Open Collections

UBC Graduate Research

Mycobacterium tuberculosis Promotes Anti-Apoptotic Activity of the Macrophage by PtpA-Dependent Dephosphorylation… Poirier, Valérie; Bach, Horacio; Av-Gay, Yossef Oct 31, 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
42591-Poirier_V_et_al_Medi_649_2014.pdf [ 668.41kB ]
Metadata
JSON: 42591-1.0075838.json
JSON-LD: 42591-1.0075838-ld.json
RDF/XML (Pretty): 42591-1.0075838-rdf.xml
RDF/JSON: 42591-1.0075838-rdf.json
Turtle: 42591-1.0075838-turtle.txt
N-Triples: 42591-1.0075838-rdf-ntriples.txt
Original Record: 42591-1.0075838-source.json
Full Text
42591-1.0075838-fulltext.txt
Citation
42591-1.0075838.ris

Full Text

Mycobacterium tuberculosis dephosphorylation of human GSK3α   1  Mycobacterium tuberculosis Promotes Anti-Apoptotic Activity of the Macrophage by PtpA-Dependent Dephosphorylation of Host GSK3α*  Valérie Poirier, Horacio Bach and Yossef Av-Gay  From the Division of Infectious Diseases, Department of Medicine, University of British Columbia, Vancouver, BC, Canada, V6H 3Z6  *Running Title: Mycobacterium tuberculosis dephosphorylation of human GSK3α   To whom correspondence should be addressed: Yossef Av-Gay, Division of Infectious Diseases, Department of Medicine, University of British Columbia, 2660 Oak Street, Vancouver, BC, Canada. Tel.: (604) 875-4588; Fax: (604) 875-4013; Email: yossi@mail.ubc.ca  Keywords: Mycobacterium tuberculosis; Macrophage; Tyrosine Phosphatase; Signal Transduction; Apoptosis   Background: Alveolar macrophages are the primary target of Mycobacterium tuberculosis infection.  Results: Mycobacterial PtpA dephosphorylates host GSK3α Y279 resulting in modulation of its activity. Conclusion: Dephosphorylation of GSK3α decreases apoptosis of the host early in infection promoting survival of the macrophage and the pathogen within it. Significance: Understanding the mechanisms by which Mycobacterium tuberculosis enables successful infection is essential for understanding the pathogenesis of Tuberculosis.    ABSTRACT  Mycobacterium tuberculosis tyrosine phosphatase PtpA inhibits two key cellular events in macrophages required for the elimination of invading organisms; phagosome acidification and maturation. Kinome analysis revealed multiple PtpA-dependent changes to the phosphorylation status of macrophage proteins upon M. tuberculosis infection. Among those, we show that PtpA dephosphorylates GSK3α on amino acid Y279, which leads to modulation of GSK3α anti-apoptotic activity, promoting pathogen survival early during infection.     Mycobacterium tuberculosis (M. tuberculosis), one of the most notorious infectious agents of humans, is estimated to have caused 1.3 million deaths in 2012 (WHO Report, 2013). The combination of co-infection with HIV and the emergence of multidrug-resistant strains gives Tuberculosis the highest mortality rate of any infectious disease (1).    M. tuberculosis infects the human lung, where circulating alveolar macrophages paradoxically serve as both first line of defence against microbial infections as well as the  bacilli’s natural habitat (2). Once engulfed by the macrophage, M. tuberculosis replicates and persists in a secluded organelle named the mycobacterial phagosome. M. tuberculosis inhibits phagosome maturation, a natural macrophage process whereby  phagosomes harbouring foreign particles fuse with lysosomes (3), and thus prevents proteolytic degradation and downstream immunological processes required to initiate an adaptive immune response (2). This phenomenon highlights how M. tuberculosis interferes with the macrophage trafficking machinery, a process essential for M. tuberculosis infectivity (3-7).    We have previously shown that the low molecular weight tyrosine phosphatase, PtpA, is needed to block phagosome maturation and is essential for M. tuberculosis pathogenicity within human macrophages (8). PtpA’s substrate in the host is the human Mycobacterium tuberculosis dephosphorylation of human GSK3α   2  vesicle trafficking protein Vacuolar Protein Sorting 33B (hVPS33B) (8,9) which plays a key role in the regulation of membrane fusion in the endocytic pathway (10). Dephosphorylation of hVPS33B by PtpA translates directly into  phagosome maturation arrest (8). In parallel, PtpA disrupts the macrophage’s V-ATPase pump assembly (11); a protein complex that controls phagosome acidification by transporting protons across membranes (12). During phagosome maturation, the recruitment of the pump to the phagosome generally results in a significant reduction in  phagosomal pH (13). However, the binding of PtpA to subunit H of the macrophage V-ATPase pump results in reduction of phagosome acidification (11).           