UBC Community, Partners, and Alumni Publications

Age-related appearance of a CMV-specific high-avidity CD8+ T cell clonotype which does not occur in young… Schwanninger, Angelika; Weinberger, Birgit; Weiskopf, Daniela; Herndler-Brandstetter, Dietmar; Reitinger, Stephan; Gassner, Christoph; Schennach, Harald; Parson, Walther; Würzner, Reinhard; Grubeck-Loebenstein, Beatrix Nov 12, 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


52387-12979_2008_Article_58.pdf [ 669.21kB ]
JSON: 52387-1.0223383.json
JSON-LD: 52387-1.0223383-ld.json
RDF/XML (Pretty): 52387-1.0223383-rdf.xml
RDF/JSON: 52387-1.0223383-rdf.json
Turtle: 52387-1.0223383-turtle.txt
N-Triples: 52387-1.0223383-rdf-ntriples.txt
Original Record: 52387-1.0223383-source.json
Full Text

Full Text

ralssBioMed CentImmunity & AgeingOpen AcceShort reportAge-related appearance of a CMV-specific high-avidity CD8+ T cell clonotype which does not occur in young adultsAngelika Schwanninger†1, Birgit Weinberger†1, Daniela Weiskopf1, Dietmar Herndler-Brandstetter1, Stephan Reitinger1, Christoph Gassner2, Harald Schennach2, Walther Parson3, Reinhard Würzner4 and Beatrix Grubeck-Loebenstein*1Address: 1Institute for Biomedical Aging Research, Austrian Academy of Sciences, Rennweg 10, 6020 Innsbruck, Austria, 2Central Institute for Blood Transfusion and Division for Immunology, University Hospital, 6020 Innsbruck, Austria, 3Institute of Legal Medicine, Innsbruck Medical University, 6020 Innsbruck, Austria and 4Department of Hygiene, Microbiology and Social Medicine, Innsbruck Medical University, 6020 Innsbruck, AustriaEmail: Angelika Schwanninger - aschw@interchange.ubc.ca; Birgit Weinberger - birgit.weinberger@oeaw.ac.at; Daniela Weiskopf - daniela.weiskopf@oeaw.ac.at; Dietmar Herndler-Brandstetter - dietmar.herndler-brandstetter@oeaw.ac.at; Stephan Reitinger - sreit@chem.ubc.ca; Christoph Gassner - christoph.gassner@uki.at; Harald Schennach - harald.schennach@uki.at; Walther Parson - walther.parson@i-med.ac.at; Reinhard Würzner - reinhard.wuerzner@i-med.ac.at; Beatrix Grubeck-Loebenstein* - beatrix.grubeck@oeaw.ac.at* Corresponding author    †Equal contributorsAbstractOld age is associated with characteristic changes of the immune system contributing to higherincidence and severity of many infectious diseases. Particularly within the T cell compartment latentinfection with human Cytomegalovirus (CMV) is contributing to and acceleratingimmunosenescence. However, latent CMV infection and reactivation usually does not cause overtsymptoms in immunocompetent elderly persons indicating immunological control of disease. Littleis still known about the clonal composition of CMV-specific T cell responses in donors of differentage. We therefore analyzed CD8+ T cells specific for an immunodominant pp65-derived nonamer-peptide (NLVPMVATV; CMVNLV) in different age-groups. Independent of donor age CMVNLV-specific CD8+ T cells preferentially use the V beta family 8. This family has monoclonal expansionsin the majority of donors after stimulation of CD8+ T cells with the peptide. By sequencing theCDR3 region of the T cell receptor we demonstrated that CMVNLV-specific, BV8+ CD8+ T cellsshare the conserved CDR3-sequence motif SANYGYT in donors of all age groups. Interestingly, asecond conserved clonotype with the CDR3-sequence motif SVNEAF appears in middle-aged andelderly donors. This clonotype is absent in young individuals. The age-related clonotype SVNEAFbinds to the pMHC-complex with higher avidity than the clonotype SANYGYT, which ispredominant in young adults. The dominance of this high avidity clonotype may explain the lack ofovert CMV-disease in old age.Published: 12 November 2008Immunity & Ageing 2008, 5:14 doi:10.1186/1742-4933-5-14Received: 8 October 2008Accepted: 12 November 2008This article is available from: http://www.immunityageing.com/content/5/1/14© 2008 Schwanninger et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 9(page number not for citation purposes)Immunity & Ageing 2008, 5:14 http://www.immunityageing.com/content/5/1/14BackgroundAgeing is associated with an increase in the incidence andseverity of many infectious diseases. The most commoninfections in the elderly are influenza, infections withStreptococcus pneumoniae, infections of the skin and alsoof the urogenital tract [1]. In addition, reactivation oflatent viruses and bacteria such as Varicella-Zoster-Virusleading to Herpes zoster [2,3] and Mycobacterium tuber-culosis [4,5] are more frequent in old age. This may be dueto decreased immunosurveillance as well as to other fac-tors such as age-associated diseases, poor nutrition,chronic renal failure and institutionalization.Cytomegalovirus (CMV) is a human beta-herpesviruswith a prevalence of 60–100% in the