UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Synthesis of template-assembled nucleotide quartets Bare, Grant 2012

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
ubc_2012_fall_bare_grant.pdf [ 6MB ]
Metadata
JSON: 1.0062412.json
JSON-LD: 1.0062412+ld.json
RDF/XML (Pretty): 1.0062412.xml
RDF/JSON: 1.0062412+rdf.json
Turtle: 1.0062412+rdf-turtle.txt
N-Triples: 1.0062412+rdf-ntriples.txt
Original Record: 1.0062412 +original-record.json
Full Text
1.0062412.txt
Citation
1.0062412.ris

Full Text

SYNTHESIS OF TEMPLATE-ASSEMBLED NUCLEOTIDE QUARTETS   by  Grant Bare  Bachelor of Science Honours, University of Saskatchewan, 2004  A THESIS SUBMITTED IN PARTIAL FULLFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Chemistry)  UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  July 2012    © Grant Bare, 2012 ! ii Abstract   The thesis work described herein addresses a desire to isolate a guanine quartet and other unknown nucleobase quartets in Nature's solvent, water. Template-assembly of the nucleobase quartets or tetrads by the application of a cavitand template molecule was utilized as a synthetic strategy. Several synthetic precedents were sought and included developing DNA synthetic methodologies for four-fold nucleotide coupling of deoxyguanosine onto an individual substrate, imparting solubility in water on the resultant supramolecular constructs, and designing molecules capable of stabilizing G- quartet or G-tetrad self-assemblies.   Chapter 1 forms an introduction for this work by summarizing significant reports in the scientific literature on nucleic acid structure and function and on known template- assembled syntheses of nucleic acid elements. Chapter 2 describes the development of phosphite triester and phosphoramidite DNA synthetic methodologies for synthesizing water-soluble phosphate-linked cavitand-nucleotide conjugates. The synthesis of triazole- linked cavitand-guanosine conjugates with imparted water-solubility is dealt with in Chapter 3. In Chapter 4, evidence is provided for the observation of unimolecular cation- free template-assembled guanine and thymine quartets in methanol solvent using the phosphate-linked architecture. Finally, Chapter 5 describes the first potential isolation of a single G-tetrad in water through template-assembly directed by a phosphate-linked cavitand-nucleotide conjugate. This species is shown to interact with small molecule binders of G-quadruplex DNA and inhibitors of the human telomerase enzyme.  ! iii  The novel supramolecules synthesized in this thesis have been shown to assist in the discovery of unusual DNA based structures, to act as a minimal model of human telomeric G-quadruplex DNA, and to serve as artificial receptors for potential anticancer therapeutics.                    ! iv Preface   Parts of Chapter 3 were carried out in collaboration with Mehran Nikan and have been published elsewhere.1 The synthesis of compounds 16 from 11 and 19b from 16 was precedented by M. Nikan.2,3 Compounds 11-16 and 19b were also synthesized by the author. The published manuscript was written by the author, and all published 1H NMR and HRMS characterization of compounds numbered here as 11-16 were performed by the author.1 Characterization by 13C NMR for compounds numbered here as 11-16 for publication and writing of the experimental procedures appearing in the supplementary data were carried out in collaboration with M. Nikan. Design, synthesis, and characterization by 1H NMR, 13C NMR, and MS of the published water-soluble triazole- linked cavitand-guanosine conjugate numbered here as 19a was the sole work of the author. As well, the synthesis of compound 18 from 17 is novel to this author. All other work described in thesis chapters 2, 4, and 5 is original to the author and is unpublished.       (1) Nikan, M.; Bare, G. A. L.; Sherman, J. C. Tetrahedron Lett. 2011, 52, 1791-1793. (2) Nikan, M. Dissertation, University of British Columbia, 2009. (3) Nikan, M.; Sherman, J. C. unpublished results, 2010. ! v Table of Contents  Abstract..................................................................................................................ii Preface..................................................................................................................iv Table of Contents...................................................................................................v List of Tables.........................................................................................................ix List of Figures.........................................................................................................x List of Schemes..................................................................................................xvii List of Abbreviations...........................................................................................xviii Acknowledgments................................................................................................xxi   Chapter 1: Introduction...........................................................................................1  1.1 An Introduction to DNA structure: Unraveling the B-DNA Helix........1  1.2 A New Paradigm in DNA Structure: The Guanine Tetramer...........6  1.3 The "End-Replication Problem", Telomeres, Telomerase, and the    Connection to G-Quartet DNA...................................................10  1.4  Targeting Telomeres and Telomerase as a Novel Strategy for    the Development of Cancer Therapeutics......................................18  1.5 The Search for G-Quadruplex Binding Ligands..............................20  1.6 Towards Template-Assembled Guanine Tetrads and Guanine    Quadruplexes.................................................................................28 ! vi  1.7 Canonical Nucleobase Quartets not Based on Guanine................35  1.8 Thesis Aims....................................................................................36   Chapter 2: Synthesis of Phosphate-Linked Cavitand-Nucleotide Conjugates.....39  2.1  Synopsis.........................................................................................39  2.2  Synthetic Strategy..........................................................................40  2.3  Phosphite Triester Synthesis of Guanine Base Phosphate-Linked    Cavitand-Nucleotide Conjugates....................................................43  2.4  Phosphoramidite Synthesis of Phosphate-Linked Cavitand-    Nucleotide Conjugates of the Canonical Nucleobase Series.........48  2.5 Experimental Procedures...............................................................53  2.6 Supplementary 1H 1H COSY NMR Spectra....................................64   Chapter 3: Synthesis of Water-Soluble Triazole-Linked Cavitand-Guanosine Conjugates...........................................................................................................73  3.1  Synopsis.........................................................................................73  3.2  Synthetic Strategy..........................................................................74  3.3  Synthesis of Triazole -Linked Cavitand-Guanosine Conjugates.....75  3.4  Preliminary Characterization of Triazole-Linked Cavitand-    Guanosine Conjugates...................................................................79  3.5 Experimental Procedures...............................................................83  3.6 Supplementary 1H 1H COSY NMR Spectra ...................................90  ! vii Chapter 4: Discovery of Cation-Free Unimolecular Template-Assembled Guanine and Thymine Quartets in Methanol......................................................................94  4.1 Synopsis.........................................................................................94  4.2 Circular Dichroism of Phosphate-Linked Cavitand-Nucleotide    Conjugates at Feet Position...........................................................95  4.3 NMR Spectroscopy of Phosphate-Linked Cavitand-Nucleotide    Conjugates in Methanol ...............................................................104  4.4 Diffusion Ordered NMR Spectroscopy of Phosphate-Linked     Cavitand-Nucleotide Conjugates in Methanol ..............................110  4.5 The Role of Cations in Template-Assembly.................................114  4.6 Experimental Procedures.............................................................116   Chapter 5: Template-Assembled Isolation of a Guanine Tetrad in Water and its Application as an Artificial Receptor for G-quadruplex Binding Ligands............117  5.1  Synopsis.......................................................................................117  5.2 Template-Assembled Isolation of a Guanine Tetrad in Water......118  5.3 Structural Significance of an Isolated Template-Assembled Guanine   Tetrad in Water.............................................................................126  5.4 Application of a Water-Soluble Template-Assembled G-tetrad as an   Artificial G-quadruplex Binding Ligand Receptor..........................129  5.5 Experimental Procedures.............................................................136   ! viii Chapter 6: Thesis Summary and Conclusions...................................................138   References.........................................................................................................141                  ! ix List of Tables  Table 4.1 Diffusion coefficients, D for 7.1 mg/mL methanolic solutions of phosphate-linked    cavitand-nucleotide conjugates at 25 °C............................................................113                 ! x List of Figures ! Figure 1.1 a) The purine and pyrimidine nitrogeneous bases of DNA. b) Examples of the 2'-   deoxyribonucleosides: 2'-deoxycytidine and 2'-deoxyadenosine. c) A single    polynucleotide strand of DNA depicted in the 5'-3' sense......................................2 Figure 1.2! a) The double helical structure of B-form DNA proposed by Watson and Crick. b)    The A • T and G • C complementary Watson-Crick base pairs..............................3! Figure 1.3! A Hoogsteen type base pair between 1-methylthymine and 9-methyladenine......4 Figure 1.4 X-ray crystallographic structure of the B-DNA dodecamer d(CGCGAATTCGCG)    (PDB entry 1BNA) looking a) towards helical axis and b) down helical axis    modeled with UCSF Chimera, a visualization system for exploratory research and   analysis. (Pettersen E.F.; Goddard T.D.; Huang C.C.; Couch G.S.; Greenblatt    D.M.; Meng E.C.; Ferrin T.E. J Comput Chem. 2004, 25, 1605-1612). Important    ribose sugar conformations in DNA and RNA structure: c) N-glycosidic torsion    angles and d) sugar ring puckers...........................................................................5! Figure 1.5!! a) 5' and 3' guanosine monophosphates observed in gel formation. Structures    proposed by Gellert: b) G-tetrad and c) helical stack of G-tetrads.........................7 Figure 1.6! a) Various G-quadruplex strand topologies: a) four-stranded all parallel as in    Zimmerman's poly r(G) or Sen's immunoglobin switch region, b) intramolecular    antiparallel reported by Williamson for DNA strand d[(T4G4)4], and c)     antiparallel dimer reported by Sundquist for DNA strand d[(T2G4T2G4)2]. Helical    twist is not shown for simplicity. d) Alternating N-glycosidic conformations within    G-quartet plane of an antiparallel structure. Sodium cation is bound in-plane.    e) Coordination of potassium cation between G-quartet planes............................8 Figure 1.7! The end-replication problem: DNA replication of linear chromosome ends leads  ! xi   to a 3' overhang on the parent strand and a 5' gap on the daughter strand........11 Figure 1.8 The maintenance of Tetrahymena telomeres by telomerase enzyme requires    reverse transcriptase elongation and translocation activities...............................14! Figure 1.9 Solid-state and solution structures of DNA oligonucleotides containing telomeric    sequences: a) Oxytricha d[(G4T4G4)2] (PDB entry 1D59) b) Tetrahymena     d[(TG4T)4] (PDB entry 244D) c) human d[AG3(TTAG3)3] (PDB entry 143D) d)    human d[(TAG3TTAG3T)2] (PDB entry 1K8P) modeled with UCSF Chimera.......16 Figure 1.10 A potential strategy to develop G-quadruplex ligands into anticancer therapeutics:   The G-quadruplex binding ligand targets the G-rich 3'-overhang of the telomere,    stabilizes G-quadruplex DNA structures, and leads to cell growth arrest in the    tumor cell..............................................................................................................20 Figure 1.11! Some early G-quadruplex binding ligands derived from anthraquinone, acridine,    and perylene structures........................................................................................21 Figure 1.12 Crystal structure of a ligand-G-quadruplex complex depicting a BSU6039 ligand    (magenta) end-stacking to the terminal G-tetrad of an Oxytricha telomere G-   quadruplex (PDB entry B1L1) modeled with UCSF Chimera...............................23 Figure 1.13 Some G-quadruplex binding ligands based on the porphyrin structure...............24 Figure 1.14  Solution structure of a ligand-G-quadruplex complex depicting a TMPyP4 ligand    (magenta) end-stacking to the terminal G-tetrad of a human c-myc promotor !   G-quadruplex (PDB entry 2A5R) modeled with UCSF Chimera..........................26 Figure 1.15 Some natural product and natural product analogue derived G-quadruplex    binding ligands.....................................................................................................27 Figure 1.16 Template-assembled thymine adenine base pairs: a) intramolecular with     cyclodextrin template, b) intermolecular with crown ether template forming "DNA    box", and c) intermolecular with artificial dinucleotide complex...........................29 ! xii Figure 1.17  a) A di-functionalized deoxythymidine calixarene containing phosphate linkages.    b) Proposed thymine-thymine hydrogen bonding of trimer assembly..................30 Figure 1.18  A guanosine functionalized calixarene with alternate scaffold assembles into    intermolecular G-quartet based nanotubes in the presence of sodium................31 Figure 1.19  A cavitand based cation-free template-assembled G-quartet in chloroform that    dimerizes in the presence of cesium cation.........................................................32 Figure 1.20  Examples of template-assembled G-quadruplexes based on a) a tetra-end-linked   template and b) Mutter's template........................................................................34 Figure 1.21 A hydrogen bonded planar cation bound uracil tetrad and cation-free thymine    tetrad....................................................................................................................36 Figure 1.22  Aims of this thesis work included: 1. developing DNA synthetic methodologies for   the construction of a water-soluble template-assembled G-quartet, 2. probing    intermolecular association, cation binding, and G-quadruplex ligand binding, and    3. exploring analogous non-guanine nucleobase systems..................................38 Figure 2.1 Various depictions of alcohol functionalized cavitands..................................40 Figure 2.2 a) Michelson and Todd's synthesis of a thymine thymine dinucleotide. b)     Khorana's phosphate diester coupling methodolgy utilized in first total gene    synthesis. c) Letsinger's phosphite triester coupling approach. d) Beaucage's    original phosphoramidite procedure. Protecting groups: Ac: acetyl; An: anisoyl;    Bn: benzyl; Bz: benzoyl; DMT: 4,4'-dimethoxytrityl; MMT: 4-monomethoxytrityl;    TCE: 2,2,2-trichloroethyl......................................................................................42 Figure 2.3  31P NMR spectrum of silyl protected phosphoramidite 8d......................50 Figure 2.4 1H 1H COSY NMR spectrum of 3a in CD3OD at 400 MHz...................................65 Figure 2.5 1H 1H COSY NMR spectrum of 3b in CD3OD at 400 MHz...................................66 ! xiii Figure 2.6 1H 1H COSY NMR spectrum of 3c in CD3OD at 400 MHz...................................67 Figure 2.7 1H 1H COSY NMR spectrum of 3d in CD3OD at 400 MHz...................................68 Figure 2.8 1H 1H COSY NMR spectrum of 7 in D2O at 400 MHz..........................................69 Figure 2.9 1H 1H COSY NMR spectrum of 9a in CD3OD at 400 MHz...................................70 Figure 2.10 1H 1H COSY NMR spectrum of 9b in CD3OD at 400 MHz...................................71 Figure 2.11 1H 1H COSY NMR spectrum of 9c in CD3OD at 400 MHz...................................72 Figure 3.1 Strategy for a water-soluble TASQ analogue.......................................................75 Figure 3.2  Variable temperature 1H NMR spectra of 2mM solutions in D2O at 400 MHz for a)   diol 19a and b) isopropylidene 19b..............................................................82 Figure 3.3 1H 1H COSY NMR spectrum of 19a in (CD3)2SO at 400 MHz..............................91 Figure 3.4 1H 1H COSY NMR spectrum of 19a in D2O at 400 MHz......................................92 Figure 3.5 1H 1H COSY NMR spectrum of 19b in (CD3)2SO at 400 MHz..............................93 Figure 4.1  An exciton coupling interaction between electric transition dipoles (black) of two    adjacently stacked guanine bases in G-quadruplex DNA....................................96 Figure 4.2 Some potential exciton couplings in the two helical configurations of a single    nucleobase quartet...............................................................................................97 Figure 4.3 Nucleobase quartets for a) guanine (common), b) adenine (rare), c) thymine    (rare), and d) cytosine (not known)......................................................................98 Figure 4.4 Phosphate-linked cavitand-nucleotide conjugates at feet position.....................100 Figure 4.5 CD spectra of adenine conjugate 3b in methanol (red) and in 10 mM Tris-borate    pH 8 buffer (blue) and of blocked adenine conjugate 9b in methanol (green)...101 Figure 4.6 CD spectra of guanine conjugate 3a in methanol (red) and in 10 mM Tris-borate    pH 8 buffer (blue) and of blocked guanine conjugate 9a in methanol (green) and  ! xiv   in 10 mM Tris-borate pH 8 buffer (orange).........................................................102 Figure 4.7 CD spectra of cytosine conjugate 3c in methanol (red) and in 10 mM Tris-borate    pH 8 buffer (blue) and of blocked cytosine conjugate 9c in methanol (green)...103 Figure 4.8 CD spectra of thymine conjugate 3d in methanol (red) and in 10 mM Tris-borate    pH 8 buffer (blue)...............................................................................................104 Figure 4.9 1H NMR spectra in 9:1 CH3OH / CD3OD at 400 MHz for a) guanine conjugate 3a    at -25 °C, b) thymine conjugate 3d at 25 °C, and c) 5'-TBS-2'-deoxythymine at -   25 °C..................................................................................................................105 Figure 4.10 A C4 axis of symmetry is preserved between a) a single nucleobase quartet and    b) a template-assembled single nucleobase quartet..........................................107 Figure 4.11 a) Glycosidic bond syn conformation gives rise to NOE correlation between    guanine base and sugar protons. b) 2D NOESY spectrum in CD3OD at 400 MHz    for guanine conjugate 3a at -25 °C indicating syn conformation. Mixing time was    800 ms...............................................................................................................108 Figure 4.12 Observed ROE correlations in 2D ROESY NMR experiment in 9:1 CH3OH /    CD3OD at 400 MHz for thymine conjugate 3d at -15 °C. A ROESY spin-lock pulse   of 800 ms was used...........................................................................................109 Figure 4.13 Data points from a 2D DOSY NMR experiment in CD3OD at 400 MHz for a 7.1    mg/mL solution thymine conjugate 3d at 25 °C show the decay of signal intensity    as a function of gradient strength. Curve fitting (blue) gave a diffusion coefficient    of 2.72 × 10-10 m2s-1...........................................................................................112 Figure 4.14 Cartoon representations of unimolecular template-assembled nucleobase    quartets by guanine conjugate 3a (blue) and thymine conjugate 3d (red). The    cavitand (black) has its concave surface directed away from the quartet..........114 Figure 5.1 Phosphate-linked guanine based cavitand-nucleotide conjugates with unblocked  ! xv   residues at the rim position and blocked residues at the pendant position........119 Figure 5.2 CD spectra of 0.02 mM guanine conjugate 7 in methanol (red) and in 10 mM Tris-   borate pH 8 buffer (blue) and of blocked guanine 9a in methanol (orange) and in    10 mM Tris-borate pH 8 buffer (green)..............................................................120 Figure 5.3 Correlation of the Absorbance and CD spectra of guanine conjugate 7 in 10    mM Tris-borate pH 8 buffer................................................................................122 Figure 5.4 1H NMR spectra of guanine 7 in 9:1 H2O / D2O at 400 MHz for the a) imino region   and b) amino (black arrow) region with suppression of water by presaturation.123 Figure 5.5 a) Proposed G-tetrad assembly with syn glycosidic torsion angles for conjugate 7   indicating a NOE interaction between sugar and base protons. b) 2D NOESY    spectrum of 7 in H2O / D2O at 400 MHz and 5 °C with a mixing time of 800    ms......................................................................................................................124 Figure 5.6 CD spectra of 0.02 mM guanine conjugate 7 in 10 mM Tris-borate pH 8 buffer    (blue dashed) and in the presence of 50 mM NaCl (orange) or KCl (green)......126 Figure 5.7 Small molecule G-quadruplex binders and telomerase inhibitors used to     probe the receptor potential of guanine conjugate 7..........................................130 Figure 5.8 CD spectra in water of guanine conjugate 7 alone (blue), TMPyP4 ligand alone    (red), and 7 and TMPyP4 mixed (orange). Concentrations were 0.01 mM........131 Figure 5.9 CD spectra in water of guanine conjugate 7 alone (blue), PIPER ligand alone    (red), and 7 and PIPER mixed (orange). Concentrations were 0.01 mM...........132 Figure 5.10 Scatchard plot monitored at 422 nm for the titration of 5 μM TMPyP4 ligand with    guanine conjugate 7 in 10 mM Tris-borate pH 8, 0.1 mM EDTA. The slope and y-   intercept of the resultant fitted line were -8.5 and 12 respectively. An R2 value of    0.98 demonstrated good linearity of the data points..............................133 ! xvi Figure 5.11 Job plot for the binding of guanine conjugate 7 with TMPyP4 ligand in 10 mM    Tris-borate pH 8, 0.1 mM EDTA. The normalized change in absorbance at 436    nm is shown as a function of mol fraction of TMPyP4 for mixed solutions of 7 and   TMPyP4 with fixed concentration at 5 μM. 436 nm corresponds to the maximum    bathochromic shifted Soret band observed for bound TMPyP4.........................134 Figure 5.12 Bleaching plot for titration of 5 μM TMPyP4 ligand with guanine conjugate 7 in 10   mM Tris-borate pH 8, 0.1 mM EDTA monitored at 422 nm................................135 Figure 5.13 Cartoon representation of end-stacking of TMPyP4 ligand (orange) to the    exposed G-tetrad face (blue) of conjugate 7. The cavitand (black) has its concave   surface directed toward the quartet....................................................................136               ! xvii List of Schemes ! Scheme 2.1 Phosphite triester synthesis of guanine base cavitand-nucleotide conjugate at the   feet position..........................................................................................................44 Scheme 2.2 Synthesis of alcohol functionalized cavitand at rim position................................46 Scheme 2.3 Phosphite triester synthesis of guanine base cavitand-nucleotide conjugate at the   rim position...........................................................................................................47 Scheme 2.4  Preparation of silyl protected phosphoramidite reagents.....................................49 Scheme 2.5 Phosphoramidite synthesis cavitand-nucleotide conjugates at the feet position.51 Scheme 2.6 Phosphoramidite synthesis of guanine base cavitand-nucleotide conjugate at    rim position...........................................................................................................52 Scheme 2.7 Phosphoramidite synthesis of base-protected cavitand-nucleotide conjugate at    the feet position....................................................................................................53 Scheme 3.1 Synthesis of cavitand template...........................................................................76 Scheme 3.2 Nucleosides utilized in the synthesis of triazole-linked cavitand-guanosine    conjugates............................................................................................................78 Scheme 3.3 Synthesis of triazole-linked cavitand-guanosine conjugates................................80        ! xviii List of Abbreviations  1D  one-dimensional 2D  two-dimensional A   adenine Å   angstrom Ac  acetyl An  anisoyl Bn  benzyl br  broad Bu  butyl Bz  benzoyl C    cytosine CD  circular dichroism CE  2-cyanoethyl COSY  correlational spectroscopy d  doublet DCM  dichloromethane DEAE  diethylaminoethyl DIPEA N,N-diisopropylethylamine DMF  dimethylformamide DMSO dimethylsulfoxide ! xix DMT  4,4'-dimethoxytrityl DNA   deoxyribonucleic acid DOSY  diffusion ordered nuclear magnetic resonance spectroscopy EDTA  ethylenediaminetetraacetic acid ESI  electrospray ionization Et  ethyl GMP  guanosine monophosphate h  hour HRMS high resolution mass spectrometry i-Pr  isopropyl Ibu  isobutyryl IC50   inhibition concentration required for 50 % of  telomerase activity  m  multiplet Me  methyl min  minute MALDI-TOF matrix assisted laser desorption and ionization - time of flight MMT  4-monomethoxytrityl MS  mass spectrometry NOE  nuclear Overhauser effect NOESY nuclear Overhauser effect spectroscopy NMR   nuclear magnetic resonance PCR   polymerase chain reaction ! xx PDB  protein data bank ROESY rotating frame nuclear Overhauser effect spectroscopy  RNA   ribonucleic acid s  singlet rt  room temperature t  triplet T   thymine t-Bu  tert-butyl TASQ  template-assembled synthetic G-quartet TBAF  tetra-n-butylammonium fluoride TBS  tert-butyldimethylsilyl TCE  2,2,2-trichloroethyl TEA  triethylammonium TEAB  triethylammonium bicarbonate THF  tetrahydrofuran TRAP  telomeric repeat amplification protocol  Tris  tris(hydroxymethyl)aminomethane U   uracil UV / VIS ultraviolet / visible    ! xxi Acknowledgments   I would like to foremost thank my supervisor Professor John Sherman for the inspiration for this thesis project and for providing an opportunity to carry out this research in his laboratory. I would like to thank past and current group members for helpful discussion and support including M. Nikan, J. Freeman, and B. Hui. The technical expertise provided by the UBC NMR and mass spectrometry laboratories staff, including Zorana Danilovic, Maria Ezhova, Yun Ling, Marshall Lapawa, and David Wong, has been an invaluable service. Zorana Danilovic designed ROESY NMR programs for the characterization of compound 3d. Thank you to Brian Ditchburn for making many custom glassware pieces that made difficult synthetic steps manageable. Thanks goes to Bert Mueller of UBC Okanagan for performing all ICP-MS analysis. High resolution mass spectrometry of compound 19a was carried out by the mass spectrometry staff in the Department of Chemistry at the University of Alberta. Finally, I am grateful for financial support that NSERC has provided to me through several scholarships.        