Phosphatases play key roles in signal transduction in different pathways (14). In order to decipher the multifaceted activity of PtpA on macrophage signaling pathways, we conducted a large-scale analysis of signaling networks, termed kinome analysis (15), and discovered that PtpA affects the phosphorylation pattern of a series of host signaling proteins. Most significantly, we identified human Glycogen Synthase Kinase 3 (GSK3) as another potential substrate for mycobacterial PtpA.   GSK3 is a multifunctional serine/threonine kinase that acts as a regulatory switch for numerous signaling pathways including the insulin response, glycogen regulation, cell survival and apoptosis (16). There are two mammalian isoforms of GSK3 encoded by distinct genes: GSK3α (51 kDa) and GSK3β (47 kDa). These two isoforms share a high degree of structural similarity, specifically in their kinase domain (98% identity), but are not functionally identical (17). GSK3α and GSK3β are constitutively active in resting cells and are primarily regulated through the inhibition of their activity via phosphorylation of S21 and S9 respectively (18). Conversely, the isoforms’ activity is positively regulated by the phosphorylation of a tyrosine residue located in the activation loop, Y279 (GSK3α) and Y216 (GSK3β), and this phosphorylation is essential for full activity of the enzyme (19). Apoptotic stimuli increase the isoforms’ activity by tyrosine phosphorylation (Y279/216) in certain cell lines (20), providing evidence for a role for tyrosine phosphorylation in apoptosis.    In this study, we show that PtpA is capable of interfering with multiple signaling pathways within human macrophages, resulting in observable changes in the phosphorylation pattern of host signaling proteins. Most notably, we reveal that PtpA dephosphorylates GSK3α on Y279. We suggest that modulation of GSK3α’s activity interferes with apoptosis of the macrophage, the programmed self destruction process considered to be a defence mechanism utilized by the human host against M. tuberculosis.   EXPERIMENTAL PROCEDURES  Tissue Culture Maintenance and Differentiation - The human monocytic leukemia cell line THP-1 (TIB-202; ATCC) was cultured in RMPI 1640 medium (Sigma-Aldrich) supplemented with 10% FBS (PAA Laboratories Inc.), 1% L-glutamine, 1% penicillin and 1% streptomycin (StemCell). Cells were seeded in 10 cm (diameter) tissue culture dishes at a density of 7.0 x 106 cells/dish and differentiated into a macrophage-like cell line with 20 ng/ml phorbol myristate acetate (PMA) (Sigma-Aldrich) in RPMI 1640 medium supplemented with 10% FBS and 1% L-glutamine (incomplete RPMI) at 37 °C in a humidified atmosphere of 5% CO2 for 18 h.   Macrophage Infection - Bacterial cells were washed with Middlebrook 7H9 broth supplemented with 0.05% (v/v) Tween 80 (Sigma-Aldrich). Infection of THP-1 macrophage-like cells was performed using human serum-opsonized M. tuberculosis at a multiplicity of infection (MOI) of 10:1 in RPMI 1640 medium. After a 3 h incubation at 37 °C and 5% CO2, cells were washed with RPMI 1640 medium to remove non-internalized bacteria and re-incubated at 37 °C and 5% CO2 in incomplete RPMI containing 100 μg/ml gentamicin (Invitrogen) for 4, 18 or 48 h.  Mycobacterium tuberculosis dephosphorylation of human GSK3α   3   Macrophage Cellular Extraction - At defined time points after infection, infected THP-1 macrophage-like cells were washed twice with cold PBS and cellular extracts were harvested in lysis buffer (20 mM Tris-HCl, 5 mM EDTA, 1% Triton X-100, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 1 mM phosphatase inhibitor cocktail (Sigma-Aldrich), pH 7.2) by drawing the solution in and out of a blunt syringe 15-20 times. The cellular extracts were centrifuged for 10 min at 13 000 RPM and passed through a 0.22 μm filter column (Millipore Corporation).  