analysis of a hybrid poplar wound-inducible promoter reveals developmental patterns of expression similar to that of storage protein genes. Plant Physiol 109: 73-85 Huber DP, Philippe RN, Madilao LL, Sturrock RN, Bohlmann J (2005) Changes in anatomy and terpene chemistry in roots of Douglas-fir seedlings following treatment with methyl jasmonate. Tree Physiol 25:1075-83 Huber DPW, Ralph S, Bohlmann J (2004) Genomic hardwiring and phenotypic plasticity of terpenoid-based defenses in conifers. J Chem Ecol 30: 2399-2418 Jefferson RA (1987) Assaying chimeric genes in plants: The GUS gene fusion system. Plant Mol Biol Rep 5: 387-405 Kappers IF, Aharoni A, van Herpen TWJM, Lückerhoff LLP, Dicke M, Bouwmeester HJ (2005) Genetic engineering of terpenoid metabolism attracts bodyguards to Arabidopsis. Science 309: 2070-2072 Keeling CI, Bohlmann J (2006a) Genes, enzymes and chemicals of terpenoid diversity in the constitutive and induced defence of conifers against insects and pathogens. New Phytol. 170: 657–675 Keeling CI, Bohlmann J (2006b) Diterpene resin acids in conifers. Phytochem 67: 2415-2423 Keinonen-Mettälä K, Pappinen A, von Weissenberg K (1998) Comparisons of the efficiency of some promoters in silver birch (Betula pendula). Plant Cell Rep 17:356-361 Kim SR, Lee M, An G, Kim S (2000) Differential expression of the potato proteinase inhibitor II promoter in transgenic tobacco. J Plant Biol 43: 48-55  53  Klimaszewska K, Rutledge RG, Seguin A (2004). Genetic transformation of conifers utilizing somatic embryogenesis. In Methods in Molecular Biology, L. Peña, ed (Humana Press, Totowa, NJ), pp. 151–164 Klopfenstein NB, Shi NQ, Kernan A, McNabb HS, Hall RB, Hart ER, Thornburg RW (1991) Transgenic Populus hybrid expresses a wound-inducible potato proteinase inhibitor II - CAT gene fusion. Can J For Res 21: 1321–1328 Kolosova N, Miller B, Ralph S, Ellis BE, Douglas C, Ritland K, Bohlmann J (2004) Isolation of high-quality RNA from gymnosperm and angiosperm trees. BioTech 36: 1-4 Lavy M, Zuker A, Lewinsohn E, Larkov O, Ravid U, Vainstein A, Weiss D (2002) Linalool and linalool oxide production in transgenic carnation flowers expressing the Clarkia breweri linalool synthase gene. Mol Breed 9: 103–111 Levee V, Seguin A (2001) Inducible expression of the heterologous PAL2 promoter from bean in white pine (Pinus strobus) transgenic cells. Tree Physiol 21:665-672 Lücker J, Bowen P, Bohlmann J (2004a) Vitis vinifera terpenoid cyclases: Functional identification of two sesquiterpene synthase cDNAs encoding (+)-valencene synthase and (-)germacrene D synthase and expression of mono- and sesquiterpene synthases in grapevine flowers and fruits. Phytochem 65:2649-2659 Lücker J, Schwab W, Franssen MCR, van der Plas LHW, Bouwmeester HJ, Verhoeven HA (2004b) Metabolic engineering of monoterpene biosynthesis: two-step production of (+)trans-isopiperitenol by tobacco. Plant J 39: 135-145 Lücker J, Schwab W, van Hautum B, Blaas J, van der Plas LHW, Bouwmeester HJ, Verhoeven HA (2004c) Increased and Altered Fragrance of Tobacco Plants after Metabolic Engineering Using Three Monoterpene Synthases from Lemon. Plant Physiol 134: 510-519 Mahmoud SS, Croteau R (2002) Strategies for transgenic manipulation of monoterpene biosynthesis in plants. TIPS 7: 366-373 Martin DM, Fäldt J, Bohlmann J (2004) Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily. Plant Physiol 135:1908-27 Martin DM, Gershenzon J, Bohlmann J (2003) Induction of volatile terpene biosynthesis and diurnal emission by methyl jasmonate in foliage of Norway spruce. Plant Physiol 132: 15861599 Martin D, Tholl D, Gershenzon J, Bohlmann J (2002) Methyl jasmonate induces traumatic resin ducts, terpenoid resin biosynthesis, and terpenoid accumulation in developing xylem of Norway spruce stems. Plant Physiol 129:1003-18 Miller B, Madilao LL, Ralph S, Bohlmann J (2005) Insect-induced conifer defense. White pine weevil and methyl jasmonate induce traumatic resinosis, de novo formed volatile emissions, and accumulation of terpenoid synthase and putative octadecanoid pathway transcripts in Sitka spruce. Plant Physiol 137: 369-82  54  Ralph S, Park JY, Bohlmann J, Mansfield SD (2006) Dirigent proteins in conifer defense: gene discovery, phylogeny and differential wound- and insect-induced expression of a family of DIR and DIR-like genes in spruce (Picea spp.). Plant Mol Biol 60: 21-40 Ralph SG, Yueh H, Friedmann M, Aeschliman D, Zeznik JA, Nelson CC, Butterfield YSN, Kirkpatrick R, Liu J, Jones SJM, Marra MA, Douglas CJ, Ritland K, Bohlmann J (2006) Conifer defence against insects: microarray gene expression profiling of Sitka spruce (Picea sitchensis) induced by mechanical wounding or feeding by spruce budworms (Choristoneura occidentalis) or white pine weevils (Pissodes strobi) reveals large-scale changes of the host transcriptome. Plant Cell Env 29: 1545-1570 Ralph SG, Hudgins JW, Jancsik S, Franceschi VR, Bohlmann J (2007) Aminocyclopropane carboxylate synthase is a regulated step in ethylene-dependent induced conifer defense: Fulllength cDNA cloning of a multi-gene ACS family, differential constitutive and wound- and insect-induced expression, and cellular and subcellular localization in spruce and Douglas fir. Plant Physiol, in press. Ro DK, Arimura GI, Lau SYW, Piers E, Bohlmann J (2005) Loblolly pine abietadienol/abietadienal oxidase PtAO (CYP720B1) is a multifunctional, multisubstrate cytochrome P450 monooxygenase. Proc Natl Acad Sci USA 102: 8060-8065 Ro DK, Bohlmann J (2006) Diterpene resin acid biosynthesis in loblolly pine (Pinus taeda): Functional characterization of abietadiene/levopimaradiene synthase (PtTPS-LAS) cDNA and subcellular targeting of PtTPS-LAS and abietadienol/abietadienal oxidase (PtAO, CYP720B1). Phytochemistry 67: 1572-1578 Ro DK, Paradise EM, Ouellet M, Fisher KJ, Newman KL, Ndungu JM, Chang MCY, Ham TS, Eachus RA, Ho KA, Shiba Y, Sarpong R, Keasling JD (2006) Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature 440: 940-943 Ross ARS, Ambrose SJ, Cutler AJ, Feurtado JA, Kermode AR, Nelson KM, Zhou R, Abrams, SR (2004) Determination of Endogenous and Supplied Deuterated Abscisic Acid in Plant Tissues by High Performance Liquid Chromatography-Electrospray Ionization Tandem Mass Spectrometry with Multiple Reaction Monitoring. Anal Biochem 329: 324-333 Ryan CA (1992) The search for the proteinase inhibitor-inducing factor, PIIF. Plant Mol Bio 19:123-133 Tang W, Newton RJ, Charles TM (2005) High efficiency inducible gene expression system based on activation of a chimeric transcriprion factor in transgenic pine. Plant Cell Rep 24: 619628 Thornburg RW, An G, Cleveland TE, Johnson R, Ryan CA (1987) Wound-inducible expression of a potato inhibitor II-chloramphenicol acetyltransferase gene fusion in transgenic tobacco plants. Proc Natl Acad Sci USA 84: 744-748 Wagner MR, Clancy KM, Tinus RW (1989) Maturational variation in needle essential oils from Pseudotsuga menziesii, Abies concolor and Picea engelmannii. Phytochem 28: 765-770 Wagner A, Phillips L, Narayan RD, Moody JM, Geddes B (2005) Gene silencing studies in the gymnosperm species Pinus radiate. Plant Cell Rep 24: 95-102. Zeng, G (1998) Sticky-end PCR: New method for subcloning. Biotech 25: 206–208  55  Zeringue H (1987) Changes in cotton leaf chemistry induced by volatile elicitors. Phytochem 26:1357-1360  .  56  CHAPTER  3:  MONOTERPENE  INDUCED  RESPONSES  IN  ARABIDOPSIS  THALIANA 2  3.1 INTRODUCTION  Plants emit a large variety of volatile organic compounds (VOCs), including a diverse array of low molecular weight terpenoids (Dudareva et al., 2006; Pichersky et al., 2006). Some of these volatile emissions function as chemical communication signals between plants and other organisms, such as the attraction of pollinators, host recognition by herbivores, or signalling in multi-trophic plant-arthropod defence interactions (e.g., Paré and Tumlinson, 1999; De Moares et al., 1998; Dicke and Van Loon, 2000; De Moares et al., 2001; Kessler and Baldwin, 2001; Kappers et al., 2005; Rasmann et al., 2005). Whether or not plants can receive biologically relevant information by detecting volatiles emitted from other plants, or from distant parts of the same plant, is a question that dates back more than two decades (Baldwin and Schultz, 1983; Rhoades, 1983). The topic of volatiles in plant signalling has been critically re-addressed in several recent experimental studies and reviews (e.g., Arimura et al., 2000; Birkett et al., 2000; Dolch and Tscharntke, 2000; Karban et al., 2000; Karban, 2001; Dicke et al., 2003; Engelberth et al., 2004; Baldwin et al., 2006; Heil and Bueno, 2007; Paschold et al., 2006; Runyon et al., 2006). For example, Runyon et al. clearly showed that the parasitic dodder plant (Cuscuta pentagona) detects terpenoid volatiles emitted from young tomato plants as biologically active signals for successful host targeting. Also, 2  A version of this chapter will be submitted for publication. Godard KA, White R and Bohlmann J. Monoterpeneinduced molecular responses in Arabidopsis thaliana (2008)  57  exposure to volatiles from damaged sagebrush was shown to prime the elicitation of proteinase inhibitors in close neighbouring tobacco, and plants exposed to volatiles subsequently received less damage from herbivores (Karban et al., 2000). Another group showed that corn seedlings previously exposed to VOCs released from herbivore attacked seedlings responded to C6 aldehydes with an increased sesquiterpenoid emission and higher jasmonate (JA) accumulations (Engelberth et al., 2004). Also, Kishimoto et al. (2005; 2006b) have recently shown that exposure of Arabidopsis to the monoterpene allo-ocimene caused increased abundance of a few gene transcripts and increased plant resistance against the pathogen Botrytis cinerea. Based on the above mentioned prior work, I hypothesized that the detection of terpenoid volatiles could result in substantial changes in molecular processes in plant tissues. No large-scale analysis of a plant response to terpenoid volatiles has previously been reported, despite considerable research activity in this area. Arabidopsis has the genomic, biochemical, and physiological capacities to produce and emit monoterpenoid volatiles, including myrcene and (E)-β-ocimene (Bohlmann et al., 2000; Aubourg et al., 2002; Aharoni et al., 2003; Fäldt et al., 2003). The objective of the present study was to evaluate, using molecular and chemical genomics, the extent to which exposure to monoterpene volatiles can affect a plant’s transcriptome and to identify components of signaling in the response to monoterpenes in Arabidopsis thaliana. To the best of my knowledge, no prior work has evaluated a plant response to terpenoid volatiles in a genome-wide transcriptome analysis. Using the stress-inducible pinII-promoter::GUS reporter Arabidopsis plants described in chapter 2 (Godard et al., in press), several acyclic and cyclic monoterpene volatiles were tested as potential stress cues in Arabidopsis. This was followed by a genome-wide expression profiling of Arabidopsis exposed to the volatile monoterpenes myrcene and ocimene. Jasmonate 58  metabolite analysis as well as mutant analysis of ocimene treated Arabidopsis was also done. Together, the results described in this chapter demonstrate that monoterpenes have a substantial effect on the Arabidopsis leaf transcriptome, and that octadecanoids play an important role in mediating the monoterpene-induced plant response.  3.2 MATERIALS AND METHODS  Plant and Insect Materials. Arabidopsis thaliana (Col-0) seeds were provided by Dr. Ljerka Kunst (University of British Columbia, Vancouver, Canada). Stable (T3) plants containing pinII-GUS were generated as described in chapter 2. Fourth generation mutant lines (aoc, coi1, etr2) were from the Arabidopsis Biological Resource Center (http://www.arabidopsis.org/abrc/) and confirmed by PCR. Seeds of wild type, mutant, and transformed plants were germinated on 50% MS media, individual seedlings were then transferred to 6 x 4 x 4 cm plastic pots with soil mix (Sunshine Mix 5; SunGro, Canada), and grown for approximately two weeks at 22°C, 16/8 h light/dark, 70 micromoles/m2/s of light intensity to approximately 3 to 4 cm height. Cabbage looper (Trichoplusia ni) larvae were provided by Dr. Murray Isman (UBC, Vancouver).  Plant Treatment. For exposure to monoterpene or MeJA volatiles, potted plants were placed in a fume hood on a clean, aluminum foil-covered surface under a 1L-glass beaker together with a cotton ball of 1 to 2 cm diameter containing a defined concentration of the volatile compound (0.4-4 :L for GUS assays; 4 :L for microarray and RT-PCR gene expression studies). Compounds were used individually without solvents added. The following pure (90%-99%) monoterpenes were from Sigma Aldrich  59  (Oakville, Canada): (+)-α-pinene (99%), (-)-β-pinene (99%), (+)-β-pinene (99%); myrcene (90%); racemic linalool (95%), racemic limonene (96%). A 95%-pure mixture of 70% (E)-β-ocimene, 10% (Z)-β-ocimene, and 15% allo-ocimene was from International Flavours and Fragrance (New York, USA). MeJA (95%) was from Sigma Aldrich. Control plants were treated in the same fashion without any compound added to the cotton ball. Plants were exposed to volatiles released from the cotton ball for 0.5, 2, 6 or 24 h. Above-ground tissues were harvested, frozen in liquid nitrogen, and stored at –80°C prior to RNA or metabolite extraction. GUS staining assays (Jefferson, 1987) were done with leaves detached from treated plants (at 2 h). To test for priming effects, plants were exposed to ocimene for 2 h followed by mechanical damage applied by gently pressing rosette leaves twice between forcep ends (experiment a). Plants were harvested 2 h after wound treatment. In the pre-treatment experiment (b), ocimene-pretreated plants were exposed to feeding for 2 h by cabbage looper larvae, third instar (two larvae per plant).  Microarray Gene Expression Analysis. RNA was isolated using Trizol reagent (Invitrogen; Burlington, Canada) following the manufacturer’s protocol with a second chloroform extraction. RNA was precipitated using 0.5 volumes of isopropanol and 0.5 volumes of 0.8M Na3-Citrate. RNA quality was assessed by agarose gel separation and spectrophotometrically. Total RNA was used for a direct labeling procedure. Total RNA (80 µg) was incubated with 0.27 µM T17VN primer, 0.15 mM dATP, dCTP, and dGTP, 0.05 mM dTTP (Invitrogen), 0.025 mM Cyanidin3- or Cyanidin5-conjugated dUTP (Amersham, Piscataway, NJ, USA), 40 U RNAseInh (Promega, San Luis Obispo, CA, USA), and 400 U SuperscriptII (Invitrogen) in 10 mM DTT and 1x first strand buffer in a  60  total volume of 40 µL. In addition, 0.3 fmol human cRNAs complementary to the human negative control oligonucleotides were used in labeling reactions (HsD17B1, KRT1, and MB). Prior to the addition of enzymes the solution was heated to 65°C for 5 min and for primer annealing cooled to 42°C. Following an incubation at 42°C for 2.5 h, the RNA was degraded with 8 µL 1 M sodium hydroxide for 15 min at 65°C, neutralized with 8 µL 1 M hydrochloric acid and buffered with 4 µL 1 M Tris, pH 7.5. Subsequently, the labeled cDNA was purified using a PCR purification kit according to the manufacturer’s protocol (Qiagen, Mississauga, ON, Canada). DNA was eluted in 100 µL 10mM Tris, pH 8.5, the two labeling reactions were combined, and 1 µL Cyanidin5labeled GFP was added. Following an ethanol/sodium acetate precipitation the airdried cDNA pellet was resuspended in 3 µL water, denatured at 95°C for 3 min, added to 50 µL pre-warmed array hybridization buffer no. 1 (Ambion, Austin, TX, USA), and kept at 65°C until further use. Microarray slides were pre-hybridized for 45 min at 48°C in 5x SSC, 0.1% SDS, 0.2% BSA. Slides were washed twice with water for 15 sec, dipped five times in isopropanol, and spun dry in Falcon tubes at 100 g for 3 min. The hybridization solution was applied to the microarray slides and covered with untreated glass cover slips (Fisher Scientific, Nepean, ON, Canada). Arrays were incubated over night in CMT hybridization chambers (Corning, Corning, NY, USA) submerged in a water bath at 42°C with moderate vertical shaking. Hybridization chambers were disassembled and slides were washed for 15 min at 42°C in 2x SSC, 0.5% SDS, and for two times 15 min in 0.5x SSC, 0.5% SDS. Subsequently, arrays were dipped five times in 0.1x SSC and spun dry as described above. Details of the 70-mer microarray platform have previously been described (Ehlting et al., 2005). In the present study we used the same platform with an extended AROS V3.0 oligo set (Operon Biotechnologies, Huntsville, USA; www.operon.com/arrays/oligosets_arabidopsis.php) 61  of 29,110 Tm-optimized 70-mers representing 26,173 protein-coding genes, 28,964 protein-coding gene transcripts, and 87 microRNA genes from Arabidopsis.  