adult population.The link between CMV-infection, immunosenescence andlongevity has recently been a subject of great interest [6,7].Despite frequent reactivation of latent CMV in the elderlyas suggested by increased anti-CMV antibodies and viralshedding in the urine [8] there are no reports about overtCMV-disease in immunocompetent elderly persons. Tcells are essential for the control of viral replication,spread and disease [9-12]. In CMV-seropositive elderlypersons up to 25% of the total CD8+ T cell pool can bespecific for CMV with the epitope NLVPMVATV of thepp65 matrix protein (CMVNLV) being immunodominant[13]. These CMV-specific cells show a highly differenti-ated effector phenotype [14-16] and express markers forcytotoxicity [14,16]. They are proinflammatory [16], andto a high degree clonally expanded [13,17,18]. This hasled to the suggestion that CMV-specific T cell clones takeup a lot of space and may therefore be responsible for theloss of T cells of other specificities, such as for instance forEpstein-Barr virus (EBV) [19]. The proinflammatory prop-erties of the steadily increasing number of CMV-specific Tcells may represent an additional problem, as age-relatedsubclinical inflammatory processes termed "inflamm-age-ing" can be enhanced [20]. Inflammation is known tosupport the development and progression of age-relateddiseases such as for instance Alzheimer's disease [21]. Inlongitudinal studies on octo- and nonagenerians CMV-seropositivity has also been linked to the so-called"immune-risk phenotype" and with increased mortality[22,23].Despite the obvious importance of CMV infection in oldage little is known about the clonal composition of CMV-specific T cells in apparently healthy elderly persons. Wetherefore analyzed the clonal composition of CD8+ T cells,which are specific for the HLA-A*0201-restricted, immun-odominant pp65-derived epitope NLVPMVATV [24,25] inpersons of different age.Results and discussionStimulation of CD8+ T cells with CMVNLV-peptide leads to expansion of CMVNLV-specific cells with restricted V beta usageCD8+ T cells were isolated from peripheral blood ofhealthy donors of different age groups and were cultivatedfor 14 days in the presence of the immunodominant, HLAA*0201-restricted CMV-derived peptide NLVPMVATV, IL-2 and autologous irradiated feeder cells. The frequenciesof CMVNLV-specific CD8+ T cells were determined ex vivoand were 0.6% ± 0.7, 1.7% ± 0.8, and 1.7 ± 1.9, for young,middle-aged and elderly donors respectively (mean ± SD;p < 0.05 for young vs. middle-aged and young vs. old).Irrespective of age, high frequencies of CMVNLV-specific Tcells were obtained for most donors after 14 days of cul-ture (mean 77.0% ± 14.9). Figure 1A shows examples ofpentamer-FACS-stainings before and after culture for oneyoung, one middle-aged and one elderly donor.In order to analyze the T cell receptor (TCR) repertoireCMVNLV-specific T cells were further purified using pen-tamers and microbeads reaching a purity of CMVNLV-spe-cific CD8+ T cells above 95% for all samples. Spectratypingof the CDR3 (complementary determining region 3)region of the TCR beta chain was performed as previouslydescribed [26,27]. CMVNLV-specific CD8+ T cells preferen-tially used BV 8 and BV 13 after culture (Figure 1B). 64%and 59% of all donors had monoclonal expansions (clon-ality score 3) in BV8 or BV13, respectively. No differencesin the spectratype scores were observed between the differ-ent age groups (data not shown). Previous work analyzingthe V beta usage of CMVNLV-specific T cells shows that thebroad repertoire of CMV-specific T cells, which is stimu-lated during primary infection rapidly focuses on individ-ual BV families within the first weeks after infection [28].Restimulation in vitro does not alter the T cell repertoire[29,30]. In accordance with our results it has been shownthat CMVNLV-specific T cells preferentially use BV 8, 13and 6 in healthy adults as well as in immunosuppressedpatients [28-33].The sequence of the CDR3 region of BV8+ T cell receptors of CMVNLV-specific CD8+ T cells changes with ageIn order to characterize the repertoire of CMVNLV-specificCD8+ T cells in more detail we sequenced the CDR3-region of the T cell receptor of in vitro expanded and puri-fied BV8+ T cells. We chose this BV family as the mostdominant family within CMVNLV-specific T cells. TCRsequences were amplified from cDNA and were clonedinto a bacterial vector. Plasmid-DNA was isolated andsequenced by standard procedures. Figure 2 shows theamino acid sequences of the antigen binding site forCMVNLV-specific T cell receptors. In accordance with liter-Page 2 of 9(page number not for citation purposes)ature on CDR3-sequences from healthy and HIV-infectedadults [30-33] the highly conserved