Macrophage RNA Extraction and cDNA Synthesis - Total RNA was extracted from M. tuberculosis-infected THP-1-derived macrophages (7.0 x 106 cells) at defined time points (4, 18, and 48 h) using the RNAspin Mini Kit according to the manufacturer’s instructions (GE Healthcare). RNA was reversed transcribed to cDNA using the EasyScript cDNA Synthesis Kit following the manufacturer’s protocol (ABM). For each cDNA synthesis, 1 µg of total RNA, measured by an Epoch Microplate Spectrophotometer (BioTek), and 0.5 µM oligo(dT) oligonucleotides primers were used.   Quantitative Polymerase Chain Reaction (qPCR) - Primers specific for GSK3α and caspase-3 mRNA were designed using Primer-BLAST (National Center for Biotechnology Information) (Table 1). Control PCR amplifications for the expressions of the gene-specific mRNAs were performed on cDNA templates from uninfected PMA-differentiated THP-1 cells to confirm the specificity of the designed primers. Each qPCR reaction contained 2 X EvaGreen qPCR Mastermix (ABM), 15 ng cDNA and 1 μM of each primer and was analyzed in quantification mode on a DNA Engine Opticon instrument (Bio-Rad Laboratories). The following cycling conditions were used: 95 °C for 10 min, 40 cycles of 95 °C for 15 sec, 52 °C for 15 sec, and 60 °C for 30 sec with data collection during each cycle. Mock reactions (no reverse transcriptase) were also included with each experiment to confirm the absence of genomic DNA contamination. Ct values were converted to copy numbers using standard curves. Results were analyzed using GraphPad Prism 5.0 software. All values of gene-specific mRNA were internally normalized to cDNA expression levels of the housekeeping gene gapdh.   Cloning of DNA and Expression of Recombinant Proteins - The list of plasmids and oligonucleotides used for cloning in this study are described in Table 2 and Table 3 respectively. GSK3α was obtained as a plasmid (pANT7-GSK3α) from the DNASU Plasmid Repository and PCR-amplified and cloned into the pGEX-6P-3 vector (GE Healthcare). The plasmid pBO1-GSK3α encoding for a His-tagged fusion protein was purchased from GeneCopoeia Inc. The gene encoding Rab7 was PCR-amplified from cDNA prepared from THP-1 cells and was cloned into pET22b (Millipore Corporation). The M. tuberculosis ptpA gene was cloned into pGEX-6P-3. All plasmid constructs were verified by sequencing (Eurofins MWG Operon). Chemically competent BL21 E. coli cells were transformed with the expression plasmids and expressed according to established protocols. His-tagged recombinant proteins were purified from the soluble fraction by affinity chromatography on Ni-NTA polyhistidine-tag purification resin (Qiagen) and GST-tagged proteins, by affinity chromatography on glutathione-agarose resin (Sigma-Alrich).   Kinome Analysis by Kinetworks Phospho-Site Screen (KPSS) Assay - Kinome analysis was performed as  previously described (21). Briefly, THP-1 macrophage-like cells were infected with wild-type M. tuberculosis H37Rv and with the H37Rv strain in which the ptpA gene was deleted (ΔptpA M. tuberculosis) (8) and cellular extracts were harvested 18 h post-infection. The macrophage lysates were prepared for kinome analysis according to the manufacturer’s instructions (Kinexus Bioinformatics Corporation, http://www.kinexus.ca). Samples were sent to Kinexus Bioinformatics Corporation where the assay was performed. Data was analysed according to statistical confidence provided by Mycobacterium tuberculosis dephosphorylation of human GSK3α   4  experience in analysing over ten thousand screens. According to Kinexus, the significance levels of change are over 25% variability in intensity.   Western Blot Analysis - In vivo Western blot analyses were performed using cellular extracts of infected THP-1 macrophage-like cells harvested 18 and 48 h post-infection as described above. Briefly, 50 μg of THP-1 cellular extracts were resolved by SDS-PAGE and transferred onto a nitrocellulose membrane (Bio-Rad Laboratories). The blots were probed with affinity purified rabbit polyclonal anti-phosphoGSK3α (pY279) (Invitrogen), anti-GSK3α or with affinity purified rabbit polyclonal anti-caspase-3 (Cell Signaling) (final IgG dilution for both antibodies, 1:1000) and incubated overnight at 4 °C. For detection of phosphorylated GSK3α (Y279), horseradish peroxidase-conjugated goat anti-rabbit (Sigma-Aldrich) (final IgG dilution, 1:3500) antibody was used as the secondary detection reagent and the blot was developed by enhanced chemiluminescence (ECL) (Thermo Fisher Scientific). For detection of GSK3α and caspase-3, Alexa Fluor 680 goat anti-rabbit (Invitrogen) antibody was used as the secondary detection reagent (final IgG dilution, 1:10 000) and detection was done using an Odyssey Infrared CLx Imager (LI-COR Biosciences).   