Oligo  design was based on the ATH1 release 5.0 of the TIGR Arabidopsis genome annotation database (www.tigr.org) and the 4.0 release of the miRNA Registry at the Sanger Institute (www.sanger.ac.uk). Microarray hybridizations were done with equal numbers of Cy3- and Cy5-labeled treatment and control RNA samples to eliminate fluorescent dye bias. Initial hybridizations were performed with two independent biological and two technical replicates for the 2 h ocimene treatment to confirm technical reproducibility. All subsequent array hybridizations included four independent biological replicates. Microarray slides were scanned on a Packard Bioscience BioChip Technologies Model ASCEX00 Scan Array (Montreal, Canada). Laser power was adjusted to optimal signal/background levels for each experiment with background fluorescence not exceeding 250 pixels.  Spots were quantified using the Imagene  software (BioDiscovery, Marina Del Rey, USA). Grids were manually placed and spot finding was performed using the “auto adjust” function three times. Median pixel intensity was used for all analyses. To limit user bias, no flagging was done. Each channel was background corrected using the lowest 10% of foreground intensities. The two channels of each array were then normalized to each other using vsn thereby generating the delta h measure for each array. Using all slides, a linear model was used to estimate all effects and their standard errors. Student’s t-test was used to compute a p-value for each effect. Q-values were computed to adjust for the false discovery rate. Additional data processing was done using customized scripts for R and Bioconductor (The R Development Core Team, http://www.r-project.org). See Supplemental data for preliminary assessment script and quality control scatter plots. Only spots showing reproducible expression at p < 0.05 were assessed; spots with > 262  fold differential expression were submitted to the TAIR GO annotation database search engine (http://www.arabidopsis.org/tools/bulk/go/index.jsp), and placed into functional categories. Genome representation of GO categories were from the TAIR GO annotation database using whole genome characterization.  Significant differential  representation between genomic abundance and transcript abundance was calculated using a test for equality of proportions. Microarray data were obtained according to MIAME standards and are available in the European Bioinformatics Institute (EBI) database.  Quantitative real time-PCR Analysis. For cDNA synthesis, 2.5 µg of RNA was treated with 1 µL of DNAse I (Invitrogen) in a final volume of 10 µL at room temperature for 15 min, followed by addition of 1 :L of 25mM EDTA and incubation for 10 min at 65°C, and further addition of 1 µL oligo dT, 1 µL 10mM of each dNTPs and 1 µL water and additional incubation for 5 min at 65°C. Reactions were placed on ice and spun down at 3000 rpm in an QuickSpin minifuge. 5X RT buffer, 2 µL 0.1 M DTT and 1 µL SUPERSCRIPT II RT were added to a final 20 µL volume.  The reaction was  incubated for 1h at 42°C. The resulting cDNA was diluted 10-fold with water. PCR was conducted using Qiagen QuantiTect SYBR Green Mastermix (Mississauga, Canada) in final reaction volumes of 20 µL with PCR reactions done as described in chapter 2. In all RT-PCR experiments, transcript levels were measured with three independent biological replicates, and each biological replicate was analyzed in two or three technical replicates. Primers used for RT-PCR are listed in (supporting information Table 1).  63  Metabolite Analysis.  Tissue extraction for MeJA analysis was done as described  by Meyer et al. (2003). Tissues were ground to a fine powder with a mortar and pestle under liquid nitrogen. Extraction buffer (0.1% HCl in MeOH) was added (2 mL/g tissue fresh weight) and extracts transferred to 1.5 mL microcentrifuge tubes, shaken for 5 min, and centrifuged at 3,000 rpm for 1 min. Extraction of tissue pellets was repeated four times and supernatants were pooled, transferred into dark glass vials and concentrated under N2 to 300 µL. Residual solids were removed by centrifugation and the MeOH-extract analysed on an Agilent (Canada) 1100 LC-MSD-Trap XCT plus system equipped with a Rapid Resolution HT Zorbax SB-C18 4.6 X 50mm, 1.8 micron column. Instrument settings and analytical conditions were: Positive ion electrospray with dry temperature set at 350 ºC; nebulizer pressure at 65 psi; dry gas flow at 12 L/min; column flow at 1.5 mL/min; column temperature at 50 ºC; mobile phase was H2O with 0.2% formic acid (A) and acetonitrile with 0.2% formic acid (B) with a gradient program of 10% B at 0 min to 80% B at 6 min; injection vol: 30:L in triplicates. MeJA was identified by comparison of mass spectra and retention times with those of authentic standard (Sigma Aldrich). For quantitative MeJA analysis, standard curves were generated. Seven pure standards (1.4 ng to 89.6 ng) of MeJA were combined with 16.5 ng of d3-MeJA (Sigma Aldrich), then injected into the LC-MS. Analyte standard curves were calculated using Bruker Daltonik LC/MSD Trap Software 5.2 build 382.  d3-MeJA was also used as internal standard to assess recovery  (consistently ~50%) from plant extracts. JA was analyzed by HLPC-MS/MS at the Plant Biotechnology Institute of the National Research Council of Canada. Fresh plant material was frozen in liquid nitrogen and ground to a fine powder. Samples of 300 mg were extracted with 3 mL of  64  methanol : water : glacial acetic (90:9:1; v/v/v) and addition of the internal standard [50 ng 2,2-d2-jasmonic acid (1) dissolved in 15% acetonitrile in water + 0.1% formic acid] by sonication (5 min) followed and shaking (4 °C, 5 min). Samples were centrifuged to pellet debris. Supernatant was transferred to a clean tube and pellets re-suspended in 2 mL of extraction solution. Extraction was repeated three times and extracts combined. Methanol was then evaporated under a constant nitrogen stream. A solution of 2 mL of 0.1 M NaOH was added to the residual water phase and neutral components were removed by extraction with 3 mL of dichloromethane. The water layer was transferred to a clean tube. The dichloromethane layer was re-extracted with a fresh portion (2 mL) of 0.1 M NaOH. Both aqueous layers were combined and acidified with 5% aq HCl (on ice) followed by the partitioning with 1 mL of ethyl acetate : cyclohexane (1:1, v/v) solvent mixture. The organic phase was collected and the water phase was extracted the second time with 0.5 mL of ethyl acetate : cyclohexane mixture. The organic fractions were pooled and the solvent was evaporated under constant nitrogen stream. The samples were reconstituted in 200 µL of 15% acetonitrile in 0.1% aqueous formic acid. Analysis of JA was carried out by HPLC/ES-MS/MS utilizing an HP1100 series binary solvent pump and autosampler (Hewlett-Packard) coupled to a Quattro LCTM quadrupole tandem mass spectrometer via a Z-sprayTM interface (Micromass, Manchester, UK). A 100 x 2.1 mm C18 ACE® HPLC column (Advanced Chromatography Technologies, Aberdeen, Scotland) was used.  Mobile phase A  comprised 1% formic acid in HPLC-grade water; mobile phase B comprised HPLCgrade acetonitrile. Sample volumes of 5 µL were injected onto the column at a flow rate of 0.2 mL/min under initial conditions of 5%B, which was maintained for 3 minutes, then increased to 50% at 20 minutes. B was again increased to 60% at 30 minutes and to 80% at 35 minutes.  The mobile phase composition was returned to initial 65  conditions by 40 minutes and the column allowed to equilibrate for 20 minutes before the next injection. The analytes were ionized by negative-ion electrospray using the following conditions: capillary potential 2.5kV; cone voltage 30V; desolvation gas flow 505 L/h; source and desolvation gas temperatures, 120 oC and 350 oC, respectively. The MS function employed to quantify the endogenous analyte d0JA and its internal standard d2JA was Multiple Reaction Monitoring (MRM) in which the first quadrupole mass filter was set to the m/z of the deprotonated molecular ion (208.8 and 210.8, respectively) and the second mass filter is set to the m/z of a fragment product (59.3 and 61.3, respectively). Collision energy was 12 eV and collision gas pressure was 2 x 10-3 mBar. Analytical procedures analogous to those reported in Ross et al. were employed to determine the quantities of JA in the plant extracts. The calculated average recovery of JA and 2,2-d2-jasmonic acid during the extraction of plant tissue samples was 78%.  3.3 RESULTS  Monoterpene volatiles induce a heterologous pinII promoter in Arabidopsis. To establish a system that allows for rapid screening of volatiles that can induce a plant response, the Arabidopsis plants transformed with a GUS-reporter gene under the control of the potato pinII promoter (Thornburg et al., 1998) described in chapter 2 were used. This promoter is known to drive wound-, herbivore-, or octadecanoidinduced gene expression in several plant species (Ryan, 1992). In initial tests, I found pinII-dependent GUS expression induced in Arabidopsis in response to mechanical wounding, insect feeding, or exposure to MeJA volatiles (Fig. 3.1). Using an enclosed system, I then assessed several different monoterpene volatiles for induction of pinII66  dependent GUS activity. Potted plants were placed under an upside down 1L-glass beaker containing a cotton ball with 0.4 or 4 µL of the monoterpene compound (0.4 µL myrcene is equivalent to approximately 2 µmoles) (Fig. 3.2). As a negative control, plants were treated in the same fashion without any compounds added to the cotton ball. Plants were exposed to the volatiles for two hours. The monoterpene volatiles tested individually were myrcene, (+)-α-pinene, (–)-α-pinene, (–)-β-pinene, racemic limonene, racemic linalool, and a blend of 70% (E)-$-ocimene, 10% (Z)-$-ocimene and 15% allo-ocimene. Non-flowering Arabidopsis do not produce any significant amount of these compounds (Aharoni et al., 2003, Chen et al., 2002). GUS tissue staining assays of leaves showed that all monoterpenes tested caused the induction of the pinII promoter (results shown for ocimene; Fig. 3.1). A GUS response was detected with as little as 0.4 µL of monoterpene applied to a cotton ball. Using the initial weight of ocimene and the weight of the compound after 2 hours enclosed, it was determined that less than half (approximately 0.15–0.2 µL) was released into the vapor phase after two hours. For comparison, MeJA (containing approximately 10% of the putatively active cis-isomer) evaporating from a volume of 0.4 µL applied to a cotton ball did not result in detectable GUS tissue staining, but an induced response was detectable with 2 µL MeJA (Fig. 3.1). In control experiments without volatiles added, enclosure of Arabidopsis for two hours under a 1L-glass container did not lead to GUS activation (Fig. 3.1A), suggesting that the pinII promoter response observed with monoterpenes or MeJA is triggered by the volatiles present in the gas phase. To test if monoterpenes used for plant treatment were retained by the potted plants, treated plants were moved into a fresh beaker for 2 hours and the headspace surrounding treated plants was sampled by SPME. Although the compounds tested 67  (myrcene and ocimene) were not detected in untreated plants, these compounds were detected in the headspace of treated plants. To eliminate the possibility that the plastic pots or soil were solely responsible for the capture of monoterpenes used for treatment, plants cut above ground were also tested and showed detectable levels of the monoterpenes used for treatment. As Arabidopsis does not emit significant amounts of these compounds from its foliage (Aharoni et al., 2003, Chen et al., 2002), this likely indicates that the compounds are adsorbed and re-released by the plant. Figure 3.1: Monoterpenes, MeJA, wounding or insect feeding induce heterologous pinII-promoter activity in Arabidopsis. Plants transformed with a pinII::GUS construct were either (A) untreated, exposed for 2h to (B) monoterpene (ocimene) volatiles (C) treated by mechanical wounding or (D) insect feeding (E) exposed to MeJA volatiles. Promoter activity was detected by GUS staining assays of rosette leaves.  Figure 3.2: Experimental set up: Plants were exposed to monoterpene volatile in an enclosed environment. Compounds were placed on a cotton ball and left to evaporate resulting in the plant being exposed to the volatiles. 68  Transcriptome response of wild-type Arabidopsis exposed to monoterpenes volatiles. Following the observation that monoterpene volatiles induced heterologous pinII activity, a chemical genomics approach was used to test the effect of monoterpene volatiles on gene expression in wild-type Arabidopsis. Microarray analyses were done on a 70-mer oligonucleotide platform representing 29,110 different transcripts (Ehlting et al., 2005). Plants were exposed for two hours to ocimene or myrcene volatiles released from 4 :l applied to a cotton ball as described above. The ocimene-induced transcriptome response was also measured over a time course with plants exposed to volatiles for 0.5, 2, 6 or 24 hours. Transcriptome profiles of treated plants were compared with those of untreated controls (Fig. 3.3; Fig. 3.4). Microarray analyses were performed with above-ground tissues flash frozen in liquid nitrogen after treatment. Experiments were repeated with at least two and in most cases four independent biological replicates per treatment and timepoint.  Raw data were  deposited in the European Bioinformatics Institute database. Figure 3.3: Experimental design of the transcriptome profiling of Arabidopsis exposed to myrcene or ocimene volatiles. Numbers at arrows indicate the number of replicates. Each experiment was performed with four biological replicates, including two replicate dyeflips. In only one case, ocimene 2h treatment, only two biological replicates were used with an additional two technical replicates. All experiments were started at 12:30 PM and tissues collected after the respective treatment times of 0.5h, 2h, 6h or 24h. Controls were harvested at the same time as the corresponding treated plants to reduce effects from changes of gene expression independent of volatile treatment. For the 0.5h-treatment (*), plants were kept in the non-treated environment for 1.5h prior to volatile exposure for the following 0.5hrs, which permits the use of the same control as for 2h treatments. 69  Figure  3.4: Transcriptome profiling of Arabidopsis exposed to myrcene or ocimene volatiles. Number of different transcripts showing change in transcript abundance of at least 2-fold (p < 0.05). Plants were exposed to myrcene volatiles for 2h (M2h), or to ocimene volatiles for 2h (O2h), for 6h (O6h), or 24h (O24h).  Transcripts corresponding to 6,243 different array elements were reproducibly detected with parametric p values < 0.05 (Student’s t-test). From this set, differentially regulated genes were defined as those with at least two-fold monoterpene-induced increase or decrease in transcript abundance relative to the corresponding non-treated control.  