CDR3-sequence motifImmunity & Ageing 2008, 5:14 http://www.immunityageing.com/content/5/1/14Page 3 of 9(page number not for citation purposes)Preferential expansion of BV8 and BV13 CD8+ T cells after stimulation with CMVNLV-peptideFigu  1Preferential expansion of BV8 and BV13 CD8+ T cells after stimulation with CMVNLV-peptide. Cells were stimu-lated in vitro for 14 days with CMVNLV-peptide in the presence of IL-2 and autologous, irradiated PBMC. (A) CD8+ T cells were stained with APC-conjugated pentamers containing the CMVNLV-peptide. Representative examples are shown for one young, one middle-aged and one elderly donor directly ex vivo and after 14 days of culture. Percentages of CD8+ CMVNLV-specific T cells are indicated. (B) After 14 days of culture CMVNLV-specific T cells were further purified from the expanded cells using MACS-technology. Spectratyping was performed from PCR-products of 24 individual V beta families for 31 donors (10 young, 7 middle-aged, 14 elderly). In the right panel examples for the different clonality and intensity scores (see Methods) are shown. Clonality and intensity scores are added to obtain a total score. For each BV family the percentage of donors with a total score above 5 is shown.Aex vivoday 14young middle-aged elderly0.5% 2.0%FSCCMV-Pentamerclonality score intensity score312dilution1:1003121.4%76.5% 75.5% 74.6%V beta familiy1 2 3 4 5.1 5.3 6.1 6.2 7 8 9 11 12 13 14 15 16 17 18 20 21 22 23 24donors with spectratype score >50%20%40%60%80%100%BImmunity & Ageing 2008, 5:14 http://www.immunityageing.com/content/5/1/14Page 4 of 9(page number not for citation purposes)Sequence analysis of the CDR3-region of BV8+ CMVNVL-specific T cells from different age-groupsFig re 2Sequence analysis of the CDR3-region of BV8+ CMVNVL-specific T cells from different age-groups. PCR-products were generated of the relevant TCR-sequences and cloned into a bacterial vector. 4 arbitrarily chosen bacterial clones are shown for each donor. Two dominant sequences and a variety of individually used sequences were detected. Conserved sequences were categorized as "SANYGYT" (light grey) and "SVNEAF" (dark grey). Discordance of one or two amino acids from the conserved dominant sequences was considered as minor variation, and these clones were included in these two cat-egories. Sequences with greater variations were considered as private clones.CASS~~LVGTGGSYEQY~~FGPCASS~~HSRDSYNEQF~~~FGPCASS~~HSRDSYNEQF~~~FGPCASS~~PYGQFYEQY~~~~FGPE-1CAPR~~VHTGELF~~~~~~FGECAPR~~VHTGELF~~~~~~FGECAPR~~VHTGELF~~~~~~FGECAPR~~VHTGELF~~~~~~FGEM-1CASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSY-1CASS~~VVGGRYGYT~~~~FGSCASS~~VVGGRYGYT~~~~FGSCASS~~VVGGRYGYT~~~~FGSCASS~~VVGGRYGYT~~~~FGSE-6CASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~STTGYT~~~~~~~FGSCASS~~STTGYT~~~~~~~FGSM-6CASS~~ANLAGDYNEQF~~FGPCASS~~LDVDSYNEQF~~~FGPCASS~~SLTGTGYNEQF~~FGPCASS~~SANYGYT~~~~~~FGSY-6CASS~~SVNEAF~~~~~~~FGQCASS~~SVNEAF~~~~~~~FGQCASS~~SVNEAF~~~~~~~FGQCASS~~SVDEAF~~~~~~~FGQE-7CASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSY-7CASS~~SAFYGYT~~~~~~FGPCASS~~IVNEQF~~~~~~~FGPCASS~~IVNEQF~~~~~~~FGPCASS~~IVNEQF~~~~~~~FGPE-8CASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SASYGYT~~~~~~FGSY-8CASS~~SVNEAF~~~~~~~FGQCASS~~SVNEAF~~~~~~~FGQCASS~~SVNEAF~~~~~~~FGQCASS~~LSTAEAF~~~~~~FGQE-9CASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~FANYGYT~~~~~~FGSE-10CASS~~SVNEAF~~~~~~~FGQCASS~~SVNEAF~~~~~~~FGQCASS~~SVNEAF~~~~~~~FGQCASS~~SVNEAF~~~~~~~FGQE-11CASS~~SASYGYT~~~~~~FGSCASS~~PGNILYGYT~~~~FGSCASS~~SASYGYT~~~~~~FGSCASS~~SASYGYT~~~~~~FGSE-5CASS~~SAFYGYT~~~~~~FGSCASS~~SVNGAF~~~~~~~FGQCASS~~SVNGAF~~~~~~~FGQCASS~~SVNGAF~~~~~~~FGQM-5CASS~~SASYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSY-5CASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGSE-4CASS~~SANYGYT~~~~~~FGSCASS~~SANYGYT~~~~~~FGQCASS~~LIGGRNGYT~~~~FGQCASS~~LIGGRNGYT~~~~FGQM-4CASS~~QWSNEKLF~~~~~FGSCASS~~QWSNEKLF~~~~~FGSCASS~~QWSNEKLF~~~~~FGSCASS~~SANYGYT~~~~~~FGSY-4CASS~~SASYGYT~~~~~~FGPCASS~~SASYGYT~~~~~~FGPCASS~~SASYGYT~~~~~~FGPCASS~~SASYGYT~~~~~~FGPE-3CASS~~SVNEQY~~~~~~~FGPCASS~~SVNEQY~~~~~~~FGPCASS~~SVNEQY~~~~~~~FGPCASS~~SVNEQY~~~~~~~FGPM-3CASS~~SANYGYT~~~~~~FGSCASS~~LTGQETQY~~~~~FGPCASS~~VGGPYTGELF~~~FGECASS~~VGGPYTGELF~~~FGEY-3CASS~~PGNILYGYT~~~~FGSCASS~~PGNILYGYT~~~~FGSCASS~~PGNILYGYT~~~~FGSCASS~~PGNILYGYT~~~~FGSE-2CASS~~SVNEQY~~~~~~~FGPCASS~~SVNEQY~~~~~~~FGPCASS~~SVNEQY~~~~~~~FGPCASS~~SVNEQY~~~~~~~FGPM-2CASS~~SATYGYT~~~~~~FGSCASS~~SATYGYT~~~~~~FGSCASS~~SATYGYT~~~~~~FGSCASS~~SATYGYT~~~~~~FGSY-2sequence CDR3donorsequence CDR3donorsequence CDR3donorelderlymiddle-agedyoungImmunity & Ageing 2008, 5:14 http://www.immunityageing.com/content/5/1/14SANYGYT was detected in all young donors. 72% of allbacterial clones derived from young individuals share thissequence motif. 