For in vitro Western blot analysis, different reactions containing 1 to 4 μM of recombinant GSK3α were incubated with 0.15 mM ATP for 1 h at 37 °C. A fixed concentration of recombinant PtpA (0.04 μM) was added to the different GSK3α reactions and incubation was continued for 45 min at 37 °C. The resulting samples were resolved by SDS-PAGE and transferred onto a nitrocellulose membrane. The blot was probed with rabbit anti-phosphoGSK3α (pY279) IgG and horseradish peroxidase-conjugated goat anti-rabbit antibody was used as the secondary detection reagent as previously described. The blot was developed by ECL. To ensure identical protein loading of the different samples, Ponçeau staining of the blot was performed.    In Vitro Kinase Assay - Three separate subsets of reactions containing 2, 3 and 4 μM of recombinant GSK3α were autophosphorylated in a kinase buffer (50 mM Tris-HCl, 5 mM MgCl2, 2 mM MnCl2, 1 mM DTT, pH 7.5) containing 10 μCi γ32P-ATP (PerkinElmer) for 30 min at 37 °C. After this incubation period, 0.04 μM of PtpA was added to the second subset of reactions and 0.04 μM of PtpA and 1.5 mM or 5 μM of the phosphatase inhibitors, Na3VO4 or BVT 948 respectively, to the third. Incubation of all three subsets was continued for 15 min at 37 °C. At the end of the incubation period, reactions were stopped with the addition of SDS sample loading buffer and heated at 95 °C for 8 min. The samples were resolved by 12% SDS-PAGE. The gel was silver-stained, dried and exposed to a screen overnight. The 32P-radioactively labeled protein bands were detected by a PhosphorImager SI apparatus (GE Healthcare). Bands corresponding to phosphorylated GSK3α were cut, submerged in scintillation fluid (Beckman Coulter Inc.) and analyzed by scintillation counting using a Beckman Coulter LS 6500 (Beckman Coulter Inc.).  Radiometric Kinase Assay - The kinase assay was performed as described above up to the end of the second incubation period. Reactions were spotted onto phosphocellulose paper (GE Healthcare), dried and washed thoroughly with 1% phosphoric acid six times for 10 min. Radioactivity levels were measured by submerging the phosphocellulose papers in scintillation fluid and analyzed by scintillation counting.   Determination of PtpA and GSK3α Dissociation Constant - The interaction between PtpA and GSK3α was measured using a Fusion-α-HT Multimode Microplate Reader (PerkinElmer) and the ALPHAScreen Histidine (Nickel Chelate) Detection Kit (PerkinElmer). Purified GST-tagged recombinant PtpA was biotinylated using the Mycobacterium tuberculosis dephosphorylation of human GSK3α   5  EZ-Link Biotinylation Kit (Thermo Fisher Scientific) and diluted in the assay buffer (25 mM HEPES, 100 mM NaCl, and 0.1% Tween 20, pH 7.4) in 384-well microplates (PerkinElmer). Purified His-tagged recombinant GSK3α was added to wells containing PtpA. Nickel chelating acceptor beads were further added to the proteins and the microplate was incubated for 30 min at room temperature. Streptavidin donor beads were then added to the reactions and incubation was continued for 1 h at room temperature.  Kinetics of the reactions was monitored in the ALPHAScreen apparatus by luminescence signals generated from protein-protein interactions (counts per second (cps)). Results obtained were analyzed with GraphPad 5.0 software for dissociation constant determination.  RESULTS  Global Effect of PtpA on Macrophage Proteins - PtpA is secreted into the macrophage cytosol (8). The in vitro dephosphorylation assay, under which recombinant PtpA was incubated with host macrophage’s extracts, resulted in dephosphorylation of multiple host proteins in addition to hVPS33B, a host substrate we have identified before (Fig. 1 and Table 4) (8). This demonstrates that as an active phosphatase, PtpA is capable of interacting with multiple host signaling proteins.   