Using these criteria, no statistically significant differences in transcript  abundance were found with plants exposed for 0.5 h to ocimene volatiles. At 2 h of exposure to ocimene, 468 genes showed differences in transcript abundance, of which 398 (85%) were up- and 70 (15%) were down-regulated (Fig. 3.4). The overall response to ocimene was reduced by 6 h and 24 h with 249 and 340 genes, respectively, showing differences in transcript abundance, the majority of which (211 and 308, respectively) were up-regulated. The transcriptome response to ocimene volatiles showed a dynamic temporal pattern with partial overlap of differentially regulated genes for the timepoints tested (Fig. 3.5). Only 35 genes were up-regulated 70  over the entire time course (Table 3.1). Of these common elements, most have been shown  to  be  involved  in  the  response  to  MJ  (http://www.genevestigator.ethz.ch/at/index.php). In addition, 76 genes showed upregulation and four showed down-regulation both at the 2h- and 6h-timepoints. Sixty one genes were commonly up-regulated, and three were commonly down-regulated for the 6h- and 24h-response. Common to the 2h- and 24h-timepoints were 77 genes that were up-regulated and one that was down-regulated. Similar to the response induced with ocimene at 2 h, a 2h-treatment with myrcene volatiles resulted in a significant change of transcript abundance for 986 elements on the array, of which 730 (74%) were up- and 256 (26%) were downregulated (Fig. 3.4). Sixty percent (237) of the genes that were up-regulated by ocimene at 2 h were also up-regulated at the same timepoint by myrcene, and 29% (20) of the genes down-regulated by ocimene were commonly down-regulated by myrcene . Figure 3.5. Overview of the effects of myrcene and ocimene on transcriptome changes in Arabidopsis. Venn diagrams illustrate the number and overlap of genes down- or up-regulated in response to 2h-exposure of plants to myrcene or ocimene; and the number and overlap of genes down- or up-regulated in response to ocimene over a time-course of 2, 6 and 24 h. M2: exposure to myrcene for 2 h; O2, O6 and O24: exposure to ocimene for 2, 6 and 24 h, respectively.  71  Table 3.1: List of transcripts that were up-regulated at all time points (2h, 6h, 24h) of exposure of A. thaliana to ocimene volatiles; FC: Fold Change, P: p value, Q: q value. P and Q values shown as 0.00 are not zero, but rather smaller than 0.004  2h  6h  24 h  Locus  Description  FC  P  Q  FC  P  Q  FC  P  Q  At2g29500 At2g29460 At2g24850 na At1g10585 At1g66690 At1g15520 At2g38240 At1g76680 At4g01870 At1g76690 At5g16990 na At3g11340 At3g45140 At2g34610 At1g43160 At3g14620 At2g02990 na At2g29490 At4g17470 At5g63790 At3g46660 At5g06870 At3g50770 At4g08870 At3g21480 At4g39670 At5g61820 At1g32950 At5g26340 At2g18690 At5g42050 At5g33355  small heat shock protein -related glutathione transferase, putative Aminotransferase, putative BAC T10O24 from Chromosome 1 similar to bHLH transcription factor methyltransferase-related ABC transporter family protein oxidoreductase, 2OG-Fe(II) oxygenase family 12-oxophytodienoate reductase (OPR1) expressed protein 12-oxophytodienoate reductase (OPR2) allyl alcohol dehydrogenase, putative BAC F9L11 genomic sequence glycosyltransferase family lipoxygenase (LOX2) expressed protein AP2 domain transcription factor RAP2.6 Cytochrome P450, putative ribonuclease, RNS1 Chromosome 4, contig fragment No. 46 glutathione transferase, putative palmitoyl protein thioesterase precursor, putative no apical meristem (NAM) protein family glucosyltransferase-related protein polygalacturonase inhibiting protein (PGIP2) calmodulin-related protein, putative arginase-related expressed protein expressed protein expressed protein subtilisin-like serine protease hexose transporter, putative expressed protein expressed protein defensin like protein  13.3 10.1 7.4 6.9 6.3 5.9 5.4 5.3 5.0 4.6 4.4 4.1 3.9 3.8 3.5 3.4 3.2 3.1 3.0 2.9 2.9 2.8 2.8 2.7 2.5 2.5 2.5 2.4 2.4 2.3 2.2 2.2 2.2 2.0 2.0  0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.02 0.03 0.00 0.03 0.00 0.00 0.00 0.01 0.01 0.01 0.03 0.00 0.08 0.00 0.00 0.06 0.02  0.00 0.00 0.00 0.04 0.05 0.02 0.02 0.03 0.00 0.02 0.00 0.00 0.06 0.00 0.29 0.08 0.15 0.01 0.28 0.38 0.05 0.36 0.05 0.07 0.14 0.25 0.25 0.20 0.35 0.00 0.55 0.11 0.13 0.47 0.32  3.7 5.7 3.7 2.2 4.0 2.0 2.1 5.4 5.6 2.4 4.3 2.1 2.2 2.5 5.0 5.6 2.1 2.0 5.6 5.8 4.6 4.7 3.2 2.4 2.0 2.2 2.4 2.4 2.8 4.3 2.5 2.3 2.3 2.3 5.1  0.38 0.50 0.00 0.61 1.00 0.92 0.72 0.28 0.09 0.29 0.01 0.62 0.06 0.01 0.59 0.13 0.90 0.09 0.18 0.65 0.50 0.14 0.88 0.71 0.01 0.96 0.00 0.28 0.57 0.75 0.88 0.48 0.95 0.08 0.02  0.74 0.78 0.14 0.81 0.87 0.87 0.83 0.69 0.51 0.69 0.27 0.81 0.45 0.22 0.80 0.56 0.86 0.50 0.61 0.81 0.78 0.56 0.86 0.83 0.22 0.87 0.11 0.68 0.80 0.84 0.86 0.77 0.87 0.48 0.33  2.1 3.4 4.4 4.8 9.4 2.6 3.8 2.6 2.0 2.3 2.4 2.1 3.2 2.7 4.8 3.1 3.1 3.3 4.0 3.9 2.7 4.0 2.1 2.5 2.8 2.3 2.0 2.5 2.2 2.1 3.0 2.3 2.2 3.8 2.7  0.09 0.00 0.00 0.00 0.00 0.02 0.00 0.02 0.00 0.02 0.00 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.01 0.00 0.01 0.01 0.00 0.00 0.02 0.05 0.01 0.04 0.00 0.02 0.00 0.00 0.00 0.00  0.36 0.15 0.09 0.15 0.07 0.23 0.14 0.22 0.09 0.21 0.06 0.10 0.15 0.09 0.15 0.15 0.16 0.06 0.15 0.18 0.14 0.16 0.19 0.15 0.14 0.21 0.28 0.17 0.27 0.06 0.23 0.14 0.15 0.12 0.14  72  Stress-related genes, membrane proteins, and transcription factors are overrepresented in the monoterpene-induced transcriptome. To gain further insight into the qualitative changes of the transcriptome affected by myrcene or ocimene, associations of differentially regulated genes (detected upon ocimene or myrcene exposure at the 2h-timepoint) with functional categories were identified using the TAIR gene ontology (GO) system (www.arabidopsis.org). Differentially regulated genes of known or putative functions were sorted by GO categories for biological processes, cellular components, or molecular functions (Fig. 3.6). The relative abundance of monoterpene-regulated transcripts for a particular GO category was compared to the relative abundance of that GO category within the Arabidopsis genome using a test for quality of proportion with a threshold p value of 0.001. Several gene categories were identified as over- or under-represented in the transcriptome of plants exposed to monoterpene volatiles relative to their genome abundance (Fig. 3.6). In the biological processes categories, transcripts associated with abiotic and biotic stress and transcripts associated with general stress were significantly overrepresented in the transcriptome affected by myrcene or ocimene relative to the account of these categories in the Arabidopsis genome (Fig. 3.6). This finding is further supported by data showing that 25% of genes identified as up-regulated by ocimene at more than one time point were annotated as stress-related. In contrast, transcripts associated with protein metabolism, developmental processes, cell organization, and DNA/RNA metabolism were significantly under-represented in the transcriptomes of ocimene- or myrcene-treated plants. In the cellular components categories, only transcripts associated with membranes were significantly over-represented in myrcene treated plants. 73  Figure 3.6: Relative abundance of genes organized by GO categories in the Arabidopsis genome and in the transcriptome of plants treated for 2h with ocimene or myrcene volatiles. Distribution of differentially regulated transcripts (> 2fold change abundance; p < 0.05) across GO categories for biological processes, cellular components and molecular functions. Black bars represent the differentially regulated transcriptome in myrcene-treated plants. Open bars represent the differentially regulated transcriptome in ocimene-treated plants. Grey bars represent genome abundance. Only genes with known or putative functions are represented. A test for quality of proportions (p < 0.001) was used to assess differential representation between transcriptome and genome abundance. Asterisks indicate categories significantly over-represented in the transcriptome; squiggles indicate categories significantly under-represented in the transcriptome. 74  In the category “molecular functions”, abundance of transcription factors was significantly higher in monoterpene-induced transcriptomes relative to their genomic abundance. At 2 h of plant exposure to volatiles, transcription factors accounted for 7.3% and 6.3% of the differentially regulated transcriptome in plants treated with ocimene or myrcene, respectively. This induced over-representation of transcription factors was an early and transient response to the treatment with volatiles. At 24 h, only 4.4% of the transcriptome corresponded to transcription factors, without being significantly different from the 4.2% representation of transcription factors in the Arabidopsis genome. At 2 h of treatment with myrcene or ocimene, 83 different transcription factors were shown to be differentially expressed in at least one treatment (Fig. 3.7). Most prominent among the differentially expressed transcription factors were members of the AP2/ERF family with 19% of the transcription factors in the monoterpene-induced transcriptome, followed by bHLH elements (17%), and WRKY and NAM factors (13%). Other volatile-induced transcription factors included MYB and bZIP factors, as well as transcription factors containing zinc finger elements. Most of the differentially expressed transcription factors were up-regulated and only about 25% showed downregulation.  Monoterpene volatiles induce octadecanoid responses at the levels of gene expression and metabolite accumulation. Given the prominence of stress-related transcripts in the response of Arabidopsis to myrcene or ocimene volatiles, this group of monoterpene-induced transcripts was further dissected (Fig. 3.8). Genes of the octadecanoid pathway and genes known to respond to octadecanoids (biosynthesis or response to JA) were the 75  Figure 3.7. Transcription factor expression profile of Arabidopsis exposed for 2h to myrcene or ocimene volatiles. (A) Fold up- (positive scale) or fold down-regulation (negative scale) of transcripts encoding transcription factor. Transcripts with > 2-fold change of abundance (p < 0.05) are shown outside of the grey shaded zone. (B) Categories and distribution of monoterpene-regulated transcription factors. Standard acronyms are used. HS, heat shock transcription factors; NAM, no apical meristem transcription factors.  most prevalent within the stress-gene category up-regulated both by ocimene or myrcene (Fig. 3.8). In the 2h-exposure experiments, octadecanoid pathway and response genes represented 21% and 12% of regulated stress genes in the ocimeneand myrcene-treated plants, respectively (Fig. 3.8). At this timepoint, several known steps in the biosynthesis of JA and MeJA were detected by microarray analysis as upregulated by ocimene (> 2-fold increase; p < 0.05) (Table 3.2). Although the jasmonic 76  acid methyl-transferase (JMT) enzyme is not highly upregulated, five putative methyl transferases are highly upregulated at the two-hour timepoint. In fact, four of these methyl transferases are within the top six upregulated elements showing between 17and 23-fold difference to control (Table 3.3). The octadecanoid pathway genes LOX2 (lipoxygenase; At3g45140), AOS (allene oxide synthase; At5g42560), and OPR3 (oxophytodienoate reductase, At2g06050) were included in RT-PCR transcript analysis (Fig. 3.9). Genes with known association to plant defense, and with a variation in microarray differential regulation were assessed by RT-PCR to confirm microarray results. Fifteen of the sixteen genes tested confirmed the microarray results (Table 3.4). Over the 2 to 24 h time course, LOX2 responded with 2.2 to 12.2 fold induction, AOS with 3.2 to 12.4 fold induction, OPR3 with a 1.5 to 5.1 fold induction as detected by RT-PCR (Fig.3.9).  Other highly abundant genes in the myrcene-affected  transcriptome were genes associated with responses to biotic stress and known defence genes (Fig. 3.8). To test if monoterpene-induced increase in transcript abundance for octadecanoid biosynthesis was translated into metabolic changes I measured levels of JA and MeJA in plant tissues exposed to ocimene volatiles (Fig. 3.10). As a control, levels of MeJA and JA were also measured in wounded plants. To assess the efficiency of the extraction protocol and of deuterated MeJA (dMeJA) and cis-jasmone as internal standards, extraction with known amounts of metabolite were done and measured. The protocol used consistently recovered approximately 60% of the MeJA and approximately 50% of the dMeJA. Although 35% of cis-jasmone could reliably be recovered, it was not comparable to the JA metabolite as JA could not be consistently extracted. Therefore the JA analysis was contracted to an outside laboratory specializing in JA measurement (Sue Abrams, Saskatoon, Canada) 77  Figure 3.8 Abundance of monoterpene induced stress-related transcript species. Categories of stress-related genes are based on the GO from the TAIR database. Table 3.2 Monoterpene-induced change of transcript abundance for the octadecanoid pathway detected by microarray analysis (O2: exposure to ocimene volatiles for 2h; M2: exposure to myrcene volatiles for 2h; FC: fold change). P values shown as 0.00 are not zero, but rather smaller than 0.004 O2  M2  Gene Function  Locus  FC  p  FC  p  lipoxygenase (LOX2)  At3g45140  3.5  0.06  2.6  0.02  allene oxide synthase (AOS)  At5g42650  3.4  0.10  1.6  0.00  allene oxide cyclase (AOC)  At3g25780  3.0  0.00  2.2  0.00  12-oxophytodienoate reductase (OPR3)  At2g06050  5.0  0.00  2.5  0.00  OPC-8:0 CoA Ligase1 (OPCL1)  At1g20510  3.1  0.00  4.7  0.00  JA carboxyl methyltransferase (JMT)  At1g19640  2.2  0.00  2.4  0.00  78  Table 3.3: Putative jasmonic acid methyl transferase. Shown are fold change values of monoterpene induced methyl-transferases-related transcripts in A. thaliana. P values and q values shown as 0.00 are not zero, but rather smaller than 0.004.  locus description At1g66700 methyltransferase-related At5g38100 methyltransferase-related At1g66690 methyltransferase-related At3g44870 methyltransferase-related At5g38780 methyltransferase-related  FC 22.57 21.00 18.23 16.78 2.91  p val 0.00 0.00 0.00 0.00 0.00  q val 0.00 0.00 0.00 0.00 0.01  Figure 3.9: Ocimene-induced transcript levels for selected steps of the octadecanoid pathway measured by RT-PCR. Exposure to ocimene volatiles for 2, 6 or 24 h. Mean with standard error (n=3 biological replicates each with two-fold technical replication). LOX2: lipoxygenase2, AOS: allene oxide synthase, OPR3: 12oxophytodienoate reductase. 79  Table 3.4: RT-PCR transcript profiling of select genes used for validation of microarray analysis at the 2 hour time point; mean fold change (FC) of treatment over control, SE (n=3) standard error. Gene  Locus  FC  SE  RAP2.6  At4g77410  15.1  3.5  TPS04  At1g61120  13.2  6.3  WRKY40  At1g80840  12.7  5.9  ERF1  At3g23240  12.5  0.5  DR  At2g34930  8.8  3.1  VSP1  At5g24780  5.0  0.9  HS  At2g29500  4.8  2.3  COR1  At1g19670  4.6  2.1  IAR3  At1g51760  4.0  0.9  ERF11  At1g28370  3.9  1.4  OPR1  At1g76680  3.6  0.5  RD26  At4g77410  3.1  0.4  STI  At1g62740  2.6  1.0  LOX2  At3g45140  2.2  0.4  AOS  At5g42650  3.1  0.9  OPR3  At2g06050  1.5  0.6  Tissue levels of MeJA were below our detection limits in the untreated control plants. However, MeJA levels increased to approximately 0.4 ng/g fresh weight at 2 h or 6 h of treatment, and 0.2 ng/g at 24 h of treatment. The induced levels of MeJA were similar to those found with wound-treated plants. While changes in JA levels were not detected in any consistent fashion in ocimene-treated plants, JA was increased in wounded plants.  80  JA  Figure 3.10: Levels of MeJA (upper panel) and JA (lower panel) in wounded and ocimene-exposed plants. Each bar represents the mean of three or four biological replicates with standard error. When no error bars are shown, metabolite levels were below detection limit in all but one replicate.  