1 Chapter 1: Introduction   1.1 An Introduction to DNA structure: Unraveling the B-DNA Helix   Perhaps a no more fitting example exists than that of the structure of DNA for the observation that in Nature simplicity begets complexity. In a pair of now celebrated papers put forth by J.D. Watson and F.H.C. Crick in 1953 on how the polynucleotide strands of the salt of DNA could associate, the universal basis of molecular genetics for all known living organisms was revealed.1,2 At that time, the chemical constitution of DNA had already been recognized correctly as a polymer of 2'-deoxyribonucleosides connected through 3',5' phosphodiester linkages (Figure 1.1). The 2'- deoxyribonucleosides are a class of molecules composed from a D-ribose sugar attached at the C1' atom to the N1 or N9 atom of a respective pyrimidine or purine nitrogenous base in a β- configuration. In their model of what is now referred to as B-DNA or physiological DNA, Watson and Crick proposed that two antiparallel polynucleotide strands could associate non-covalently to form an asymmetric right-handed double helical structure with the nitrogenous bases lying perpendicular to the helical axis (Figure 1.2). The nitrogenous bases associated in one of two ways through hydrogen bonded complementary base paring. Only thymine could go with adenine, and only cytosine could go with guanine. The resulting helix repeated itself every 10 residues or 34 Å. Several observations were cited in the deduction of this structure. Chargaff had reported   2 Figure 1.1 a) The purine and pyrimidine nitrogeneous bases of DNA. b) Examples of the 2'-   deoxyribonucleosides: 2'-deoxycytidine and 2'-deoxyadenosine. c) A single    polynucleotide strand of DNA depicted in the 5'-3' sense.    that the molar ratio of thymine to adenine and cytosine to guanine in microbial DNA was close to unity.3 Guanine and thymine were assumed to exist exclusively in their more stable keto tautomeric forms. Finally, data from colleagues at Cambridge concerning the X-ray diffraction of DNA fibers was consistent with a two stranded helix.4,5  The solution to two mysteries of molecular genetics became immediately apparent from the proposal of the B-DNA model. Firstly, the belief that the sequence of bases was irregular suggested to them that the genetic information of an organism lies in its  O O P O O O O O P O O O base base O OH P O O O base P O O O O O base O 1' 2'3' 4' 5' N NN N H N N N NN N H N NHN N H NH NH N H N purine pyrimidine adenine guanine thyminecytosine NH2 NH2 O O O NH2 O 657 8 9 1 2 3 1 2 3 4 5 6 4 OHO OH N OHO OH N N N N N NH2 O NH2 β β a) c) b) 5'−3' 3 Figure 1.2 a) The double helical structure of B-form DNA proposed by Watson and Crick. b)    The A • T and G • C complementary Watson-Crick base pairs.    sequence of bases. Secondly, the complementary nature of the two strands of the DNA molecule provided a mechanism whereby each strand could in turn act as a template for its complementary strand allowing the exact duplication of the DNA molecule or the genetic information found within it. Thus, the simple model of DNA could now account for the tremendous diversity observed among known living organisms.  A structural proof of the B-DNA helix would prove to be elusive due in part to a lag in the development of DNA synthetic methodologies that were suitable for producing sufficient amounts of pure sequence for crystallization and X-ray analysis. High resolution X-ray crystallographic structures of 1-methylthymine and 9-methyladenine confirming the existence of a Watson-Crick base pair and the existence of an alternative pairing type referred to as Hoogsteen base pairing that involved hydrogen bonding at the non Watson-Crick face were known soon after Watson and Crick's proposal (Figure N N N N O O H N N N H H CH3 N N N N O N N O N H H NH H H major groove minor groove 5'−3' 3'−5' b)a) G • C A • T 4 1.3).6,7 However, a confirmation of the structure of Watson and Crick's B-DNA was not achieved until 28 years after its discovery.   Figure 1.3 A Hoogsteen type base pair between 1-methylthymine and 9-methyladenine.     The first single crystal structure of B-DNA was of a self-complementary dodecamer of sequence d(CGCGAATTCGCG) that incorporated the EcoRI restriction endonuclease site, GAATTC (Figure 1.4).8,9 This structure was found to be similar to the idealized B-form structure in many respects. It was a right-handed double helix with 10.1 base pairs per turn with a height of 3.4 Å per base pair. The N-glycosidic torsion angles were orientated anti as opposed to syn. Sugar pucker conformations were distributed closer to C2'-endo and not the C3'-endo conformation found in an A-form DNA helix. A departure from the classical B-DNA model was evident however from the observation that the Watson-Crick base pairs deviated from planarity and propeller-twisted in the crystal structure.    N N N N O OH3C H N N NH H3C CH3 H 5 Figure 1.4 X-ray crystallographic structure of the B-DNA dodecamer d(CGCGAATTCGCG)    (PDB entry 1BNA) looking a) towards helical axis and b) down helical axis    modeled with UCSF Chimera, a visualization system for exploratory research and   analysis. (Pettersen E.F.; Goddard T.D.; Huang C.C.; Couch G.S.; Greenblatt    D.M.; Meng E.C.; Ferrin T.E. J. Comput. Chem. 2004, 25, 1605-1612). Important    ribose sugar conformations in DNA and RNA structure: c) N-glycosidic torsion    angles and d) sugar ring puckers.                 a)! b)! OHO OH N HN O O OHO OH N NH O O OHO OH HN N N N O H2N OHO OH NH NN N O NH2 anti syn syn anti O base5' O 5' base 1' 2' 3' 4' 4' 3' 2' C2'-endo C3'-endo c) d) 6 1.2 A New Paradigm in DNA Structure: The Guanine Tetramer   It was known as early as 1910 that concentrated solutions of guanylic acid exhibited the peculiar property of gel formation.10 In 1962, Ralph and coworkers observed that DNA oligonucleotides containing three and four guanines and with a phosphate at the 5' position showed unusually stable secondary structure that was absent in the analogous oligonucleotides containing thymine, adenine, or cytosine.11 At the same time, Gellert reported that concentrated solutions of guanylic acid, specifically 5'-GMP and 3'-GMP, formed gels at pH 5 in the presence of sodium chloride salt.12 Based primarily on X-ray diffraction data and modeling studies inspired by Donohue's comprehensive investigation of base pairing in DNA polynucleotides, Gellert proposed that the remarkable properties of guanine shown thus far could be explained by the formation of hydrogen bonded planar guanine tetramers with four fold rotational symmetry (Figure 1.5).13 In this arrangement, the 2-amino hydrogen could donate one hydrogen bond to the 7-nitrogen of a neighboring residue, and the 1-imino hydrogen could donate one hydrogen bond to the 6-carbonyl oxygen of the same residue. Guanine is the only base to possess two sets of hydrogen bond donor-acceptor pairs oriented at near right angles with respect to each other. These planar guanine tetramers can stack favorably, and in the case of 5'-GMP, Gellert pointed out that the existence of a left- handed helix where each tetramer has a helical rotation of 22.5° and an axial translation of 3.25 Å would be consistent with the X-ray diffraction results.   The first direct evidence that polynucleotide strands could indeed assemble into helical structures of stacked guanine tetramers came from studies of RNA   7 Figure 1.5  a) 5' and 3' guanosine monophosphates observed in gel formation. Structures    proposed by Gellert: b) G-tetrad and c) helical stack of G-tetrads.    polynucleotides. A four-stranded model was suggested to explain the X-ray diffraction patterns obtained from salts of polyguanylic acid (Figure 1.6).14 In this model, four individual polynucleotide strands can be envisioned to associate through four in-plane hydrogen bonded guanine residues where each residue is donated by one of the four polynucleotide strands. A helix structure results with a helical rotation of 31.2° per tetramer. Certain stereochemical requirements needed to be satisfied in the proposed structure. Guanine residues needed to be oriented anti with respect to the glycosidic bond conformation, and the steric bulk of the 2' alcohol required that sugars adopt a C3'-endo conformation. Helical stacks of guanine tetrads either covalently linked as in the  OO N N N NH O NH2 OHO N N N NH O NH2 OHHO OH P O O HO O P OO HO N N N N O N R H H H NN N N O N R H H H N N N N O N R H H H N N N N O N R H H H a) c) b) 8 Figure 1.6 a) Various G-quadruplex strand topologies: a) four-stranded all parallel as in    Zimmerman's poly r(G) or Sen's immunoglobin switch region, b) intramolecular    antiparallel reported by Williamson for DNA strand d[(T4G4)4], and c)     antiparallel dimer reported by Sundquist for DNA strand d[(T2G4T2G4)2]. Helical    twist is not shown for simplicity. d) Alternating N-glycosidic conformations within    G-quartet plane of an antiparallel structure. Sodium cation is bound in-plane.    e) Coordination of potassium cation between G-quartet planes.   G G G G G G G G G G G G G G G G 5' 5' 5'5' 3' 3' 3' 3' G G G G G G G G G G G G 5' 3' G T T T T G T TG G T G G G G G G G G G G G G G T T G G G G T T 5' 3' 3' 5' T T T T a) b) c) N N N N O N H H H NN N N O NH H H N N N N O N H H H N N N N O N H H H O O O O Na+ anti anti syn syn O O OO O O OO K+ d) e) 9 case of Zimmerman's poly r(G) oligomers or non-covalently linked like Gellert's ribonucleosides are commonly referred to as G-quadruplexes.   The investigation by Henderson et al. in 1987 on the physical properties of synthetic DNA oligonucleotides containing the guanine rich telomeric sequences of several organisms, including the ciliated protozoans Oxytricha and Tetrahymena, by gel electrophoresis and NMR methods revealed guanine's potential in vivo significance.15 Although they did not go as far as to conclude the existence of guanine tetramers in these oligonucleotides, they did however provide evidence for the stabilization of intramolecular structures by non Watson-Crick guanine-guanine hydrogen bonded base pairs in the syn conformation. Shortly thereafter, Sen and Gilbert reported gel electrophoresis and N7 methylation experiments on single stranded DNA containing a guanine rich repeating motif found in the immunoglobulin switch region.16 It was concluded that under physiological salt concentrations, these strands were forming parallel four-stranded structures containing adjacent hydrogen bonded guanine tetrads resembling the model presented by Zimmerman for polyguanylic acid.   A further investigation of telomeric sequences found in Oxytricha and Tetrahymena by Williamson and coworkers showed that individual DNA oligonucleotides containing several repeats of these sequences could be induced in the presence of sodium, potassium, or cesium cations, but not lithium cations, to self-fold into a new type of antiparallel structure.17 In this antiparallel helix, strands alternate in sense and with respect to glycosidic torsion angle, such that in any guanine tetramer or "G-quartet" as they were coined, the residues will alternate between syn and anti. A binding site for the monovalent cation was proposed to be the G-quartet itself. The cation  10 selectivity was rationalized by the fact that lithium would be too small to fit in the center of the quartet, while sodium fit in plane and potassium and cesium fit out of plane. The observation that Tetrahymena telomeric DNA could also dimerize to form an antiparallel structure was reported by Sundquist.18 Sundquist further refined the cation binding model. For example, potassium was believed to sit between planes of G-tetrads such that it was coordinated to all eight carbonyl oxygens in an octahedral cage.    1.3 The "End-Replication Problem", Telomeres, Telomerase, and  the Connection to G-Quartet DNA   It was Watson, while studying the replication of linear viral T7 DNA together with the Russian biochemist, Olovnikov, who pointed out what is known to molecular biologists as the "end-replication problem" (Figure 1.7).19-21 During DNA replication, daughter strand synthesis by DNA polymerases was known to proceed in the 5'-3' direction by adding incoming nucleotides to an already existing 3'-OH on the daughter strand polynucleotide chain. The requirement for a 3'-OH substrate by the DNA polymerase was satisfied by the placement of RNA primers, for example those found in Okazaki's pieces, during the initiation of strand synthesis.22 However, it was realized that the removal of the terminal 5' RNA primer on either daughter strand by subsequent enzymatic degradation would give rise to a 5' gap and a 3' overhanging single strand. Thus, each round of replication of DNA would result in a progressively shorter   11 Figure 1.7 The end-replication problem: DNA replication of linear chromosome ends leads    to a 3' overhang on the parent strand and a 5' gap on the daughter strand.    chromosome end. Organisms containing circular DNA genomes such as those found in bacteria and in some viruses would be exempt from this end degradation process during DNA replication.   Elucidation of the structure and maintenance of the end or telomeric region of linear chromosomes was necessary to provide a solution to the end-replication problem. Telomeres can be defined as the DNA elements belonging to the end region of a linear 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' overhang / 5' gap duplex parent DNA linear end daughter strand synthesis initiation by RNA primers strand elongation by DNA polymerases completion of strand synthesis, removal of RNA primers lagging strand Okazaki pieces leading strand 12 chromosome that impart stability on the chromosome together with the proteins that are necessary to maintain these DNA elements.23, 24 Telomeres perform a protective function against chromosomal end degradation and end-end chromosomal fusion events, whereas in contrast, double-stranded breaks in chromosomes lead to instability.25   In 1978, Blackburn and Gall identified a hexanucleotide sequence, CCCCAA, in the protozoan Tetrahymena that was tandemly repeated 20 to 70 times at the termini of linear ribosomal DNA.26 Szostak and Blackburn shortly thereafter reported the construction of a stable linear yeast plasmid after attaching a fragment containing the  Tetrahymena terminal ribosomal DNA hexanucleotide repeat to the ends of a yeast chromosome.27 Astonishing was the observation that the yeast cellular machinery was able to recognize and elongate the Tetrahymena sequence with a distinct yeast telomeric sequence. Thus, the Tetrahymena hexanucleotide repeat not only represented a stable telomere, it also suggested that telomeres were highly conserved in evolution between two distantly related organisms like a protozoan and yeast.  The discovery of telomere terminal transferase or telomerase activity in Tetrahymena extracts helped to provide further insight into the mechanism of telomere elongation.28 A telomere elongating enzyme that could catalyze the addition of the Tetrahymena telomere repeat TTGGGG of the G-rich strand onto an appropriate substrate had now been identified. The fact that only synthetic single stranded DNA primers containing the G-rich strand tandem repeats and not the C-rich repeats of the Tetrahymena and yeast telomeres, and that only dGTP and dTTP could act as substrates for the Tetrahymena extracts demonstrated that the G-rich strand was the functional telomere strand. The G-rich strand of the telomere has always been found to be oriented  13 in the 5'-3' sense toward the end of the chromosome and to form a 3' overhang beyond the C-rich strand for a wide range of eukaryotic organisms.24 Tetrahymena telomerase was identified as a ribonucleoprotein complex29 with an internal RNA template30 of sequence CAACCCCAA complementary to the G-rich telomere sequence essential for activity. Furthermore, the identification of an internal template suggested a mechanism for telomerase function where single-stranded telomere elongation could proceed by alternating rounds of reverse transcriptase-catalyzed elongation in the standard 5'-3' direction and translocation of the telomerase enzyme on the 3' overhang telomere substrate (Figure 1.8).   The human telomere is found to contain approximately five to fifteen kilobases of the repeating sequence TTAGGG, a sequence that is conserved in vertebrates, and to consist of atypically long 3' overhangs of the G-rich strand.31,32 For example, Makarov reported 3' overhangs with average lengths of approximately 100 to 200 nucleotides in human telomeres.33  Human telomerase like the telomerase identified beforehand in Tetrahymena is a ribonucleoprotein complex with a complementary internal RNA template.17,34 The enzyme uses its 11 nucleotide template with sequence CUAACCCUAAC to elongate the G-rich 3' overhang substrate by successively adding TTAGGG units through its reverse transcriptase and translocase activities. Many proteins are found to be associated with human telomeres in addition to telomerase, and some of these proteins are necessary for proper function of human telomeres. Among them is the widely studied shelterin complex, a six subunit telomere binding protein that imparts stability on the telomere.35,36  14 Figure 1.8 The maintenance of Tetrahymena telomeres by telomerase enzyme requires    reverse transcriptase elongation and translocation activities.     The existence of the repeating guanine run sequence motif in the 3' overhanging strand of all studied telomeres is not accidental. Synthetic DNA oligonucleotides comprising the telomere repeating sequences of ciliated protozoans and of humans have CCCCAACCCCAACCC  5' GGGGTTGGGGTTGGGGTTGGGGTTGGGG  3' 5'  AACCCCAAC  3' CCCCAACCCCAACCC GGGGTTGGGGTTGGGGTTGGGGTTGGGGTTG AACCCCAAC CCCCAACCCCAACCC GGGGTTGGGGTTGGGGTTGGGGTTGGGGTTG AACCCCAAC CCCCAACCCCAACCC GGGGTTGGGGTTGGGGTTGGGGTTGGGGTTGGGGTTG AACCCCAAC elongation translocation elongation tetrahymena telomere telomerase enzyme 15 been demonstrated in vitro to form G-quadruplex structures in the solid-state through high-resolution X-ray crystallography and in the solution-state by NMR methods (Figure 1.9). The first high-resolution X-ray crystal structure of a G-quadruplex was that published by Kang and coworkers for the Oxytricha telomere oligonucleotide d(GGGGTTTTGGGG).37 The four-stranded antiparallel quadruplex structure was formed by dimerization of two hairpin-forming thymine-looped oligonucleotides. Glycosidic bond conformations were found expectedly to alternate between syn and anti within the guanine quartet. However, novel to all proposed models of G-quadruplex DNA, was the presence of alternating syn / anti conformations within the chains. Evidence for coordination of a potassium cation in-center but off-plane relative to the guanine tetrad was also presented. A short oligonucleotide containing the Tetrahymena telomere repeat, d(TGGGGT), also was crystallized into G-quadruplex DNA.38 The resulting right-handed tetrameric structure was found to contain all parallel strands and anti glycosidic torsion angles. All but one sodium cation was coordinated with the eight carbonyls between two planes of guanine quartets.  The earliest report of a human telomere structure was by Wang et al. for solving the solution structure of d[AGGG(TTAGGG)3] by NMR and molecular dynamics. 39 In the presence of sodium, an intramolecular G-quadruplex with three stacked G-tetrads and connected through TTA loops was elucidated. The right-handed twisted helix revealed asymmetrical grooves, parallel / antiparallel / antiparallel / parallel folding topology, and C2'-endo sugars with syn / anti / anti / syn conformations. A decade later, the same oligonucleotide in addition to a shortened variant with sequence d(TAGGGTTAGGGT)   16 Figure 1.9 Solid-state and solutions structures of DNA oligonucleotides containing telomeric    sequences: a) Oxytricha d[(G4T4G4)2] (PDB entry 1D59) b) Tetrahymena     d[(TG4T)4] (PDB entry 244D) c) human d[AG3(TTAG3)3] (PDB entry 143D) d)    human d[(TAG3TTAG3T)2] (PDB entry 1K8P) modeled with UCSF Chimera.  a)! b)! c)! d)! 17 were crystallized.40 Consistent with the solution structure beforehand was an intermolecular twisted three-layered quadruplex with C2'-endo sugar puckers. The shortened strand made an intermolecular dimer, but shared the same structural features of the longer strand. Dramatic differences in folding topology were observed however in the solid-state. An all parallel all anti structure was apparent with unique propeller loops connecting adjacent chains. Potassium cations were coordinated to eight carbonyls in the predicted bipyramidal antiprismatic fashion.  Direct in vivo evidence for G-quadruplex DNA in the genome of eukaryotic organisms has proved to be all but elusive. Representative work is given from the study of the interaction of G-quadruplex specific antibodies with DNA inside the cell nucleus. Immunofluorescence was observed when in vitro generated antibodies specific to G- quadruplex formed from the telomere of hypotrichous ciliated protozoan, d(TTTTGGGG), were reacted with the macronuclei of Stylonychia lemnae.41  Sequences of DNA with G-quadruplex forming potential are not unique to the telomere regions in genomic DNA. Huppert has proposed that G-quadruplex-forming motifs are prevalent in the human genome outside the telomeres and are localized to over 40 % of gene promoter regions.42 Moreover, promoter G-quadruplex structures are believed to be involved with the control of gene transcription. The promoter of the human oncogene c-myc is the most widely studied of these types of promoter regions. Formation of G-quadruplex by c-myc promoter elements in vitro,43 and the transcriptional suppression and activation of the c-myc gene by respective G-quadruplex stabilizing and destabilizing conditions has been reported.44, 45    18 1.4 Targeting Telomeres and Telomerase as a Novel Strategy for  the Development of Cancer Therapeutics   It has been known for over a half-century that normal human cells have a finite capacity for dividing under laboratory conditions. Pioneering work undertaken by Hayflick demonstrated that many strains of human fibroblasts degenerate after approximately 50 cultivations or one-year of storage, and that this degeneration or cellular senescence as it was called has an intrinsic cellular origin.46 The connection between cellular aging and cancer processes to telomere maintenance was not made until several decades following Hayflick's analysis. In 1990, Harley showed that telomere shortening could be correlated to the age of human fibroblasts.47 Soon after, certain cells were observed to become immortalized following their entry into a crisis state after their telomeres had become sufficiently shortened due to excessive doublings.48 The overexpression of telomerase activity was found in these immortalized cells, whereas no significant telomerase activity was found in control cells.   