28% of all sequences were private, whichmeans that they were not conserved between differentdonors. However, we now show that with increasing agethe dominance of the clonotype SANYGYT decreases, asthis sequence is only present in 21% or 36% of the bacte-rial clones obtained from middle-aged and elderlydonors, respectively. Interestingly, a second dominantclonotype with a shorter CDR3-region and the CDR3-sequence motif SVNEAF appears in middle-aged and eld-erly donors. Exchanges of one or two aminoacids wereconsidered as minor variations. The age-dependency ofCDR3-sequences was analyzed in a cross-table with calcu-lation of Pearson-Chi-square and was shown to be signif-icant (p < 0.01). The CDR3-sequence motif SVNEAF hasbeen detected in previous studies in adult persons [32,33],but was not identified as a conserved sequence. None ofthis previous work refers to the age of the donors and itcan thus be assumed that most of the donors studied wereyoung adults. We now for the first time report that aCMVNLV-specific BV8+ clonotype with the CDR3 sequenceSVNEAF becomes dominant with increasing age, whilethe frequency of the "youth related" clonotype SANYGYTdecreases.CMV-specific BV8+ CD8+ T cells with the TCR-sequence SVNEAF have a higher antigen avidity than corresponding cells with the sequence SANYGYTIn order to further investigate CMVNLV-specific BV8+ T cellswith different conserved CDR3-sequences we analyzedthe antigen avidity of T cells with either the CDR3-sequence-motif SANYGYT or SVNEAF. For this purposecultures were selected, in which BV8+ CMVNLV-specific Tcells had a monoclonal profile with the CDR3-sequenceSANYGYT or SVNEAF, respectively. Binding and dissocia-tion of pMHC pentamers to the T cell receptor of in vitroexpanded BV8+ CMVNLV-specific T cells were analyzed.Staining with increasing amounts of CMVNLV-pentamershows that pentamer binding and therefore avidity of theTCR is significantly increased for T cells with the CDR3-sequence SVNEAF compared to corresponding cells withthe CDR3-sequence SANYGYT (Figure 3A; note the loga-rithmic scale). The kinetics of TCR-pMHC dissociationprovides information on the stability of the TCR-pMHCcomplexes. T cells were stained with saturated amounts ofCMVNLV-pentamer and anti-HLA-A2*0201 antibodieswere added to prevent re-binding of dissociated pentam-ers. We could show that CMV-pentamers dissociated moreslowly from CMV-specific CD8+ T cells with the CDR3-sequence SVNEAF, whereas TCR-pMHC complexes oncells with the sequence SANYGYT were less stable (Figure3B). In summary these data show that the interactionbinding-motif SVNEAF indicating higher avidity of theseT cells.High avidity CD8+ T cells are essential for clearance ofviral infections [34-37] and for the elimination of tumourcells [38-40]. Therefore, anti-tumour vaccination aims toinduce high avidity tumour-specific T cells. In concord-ance, immunotherapy for viral diseases such as EBV- orCMV-reactivation and infection in immunosuppressedpatients after haematopoietic stem cell transplantationbenefits from selection of virus-specific T cells with highavidity [41]. Regarding our data, the question arises, whythe high avidity clonotype SVNEAF is absent in youngindividuals while it is dominant in a subset of the middle-aged and elderly persons. In view of the well knowndecline of immune function with age [42] it seems likelythat a subgroup of elderly persons suffers from high CMV-activity and pronounced viral reactivation [8], whichnecessitated the expansion of the high avidity BV8+CMVNLV-specific clonotype for viral control. Due to itshigh avidity this clonotype expands and presumablyexerts increased effector functions in vivo leading to pro-tection from CMV-disease. However, accumulation ofCMV-specific T cells of this specific clonotype may be par-ticularly prone to inhibit T cells of other specificities [19].CMV-seropositivity has also been associated with non-responsiveness to anti-influenza vaccination [43] andwith frailty [44]. The price for good protection againstCMV -as provided by CMV-specific cytotoxic T lyphocyteswith high avidity- might thus be accelerated immunose-nescence and potentially lower responses to other patho-gens.MethodsBlood donorsPeripheral blood was obtained from healthy, CMV-serop-ositive, HLA A*0201- positive donors of different agegroups (Table 1). A medical history was obtained andonly individuals without malignancies, acute diseases oradvanced stages of severe chronic diseases, such as chronicinflammatory disease, atherosclerotic disease, congestiveheart failure, poorly controlled diabetes mellitus, renal orhepatic disease or chronic obstructive pulmonary diseaseand persons without immunosuppressive therapy