Octadecanoid mutants coi1 and aoc have a diminished response to ocimene volatiles. Since gene expression profiling and metabolite analysis suggest a role for octadecanoids in the response to monoterpene volatiles, the effect of ocimene with mutants in octadecanoid biosynthesis (aoc, allene oxide cyclase mutant) and octadecanoid signalling (coi1, coronatine insensitive) was tested. Using a set of 13 genes induced by ocimene in wild-type (wt) plants, changes of transcript abundance in treated (2 h ocimene) relative to untreated plants in wt, coi1 and aoc plants were measured. For comparison this was also done for the ethylene response (etr2) mutant (Fig. 3.11). The aoc plants showed significantly (90% confidence interval) reduced 81  ocimene-induction for two ethylene response factors (RAP2.6, ERF1), RD26 transcription factor, octadecanoid response elements COR1, IAR3 and OPR1, and for two stress-induced proteins (TPS, DR). In addition, other genes (ERF11, WRKY40,  Figure 3.11: Change of transcript abundance in wt, etr2, aoc, or coi1 ocimene treated plants. Mean fold-change of transcript-abundance in treated plants over nontreated plants with standard error (n=3) detected by RT-PCR. Symbols (*,^) indicate change of transcript levels in mutants as significantly different from wt plants at 90% (*) or 95% (^) confidence intervals. RAP2.6:At1g43160; TPS:At1g61120; WRKY40:At1g80840; ERF1:At3g23240; DR:At2g34930; VSP1:At5g24780; HS:At2g29500; COR1:At1g19670; IAR3:At1g51760; ERF11:At1g28370; OPR1;At1g76680; RD26:At4g27410; STI:At1g62740. STI) also appeared to have reduced ocimene-induction in the aoc plants, but the effect was not statistically significant within a 90% confidence interval. Only two ocimeneinducible genes tested, VSP1 and HS, were not affected by the aoc mutant. The octadecanoid signalling mutant coi1 showed a very similar effect of reduced ocimeneinduced gene expression with an additional reduced repression of VSP1, but a lack of effect on RD26 and OPR1. Several ocimene-induced genes (RAP2.6, ERF1, ERF11, COR1, IAR3) also showed a reduced response in the etr2 mutant. 82  Ocimene pretreatment did not affect wound- or insect-induced gene expression. The microarray analysis demonstrated that of the set of genes with differential expression at two hours after treatment with ocimene and myrcene, the majority (90% and 94%, respectively) show a relatively modest level of two- to five-fold change of transcript abundance. The highest level of change detected was 24-fold. This level of response was lower than what is typically seen in microarray analysis after wounding or insect feeding in Arabidopsis (Cheong et al., 2002). It is therefore possible that the monoterpene may not induce a full response of gene expression but instead only causes a priming effect. Priming of defence responses as the result of plants detecting volatiles has previously been documented (Dicke and Bruin, 2001; Engelberth et al., 2004; Paschold et al., 2006). To test the concept of priming at the transcriptome level, microarray gene expression profiling was used to test if prior treatment of Arabidopsis with ocimene volatiles affected the response to mechanical wounding or feeding by cabbage looper (CL, Trichoplusia ni) larvae (Fig. 3.12A). The transcriptomes of previously untreated plants at 2 h after mechanical wounding were compared with the transcriptomes of plants that were first exposed for 2 h to ocimene, followed by mechanical wounding and then harvested at 2 h after wounding (experiment a). This experiment was performed with four biological replicates, including dye-flips. In a second experiment (b), individual plants were exposed for 2 h to feeding by two CL larvae instead of mechanical wounding. In a third experiment (c) consisting of 2 biological replicates, I compared the transcriptome of plants pretreated with ocimene for 2 h and subsequently woundtreated with the transcriptome of plants that were pretreated with ocimene for 2 h and  83  Figure 3.12. Effect of ocimene exposure on gene expression induced by mechanical wounding or insect feeding. (A) Experimental design for comparison of plant responses at 2h after wounding (wounding 2h) or cabbage looper feeding (insect feeding 2h), in which plants were either previously exposed for 2h to ocimene volatiles (ocimene 2h) or not pretreated (control). Numbers at arrows represent biological replicates. Letters correspond to the data set shown in part B. (B) Histogram of parametric p values comparing the differential expression between treatments. Bars represent the parametric p value distribution. A horizontal line shows the estimated cut-off of genes differentially regulated at least 2-fold. T1-C1: comparison between [plants wounded for 2 h] and [plants wounded for 2 h subsequent to 2 h ocimene treatment]; T2-C2: comparison between [plants treated by insect feeding for 2 h] and [plants treated by insect feeding subsequent to 2 h ocimene treatment]; T2-T1: comparison between [plants wounded for 2 h subsequent to 2 h ocimene treatment] and [plants treated by insect feeding subsequent to 2 h ocimene treatment]. subsequently exposed to feeding CL larvae. The results of experiments (a) and (b) did not reveal an effect of ocimene pretreatment in the response to subsequent mechanical wounding or insect feeding at the time points chosen. Only 2.1% of all transcripts detected showed differences in abundance in the comparison of experiment (a); no 84  genes were identified as differentially expressed in the comparison of experiment (b) (Fig. 3.12B).  For comparison, experiment (c) showed almost 30% of all genes  represented on the array as differentially expressed between insect treatment and mechanical wounding in ocimene-pretreated plants.  3.4 DISCUSSION:  Research described in this chapter was based on the results of Chapter 2, specifically the observation of a high level of sensitivity of the pinII-promoter in response to low impact stress observed in transgenic Arabidopsis plants. This result prompted me to explore Arabidopsis plants transformed with pinII::GUS as a reporter system to screen for the effect of airborne monoterpene volatiles in Arabidopsis. Following the discovery of monoterpene-induced activation of the pinII-promoter in Arabidopsis, I assessed the response to monoterpenes in wild-type and mutant Arabidopsis plants at the transcriptome and metabolite level. The discovery of a large-scale molecular response of Arabidopsis to monoterpene volatiles and the finding that octadecanoid formation and signaling are involved in this response, is supported by results from several different experiments showing (a) monoterpene-induced activation of a heterologous pinII-promoter, (b) change of transcriptome as assessed by genome-wide microarray profiling and RTPCR, (c) increased MeJA tissue levels, and (d) reduced volatile-induced response in the aoc and coi1 mutants. To the best of my knowledge, the monoterpene-inducible pinII-promoter (Thornburg et al., 1987) has not previously been tested as a reporter system in Arabidopsis, where it provides a useful tool to assess plant responses to the environment and where it can be applied in large-scale screenings. 85  Since several structurally different cyclic and acyclic monoterpenes induced pinII activity, it is not likely that the response to monoterpenes is mediated by a specific receptor. Rather the response could be the effect of lipophilic monoterpenes disturbing cell membranes and thereby activating signaling events such as octadecanoid signals. It is possible that the response induced by monoterpene volatiles may be similar to responses induced by other lipophilic volatiles such as C6-aldehydes. Although another group has shown that the monoterpene allo-ocimene and C6-volatiles induce similar resistance in Arabidopsis to Botrytis cinerea (Kishimoto et al., 2005; 2006a; 2006b; Shiojiri et al., 2005), plant response to monoterpene volatiles has not yet been tested at the transcriptome level. Genes associated with response to biotic or abiotic stress, defence, and transcription factor activation dominate the transcriptome response of Arabidopsis to monoterpene volatiles. A shift of resource allocation from primary metabolism to secondary defence pathways is also indicated by the under-representation of ribosome, protein metabolism, developmental processes, cell organization and DNA/RNA metabolism related transcripts. This response is very similar in transcripts to the response observed in Arabidopsis plants exposed to diamond-back moth feeding analyzed using the same oligonucleotide array platform (preliminary observations communicated by J. Bohlmann and J. Ehlting). Since monoterpene volatiles are often produced in response to wounding or insect feeding (Dudareva et al., 2006; Pichersky et al., 2006; Paré and Tumlinson, 1999), these compounds are suitable for plant-toplant signaling as part of complex plant stress responses. Similarly, monoterpenes could also function as signals between distant parts of the same plant (Heil and Bueno, 2007). The involvement of octadecanoids in the response of Arabidopsis to monoterpenes suggests that the effect of monoterpenes is mediated at least in part 86  through signaling processes that also function in wound- or insect induced plant stress responses. Although I did not observe a priming effect of volatile exposure in subsequent wound- or insect-induced transcriptome changes, a further analysis of priming effects is warranted with more extensive time-course analyses and additional biological tests inclusive of pathogens (Engelberth et al., 2004, Kishimoto et al., 2006b) In conclusion, my results from a series of carefully replicated experiments with intact plants provide new and fundamental information about the large-scale response of Arabidopsis to monoterpenes and clearly establish a role for octadecanoids in the plant response to these volatiles.  The results described here will guide future  experiments to test mechanisms of monoterpene-induced plant responses with the inclusion of the available genetic and genomic tools for the Arabidopsis model system. In previous work it has already been shown that treatment of Arabidopsis with alloocimene or C6-volatiles can enhance resistance against Botrytis cinerea (Kishimoto et al., 2005; 2006a; 2006b; Shiojiri et al., 2005). Also, a recent, very elegant study, using a non-molecular approach, clearly demonstrated biological relevance of monoterpene volatile signaling in a plant-to-plant interaction (Runyon et al., 2006). The present study provides an unprecedented plethora of new molecular targets, in particular in the arena of transcription factors and octadecanoid signaling, for functional dissection of plant-toplant or within-plant volatile signaling in nature. 3.5 ACKNOWLEDGMENTS  For the work in this specific chapter, I would like to thank Lina Madilao for technical assistance with LC analysis; Sunita Chowrira, Jürgen Ehlting, Natalie Mattheus for technical advice on microarray analysis, Jürgen Ehlting for providing the R script template, and Natalia Kolosova  87  for assistance with phenol based RNA extraction while I was pregnant. I would also like to acknowledge Patrycia Galka, Richard Hughes, Irina Zaharia and Sue Abrams for help in JA analysis  .  3.6 LITERATURE CITED: Alméras E; Stolz S; Vollenweider S; Reymond P; Mène-Saffrané L; Farmer EE (2003) Reactive electrophile species activate defense gene expression in Arabidopsis. Plant J 34: 205-216 Arimura GI, Ozawa R, Horiuchi JL, Nishioka T, Takabayashi J (2001) Plant-plant interactions mediated by volatiles emitted from plants infested by spider mites. Bioch Syst Ecol 29: 1049-1061 Arimura G, Ozawa R, Kugimiya S, Takabayashi J, Bohlmann J (2004) Herbivore-induced defense response in a model legume. Two-spotted spider mites induce emission of (E)-betaocimene and transcript accumulation of (E)-beta-ocimene synthase in Lotus japonicus. Plant Physiol 135:1976-83 Arimura GI, Ozawa R, Shimoda T, Nishioka T, Boland W, Takabayashi J (2000) Herbivoryinduced volatiles elicit defense genes in lima bean leaves. Nature 406: 512-515 Aubourg S, Lecharny A, Bohlmann J (2002) Genomic analysis of the terpenoid synthase (AtTPS) gene family of Arabidopsis thaliana. Mol Genet Genomics 267: 730-745 Ausubel FM, Brent R, Kingston RE, Moore DM, Seidman JG, Smith JA, Struhl K, Chanda VB (2000) Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., Brooklyn, New York, 3.5.3-3.5.6 Baldwin IT (1998) Jasmonate-induced responses are costly but benefit plants under attack in native populations. Proc Natl Acad Sci USA 95: 8113-8 Baldwin IT, Halitschke R, Paschold A, von Dahl CC, Preston CA (2006) Volatile Signaling in Plant-Plant Interactions: "Talking Trees" in the Genomics Era. Science 311: 812 815 Baldwin IT, Schultz JC (1983) Rapid changes in tree leaf chemistry induced by damage: evidence for communication between plants. Science 221: 277–279 Birkett MA, Campbell CAM, Chamberlain K, Guerrieri E, Hick A, Martin JL, Matthes M, Napier JA, Pettersson J, Pickett JA, Poppy GM, Pow EM, Pye BJ, Smart LE, Wadhams GH, Wadhams LJ and CM Woodcock (2000) New roles for cis-jasmone as an insect semiochemical and in plant defense. Proc Natl Acad Sci USA 97: 9329–9334 Bohlmann J, Martin D, Oldham N, Gershenzon J (2000) Terpenoid secondary metabolism in Arabidopsis thaliana: cDNA cloning, characterization and functional expression of a myrcene / (E)-β-ocimene synthase. Arch Biochem Biophys 375: 261-269  88  Bruin J, Dicke M (2001) Chemical information transfer between wounded and unwounded plants: backing up the future. Bioch Syst Ecol 29: 1103-1113 Bruin J, Dicke M, Sabelis MW (1992) Plants are better protected against spider mites after exposure to volatiles from infested conspecifics. Experientia 48: 525-529 Chen F, Tholl D, D'Auria JC, Farooq A, Pichersky E, Gershenzon J (2003) Biosynthesis and Emission of Terpenoid Volatiles from Arabidopsis Flowers. Plant Cell 15:1-14 Cheong YH, Chang HS, Gupta R, Wang X, Zhu T, Luan S (2002) Transcriptional Profiling Reveals Novel Interactions between Wounding, Pathogen, Abiotic Stress, and Hormonal Responses in Arabidopsis. Plant Physiol 129: 661-677 Clough S, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 De Moraes CM, Lewis WJ, Paré PW, Alborn HT, Tumlinson JT (1998) Herbivore-infested plants selectively attract parasitoids. Nature 393: 570-573 De Moraes CM, Mescher MC, Tumlinson JH (2001) Caterpillar-induced nocturnal plant volatiles repel conspecific females. Nature 410: 577-579 Dicke M, Agrawal AA, Bruin J (2003) Plants talk, but are they deaf? Trends in Plant Science 8: 403-405 Dicke M, Bruin J (2001) Chemical information transfer between plants: back to the future. Bioch Syst Ecol 29: 981-994 Dicke M, Gols R, Ludeking D, Posthumus MA (1999) Jasmonic acid and herbivory differentially induce carnivore-attracting plant volatiles in lima bean plants. J Chem Ecol 25:1907-1922 Dicke M, Van Beek TA, Posthumus MA, Ben Dom N, Van Bokhoven H, De Groot AE (1990) Isolation and identification of volatile kairomone that affects acarine predatorprey interactions Involvement of host plant in its production. J Chem Ecol 16: 381-396 Dicke M, Van Loon JJA (2000) Multitrophic effects of herbivore-induced plant volatiles in an evolutionary context. Entomol Exp Appl 97: 237-249 Dolch R, Tscharntke T (2000) Defoliation of alder (Alnus glutinosa) affects herbivory by leaf beetles on undamaged neighbours. Oecologia 125: 504-511 Ehlting J, Mattheus N, Aeschliman DS, Li E, Hamberger B, Cullis IF, Zhuang J, Kaneda M, Mansfield SD, Samuels AL, Ritland K, Ellis BE, Bohlmann J, Douglas CJ (2005) Global transcript profiling of primary stems from Arabidopsis thaliana identifies candidate genes for missing links in lignin biosynthesis and transcriptional regulators of fiber differentiation. Plant Journal 42: 618 - 640 Engelberth J, Alborn HT, Schmelz EA, Tumlinson JH (2004) Airborne signals prime plants against insect herbivore attack. Proc Natl Acad Sci USA 101: 1781-1785 Euglem T (2005) Regulation of the Arabidopsis defense transcriptome. TIPS 10: 71-78  89  Fäldt J, Arimra GI, Gershenzon J, Takabayashi J, Bohlmann J (2003) Functional identification of AtTPS03 as (E)-β-myrcene synthase: a new monoterpene synthase catalyzing jasmonate- and wound-induced volatile formation in Arabidopsis thaliana. Planta 216: 745-751 Farmer E (2001) Surface-to-air signals. Nature 411:854-856 Farmer E, Ryan C (1990) Interplant Communication: Airborne Methyl Jasmonate Induces Synthesis of Proteinase Inhibitors in Plant Leaves. Proc Natl Acad Sci USA 87: 7713-7716 Galka PW, Ambrose SJ, Ross ARS, Abrams SR (2005) Syntheses of deuterated jasmonates for mass spectrometry and metabolism studies. J Label Comp Radiopharm 48: 797-809 Gang D (2005) Evolution of flavors and scents. Ann Rev Plant Biol 56: 301–325 Gershenzon J (2007) Plant volatiles carry both public and private messages. Proc Natl Acad Sci USA 104: 5257-5258 Godard