A rigorous investigation of telomerase activity over a wide range of human cell types by Kim and coworkers has produced the most comprehensive results linking telomerase activity to cancer and aging to date.49 Human cultured cell samples representing 18 tissue types were assayed for telomerase activity to establish a relationship between telomerase and cell mortality. Ninety-eight percent of immortal cell samples gave positive results for telomerase activity, while none of the mortal cell samples did. The relationship between telomerase and cancer was equally convincing. An  19 astonishing 90 % of samples made up of 12 different human tumor types showed telomerase activity, while none of the 50 normal somatic tissue samples showed activity.    These results provided a rationale for targeting the telomerase enzyme as a potential treatment against cancer. A strategy of inducing G-quadruplex stabilization in the telomere in order to inhibit telomerase activity and subsequent human tumor growth was envisioned (Figure 1.10).50 In the presence of G-quadruplex stabilizing ligands, the now folded telomere could be imagined to lose its function as an active substrate for the enzyme. This targeting of the telomerase substrate constitutes an independent mechanism of telomerase inhibition compared to the more classical approach of designing direct inhibitors of the active site. The latter classical approach is exemplified by the design of a complementary strand of peptide nucleic acid that targets the telomerase's RNA template in order to block reverse transcription.51 This earlier method has now been largely superseded by the pursuit of finding G-quadruplex ligands for sequestering the single stranded 3'-overhang telomere substrate. A proof of principle was achieved when the G- quadruplex interacting agent, BSU1051, was shown to inhibit human telomerase.52    20 Figure 1.10 A potential strategy to develop G-quadruplex ligands into anticancer therapeutics:   The G-quadruplex binding ligand targets the G-rich 3'-overhang of the telomere,    stabilizes G-quadruplex DNA structures, and leads to cell growth arrest in the    tumor cell.     1.5 The Search for G-Quadruplex Binding Ligands   An explosion of interest in developing G-quadruplex ligands as potential telomerase inhibitors followed the BSU1051 precedent and has kept up for over a TTAGGGTTAGGGTTAGGGTTAGGTTAGGGTTAG AATCCCAATCC  5' duplex region ~ 5-15 kilobases single-stranded 3' overhang ~ 100-200 nucleotides elongation G-quadruplex binding ligand TTAGGGTTAGGGTTAGGGTTAGGTTA AATCCCAATCC  5' G G G G G G G G G G G G inhibition of elongation telomerasehuman teleomere 3' 21 decade.53-61 Common structural themes are apparent in many of the G-quadruplex ligands (Figure 1.11). A large planar aromatic core provides a favorable surface on which G-  Figure 1.11 Some early G-quadruplex binding ligands derived from anthraquinone, acridine,    and perylene structures.    N H O O H N N H O O N NHO OH BSU1051 N H O N H O H N H N 3,6-disubstituted acridine N H N H O N H O NN HN N H H BRACO19 N N O O O O N N H H PIPER 22 tetrads can π-π stack. Flexible side arms that have a potential to hold a positive charge are able to form favorable electrostatic interactions with negatively charged quadruplex phosphate groups. This is often accomplished by the presence of tertiary amines, which will be protonated under physiological pH in aqueous solution, or by the use of quaternary ammonium groups that hold an intrinsic positive charge. Cationic side groups can also enhance water-solubility that may be compromised by the nonpolar hydrophobic core. It is observed that end-stacking of ligands to the exposed face of the terminal G- tetrad is an important mode of interaction for many of the G-quadruplex binding ligands with the quadruplex.   A series of 3,6-disubstituted and 3,6,9-trisubstituted acridine derivatives were developed inside Stephen Neidle's laboratory in addition to the structurally related 2,6- diamidoanthraquinone, BSU1051. Both classes share a tricyclic electron deficient aromatic core with amide linked cationic ammonium groups. A first generation 3,6- disubstituted model compound inhibited telomerase elongation approximately 10 times better than BSU1051, with an IC50 of 1.3 µM relative to the IC50 of 23 µM found for BSU1051.62 In the case of BRACO19, another order of magnitude of enhanced telomerase inhibition was afforded after an additional substitution at the 9 position.63 BRACO19 also demonstrated potent in vivo and in vitro antitumor activity. A crystal structure of a complex between the acridine, BSU6039, and an Oxytricha telomere G- quadruplex showed the ligand to be end-stacked (Figure 1.12).64  Another first generation G-quadruplex ligand is the perylene diimide, PIPER.65 This ligand was shown to quantitatively inhibit telomerase activity at 100 µM concentrations. Spectroscopic evidence also provided information about ligand-  23 Figure 1.12 Crystal structure of a ligand-G-quadruplex complex depicting a BSU6039 ligand    (magenta) end-stacking to the terminal G-tetrad of an Oxytricha telomere G-   quadruplex (PDB entry B1L1) modeled with UCSF Chimera.    quadruplex complex formation. Both intercalation and terminal guanine quartet end- stacking binding modes were presented for different human telomere derived G- quadruplexes.  Cationic porphyrins are a class of G-quadruplex ligands that have received considerable attention (Figure 1.13). The most heavily studied of these is TMPyP4, which was rationalized as a potential G-quadruplex ligand due to it having a planar structure with comparable size to the G-tetrad as well as having cationic quaternary aromatic   24 Figure 1.13 Some G-quadruplex binding ligands based on the porphyrin structure.    N HN NH N N N N N N HN NH N N N N N TMPyP4 TMPyP3 N N HN N N NH N N N N N N 3,4-TMPyPz N N N N Mn HN HN NH NH O N O O O N N N pentacationic manganese (III) porphyrin 25 ammoniums.66,67 Binding constants as high as 106 M-1 have been determined from optical studies,68 and a telomerase IC50 of 6.5 µM was measured.67 These ligands initially showed good selectivity over duplex DNA, and this selectivity has been dramatically improved in later generations of porphyrins.66 For example, the pentacationic manganese (III) centered metalloporphyrin is a 10000 fold increase more selective for G-quadruplex than duplex DNA.69 Preference for binding to different G-quadruplex strand topologies is also of interest in the context of the development of cancer therapeutics since different topologies may be involved in vivo. The analogue, TMPyP3, was shown to exclusively promote G-quadruplex formation in parallel stranded structures over the TMPyp4 and TMPyP2 variants.70 In contrast, the porphyrazine, 3,4-TMPyPz can induce the formation of antiparallel human telomere G-quadruplexes.71 Debate existed in the early literature over whether the preferred mode of interaction for TMPyP4 was intercalative or end- stacking but this debate has largely been resolved with the conclusion that both modes are important. Phan reported the NMR based solution structure of a complex with a c-myc promoter G-quadruplex that showed an exclusive end-stacking arrangement (Figure 1.14).72 Alternatively, Wei et al. reported that end-stacking was favored for a parallel stranded G-quadruplex topology, but that intercalation was favored for dimer hairpin and intramolecularly folded topologies.73  Known ligands that bind to G-quadruplex DNA are not limited to synthetic molecules, and in fact, one of the most potent telomerase inhibitors, telomestatin, belongs to the natural product family (Figure 1.15). Telomestatin isolated from Streptomyces anulatus is an uncharged macrocycle of seven consecutive oxazole rings and a lone thiazoline ring.74 It has been shown to have one of the lowest IC50 against telomerase at   26 Figure 1.14  Solution structure of a ligand-G-quadruplex complex depicting a TMPyP4 ligand    (magenta) end-stacking to the terminal G-tetrad of a human c-myc promotor    G-quadruplex (PDB entry 2A5R) modeled with UCSF Chimera.   0.005 µM. Furthermore, no measurable inhibition of DNA polymerase or reverse transcriptase was found. Proof of interaction with an antiparallel intramolecular human telomeric G-quadruplex75 and of inhibition of cell growth towards human leukemia cells76 has been demonstrated. Of note, is that a multi-step convergent total synthesis of telomestatin has been reported and was based on the strategy of forming the hydrolytically labile thiazoline ring during the final stage.77 Total synthesis of a natural product like telomestatin represents synthetically a significantly more demanding task than that for conventional synthetic ligands.    27 Figure 1.15 Some natural product and natural product analogue derived G-quadruplex    binding ligands.     The plant alkaloid berberine is an additional natural product of interest for the development of anticancer agents. The singly charged five-fused ring molecule is a known moderate inhibitor of telomerase.78 Derivatization and aromatization to the semi- synthetic analogue, coralyne, resulted in improvements in telomerase inhibition, G- quadruplex affinity, and G-quadruplex selectivity over double-stranded DNA with respect to berberine.79  All but a few of the IC50 values towards human telomerase reported for the various ligands were measured by the telomeric repeat amplification protocol (TRAP) assay first developed by Kim and coworkers49 or by a modified TRAP assay such as Gomez's.80 De Cian and colleagues have proposed a reevaluation of the inhibition of telomerase due to intrinsic flaws of the TRAP assay.81 The telomerase inhibitory action of G-quadruplex ligands may be exaggerated in the polymerase chain reaction (PCR) based TRAP assay compared to direct measure methods, because G-quadruplex ligands are more capable inhibitors of telomere amplification rather than elongation. This O N NO S N N O N O O N N O O N CH3 CH3 telomestatin N O O H3CO OCH3 N H3CO OCH3 OCH3 OCH3 berberine coralyne 28 suggests that the mechanism of action of G-quadruplex ligands to arrest cell proliferation in many immortalized and tumor cells may involve a fundamentally different mechanism less dependent on the telomerase enzyme.    1.6 Towards Template-Assembled Guanine Tetrads and Guanine  Quadruplexes   The concept of using a covalent template to preorganize multiple nucleic acid elements for intramolecular and intermolecular self-assembly has its origins in the simple linkage of nucleobases to cyclodextrins, crown ethers, and polycyclic aromatics (Figure 1.16). Generation of an intramolecular hydrogen bonded complementary base pair from a β-cyclodextrin bifunctionalized with thymine and adenine nucleobases was reported by Nagai.82 Adenine's propensity to form intramolecular base pairs with thymine and uracil has also been investigated by the construction of "DNA boxes" from alkyl linked crown ethers and by the synthesis of artificial dinucleotide complexes from palladium cross couplings of protected nucleosides with polycyclic templates.83-86   The driving force for template-assembled synthesis of nucleic acid elements, such as for the previous examples of synthetic hydrogen bonded base pairs, lies in the thermodynamic principle of entropy, and is analogous to the concept used in the creation of synthetic templated proteins.87 Covalent templates function to remove translational and rotational degrees of freedom from the free recognition elements thereby making the   29 Figure 1.16 Template-assembled thymine adenine base pairs: a) intramolecular with     cyclodextrin template, b) intermolecular with crown ether template forming "DNA    box", and c) intermolecular with artificial dinucleotide complex.    O OO S O O O O OO OO O O O O O O O OO O OH O O O O OH O O O O O S O N NN N O O H N N NH H H3C H H H H H H H H H HHH H H H H H N O O N O O N N N N O O H N N N H H CH3 N N N N O O H N N N H H CH3 N O O N O O N N N N O O H N N N H H R R N NNN O O H NH H R R N N O O O O O O O R = a) b) c) 30 absolute value of the entropically disfavored assembly process smaller for a templated system as compared to a template-free system. A thermodynamically stabilized templated system results, whereas self-assembly of the free recognition elements would not be expected to be thermodynamically feasible.  Calix[4]arene templates have received considerable attention for the self- assembly of nucleobases. Deoxythymidine residues have been attached via phosphate linkages (Figure 1.17).88 The resulting bis-coupled nucleotide-calixarene conjugate was proposed to self-assemble through thymine-thymine mediated hydrogen bonding into a termolecular supramolecule. Davis's laboratory has investigated the functionalization of calix[4]arene-1,3-alternate scaffolds with modified guanosine nucleosides in an effort to design artificial ion channels (Figure 1.18).89,90 Cation stabilization of intermolecular G- quartets facilitated the creation of nanotubes and a lipophilic ion-pair receptor from these constructs.  Figure 1.17  a) A di-functionalized deoxythymidine calixarene containing phosphate linkages.    b) Proposed thymine-thymine hydrogen bonding of trimer assembly.  OO OO OO OHO N NH O O OHO N NH O O P P O O HO O OHO N N OO H N NO O H NN O O H N N O O H N N O O H N N O O H a) b) 31 Figure 1.18  A guanosine functionalized calixarene with alternate scaffold assembles into    intermolecular G-quartet based nanotubes in the presence of sodium.     The cavitand, another prevalent structure used by synthetic chemists to control non-covalent interactions, has found use in the synthesis of a template-assembled cation- free G-quartet (Figure 1.19).91 In comparison to Davis's calixarene template, the rigid cavitand facilitated preorganization on one face of the template. Intramolecular G-quartet formation was observed accordingly. In the presence of cesium cation, tuning of the unimolecular species into dimeric structures was afforded.92 It should be noted that the guanosine coupled calixarenes and cavitands described thus far share a common chemical limitation in that they are lypophilic chloroform soluble systems. It is a goal of the synthetic chemist interested in the bottom-up design of minimal models of telomere-like G-quartets and G-quadruplexes to impart water-solubility on such systems. Water-soluble  OO O O O NN N H NO NH2 O NHO O O O NN N N H O NH2 NH O O OO O N N N N H O H2N HN O O O N N N H N O H2N HN O O NaBPh4 G G G G Na+ G G G G Na+ G G G G Na+ Na+ 32 Figure 1.19  A cavitand based cation-free template-assembled G-quartet in chloroform that    dimerizes in the presence of cesium cation.    O OO O O O O O RR R R O O N NN N N O NH2 O O N N H O ON N N N N O NH2 O O NN H O O N N N N N O H2N O O N N H O O NN N N N O H2N OO N N H G G GGCHCl3 Cs + Cs+ 33 synthetic guanine tetrads may be beneficial to the understanding of in vivo processes involving the telomere and may aid in the discovery of the anticancer potential of G- quadruplex binding ligands.  The role of templates in G-quadruplex formation was first explored with the solid- phase phosphoramidite synthesis of tetra-end-linked oligonucleotides (Figure 1.20).93,94 Control of G-quadruplex topology with the use of non-nucleotidyl linkers of varied length and orientation proved to be ineffective as all template G-quadruplexes preferred a parallel strand association.95 Tetra-end-linked G-quadruplexes demonstrated application as an anti-HIV aptamer.96 A parallel template assembled G-quadruplex was also achieved after the oxime-based coupling of G-rich oligonucleotides to Mutter's cyclic peptidic scaffold.97 Various G-quadruplex ligands were shown to interact with this peptidically templated G-quadruplex.98           34 Figure 1.20  Examples of template-assembled G-quadruplexes based on a) a tetra-end-linked   template and b) Mutter's template.    G G G G G G G G G G G G G G G G T T T T T T T T HO P O O O P O O O P O O O O O O O oligo oligo oligo oligoO O O non-nucleotidyl tetra-end linker a) b) Gly Lys Lys Lys Pro Pro Lys Ala Lys Gly biotin A A A G G G G G G G G G G G G A T T T T T T T T T T T T O O O O OO O OO O O N N N O N 35 1.7 Canonical Nucleobase Quartets not Based on Guanine   In relation to guanine, hydrogen bonded tetrads or quartets built from the other canonical nucleobases of DNA or RNA are rare. Of those reported, uracil tetrads are the most frequently encountered (Figure 1.21). The first being the report of a U-quartet terminating the parallel tetramolecular RNA G-tetraplex of r(UGGGGU) strand sequence.99 The existence of such a novel structure was hinted at from the observation of a downfield uracil imino signal in the 1H NMR spectrum in water. Crystal structures have corroborated the assembly of U-quartets in the same RNA tetraplex100 and from the free base when coordinated in a platinum complex.101 Tetrads of uracil in all but a few cases belong to nucleoside residues in G-quadruplex forming oligonucleotide strands. Thus, it may be assumed that G-quadruplex scaffolds must be U-quartet stabilizing, however the opposite case has been shown to be true.102 A cavitand template-assembled synthetic U- quartet has also been demonstrated.103 Similar to the uracil tetrad imbedded quadruplexes, is a G-quadruplex structure terminating in a thymine quartet, which had been deduced by NMR studies.104 Several reports exist proposing stabilized A-tetrads as part of adjacent G-quadruplex structures.105,106 Evidence for a bona fide cytosine hydrogen bonded tetrad is lacking.    36 Figure 1.21 A hydrogen bonded planar cation bound uracil tetrad and cation free thymine    tetrad   1.8 Thesis Aims   The global aim of this thesis work was established almost five years ago with the concept of connecting four guanine nucleosides onto a cavitand substrate in order to create a molecule that was not only water-soluble, but that could template assemble a guanine quartet in an aqueous environment (Figure 1.22)! At the time that this project was undertaken, there were no known precedents of synthetic methodologies used for four-fold covalent couplings of guanine nucleotides on a single molecule. Nor were there even any known water-soluble substrates bearing four guanine bases. It was an intention from the start to make the potential water-soluble template-assembled guanine-cavitand construct to be the most DNA-like possible. This intention served two purposes. First, it narrowed down the synthetic strategy used for the target molecule to those tried and true reactions pioneered for the chemical synthesis of DNA, like the phosphite triester and N N O N N O O H O H H3C H3C N N O N N O O H O H CH3 CH3 N N O N N O O H O H N N O N N O O H O H U-tetrad T-tetrad M+ 37 phosphoramidite reactions used herein, and secondly, it sought to improve the in vivo significance of the final construct. In the context of a bottom-up synthesis of a minimal model of telomere DNA, working in Nature's solvent and making use of proper DNA elements like the correct phosphate linkages seemed advantageous.   Questions arose as work progressed, and these questions were used as a guide to further research. Is it possible to solubilize four guanosine residues and a template in water? What water-solublizing groups should be chosen, how many groups are needed, and where will they go? Are there reactions and templates chemically efficient enough to couple four residues with? How will the complex mixture of diastereomers formed after the coupling synthetic step be handled, deblocked, characterized, and finally purified to arrive at the pure target molecule? Could a G-quartet exist in water in the absence of cation stabilization? Could a free unimolecular G-quartet face be created, and could this face act as an artificial receptor for G-quadruplex binding ligands? How energetically feasible is it to form template assembled nucleobase quartets of the other canonical bases? Could these systems described here have practical application towards the study of G-quadruplex binding ligands as novel anticancer therapeutics? It is the hope of the author that solutions to questions like these will have been provided in the following chapters.        38 Figure 1.22  Aims of this thesis work included: 1. developing DNA synthetic methodologies for   the construction of a water-soluble template-assembled G-quartet, 2. probing    intermolecular association, cation binding, and G-quadruplex ligand binding, and    3. exploring analogous non-guanine nucleobase systems.        OO O OO O O O R' R'R' R' H H RR R R H H G G GG G G M+ M+ G G GG G G GG G G GG O N N N NH O NH2 HO HO N HN NH N N N N N G G GG P P P P G G cavitand template DNA synthesis??? O P HO O O deoxyguanosine water-solublizing groups? cation free G-quartet? cation bound G-quartet? G-quartet dimerization? G-quadruplex ligand receptor T T T T other nucleobase quartets? 39 Chapter 2: Synthesis of Phosphate-Linked Cavitand-Nucleotide Conjugates   2.1  Synopsis   The phosphite triester methodology for DNA synthesis was applied in the construction of tetra-coupled guanine based cavitand-nucleotide conjugates linked through natural 3' phosphate diesters. This synthesis represents an early example of a water-soluble substrate covalently bound with four guanine bases and the first template coupled to four deoxyguanosine residues through natural phosphate linkages. A novel alcohol rim functionalized cavitand was used in the construction of one of the cavitand- nucleotide conjugates. The phosphoramidite methodology for DNA synthesis was similarly applied. A class of silyl ether protected phosphoramidite reagents of the canonical deoxynucleoside series was developed for use in the synthesis of tetra-coupled cavitand-nucleotide conjugates. In addition, the phosphoramidite approach allowed a route to the synthesis of base-protected cavitand-nucleotide conjugates. The synthesis herein was designed with the goals in mind of synthesizing a water-soluble template- assembled guanine quartet as a potential simplified model of G-quadruplex telomere DNA or as an artificial G-quadruplex binding ligand receptor and of discovering non- guanine based template assembled nucleobase quartets.   40 2.2  Synthetic Strategy   A strategy was envisioned towards the synthesis of a water-soluble template assembled guanine quartet. Various molecular structural requirements were incorporated into this strategy with the foresight that such a template assembled system could act as a minimal design for telomeric G-quadruplex DNA or as a receptor for G-quadruplex binding ligands. The [4]cavitand was selected as a suitable supramolecular template (Figure 2.1). The bowl shaped cavitand is rigidified through acetal bridges preventing   Figure 2.1 Various depictions of alcohol functionalized cavitands.  O CH3 O HoutHin OH 4 O OO O O O O O H3CCH3 CH3H3C O O O O OH OH HO HO O OO O O OOO HH CH3 CH3CH3H3C OH HO HO OH HH O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 HO HO OHOH rim feet rim feet 41 undesirable bond rotations and flexibility and possesses a four-fold proper axis of rotation symmetry element like that found in the planar G-tetrad. The ability of a cavitand to pre- organize a guanine and an uracil nucleoside quartet on one face has been demonstrated in a nonpolar organic solvent.103,91  Coupling four guanine nucleotides through phosphate linkages to a single substrate had been unprecedented, and already established methodologies for the chemical synthesis of DNA were drawn upon as a means to accomplish this synthetic challenge. Application of existing methodologies would be advantageous in creating a target molecule that would have high "DNA-like" character by incorporating 2'- deoxynucleosides attached through a potentially water-solubilizing natural 3' phosphate diester linkage. Solubilizing four guanine residues on an individual template in an aqueous medium had also not been demonstrated when work began.   