wereincluded in the study. The study was approved by the localethical committee and all participants gave their writteninformed consent. Peripheral blood mononuclear cells(PBMC) were isolated by density gradient centrifugation(FicollHypac; Amersham Biosciences). CMV-specific anti-body levels were determined by enzyme-linked immuno-sorbent assay (Enzygnost® anti-CMV/immunoglobulin G;Dade Behring) according to the manufacturer's protocol.Recent primary infection with CMV is associated with thePage 5 of 9(page number not for citation purposes)between pMHC complexes and the TCR is stronger andmore stable for T cells that express a TCR with the antigen-presence of low-avidity CMV-specific antibodies. In a flu-orescence-based assay (Euroimmun) the avidity of CMV-Immunity & Ageing 2008, 5:14 http://www.immunityageing.com/content/5/1/14Figure 3 (see legend on next page)ABCMV-pentamer (μg/ml)0,01 0,1 1 10MFI10100100010000SANYGYTSVNEAF****MFIdissociation time (min)0 50 100 150 200% of max.pentamer binding5060708090100* **SANYGYTSVNEAF% of max.pentamer bindingPentamer bindingPentamer dissociationPage 6 of 9(page number not for citation purposes)Immunity & Ageing 2008, 5:14 http://www.immunityageing.com/content/5/1/14specific IgG was measured by analyzing the stability of theantigen-antibody-complex in the presence of urea. Low-avidity antibodies show a "relative avidity index" (RAI;optical density in the presence of urea compared to opticaldensity without urea) of <40%. For all samples tested theRAI was >45% indicating past infection and excludingrecent primary infection.Cultivation of CD8+ T lymphocytes and enrichment of CMVNLV-specific T cellsCD8+ T cells were isolated using anti-CD8-conjugatedmicrobeads and the magnetic-activated cell sorting(MACS) system (Milteny Biotech) according to the speci-fications given by the manufacturer. CD8+ T cells were cul-tivated in RPMI 1640 (Cambrex) supplemented with 10%FCS (Sigma-Aldrich) and 1% penicillin-streptamycin(Cambrex) at 37°C and 5% CO2. T cells were stimulatedfor 14 days with 0.1 μg/ml of the immunodominant pep-tide NLVPMVATV (Bachem) derived from the CMV-encoded protein pp65 in the presence of IL-2 (20 ng/ml)and irradiated (30 Gy) autologous PBMC in a CD8+ :PBMC ratio of 1:1. IL-2 (20 ng/ml) was added every threedays and cells were restimulated with peptide and irradi-ated autologous PBMC after 7 days. Percentages ofCMVNLV-specific CD8+ T cells were determined prior toculture and after 14 days of stimulation by immunofluo-rescence surface staining with APC-coupled pentamerscontaining the CMVNLV peptide (Pro5® MHC, Proim-mune). After 14 days of cultivation CMVNLV-specific CD8+T cells were purified using APC-conjugated CMV-pen-tamer, anti-APC-antibodies coupled with magnetic beadsand MACS-technology. Purity of CMVNLV-specific T cellswas >95% in all cases.Isolation of RNA and cDNA synthesisRNA was isolated from CMVNLV-specific T cells using theRNeasy Plus Mini Kit (QIAGEN) and cDNA-synthesis wasperformed using a Reverse Transcription system withOligo(dT)-primers (Promega).CDR3 spectratyping of V beta familiesPCR fragments were amplified from cDNA for 24 V betafamilies (BV) and complementarity determining region(CDR3) spectratyping was performed as previouslydescribed [26,27]. Analysis of the raw data was performedwith the GeneScan 3.7 analysis software package (PEApplied Biosystems) using the Local Southern method forfragment size estimation [27]. The occurrence of domi-nant clonal expansions was quantified for each V betafamily by assigning scores for clonality (1 = Gaussian dis-tribution; 2 = several peaks; 3 = one peak; compare with[28]) and intensity as measured in relative fluorescenceunits (RFU) (0 = < 500 RFU; 1 = 500–3000 RFU; 2 =3000–8000; 3 = >8000). If necessary, PCR-products werediluted prior to spectratyping and the dilution factor wastaken into account for the calculation of the intensityscore. Diversity and intensity scores were added and BVfamilies with a total score of ≥ 5 were considered as pre-dominant. This score equally weights monoclonal BVfamilies with intermediate intensity (3+2) as well as oligo-clonal BV families with high intensity (2+3). Both catego-ries as well as monoclonal BV families with high intensity(3+3) were considered as predominant.Higher antigen avidity of CMV-specific CD8+ T cells with the CDR3-sequence SVNEAFFi ure 3 (see previous page)Higher antigen avidity of CMV-specific CD8+ T cells with the CDR3-sequence SVNEAF. CMVNLV-specific CD8+ T cells were stimulated in vitro with CMVNLV-peptide for two weeks. Donors with a monoclonal profile of BV8+ CMVNLV-specific T cells with the CDR3-sequence SANYGYT or SVNEAF respectively were selected. BV8+ T cells were identified by FACS-staining and results are shown