KA, Byun-McKay A, Levaseur C, Plant A, Séguin A, Bohlmann J (2007) Testing of a heterologous, wound- and insect- inducible promoter for functional genomics studies in conifer defense. Plant Cell Rep. on line Haggman HM, Aronen TS, Nikkanen TO (1997) Gene transfer by particle bombardment to Norway spruce and Scots pine pollen. Can J For Res 27: 928-935 Heil M, Bueno JCS (2007) Within-plant signaling by volatiles leads to induction and priming of an indirect plant defense in nature. Proc Natl Acad Sci USA 104: 5467-5472 Heil M; Kost C (2006): Priming of indirect defences. Ecol Let 9: 813-817 Jefferson RA (1987) Assaying chimeric genes in plants: The GUS gene fusion system. Plant Mol Biol Rep 5: 387-405 Kappers IF, Aharoni A, van Herpen TWJM, Lückerhoff LLP, Dicke M, Bouwmeester HJ (2005) Genetic engineering of terpenoid metabolism attracts bodyguards to Arabidopsis. Science 309: 2070-2072 Karban R (2001) Communication between sagebrush and wild tobacco in the field. Bioch System and Ecol 29: 995-1005 Karban R, Baldwin IT, Baxter KJ, Laue G, Felton GW (2000) Communication between plants: Induced resistance in wild tobacco plants following clipping of neighbouring sagebrush. Oecologia 125: 66-71 Karban R, Maron J, Felton GW, Ervin G, Eichenseer H (2003) Herbivore damage to sagebrush induces resistance in wild tobacco: evidence for eavesdropping between plants. Oikos 100: 325-332 Karban R, Shiojiri K, Huntzinger M, McCall AC (2006) Damage-induced resistance in sagebrush. Volatiles are key to intra and interplant communication. Ecology 87: 922-930 Kessler A, Baldwin IT (2001) Defensive function of herbivore-induced plant volatile emissions in nature. Science 291: 2141-2144  90  Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2006a) Analysis of defense responses activated by volatile allo-ocimene treatment in Arabidopsis thaliana. Phytochem 67: 1520-1529 Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2006b) Components of C6-aldehydeinduced resistance in Arabidopsis thaliana against a necrotrophic fungal pathogen, Botrytis cinerea. Plant Science 170: 715-723 Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2005) Volatile C6-aldehydes and Alloocimene Activate Defense Genes and Induce Resistance against Botrytis cinerea in Arabidopsis thaliana. Plant and Cell Phys 46:1093-1102 Kost C, Heil M (2006) Herbivore-induced plant volatiles induce an indirect defence in neighbouring plants. J Ecol 94: 619-628 Meyers R, Rautenbach GF, Dubery IA (2003) Identification and quantification of methyl jasmonate in leaf volatiles of Arabidopsis thaliana using solid-phase microextraction in combination with gas chromatography and mass spectrometry. Phytochem Anal 14: 155-159 Paré PW, Tumlinson JH (1999) Plant volatiles as a defense against insect herbivores. Plant Physiol 121: 325-331 Paschold A, Halitschke R, Baldwin IT (2006) Using ‘mute’ plants to translate volatile signals. Plant Journal 45: 275-291 Rai VK, Gupta SC, Singh B (2003) Volatile monoterpenes from Prinsepia utilis L. leaves inhibit stomatal opening in Vicia faba L. Biologia Plantarum 46:121-124 Rhoades DF (1983) Responses of alder and willow to attack by tent caterpillars and webworms - evidence for pheromonal sensitivity of willows. ACS Symposium Series 208: 55– 68 Ross ARS, Ambrose SJ, Cutler AJ, Feurtado JA, Kermode AR, Nelson KM, Zhou R, Abrams, SR (2004) Determination of Endogenous and Supplied Deuterated Abscisic Acid in Plant Tissues by High Performance Liquid Chromatography-Electrospray Ionization Tandem Mass Spectrometry with Multiple Reaction Monitoring. Anal Biochem 329: 324-333 Runyon JB, Mescher MC, De Moraes CM (2006) Volatile chemical cues guide host location and host selection by parasitic plants. Science 313: 1964-1967 Seo S, Seto H, Koshino H, Yoshida S, Ohashi Y. (2003) A Diterpene as an Endogenous Signal for the Activation of Defense Responses to Infection with Tobacco mosaic virus and Wounding in Tobacco. Plant Cell 15: 863 - 873 Shiojiri K, Kishimoto K, Ozawa R, Kugimiya S, Urashimo S, Arimura G, Horiuchi J, Nishioka T, Matsui K, Takabayashi J (2006) Changing green leaf volatile biosynthesis in plants: An approach for improving plant resistance against both herbivores and pathogens. Proc Natl Acad Sci USA 103: 16672-16676 van Poecke RMP, Posthumus MA, Dicke M (2001) Herbivore-Induced Volatile Production By Arabidopsis thaliana Leads To Attraction Of The Parasitoid Cotesia rubecula: Chemical, Behavioral, And Gene-Expression Analysis. J Chem Ecol 27: 1911-1928 Zeng, G (1998) Sticky-end PCR: New method for subcloning. Biotech 25: 206–208  91  CHAPTER 4: GENERAL DISCUSSION  Terpenoid metabolites are well known plant defence chemicals with functions in both direct and indirect defences (Harborne 2001, Cheng et al., 2007). Recently, several studies have been published showing that these metabolites may also have signaling roles in the communication of plants with other organisms beyond the known signaling in plant-insect tritrophic defences. Terpenoids with obvious signaling functions include sesquiterpenes acting as a branching factor in mycorrhizal association in Lotus roots (Akiyama et al., 2005), diterpenes functioning as endogenous signals for the activation of viral responses in tobacco (Seo et al., 2003), and monoterpenes as biologically active plant-to-plant signals for successful host targeting in the parasitic dodder plant (Runyon et al., 2006). A substantial number of papers have also suggested that volatile compounds emitted from herbivore-attacked plants not only participate in tritrophic interactions with insects and other arthropods, but may also be perceived as stress signals by neighbouring plants (e. g. Birkett et al., 2000; Karban et al., 2000; 2001, 2003; Shualev et al., 1997, Engelberth et al., 2004; Kost and Heil 2006; Paschold et al., 2006, Arimura et al., 2000; Kishimoto et al., 2005, 2006; Rai et al., 2003, Rhoades 1983, Baldwin and Schultz 1983) or by distant parts of the same plant (Heil and Bueno 2007; Karban et al., 2006). Most of these studies examine the effect of the total volatile bouquet and a few show the induction of a response to specific volatile terpenes, namely the monoterpenes (E)-β-ocimene and allo-ocimene (Arimura et al., 2000; Kishimoto et al., 2005, 2006a, 2006b), the homoterpenes (E)-4,8-dimethyl1,3,7-nonatriene (DMNT) and (E,E)-4,8,12-trimethyl-1,3,7,11-tridecatetraene (TMTT) (Arimura et al., 2000). At the time when I started the work presented in this thesis, and  92  to some extent still today, the concept of plant-plant signalling with volatiles has been met with scepticism and there existed very limited information on the molecular reactions induced in response to terpenes. The goal of this research was to increase knowledge on the effects of volatile terpenoids on plants at the molecular level. Using transgenic Arabidopsis plants described in chapter 2 as a screening system, an assessment of responses induced with monoterpene volatiles led the way to the analysis of the monoterpene-induced transcriptome in chapter 3. Further research showed the octadecanoid pathway, both at the transcript and metabolite level, to be involved in the ocimene- or myrceneinduced response in Arabidopsis (chapter 3).  4.1 PinII::GUS-engineered Arabidopsis as a screening system  The pinII::GUS-engineered Arabidopsis plants described in chapter 2 and 3 provided a good tool for the screening of monoterpene volatiles as airborne elicitors. The fact that the pinII-promoter showed a strong response to monoterpenes may be due to the effect of monoterpenes on octadecanoid signaling demonstrated in chapter 3. The pinII-promoter has previously been shown to be induced by octadecanoids (Thornburg et al., 1987). The same pinII::GUS-engineered Arabidopsis plants can now be used as a versatile tool in the screening of other low impact environmental stresses or for extended chemical screenings of compound libraries. As described in chapter 1.2 the utilization of pinII::GUS-engineered Arabidopsis plants for screening of the effect of low impact stress was an unexpected discovery of a project that was initially targeted at the metabolic engineering of terpenoid emissions in plants.  93  4.2 Monoterpene-induced responses in Arabidopsis  4.2.1 The octadecanoid pathway is involved in the response of Arabidopsis to monoterpene volatiles Following the observation that monoterpene vapor induced the heterologous pinII-promoter in Arabidopsis, the monoterpene-induced response was analyzed across the transcriptome using microarray analysis. The analysis of wild-type and mutant plants showed an involvement of the octadecanoid pathway in the monoterpeneinduced response as demonstrated by changes of transcript accumulation of the octadecanoid pathway, an increase of MeJA (but not JA), and altered responses in octadecanoid mutants. Other studies have also shown the importance of the octadecanoid pathway in VOC-induced responses in plants by measuring VOCinduced transcripts (Arimura et al., 2000; Arimura et al., 2002; Kishimoto et al., 2006; Paschold et al., 2006) or by measuring JA or MeJA levels (Arimura et al., 2002, Engelberth et al., 2004; Karban et al., 2000; Paschold et al., 2006). Interestingly, I noticed a similar increase of MeJA in both wounded and ocimene-treated plants, but no accumulation of JA in ocimene treated plants was seen. Engelberth et al. (2004) reported an increase of JA in corn seedlings after treatment with C6-aldehydes. Arimura et al. (2002) also showed a weak increase of JA in lima bean exposed to VOCs, which included both C6-aldehydes and monoterpenes. To my knowledge, no other studies have linked an increase in MeJA to monoterpene treatment. It is not known from the literature, if Arabidopsis treated with C6-aldehydes may cause an increase in MeJA, and if plants treated with both monoterpenes and C6 aldehydes may induce an increase in both JA and MeJA metabolites. A dissection of the VOCs with regard to their ability to induce increased levels of JA, MeJA or both 94  would contribute to our understanding of the specificity in the translation of VOC into octadecanoid signals.  4.2.2 Monoterpenes as possible signals in plants Herbivore-induced VOCs have been associated with  indirect plant defence,  plant-to-plant signaling, within-plant signaling, and the priming of induced defences (e.g. Arimura et al., 2000; Baldwin and Schultz 1983, Birkett et al., 2000; DeMoares et al., 1998; Engelberth et al., 2004; Heil and Bueno 2007; Kost and Heil Kost 2006; Karban et al., 2000; 2001, 2003; 2006, Kishimoto et al., 2005, 2006, Paschold et al., 2006, Rai et al., 2003, Rhoades 1983, Shualev et al., 1997). Thus, signaling mediated with VOCs is likely to increase collective fitness when plants are at risk of attack from herbivores. The different compounds forming the induced bouquet of VOCs emitted from plants may have different signaling properties. For example, low molecular weight and highly volatile compounds such as monoterpenes are thought to diffuse rapidly into the headspace (Baldwin et al., 2006). The rapid dilution of these compounds make signaling over longer distances less likely than for heavier compounds. Compounds, such as MeJA, with lower volatility have a slower rate of dispersal that allows for the development of plumes of higher concentrations (Thistle et al., 2004). In contrast, monoterpenes would be well suited for signaling over short distances or between different parts of the same plant. It is conceivable, that different types of volatiles may act synergistically in short- and long-distance signaling. For example, MeJA is known to function in airborne plant stress signaling (Farmer and Ryan, 1990; Farmer 2001), and exposure of plants to MeJA can induce active processes of monoterpene emission (Kessler and Baldwin, 2001; Martin et al., 2003; Miller et al., 2005). Conversely, the 95  present study is the first report showing that monoterpenes can induce MeJA production in comparable levels as those induced by wounding. Synergistic activities between monoterpenes and MeJA could facilitate the positive feedback and possible enhancement of volatile signals to counter effects of signal dilution. The new information generated in this thesis about monoterpene-induced responses in Arabidopsis together with the wealth of knowledge and resources available for octadecanoid signaling in Arabidopsis make it possible to test these concepts in future work.  4.2.3 Monoterpenes as possible priming signals Induced plant VOC emissions can have a priming effect in plant defence activation in neighbouring plants (Dicke and Bruin, 2001; Engelberth et al., 2004; Kishimoto et al., 2006). If priming is effective in inducing a low-level defence state, the receiver plant has an enhanced ability to mount a stronger induced defence against subsequent attack from insect herbivores (Engelberth et al., 2004; Kost and Heil, 2006) or fungal pathogens (Kishimoto et al., 2005, 2006). Priming allows a plant to be prepared for a potential attack without immediately activating a full-fledged defence response. My work supports this concept to some extent. I show at the level of the transcriptome of Arabidopsis, that monoterpenes induce a low level induction of defence gene transcripts and formation of MeJA. However, in this study, I was not able to conclusively demonstrate a priming effect for subsequent wounding or feeding by cabbage loopers. Since I only tested for priming at a single timepoint with general stresses (wounding and feeding by a generalist herbivore), further studies are warranted to test for monoterpene-induced priming effects with more extensive time-  96  courses and additional stress treatments including specialist herbivores or pathogen challenges.  4.2.4 Detection of airborne monoterpenes One of the major challenges in the study of plant defence signalling with VOCs is the lack of known receptors for such compounds, except for ethylene receptors. For example, despite the well established role of MeJA as a volatile plant defence signal, a receptor for MeJA or JA is not known. Nothing is known about the mechanisms of detection of monoterpenes in plants. Since many monoterpenes such as ocimene and myrcene are highly lipophilic compounds their detection may not necessarily require specialized receptors.  As an alternative model, volatile monoterpenes could be  absorbed into the lipophilic plant cuticule or could enter plants through stomata. From there, monoterpenes could reach cell membranes and activate downstream signals by interference with membrane integrity.  However, at this time there are no data to  support such a model. The present study provides some support for the possibility that airborne terpenes can be trapped into lipophilic plant surfaces.  When I tried to obtain  quantitative data for terpenoid emissions from pinII::(E)-α-bis transgenic plants described in chapter 2 (Figure 2.8-2.10), I observed a substantial trapping of terpenoids that prevented the use of standards for quantitative analyses. Specifically, up to 99% of the internal sequiterpenol standard, nerolidol, disappeared from the headspace of the collection system when a plant was present (Figure 4.1). In contrast, when no plant was present in the collection system, the standard could be easily recovered by SPME. To rule out the possibility that the pots or soil may be causing the loss of standard, plants cut above ground were also tested with similar results. To test if the trapping of 97  terpenoids could be due to lipophilic surfaces, I tested the possibility of terpenoid trapping with a sheet of ParafilmTM instead of plants in the collection system. ParafilmTM has a similar composition to plant epicuticular wax (personal communication, Dr. Reinhardt Jetter, Department of Botany, University of British Columbia). Like the presence of plants, parafilm acted as a strong trap and caused a reduction of up to 95% of the internal standard from the headspace (Figure 4.1). Similar results were obtained with different sesquiterpenes (bisabolenes, nerolidol) and monoterpenes (myrcene, ocimene, linalool) tested.  