We have used a specific proteomics approach termed kinome analysis to identify macrophage signaling proteins that might be affected by M. tuberculosis PtpA. This method uses an array of phospho-specific antibodies against defined human signaling proteins and networks (15). To test PtpA’s effect on signal transduction pathways, we monitored and compared the phosphorylation status of a predefined set of signaling proteins from uninfected macrophages, macrophages infected with M. tuberculosis and macrophages infected with ΔptpA M. tuberculosis. We chose to investigate events occurring 18 h post-infection since at this time point bacteria are well established in the environment of the host, allowing for the monitoring of macrophage responses to bacteria residing within phagosomes.  As illustrated in Figure 2, cellular extracts of uninfected and M. tuberculosis-infected macrophages were subjected to simultaneous screens (Fig. 2A-C). Changes in phosphorylation were measured based on the intensity of 38 predefined phosphoproteins (Table 5) shown as bands in each gel. The phosphorylation levels of the three different treatments were compared in terms of the relative fold change in phosphorylation. The fold change was calculated by comparing the accumulated signal of proteins obtained over a given scan time (normalized counts per minute) from uninfected macrophages and macrophages treated with M. tuberculosis, to the accumulated signal of proteins from macrophages treated with ΔptpA M. tuberculosis (control; accumulated signal set as 1) (Table 5). Due to the high sensitivity of the assay in determining the phosphorylation state of phosphoproteins, a change in phosphorylation greater than 25% between treated cells is considered significant according to the company, Kinexus Bioinformatics Corporation, which provides the screening kit. A change in phosphorylation of less than this percentage may be due to experimental variation.    As seen in Figure 2, and detailed in Table 5, out of 38 tested signaling proteins, an accumulated signal was detected for 17 macrophage phosphoproteins. Among these, several displayed significant changes in phosphorylation between macrophages infected with M. tuberculosis and the control ΔptpA mutant. These include Protein Kinase C α (PKCα; fold change of 1.25 compared to the control), Double-Stranded RNA-Dependent Protein Kinase (PKR1; 1.54), Protein Kinase C α/β2 (PKCα/β2; 0.62), Raf 1 Proto-Oncogene-Encoded Protein Kinase (Raf1; 0.47), Protein Kinase C δ (PKCδ; 0.51), Mitogen- and Stress-Activated Protein Kinase 1 (Msk1; 0.67), Src Proto-Oncogene-Encoded Protein Kinase (Src; 1.57), Glycogen Synthase Kinase 3α (GSK3α; 0.33), and Glycogen Synthase Kinase 3β (GSK3β; 0.61). Among Mycobacterium tuberculosis dephosphorylation of human GSK3α   6  these, Src kinase was the only protein previously shown to be associated with M. tuberculosis infection (22).    Interestingly, the serine/threonine protein kinase GSK3α was identified as the protein dephosphorylated the most by M. tuberculosis. GSK3α Y279 showed a 67% decrease in phosphorylation when macrophages infected with M. tuberculosis were compared to macrophages infected with the ΔptpA mutant strain. Due to its status as a key player in the regulation of cell fate in both pro- and anti-apoptotic processes (23,24), GSK3α was selected for further analysis.    PtpA Does Not influence GSK3α Transcription Levels - To rule out the possibility that the GSK3α dephosphorylation observed in the kinome analysis (Fig. 2) was caused by reduced levels of expression due to PtpA’s effect on GSK3α transcription levels, we examined levels of GSK3α transcripts by quantitative PCR (qPCR). RNA from uninfected THP-1 cells and from THP-1 cells infected with M. tuberculosis and ΔptpA M. tuberculosis was harvested 18 h post-infection corresponding to the time point at which lysates were harvested for the kinome analysis. As seen in Figure 3, qPCR profiling revealed a general modest increase in GSK3α transcript levels in cells infected with both M. tuberculosis and the ΔptpA mutant (Fig. 3A-B) without significant difference between the two. Therefore, we concluded that PtpA does not have an impact on GSK3α expression levels and that the dephosphorylation observed in the kinome analysis is not due to PtpA’s effect on GSK3α transcription level, but rather on bona fide dephosphorylation of GSK3α by PtpA.    