for BV8+ gated, CMVNLV-specific-T cells only. (A) CMVNLV-specific BV8+ T cells were stained with different concentrations of CMVNLV-pentamer. The mean fluorescence intensity (MFI; note the logarithmic scale) of bound pentamer is indicated for donors with the CDR3-sequence SANYGYT (light grey) or SVNEAF (dark grey). n = 3; mean ± SEM. * p < 0.05 (Student's t-test for unpaired data). (B) CMVNLV-specific CD8+ T cells were stained with saturated amounts of CMVNLV-pentamer (1.25 μg/ml) and the dissociation rates of pentamers from CMV-specific CD8+ T cells were determined for donors with the CDR3-sequence SANYGYT (light grey) or SVNEAF (dark grey). Dissociation of pentamers was assessed by FACS analysis at different time points (range 0–180 min). Mean fluorescence intensity (MFI) of pentamer-positive T cells at time point 0 (maximum pentamer binding) was considered as 100%. n = 3; mean ± SEM. * p < 0.05 (Student's t-test for unpaired data).Table 1: Gender and age of blood donorsn male/female median age (years) age range (years)young (≤ 39 y) 10 4/6 33 28–37middle-aged (40–64 y) 7 3/4 49 42–53elderly (≥ 65 y) 15 7/8 70 65–87Page 7 of 9(page number not for citation purposes)Immunity & Ageing 2008, 5:14 http://www.immunityageing.com/content/5/1/14Bacterial cloning of TCR-sequences and sequence analysisT cell receptor sequences of the BV8 family were amplifiedusing a forward primer specific for the BV8 family (5'CGTTCCGATAGATGATTCAGG 3') and a reverse primer(5' CTGGGTCCACTCGTCATTCT 3') located in the con-stant region of the TCR beta chain. PCR fragments werecloned into the pCR®-II-TOPO® vector (Invitrogen) via TA-cloning and the vector was transformed into chemicallycompetent E. coli (One Shot TOP10, Invitrogen). For eachdonor several positive clones were picked and plasmidDNA was extracted using standard procedures (QIAprepSpin Miniprep Kit, QIAGEN). TCR-sequences were deter-mined by standard sequencing procedures (QIAGEN) andsequence data were analyzed using the Bioedit SequenceAlignment Editor of TCR binding kineticsCMVNLV-specific CD8+ T cells were harvested after 14 daysof culture and used for pentamer binding and dissociationassays as previously described [29,30] with minor modifi-cations. Briefly, T cells were stained with increasingamounts (range 0.1 to 5 μg/ml) of CMVNLV-pentamers.Mean fluorescence intensity (MFI) of pentamer-bindingCD8+ T cells was measured by a FACSCalibur flow cytom-eter (BD Pharmingen). For the analysis of pentamer disso-ciation T cells were stained with saturated amounts ofCMVNLV-pentamers (1.25 μg/ml). 25 μg/ml unlabelledanti-HLA-A2*0201 antibodies (clone BB7.2) were addedto prevent re-binding of dissociated pentamers. Dissocia-tion of pentamers was assessed by FACS analysis at differ-ent time points (range 0–180 min). The MFI of pentamer-positive T cells at time point 0 (maximum pentamer bind-ing) was considered as 100%.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsAS carried out the TCR avidity studies. BW carried outcloning and sequencing experiments and prepared themanuscript. DW carried out cloning and sequencingexperiments. DHB performed FACS-analysis. SR partici-pated in the analysis of sequence data. CG collected bloodfrom healthy donors and performed HLA-analysis. HScollected blood from healthy donors and performed HLA-analysis. WP performed the spectratyping. RW performedantibody analysis. BGL designed the study and supervisedthe preparation the manuscript.AcknowledgementsThis work has been supported by the Austrian Science Fund (project S9308-B05) and part of this project was supported by, and carried out within the EU-funded Network of Excellence LifeSpan (FP6 036894). We thank Michael Keller and Brigitte Jenewein for outstanding technical sup-Europe) post-doctoral fellowship funded by the Austrian Federal Ministry of Science and Research.References1. Gavazzi G, Krause KH: Ageing and infection.  Lancet Infect Dis2002, 2:659-666.2. Edmunds WJ, Brisson M, Rose JD: The epidemiology of herpeszoster and potential cost-effectiveness of vaccination in Eng-land and Wales.  Vaccine 2001, 19:3076-3090.3. Volpi A, Gross G, Hercogova J, Johnson RW: Current manage-ment of herpes zoster: the European view.  Am J Clin Dermatol2005, 6:317-325.4. Rajagopalan S, Yoshikawa TT: Tuberculosis in the elderly.  Z Ger-ontol Geriatr 2000, 33:374-380.5. Yoshikawa TT: Tuberculosis in aging adults.  J Am Geriatr Soc1992, 40:178-187.6. Nikolich-Zugich J: Ageing and life-long maintenance of T-cellsubsets in the face of latent persistent infections.  Nat RevImmunol 2008, 8:512-522.7. Pawelec G, Akbar A, Caruso C, Solana R, Grubeck-Loebenstein B,Wikby A: Human immunosenescence: is it infectious?  