Figure 4.1: Nerolidol recovery assay. Nerolidol standard recovered from the volatile set-up environment with SPME, in the absence of plant or parafilm (black); in the presence of with a 8cm x 4cm piece of parafilm (red); and in the presence of an Arabidopsis plant (blue). The experimental set-up for SPME volatile collection from the headspace is illustrated in Figure S4.  98  The interaction between the lipophilic monoterpenes and the plant surface lipids may elicit reactions similar to responses induced by other lipophilic volatiles such as C6-aldehydes (Kishimoto et al., 2005; 2006a; 2006b; Shiojiri et al., 2006), OPDA (Stintzi et al., 2001), acrolein and methyl vinyl ketone (Almeras et al., 2003) and could involve a downstream activation of octadecanoid signals.  4.2.5 Molecular targets for future characterization of plant VOC signaling The present study provides a number of new molecular targets for future characterization and possible dissection of plant-to-plant or within-plant volatile signaling. Given the extent of the transcriptome response upon myrcene and ocimene treatment, it is fair to suggest that the response of plants to VOCs requires at least some regulation at the level of transcription factors. Based on the array data described in chapter 3 and comparison with Arabidopsis gene expression data available in the public  domain  (https://www.genevestigator.ethz.ch/at/),  several  Arabidopsis  transcription factors that responded to monoterpenes, did not show a similar response in plants treated with other stress molecules such as abscisic acid, ethylene, MeJA and salicylic acid (Table 4.1 and Figure 4.2). Curiously, several of these transcription factors are not well characterized. My observation of a monoterpene-induced MeJA increase and the absence of a similar increase of JA could suggest rapid methylation of JA in monoterpene treated Arabidopsis leaves. Surprisingly, I only found a weak induction for a known JA methyl transferase (JMT). However, I also found five other methyl transferases of unknown functions, that were highly upregulated in response to monoterpene treatment (Table 3.3). Four out of these five methyl transferases were among the top six most strongly  99  Monoterpene MeJA ABA Ethylene SA  AT1G21200 AT3G04410 AT2G41710 AT1G02230 AT2G27990 AT3G04670 AT1G08000 AT2G28200 AT2G24430 AT2G40220 AT3G50650 AT1G13260 AT1G74930 AT4G37730 AT2G20570 AT4G39070 AT3G61970 AT2G20180  Fold change  4.50 4.00 3.50 3.00 2.50 2.00 1.50 1.00 0.50 0.00  Gene Figure 4.2: Fold change of transcription factors differentially expressed in monoterpene induced A. thaliana that have a different pattern of expression in plants treated with MeJA, ethylene, ABA, or SA. MeJA, ethylene, ABA and SA expression data were obtained from the Gene Express Viewer public database. Table 4.1: Locus and description of transcription factors differentially expressed in monoterpene induced A. thaliana that have a different pattern of expression in plants treated with MeJA, ethylene, ABA, or SA. LOCUS  DESCRIPTION  AT1G21200  transcription factor; similar to unknown protein  AT3G04410  transcription factor; similar to ANAC004  AT2G41710  ovule development protein, putative; similar to WRI1 (WRINKLED 1)  AT1G02230  ANAC004 (Arabidopsis NAC domain containing protein 4)  AT2G27990  BLH8 (BEL1-LIKE HOMEODOMAIN 8); DNA binding / transcription factor  AT3G04670  ATWRKY39 member of WRKY Transcription Factor; Group II-d  AT1G08000  zinc finger (GATA type) family protein; Identical to GATA transcription factor 5  AT2G28200  nucleic acid binding / transcription factor/ zinc ion binding; similar to zinc finger (C2H2 type)  AT2G24430  no apical meristem (NAM) family protein; similar to ANAC058  AT2G40220  ABI4 encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4).  AT3G50650  scarecrow-like transcription factor 7 (SCL7); similar to putative chitin-inducible  AT1G13260  RAV1 Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temp.  AT1G74930  encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family.  AT4G37730  bZIP transcription factor family protein; similar to bZIP transcription factor family protein  AT2G20570  GPRI1 Encodes a protein containing a GARP DNA-binding domain  There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.  AT4G39070  zinc finger (B-box type) family protein  AT3G61970  NGA2 (NGATHA2); transcription factor; similar to NGA1 (NGATHA1)  AT2G20180  key negative regulator of phytochrome-mediated seed germination. Represses seed germination in the dark. Negatively regulates GA3 oxidase expression.  100  up-regulated transcripts detected by the microarray analysis with 17- to 23-fold increase relative to controls. These putative methyl transferases genes are interesting targets for functional characterization.  Future characterization of enzyme activities  should test the possibility if any of these enzymes could be involved in the metabolism of JA in addition to the known JMT (Seo et al., 2001).  Finally, I found 35 genes that showed consistent up-regulation over all three time points analyzed after treatment of plants with ocimene (Table 3.1).  These 35  transcripts are also found as differentially expressed in response to a variety of other stress treatments such as a variety of pathogens, insects, MeJA, ethylene, SA and wounding.  (Gene Investigator: https://www.genevestigator.ethz.ch/at/). Six of these  genes are of unknown function and the majority of the remaining genes of these monoterpene-induced genes are only annotated with putative functions based on similarity to other genes.  4.2.6 Future Research Directions This study provides a foundation for several new lines of research into the molecular mechanisms of underlying monoterpene induced responses in Arabidopsis and VOC signalling in plants.  1- In this thesis I demonstrated a monoterpene-induced molecular response of Arabidopsis plants using a laboratory set-up. Based on the results obtained  here, it is now important to validate the laboratory studies with experiments that 101  are closer to scenarios of possible VOC signalling in nature. For example, VOC concentrations need to match those found in nature and experiments should avoid enclosure of plants. Such future studies could make use of plants other than Arabidopsis with higher levels of VOC emissions, and could include engineered systems following the approach highlighted by Paschold et al. (2006). Here, the pinII::GUS Arabidopsis reporter system will be of continued value. 2- In future studies, the VOC-induced molecular responses should be investigated at different plant developmental stages. A microarray study similar to the one I presented here could be done to establish the transcriptome of the response comparing the response over the development from seeding to mature plants. 3- The potential discrepancy in the octadecanoid metabolites induced after monoterpene treatment (this thesis) or C6-aldehyde treatment (Engelberth et al., 2004) should be further investigated. 4- Extended tests for a possible monoterpene-dependent priming effect need to be done as reported by Kishimoto et al. (2005; 2006a). These should include a more elaborate time course, and a variety of subsequent stresses. 5- The possible role of trapping of lipophilic VOC in plant epicuticular waxes and a possible role of such trapping in VOC signaling needs to be rigorously tested. Future experiments in this direction could involve the uses of wax-less or waxover-producing mutants. 6- Genes and enzymes identified in section 4.2.5 section provide targets for future functional characterization for their role in VOC signaling.  102  4.3 LITERATURE CITED: Akiyama K, Matsuzaki KI, Hayashi H (2005) Plant sesquiterpenes induce hyphal branching in arbuscular mycorrhizal fungi.Nature 435: 824-827 Alméras E; Stolz S; Vollenweider S; Reymond P; Mène-Saffrané L; Farmer EE (2003) Reactive electrophile species activate defense gene expression in Arabidopsis. Plant J 34: 205-216 Arimura GI, Ozawa R, Horiuchi JL, Nishioka T, Takabayashi J (2001) Plant-plant interactions mediated by volatiles emitted from plants infested by spider mites. Bioch Syst Ecol 29: 1049-1061 Arimura G, Ozawa R, Kugimiya S, Takabayashi J, Bohlmann J (2004) Herbivore-induced defense response in a model legume. Two-spotted spider mites induce emission of (E)-betaocimene and transcript accumulation of (E)-beta-ocimene synthase in Lotus japonicus. Plant Physiol 135:1976-83 Arimura GI, Ozawa R, Shimoda T, Nishioka T, Boland W, Takabayashi J (2000) Herbivoryinduced volatiles elicit defense genes in lima bean leaves. Nature 406: 512-515 Baldwin IT (1998) Jasmonate-induced responses are costly but benefit plants under attack in native populations. Proc Natl Acad Sci USA 95: 8113-8 Baldwin IT, Halitschke R, Paschold A, von Dahl CC, Preston CA (2006) Volatile Signaling in Plant-Plant Interactions: "Talking Trees" in the Genomics Era. Science 311: 812 815 Baldwin IT, Schultz JC (1983) Rapid changes in tree leaf chemistry induced by damage: evidence for communication between plants. Science 221: 277–279 Birkett MA, Campbell CAM, Chamberlain K, Guerrieri E, Hick A, Martin JL, Matthes M, Napier JA, Pettersson J, Pickett JA, Poppy GM, Pow EM, Pye BJ, Smart LE, Wadhams GH, Wadhams LJ and CM Woodcock (2000) New roles for cis-jasmone as an insect semiochemical and in plant defense. Proc Natl Acad Sci USA 97: 9329–9334 Bruin J, Dicke M (2001) Chemical information transfer between wounded and unwounded plants: backing up the future. Bioch Syst Ecol 29: 1103-1113 Bruin J, Dicke M, Sabelis MW (1992) Plants are better protected against spider mites after exposure to volatiles from infested conspecifics. Experientia 48: 525-529 Cheng AX, Lou YG, Mao YB, Lu S, Wang LG, Chen XY (2007) Plant Terpenoids: Biosynthesis and Ecological Functions. J Integ Plant Bio 49: 179-186 Dicke M, Bruin J (2001) Chemical information transfer between plants: back to the future. Bioch Syst Ecol 29: 981-994 Engelberth J, Alborn HT, Schmelz EA, Tumlinson JH (2004) Airborne signals prime plants against insect herbivore attack. Proc Natl Acad Sci USA 101: 1781-1785 Farmer E (2001) Surface-to-air signals. Nature 411:854-856  103  Farmer E, Ryan C (1990) Interplant Communication: Airborne Methyl Jasmonate Induces Synthesis of Proteinase Inhibitors in Plant Leaves. Proc Natl Acad Sci USA 87: 7713-7716 Heil M, Bueno JCS (2007) Within-plant signaling by volatiles leads to induction and priming of an indirect plant defense in nature. Proc Natl Acad Sci USA 104: 5467-5472 Heil M; Kost C (2006): Priming of indirect defences. Ecol Let 9: 813-817 Kappers IF, Aharoni A, van Herpen TWJM, Lückerhoff LLP, Dicke M, Bouwmeester HJ (2005) Genetic engineering of terpenoid metabolism attracts bodyguards to Arabidopsis. Science 309: 2070-2072 Karban R (2001) Communication between sagebrush and wild tobacco in the field. Bioch System and Ecol 29: 995-1005 Karban R, Baldwin IT, Baxter KJ, Laue G, Felton GW (2000) Communication between plants: Induced resistance in wild tobacco plants following clipping of neighbouring sagebrush. Oecologia 125: 66-71 Karban R, Maron J, Felton GW, Ervin G, Eichenseer H (2003) Herbivore damage to sagebrush induces resistance in wild tobacco: evidence for eavesdropping between plants. Oikos 100: 325-332 Karban R, Shiojiri K, Huntzinger M, McCall AC (2006) Damage-induced resistance in sagebrush. Volatiles are key to intra and interplant communication. Ecology 87: 922-930 Kessler A, Baldwin IT (2001) Defensive function of herbivore-induced plant volatile emissions in nature. Science 291: 2141-2144 Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2006a) Analysis of defense responses activated by volatile allo-ocimene treatment in Arabidopsis thaliana. Phytochem 67: 1520-1529 Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2006b) Components of C6-aldehydeinduced resistance in Arabidopsis thaliana against a necrotrophic fungal pathogen, Botrytis cinerea. Plant Science 170: 715-723 Kishimoto K, Matsui K, Ozawa R, Takabayashi J (2005) Volatile C6-aldehydes and Alloocimene Activate Defense Genes and Induce Resistance against Botrytis cinerea in Arabidopsis thaliana. Plant and Cell Phys 46:1093-1102 Koch T, Krumm T, Jung V, Engelberth J, Boland W (1999) Differential Induction of Plant Volatile Biosynthesis in the Lima Bean by Early and Late Intermediates of the OctadecanoidSignaling Pathway. Plant Physiol 121: 153-162 Kost C, Heil M (2006) Herbivore-induced plant volatiles induce an indirect defence in neighbouring plants. J Ecol 94: 619-628 Paré PW, Tumlinson JH (1999) Plant volatiles as a defense against insect herbivores. Plant Physiol 121: 325-331 Park CY, Lee JH, Yoo JH, Moon BC, Choi MS, Kang YH, Lee SM, Kim HS, Kang KY, Chung WS, Lim CO, Cho MJ (2005) WRKY group IId transcription factors interact with calmodulin. FEBS Let 579: 1545-1550  104  Paschold A, Halitschke R, Baldwin IT (2006) Using ‘mute’ plants to translate volatile signals. Plant Journal 45: 275-291 Rai VK, Gupta SC, Singh B (2003) Volatile monoterpenes from Prinsepia utilis L. leaves inhibit stomatal opening in Vicia faba L. Biologia Plantarum 46:121-124 Rasmann S, Kollner TG, Degenhardt J, Toepfer S, Kuhlmann U, Gershenzon J, Turlings TCJ (2005) Recruitment of entomopathogenic nematodes by insect-damaged maize roots. Nature 434: 732-737 Reddy GVP, Guerrero A (2004) Interactions of insect pheromones and plant semiochemicals. TIPS 9: 253-261 Rhoades DF (1983) Responses of alder and willow to attack by tent caterpillars and webworms - evidence for pheromonal sensitivity of willows. ACS Symposium Series 208: 55– 68 Runyon JB, Mescher MC, De Moraes CM (2006) Volatile chemical cues guide host location and host selection by parasitic plants. Science 313: 1964-1967 Seo S, Seto H, Koshino H, Yoshida S, Ohashi Y. (2003) A Diterpene as an Endogenous Signal for the Activation of Defense Responses to Infection with Tobacco mosaic virus and Wounding in Tobacco. Plant Cell 15: 863 - 873 Shulaev V, Silverman P, Raskin I (1997) Airborne signalling by methyl salicylate in plant pathogen resistance. Nature 385: 718–721 Shiojiri K, Kishimoto K, Ozawa R, Kugimiya S, Urashimo S, Arimura G, Horiuchi J, Nishioka T, Matsui K, Takabayashi J (2006) Changing green leaf volatile biosynthesis in plants: An approach for improving plant resistance against both herbivores and pathogens. Proc Natl Acad Sci USA 103: 16672-16676 Stintzi A, Weber H, Reymond P, Browse J, Farmer EE (2001) Plant defense in the absence of jasmonic acid: The role of cyclopentenones. Proc Natl Acad Sci USA 98: 12837-12842 Takabayashi J, Dicke M (1996) Plant-carnivore mutualism through herbivore-induced carnivore attractants. Trends Plant Sci 1: 109-113 Thaler JS (1999) Jasmonate-inducible plant defenses cause increased parasitism of herbivores. Nature 399: 686-688 Thistle HW, Peterson H, Allwine G, Lamb B, Strand T, Holsten EH, Shea PJ (2004) Surrogate Pheromone Plumes in Three Forest Trunk Spaces: Composite Statistics and Case Studies. Forest Science 50: 610-625 Thomma B, Cammue B, Thevissen K (2002) Plant defensins. Planta 216: 193-202 Thomma BPHJ; Broekaert WF (1998) Tissue-specific expression of plant defensin genes PDF2.1 and PDF2.2 in Arabidopsis thaliana. Plant phys bioch 36: 533-537  105  Thornburg RW, An G, Cleveland TE, Johnson R, Ryan CA (1987) Wound-inducible expression of a potato inhibitor II-chloramphenicol acetyltransferase gene fusion in transgenic tobacco plants. Proc Natl Acad Sci USA 84: 744-748 Tian Y, Lu XY (2006) The molecular mechanism of ethylene signal transduction. South African J of Bot 72:487-491 Trapp SC, Croteau R (2001) Genomic Organization of Plant Terpene Synthases and Molecular Evolutionary Implications. Genetics 158: 811-832 Ülker B, Mukhtar MS, Somssich IE (2007) The WRKY70 transcription factor of Arabidopsis influences both the plant senescence and defense signaling pathways. Planta 226: 125-137 Van Loon LC, Geraats BPJ, Linthorst JM (2006) Ethylene as a modulator of disease resistance in plants. TIPS 11:184-191 van Poecke RMP, Posthumus MA, Dicke M (2001) Herbivore-Induced Volatile Production By Arabidopsis thaliana Leads To Attraction Of The Parasitoid Cotesia rubecula: Chemical, Behavioral, And Gene-Expression Analysis. J Chem Ecol 27: 1911-1928 Vick BA, Zimmerman DC (1984) Biosynthesis of Jasmonic Acid by Several Plant Species. Plant Physiol 75: 458-461 Vick BA, Zimmerman DC (1987) Pathways of Fatty Acid Hydroperoxide