Landmarks in the chemical synthesis of DNA include Michelson and Todd's first synthesis of an internucleotide bond, Khorana's phosphate diester based total synthesis of the structural gene for a yeast alanine transfer RNA, Letsinger's development of the phosphite triester methodology, and Beaucage's preparation of phosphoramidite reagents and their use in modern automated solid-phase DNA synthesizers (Figure 2.2).107-111 All but Khorana's method for 3',5' phosphodiester bond construction utilize the more chemically reactive mode of coupling whereby a displacement reaction takes place with 5' primary alcohol nucleophile at an activated 3' secondary phosphorus III or V center. Thus chemical methods for internucleotide bond formation tend to be in opposition to in vivo enzymatic bond formation, which involve condensation of a 3' secondary alcohol nucleophile with a 5' triphosphate nucleoside.   42 Figure 2.2 a) Michelson and Todd's synthesis of a thymine thymine dinucleotide. b)     Khorana's phosphate diester coupling methodolgy utilized in first total gene    synthesis. c) Letsinger's phosphite triester coupling approach. d) Beaucage's    original phosphoramidite procedure. Protecting groups: Ac: acetyl; An: anisoyl;    Bn: benzyl; Bz: benzoyl; DMT: 4,4'-dimethoxytrityl; MMT: 4-monomethoxytrityl;    TCE: 2,2,2-trichloroethyl.  O O O PO Cl OBn P O OBn BnO O AcO HO O O O PO OBn P O OBn BnO O AcO T T T T O base deprotection O O O PO O P O O O O HO T TO + a) O HO OP O O RO ABz b) O R'O OP O O O CAn + O O O PO O P O O RO O R'O ABz CAnO S OO Cl i-Pri-Pr i-Pr c) O HO O O MMTO HO T T O O O PTCEO O O MMTO T TO PhO i) PCl2OTCE    base ii) iii) I2 / H2O O PhO O O DMTO O O HO GIbu T O O DMTO PH3CO O O GIbu TO i) ii) oxidation P NH3CO N N N NH O O O O O d) 43 2.3  Phosphite Triester Synthesis of Guanine Base Phosphate-  Linked Cavitand-Nucleotide Conjugates   Significantly improved yields and shortened reaction times were reported by Letsinger for the use of phosphorus III containing phosphorochloridites as coupling agents in the formation of 3',5' phosphate triesters in comparison to the analogous phosphorus V containing phosphorochloridates (Figure 2.2c).109 In this manual solution- phase phosphite triester approach, an in-situ displacement of two chlorides of a phosphorodichloridite by successive addition of a 3' and then a 5' unprotected nucleoside takes place cleanly at -78 ºC in tetrahydrofuran in the presence of a base on the minute time-scale. Brief iodine catalyzed oxidation of the phosphite triester gives the protected phosphate triester analogue. Subjecting the fully coupled and protected oligodeoxynucleotide to deblocking conditions and purification facilitates the completion of the synthesis. The use of simple starting materials, the avoidance of any preparation and isolation of unstable activated intermediates, and the ability to perform two couplings in one pot contribute to the attractiveness of this approach.  Known 2'-deoxyguanosine nucleoside, 1a, protected at the base amino position as the isobutyryl (Ibu) amide and at the 5' alcohol position with tert-butyldimethylsilyl (TBS) ether was chosen to couple together with known cavitand 2 (Scheme 2.1).112-115 Cavitand 2 possesses primary propyl alcohol feet capable of mimicking the 5' primary alcohol nucleophile required for DNA synthesis. Conventional DNA synthesis utilizes a bulky   44 Scheme 2.1 Phosphite triester synthesis of guanine base cavitand-nucleotide conjugate at the   feet position.    acid labile dimethoxytrityl (DMT) protecting group on the 5' alcohol.116 For the reasons of minimizing steric demand during four fold coupling and avoiding acid catalyzed depurination side reactions, the TBS group was chosen in favour of the DMT group for 5' protection. In order to achieve complete conversion of starting material 2 to the fully O HO OSi NH NN N O N H O OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O GHO O P O GHO O O OP O O GHO OO P O O GHO O O P O O NBu4 NBu4 NBu4 NBu4 N P Cl Cl O Cl Cl Cl OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O GIbuTBSO O P O GIbuTBSO O O TCEOP O O GIbuTBSO OTCEO P O O GIbuTBSO TCEO O P O OTCE OO O OO O O O H H CH3H3C CH3 CH3 HO OH OHHO H H + i.      THF, 1h, -78 oC ii.      4h, 0 oC iii. I2 / H2O / pyridine, 5 min, 0 oC 1. Zn / Cu, acetylacetone     pyridine, 4h 2. NH4OH / MeOH     16h, 55 oC 3. TBAF     24h 1a 2 3a 16 % NH NN N NH NN N GIbu = G = N H O O O NH2 45 coupled and protected intermediate conjugate, four equivalents of 1a per alcohol function was used. Starting material 2 or any mono-, di-, or tri-coupling intermediates could not be detected by thin-layer chromatography after several hours of reaction progress. Coupling and deblocking reactions were carried out in succession without isolation or characterization of the intermediates due to the problematic generation of diastereomeric mixtures when asymmetric phosphate triesters are formed and due to issues of solubility. Deblocking of the 2,2,2-trichloroethyl (TCE) phosphate protecting group was accomplished by zinc / copper couple in pyridine in the presence of acetylacetone.117,118 Guanine base isobutyryl group deprotection was carried out with ammonia treatment in a water methanol mixture. Final removal of the TBS ether group with TBAF in tetrahydrofuran followed by purification on C18 reversed-phase silica afforded the cavitand-nucleotide conjugate 3a as a tetrabutylammonium salt in 16 % yield from the coupling step. The incorporation of a n-tetrabutylammonium counterion into the final purified product was not by design. However, choosing standard silyl ether protection and fluoride cleavage was fortuitous, since this counterion imparted the desired solubility properties on the target while other counterions could not be found to do so. Compound 3a was observed to have millimolar solubility in the polar protic solvents methanol and water.   Cavitands have a nonpolar concave surface or hydrophobic cavity that may be expected to influence the solubility behavior of a particular cavitand-based construct in water. Thus, an additional goal existed to synthesize a cavitand functionalized at the rim with primary alkyl alcohols. This was accomplished by substitution of known tetrol cavitand 4 with ethyl bromoacetate in the presence of potassium carbonate base followed  46 by reduction of the ester with lithium aluminum hydride to yield the new tetra-alcohol cavitand 6 (Scheme 2.2).119,120 Accordingly, cavitand 6 was utilized as a substrate for the phophite triester synthesis of cavitand-nucleotide conjugate 7 and demonstrated identical solubility character to its feet functionalized analogue 3a (Scheme 2.3).  Scheme 2.2 Synthesis of alcohol functionalized cavitand at rim position.      O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 HO HO OHOH O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 EtO EtO OEtOEt O O O O O OO O O OOO HH OH OHOHHO HH CH3 CH3 CH3 CH3 Br OEt O K2CO3 acetone reflux, 4 days 4 5 78 % 6 58 % LiAlH4 THF, -78 oC to rt, 2h 47 Scheme 2.3 Phosphite triester synthesis of guanine base cavitand-nucleotide conjugate at the   rim position.    O HO OTBS NH NN N O N H O NBu4 N P Cl Cl O Cl Cl Cl O O TCEOO O GIbuTBSO O P O GIbuTBSO O O TCEOP O O GIbuTBSO OTCEO P O O GIbuTBSO TCEO O P O O O OO O O OOO HH O OOO HH + i.      THF, 1h, -78 oC ii.      4h, 0 oC iii. I2 / H2O / pyridine, 5 min, 0 oC 1. Zn / Cu, acetylacetone     pyridine, 4h 2. NH4OH / MeOH     16h, 55 oC 3. TBAF     24h 1a 6 7 26 % CH3 CH3 CH3 CH3 HO HO OHOH O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 O O OO O GHO O P O GHO O O OP O O GHO OO P O O GHO O O P O O O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 NBu4 NBu4 NBu4 NH NN N NH NN N GIbu = G = N H O O O NH2 48 2.4  Phosphoramidite Synthesis of Phosphate-Linked Cavitand-  Nucleotide Conjugates of the Canonical Nucleobase Series   Application of phosphoramidite reagents to the synthesis of DNA is widespread and is routinely observed in modern automated solid-phase DNA synthesis or "gene machines".111 An impressive transformation in the biological sciences has taken place as a consequence of the advent of gene machine technology. It is now possible for a technician who is not a specialized organic chemist to produce a purified oligodeoxynucleotide of approximately 20 residues long in a matter of hours. In the past, such a synthetic feat like that seen in the original construction of a non-repeating icosanucleotide in Khorana's laboratory by manual methods would take many months.121 Phosphoramidites were chemically advantageous for application in solid-phase synthesis in relation to the preceding phosphorus III phosphite triester reagents. Phosphoramidite reagents are moderately stable under normal laboratory conditions in comparison to their chloride analogues and can be isolated and stored for use in tetrazole-catalyzed nucleotide couplings at room temperature without the formation of undesired pyridinium chloride precipitates or the use of hazardous tetrahydrofuran solvent and unstable phosphorodichloridite reagents.   Although 5' DMT is a conventional protecting group for phosphoramidite reagents, the TBS group was preferred for 5' protection due to the arguments outlined previously for the phosphite triester approach. Reports of the preparation of analogous 5' TBS phosphoramidites were unavailable in the literature. Thus, a series of silyl protected  49 phosphoramidite reagents of the canonical deoxynucleosides were prepared with standard N-Ibu or N-benzoyl (Bz) base protection and 5' TBS ether protection using Singha et al.'s original procedure for the 2-cyanoethyl,-N,N-diisopropylamino phosphoramidites (Scheme 2.4).112-114,122 Isolation of the moisture and air sensitive phosphoramidites 8a-d   Scheme 2.4  Preparation of silyl protected phosphoramidite reagents.    as a mixture of diastereomers was confirmed by the appearance of two singlets in the 150 ppm range in the 31P NMR spectrum (Figure 2.3).  O HO R TBSO 1a-d O O R TBSO P NO NC 8a-d 77-94% Cl P NO NC + N NN N NH NN N N N HN O NH N O O H3C a, R = GIbu b, R = ABz c, R = CBz d, R = T O DIPEA THF, 4h HN O N H O O 50  Couplings were performed at room temperature in tetrahydrofuran or dichloromethane with 16 equivalents of phosphoramidites 8a-d and 24 equivalents of 5- (ethylthio)-tetrazole with foot-functionalized cavitand 2 or rim-functionalized cavitand 6 (Schemes 2.5-2.6). Simplified two step deblocking was carried out by simultaneous removal of the ammonia sensitive base and phosphate protecting groups followed by   Figure 2.3  31P NMR spectrum of silyl protected phosphoramidite 8d.    TBAF treatment and purification. The n-tetrabutylammonium salts 3a-d and 7 were afforded in improved yield over the phosphite triester methodology. O O TBSO P NO NC NH N O O H3C 51  A route to synthesizing base-protected analogues of cavitand-nucleotide conjugates 3a-d was revealed (Scheme 2.7). Base-protected cavitand-nucleotide conjugates 9a-c were desired for control studies based on analytical techniques such as circular dichroism (CD) and diffusion ordered NMR spectroscopy (DOSY). Probing of the self-assembly potential of the unblocked conjugates could be aided by comparison with an analogue conjugate with blocked hydrogen bonding capacity.   Scheme 2.5 Phosphoramidite synthesis of cavitand-nucleotide conjugates at the feet position.  OO O OO O O O H H CH3H3C CH3 CH3 HO OH OHHO H H i.      THF, 4h ii. I2 / H2O / pyridine, 5 min, 0 oC OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O RTBSO O P O RTBSO O O CEOP O O RTBSO OCEO P O O RTBSO CEO O P O OCE O O RTBSO P NONC 8a-d N N N H N SEt + OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O R'HO O P O R'HO O O OP O O R'HO OO P O O R'HO O O P O O NBu4 NBu4 NBu4 NBu4 3a-d 34-40 % N NN N NH NN N N N HN O NH N O O H3C a, R = GIbu b, R = ABz c, R = CBz d, R,R' = T O HN O N H O O N NN N NH NN N N N NH2 O a, R' = G b, R' = A c, R' = C NH2 NH2 O 2 1. NH4OH / MeOH     16h, 55 oC 2. TBAF     24h 52 Selective removal of the 2-cyanoethyl (CE) phosphate protecting group was accomplished by substitution of a sterically hindered tertiary amine base in anhydrous pyridine in place of ammonia treatment.   Scheme 2.6 Phosphoramidite synthesis of guanine base cavitand-nucleotide conjugate at    rim position.    i.      THF, 4h ii. I2 / H2O / pyridine, 5 min, 0 oC O O GIbuTBSO P NONC 8a N N N H N SEt + 6 1. NH4OH / MeOH     16h, 55 oC 2. TBAF     24h O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 HO HO OHOH NBu4 O O CEOO O GIbuTBSO O P O GIbuTBSO O O CEOP O O GIbuTBSO OCEO P O O GIbuTBSO CEO O P O O 7 35 % O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 O O OO O GHO O P O GHO O O OP O O GHO OO P O O GHO O O P O O O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 NBu4 NBu4 NBu4 NH NN N NH NN N GIbu = G = N H O O O NH2 53 Scheme 2.7 Phosphoramidite synthesis of base-protected cavitand-nucleotide conjugate at    the feet position.    2.5  Experimental Procedures  General Procedures. All chemicals were purchased from standard suppliers. Reaction solvents were dried prior to use. Acetone, dichloromethane, ethyl acetate, and hexanes were HPLC grade and were dried over 3 Å molecular sieves. Dichloromethane, ethyl OO O OO O O O H H CH3H3C CH3 CH3 HO OH OHHO H H i.      THF, 4h ii. I2 / H2O / pyridine, 5 min, 0 oC OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O RTBSO O P O RTBSO O O CEOP O O RTBSO OCEO P O O RTBSO CEO O P O OCE O O RTBSO P NONC 8a-c N N N H N SEt + OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O RHO O P O RHO O O OP O O RHO OO P O O RHO O O P O O NBu4 NBu4 NBu4 NBu4 9a-c 18-42 % N NN N NH NN N N N HN O a, R = GIbu b, R = ABz c, R = CBz O HN O N H O O 2 1. Et3N     pyridine, 4h 2. TBAF     24h 54 acetate, and hexanes used as reaction solvents or during the work-up for the synthesis of phosphoramidites 8a-d or for cavitand-nucleotide conjugate 3c were bubbled with argon gas 30 min immediately prior to use. Dry tetrahydrofuran was obtained by distillation from sodium / benzophenone under a nitrogen atmosphere. Reactions were monitored by thin-layer chromatography on silica gel 60 F254nm aluminum sheets using methanol / dichloromethane developing solvent mixtures. Developed thin-layer chromatography plates were visualized at 254 nm followed by staining with aqueous 10 % H2SO4 solution and heating. Silica gel used for column chromatography was 230-400 mesh. All reported 1H NMR and 13C NMR chemical shifts were calibrated using the residual solvent signal relative to tetramethylsilane. Phosphorus NMR was performed with proton decoupling, and all reported 31P NMR chemical shifts were referenced relative to aqueous 85 % H3PO4. The general numbering conventions used for NMR assignments are given below.       General Phosphite Triester Synthetic Procedure for Cavitand-Nucleotide Conjugates 3a and 7. To a stirred solution of 2,2,2-trichloroethylphosphorodichloridite O O HoutHin 4 a b c d H aryl O O RO NH N O O H3C N NN N NH NN N N N NH2 O NH2 NH2 O 1' 2'3' 4'5' cavitand: nucleoside: R= 8 5 6 2 8 6 55 (0.13 mL, 0.83 mmol, 14 eq) and 2,6-lutidine (0.4 mL, 3.4 mmol, 57 eq) in 3 mL of tetrahydrofuran at -78 °C under an argon atmosphere was added dropwise over 5 min nucleoside 1a (0.44 g, 0.97 mmol, 16 eq, coevaporated two times with 2 mL of tetrahydrofuran) in 2 mL of tetrahydrofuran. The reaction flask was occasionally removed from the cold bath and swirled while stirring was maintained for 1 h at -78 °C. The reaction mixture was warmed to 0 °C, and cavitand 2 or cavitand 6 (50 mg, 0.06 mmol, 1 eq, coevaporated two times with 2 mL of tetrahydrofuran) was added dropwise over 5 mins in 4 mL of tetrahydrofuran. Stirring was maintained for 4 h at 0 °C. A solution of 0.1 M iodine in tetrahydrofuran / pyridine / water (14 mL, 80:20:2) was added, and stirring was continued for 5 min at 0 °C. The reaction solvent was removed by rotary evaporation, and the residue was dissolved in 40 mL of dichloromethane and washed with 100 mL of 5 % aqueous sodium metabisulfite. The aqueous layer was extracted two more times with 40 mL of dichloromethane. The combined organic layer was washed with 100 mL of brine and dried over anhydrous MgSO4. The solvent was removed by rotary evaporation, and the crude product was purified by flash chromatography on silica gel using methanol / dichloromethane as a solvent system (1:20 then 1:10). Complete deblocking was performed without isolation of the partially deblocked intermediates. The fully blocked product mixture was coevaporated two times in 2 mL of dichloromethane. Acetylacetone (0.2 mL) and Zn / Cu couple (two times mass of the fully blocked product mixture) were added, and the reaction mixture was suspended in 20 mL of pyridine. The reaction was stirred for 4 h under an argon atmosphere. A 40 mL solution of 1:1 pyridine / water and 4 g of DOWEX 50WX8 50- 100 (NH4 + form) ion-exchange resin were added, and stirring was continued for 15 mins.  56 The resin was filtered off, and the solvent was removed by rotary evaporation. The residue was dissolved in 6 mL of methanol and 6 mL of concentrated aqueous ammonia and stirred for 16 h at 55 °C. After evaporation of the solvent, the residue was dissolved in 3 mL of 1 M TBAF in tetrahydrofuran and stirred for 24 h. The reaction was diluted in 15 mL of water, loaded onto a Sep-Pak Vac 12 cc (2 g) C18 cartridge, and purified by step-gradient elution with pure water to pure methanol in 10 % increments with 40 mL per step. Fractions were monitored by UV / VIS spectrophotometry at 260 nm, and products were eluted at approximately 50 % methanol composition. Lyophilization from water afforded compounds 3a and 7 as white powders in n-tetrabutylammonium salt form.  3a. 30 mg (16 % overall yield); 1H-NMR (400 MHz, CD3OD) δ 7.90 (s, 4H, H-8), 7.10 (s, 4H, aryl), 6.21 (t, J = 7.0 Hz, 4H, CH-1'), 5.68 (d, J = 7.0 Hz, 4H, Hout), 5.03 (br. s, 4H, CH-3'), 4.74 (t, J = 8.0 Hz, 4H, CH-a), 4.21 (br, 4H, CH-4'), 4.09 (d, J = 7.0 Hz, 4H, Hin), 4.00 (m, 8H, CH2-d), 3.82 (m, 8H, CH2-5'), 2.66 (m, 4H, CHa-2'), 2.42 (m, 12H, CH2-b, CHb-2'), 1.76 (s, 12H, methyl), 1.80 (overlap, 8H, CH2-c); 13C-NMR (101 MHz, CD3OD) δ 159.4, 155.1, 154.7, 152.3, 138.6, 138.4, 125.3, 119.2, 118.4, 99.8, 88.4, 86.1, 76.9, 65.7, 63.8, 59.5, 40.1, 37.0, 29.7, 26.2, 24.8, 20.7, 14.0, 10.0; 31P-NMR (162 MHz, CD3OD) δ 2.3 (s); MS (MALDI-TOF) calculated for C88H103N20O36P4 (M-H)-: 2139.6; found: 2142.0.  7. 49 mg (26 % overall yield); 1H-NMR (400 MHz, D2O) δ 8.03 (s, 4H, H-8), 6.99 (s, 4H, aryl), 6.25 (t, J = 7.0 Hz, 4H, CH-1'), 5.88 (d, J = 7.0 Hz, 4H, Hout), 4.94 (br, 4H, CH-3'),  57 4.32 (q, J = 7.0 Hz, 4H, CH-a), 4.23 (br, 4H, CH-4'), 4.2-3.8 (m, 20H, Hin, -OCH2CH2O- ), 3.75 (m, 8H, CH2-5'), 2.88 (m, 4H, CHa-2'), 2.76 (m, 4H, CHb-2'), 1.60 (overlap, 12H, methyl); 13C NMR (101 MHz, D2O) δ 158.4, 153.9, 151.2, 147.3, 142.8, 139.9, 137.5, 115.8, 115.1, 100.3, 86.4, 83.9, 76.3, 73.7, 65.1, 61.9, 58.2, 37.2, 31.2, 23.3, 19.3, 15.2, 12.8; 31P-NMR (162 MHz, D2O) δ -2.4 (s); MS (MALDI-TOF) calculated for C84H95N20O40P4 (M-H) -: 2147.5; found: 2149.2.  Cavitand 5. To a stirred solution of cavitand 4 (1.95g, 2.97 mmol, 1 eq, coevaporated two times with 10 mL of acetone) in 100 mL of acetone under an argon atmosphere was added anhydrous potassium carbonate (2.50 g, 18.1 mmol, 6 eq) and ethyl bromoacetate (2.8 mL, 25.1 mmol, 8.5 eq). Stirring was maintained under reflux for 4 days. After removal of the solvent by rotary evaporation, the residue was partioned between 100 mL of dichloromethane and 200 mL of 2 % HCl solution extracted three times. The combined organic layer was washed with 100 mL of brine, dried over anhydrous MgSO4, and the solvent was removed by rotary evaporation. The residue was dissolved in 15 mL of dichloromethane, precipitated into stirring 200 mL of hexanes, suction filtered, and dried under high vacuum to give 2.34 g (78 % yield) of compound 5 as a white solid.   1H NMR (400 MHz, CDCl3) δ 6.93 (s, 4H, aryl), δ 5.75 (d, J = 7.5 Hz, 4H, Hout), δ 4.93 (q, J = 7.5 Hz, 4H, CH-a), δ 4.52 (s, 8H, -CH2CO-, 8H), δ 4.44 (d, J = 7.5 Hz, 4H, Hin), δ 4.23 (q, J = 7.0 Hz, 8H, -OCH2CH3), δ 1.71 (d, J = 7.5 Hz, 12H, methyl), δ 1.29 (t, J = 7.0 Hz, 12H, -OCH2CH3); 13C NMR (101 MHz, CDCl3) δ 169.4, 147.1, 143.9, 139.8,  58 113.9, 100.0, 70.2, 61.1, 31.2, 16.0, 14.3; HRMS (ESI) calculated for C52H56O20Na (M+Na)+: 1023.3263; found: 1023.3248.  Cavitand 6. To a stirred solution of cavitand 5 (1.00 g, 1.00 mmol, 1 eq, coevaporated two times in 5 mL of tetrahydrofuran) in 25 mL of tetrahydrofuran under an argon atmosphere and cooled to -78 °C was added LiAlH4 (0.50 g, 13 mmol, 13 eq). The reaction mixture was allowed to warm to room temperature over 2 hours. The reaction mixture was cooled to 0 °C, quenched with 10 mL of ethyl acetate followed by 10 mL of water, and the solvent was reduced by rotary evaporation. The residue was partitioned between 75 mL of ethyl acetate and 200 mL of 3 M H2SO4 and extracted three times. The combined organic layer was washed with 100 mL of water, 100 mL of saturated aqueous NaHCO3, and 100 mL of brine, dried over anhydrous MgSO4, and the solvent was removed by rotary evaporation. The crude product was purified by flash chromatography on silica gel using ethanol / dichloromethane as a solvent system (1:20 then 1:10) and dried under high vacuum to give 0.48 g (58 % yield) of compound 6 as white solid.  1H NMR (400 MHz, CDCl3) δ 6.96 (s, 4H, aryl), δ 5.88 (d, J = 7.0 Hz, 4H, Hout), δ 4.91 (q, J = 7.0 Hz, 4H, CH-a), δ 4.44 (d, J = 7.0 Hz, 4H, Hin), δ 4.11 (br, 8H, -OCH2CH2OH), δ 3.64 (br, 8H, -OCH2CH2OH), δ 3.14 (br. s, 4H, OH), δ 1.74 (d, J = 7.0 Hz, 12H, methyl); 13C NMR (101 MHz, CDCl3) δ 147.8, 143.5, 140.0, 114.1, 99.7, 75.6, 61.5, 31.3, 15.9; HRMS (ESI) calculated for C44H48O16Na (M+Na) +: 855.2840; found: 855.2829.   59 General Synthetic Procedure for Phosphoramidites 8a-d. To a stirred solution of nucleoside 1a-d (3.30 mmol, 1 eq, coevaporated three times in 2 mL of tetrahydrofuran) and N,N-diisopropylethylamine (2.3 mL, 13 mmol, 4 eq) in 15 mL of tetrahydrofuran under an argon atmosphere was added dropwise over 2 mins 2-cyanoethyl-N,N- diisopropylchlorophosphoramidite (0.90 mL, 4 mmol, 1.2 eq). Stirring was maintained for 4 h. After removal of the solvent by rotary evaporation, the residue was dissolved in 50 mL of ethyl acetate and washed with 50 mL of saturated aqueous NaHCO3, 50 mL of brine, and dried over anhydrous MgSO4. The solvent was removed by rotary evaporation, and the residue was dissolved in 3 mL of ethyl acetate (dichloromethane was used in place of ethyl acetate to dissolve 8c). The solution was added dropwise into 400 mL of stirring hexanes at -78 ºC under argon, and the resultant precipitate was suction filtered, and coevaporated three times in tetrahydrofuran (dichloromethane was used in place of tetrahydrofuran for 8c), and dried under high vacuum. The white crystalline compounds were stable over months when stored under argon at -20 ºC.   8a. 2.03 g (94 % yield); mixture of diastereomers; 31P-NMR (162 MHz, CDCl3) δ 150.2 (s), 148.7 (s); HRMS (ESI) calculated for C29H51N7O6PSi (M+H) +: 652.3408; found: 652.3417.  8b. 1.81 g (88 % yield); mixture of diastereomers; 31P-NMR (162 MHz, CDCl3) δ 149.9 (s), 149.8 (s); HRMS (ESI) calculated for C32H49N7O5PSi (M+H) +: 670.3302; found: 670.3317.    60 8c. 1.51 g (77 % yield); mixture of diastereomers;31P-NMR (162 MHz, CDCl3) δ 148.0 (s), 147.95 (s); HRMS (ESI) calculated for C31H49N5O6PSi (M+H) +: 646.3190; found: 646.3179.  8d. 1.60 g (95 % yield); mixture of diastereomers;31P-NMR (162 MHz, CDCl3) δ 149.4 (s), 149.4 (s); HRMS (ESI) calculated for C25H46N4O6PSi (M+H) +: 557.2924; found: 557.2923.  General Phosphoramidite Synthetic Procedure for Cavitand-Nucleotide Conjugates 3a-d and 7. To a stirred solution of phosphoramidite 8a-d (0.97 mmol, 16 eq) and 5- (ethylthio)tetrazole (0.19 g, 1.5 mmol, 24 eq, coevaporated two times in 2 mL of tetrahydrofuran) in 6 mL of tetrahydrofuran under an argon atmosphere was added dropwise over 5 mins cavitand 2 or cavitand 6 (50 mg, 0.60 mmol, 1 eq, coevaporated two times in 2 mL of tetrahydrofuran) in 4 mL of tetrahydrofuran (dichloromethane was used in place of tetrahydrofuran for the reaction of phosphoramidite 8c). Stirring was maintained for 3 h. The reaction mixture was cooled to 0°C, 0.2 mL of water was added, and stirring was continued for 1 min. A solution of 0.1 M iodine in tetrahydrofuran / pyridine / water (14 ml, 80:20:2) was added, and stirring was continued for 5 mins at 0 °C. The reaction solvent was removed by rotary evaporation, and the residue was dissolved in 40 mL of dichloromethane and washed with 100 mL of 5 % aqueous sodium metabisulfite. The aqueous layer was extracted two more times with 40 mL of dichloromethane. The combined organic layer was washed with 100 mL of saturated aqueous NaHCO3, 100 mL of brine, and dried over anhydrous MgSO4. The solvent was  61 removed by rotary evaporation, and the crude product was immediately purified by flash chromatography on silica gel using methanol / dichloromethane as a solvent system (1:20 then 1:10). Deblocking was performed by dissolving the fully blocked product mixture in 6 mL of methanol and 6 mL of concentrated aqueous ammonia followed by stirring for 24 h at 55 °C. After evaporation of the solvent, the residue was dissolved in 3 mL of 1 M TBAF in tetrahydrofuran and stirred for 24 h at room temperature. The reaction was diluted in 15 mL of water, loaded onto a Sep-Pak Vac 12 cc (2 g) C18 cartridge, and purified by step-gradient elution with pure water to pure methanol in 10 % increments with 40 mL per step. Fractions were monitored by UV / VIS spectrophotometry at 260 nm, and products were eluted at approximately 50 % methanol composition. Lyophilization from water afforded final compounds 3a-d as white powders in n- tetrabutylammonium salt form.  3a. 67 mg (36 % overall yield)  3b. 74 mg (40 % overall yield); 1H-NMR (400 MHz, CD3OD) δ 8.36 (s, 4H, H-2), 8.19 (s, 4H, H-8), 7.16 (s, 4H, aryl), 6.44 (t, J = 6.0 Hz, 4H, CH-1'), 5.67 (d, J = 7.0 Hz, 4H, Hout), 5.00 (br, 4H, CH-3'), 4.79 (t, J = 8.0 Hz, 4H, CH-a), 4.29 (br, 4H, CH-4'), 4.11 (d, J = 7.0 Hz, 4H, Hin), 4.01 (m, 8H, CH2-d), 3.80 (br, 8H, CH2-5'), 2.80 (m, 4H, CHa-2'), 2.57 (m, 4H, CHb-2'), 2.44 (m, 8H, CH2-b), 1.77 (s, 12H, methyl), 1.80 (overlap, 8H, CH2-c);  13C-NMR (101 MHz, CD3OD) δ 156.3, 154.6, 152.0, 149.7, 142.1, 138.5, 125.1, 120.7, 119.1, 99.9, 88.9, 86.9, 77.1, 65.9, 63.6, 59.5, 40.8, 36.8, 29.8, 27.0, 24.8, 20.7,  62 14.0, 10.4; 31P-NMR (162 MHz, CD3OD) δ 2.1 (s); MS (MALDI-TOF) calculated for C88H103N20O32P4 (M-H) -: 2075.6; found: 2076.5.  