ImmunolRev 2005, 205:257-268.8. Stowe RP, Kozlova EV, Yetman DL, Walling DM, Goodwin JS, GlaserR: Chronic herpesvirus reactivation occurs in aging.  Exp Ger-ontol 2007, 42:563-570.9. Polic B, Hengel H, Krmpotic A, Trgovcich J, Pavic I, Luccaronin P, Jon-jic S, Koszinowski UH: Hierarchical and redundant lymphocytesubset control precludes cytomegalovirus replication duringlatent infection.  J Exp Med 1998, 188:1047-1054.10. Reusser P, Riddell SR, Meyers JD, Greenberg PD: Cytotoxic T-lym-phocyte response to cytomegalovirus after human alloge-neic bone marrow transplantation: pattern of recovery andcorrelation with cytomegalovirus infection and disease.  Blood1991, 78:1373-1380.11. Walter EA, Greenberg PD, Gilbert MJ, Finch RJ, Watanabe KS, Tho-mas ED, Riddell SR: Reconstitution of cellular immunity againstcytomegalovirus in recipients of allogeneic bone marrow bytransfer of T-cell clones from the donor.  N Engl J Med 1995,333:1038-1044.12. Reddehase MJ: The immunogenicity of human and murinecytomegaloviruses.  Curr Opin Immunol 2000, 12:390-396.13. Khan N, Shariff N, Cobbold M, Bruton R, Ainsworth JA, Sinclair AJ,Nayak L, Moss PA: Cytomegalovirus seropositivity drives theCD8 T cell repertoire toward greater clonality in healthyelderly individuals.  J Immunol 2002, 169:1984-92.14. Appay V, Dunbar PR, Callan M, Klenerman P, Gillespie GM, PapagnoL, Ogg GS, King A, Lechner F, Spina CA, et al.: Memory CD8+ Tcells vary in differentiation phenotype in different persistentvirus infections.  Nat Med 2002, 8:379-385.15. Gillespie GM, Wills MR, Appay V, O'Callaghan C, Murphy M, Smith N,Sissons P, Rowland-Jones S, Bell JI, Moss PA: Functional heteroge-neity and high frequencies of cytomegalovirus-specificCD8(+) T lymphocytes in healthy seropositive donors.  J Virol2000, 74:8140-8150.16. Almanzar G, Schwaiger S, Jenewein B, Keller M, Herndler-Brandstet-ter D, Wurzner R, Schonitzer D, Grubeck-Loebenstein B: Long-term cytomegalovirus infection leads to significant changesin the composition of the CD8+ T-cell repertoire, which maybe the basis for an imbalance in the cytokine production pro-file in elderly persons.  J Virol 2005, 79:3675-3683.17. Jin X, Demoitie MA, Donahoe SM, Ogg GS, Bonhoeffer S, KakimotoWM, Gillespie G, Moss PA, Dyer W, Kurilla MG, et al.: High fre-quency of cytomegalovirus-specific cytotoxic T-effector cellsin HLA-A*0201-positive subjects during multiple viral coin-fections.  J Infect Dis 2000, 181:165-175.18. Weekes MP, Carmichael AJ, Wills MR, Mynard K, Sissons JG: HumanCD28-CD8+ T cells contain greatly expanded functionalvirus-specific memory CTL clones.  J Immunol 1999,162:7569-7577.19. Khan N, Hislop A, Gudgeon N, Cobbold M, Khanna R, Nayak L, Rick-inson AB, Moss PA: Herpesvirus-specific CD8 T cell immunityin old age: cytomegalovirus impairs the response to a cores-Page 8 of 9(page number not for citation purposes)port. DHB is supported by a FLARE (Future Leaders of Ageing Research in ident EBV infection.  J Immunol 2004, 173:7481-9.Publish with BioMed Central   and  every scientist can read your work free of charge"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."Sir Paul Nurse, Cancer Research UKYour research papers will be:available free of charge to the entire biomedical communitypeer reviewed and published immediately upon acceptancecited in PubMed and archived on PubMed Central Immunity & Ageing 2008, 5:14 http://www.immunityageing.com/content/5/1/1420. Franceschi C, Bonafe M, Valensin S, Olivieri F, De LM, Ottaviani E, DeBG: Inflamm-aging. An evolutionary perspective on immu-nosenescence.  Ann N Y Acad Sci 2000, 908:244-254.21. Blasko I, Stampfer-Kountchev M, Robatscher P, Veerhuis R, Eikelen-boom P, Grubeck-Loebenstein B: How chronic inflammation canaffect the brain and support the development of Alzheimer'sdisease in old age: the role of microglia and astrocytes.  AgingCell 2004, 3:169-176.22. Olsson J, Wikby A, Johansson B, Lofgren S, Nilsson BO, Ferguson FG:Age-related change in peripheral blood T-lymphocyte sub-populations and cytomegalovirus infection in the very old:the Swedish longitudinal OCTO immune study.  Mech AgeingDev 2000, 121:187-201.23. Wikby A, Johansson B, Olsson J, Lofgren S, Nilsson BO, Ferguson F:Expansions of peripheral blood CD8 T-lymphocyte subpopu-lations and an association with cytomegalovirus seropositiv-ity in the elderly: the Swedish NONA immune study.  ExpGerontol 2002, 37:445-53.24. Wills MR, Carmichael AJ, Mynard K, Jin X, Weekes MP, Plachter B,Sissons JG: The human cytotoxic T-lymphocyte (CTL)response to cytomegalovirus is dominated by structural pro-tein pp65: frequency, specificity, and T-cell receptor usage ofpp65-specific CTL.  J Virol 1996, 70:7569-7579.25. Boppana SB, Britt WJ: Recognition of human cytomegalovirusgene products by HCMV-specific cytotoxic T cells.  