Metabolism in Spinach Leaf Chloroplasts. Plant Physiol 85: 1073-1078 von Dahl CC, Baldwin IT (2007) Deciphering the Role of Ethylene in Plant–Herbivore Interactions. J Plant Growth Reg. online preview von Dahl CC, Winz RA, Halitschke R, Kuhnemann F, Gase K, Baldwin IT (2007) Tuning the herbivore-induced ethylene burst: the role of transcript accumulation and ethylene perception in Nicotiana attenuata. Plant J 51: 293-307 Wagner MR, Clancy KM, Tinus RW (1989) Maturational variation in needle essential oils from Pseudotsuga menziesii, Abies concolor and Picea engelmannii. Phytochem 28: 765-770 Wagner A, Phillips L, Narayan RD, Moody JM, Geddes B (2005) Gene silencing studies in the gymnosperm species Pinus radiate. Plant Cell Rep 24: 95-102. Wiermer M, Feys BJ, Parker JE (2005) Plant immunity: the EDS1 regulatory node. Curr Op in Plant Bio 8:383-389 Zhao J, Davis LC, Verpoorte R (2005) Elicitor signal transduction leading to production of plant secondary metabolites. Biotech Adv 23: 283-333 Zeng, G (1998) Sticky-end PCR: New method for subcloning. Biotech 25: 206–208 Zeringue H (1987) Changes in cotton leaf chemistry induced by volatile elicitors. Phytochem 26:1357-1360  106  Zook M, Hohn T, Bonnen A, Tsuji J, Hammerschmidt R (1996) Characterization of Novel Sesquiterpenoid Biosynthesis in Tobacco Expressing a Fungal Sesquiterpene Synthase. Plant Physiol 112: 311-318  107  APPENDIX: Supplement Table 1: Primers used for RT-PCR gene expression analysis. Target gene Forward primer  Reverse primer  At1g19670  cgtcgccttacactctttgt  gatccagtcgcaggaactaa  At1g28370  tcaaacttcctcagcgtttc  atagcacgtttgtcgtaggc  At1g43160  gtgtatggcttgggacatc  aatggttgttgttgctccat  At1g51760  ggtgctttcaatgtgattcc  gcctgaaacgttcttgaaaa  At1g61120  atcacaattgccgatgactt  atgttgcgaagatggacaat  At1g62740  ctctctcagacgcgaagaag  agaagctttcgcatcagcta  At1g76680  ctggagtttcagatacagc  catttggctgaaacccgc  At1g80840  aatcgattttccccaagttc  gccgaatgtattggagatg  At2g06050  gcggcacaagggaactc  ggtactccgttcaacgcc  At2g29500  ccgtaacagtcaacacacca  ggagagagacacgtggagaa  At2g34930  ggtttctagacgccttctcc  gtgacgccatgtttcctatc  At3g23240  atgagacggagaatgaccaa  tgttctcccaaatcctcaaa  At3g45140  ccaaacaccagagcctctta  agtcgtaaatgcgctcaaac  At4g27410  gaatgtttgacccgaaacac  cccggagataaaagacca  At5g24770  tcaacgtgcactaaaaacga  tgaggtggggttatgagaaa  At5g24780  gaattcgaacaccatctttgg  caagtcctttggcgtaaaaa  Actin  cgatgaagctcaatccaaacga  cagagtcgagcacaataccg  108  Supplemental Figure 1: Quality Control: Scatter Plot of channel 1 (Cy5) against channel 2 (Cy3) .  109  Supplemental Figure 1: Quality Control: continued from p 102  .  110  Supplemental Figure 1: Quality Control: continued from p 103  111  Supplemental Figure 1: Quality Control: continued from p 104  112  Supplemental Table 2: Locus, Gene Model and Description of stress related genes presented in Figure 3.8. Descriptions were modified from the TAIR description to allow them to fit in this table. Locus  Gene Model  AT1G01720 ATAF1  Description belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding.  AT1G07400 AT1G07400.1 17.8 kDa class I heat shock protein AT1G09080 AT1G09080.1 luminal binding protein 3 (BiP-3) (BP3) AT1G12110 AT1G12110.1 Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. AT1G17190 AT1G17190.1 Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). AT1G17290 AT1G17290.1 Encodes for alanine aminotransferase (ALAAT1), involved in alanine catabolism during plants recovery from hypoxia AT1G17420 LOX3  Lipoxygenase  AT1G19640 JMT  Encodes a S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase. Its expression is induced in response to wounding or MeJA  AT1G19670 ATCLH1  Chlorophyllase is the first enzyme involved in chlorophyll degradation. Its expression is induced rapidly by methyljasmonate  AT1G20440 COR47  Belongs to the dehydrin protein family, responds to osmotic stress, ABA, dehydration  AT1G20510 AT1G20510.1 OPCL1 (OPC-8:0 COA LIGASE1); AT1G27730 STZ  Cys2/His2-type zinc-finger proteins found in higher plants. localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin  AT1G32640 ATMYC2  Encodes a 68 kD MYC-related transcriptional activator. Its transcription is induced by dehydration stress and ABA treatment  AT1G45145 ATTRX5  encodes a cytosolic thioredoxin that reduces disulfide bridges  AT1G48960 AT1G48960.1 universal stress protein (USP) family protein; AT1G51680 4CL1  encodes an isoform of 4-coumarate:CoA ligase (4CL)  AT1G52890 AT1G52890.1 encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. AT1G54100 ALDH7B4  Aldehyde dehydrogenase  AT1G55920 ATSERAT2;1  Encodes a chloroplast/cytosol localized serine O-acetyltransferase  AT1G58200 MSL3  A member of MscS-like gene family,  AT1G59860 AT1G59860.1 17.6 kDa class I heat shock protein (HSP17.6A-CI) AT1G61120 AT1G61120.1 terpene synthase/cyclase family protein AT1G72520 AT1G72520.1 lipoxygenase, putative; similar to LOX3 AT1G74310 ATHSP101  Encodes ClpB1. Involved in refolding of proteins which form aggregates under heat stress. Also known as AtHsp101.  AT1G76680 OPR1  alpha/beta barrel fold family of FMN-containing oxidoreductases. Involved in jasmonic acid biosynthesis.  AT1G76690 OPR2  Encodes one of two closely related 12-oxophytodienoic acid reductases.  AT1G79930 HSP91  encodes high molecular weight heat shock protein 70 , mRNA is constitutively expressed but transiently induced after heat shock  AT2G02990 RNS1  member of the ribonuclease T2 family, involved in wound-induced signaling independent of jasmonic acid.  AT2G04240 AT2G04240.2 Encodes a small protein . Gene expression is induced by salt and osmotic stress. AT2G06050 OPR3  Encodes a 12-oxophytodienoate reductase that is required for jasmonate biosynthesis. Mutants are male sterile and defective in pollen dehiscence.  AT2G19310 AT2G19310.1 similar to HSP18.2 (HEAT SHOCK PROTEIN 18.2  113  AT2G21620 RD2  Encodes gene that is induced in response to dessication; mRNA expression is seen 10 and 24 hrs after start of dessication treatment.  AT2G23680 AT2G23680.1 stress-responsive protein, putative; similar to stress-responsive protein, putative; similar to cold acclimation protein AT2G24210 AT2G24210.1 TPS10 (TERPENE SYNTHASE 10); myrcene/(E)-beta-ocimene synthase AT2G24850 AT2G24850.1 Encodes a tyrosine aminotransferase that is responsive to treatment with jasmonic acid. AT2G29450 ATGSTU5  Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides.  AT2G29500 AT2G29500.1 17.6 kDa class I small heat shock protein (HSP17.6B-CI) AT2G33380 RD20  Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication.  AT2G38170 CAX1  Encodes a high affinity vacuolar calcium antiporter.  AT2G38750 ANNAT4  one of four annexins identified in Arabidopsis.  AT2G39770 CYT1  Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase.  AT2G39800 P5CS1  encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline.  AT2G40220 ABI4  encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4).  AT2G41560 ACA4  encodes a calmodulin-regulated Ca(2+)-ATPase that improves salt tolerance in yeast. localized to the vacuole.  AT3G05210 ERCC1  encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease.  AT3G05550 AT3G05550.1 hypoxia-responsive family protein; similar to hypoxia-responsive family protein AT3G11480 AT3G11480.1 The gene encodes a SABATH methyltransferase that methylates both salicylic acid and benzoic acid. AT3G12580 AT3G12580.1 HSP70 (heat shock protein 70); ATP binding; similar to heat shock cognate 70 kDa protein 3 (HSC70-3) AT3G14210 ESM1  Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis.  AT3G15500 AT3G15500.1 Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM AT3G19580 AZF2  Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild dessication. acts as a transcriptional repressor.  AT3G23250 AT3G23250.2 Member of the R2R3 factor gene family. AT3G25780 AOC3  Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis  AT3G45140 LOX2  Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.  AT3G46130 AT3G46130.2 Encodes a putative transcription factor (MYB48). AT3G48090 EDS1  Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases.  AT3G50970 LTI30  Belongs to the dehydrin protein family, mRNA upregulated by water deprivation and abscisic acid.  AT3G50980 AT3G50980.1 dehydrin, putative; Identical to Dehydrin Xero 1 (XERO1) AT3G51660 AT3G51660.1 macrophage migration inhibitory factor family protein AT3G57260 BGL2  beta 1,3-glucanase  AT3G62550 AT3G62550.1 universal stress protein (USP) family protein; similar to ethylene-responsive protein, putative AT4G02380 SAG21  SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance.response to various stresses.  AT4G08780 AT4G08780.1 peroxidase, putative; AT4G11280 ACS6  encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase  AT4G12400 AT4G12400.1 stress-inducible protein, putative; similar to stress-inducible protein  114  AT4G16740 ATTPS03  Monoterpene synthase, catalyzes the formation of the acyclic monoterpene (E)-beta-ocimene in response to wounding or treatment with JA  AT4G20830 AT4G20830.1 FAD-binding domain-containing protein; Identical to Reticuline oxidase-like protein precursor AT4G21830 AT4G21830.2 protein-methionine-S-oxide reductase; similar to methionine sulfoxide reductase domain-containing protein AT4G21870 AT4G21870.1 26.5 kDa class P-related heat shock protein (HSP26.5-P) AT4G23190 CRK11  Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria  AT4G26070 MEK1  Member of MAP Kinase Kinase. Can phosphorylate the MAPK AtMPK4, in response to stress. Gets phosphorylated by MEKK1 in response to wound  AT4G27410 RD26  Encodes a NAC transcription factor induced in response to dessication. transcriptional activator in ABA-mediated dehydration response.  AT4G34150 AT4G34150.1 C2 domain-containing protein; similar to (AT)SRC2/SRC2 (SOYBEAN GENE REGULATED BY COLD-2) AT4G34710 ADC2  encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway  AT4G35770 SEN1  Senescence-associated gene that is strongly induced by phosphate starvation.  AT4G36990 HSF4  encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins.  AT4G38840 AT4G38840.1 auxin-responsive protein, putative; similar to auxin-responsive protein, putative AT5G05730 ASA1  ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis.  AT5G16970 AT5G16970.1 encodes a 2-alkenal reductase (EC 1.3.1.74), plays a key role in the detoxification of reactive carbonyls AT5G16980 AT5G16980.1 NADP-dependent oxidoreductase, putative; similar to AT-AER (ALKENAL REDUCTASE), 2-alkenal reductase AT5G17000 AT5G17000.1 NADP-dependent oxidoreductase, putative; similar to AT-AER (ALKENAL REDUCTASE), 2-alkenal reductase AT5G20410 MGD2  Encodes a type B monogalactosyldiacylglycerol (MGDG) synthase. Strongly induced by phosphate deprivation, and in non-photosynthetic tissues  AT5G24770 VSP2  Has acid phosphatase activity dependent on the presence of divalent cations (Mg2+, Co2+, Zn2+, Mn2+) and anti-insect activity.  AT5G27760 AT5G27760.1 hypoxia-responsive family protein; similar to hypoxia-responsive family protein AT5G37770 TCH2  Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes.  AT5G37940 AT5G37940.1 NADP-dependent oxidoreductase, putative; similar to NADP-dependent oxidoreductase, putative AT5G37980 AT5G37980.1 NADP-dependent oxidoreductase, putative; similar to NADP-dependent oxidoreductase, putative AT5G38000 AT5G38000.1 NADP-dependent oxidoreductase, putative; similar to NADP-dependent oxidoreductase, putative AT5G42650 AOS  Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase.  AT5G44420 PDF1.2  Encodes an ethylene- and jasmonate-responsive plant defensin. mRNA levels are not responsive to salicylic acid treatment  AT5G44680 AT5G44680.1 methyladenine glycosylase family protein; similar to methyladenine glycosylase family protein AT5G44750 REV1  Gene involved in damage-tolerance mechanisms through translesion synthesis(TLS).  AT5G45340 CYP707A3  Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism.  AT5G49480 ATCP1  AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl.  AT5G51440 AT5G51440.1 23.5 kDa mitochondrial small heat shock protein (HSP23.5-M) AT5G56030 HSP81-2  a member of heat shock protein 90 (HSP90) gene family.Expression is NOT heat-induced but induced by IAA and NaCl.  AT5G60890 ATR1  Myb-like transcription factor that modulates expression of ASA1, a key point of control in the tryptophan pathway  AT5G64750 ABR1  Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2  115  Supplemental Materials and Methods 2:  Script used to generate primary report ## 1.3 Import you data file:## ################################## #for structure of "your_array.txt" see helpfile # in: "FOAR03_S1_0003_EE001_10to13RD.txt" all.dat=read.table("controls_raw_data.txt",header=TRUE,sep="\t",as.is=TRUE,quote="\"") #Check file dimensions dim(all.dat) #Check column names names(all.dat) #Out: all.dat ##1.4 Removing Controls:### ################################## #In: all.dat (see 1.3) #...change on web page...# ok! all.int=(all.dat)[-c( grep("control",all.dat[,5]),),] dim(all.int) #Out: all.int ##1.5 Removing all manually flagged spots## ############################################ #In: all.int for (i in seq(6,(length(all.int[1,])-2),3)){ all.int[all.int[,i]==1,i+1]=NA} summary(all.int) #Out: all.int ##1.6 Uniformity of signal (calculate the number of detectible spots) ## ######################################################################## #In: all.int det.spots=NULL for (i in seq(7,(length(all.int[1,])-1),3)){ gt.bg3=sum(all.int[,i] > (2*all.int[,i+1]),na.rm=T) / length(all.int[,1])*100 det.spots=c(det.spots,gt.bg3)} cbind(names(all.int[seq(7,(length(all.int[1,])-1),3)]),round(det.spots, digits=0)) #Out: det.spots ##1.7 Signal Intensity boxplot#### ################################## # In: all.int source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/all.signal.boxplot.txt") #Usage (for sourced function): all.signal.boxplot(x, label, ylabel) #x: a matrix of signal intensities #label: text to be plotted as title, default: label="signal spread" #ylabel: text to be plotted as y axis label, default: ylabel="signal intensity"  116  #Plot #choose (JPEG or PDF by adding or removing '#' signs) #jpeg(filename = "ocimenetrial6.jpg", width = 1000, height = 800) pdf(file = "ocim_trial6_boxplot.pdf", width = 10, height=8, onefile = TRUE, family = "Helvetica",pointsize=18) all.signal.boxplot(log2(all.int[,seq(7,length(all.int[1,])-1,3)]), label="signal spread, raw data", ylabel="log2(raw intensities)") dev.off() #Out: graphic ##1.8 2x2 scatterplot of Raw intensities for Cy3 and Cy5 for all slides####### ############################################################################### #In: all.int source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/two.by.two.plot.txt") #usage(for sourced function): twobytwoplot(x,y,foldchange=2,arrayname="text",xlabel="text", ylabel="text") #x: Channel 1 data present in "all.int.bckg", regardless of background subtraction method used #y: Channel 2 data present in "all.int.bckg", regardless of background subtraction method used #foldchange: default is '2' #arrayname: text to be plotted as main title, default is: "array",count,"(",Bckg.corr.method,"background correction)" #xlabel: text to be plotted as x axis label, default= whatever you designate Chan1 as #ylabel: text to be plotted as y axis label, default= whatever you designate Chan2 as #Designate channels (careful here not to get confused if you are doing dye flips) Chan1="log2(Chan1)" Chan2="log2(Chan2)" #Plotting pdf(file= "ocimenetrial6_scatterplot.pdf", width=14, height=18, onefile=TRUE, family = "Helvetica",pointsize=18) #jpeg(filename = "ocimene_twobytwo.jpg", width = 1000, height = 2400)  par(mfrow=c(3,2),pty="s",mar=c(5, 4, 6, 2)) count=1 for (i in seq(7,length(all.int[1,])-4,6)){ twobytwoplot(log2(all.int[,i]),log2(all.int[i+3]) ,foldchange=2,arrayname=paste(count,"(raw signal)"), xlabel=Chan1,ylabel=Chan2) count=count+1 } dev.off() #Out:graphic ##2.1 Per spot background correction## ###################################### #In: all.int #Bckg.corr.method="Local" #all.int.bckg=NULL #for (i in seq(7,(length(all.int[1,])-1),3)){ #tmp=all.int[,i]-all.int[,i+1] #all.int.bckg=cbind(all.int.bckg, tmp)}  117  #summary(all.int.bckg) #Shift values so no negative signals occur# #some functions in future