3c. 54 mg (34 % overall yield); 1H-NMR (400 MHz, CD3OD) δ 8.10 (d, J = 7.0 Hz, 4H, H-6), 7.15 (s, 4H, aryl), 6.30 (t, J = 6.0 Hz, CH-1'), 6.08 (d, J = 7.0 Hz, 4H, H-5), 5.78 (d, J = 7.0 Hz, 4H, Hout), 4.78 (br, 8H, CH-3', CH-a), 4.16 (br., 8H, CH-4', Hin), 3.96 (br, 8H, CH2-d), 3.80 (br, 8H, CH2-5'), 2.47 (br, 4H, CHa-2'), 2.34 (br, 8H, CH2-b), 2.06 (br, 4H, CHb-2'), 1.89 (s, 12H, methyl), 1.72 (overlap, 8H, CH2-c); 13C-NMR (101 MHz, CD3OD) δ 166.1, 154.7, 143.4, 139.0, 138.4, 125.8, 119.1, 99.9, 96.3, 88.1, 87.9,  86.8, 76.0, 65.5, 63.0, 59.5, 40.8, 36.7, 29.8, 26.5, 24.8, 20.7, 13.9, 10.6; 31P-NMR (162 MHz, D2O) δ -2.8 (s); MS (MALDI-TOF) calculated for C84H103N12O36P4 (M-H) -: 1979.6; found: 1982.1.  3d. 64 mg (35 % overall yield); 1H-NMR (400 MHz, CD3OD) δ 7.87 (s, 4H, H-6), 7.19 (s, 4H, aryl), 6.30 (t, J = 7.0 Hz, 4H, CH-1'), 5.79 (d, J = 7.0 Hz, 4H, Hout), 4.7-4.9 (overlap, 8H, CH-3',CH-a), 4.21 (d, J = 7.0, 4H, Hin), 4.14 (br, 4H, CH-4'), 3.99 (br. 8H, CH2-d), 3.78 (br, 8H, CH2-5'), 2.44 (br, 8H, CH2-b), 2.1-2.3 (m, 8H, CH2-2'), 1.93 (s, 12H, methyl), 1.91 (s, 12H, methyl), 1.75 (overlap, 8H, CH2-c); 13C-NMR (101 MHz, CD3OD) δ 166.4, 154.8, 152.2, 138.6, 138.3, 125.4, 119.2, 111.6, 99.9, 87.9, 86.3, 76.5, 65.7, 62.9, 59.5, 40.4, 37.3, 29.9, 27.0, 24.8, 20.7, 14.0, 12.7, 10.3; 31P-NMR (162 MHz, D2O) δ -2.6 (s); MS (MALDI-TOF) calculated for C88H109N8O40P4 (M+H)+: 2041.6; found: 2043.9.  7. 65 mg (35 % overall yield)  63 General Phosphoramidite Synthetic Procedure for Base-Protected Cavitand- Nucleotide Conjugates 9a-c. The general phosphoramidite synthetic procedure for cavitand-nucleotide conjugates 3a-d was performed with the following modifications. Treatment of the fully blocked product mixture with concentrated aqueous ammonia and methanol solution was avoided. To a stirred solution of the fully blocked product mixture coevaporated three times in 2 mL of pyridine and dissolved in 10 mL of pyridine was added 6 mL of triethylamine under an argon atmosphere. Stirring was maintained for 4 h. The solvent was removed by rotary evaporation, and the residue was coevaporated three times in pyridine. Subsequent TBAF treatment and purification was carried out as described previously to afford compounds 9a-c as white powders in n- tetrabutylammonium salt form.  9a. 70 mg (34 % overall yield); 1H-NMR (400 MHz, CD3OD) δ 8.26 (s, 4H, H-8), 7.09 (s, 4H, aryl), 6.32 (t, J = 7.0 Hz, 4H, CH-1'), 5.61 (d, J = 7.0 Hz, 4H, Hout), 5.01 (br, 4H, CH-3'), 4.68 (t, J = 8.0 Hz, 4H, CH-a), 4.19 (br, 4H, CH-4'), 4.06 (m, 8H, Hin, CH2-d), 3.78 (br, 8H, CH2-5'), 2.82 (m, 4H, -CH(CH3)2) 2.67 (m, 4H, CHa-2'), 2.57 (m, 4H, CHb- 2'), 2.37 (m, 12H, CH2-b), 1.77 (s, 12H, methyl), 1.72 (overlap, 8H, CH2-c), 1.21 (m, 24H, -CH(CH3)2);  13C-NMR (101 MHz, CD3OD) δ 182.2, 157.5, 154.8, 150.2, 149.7, 140.1, 138.6, 125.4, 121.4, 119.2, 100.0, 88.4, 85.5, 76.9, 66.3, 63.3, 59.5, 40.7, 37.6, 36.8, 30.2, 26.8, 24.8, 20.7, 19.5, 14.0, 10.2; 31P-NMR (162 MHz, CD3OD) δ 2.0 (s); MS (MALDI-TOF) calculated for C104H129N20O40P4 (M+H) +: 2421.7; found: 2424.5.   64 9b. 89 mg (42 % overall yield); 1H-NMR (400 MHz, CD3OD) δ 8.69 (s, 4H, H-2), 8.65 (s, 4H, H-8), 8.08 (m, 8H, benzoyl-o), 7.61 (m, 4H, benzoyl-p), 7.53 (m, 8H, benzoyl-m), 7.12 (s, 4H, aryl), 6.54 (t, J = 7.0 Hz, 4H, CH-1'), 5.63 (d, J = 7.0 Hz, 4H, Hout), 5.02 (br, 4H, CH-3'), 4.73 (t, J = 8.0 Hz, 4H, CH-a), 4.29 (br. s, 4H, CH-4'), 4.05 (m, 8H, Hin, CH2-d), 3.81 (br, 8H, CH2-5'), 2.80 (m, 4H, CHa-2'), 2.59 (m, 4H, CHb-2'), 2.41 (m, 8H, CH2-b), 1.74 (s, 12H, methyl), 1.74 (overlap, 8H, CH2-c); 31P-NMR (162 MHz, CD3OD) δ 2.2 (s); MS (MALDI-TOF) calculated for C116H119N20O36P4 (M-H)-: 2491.7; found: 2494.8.  9c. 37 mg (18 % overall yield); 1H-NMR (400 MHz, CD3OD) δ 8.55 (d, J = 7.5 Hz, 4H, H-6), 7.97 (m, 8H, benzoyl-o), 7.40-7.70 (m, 16H, benzoyl-m/p. H-5), 7.19 (m, 4H, aryl), 6.30 (t, J = 6.5 Hz, 4H, CH-1'), 5.77 (d, J = 7.0 Hz, 4H, Hout), 4.87 (overlap, 4H, CH-3') 4.80 (overlap, 4H, CH-a), 4.27 (br, 4H, CH-4'), 4.19 (br, 4H, Hin), 4.03 (m, 4H, CH2-d), 3.84 (br, 8H, CH2-5'), 2.65 (m, 4H, CHa-2'), 2.45 (br, 8H, CH2-b), 2.24 (m, 4H, CHb-2'), 1.90 (s, 12H, methyl), 1.6-1.8 (overlap, 8H, CH2-c); 13C-NMR (101 MHz, CD3OD) δ 169.0, 164.6, 157.6, 154.9, 146.9, 138.7, 134.8, 134.1, 129.8, 129.3, 125.5, 119.3, 100.1, 98.5, 88.7, 88.5, 76.5, 66.2, 62.7, 59.5, 53.7, 41.7, 37.3, 30.0, 26.7, 24.8, 20.7, 14.0, 10.3; 31P-NMR (162 MHz, CD3OD) δ 0.6 (s); MS (MALDI-TOF) calculated for C112H121N12O40P4 (M+H) +: 2397.7; found: 2400.0.   2.6  Supplementary 1H 1H COSY NMR Spectra   Supplementary 1H 1H COSY NMR spectra begins on the following page. 8 aryl 1 out 3 2,b Me,c 4,in,d,5 a 65 Figure 2.4 !1H 1H COSY NMR Spectrum of 3a in CD3OD at 400 MHz.! OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O GHO O P O GHO O O OP O O GHO OO P O O GHO O O P O O NBu4 NBu4 NBu4 NBu42,8 aryl 1 out 3 a 4,in,d,5 2,b Me,c 66 Figure 2.5 !1H 1H COSY NMR Spectrum of 3b in CD3OD at 400 MHz.! OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O AHO O P O AHO O O OP O O AHO OO P O O AHO O O P O O6 aryl 1 5 out 3,a 4,in,d,5 2,b Me,c 67 Figure 2.6 !1H 1H COSY NMR Spectrum of 3c in CD3OD at 400 MHz.! OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O CHO O P O CHO O O OP O O CHO OO P O O CHO O O P O O6 aryl 1 out 3,a in,4’,d,5 b, 2 2Me,c 68 Figure 2.7 !1H 1H COSY NMR Spectrum of 3d in CD3OD at 400 MHz.! OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O THO O P O THO O O OP O O THO OO P O O THO O O P O O8 aryl 1 out 3 in,-CH2CH2- 2 Me CH,4 5 69 Figure 2.8 !1H 1H COSY NMR Spectrum of 7 in D2O at 400 MHz.! NBu4O O OO O GHO O P O GHO O O OP O O GHO OO P O O GHO O O P O O O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 NBu4 NBu4 NBu48 aryl 1 out 3 a 4,in,d,5 Ibu,2,b Me,c Ibu 70 Figure 2.9 !1H 1H COSY NMR Spectrum of 9a in CD3OD at 400 MHz.! OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O GIbuHO O P O GIbuHO O O OP O O GIbuHO OO P O O GIbuHO O O P O O2,8 aryl 1 out 3 a 4,in,d,5 2,b Me,c Bz 71 Figure 2.10 !1H 1H COSY NMR Spectrum of 9b in CD3OD at 400 MHz.! OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O ABzHO O P O ABzHO O O OP O O ABzHO OO P O O ABzHO O O P O O6 aryl 1 out 3,a 4,in,d,5 2,b Me,c Bz,5 72 Figure 2.11 !1H 1H COSY NMR Spectrum of 9c in CD3OD at 400 MHz.! OO O OO O O O H H CH3H3C CH3 CH3 O O OO H H O CBzHO O P O CBzHO O O OP O O CBzHO OO P O O CBzHO O O P O O! 73 Chapter 3: Synthesis of Water-Soluble Triazole-Linked Cavitand- Guanosine Conjugates  3.1  Synopsis   Two convergent syntheses of a water-soluble cavitand bearing four triazole-linked guanosines were achieved. The critical coupling reaction entailed a copper-catalyzed azide-alkyne cycloaddition between 5’-azido-5’-deoxyguanosine or 5’-azido-5’-deoxy- 2’,3’-O-isopropylidene-guanosine and a cavitand template functionalized with propargyl ether rim groups and water-solubilizing phosphate pendant groups. This synthesis represented the first known example in the literature of a template bearing four guanosine residues that exhibited water-solubility. The cavitand-guanosine conjugates described here were envisioned to act as template assembled G-quartets and G-quadruplex binding ligand receptors in water. The 2’,3’-isopropylidene analogue displayed undesirable broadening in its NMR spectra preventing aquisition of a quality 13C NMR spectrum in (CD3)2SO and a quality 1H NMR spectrum in D2O. Thus, full characterization of this compound was prevented. The 2’,3’-diol analogue demonstrated much improved NMR qualities that allowed its full characterization. A failure to observe any significant signal in the CD spectra in water over a wide range of conditions for these triazole-linked cavitand-guanosine conjugates suggests that these compounds do not offer much potential for G-quartet assembly. Parts of the work described in this chapter have been published already.123 ! 74 3.2  Synthetic Strategy  Pioneering work by Nikan and Sherman demonstrated the utility of a cavitand template to direct the assembly of four covalently linked guanosine residues into a G- quartet in chloroform.91 Synthesis of this lipophilic template-assembled synthetic G- quartet or TASQ was based on the copper-catalyzed azide-alkyne cycloaddition between 5’-azido-5’-deoxy-2’,3’-O-isopropylidene-guanosine nucleoside and a cavitand template functionalized with a propargyl ether rim group to construct a triazole-linked cavitand- guanosine conjugate. The synthetic strategy described here towards a water-soluble analogue of a TASQ was to incorporate water-solubilizing groups at the pendant or ‘feet’ position of the cavitand while maintaining the triazole-linked guanosine upper rim architecture (Figure 3.1). Functional groups previously shown to impart water-solubility on the resorcin[4]arene based cavitands include alkoxides, carboxylic acids, quaternary ammoniums, and polyethylene glycol chains.124 Instead, phosphates were chosen as ionizable groups due to their accessibility at the pendant position, their potential to form an octaanionic species, and their existence as the water-solubilizing groups in DNA, RNA, and nucleotides.115  ! 75 Figure 3.1 Strategy for a water-soluble TASQ analogue.    3.3  Synthesis of Triazole-Linked Cavitand-Guanosine Conjugates   A synthetic route already estabilished by Nikan towards propargyl ether rim and phosphate foot functionalized cavitand 16 was employed with modifications.125 Synthesis of template cavitand 16 required exploitation of recognized orthogonal rim and feet cavitand chemistries (Scheme 3.1).126,115 Known bromo aryl cavitand 10 was protected at its propyl alcohol feet with t-butyldimethylsilylchloride in the presence of imidazole to afford silylated cavitand 11.127 To access the upper rim chemistry of 11, tetrol formation by lithium halogen exchange followed by treatment with trimethyl borate and then   O OO O O OOO HH O OOO OR' R'O R'O OR' HH NN N R N NN R NN N R N NN R R = triazole-linked rim architecture R' = water-solubilizing feet! 76 Scheme 3.1 Synthesis of cavitand template.    O Br O OH 4 O Br O OTBS 4 O OH O OTBS 4 O O O OTBS 4 O O O OH 4 O O O O 4 P O Ot-Bu Ot-Bu O O O O 4 P O OH OH TBS-Cl imidazole DMF, 22 h 10 11 69 % 12 55 % 13 75 % 14 94 % 15 81 % 16 99 % i) n-BuLi, THF, 10 min, -78 oC ii) B(OMe)3, 3h, -78 oC to rt iii) NaOH, H2O2, 3h, -78 oC to rt Br K2CO3 acetone reflux, 24h TBAF THF, 2h i) PNEt2(Ot-Bu)2    1H-tetrazole    THF, 1h ii) H2O2, -78 oC to rt HO CF3 DCM, 10 min O OO O O OOO HH O OOO O O O O HH P P P P OHO OH HO O OH OHO OH OHO OH O! 77 sodium hydroxide / hydrogen peroxide solution was utilized to give phenolic cavitand 12.128 Introduction of the alkyne functionality for nucleoside coupling was then performed by refluxing 12 with propargyl bromide and potassium carbonate to give propargyl ether 13.129 Removal of the TBS protecting group with fluoride treatment followed by installation of the phosphate group as a protected di-t-butyl ester with a 1H- tetrazole activated phosphoramidite reaction yielded cavitand 15.115 Final quantitative removal of t-butyl by trifluoroacetic acid gave a clean preparation of 16 as a neutral phosphate monoester.  Incorporation of the azido function at the 5’ position of guanosine has been reported with tosyl and phosphate activation prior to azide substituion.130,131 However, these methods are accompanied by intramolecular cyclization with the guanine base at the 5’ position and / or poor yields. Dean’s improved synthesis based on 5’ iodine activation avoids these problems and was utilized to synthesize 5’-azido-5’- deoxyguanosine, 17.132 Conversion of nucleoside 17 into its 2’,3’ isopropylidene variant 18 was accomplished with toluene sulfonic acid and 2,2-dimethoxypropane (Scheme 3.2).133 Characterization data for 18 from NMR and mass spectrometry were identical to that reported previously.131  ! 78 Scheme 3.2 Nucleosides utilized in the synthesis of triazole linked cavitand-guanosine    conjugates.    The key step for construction of targets 19a-b was performed by ‘clicking’ on nucleosides 17 or 18 via a copper-catalyzed azide-alkyne cycloaddition (Scheme 3.3).134,135 Final purification of the triazole-linked cavitand-guanosine conjugates was achieved by a classical DNA purification technique with diethylaminoethyl(DEAE)- cellulose anion exchange chromatography and pH 8 triethylammoniumbicarbonate buffer (TEAB) to afford 19a-b in approximately 30 % yield in triethyammonium salt form.136 Compounds 19a-b were found to readily dissolve in the millimolar concentration range in DMSO and water. In opposition to the propensity of guanosine and its derivatives to gel or precipitate in solution, this work demonstrated that a carefully selected template is sufficient to solubilize four guanosine nucleosides on an individual template in the absence of the solubilizing sugar-phosphate backbone present in RNA and DNA oligonucleotides.137-139 Compounds 19a-b, in addition to compounds 3a and 7 described in Chapter 2 represent early examples of water-soluble templates coupled to four guanine containing residues, and were unprecedented in the literature when this work was O HO N3 NH NN N O NH2 OH O N3 NH NN N O NH2 O O 17 18 73 % MeO OMe toluenesulfonic acid acetone, 12h! 79 undertaken. A peptidic template has been functionalized with triazole-linked guanosine residues and has also demonstrated water-solubility.140    3.4  Preliminary Characterization of Triazole-Linked Cavitand-  Guanosine Conjugates    Both cavitand-guanosine conjugates described here showed well resolved signals in the 1H NMR spectrum in deuterated DMSO. Full signal assignments could be made under these conditions from two-dimensional NMR correlational spectroscopy 1H 1H COSY experiments (Sections 3.5-6). Diol 19a demonstrated ideal NMR properties in contrast to isopropylidene 19b and facilitated the collection of a quality 13C NMR spectrum in (CD3)2SO and of a quality 1H NMR spectrum in D2O. Isopropylidene 19b gave broadened and uninterpretable NMR spectra for 13C and 1H in (CD3)2SO and D2O, respectively. This broadening was ascribed to aggregation of the compound in solution.141  Variable temperature NMR experiments were conducted in an effort to denature intermolecular aggregation of 19b (Figure 3.2) Improved resolution was observed at temperatures of 55 and 85 °C, and diol 19a is shown in comparison. Circular dichroism (CD) spectroscopy is a highly sensitive technique widely utilized to confirm the existence and conformation of G-quadruplex DNA.142 Furthermore, lypophilic TASQs were observed to give rise to characteristic CD spectra in chloroform.92 However, the   ! 80  Scheme 3.3  Synthesis of triazole-linked cavitand-guanosine conjugates.    O OO O O OOO HH O OOO O O O O HH P P P P OHO OH HO O OH OHO OH OHO OH NN N R N NN R NN N R N NN R O HO N3 NH NN N O NH2 OH 17 O N3 NH NN N O NH2 O O 18 O OO O O OOO HH O OOO O O O O HH P P P P OHO OH HO O OH OHO OH OHO OH nucleoside CuSO4•5H2O Na ascorbate DMSO, 20h, 70oC 16 nucleoside = R = O HO NH NN N O NH2 OH O NH NN N O NH2 O O product = R = 19a 31 % 19b 34 %! 81 successful acquisition of any significant signal in the CD spectra for compounds 19a-b over a wide range of conditions, including variations in concentration, cation identity, and pH, in aqueous solution was not possible. This information suggests that the water- soluble triazole-linked cavitand-guanosine conjugates synthesized here do not possess high G-tetrad forming potential.                  ! 82 Figure 3.2  Variable temperature 1H NMR spectra of 2mM solutions in D2O at 400 MHz for a)   diol 19a and b) isopropylidene 19b.     55 oC! 85 oC! 25 oC! a)! 55 oC! 85 oC! 25 oC! b)!! 83 3.5  Experimental Procedures  General Procedures. General procedures outlined in section 2.5 Experimental Procedures were followed with additions given below. Dimethylformamide, toluene, and dimethylsulfoxide were dried over 3 Å molecular sieves. Triethylammonium bicarbonate buffer (TEAB) was prepared by bubbling sublimed CO2 through a 2 M solution of triethylamine in Milli-Q water at 4 °C until the solution reached pH 8. Synthesis of cavitands 11-16 was based on a synthetic route shown previously.125 A synthetic route to compound 19b had been established prior.143 General numbering conventions used for assignment of NMR spectra are given below.     Cavitand 11. To a stirred solution of cavitand 10 (9.88 g, 9.11 mmol, 1 eq) and imidazole (12.42 g, 182.4 mmol, 20 eq) coevaporated two times in 50 mL of dimethylformamide / toluene 1:1 and dissolved in 200 mL of dimethylformamide was added t-butyldimethylsilyl chloride (20.63 g, 136.9 mmol, 15 eq) under an argon O O O HoutHin 4 a b c d N O HO NH NN N O NH2 OH N N e 2' 3' 4' R triazole 1' 5' 8 aryl O PHO O OH R =! 84 atmosphere. The reaction was maintained for 22 hours, 20 mL of water was added, and the reaction was stirred for 30 min further. Solvent was removed by rotary evaporation. The residue was dissolved in 400 mL of chloroform, washed three times with 100 mL of water, and dried with anhydrous MgSO4. After removal of the solvent by rotary evaporation, the residue was dissolved in dichloromethane and embedded on silica. Purification by silica gel column chromatography with ethyl acetate / hexanes 1:50 gave 9.69 g (69 % yield) of 1 as a white solid.  1H NMR (400 MHz, CDCl3) δ = 7.06 (s, 4H, aryl), 5.97 (d, J = 7.5 Hz, 4H, Hout), 4.89 (t, J = 8.0 Hz, 4H, CH-a), 4.41 (d, J = 7.5 Hz, 4H, Hin), 3.72 (t, J = 6.5 Hz, 8H, CH2-d), 2.28 (m, 8H, CH2-b), 1.59 (m, 8H, CH2-c), 0.95 (s, 36H, t-butyl), 0.10 (s, 24H, dimethyl); 13C NMR (101 MHz, CDCl3) δ = 152.3, 139.2, 119.1, 113.7, 98.6, 62.5, 37.2, 30.6, 26.2, 26.1, 18.5, -5.1; HRMS (ESI) Calculated for C68H101O12Si4Br4 (M+H) +: 1539.3083; found: 1539.3123.  Cavitand 12. To a stirred solution of cavitand 11 (3.00 g, 1.95 mmol, 1eq) coevaporated two times in 150 mL of tetrahydrofuran / toluene 1:1, one time with 100 mL of tetrahydrofuran, and dissolved in 450 mL of tetrahydrofuran, was added dropwise n- butyllithium (10 mL, 1.6 M solution in hexanes, 16 mmol, 8.2 eq) under an argon atmosphere at −78 °C. After stirring for 10 minutes, trimethyl borate (2.2 ml, 19 mmol, 9.7 eq) was added, and the solution was allowed to warm to room temperature over 3 hours. The reaction mixture was cooled to −78 °C, and a 90 mL solution of 1.5 M NaOH in 15% H2O2 was added. The reaction mixture was allowed to warm to room temperature ! 85 over 3 hours and stirring was continued overnight. Excess H2O2 was neutralized by the careful addition of Na2S2O5 (20.00 g, 105.2 mmol, 54 eq) in portions at 0 °C. The solvent was removed by rotary evaporation, and the residue was suspended in water and suction filtered. Purification by silica gel column chromatography with ethanol / dichloromethane 1:10 then 1:5 gave 1.38 g (55 % yield) of 12 as a white solid.  1H NMR (300 MHz, CDCl3) δ = 6.65 (s, 4H, aryl), 5.97 (d, J = 7.0 Hz, 4H, Hout), 4.74 (t, J = 8.0 Hz, 4H, CH-a), 4.45 (d, J = 7.0 Hz, 4H, Hin), 3.71 (t, J = 6.5 Hz, 8H, CH2-d), 2.24 (m, 8H, CH2-b), 1.59 (m, 8H, CH2-c), 0.95 (s, 36H, t-butyl), 0.09 (s, 24H, dimethyl), 4 phenolic protons not observed due to exchange; 13C NMR (101 MHz, CDCl3) δ = 142.2, 141.0, 138.5, 110.2, 99.9, 62.8, 36.4, 30.8, 26.2, 25.9, 18.6, -5.1; HRMS (ESI) Calculated for C68H105O16Si4 (M+H) +: 1289.6480; found: 1289.6467.  Cavitand 13. To a stirred suspension of cavitand 12 (1.10 g, 0.853 mmol, 1 eq) and anhydrous potassium carbonate (2.40 g, 17.4 mmol, 20 eq) in 60 mL of acetone was added propargyl bromide (1.5 mL, 80 % w/w propargyl bromide in toluene, 14 mmol, 16 eq) under an argon atmosphere. The reaction mixture was refluxed for 24 hours. The solvent was removed by rotary evaporation. The residue was suspended in 100 mL of dichloromethane and stirred for 30 minutes at 35 °C. The resultant precipitate was removed by gravity filtration and the mother liquor was concentrated. Purification by silica gel column chromatography with methanol / dichloromethane 1:100 gave 0.92 g (75 % yield) of 13 as an off-white solid.  ! 86 1H NMR (300 MHz, CDCl3) δ = 6.82 (s, 4H, aryl), 5.90 (d, J = 7.0 Hz, 4H, Hout), 4.75 (t, J = 8.0 Hz, 4H, CH-a), 4.61 (d, J = 2.5 Hz, 8H, CH2-e), 4.40 (d, J = 7.0 Hz, 4H, Hin), 3.71 (t, J = 6.5 Hz, 8H, CH2-d), 2.48 (t, J = 2.5 Hz, 4H, alkyne), 2.23 (m, 8H, CH2-b), 1.60 (m, 8H, CH2-c), 0.95 (s, 36H, t-butyl), 0.09 (s, 24H, dimethyl); 13C NMR (101 MHz, CDCl3) δ = 148.4, 143.7, 138.8, 114.8, 99.7, 79.6, 75.0, 63.0, 61.0, 36.4, 30.9, 26.2, 26.1, 18.6, - 5.0; HRMS (ESI) Calculated for C80H113O16Si4 (M+H) +: 1441.7106; found 1441.7133.  Cavitand 14. To a stirred solution of cavitand 13 (900 mg, 0.624 mmol, 1 eq) in 40 mL of tetrahydrofuran was added tetrabutylammonium fluoride (7.5 mL, 1.0 M solution in tetrahydrofuran, 7.5 mmol, 12 eq) at 0 °C. The reaction was warmed to room temperature and maintained for 2 hours. The solvent was removed by rotary evaporation, and the residue was embedded on silica gel. Purification by silica gel column chromatography with ethanol / ethyl acetate 1:10 gave 578 mg (94 % yield) of 14 as a white solid.  1H NMR (400 MHz, CDCl3) δ = 6.98 (s, 4H, aryl), 5.91 (d, J = 7.0 Hz, 4H, Hout), 4.76 (t, J = 8.0 Hz, 4H, CH-a), 4.62 (d, J = 2.5 Hz, 8H, CH2-e), 4.42 (d, J = 7.0 Hz, 4H, Hin), 3.79 (t, J = 5.5 Hz, 8H, CH2-d), 2.49 (t, J = 2.5 Hz, 4H, alkyne), 2.39 (m, 8H, CH2-b), 1.63 (br, 8H, CH2-c), 1.26 (br, 4H, OH); 13C NMR (101 MHz, (CD3)2SO) δ = 147.4, 142.8, 138.7, 116.6, 99.2, 79.6, 78.2, 60.4, 60.4, 36.7, 30.9, 25.4; HRMS (ESI) Calculated for C56H57O16 (M+H) +: 985.3647; found: 985.3677.  Cavitand 15. To a rapidly stirred suspension of cavitand 14 (125 mg, 0.127 mmol, 1 eq) and 1H-tetrazole (284 mg, 4.05 mmol, 32 eq) coevaporated two times in 2 mL of ! 87 tetrahydrofuran and dissolved in 10 mL of tetrahydrofuran was added dropwise di-t-butyl N,N-diethylphosphoramidite (0.58 mL, 2.1 mmol, 16 eq) under an argon atmosphere. The reaction was maintained for 1 hour. The reaction was cooled to -78 °C, and 0.4 mL of 30 % H2O2 was added. The reaction was allowed to warm to room temperature, and the solvent was removed by rotary evaporation. The residue was dissolved and extracted three times with 30 mL of dichloromethane from 50 mL of aqueous 5% Na2S2O5. The combined organic phase was washed with 50 mL of saturated NaHCO3 and 50 mL of brine, dried over anhydrous MgSO4, and the solvent was removed. Purification by silica gel column chromatography with methanol / dichloromethane / triethylamine 1:50:0.5 gave 180 mg (81 % yield) of 15 as a glassy solid.   1H NMR (400 MHz, CDCl3) δ = 6.82 (s, 4H, aryl), 5.89 (d, J = 7.5 Hz, 4H, Hout), 4.79 (t, J = 8.5 Hz, 4H, CH-a), 4.60 (d, J = 2.5 Hz, 8H, CH2-e), 4.39 (d, J = 7.5 Hz, 4H, Hin), 4.04 (m, 8H, CH2-d), 2.48 (t, J = 2.5 Hz, 4H, alkyne), 2.33 (m, 8H, CH2-b), 1.73 (m, 8H, CH2- c), 1.49 (s, 72H, t-butyl); 13C NMR (101 MHz, CDCl3) δ = 148.5, 143.7, 138.6, 114.8, 99.6, 82.2, 79.5, 75.1, 66.3, 60.9, 36.3, 30.0, 29.9, 25.7; HRMS (ESI) Calculated for C88H124O28P4Na (M+Na) +: 1775.7127; found: 1775.7097.  Cavitand 16. To a stirred solution of cavitand 15 (139 mg, 79.3 umol, 1 eq) coevaporated two times in 2 mL of dichloromethane and dissolved in 5 mL of dichloromethane was added trifluoracetic acid (1.2 mL, 16 mmol, 200 eq) under an argon atmosphere. The reaction was maintained for 10 minutes. Removal of solvent by rotary evaporation and ! 88 coevaporation three times with 5 mL of methanol gave 102 mg (99 % yield) of 16 as a white solid.   1H NMR (300 MHz, CD3OD) δ = 7.10 (s, 4H, aryl), 5.86 (d, J = 7.5 Hz, 4H, Hout), 4.75 (t, J = 8.0 Hz, 4H, CH-a), 4.61 (d, J = 2.5 Hz, 8H, CH2-e), 4.38 (d, J = 7.5 Hz, 4H, Hin), 4.11 (br, 8H, CH2-d), 2.89 (t, J = 2.5 Hz, 4H, alkyne), 2.42 (m, 8H, CH2-b), 1.71 (br, 8H, CH2-c), 8 phosphoric protons not observed due to exchange; 13C NMR (101 MHz, CD3OD) δ = 149.9, 144.8, 139.8, 116.6, 101.3, 80.1, 76.7, 67.6, 61.7, 38.2, 30.2, 26.9; HRMS (ESI) Calculated for C56H59O28P4 (M-H) -: 1303.2143; found: 1303.2102.  