Virology1996, 222:293-296.26. Saurwein-Teissl M, Lung TL, Marx F, Gschosser C, Asch E, Blasko I,Parson W, Bock G, Schonitzer D, Trannoy E, et al.: Lack of antibodyproduction following immunization in old age: associationwith CD8(+)CD28(-) T cell clonal expansions and an imbal-ance in the production of Th1 and Th2 cytokines.  J Immunol2002, 168:5893-5899.27. Herndler-Brandstetter D, Schwaiger S, Veel E, Fehrer C, Cioca DP,Almanzar G, Keller M, Pfister G, Parson W, Wurzner R, et al.: CD25-expressing CD8+ T cells are potent memory cells in old age.J Immunol 2005, 175:1566-1574.28. Day EK, Carmichael AJ, ten BI, Waller EC, Sissons JG, Wills MR:Rapid CD8+ T cell repertoire focusing and selection of high-affinity clones into memory following primary infection witha persistent human virus: human cytomegalovirus.  J Immunol2007, 179:3203-3213.29. Peggs K, Verfuerth S, Pizzey A, Ainsworth J, Moss P, Mackinnon S:Characterization of human cytomegalovirus peptide-specificCD8(+) T-cell repertoire diversity following in vitro restimu-lation by antigen-pulsed dendritic cells.  Blood 2002,99:213-223.30. Hamel Y, Rohrlich P, Baron V, Bonhomme D, Rieux-Laucat F, NeckerA, Lemonnier F, Ferradini L, Fischer A, Cavazzana-Calvo M: Charac-terization of antigen-specific repertoire diversity following invitro restimulation by a recombinant adenovirus expressinghuman cytomegalovirus pp65.  Eur J Immunol 2003, 33:760-768.31. Trautmann L, Rimbert M, Echasserieau K, Saulquin X, Neveu B,Dechanet J, Cerundolo V, Bonneville M: Selection of T cell clonesexpressing high-affinity public TCRs within Human cytome-galovirus-specific CD8 T cell responses.  J Immunol 2005,175:6123-6132.32. Weekes MP, Wills MR, Mynard K, Carmichael AJ, Sissons JG: Thememory cytotoxic T-lymphocyte (CTL) response to humancytomegalovirus infection contains individual peptide-spe-cific CTL clones that have undergone extensive expansion invivo.  J Virol 1999, 73:2099-2108.33. Price DA, Brenchley JM, Ruff LE, Betts MR, Hill BJ, Roederer M, KoupRA, Migueles SA, Gostick E, Wooldridge L, et al.: Avidity for anti-gen shapes clonal dominance in CD8+ T cell populations spe-cific for persistent DNA viruses.  J Exp Med 2005,202:1349-1361.34. Derby M, exander-Miller M, Tse R, Berzofsky J: High-avidity CTLexploit two complementary mechanisms to provide betterprotection against viral infection than low-avidity CTL.  JImmunol 2001, 166:1690-1697.35. Gallimore A, Dumrese T, Hengartner H, Zinkernagel RM, Rammen-see HG: Protective immunity does not correlate with thehierarchy of virus-specific cytotoxic T cell responses to nat-urally processed peptides.  J Exp Med 1998, 187:1647-1657.toxic T-lymphocyte response is associated with antiviral pro-tective immunity.  J Virol 2000, 74:5769-5775.37. Alexander-Miller MA, Leggatt GR, Berzofsky JA: Selective expan-sion of high- or low-avidity cytotoxic T lymphocytes and effi-cacy for adoptive immunotherapy.  Proc Natl Acad Sci USA 1996,93:4102-4107.38. Yee C, Savage PA, Lee PP, Davis MM, Greenberg PD: Isolation ofhigh avidity melanoma-reactive CTL from heterogeneouspopulations using peptide-MHC tetramers.  J Immunol 1999,162:2227-2234.39. Zeh HJ III, Perry-Lalley D, Dudley ME, Rosenberg SA, Yang JC: Highavidity CTLs for two self-antigens demonstrate superior invitro and in vivo antitumor efficacy.  J Immunol 1999,162:989-994.40. Yang S, Linette GP, Longerich S, Haluska FG: Antimelanoma activ-ity of CTL generated from peripheral blood mononuclearcells after stimulation with autologous dendritic cells pulsedwith melanoma gp100 peptide G209-2M is correlated toTCR avidity.  J Immunol 2002, 169:531-539.41. Moss P, Rickinson A: Cellular immunotherapy for viral infec-tion after HSC transplantation.  Nat Rev Immunol 2005, 5:9-20.42. Weinberger B, Herndler-Brandstetter D, Schwanninger A, WeiskopfD, Grubeck-Loebenstein B: Biology of immune responses tovaccines in elderly persons.  Clin Infect Dis 2008, 46:1078-1084.43. Trzonkowski P, Mysliwska J, Szmit E, Wieckiewicz J, Lukaszuk K, Bry-dak LB, Machala M, Mysliwski A: Association between cytomeg-alovirus infection, enhanced proinflammatory response andlow level of anti-hemagglutinins during the anti-influenzavaccination–an impact of immunosenescence.  Vaccine 2003,21:3826-3836.44. Schmaltz HN, Fried LP, Xue QL, Walston J, Leng SX, Semba RD:Chronic cytomegalovirus infection and inflammation areassociated with prevalent frailty in community-dwellingolder women.  J Am Geriatr Soc 2005, 53:747-754.yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralPage 9 of 9(page number not for citation purposes)36. Sedlik C, Dadaglio G, Saron MF, Deriaud E, Rojas M, Casal SI, LeclercC: In vivo induction of a high-avidity, high-frequency cyto-


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items