PtpA Dephosphorylates GSK3α Under In Vivo and In Vitro Growth Conditions - To examine the dephosphorylation of GSK3α by PtpA, we conducted a Western blot assay in which we tested cellular extracts of macrophages infected with M. tuberculosis and the ΔptpA mutant (Fig. 4A). The phosphorylation level was monitored using the same anti-phosphoGSK3α (pY279) antibody used in the kinome analysis (Fig. 2). As seen in Figure 4A, GSK3α phosphorylation levels were found to be higher in extracts obtained from macrophages infected with the ΔptpA mutant compared to macrophages extracts obtained from infection by the parental M. tuberculosis strain, confirming our kinome analysis screening. We used an anti-GSK3α antibody to confirm that total protein levels of GSK3α did not change between samples.   To determine whether GSK3α is a direct substrate of PtpA, we used two separate approaches: biochemical assays to monitor catalysis and a protein-protein interaction analysis to determine interaction between the two proteins. Western blot analysis of recombinant GSK3α to which PtpA was added was performed and the result demonstrated that Y279 is dephosphorylated by PtpA in vitro (Fig. 4B). To assess the veracity of the dephosphorylating effect of PtpA on GSK3α, two Western blot analyses were performed in which the tyrosine phosphatase inhibitors sodium orthovanadate (Na3VO4) and BVT 948 were added to a GSK3α reaction containing PtpA. Although these are non-specific protein tyrosine phosphatase inhibitors, their inhibitory effect on PtpA is noticeable bringing the GSK3α Y279 phosphorylation level closer to its basal level (Fig. 4C-D).   A more sensitive radioactive assay monitoring GSK3α kinase activity revealed that its autophosphorylation levels were significantly reduced in the presence of recombinant PtpA (Fig. 5A). This phenomenon was ameliorated upon addition of the tyrosine phosphatase inhibitor Na3VO4 and completely reversed by the addition of BVT 948 (Fig. 5B-C). The extent of γ32P-ATP incorporation into GSK3α confirms that GSK3α is a self-phosphorylating autokinase dephosphorylated by PtpA.   To assess whether PtpA binds to GSK3α, ALPHAScreen (Amplified Luminescent Proximity Homogeneous Assay), which is used to monitor protein-protein interactions, was performed. GSK3α was immobilized to beads by His-tag while GST-Mycobacterium tuberculosis dephosphorylation of human GSK3α   7  PtpA was immobilized by biotinylation according to the manufacturer’s protocol (PerkinElmer). The results show direct and dose-dependent interaction between PtpA and GSK3α (Fig. 6). A hyperbolic curve fitting the 1:1 Langmuir binding model and a dissociation constant (Kd) of 4.023 × 10-9 M indicate a high level of affinity between the two proteins. PtpA binding to its known host substrate, hVPS33B, has a similar strength with an assessed Kd value of 2.1 x 10-9 M (8).   PtpA Interferes with Host Macrophages Apoptosis Early During Infection - GSK3α plays a key role in the control of cell fate (23,24). Previous studies  have shown that phosphorylation of GSK3α Y279 is essential for the full activity of the enzyme (19) and that apoptotic stimuli increase its tyrosine phosphorylation activity (20). To check whether dephosphorylation of GSK3α Y279 by PtpA affects apoptosis, measurements of transcriptional and translational expression levels of the apoptotic executioner, caspase-3, were taken (25).   To investigate caspase-3 transcription levels, comparative qPCR levels of caspase-3 were performed on cellular extracts from either uninfected macrophages or infected with M. tuberculosis, the ΔptpA mutant or with the complemented ΔptpA mutant (ΔptpA::ptpA). As seen in Figure 7A-B, we observed a significant difference in the expression levels of caspase-3 between cells infected with M. tuberculosis and ones infected with the ΔptpA mutant. Eighteen hours post-infection, caspase-3 transcription levels were two fold higher in the ΔptpA mutant-infected macrophages compared to wild-type M. tuberculosis-infected macrophages (Fig. 7A), indicating that suppression of  caspase-3  expression by M. tuberculosis is PtpA-dependent early during infection. Caspase-3 expression levels were even lower in macrophages infected with M. tuberculosis than in uninfected macrophages (Fig. 7A).  