Nucleoside 18. To a stirred suspension of nucleoside 17 (1.00 g, 3.23 mmol, 1 eq) and p- toluenesulfonic acid monohydrate (0.42 g, 3.9 mmol, 1.2 eq) in 25 mL of acetone was added 2,2-dimethoxypropane (4.0 mL, 33 mmol, 10 eq). The reaction was maintained for 12 hours. Concentrated aqueous ammonium hydroxide solution was added dropwise until the reaction mixture turned basic, and the resultant white precipitate was suction filtered. The precipitate was partitioned between 50 mL of chloroform and 50 mL of saturated aqueous NaHCO3 and extracted two times. The combined organic phase was washed with 50 mL of brine, dried over anhydrous MgSO4, and embedded on silica gel. Purification by silica gel column chromatography with ethanol / chloroform / triethylamine 1:4:0.05 gave 0.82 g (73 % yield) of 18 as an off-white solid.   General click synthetic procedure for triazole linked cavitand-nucleoside conjugates 19a-b. To a stirred solution of cavitand 16 (20 mg, 15 umol, 1 eq) and nucleoside 17 or ! 89 18 (66 umol, 4.4 eq) in 10 mL of argon purged dimethylsulfoxide was added a solution of copper(II) sulfate pentahydrate (0.65 mL, 0.008 M in argon purged Mili-Q water, 0.52 umol, 0.35 eq) and a solution of sodium ascorbate (1.3 mL, 0.04 M in argon purged Mili- Q water, 5.2 umol, 3.5 eq) under an argon atmosphere. The reaction was heated to 70 °C and maintained for 20 hours. Solvent was removed by rotary evaporation, and the residue was suspended in water, sonicated, and suction filtered. The resulting precipitate was dissolved in a 5 mL mixture of triethylamine / water 4:1, vortexed, and lyophilized. The crude product was dissolved in 0.01 M TEAB buffer and purified by ion-exchange chromatography on DEAE-cellulose (30 cm x 1.5 cm column, detection at 254 nm) with gradient elution (3 mL min-1, 0.5 M to 1 M TEAB buffer, 50 mins) followed by isocratic elution (1 M TEAB buffer). Reduction of the solvent followed by lyophilization afforded 19a-b in triethylammonium form as white powders.   19a. 16 mg (31 % yield); triethylamine was removed for collection of NMR spectra in (CD3)2SO by repeated coevaporation with (CD3)2SO: 1H NMR (400MHz, (CD3)2SO) δ = 8.08 (s, 4H, triazole), 7.84 (s, 4H, CH-8’), 7.37 (s, 4H, aryl), 6.53 (br, 8H, NH2), 5.86 (d, J = 7.5 Hz, 4H, Hout), 5.70 (d, J = 6.5 Hz, 4H, CH-1’), 4.94 (s, 8H, CH2-e), 4.74 (m, 8H, CH2-5’), 4.55 (m, 8H, CH-2’, CH-a), 4.24 (m, 8H, CH-4’, Hin), 4.18 (m, 4H, CH-3’), 3.92 (br, 8H, CH2-d), 2.38 (br, 8H, CH2-b), 1.53 (br, 8H, CH2-c), 20 protons not observed due to water suppression and / or exchange; 1H NMR (400MHz, D2O) δ = 7.66 (br, 8H, triazole, CH-8), 7.11 (s, 4H, aryl), 5.81 (br, 4H, CH-1’), 5.53 (br, 4H, Hout), 5.3-4.7 (overlap, 16H, CH2-e, CH2-5’), 4.61 (br, 4H, CH-2’), 4.43 (br, 8H, CH-a, CH-4’), 4.30 (br, 4H, CH-3’), 3.95 (br, 12H, CH2-d, Hin), 2.32, (br, 8H, CH2-b), 1.60, (br, 8H, CH2-c),  ! 90 28 protons not observed due to exchange; 13C NMR (101 MHz, (CD3)2SO) δ = 156.8, 153.6, 151.2, 147.5, 143.8, 143.3, 138.7, 136.2, 125.2, 117.0, 116.3, 99.3, 87.0, 82.5, 72.4, 71.1, 66.5, 64.8, 51.6, 37.5, 29.3, 25.6; ); 31P NMR (162 MHz, (CD3)2SO) δ = 1.1; MS (MALDI-TOF) calculated for C96H107N32O44P4 (M-H) -: 2535.6; found: 2537.8; HRMS (ESI) calculated for C96H105N32O44P4 (M-3H) -3: 844.5304; found: 844.5305.   19b. 18 mg (34 % yield); 1H NMR (400MHz, (CD3)2SO) δ = 8.03 (s, 4H, triazole), 7.83 (s, 4H, CH-8), 7.35 (s, 4H, aryl), 6.74 (br, 8H, NH2), 6.06 (br, 4H, CH-1’), 5.81 (br, 4H, Hout), 5.28 (br, 8H, CH-2’, CH-3’), 4.98 (m, 8H, CH2-e), 4.67 (br, 8H, CH2-5’), 4.49 (br, 8H, CH-a, CH-4’), 4.22 (br, 4H, Hin), 3.86 (br, 8H, CH2-d), 2.33 (overlap, 8H, CH2-b), 1.47 (s, 12H, methyl), 1.47 (overlap, 8H, CH2-c), 1.30 (s, 12H, methyl); MS (MALDI- TOF) calculated for C108H125N32O44P4 (M+H) +: 2697.7; found: 2699.5.   3.6  Supplementary 1H 1H COSY NMR spectra   Supplementary 1H 1H COSY NMR spectra begins on the following page. triazole! 8! aryl! NH2! out,1’ ! e 5’! in,4’,3’! d! b! c! 2’,a! Figure 3.3 !1H 1H COSY NMR spectrum of 19a in (CD3)2SO at 400 MHz. ! 91 O OO O O OOO HH O OOO O O O O HH P P P P OHO OH HO O OH OHO OH OHO OH NN N R N NN R NN N R N NN R R = O HO NH NN N O NH2 OHtriazole,8! aryl! 1’  out ! 2’! 4’,a,3’,in,d! b! c! e,5’! Figure 3.4 !1H 1H COSY NMR spectrum of 19a in D2O at 400 MHz. ! 92 O OO O O OOO HH O OOO O O O O HH P P P P OHO OH HO O OH OHO OH OHO OH NN N R N NN R NN N R N NN R R = O HO NH NN N O NH2 OHtriazole! 8! aryl! NH2! 1’ out ! e   5’    in! 4’,a! d! b! c! 2’,3’! 2Me! Figure 3.5 !1H 1H COSY NMR spectrum of 19b in (CD3)2SO at 400 MHz. ! 93 O OO O O OOO HH O OOO O O O O HH P P P P OHO OH HO O OH OHO OH OHO OH NN N R N NN R NN N R N NN R R = O NH NN N O NH2 O O! 94 Chapter 4: Discovery of Cation-Free Unimolecular Template- Assembled Guanine and Thymine Quartets in Methanol   4.1 Synopsis   Phosphate-linked cavitand-nucleotide conjugates functionalized at the feet position were evaluated for template-assembly of the corresponding nucleobases into hydrogen bonded quartet structures in methanol solvent. The conjugates were initially scanned by CD spectroscopy. Spectra of the conjugates in methanol were compared to spectra in a potentially denaturing aqueous solution and to spectra of base-protected analogue compounds. These data were used to argue that potential conjugate template- assembly was observed with the unprotected conjugate in methanol. Adenine and cytosine based cavitand-nucleotide conjugates displayed weak or no CD differences under the above conditions, and their characterization was not rigorous. However, guanine and thymine conjugates exhibited CD in methanol that was suppressed significantly in water or in the case of the guanine conjugate by blocking the base. Additional NMR characterization by proton 1D, NOESY, and ROESY experiments demonstrated that both guanine and thymine conjugates possessed downfield imino resonances with increased kinetic stability typically found for hydrogen bonded base pairs and contained syn aligned nucleobases. An additional ROE correlation between the imino and 5' methyl signal was found for the thymine conjugate in pure methanol, and ! 95 this established increasing support for a rare template-assembled thymine tetrad. Finally, DOSY NMR confirmed that the guanine and thymine conjugates exist as unimolecular species in solution. The methodologies employed in the synthesis of the conjugates here were shown not to be accompanied by any significant amount of sodium contamination by ICP-MS. All of this evidence together builds a strong case for the discovery of cation- free unimolecular template-assembled guanine and thymine quartets in methanol.   4.2 Circular Dichroism of Phosphate-Linked Cavitand-Nucleotide  Conjugates at Feet Position   Circular dichroism (CD) is a type of chiroptical spectroscopy whereby a non- racemic sample of a chiral compound exhibits differential absorption between left and right circularly polarized light.144 In addition to its use for the assignment of the absolute configurations in organic molecules, this highly sensitive technique has found widespread application in the study of nucleic acid and protein secondary structure.145,146 Analysis of G-quadruplex folding topology, which includes the elements of strand sense and stoichiometry, glycosidic bond orientation, and loop conformation, by CD is no exception.142,147-149 The interpretation of CD spectra of G-quadruplex DNA to date has been almost exclusively empirical with two G-quadruplex CD signatures being dominant in the literature. Parallel G-quadruplexes with all anti glycosidic bond conformations are characterized by respective positive and negative bands near to 260 and 240 nm. In ! 96 comparison, antiparallel G-quadruplexes with alternating anti / syn glycosidic bond conformations are characterized by positive and negative bands at approximately 290 and 260 nm, respectively.  The major CD bands characterizing G-quadruplex DNA have been explained recently to arise from exciton coupling between nearest stacked guanine bases in vertically adjacent planar G-tetrads (Figure 4.1).142 In this model, CD generating chiral   Figure 4.1 An exciton coupling interaction between electric transition dipoles (black) of two    adjacently stacked guanine bases in G-quadruplex DNA.    exciton couplings occur from the interaction between electric transition dipoles of intrinsically non-chiral guanine chromophores that are orientated close in space and at angles defined by the helical twist of layered G-tetrads. When one chromophore is located close in space and chirally oriented to a second chromophore, the resultant electric transition dipole interaction can give a CD enhancement significantly beyond that originating from the interaction between a chromophore and a non-chromophoric asymmetric carbon skeleton.144 The latter case is represented by the CD of nucleosides, ! 97 which are chiral molecules made up from a planar nucleobase chromophore and a furanose ring with high stereocenter density.150 Early studies involving CD spectroscopy of G-quadruplex DNA demonstrated that an induction and enhancement of the signature CD signal accompanied increasing potassium stabilization of the G-quadruplex.151,152 Loss of CD signal for potassium stabilized G-quadruplex DNA was correlated with thermal denaturation of the folded quadruplex secondary structure.  In consideration of the above discussion, a unimolecular guanine or other nucleobase quartet, such as that formed from a template-assembled system or that arising from free nucleoside association, should give rise to an induced CD through chiral exciton couplings between neighboring bases within the quartet plane (Figure 4.2).   Figure 4.2 Some potential exciton couplings in the two helical configurations of a single    nucleobase quartet.    A clockwise or a counterclockwise helical arrangement for a single nucleobase quartet is possible. Helically arranged bases of a single quartet would not however be expected to ! 98 be empirically interpretable relative to existing G-quadruplex CD spectra for the reason that base-stacked or strand-connected nucleosides are absent in these systems i.e., information about syn or anti dihedral angles cannot be inferred from these spectra.142 Some known and potential base quartets of the DNA bases are given (Figure 4.3).   Figure 4.3 Nucleobase quartets for a) guanine (common), b) adenine (rare), c) thymine    (rare), and d) cytosine (not known).       The requirement of the nucleobase to be part of a nucleoside or nucleotide should be emphasized here, since a quartet of the nucleobase alone is not sufficient to remove N N N N O N R H H H NN N N O N R H H H N N N N O N R H H H N N N N O N R H H H N N N N N R H H N N N N N R H H NN N N N R H H N N N N N R HH N N O O HH3C N N O O H CH3 N N N H H O N N N H H O N N NH H O N N N H H O R R R R N N O O H CH3 N N O O H H3C R R R R a) b) d)c)! 99 mirror plane symmetry. Chloroform soluble guanine and uracil template-assembled synthetic quartets are unimolecular in the absence of cations and display characteristic CD signatures.92,103 Thus, CD can be considered a useful diagnostic tool for the investigation of whether template-assembly is taking place. This conclusion can be aided by comparison to analogue compounds with restricted capacity for template-assembly or by comparison under denaturing conditions.  Accordingly, the propensity of methanol and water-soluble phosphate-linked cavitand-nucleotide conjugates 3a-d and 9a-c to template-assemble nucleotide quartets was investigated (Figure 4.4). Blocking the base exocyclic amino function, a potential hydrogen bond donating group, with benzoyl or isobutyryl protection was expected to accompany a loss of self-assembly for compounds 9a-c, and these blocked analogues were expected to show depressed CD spectra. As well, suppression of CD for unblocked cavitand-nucleotide conjugates 3a-d was supposed in a denaturing solvent, if one could be found. Thus, an enhancement in the CD spectrum of a cavitand-nucleotide conjugate relative to its blocked analogue or relative to a second solvent suggests that a self- assembly process, like that for a template-assembled nucleotide quartet, is active.   Circular dichroism spectra of cavitand-nucleotide conjugates dissolved in methanol or aqueous buffer were recorded along with spectra for the blocked analogue conjugates. Benzoyl protected compounds 9b-c did not demonstrate sufficient water solubility for comparison. In the case of adenine derived cavitand-nucleotide conjugates 3b and 9b, poor signal to noise ratios were apparent. Significant magnitude differences were absent in the CD spectra for the unblocked conjugate 3b with respect to benzoyl protected conjugate 9b or between different solvents (Figure 4.5). A weak negative CD ! 100 that resides at approximately 280 nm for 9b and 265 nm and 255 nm for 3b in methanol and water respectively may be present in these spectra.  Figure 4.4 Phosphate-linked cavitand-nucleotide conjugates at feet position.  OO O OO O O O H H CH3 H3C CH3 CH3 O O OO H H O RHO O P O RHO O O OP O O RHO OO P O O RHO O O P O O NBu4 NBu4 NBu4 NBu4 N NN N NH NN N N N HN O NH N O O H3C 9a, R = GIbu 9b, R = ABz 9c, R = CBz 3d, R = T O HN O N H O O N NN N NH NN N N N NH2 O 3a, R = G 3b, R = A 3c, R = C NH2 NH2 O! 101 Figure 4.5 CD spectra of adenine conjugate 3b in methanol (red) and in 10 mM Tris-borate    pH 8 buffer (blue) and of blocked adenine conjugate 9b in methanol (green).     Adenine tetrads in solution stabilized as part of adjacent G-quadruplex structures have been proposed by a only a few groups with Patel et al.'s NMR studies being the most convincing.105,106   Methanolic CD spectra of the remaining unblocked pendant functionalized conjugates 3a and 3c-d with guanine, cytosine, and thymine bases, were compared to aqueous CD spectra and to CD spectra of blocked analogues 9a and 9c. Guanine 3a displayed pronounced magnitude enhancement and wavelength maxima shifts for both positive and negative CD bands in methanol as compared to water, and this enhancement  ! 102  Figure 4.6 CD spectra of guanine conjugate 3a in methanol (red) and in 10 mM Tris-borate    pH 8 buffer (blue) and of blocked guanine conjugate 9a in methanol (green) and    in 10 mM Tris-borate pH 8 buffer (orange).      was not observed for blocked guanine conjugate 9a in methanol or in water (Figure 4.6). Interestingly, the positive CD at 290 nm and negative CD at 260 nm displayed by guanine 3a in methanol reproduced the antiparallel G-quadruplex CD signature. These Cotton effects constitute significant wavelength and magnitude shifts relative to free guanosine nucleoside.150 Cytosine conjugate 3c showed a change in magnitude for its positive band in methanol in relation to the spectrum recorded in water (Figure 4.7). Differences in magnitude and in CD maxima wavelengths were demonstrated for blocked cytosine conjugate 9c. Thymine ! 103 Figure 4.7 CD spectra of cytosine conjugate 3c in methanol (red) and in 10 mM Tris-borate    pH 8 buffer (blue) and of blocked cytosine conjugate 9c in methanol (green).    conjugate 3d, when dissolved in methanol, exhibited enhancement in its respective negative and positive CD bands situated at approximately 220 and 270 nm (Figure 4.8).   Observation of CD enhancement suggests that a self-assembly process is operating but does not constitute proof of tetrad assembly. Enhancements in CD structure were most apparent in methanolic solutions of guanine 3a and thymine 3d, and the potential template-assembled behaviour of these conjugates was further characterized by NMR spectroscopy.  ! 104 Figure 4.8 CD spectra of thymine conjugate 3d in methanol (red) and in 10 mM Tris-borate    pH 8 buffer (blue).    4.3 NMR Spectroscopy of Phosphate-Linked Cavitand-Nucleotide  Conjugates in Methanol   The imino proton region in the proton NMR spectrum provides a convenient diagnostic window for strand association and folding in nucleic acids. For example, in duplex DNA, the imino proton resonances of thymine and guanine in hydrogen bonded Watson-Crick G!C and A!T base pairs are typically found in the 12 to 14 ppm range, whereas intitial NMR studies on G-quadruplex DNA, showed imino resonances to be ! 105 relatively upfield with chemical shifts between 10.5 and 12.5 ppm.15,153 Appearance of these downfield imino resonances in buffer is indicative of hydrogen bonded base pairing in nucleic acid structure. Chemical exchange between hydrogen bonded imino protons and solvent molecules is believed to proceed through an opening of the base pair, and catalysis for this exchange process by nitrogen-containing general bases results in exchange line broadening.154,155 Because quaternary ammoniums do not possess lone pairs and are thus not Lewis bases, preparation of phosphate-linked cavitand-nucleotide conjugates as quaternary ammonium salts was advantageous for studying the dynamics of the imino proton by NMR spectroscopy. Indeed, imino resonances for guanine conjugate 3a and thymine conjugate 3d were resolved as lone singlets in methanol solvent in the 11-12 ppm region (Figure 4.9). Resolution of the imino resonance was improved for   Figure 4.9 1H NMR spectra in 9:1 CH3OH / CD3OD at 400 MHz for a) guanine conjugate 3a    at -25 °C, b) thymine conjugate 3d at 25 °C, and c) 5'-TBS-2'-deoxythymine at    -25 °C.  a)! b)! c)!! 106 guanine conjugate 3a by cooling to -25 °C. In comparison, the imino resonance of free nucleoside control compound, 5' TBS protected thymidine, was not observed in methanol solvent even at low temperature. Thus, the fact that this resonance is observed and is present in the characteristic downfield region is highly suggestive that guanine and thymine bases of conjugates 3a and 3d are taking part in hydrogen bonded base pairing with exclusion of solvent molecules.   Examination of the 1H NMR spectra for all phosphate-linked tetra-substituted nucleotide conjugates 3a-d and 9a-c in methanol reveals that each chemical shift nonequivalent resonance of the nucleoside or cavitand is found to belong to one set of signals (Chapter 2, Section 2.5-6). For example, only one signal is seen for the cavitand aryl proton, the nucleoside CH-1' proton, or the H-8 proton in guanine conjugate 3a despite four-fold nucleotide conjugation to the cavitand template. That all conjugate nucleotides exist in identical chemical environments is a requirement of C4 symmetry or equivalence through a rapid process. Nucleobase quartets share a common C4 symmetry axis directed through the center of the quartet orthogonal to the quartet plane, and this symmetry element would be retained in a unimolecular template-assembled nucleobase quartet (Figure 4.10). This NMR symmetry is characteristic of known unimolecular template-assembled quartets.91,103  Conformational analysis of G-quadruplex DNA is routinely performed by nuclear Overhauser effect spectroscopy (NOESY) NMR.156 In the NOE experiment, information about the spatial proximity between different nuclei interacting through dipolar coupling is provided. The intensity of a dipolar interaction between two different nuclei is inversely dependent on the internuclear distance to the sixth power. ! 107 Figure 4.10 A C4 axis of symmetry is preserved between a) a single nucleobase quartet and    b) a template-assembled single nucleobase quartet.     The presence of a syn glycosidic bond conformation is detected using a 2D NOESY protocol when a NOE cross peak between the CH-1' resonance of the ribose sugar and the H-8 resonance of the guanine base exists (Figure 4.11).15 A NOE correlation indicating a syn conformation was found for guanine conjugate 3a in deuterated methanol at -25 °C. Previously reported template-assembled synthetic quartets have existed as syn conformers.91,103,140   For large molecules, NOE cross peaks may not be observable in the NOESY NMR experiment. The rotating frame Overhauser effect spectroscopy (ROESY) experiment alleviates this complication by improving sensitivity through the provision of positively phased cross peaks.157 Comprehensive structural assignment of thymine conjugate 3d in pure methanol  C4 C4a) b)! 108 Figure 4.11 a) Glycosidic bond syn conformation gives rise to NOE correlation between    guanine base and sugar protons. b) 2D NOESY spectrum in CD3OD at 400 MHz    for guanine conjugate 3a at -25 °C indicating syn conformation. Mixing time was    800 ms.     was pursued by a 2D ROESY experiment with simultaneous methanol signal suppression (Figure 4.12). Observed ROE cross peaks between the imino and 5' methyl resonances and between the H-6 and CH-1' resonances support the existence of a planar template- assembled thymine tetrad with syn glycosidic conformers. Full characterization of a thymine tetrad has only been reported recently for a cation stabilized T-tetrad capped G- quadruplex DNA.158   1' N N N HN O H2N N N N NH O NH2 O H HO H 8 syn 1'O H HO anti H 8 a)! b)! 1’! 8!! 109 Figure 4.12 Observed ROE correlations in 2D ROESY NMR experiment in 9:1 CH3OH /    CD3OD at 400 MHz for thymine conjugate 3d at -15 °C. A ROESY spin-lock pulse   of 800 ms was used.   N N O O H CH3 N N O O H H3C N N O O HH3C N N O O H CH3 OHO H H O OH H O OH H O OH H H H H O P O O O O P O O O O P O O O O PO OO 1' 6 5 imino 6! 1’! 5 ! imino! 5!! 110 4.4 Diffusion Ordered NMR Spectroscopy of Phosphate-Linked  Cavitand-Nucleotide Conjugates in Methanol   Diffusion ordered NMR spectroscopy or DOSY is an important type of pulsed field gradient NMR and has become increasingly utilized for the evaluation of the size and shape of molecular aggregates in solution by means of measuring translational diffusion coefficients.159,160 Applications of DOSY in the study of nucleobase assemblies include the determination of precise lengths for cylindrical G-quartet stacks of 5'-GMP in basic solution, of stoichiometries of several cation-templated lipophilic guanosine- derived assemblies, and of guanine and uracil dimerization for template-assembled synthetic quartets in chloroform.92,103,161,162   The translational diffusion of a spherical molecule in a medium is defined by the Stokes-Einstein equation: !! = ! !" 6!"!!  Where D is the diffusion coefficient, k is the Boltzmann constant, T is the temperature, η is the viscosity of the medium, and rs is the hydrodynamic radius of the molecule. For two spherical molecules with different hydrodynamic radii existing in the same environment at constant temperature, it can be seen clearly from this expression that the smaller molecule will diffuse at a faster rate and thus be quantified by a greater diffusion coefficient.  ! 111  The simplest pulse sequence that can be used to measure diffusion is the pulsed gradient spin echo experiment first developed by Stejskal and Tanner in 1965.159,164 Application of two magnetic field gradient pulses separated by a time interval allows labeling of nuclear positions in a sample and an extraction of a diffusion coefficient. An exponential decay of the signal intensity, I is observed during the course of the experiment and is described by the following equation: !! = ! !!!!!!! !!!!!(!!!/!) Where I0 is the unperturbed signal intensity, γ is the gyromagnetic ratio for the observed nucleus, g is the gradient strength, δ is the length of the gradient pulse, and Δ is the diffusion time. The decay of the signal intensity as a function of gradient strength is measured at constant temperature and at a defined solute concentration with optimized values for the gradient pulse length and diffusion time, and this allows a determination of a diffusion coefficient for the solute.   Circular dichroism and NMR studies described in previous sections have provided strong evidence that guanine and thymine conjugates 3a and 3d exist as hydrogen bonded self-assemblies with defined conformation in methanol solvent. However, it is not clear from these studies alone whether the assemblies are intermolecular or intramolecular by nature. Using 2D DOSY methods, diffusion coefficients were measured for phosphate- linked cavitand-nucleotide conjugates 3a and 3c-d and the blocked analogues 9a and 9c in order to ascertain whether intermolecular self-association was taking place for samples of these compounds (Figure 4.13, Table 4.1). The base-blocked analogue was chosen as an ideal control compound for DOSY experiments, since its hydrogen bonding capacity   ! 112 Figure 4.13 Data points from a 2D DOSY NMR experiment in CD3OD at 400 MHz for a 7.1    mg/mL solution thymine conjugate 3d at 25 °C show the decay of signal intensity    as a function of gradient strength. Curve fitting (blue) gave a diffusion coefficient    of 2.72 × 10-10 m2s-1.     has been removed. Thus, nucleobase mediated intermolecular hydrogen bonding between different molecules in solution should be excluded for a sample of the control compound. If identical diffusion coefficients are measured between the unblocked compound and the blocked control compound, for example between conjugates 3a and 9a, then it can be assumed that both compounds are associated to the same extent in solution. Furthermore, nucleobase assembly in the unblocked compound, in this example 3a, must be of a single template-assembled guanine quartet. 