calculations will not accept negative values #use only if applicable (i.e. you have negative values) #min(all.int.bckg) will check for this #tmp.chan1=NULL #tmp.chan2=NULL #zero.all.int=NULL #for (i in seq(1,length(all.int.bckg[1,])-1,2)){ # tmp.chan1=2*(abs(min(all.int.bckg[,i:(i+1)],na.rm=T)))+ all.int.bckg[,i] # tmp.chan2=2*(abs(min(all.int.bckg[,i:(i+1)],na.rm=T)))+(all.int.bckg[,(i+1)]) #zero.all.int=cbind(zero.all.int,tmp.chan1,tmp.chan2) # } #all.int.bckg=zero.all.int #end of optional negative value removal #summary(all.int.bckg) #Out: all.int.bckg ##2.2 Per subgrid background correction## ######################################### #In: all.int #source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/persubgridbckgr.txt") #Usage(for sourced function): per.subgrid.bckg(x,chans) #x: matrix that provides raw data. default=all.int #chans: columns with raw signal intensities, occurring within 'x', assuming that all.int was properly formatted #date() #Bckg.corr.method="Per-subgrid" #all.int.bckg=per.subgrid.bckg(all.int,chans=seq(7,length(all.int[1,])-1,3)) #date() #summary() #Shift values so no negative signals occur# #some functions in future calculations will not accept negative values #use only if applicable (i.e. you have negative values) #min(all.int.bckg) will check for this #tmp.chan1=NULL #tmp.chan2=NULL #zero.all.int=NULL #for (i in seq(1,length(all.int.bckg[1,])-1,2)){ # tmp.chan1=2*(abs(min(all.int.bckg[,i:(i+1)],na.rm=T)))+ all.int.bckg[,i] # tmp.chan2=2*(abs(min(all.int.bckg[,i:(i+1)],na.rm=T)))+(all.int.bckg[,(i+1)]) #zero.all.int=cbind(zero.all.int,tmp.chan1,tmp.chan2) # } #all.int.bckg=zero.all.int #end of optional negative value removal #summary(all.int.bckg) #date() #Out: all.int.bckg ##2.3 X_perc_mean-per subgrid background correction ## ######################################################  118  #In: all.int source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/X.per.subgrid.bckgrnd.txt") #Usage(for sourced function): x.per.subgrid.bckg(x, chans, floor, backgr) # 'x': a matrix or dataframe that must contain the metarow and metacolumn information # in column 1 and 2 respectively. Signal intensity columns in this data frame # are defined by 'chans'(no default) # 'chans': a vector defining the columns of 'x' that do contain the signal intensities (no default) # 'floor': numerical; the number of standard deviation above background used for flooring. If # defined, all signals that are below the background for that subgrid plus # 'floor' * standard deviation of that background are changed to NA. # Default is 'floor=NA' which results in no flooring # 'backgr': numerical (between 0 and 1); the quantile of the lowest signal intensities # that are being used to define background intensity for each subgrid # Default is 'backgr=0.05', which results in defining the 5% of signals with the # lowest signal intensity in each subgrid as background Bckg.corr.method="X_perc_Mean-per_subgrid" all.int.bckg=x.per.subgrid.bckg(all.int,chans=seq(7,length(all.int[1,])-1,3), floor=NA, backgr=0.1) summary(all.int.bckg) date() summary(all.int.bckg) #Shift values so no negative signals occur# #some functions in future calculations will not accept negative values #use only if applicable (i.e. you have negative values) #min(all.int.bckg) will check for this tmp.chan1=NULL tmp.chan2=NULL zero.all.int=NULL for (i in seq(1,length(all.int.bckg[1,])-1,2)){ tmp.chan1=2*(abs(min(all.int.bckg[,i:(i+1)],na.rm=T)))+ all.int.bckg[,i] tmp.chan2=2*(abs(min(all.int.bckg[,i:(i+1)],na.rm=T)))+(all.int.bckg[,(i+1)]) zero.all.int=cbind(zero.all.int,tmp.chan1,tmp.chan2) } summary(zero.all.int) all.int.bckg=zero.all.int #end of optional negative value removal summary(all.int.bckg) date() #Out: all.int.bckg ###########2.4 2x2 Plots of T vs C for Background###### # corrected signal intensities (whichever method)####### ######################################################## ###For 2x2 plots of RAW (see Section 1.8), BCKG and VSN (see Section 3.2.2), scripts dictate the same dimensions ##to allow these plots to be compared without the need to replot any of them. #In: all.int.bckg source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/two.by.two.plot.txt") #usage (for sourced function): twobytwoplot(x,y,foldchange=2,arrayname="text",xlabel="text", ylabel="text") #x: Channel 1 data present in "all.int.bckg", regardless of background subtraction method used #y: Channel 2 data present in "all.int.bckg", regardless of background subtraction method used #foldchange: default is '2' #arrayname: text to be plotted as main title, default is: "array",count,"(",Bckg.corr.method,"background correction)" #xlabel: text to be plotted as x axis label, default=names(all.int[i])  119  #ylabel: text to be plotted as y axis label, default=names(all.int[i+3]) count=1 for(i in seq(7,length(all.int[1,])-4,6)){ jpeg(filename = paste("2x2_plotsBckg.corr.method","_Slide",count,".jpg"), width = 1000, height = 2400) par(mfrow=c(1,1), pty="s") twobytwoplot(log2(all.int.bckg[,count]),log2(all.int.bckg[,count+1]),foldchange=2, arrayname=paste("array",count,"(",Bckg.corr.method,"background correction)"), xlabel=names(all.int[i]), ylabel=names(all.int[i+3])) count=count+1 dev.off() } #want a pdf document instead? #A multipage pdf document can be generated without adding the pdf function within the loop, only the par function #which will designate the number of plots per page in the pdf document:  pdf(file = paste("2x2_plots",Bckg.corr.method,".pdf"), width = 25, height=25, onefile = TRUE, family = "Helvetica", pointsize=18) count=1 for(i in seq(7,length(all.int[1,])-4,6)){ twobytwoplot(log2(all.int.bckg[,count]),log2(all.int.bckg[,count+1]),foldchange=2, arrayname=paste("array",count,"(",Bckg.corr.method,"background correction)"), xlabel=names(all.int[i]), ylabel=names(all.int[i+3])) count=count+1 } dev.off() #Out: graphic ####2.5 Background Corrected Signal Intensity Boxplots #### ############################################################ # In: all.int.bckg source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/all.signal.boxplot.txt") #usage (for sourced function): all.signal.boxplot(x, label, ylabel) #x: a matrix of signal intensities #label: text to be plotted as title, default: label="signal spread" #ylabel: text to be plotted as y axis label, default: ylabel="signal intensity" #choose (JPEG or PDF by adding or removing '#' signs TO EACH LINE OF CODE) #jpeg(filename = "your_array_signal spread.jpg", width = 1000, height = 800) pdf(file = "your_array_signal_spread_bckg.pdf", width = 11, height=8, onefile = TRUE, family = "Helvetica",pointsize=18) all.signal.boxplot(log2(all.int.bckg[,1:length(all.int.bckg[1,])]), label="signal spread, bckg. corr. data", ylabel="log2(intensity)") dev.off() #Out: graphic ##3.1 LOWESS Normalization and MA plots## ######################################### #In: all.int.bckg  120  source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/loess.norm.txt") #usage(for sourced function): loess.norm(x, span.use, jpg) # x: a matrix containing the signal intensities used for normalization, # they must not be log-transformed.Minimal input is a matrix with two # columns, no default #span.use: numerical between 0 and 1, the span used for lowess normalization # default is 'span.use=0.7' #jpg: logical, if 'jpg=TRUE' (default), MA plots are printed to jpeg files, if # 'FALSE', MA plots are printed to pdf files, for each array a separate file # is generated #outputs # a matrix containing normalized log2-ratios, which are log2(column1/column2) # If more than 2 columns are given, log2-ratios outputs are column-bound to # column1/2, coulmn3/4, coulmn5/6, etc. # # graphic files for each array (called 'MA_plots_Bckg_and_LOWESS' followed by # a number and the appropriate file extension #examples: #all.int.norm=loess.norm(all.int.bckg,span.use=0.7, jpg=F) #all.int.norm.no.bckg=loess.norm(all.int[,seq(7,length(tmp[1,])-1,3)],span.use=0.5) date() all.int.norm=loess.norm(all.int.bckg,span.use=0.7, jpg=T) date() #Out: all.int.norm, graphics ##3.4 Boxplots of Signal Ratios (normalized)## ############################################## #In: all.int.norm source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/all.signal.boxplot.ratios.txt") #usage (for sourced function): ratio.boxplot(x, chans, label, ylabel, colours) #x: a matrix or data frame that contains expression ratios in columns # defined by 'chans', default is all.int.norm #chans: a vector describing the columns of 'x' that contain the expression # ratios to be plotted, default = 1:length(all.int.norm[1,]), since each column represents a different channel #label: text string to be plotted as title, default: label="log2 expression ratio" #ylabel:text string to be plotted as y axis label, default: ylabel="log2(treatment/control)" #colours: text string(s) that define the colour(s) of the boxplots. default is c(rep("orange", 4),rep("yellow",4) #*** Plotting and Usage ***# #choose (JPEG or PDF by adding or removing '#' signs) #jpeg(filename = "your_array_ratio_spread.jpg", width = 600, height = 800) #par(cex=0.9) pdf(file = "ocim_trial2_ratio_spread.pdf", width = 6, height=8, onefile = TRUE, family = "Helvetica",pointsize=18) all.signal.boxplot.ratios(all.int.norm, chans=1:length(all.int.norm[1,]), label="normalized expression ratios", ylabel="log2(treatment/control)", colours=c(rep("orange", 4),rep("yellow",4))) dev.off() #Out: graphic ##Add an if..then statement to include the type of array analysis in the plot  121  ##5.1 Student's t-test, mean-ratio, p-value and q-value calculation## ###################################################################### #In: all.int.norm source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/ttest.mean.p.q.txt") #usage (for sourced function): ttest.mean.p.q(x, treatment.name, jpg, min.observations, lambda.q, pi0.meth.q) #examples # treatments.ttest1=ttest.mean.p.q(all.int.norm[,1:4], treatment.name="mpk3_0h") # treatments.ttest2=ttest.mean.p.q(all.int.norm[,5:8], treatment.name="mpk3_2h", pi0.meth.q="smoother") # #arguments #x: A matrix containing the normalized expression ratios from replicate arrays # in each column, no default #treatment.name: A text string describing this treatment,default is treatment.name="treatment # # Note that no options are given for performing the t-test, default setting # for t.test() are used, to change t-test settings you have to change them in the # function itself, see ?t.test for default settings # #min.observations: the minimal number of observation needed to perform a t.test; if # less expression ratios are available for a given gene p- and q-values are # set to NA for that gene #jpg: logical, if 'jpg=TRUE' (default), Q-plots are printed to jpeg files, if # 'FALSE', Q-plots are printed to pdf files, for each array a separate file # is generated #lambda.q: The values of the tuning parameter to be considered in estimating pi0. # These must be in [0,1] and are set to lambda=seq(0, 0.8, 0.05) by # default. Optional; see Storey (2002) for more information. #pi0.meth.q: Either "smoother" or "bootstrap"; the method for # automatically choosing tuning parameter lambda in the estimate of pi0. If the # lambda argument above is only given one value, then this option is ignored. # Optional; the choice 'pi0.meth.q="bootstrap"' is the default choice. ##Make sure you adjust the ranges to match the start columns for each treatment # default is treatment 1 with 4 reps [,1:4] # and treatment 2 with 4 reps too [,5:8] # for an experiment with 4 reps of 2 treatments #date() treatment1=ttest.mean.p.q(all.int.norm[,1:4], treatment.name="treatment1",jpg=T) #date() #treatment2=ttest.mean.p.q(all.int.norm[,3:6], treatment.name="treatment2",jpg=T) date() #etc. #combine the data, make sure all treamtments are listed below treatments.ttest=cbind(treatment1) #Out: treatments.ttest # t tests for each sample to see how many are different from zero in each sample: # here we also get the mean ratios ##5.2 Histogram of p-values from t-test## ######################################### #In: treatments.ttest (p values are in every 2nd column, repeating for each additional treatment source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/hist.pvalue.txt") #usage (for sourced function): hist.pvalue(x,treatment.name)  122  #example hist.pvalue(treatment.ttest[,3], treatment.name="treatment 1") # #arguments: #x: a vector of p-values (e.g. derived from a t-test or ANOVA #treatment.name: a text string describing the treatment, default is # treatment.name="treatment" #Output:a graphic displaying the frequency distribution of p-values with a # an estimation of differentially expressed genes; Note that this estimation # is NOT based on the q-value calculations, but rather estimated from the # mean number of genes in the bins covering p-values larger than 0.5 count=1 for (i in seq(2,length(treatments.ttest[1,]),3)){ #jpeg(filename = paste("t-test_p-value_distr_trmt_",count,".jpg"), width = 1200, height = 1200) pdf(file = paste("t-test_p-value_distr_trmt_",count,".pdf"), width = 9, height=18, onefile = TRUE, family = "Helvetica", pointsize=18) hist.pvalue(treatments.ttest[,i],treatment.name=paste("treatment_",count)) dev.off() count=count+1 } ##5.5 Boxplots of Mean Signal Ratios## ###################################### #In: treatments.ttest source("http://treenomix0.forestry.ubc.ca/~arabidopsis/Function%20Repository/ratio.boxplot.txt") #usage (for sourced function): ratio.boxplot(x, chans, label, ylabel, colours) #x: a matrix or data frame that contains expression ratios in columns, # here, an automatic function takes the 1,3,5, etc... column of treatments.ttest # which contains the mean expression ratios of the treatments. #chans: a vector describing the columns of 'x' that contain the expression # ratios to be plotted, no default #label: text string to be plotted as title, default: label="log2 expression ratio" #ylabel:text string to be plotted as y axis label, default: ylabel="log2(treatment/control)" #colours: text string(s) that define the colour(s) of the boxplots #*** Plotting and Usage ***# #choose (JPEG or PDF by adding or removing '#' signs) #jpeg(filename = "Ratio_spread_between_treatments.jpg", width = 600, height = 800) pdf(file = "your_arrays_mean_ratio_spread.pdf", width = 2.5, height=8, onefile = TRUE, family = "Helvetica",pointsize=18) par(cex=0.6) mean.ratios=treatments.ttest[,seq(1,length(treatments.ttest[1,]),3)] ratio.boxplot(mean.ratios, chans=1:length(mean.ratios[1,]), label="normalized mean ratios", ylabel="log2(treatment/control)", colours=c("orange", "yellow")) dev.off() #Out: graphic  ###########6 Data Output################# ######################################### #In: matrices from chosen analyses  123  ##cbind all of the colnames which were generated up to this point #i.e. for #Gene ID..................all.int[,5] #ANOVA....................ANOVA.out (p.value, q.values, and Max fold change) #mean ratios and ttests...treatments.ttest (mean values, pvalues and q.values grouped by treatment) #Rel.SI rank..............rankings.trmt (mean rank across replicates for each channel, two values for each treatment) #Raw data.................all.int (F,S and B values for genes that were not removed during flag or # control removal steps). #Spot location............all.int (Metarow,metacolumn, row, column information is placed at the # end, out of the way #Make an output matrix with all the columns # check that the output.headers match the order # of output columns output=cbind( all.int[,5], # ANOVA.out, treatments.ttest, # rankings.trmt, all.int[,6:length(all.int[1,])], all.int[,1:4] ) #Assign the column names for the output file's header row # It is VERY important that the order and content # matches the above column arrangement. output.headers=c( "GeneID", # colnames(ANOVA.out), colnames(treatments.ttest), # colnames(rankings.trmt), colnames(all.int[,6:length(all.int[1,])]), colnames(all.int[,1:4]) ) colnames(output)=output.headers write.table(output,file="2005_03_24_Test_Data.txt",sep="\t",row.names = FALSE)  #END plot("2005_02_24_Test_Data.txt"(,6)) pdf(file = "t-test.pdf", width = 2.5, height=8, onefile = TRUE, family = "Helvetica",pointsize=18)  124  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0066209/manifest

Comment

Related Items