0.0! 0.2! 0.4! 0.6! 0.8! 1.0! 0! 5! 10! 15! 20! 25! 30! 35! si gn al  in te n si ty ! gradient (G/cm)!! 113 Table 4.1 Diffusion coefficients, D for 7.1 mg/mL methanolic solutions of phosphate-linked    cavitand-nucleotide conjugates at 25 °C.     The diffusion coefficients for the unblocked and isobutyryl protected guanine based conjugates 3a and 9a were determined to be 2.54 and 2.56 × 10-10 m2s-1 respectively, and these differ by less than 1 %. Similarly, a 1 % discrepancy is seen for cytosine derived conjugates, and here diffusion coefficients were found to be 2.67 × 10-10 m2s-1 and 2.64 × 10-10 m2s-1 for 3c and 9c.  Dimerization via nucleobase elements represents the first potential level of self-association, and a dimer species would be expected to display a diffusion coefficient of approximately 79 % of the control compound according to an inverse cube root dependence between the ratios of diffusion coefficients, D and molecular weights, M for two different spherical molecules:92,103,165 !! !! != ! !! !! !  For thymine conjugate 3d, no blocked analogue was synthesized. However, its diffusion coefficient of 2.72 × 10-10 m2s-1 is 97-98 % of fellow pyrimidine compounds 3c and 9c, compound base D / 10-10 m2s-1 3a G 2.54 9a GIbu 2.56 3c C 2.67 9c CBz 2.64 3d T 2.72! 114 and it is reasonable to conclude that thymine conjugate 3d exists in an identical extent of association as 3c and 9c. The simplest conclusion to be made from the DOSY data presented here is that all guanine, cytosine, and thymine derived cavitand-nucleotide conjugates exist as unimolecular species in methanol solvent. Therefore, unimolecular guanine and thymine template-assembled nucleotide quartets have been synthesized (Figure 4.14).   Figure 4.14 Cartoon representations of unimolecular template-assembled nucleobase    quartets by guanine conjugate 3a (blue) and thymine conjugate 3d (red). The    cavitand (black) has its concave surface directed away from the quartet.    4.5 The Role of Cations in Template-Assembly   It is well understood that assembly of G-rich oligonucleotides and guanosine monophosphates in water and of guanosine nucleosides in lypophilic systems into G- quartet and G-quadruplex structures is highly dependent on metal cation stabilization.166 ! 115 Reports exist for G-quartets forming from free or template bound nucleosides in the absence of cations in organic solvent and in the solid-state, but these are relatively rare.91,167,168 Therefore, an analysis of potential metal contaminants accompanying the production of phosphate-linked cavitand-nucleotide conjugates by newly developed phosphite triester and phosphoramidite synthetic methodologies was carried out (Chapter 2, Section 2.5). Inductively coupled plasma mass spectrometry (ICP-MS) on selected samples of conjugate was performed (see Section 4.6). Sodium is persistent in the environment, and for example, the sodium atom was found to make up only 6.1 mol % for a sample of thymine conjugate 3d. Additional G-quartet stabilizing metal contaminants such as potassium were not assumed to be significant based on their absence in the synthetic preparation and in the purification methods employed. Stoichiometrically, there is a four to one molar ratio between guanine base and G-quartet stabilizing cation, and large molar excesses of cation are normally required to induce guanine assembly in aqueous media. The synthetic preparations of phosphate-linked cavitand-nucleotide conjugates here were shown to produce less than 10 mol % sodium contamination, and self-assembly behavior by any of these conjugates can be regarded as being metal cation independent.      ! 116 4.6 Experimental Procedures   Circular dichroism spectroscopy was performed using a Jasco J-815 CD spectrometer. Samples were prepared in the 0.01 to 0.02 mM concentration range in 10 mM Tris-borate pH 8 buffer or methanol in a 1 cm cell. Millipore water or spectroscopic grade methanol was used in the preparation of these solutions. The ROESY NMR experiment was performed by incorporating a water suppression enhanced through T1 effects (WET) pulse sequence into a standard Bruker 2D ROESY program to suppress both methanol signals. A standard Bruker program was used for 2D DOSY experiments. Big delta and little delta values were optimized to 100 ms and 4 ms respectively for all experiments. Gradient strength was increased over 16 steps from 2 % to 95 %. Diffusion coefficients were obtained from the signal intensity decay of the ribose sugar 1' proton as a function of gradient strength after curve fitting using the XWINNMR SimFit algorithm. Sodium analysis was performed on a Thermo Fisher Element XR ICP-MS. Samples of 1- 2 mg of conjugate were dissolved in 1% trace element nitric acid and diluted accordingly. Concentrations of sodium in the conjugate samples were determined using standard addition after calibration with sodium-23 and indium-115 internal standards and subtraction from a control sample.     ! 117 Chapter 5: Template-Assembled Isolation of a Guanine Tetrad in Water and its Application as an Artificial Receptor for G-quadruplex Binding Ligands   5.1  Synopsis   A phosphate-linked cavitand-nucleotide conjugate functionalized at the rim position was evidenced to template-assemble a guanine tetrad in water. Support for this conclusion was provided for by CD, 1H NMR, DOSY, and NOESY NMR experimentation. A strong induced CD spectrum was observed relative to an analogue conjugate blocked at the base position. Analysis of the 1H NMR spectrum in water showed an imino proton signal characteristic for guanine-guanine Hoogsteen hydrogen bonding in G-quadruplex DNA and also allowed the assignment of the amino resonance. A syn glycosidic bond conformation was confirmed by a 2D NOESY experiment. Diffusion coefficients determined by 2D DOSY were shown to be indistinguishable between the free base and the blocked conjugate. Sodium content in a sample of conjugate was shown to be less than 10 mol % by ICP-MS. However, an investigation into the role that cations may play in stabilizing or binding to this template-assembled G- tetrad failed due to ambiguous CD and NMR data. A cation-free unimolecular template- assembled G-tetrad structure with one face exposed to solvent was proposed, and this ! 118 represents the first known observation of a single unstacked G-tetrad in aqueous solution. Next, the potential for this cavitand-nucleotide conjugate to act as an artificial receptor for small molecules known to inhibit telomerase and bind to G-quadruplex DNA was probed. Mixtures of conjugate and TMPyP4 ligand or conjugate and PIPER ligand displayed characteristic CD structure consistent with a G-tetrad-ligand interaction. Finally, a binding constant of 8.5 × 105 M-1 and 1:1 binding stoichiometry was measured by Scatchard and Job plots using UV / VIS spectrophotometry for TMPyP4.    5.2 Template-Assembled Isolation of a Guanine Tetrad in Water   An investigation of rim functionalized phosphate-linked cavitand-nucleotide conjugate 7, synthesized in Chapter 2, to template-assemble a guanine tetrad in water was carried out according to the experimental techniques, namely CD, 1H NMR, NOESY, and DOSY, outlined previously in the elucidation of template-assembled nucleobase tetrads in methanol (Figure 5.1; see Sections 4.2-6). A more rigorous theoretical discussion can be found there, and the arguments used therein to justify the possibility of these methanolic nucleobase quartets should be equally applicable to the situation of water- solubility described here. Cavitand-nucleotide conjugate 9a, which is blocked at its base exocyclic amino position with isobutyryl protection, has restricted hydrogen bonded self- assembly capability and was selected as a comparison compound.  ! 119 Figure 5.1 Phosphate-linked guanine base cavitand-nucleotide conjugates with unblocked    residues at the rim position and blocked residues at the pendant position.      Circular dichroism spectra of guanine conjugate 7 and of blocked conjugate 9a in methanol and buffer are given (Figure 5.2). Guanine conjugate 7 displays CD structure in methanol in accordance with pendant functionalized cavitand-nucleotide conjugates (see   OO O OO O O O H H CH3 H3C CH3 CH3 O O OO H H O GIbuHO O P O GIbuHO O O OP O O GIbuHO OO P O O GIbuHO O O P O O NBu4 NBu4 NBu4 NBu4 NH NN N GIbu = N H O O NH NN N G = NH2 O NBu4 7 O O OO O GHO O P O GHO O O OP O O GHO OO P O O GHO O O P O O O OO O O OOO HH O OOO HH CH3 CH3 CH3 CH3 NBu4 NBu4 NBu4 9a! 120 Figure 5.2 CD spectra of 0.02 mM guanine conjugate 7 in methanol (red) and in 10 mM Tris-   borate pH 8 buffer (blue) and of 0.02 mM blocked guanine 9a in methanol    (orange) and in 10 mM Tris-borate pH 8 buffer (green).    Section 4.2). Attention should be drawn to the dramatic CD enhancement displayed for guanine conjugate 7 in water with respect to control compound 9a. Strong CD induction in water was not found previously for either triazole-linked cavitand-guanosine constructs or a pendant-functionalized phosphate-linked cavitand-guanylate conjugate and thus, is a unique property to conjugate 7 (see Sections 3.4 and 4.2). Induction of CD is explained through exciton coupling between chromophores orientated both chirally and with close spatial proximity and provides evidence for helical self-assembly of guanine bases.142 Electronic transitions of the π-π* type in guanine give rise to two well resolved -40! -30! -20! -10! 0! 10! 20! 30! 40! 220! 240! 260! 280! 300! 320! 340! Δ ε (M - 1 c m - 1 )# λ (nm)#! 121 absorption bands in the UV region at approximately 250 and 279 nm. A wavelength of maximum absorption in the absorption spectrum for an exciton coupled chromophore typically corresponds to zero CD intensity with positive and negative CD on either side. Empirically, parallel G-quadruplex DNA shows a positive exciton coupling with a negative band at 240 nm and a positive band at 260 nm. In contrast, antiparallel G- quadruplex DNA is characterized by a 260 nm negative band and a 290 nm positive band. Two overlapping negative bands close to 240 and 255 nm and two overlapping positive bands at approximately 280 and 290 nm can be seen in the CD spectrum of conjugate 7 in water, and correspond to mixed empirical features of both parallel and antiparallel G- quadruplex DNA. However, care should be taken not to infer topological structure, for example glycosidic torsion angles, in this case, because an empirical interpretation of the CD of G-quadruplex DNA is limited to stranded systems of oligonucleotides. It is conceivable that the CD spectrum of 7 in water originates from two dominant overlapping positive exciton couplets centered near to the adsorption maxima of 250 and 279 nm for free guanine (Figure 5.3).  The 1H NMR spectrum for a solution of conjugate 7 in water exhibits a downfield guanine imino proton resonance that is observable at room temperature in the ppm range characteristic of G-quadruplex DNA and is resolved at lowered temperatures (Figure 5.4).15 Hoogsteen guanine-guanine hydrogen bonded base pairing slows chemical exchange between imino protons and water solvent molecules facilitating their observation in the NMR spectrum. A new broadened signal in the water suppressed 1H NMR spectrum at approximately 6.3 ppm also resolved by variable temperature was ! 122 Figure 5.3 Correlation of the Absorbance and CD spectra of guanine conjugate 7 in 10    mM Tris-borate pH 8 buffer.    assigned to the amino protons of the guanine base. Appearance of this signal as a single broadened peak indicates that the amino protons are chemically equivalent through fast bond rotation on the NMR time scale.169 Amino and imino protons localized to the 0.0! 0.5! 1.0! 1.5! 2.0! 220! 240! 260! 280! 300! 320! 340! A bs or ba nc e! λ (nm)! -40! -30! -20! -10! 0! 10! 20! 30! 40! 220! 240! 260! 280! 300! 320! 340! Δ ε (M - 1 c m - 1 )# λ (nm)# 250 nm! 279 nm! R 250 nm! 279 nm!! 123 terminal base pairing regions are often not seen in the NMR spectrum due to rapid exchange with solvent through strand fraying processes.170 It is noteworthy that the exchangeable base protons of conjugate 7 are kinetically stabilized despite a potential that one face of 7's guanine assembly is exposed to solvent molecules. The C4 symmetry requirement for a single template assembled guanine tetrad arrangement is satisfied by the appearance of one set of signals for all four nucleotides and the cavitand in the NMR for conjugate 7.  Figure 5.4 1H NMR spectra of guanine 7 in 9:1 H2O / D2O at 400 MHz for the a) imino region   and b) amino (black arrow) region with suppression of water by presaturation.      Two-dimensional NMR methods in deuterated water were utilized to gain information regarding the conformation and the extent of self-association for guanine 25 °C! 15 °C! 5 °C! b)! !! !! !! 25 °C! 15 °C! 5 °C! a)!! 124 conjugate 7. A syn glycosidic torsion angle is evidenced by an NOE correlation between the CH-1' ribose proton at 6.2 ppm and the H-8 base proton at 8.0 ppm in the 2D NOESY  Figure 5.5 a) Proposed G-tetrad assembly with syn glycosidic torsion angles for conjugate 7   indicating a NOE interaction between sugar and base protons. b) 2D NOESY    spectrum of 7 in H2O / D2O at 400 MHz and 5 °C with a mixing time of 800 ms.  N N N N O N H H H N N N N O N H H H N N N N O N H H H NN N N O NH H H O H O P O O O HO H O O P O O O OH O O P O O O OH OO PO OO HO imino amino 8 1' syn a)! b)! 1’! 8!! 125 NMR spectrum (Figure 5.5). Diffusion coefficients were measured by 2D DOSY experiments at 25 °C for 7.1 mg/mL solutions and were determined to be 1.43 × 10-10 m2s-1 for guanine 7 and 1.45 × 10-10 m2s-1 for blocked guanine 9a. The diffusion coefficients reported here match to within 98.7 % providing evidence that conjugate 7 is not associated in solution to any significant extent and is template-assembling a single intramolecular guanine tetrad in water.   Sodium content in a sample of guanine conjugate 7 was determined to be 8.3 mol % by ICP-MS analysis. Interestingly, CD spectra in buffer were unchanged in the presence of 50 mM NaCl or KCl (Figure 5.6). Furthermore, CD data for alkali and alkaline earth metal chlorides presented the same result (data not shown). Proton NMR spectra obtained for 7 dissolved in aqueous solutions of sodium or potassium chlorides or phosphates displayed considerable line broadening that rendered spectra uninterpretable (data not shown). Thus, it can be concluded that conjugate 7 templates a guanine quartet in the absence of cation stabilization. However, the role if any that cations such as sodium or potassium play in binding to this unimolecular template-assembled guanine quartet remains uncertain.        ! 126 Figure 5.6 CD spectra of 0.02 mM guanine conjugate 7 in 10 mM Tris-borate pH 8 buffer    (blue dashed) and in the presence of 50 mM NaCl (orange) or KCl (green).    5.3 Structural Significance of an Isolated Template-Assembled  Guanine Tetrad in Water   Experimental observations supporting the isolation of a single cation-free self- assembled guanine tetrad in water through the use of covalent template organization of four attached nucleotides have been described thus far. This work represents the first known example of an individual G-tetrad in aqueous solution. It is well understood that -40! -30! -20! -10! 0! 10! 20! 30! 40! 220! 240! 260! 280! 300! 320! 340! Δ ε (M - 1 c m - 1 )# λ (nm)#! 127 the assembly of guanine moieties through Hoogsteen hydrogen bonding into the canonical cyclic tetramer structure is intrinsically unstable in water. Reported structures for guanine assemblies involving oligonucleotides and nucleotides share two defining qualities in that G-tetrads are always found to be associated in stacks and that these assemblies depend on sodium or potassium stabilization.171 Template-assembly of G- quadruplexes has become a novel strategy for molecular preorganization, and several precedents exist in addition to the work presented here. Oligonucleotides have been organized into parallel G-quadruplex DNA through the use of tetra-end-linked and peptidic templates.94,95,97,98 As well, the same peptidic template has been functionalized with four guanosine residues, but was shown to direct a dimeric species in water.140   In the context of the thesis aims outlined previously, certain questions remain to be addressed (see Section 1.8). How closely does the guanine tetrad structure of this unimolecular template-assembled cavitand-nucleotide construct resemble human telomeric G-quadruplex DNA? Can this exposed G-quartet face act as a receptor for G- quadruplex binding ligands? Can a template-assembled synthetic G-quartet have practical applications, for example, in discovering potential anticancer therapeutics?  Examination of all reported human telomeric DNA G-quadruplex structures both in solution and in the solid-state demonstrates that folding of oligonucleotides comprising the TTAGGG repeat is polymorphic by nature. At the present time, the variability between these proposed structures precludes a firm conclusion with respect to the folding topology of human telomere DNA in vivo, and it is possible that several of these topologies exist in dynamic equilibrium in the cell. The first known human G-quadruplex solution structure was presented by Wang et al. for the 22mer oligonucleotide ! 128 d[AGGG(TTAGGG)3] in sodium solution. 39 The resultant structure was of a mixed antiparallel / parallel intramolecular G-quadruplex consisting of three G-tetrad stacks connected by lateral and diagonal loops. The glycosidic torsion angles were found to alternate within a strand and within each tetrad such that a syn / anti / anti / syn or anti / syn / syn / anti pattern was present. Later, Parkinson and coworkers reported that a Wang's 22mer human telomere sequence crystallized under physiological potassium concentrations into a self-folded parallel G-quadruplex with propeller loops and all anti conformations.40 An intermolecular dimeric G-quadruplex crystal structure with similar topologies otherwise for a shortened 12mer telomeric sequence in potassium was also included in this report. Potassium concentrations are greater at the intracellular level than sodium concentrations, and this fact was used to garner support for greater physiological relevance to potassium human G-quadruplex structures. However, an even newer G- quadruplex polymorphism was provided after solving the potassium solution structure for the 22mer human telomere DNA.172-174 This later intramolecular G-quadruplex was found to have mixed antiparallel / parallel strands with different loop regions and with a novel [3+1] glycosidic torsion angle motif. Two of the three stacked G-tetrads were syn / anti / anti / anti  and the remaining tetrad was anti / syn / syn / syn. DNA G-quadruplex formed from sequences found outside the telomere regions in the human genome, such as in oncogene promoters, has also gained interest as a target for anticancer drugs, and these G-quadruplexes show polymorphisms distinct from those of telomeres.175   The guanine tetrad templated by construct 7 shares structural similarities and differences to the tetrads formed within known human G-quadruplex DNA structures. Compound 7 conserves the chemical connectivities and composition of DNA, and It ! 129 contains 2'-deoxynucleotides with the correct 3' phosphate ester linkage. In contrast, the all syn G-tetrad observed for 7 is unique to the glycosidic torsion angle patterns observed for human telomeric DNA. Conjugate 7 is believed to possess an unobstructed G-quartet face that is exposed to solvent molecules. This face may provide a model for the terminal G-tetrad of G-quadruplex structures, which is often involved in end-stacking binding modes with interacting G-quadruplex binding ligands.53 The ligand binding potential of construct 7 is explored in the following section.   5.4 Application of a Water-Soluble Template-Assembled G-tetrad  as an Artificial G-quadruplex Binding Ligand Receptor   Potential interactions in solution between guanine conjugate 7 and two small molecules with well established G-quadruplex DNA binding affinity and telomerase inhibition were probed with CD spectroscopic and UV / Vis spectrophotometric methods (Figure 5.7). The cationic porphyrin and known telomerase inhibitor, TMPyP4, has been  demonstrated to interact with a diverse set of G-quadruplex polymorphisms.66- 68,70,72,73,176,177 Circular dichroism spectra for the interaction of TMPyP4 and 7 are shown (Figure 5.8). A strong induced negative CD band in the Soret region was observed for the porphyrin upon mixing with guanine conjugate 7 indicating its interaction.66 A change in the CD structure in the 220 to 300 nm range supports the notion that TMPyP4 is binding  ! 130 Figure 5.7 Small molecule G-quadruplex binders and telomerase inhibitors used to     probe the receptor potential of guanine conjugate 7.     to the G-tetrad of 7. Similarly, the perylene diimide based G-quadruplex stabilizing PIPER ligand exhibited G-tetrad mediated interaction with guanine conjugate 7 (Figure 5.9).65,178-181 Addition of PIPER ligand resulted in respective broad positive and negative induced CD at approximately 480 and 550 nm together with a change to the characteristic G-tetrad signal.   Quantitative analysis of the binding strength and stoichiometry between guanine conjugate 7 and TMPyP4 ligand was pursued using UV / VIS spectrophotometric methods. Scatchard analysis adapted from duplex DNA-drug binding studies has been successfully applied to TMPyP4 interactions with G-quadruplex DNA in solution.66,68,182 Free TMPyP4 has a wavelength of maximum absorption situated at 422 nm for its Soret band, and binding of the porphyrin is characterized by hypochromocity and a bathochromic N N O O O O N N H H PIPER N HN NH N N N N N TMPyP4! 131  Figure 5.8 CD spectra in water of guanine conjugate 7 alone (blue), TMPyP4 ligand alone    (red), and 7 and TMPyP4 mixed (orange). Concentrations were 0.01 mM.    shift. Optical monitoring of binding at 422 nm and fitting to the simple Scatchard equation allows a determination of an equilibrium binding constant, K for the interacting ligand and DNA receptor: !/!! != ! (! − !) where r is the binding ratio between porphyrin and DNA receptor, Cf is the concentration of unbound porphyrin, and n is the number of binding sites per DNA receptor. A binding constant is obtained from the slope of a line fit to a plot of r/Cf versus r. A Scatchard plot  -60! -40! -20! 0! 20! 40! 220! 260! 300! 340! 380! 420! 460! 500! Δ ε (M - 1 c m - 1 )# λ (nm)#! 132 Figure 5.9 CD spectra in water of guanine conjugate 7 alone (blue), PIPER ligand alone    (red), and 7 and PIPER mixed (orange). Concentrations were 0.01 mM.    for the binding of TMPyP4 to conjugate 7 gave a binding constant of 8.5 × 105 M-1 in accordance with binding constants reported in the 104-106 M-1 range for the interaction with G-quadruplex DNA containing both human and non-human telomere repeat sequences (Figure 5.10).68   The method of continuous variation was used in the construction of a Job plot (Figure 5.11).68,142 An inflection point centered above 0.5 mol fraction of ligand reflects a saturating stoichiometry that is slightly greater than 1:1 for TMPyP4 ligand to conjugate 7, and this is consistent with a value of n = 1.4 obtained from Scatchard's equation. Loss  -40! -20! 0! 20! 40! 220! 270! 320! 370! 420! 470! 520! 570! 620! 670! Δ ε (M - 1 c m - 1 )# λ (nm)#! 133 Figure 5.10 Scatchard plot monitored at 422 nm for the titration of 5 μM TMPyP4 ligand with    guanine conjugate 7 in 10 mM Tris-borate pH 8, 0.1 mM EDTA. The slope and y-   intercept of the resultant fitted line were -8.5 and 12 respectively. An R2 value of    0.98 demonstrated good linearity of the data points.    of absorbance or optical bleaching at 422 nm represents the removal of free ligand from solution. An optical bleaching plot demonstrates that ligand is almost fully bound at molar ratios greater than two for the artificial G-quadruplex binding ligand receptor 7 (Figure 5.12).   An end-stacking mode where one TMPyP4 molecule is π-π stacked onto the exposed face of the assembled G-tetrad of 7 is proposed (Figure 5.13).  0.0! 2.0! 4.0! 6.0! 8.0! 0.0! 0.5! 1.0! 1.5! 2.0! r/C f × 10 5" r"! 134 Figure 5.11 Job plot for the binding of guanine conjugate 7 with TMPyP4 ligand in 10 mM    Tris-borate pH 8, 0.1 mM EDTA. The normalized change in absorbance at 436    nm is shown as a function of mol fraction of TMPyP4 for mixed solutions of 7 and   TMPyP4 with fixed concentration at 5 μM. 436 nm corresponds to the maximum    bathochromic shifted Soret band observed for bound TMPyP4.     Some controversy exists in the literature with respect to the nature of binding of TMPyP4 to G-quadruplex DNA with intercalative, end-stacking, and even loop-stacking  models of binding being proposed. Phan et al. provided an NMR solution model of a terminally stacked TMPyP4 ligand with a parallel G-quadruplex formed from a c-myc oncogene promoter region sequence.72 In contrast, Wei and coworkers carried out spectroscopic investigations that supported multiple intercalative sites on a self-folded  0.0! 0.2! 0.4! 0.6! 0.8! 1.0! 0.00! 0.20! 0.40! 0.60! 0.80! 1.00! n o rm al iz ed  ΔA ! mol fraction TMPyP4!! 135 Figure 5.12 Bleaching plot for titration of 5 μM TMPyP4 ligand with guanine conjugate 7 in 10   mM Tris-borate pH 8, 0.1 mM EDTA monitored at 422 nm.    human telomere G-quadruplex.73 In a crystal structure complex with a parallel dimer G- quadruplex containing a human telomere repeat, the TMPyP4 ligand was found to stack to a TTA loop without direct interaction with the guanine bases.176   It has been shown here that guanine based cavitand-nucleotide conjugate 7 is an effective receptor for several small molecule ligands with telomerase inhibition and G- quadruplex stabilization properties. Furthermore, 7 can be considered a model for the guanine tetrads in G-quadruplex DNA, for example of the human telomeric type, and may find practical applications for potential antitumor drug development in the telomerase targeting regime.  0.0! 0.5! 1.0! 0! 1! 2! 3! 4! 5! bo u n d fra ct io n ! [compound 7] / [TMPyP4]!! 136 Figure 5.13 Cartoon representation of end-stacking of TMPyP4 ligand (orange) to the    exposed G-tetrad face (blue) of conjugate 7. The cavitand (black) has its concave   surface directed toward the quartet.    5.5 Experimental Procedures   Further information regarding CD, NMR, and ICP-MS experiments can be found in Section 4.6 Experimental Procedures. Procedures used in the construction of Scatchard, Job, and bleaching plots were adapted from those previously reported by Haq et al.68 A 10 mM Tris-borate pH 8 and 0.1 mM EDTA buffer was used for all optical binding studies. Scatchard analysis was carried out by titrating stepwise 5 µL aliquots of stock solution of guanine 7 in 5 µM TMPyP4 into a 500 µL solution of 5 µM TMPyP4 in a 1 cm cell at 25 °C. The cell was incubated for 5 minutes after each addition. The fractional decrease in absorbance ΔA, at 422 nm was calculated from the relationship ΔA ! 137 = (Afree − A) / (Afree − Asat), where Afree is the absorbance of the free porphyrin, A is the measured absorbance upon addition of 7, and Asat is the absorbance at saturation for 8:1 molar ratio of 7 to porphyrin. The fraction of bound porphyrin, α is taken directly as ΔA, and Cf is determined using Cf = C(1 − α), where C is the fixed total porphyrin concentration at 5 µM. The binding ratio r, was calculated using r = (C − Cf) / [7]. An equation of a straight line using the least-squares method was fit to the data points obtained from a simple Scatchard plot of r/Cf versus r.    ! 138 Chapter 6: Thesis Summary and Conclusions    Foreseeing the in vivo importance of the guanine tetrad would have been difficult at the time Gellert proposed his historic arrangement of guanine tetramers in aqueous gels formed from solutions of guanylic acid and sodium chloride.12 It is now understood that this characteristic cyclic arrangement of four hydrogen bonded guanine bases comprises the basic structural motif in G-quadruplex DNA, a putative biological DNA secondary structure unique from duplex B-DNA.54 Guanine-rich regions in the human genome, including those localized to telomeres and gene promoters, have a potential to form G- quadruplex structures. Much attention has been given to the discovery of small molecule G-quadruplex binding ligands that can stabilize G-quadruplex DNA and in turn inhibit the human telomere maintenance enzyme, telomerase. Telomerase inhibition via G- quadruplex ligand binding represents a novel strategy towards antitumor drug design.   G-quadruplex DNA is intrinsically unstable and requires the presence of cations, typically sodium or potassium, for strand association. Furthermore, the guanine tetrad or quartet assembly itself is also unstable, and has never been reported to exist as an unstacked single entity in water. A synthetic question was asked as to whether a single isolated guanine quartet could exist in its native water environment, and this question formed the inspiration for the research presented in the preceding chapters. Template- assembly of nucleobases by application of a cavitand template molecule was utilized as a synthetic strategy. ! 139  In Chapter 2, classical DNA synthetic methodologies were adapted to accomplish the synthesis of water and methanol soluble phosphate-linked cavitand-nucleotide conjugates through phosphite triester and phosphoramidite couplings. All four DNA nucleotides were successfully coupled four-fold onto an individual cavitand template through a DNA-like 3' phosphate linkage. The first known synthesis of an individual substrate tetra-functionalized with guanylate was achieved. In addition, some of these compounds provided early examples of water-soluble tetra-guanine conjugates. The phosphoramidite approach simplified deblocking steps and typically gave improved yields. In contrast, the phosphite triester strategy eliminated the synthesis and isolation of unstable phosphoramidites that require expensive starting materials. These synthetic procedures may find application for multiple couplings of oligonucleotides and non- nucleic acid elements, such as of peptides and sugar molecules.  Chapter 3 described a synthetic route to water-soluble cavitand-guanosine conjugates through installation of triazole-linked nucleosides on cavitands with phosphates located at the pendant position. Evidence for guanine quartet template- assembly was not obvious in these compounds during preliminary characterization experiments. Design changes with respect to water-solubilizing group position and linker structure may improve nucleobase template-assembly in these compounds.   A rigorous characterization in methanol solvent for phosphate linked cavitand- nucleotide conjugates functionalized at the feet position was described in Chapter 4. Circular dichroism spectroscopy was demonstrated to be a useful technique for probing potential nucleobase association through template-assembly processes. Assembly of the guanine and thymine conjugates was interpreted to be more significant than of the ! 140 adenine and cytosine conjugates. Further characterization through NMR methods and ICP-MS gave support for the isolation of cation-free unimolecular template-assembled guanine and thymine quartets in methanol. The possibility of cation binding in these compounds remains to be explored. Further investigation into whether cavitand templates assemble rare adenine or novel cytosine quartets should be pursued.  In Chapter 5, characterization by CD, NMR, and ICP-MS experiments provided evidence that a water-soluble phosphate-linked cavitand-nucleotide conjugate functionalized at the rim position was template-assembling an isolated guanine quartet. This result constituted evidence for the first time of a cation-free unstacked guanine tetrad in water. The role of sodium or potassium ion binding to this construct was concluded to be ambiguous. This water-soluble template-assembled guanine quartet may serve as a minimal model for human telomeric DNA and is believed to possess an exposed G- quartet face suitable for docking G-quadruplex binding ligands. Optical binding studies demonstrated that this construct can in fact act as an artificial G-quadruplex binding ligand receptor. Binding to known small molecule G-quadruplex ligands and human telomerase inhibitors TMPyP4 and Piper was shown. Interactions of this guanine conjugate with other ligands should be explored. The synthesis of template-assembled G- quartet and G-quadruplex structures and the study of potential interactions between these structures with small molecule ligands may provide opportunities for developing anticancer therapeutics in the future.  141 References  (1) Watson, J. D.; Crick, F. H. C. Nature 1953, 171, 737-738. (2) Watson, J. D.; Crick, F. H. C. Nature 1953, 171, 964-967. (3) Zamenhof, S.; Brawerman, G.; Chargaff, E. Biochim. Biophys. Acta 1952, 9, 402-405. (4) Wilkins, M. H. F.; Stokes, A. R.; Wilson, H. R. Nature 1953, 171, 738-740. (5) Franklin, R. E.; Gosling, R. G. Nature 1953, 171, 740-741. (6) Hoogsteen, K. Acta Crystallogr. 1959, 12, 822-823. (7) Hoogsteen, K. Acta Crystallogr. 1963, 16, 907-916. (8) Wing, R.; Drew, H.; Takano, T.; Broka, C.; Tanaka, S.; Itakura, K.; Dickerson, R. E. Nature 1980, 287, 755-758. (9) Drew, H. R.; Wing, R. M.; Takano, T.; Broka, C.; Tanaka, S.; Itakura, K.; Dickerson, R. E. Proc. Natl. Acad. Sci. U.S.A. 1981, 78, 2179-2183. (10) Bang, I. Biochem. Z. 1910, 26, 293. (11) Ralph, R. K.; Khorana, H. G.; Connors, W. J. J. Am. Chem. Soc. 1962, 84, 2265- 2266. (12) Gellert, M.; Lipsett, M. N.; Davies, D. R. Proc. Natl. Acad. Sci. U. S. A. 1962, 48, 2013-2018. (13) Donohue, J. Proc. Natl. Acad. Sci. U. S. A. 1956, 42, 60-65. (14) Zimmerman, S. B.; Cohen, G. H.; Davies, D. R. J. Mol. Biol. 1975, 92, 181-191. (15) Henderson, E.; Hardin, C. C.; Walk, S. K.; Tinoco, I.; Blackburn, E. H. Cell 1987, 51, 899-908. (16) Sen, D.; Gilbert, W. Nature 1988, 334, 364-366.  142 (17) Williamson, J. R.; Rachuraman, M. K.; Cech, T. R. Cell 1989, 59, 871-880. (18) Sundquist, W. I.; Klug, A. Nature 1989, 342, 825-829. (19) Watson, J. D. Nat. New Biol. 1972, 239, 197-201. (20) Olovniko.Am J. Theor. Biol. 1973, 41, 181-190. (21) Levy, M. Z.; Allsopp, R. C.; Futcher, A. B.; Greider, C. W.; Harley, C. B. J. Mol. Biol. 1992, 225, 951-960. (22) Sugino, A.; Hirose, S.; Okazaki, R. Proc. Natl. Acad. Sci. U. S. A. 1972, 69, 1863- 1867. (23) Blackburn, E. H.; Szostak, J. W. Annu. Rev. Biochem. 1984, 53, 163-194. (24) Blackburn, E. H. Nature 1991, 350, 569-573. (25) McClintock, B. Genetics 1941, 26, 234-282. (26) Blackburn, E. H.; Gall, J. G. J. Mol. Biol. 1978, 120, 33-53. (27) Szostak, J. W.; Blackburn, E. H. Cell 1982, 29, 245-255. (28) Greider, C. W.; Blackburn, E. H. Cell 1985, 43, 405-413. (29) Greider, C. W.; Blackburn, E. H. Cell 1987, 51, 887-898. (30) Greider, C. W.; Blackburn, E. H. Nature 1989, 337, 331-337. (31) Moyzis, R. K.; Buckingham, J. M.; Cram, L. S.; Dani, M.; Deaven, L. L.; Jones, M. D.; Meyne, J.; Ratliff, R. L.; Wu, J. R. Proc. Natl. Acad. Sci. U. S. A. 1988, 85, 6622- 6626. (32) Morin, G. B. Cell 1989, 59, 521-529. (33) Makarov, V. L.; Hirose, Y.; Langmore, J. P. Cell 1997, 88, 657-666. (34) Feng, J. L., et al Science 1995, 269, 1236-1241. (35) Palm, W.; de Lange, T. Annu. Rev. Genet. 2008, 42, 301-334.  143 (36) de Lange, T. Genes Dev. 2005, 19, 2100-2110. (37) Kang, C.; Zhang, X. H.; Ratliff, R.; Moyzis, R.; Rich, A. Nature 1992, 356, 126- 131. (38) Laughlan, G.; Murchie, A. I. H.; Norman, D. G.; Moore, M. H.; Moody, P. C. E.; Lilley, D. M. J.; Luisi, B. Science 1994, 265, 520-524. (39) Wang, Y.; Patel, D. J. Structure 1993, 1, 263-282. (40) Parkinson, G.; Lee, M.; Neidle, S. Nature 2002, 417, 876-880. (41) Schaffitzel, C.; Berger, I.; Postberg, J.; Hanes, J.; Lipps, H. J.; Pluckthun, A. Proc. Natl. Acad. Sci. U. S. A. 2001, 98, 8572-8577. (42) Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2007, 35, 406-413. (43) Simonsson, T.; Pecinka, P.; Kubista, M. Nucleic Acids Res. 1998, 26, 1167-1172. (44) Siddiqui-Jain, A.; Grand, C. L.; Bearss, D. J.; Hurley, L. H. Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 11593-11598. (45) Grand, C. L.; Han, H. Y.; Munoz, R. M.; Weitman, S.; Von Hoff, D. D.; Hurley, L. H.; Bearss, D. J. Molecular Cancer Therapeutics 2002, 1, 565-573. (46) Hayflick, L.; Moorhead, P. S. Exp. Cell Res. 1961, 25, 585-620. (47) Harley, C. B.; Futcher, A. B.; Greider, C. W. Nature 1990, 345, 458-460. (48) Counter, C. M.; Avilion, A. A.; Lefeuvre, C. E.; Stewart, N. G.; Greider, C. W.; Harley, C. B.; Bacchetti, S. EMBO J. 1992, 11, 1921-1929. (49) Kim, M. W.; Piatyszek, M. A.; Prowse, K. R.; Harley, C. B.; West, M. D.; Ho, P. L. C.; Coviello, G. M.; Wright, W. E.; Weinrich, S. L.; Shay, J. W. Science 1994, 266, 2011-2015.  144 (50) Riou, J.; Guittat, L.; Mailliet, P.; Laoui, A.; Renou, E.; Petitgenet, O.; Megnin- Chanet, F.; Helene, C.; Mergny, J. Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 2672- 2677. (51) Norton, J. C.; Piatyszek, M. A.; Wright, W. E.; Shay, J. W.; Corey, D. R. Nat. Biotechnol. 1996, 14, 615-619. (52) Sun, D.; Thompson, B.; Cathers, B.; Salazar, M.; Kerwin, S.; Trent, J.; Jenkins, T.; Neidle, S.; Hurley, L. J. Med. Chem. 1997, 40, 2113-2116. (53) Franceschin, M. Euro. J. Org. Chem. 2009, 2225-2238. (54) Neidle, S. Curr. Opin. Struct. Biol. 2009, 19, 239-250. (55) De Cian, A.; Lacroix, L.; Douarre, C.; Temime-Smaali, N.; Trentesaux, C.; Riou, J.; Mergny, J. Biochimie 2008, 90, 131-155. (56) Monchaud, D.; Teulade-Fichou, M. Org. Biomol. Chem. 2008, 6, 627-636. (57) Ou, T.; Lu, Y.; Tan, J.; Huang, Z.; Wong, K.; Gu, L. ChemMedChem 2008, 3, 690- 713. (58) Mergny, J. L.; Riou, J. F.; Mailliet, P.; Teulade-Fichou, M. P.; Gilson, E. Nucleic Acids Res. 2002, 30, 839-865. (59) Neidle, S.; Parkinson, G. Nat. Rev. Drug Discovery 2002, 1, 383-393. (60) Han, H. Y.; Hurley, L. H. Trends Pharmacol. Sci. 2000, 21, 136-142. (61) Neidle, S.; Read, M. A. Biopolymers 2000, 56, 195-208. (62) Harrison, R.; Gowan, S.; Kelland, L.; Neidle, S. Bioorg. Med. Chem. Lett. 1999, 9, 2463-2468. (63) Gowan, S.; Harrison, J.; Patterson, L.; Valenti, M.; Read, M.; Neidle, S.; Kelland, L. Mol. Pharmacol. 2002, 61, 1154-1162.  145 (64) Haider, S.; Parkinson, G.; Neidle, S. J. Mol. Biol. 2003, 326, 117-125. (65) Fedoroff, O.; Salazar, M.; Han, H.; Chemeris, V.; Kerwin, S.; Hurley, L. Biochemistry 1998, 37, 12367-12374. (66) Anantha, N.; Azam, M.; Sheardy, R. Biochemistry 1998, 37, 2709-2714. (67) Wheelhouse, R.; Sun, D.; Han, H.; Han, F.; Hurley, L. J. Am. Chem. Soc. 1998, 120, 3261-3262. (68) Haq, I.; Trent, J.; Chowdhry, B.; Jenkins, T. J. Am. Chem. Soc. 1999, 121, 1768- 1779. (69) Dixon, I. M.; Lopez, F.; Tejera, A. M.; Esteve, J.; Blasco, M. A.; Pratviel, G.; Meunier, B. J. Am. Chem. Soc. 2007, 129, 1502-1503. (70) Han, H.; Langley, D.; Rangan, A.; Hurley, L. J. Am. Chem. Soc. 2001, 123, 8902- 8913. (71) Goncalves, D. P. N.; Rodriguez, R.; Balasubramanian, S.; Sanders, J. K. M. Chem. Commun. 2006, 4685-4687. (72) Phan, A.; Kuryavyi, V.; Gaw, H.; Patel, D. J. Nat. Chem. Biol. 2005, 1, 167-173. (73) Wei, C.; Jia, G.; Yuan, J.; Feng, Z.; Li, C. Biochemistry 2006, 45, 6681-6691. (74) Shin-ya, K.; Wierzba, K.; Matsuo, K.; Ohtani, T.; Yamada, Y.; Furihata, K.; Hayakawa, Y.; Seto, H. J. Am. Chem. Soc. 2001, 123, 1262-1263. (75) Kim, M.; Vankayalapati, H.; Kazuo, S.; Wierzba, K.; Hurley, L. J. Am. Chem. Soc. 2002, 124, 2098-2099. (76) Tauchi, T.; Shin-ya, K.; Sashida, G.; Sumi, M.; Nakajima, A.; Shimamoto, T.; Ohyashiki, J. H.; Ohyashiki, K. Oncogene 2003, 22, 5338-5347. (77) Doi, T.; Yoshida, M.; Shin-ya, K.; Takahashi, T. Org. Lett. 2006, 8, 4165-4167.  146 (78) Naasani, I.; Seimiya, H.; Yamori, T.; Tsuruo, T. Cancer Res. 1999, 59, 4004-4011. (79) Franceschin, M.; Rossetti, L.; D'Ambrosio, A.; Schirripa, S.; Bianco, A.; Ortaggi, G.; Savino, M.; Schultes, C.; Neidle, S. Bioorg. Med. Chem. Lett. 2006, 16, 1707- 1711. (80) Gomez, D.; Mergny, J. L.; Riou, J. F. Cancer Res. 2002, 62, 3365-3368. (81) De Cian, A.; Cristofari, G.; Reichenbach, P.; De Lemos, E.; Monchaud, D.; Teulade- Fichou, M.; Shin-Ya, K.; Lacroix, L.; Lingner, J.; Mergny, J. Proc. Natl. Acad. Sci. U. S. A. 2007, 104, 17347-17352. (82) Nagai, K.; Hayakawa, K.; Ukai, S.; Kanematsu, K. J. Org. Chem. 1986, 51, 3931- 3939. (83) Kim, M. S.; Gokel, G. W. Chem. Commun. 1987,1686-1688. (84) Schall, O. F.; Gokel, G. W. J. Am. Chem. Soc. 1994, 116, 6089-6100. (85) Sessler, J. L.; Wang, R. Z. J. Am. Chem. Soc. 1996, 118, 9808-9809. (86) Sessler, J. L.; Wang, R. Z. J. Org. Chem. 1998, 63, 4079-4091. (87) Mutter, M.; Vuilleumier, S. Angew. Chem. Int. Ed. 1989, 28, 535-554. (88) Consoli, G. M. L.; Granata, G.; Garozzo, D.; Mecca, T.; Geraci, C. Tetrahedron Lett. 2007, 48, 7974-7977. (89) Kotch, F. W.; Sidorov, V.; Lam, Y. F.; Kayser, K. J.; Li, H.; Kaucher, M. S.; Davis, J. T. J. Am. Chem. Soc. 2003, 125, 15140-15150. (90) Sidorov, V.; Kotch, F. W.; El-Khouedi, M.; Davis, J. T. Chem. Commun. 2000, 2369-2370. (91) Nikan, M.; Sherman, J. C. Angew. Chem. Int. Ed. 2008, 47, 4900-4902. (92) Nikan, M.; Sherman, J. C. J. Org. Chem. 2009, 74, 5211-5218.  147 (93) Oliviero, G.; Amato, J.; Borbone, N.; Galeone, A.; Petraccone, L.; Varra, M.; Piccialli, G.; Mayol, L. Bioconjug. Chem. 2006, 17, 889-898. (94) Oliviero, G.; Borbone, N.; Galeone, A.; Varra, M.; Piccialli, G.; Mayol, L. Tetrahedron Lett. 2004, 45, 4869-4872. (95) Oliviero, G.; Borbone, N.; Amato, J.; D'Errico, S.; Galeone, A.; Piccialli, G.; Varra, M.; Mayol, L. Biopolymers 2009, 91, 466-477. (96) Oliviero, G.; Amato, J.; Borbone, N.; D'Errico, S.; Galeone, A.; Mayol, L.; Haider, S.; Olubiyi, O.; Hoorelbeke, B.; Balzarini, J.; Piccialli, G. Chem. Commun. 2010, 46, 8971-8973. (97) Murat, P.; Cressend, D.; Spinelli, N.; Van der Heyden, A.; Labbe, P.; Dumy, P.; Defrancq, E. ChemBioChem 2008, 9, 2588-2591. (98) Murat, P.; Bonnet, R.; Van der Heyden, A.; Spinelli, N.; Labbe, P.; Monchaud, D.; Teulade-Fichou, M.; Dumy, P.; Defrancq, E. Chem. Eur. J. 2010, 16, 6106-6114. (99) Cheong, C. J.; Moore, P. B. Biochemistry 1992, 31, 8406-8414. (100) Deng, J.; Xiong, Y.; Sundaralingam, M. Proc. Natl. Acad. Sci. U. S. A. 2001, 98, 13665-13670. (101) Witkowski, H.; Freisinger, E.; Lippert, B. Chem. Commun. 1997,1315-1316. (102) Xu, Y.; Ishizuka, T.; Kimura, T.; Komiyama, M. J. Am. Chem. Soc. 2010, 132, 7231-7233. (103) Hui, B. W.; Sherman, J. C. Chem. Commun. 2012, 48, 109-111. (104) Sket, P.; Plavec, J. J. Am. Chem. Soc. 2010, 132, 12724-12732. (105) Searle, M.; Williams, H.; Gallagher, C.; Grant, R.; Stevens, M. Org. Biomol. Chem. 2004, 2, 810-812.  148 (106) Patel, P. K.; Koti, A. S. R.; Hosur, R. V. Nucleic Acids Res. 1999, 27, 3836-3843. (107) Michelson, A. M.; Todd, A. R. J. Chem. Soc. 1955, 2632-2638. (108) Agarwal, K. L.; Buchi, H.; Caruthers, M. H.; Gupta, N.; Khorana, H. G.; Kleppe, K.; Kumar, A.; Ohtsuka, E.; Rajbhand U. L.; Vandesan J.H.; Sgaramel, V; Weber, H.; Yamada, T. Nature 1970, 227, 27-34. (109) Letsinger, R. L.; Lunsford, W. B. J. Am. Chem. Soc. 1976, 98, 3655-3661. (110) Beaucage, S.; Caruthers, M. Tetrahedron Lett. 1981, 22, 1859-1862. (111) Caruthers, M. H. Science 1985, 230, 281-285. (112) Ogilvie, K. K. Can. J. Chem. 1973, 51, 3799-3807. (113) Ti, G. S.; Gaffney, B. L.; Jones, R. A. J. Am. Chem. Soc. 1982, 104, 1316-1319. (114) Eisenhuth, R.; Richert, C. J. Org. Chem. 2009, 74, 26-37. (115) Mezo, A. R.; Sherman, J. C. J. Org. Chem. 1998, 63, 6824-6829. (116) Khorana, H. G. Pure Appl. Chem. 1968, 17, 349. (117) Ogilvie, K. K.; Theriault, N. Y.; Seifert, J. M.; Pon, R. T.; Nemer, M. J. Can J. Chem. 1980, 58, 2686-2693. (118) Adamiak, R. W.; Biala, E.; Grzeskowiak, K.; Kierzek, R.; Kraszewski, A.; Markiewicz, W. T.; Stawinski, J.; Wiewiorowski, M. Nucleic Acids Res. 1977, 4, 2321-2329. (119) Fraser, J. R.; Borecka, B.; Trotter, J.; Sherman, J. C. J. Org. Chem. 1995, 60, 1207- 1213. (120) Arnaudneu, F.; Collins, E. M.; Deasy, M.; Ferguson, G.; Harris, S. J.; Kaitner, B.; Lough, A. J.; Mckervey, M. A.; Marques, E.; Ruhl, B. L.; Schwingweill, M. J.; Seward, E. M. J. Am. Chem. Soc. 1989, 111, 8681-8691.  149 (121) Weber, H.; Khorana, H. G. J. Mol. Biol. 1972, 72, 219-249. (122) Sinha, N.; Biernat, J.; Koster, H. Tetrahedron Lett. 1983, 24, 5843-5846. (123) Nikan, M.; Bare, G. A. L.; Sherman, J. C. Tetrahedron Lett. 2011, 52, 1791-1793. (124) Biros, S. M.; Rebek, J., Jr. Chem. Soc. Rev. 2007, 36, 93-104. (125) Nikan, M. Dissertation, University of British Columbia, 2009. (126) Gui, X.; Sherman, J. Chem. Commun. 2001, 2680-2681. (127) Gibb, B.; Chapman, R.; Sherman, J. J. Org. Chem. 1996, 61, 1505-1509. (128) Sherman, J.; Knobler, C.; Cram, D. J. Am. Chem. Soc. 1991, 113, 2194-2204. (129) Cram, D.; Jaeger, R.; Deshayes, K. J. Am. Chem. Soc. 1993, 115, 10111-10116. (130) Stout, M.; Robins, M.; Olsen, R.; Robins, R. J. Med. Chem. 1969, 12, 658-662. (131) Liu, F.; Austin, D. J. Org. Chem. 2001, 66, 8643-8645. (132) Dean, D. Synth. Commun. 2002, 32, 1517-1521. (133) Park, T.; Todd, E.; Nakashima, S.; Zimmerman, S. J. Am. Chem. Soc. 2005, 127, 18133-18142. (134) Kolb, H.; Finn, M.; Sharpless, K. Angew. Chem. Int. Ed. 2001, 40, 2004-2021. (135) Amblard, F.; Cho, J. H.; Schinazi, R. F. Chem. Rev. 2009, 109, 4207-4220. (136) Denny, W.; Leupin, W.; Kearns, D. Helv. Chim. Acta 1982, 65, 2372-2393. (137) Sreenivasachary, N.; Lehn, J. Chem. Asian J. 2008, 3, 134-139. (138) Sreenivasachary, N.; Lehn, J. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 5938-5943. (139) Chantot, J.; Sarocchi, M.; Guschlbauer.W Biochimie 1971, 53, 347-354. (140) Murat, P.; Gennaro, B.; Garcia, J.; Spinelli, N.; Dumy, P.; Defrancq, E. Chem. Eur. J. 2011, 17, 5791-5795.  150 (141) Gansey, M.; Bakker, F.; Feiters, M.; Geurts, H.; Verboom, W.; Reinhoudt, D. Tetrahedron Lett. 1998, 39, 5447-5450. (142) Masiero, S.; Trotta, R.; Pieraccini, S.; De Tito, S.; Perone, R.; Randazzo, A.; Spada, G. P. Org. Biomol. Chem. 2010, 8, 2683-2692. (143) Nikan, M.; Sherman, J. C. unpublished results, 2009. (144) Berova, N.; Di Bari, L.; Pescitelli, G. Chem. Soc. Rev. 2007, 36, 914-931. (145) Nakanishi, K.; Berova, N.; Woody, R. W., Eds.; In Circular Dichroism: Principles and Applications; Wiley-VCH: New York, 2000; Vol. 2nd ed. (146) Fasman, G. D., Ed.; In Circular Dichroism and the Conformational Analysis of Biomolecules; Plenum Press: New York, 1996. (147) Paramasivan, S.; Rujan, I.; Bolton, P. H. Methods 2007, 43, 324-331. (148) Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S. Nucleic Acids Res. 2006, 34, 5402-5415. (149) Dapic, V.; Abdomerovic, V.; Marrington, R.; Peberdy, J.; Rodger, A.; Trent, J.; Bates, P. Nucleic Acids Res. 2003, 31, 2097-2107. (150) Voelter, W.; Records, R.; Bunnenbe.E; Djerassi, C. J. Am. Chem. Soc. 1968, 90, 6163-6170. (151) Jin, R.; Gaffney, B.; Wang, C.; Jones, R.; Breslauer, K. Proc. Natl. Acad. Sci. U. S. A. 1992, 89, 8832-8836. (152) Scaria, P.; Shire, S.; Shafer, R. Proc. Natl. Acad. Sci. U. S. A. 1992, 89, 10336- 10340. (153) Feigon, J.; Denny, W.; Leupin, W.; Kearns, D. Biochemistry 1983, 22, 5930-5942. (154) Gueron, M.; Kochoyan, M.; Leroy, J. Nature 1987, 328, 89-92.  151 (155) Kochoyan, M.; Leroy, J.; Gueron, M. J. Mol. Biol. 1987, 196, 599-609. (156) Kessler, H.; Gehrke, M.; Griesinger, C. Angew. Chem. Int. Ed. 1988, 27, 490-536.  (157) Bothnerby, A.; Stephens, R.; Lee, J.; Warren, C.; Jeanloz, R. J. Am. Chem. Soc. 1984, 106, 811-813. (158) Sket, P.; Plavec, J. J. Am. Chem. Soc. 2010, 132, 12724-12732. (159) Cohen, Y.; Avram, L.; Frish, L. Angew. Chem. Int Ed. 2005, 44, 520-554. (160) Johnson, C. Prog. Nucl. Magn. Reson. Spectrosc. 1999, 34, 203-256. (161) Kaucher, M.; Lam, Y.; Pieraccini, S.; Gottarelli, G.; Davis, J. Chem. Euro. J. 2005, 11, 164-173. (162) Wong, A.; Ida, R.; Spindler, L.; Wu, G. J. Am. Chem. Soc. 2005, 127, 6990-6998. (163) Kaucher, M.; Lam, Y.; Pieraccini, S.; Gottarelli, G.; Davis, J. Chem. Euro. J. 2005, 11, 164-173. (164) Stejskal, E.; Tanner, J. J. Chem. Phys. 1965, 42, 288-292. (165) Waldeck, A.; Kuchel, P.; Lennon, A.; Chapman, B. Prog. Nucl. Magn. Reson.  Spectrosc. 1997, 30, 39-68. (166) Davis, J. T. Angew. Chem. Int. Ed. 2004, 43, 668-698. (167) Otero, R.; Schock, M.; Molina, L.; Laegsgaard, E.; Stensgaard, I.; Hammer, B.; Besenbacher, F. Angew. Angew. Chem. Int. Ed. 2005, 44, 2270-2275. (168) Sessler, J.; Sathiosatham, M.; Doerr, K.; Lynch, V.; Abboud, K. Angew. Chem. Int. Ed. 2000, 39, 1300-1303. (169) Kettani, A.; Gueron, M.; Leroy, J. J. Am. Chem. Soc. 1997, 119, 1108-1115. (170) Boelens, R.; Scheek, R. M.; Dijkstra, K.; Kaptein, R. J. Magn. Reson. 1985, 62, 378-386.  152 (171) Burge, S.; Parkinson, G. N.; Hazel, P.; Todd, A. K.; Neidle, S. Nucleic Acids Res. 2006, 34, 5402-5415. (172) Yue, D. J. E.; Lim, K. W.; Anh Tuan Phan J. Am. Chem. Soc. 2011, 133, 11462- 11465. (173) Ambrus, A.; Chen, D.; Dai, J.; Bialis, T.; Jones, R.; Yang, D. Nucleic Acids Res. 2006, 34, 2723-2735. (174) Luu, K. N.; Phan, A. T.; Kuryavyi, V.; Lacroix, L.; Patel, D. J. J. Am. Chem. Soc. 2006, 128, 9963-9970. (175) Qin, Y.; Hurley, L. H. Biochimie 2008, 90, 1149-1171. (176) Parkinson, G. N.; Ghosh, R.; Neidle, S. Biochemistry 2007, 46, 2390-2397. (177) Han, F.; Wheelhouse, R.; Hurley, L. J. Am. Chem. Soc. 1999, 121, 3561-3570. (178) Mazzitelli, C.; Brodbelt, J.; Kern, J.; Rodriguez, M.; Kerwin, S. J. Am. Soc. Mass Spectrom. 2006, 17, 593-604. (179) Rossetti, L.; Franceschin, M.; Bianco, A.; Ortaggi, G.; Savino, M. Bioorg. Med. Chem. Lett. 2002, 12, 2527-2533. (180) Kerwin, S. M.; Chen, G.; Kern, J. T.; Thomas, P. W. Bioorg. Med. Chem. Lett. 2002, 12, 447-450. (181) Han, H.; Cliff, C.; Hurley, L. Biochemistry 1999, 38, 6981-6986. (182) Jenkins, T. C. Methods Mol. Biol. 1997, 90, 195-218.  

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
United States 20 3
Russia 8 0
Japan 6 0
France 1 0
Poland 1 0
China 1 0
Norway 1 0
City Views Downloads
Unknown 9 0
Tokyo 6 0
La Jolla 4 2
Ashburn 4 0
Seattle 3 0
Los Angeles 2 0
Sunnyvale 2 0
Mountain View 1 0
Talence 1 0
Arlington 1 0
Puyallup 1 1
Redmond 1 0
Gdańsk 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0062412/manifest

Comment

Related Items