Interestingly, the inhibition of caspase-3 expression is overturned between 18 and 48 h post-infection where caspase-3 transcript in M. tuberculosis-infected macrophages increases, surpassing its levels in the ΔptpA mutant-infected macrophages (Fig. 7B). This turn of events indicates that PtpA interference with the apoptotic pathway is transient and macrophages are capable of initiating apoptosis regardless of the presence of PtpA (Fig. 7B).   M. tuberculosis Blocks Proteolytic Cleavage of Inactive Caspase-3 into Active Caspase-3 - To test whether PtpA’s dephosphorylation of GSK3α results in modulation of caspase-3 activity, we monitored caspase-3 proteolytic degradation using anti-caspase-3 antibody. As seen in Figure 8, M. tuberculosis infection inhibits the cleavage of inactive caspase-3 (31.6 kDa) into its active forms (17/19 kDa). Cellular extracts from uninfected cells and from cells infected with the ΔptpA mutant show both active and inactive caspase-3 whereas those from M. tuberculosis-infected macrophages show only inactive caspase-3. Macrophages infected with the ΔptpA::ptpA strain show only limited activation of caspase-3, suggesting that the observed effect of the complemented strain is not optimal and in agreement with other complementation phenotypes we have observed (8,11).  DISCUSSION  M. tuberculosis pathogenicity relies upon its ability to sense changes in the environment and respond to host defence assaults. It does so by actively interfering with macrophage physiological pathways (26). One specific strategy utilizes the secreted phosphatase, PtpA,  to block both phagosome maturation and acidification (8,11); the two key processes required for digestion of invading microorganisms and initiation of an adaptive immune response (3).   In a previous study we showed that the global kinome of macrophages changes significantly upon mycobacterial infection (21). Following the rationale that some of these changes are dependent on M. tuberculosis’ signaling protein PtpA, this study was designed to comparatively monitor Mycobacterium tuberculosis dephosphorylation of human GSK3α   8  PtpA’s contribution to the kinome status of key human signal transduction proteins during M. tuberculosis infection. We have now shown that (i) PtpA modulates global phosphorylation patterns of macrophage proteins and (ii) these modulations can impact the host cell fate.    In our previous kinome analysis, we compared the effect of infecting macrophages with live or dead Mycobacterium bovis BCG on phosphoprotein levels (21). Notably, Glycogen Synthase Kinase 3β (GSK3β) was amongst the most phosphorylated proteins upon M. bovis BCG infection (21). Interestingly, the phosphorylation pattern of M. bovis BCG and M. tuberculosis kinome analyses show some contradicting results exemplified by GSK3α and GSK3β. GSK3α and GSK3β were hyperphosphorylated on Y279/216 in cells infected with live M. bovis BCG with a fold change of 1.29 and 1.57 respectively compared to the uninfected control cells (21). Kinome analysis of M. tuberculosis infection compared to the uninfected cells show that GSK3α and GSK3β were dephosphorylated and had a fold change of 0.51 and 0.66 respectively. This discrepancy can be attributed to the genotypic differences of the two strains as M. bovis BCG is an avirulent vaccine strain (27). It is also well documented that macrophages respond differently to M. bovis BCG than they do to M. tuberculosis (28). The function of PtpA in M. bovis BCG is still under investigation. Potential reduction or absence of secreted PtpA in this vaccine strain could explain the hyperphosphorylation occurring in macrophages harbouring this non-virulent strain.    It is worth noting that, in comparison to uninfected cells, the relative fold change of the GSK3 isoforms in macrophages infected with ΔptpA M. tuberculosis resembles that of the isoforms in macrophages infected with live M. bovis BCG. In fact, an increase in phosphorylation for GSK3α (fold change of 1.54) and for GSK3β (1.07) is observed in macrophages infected with ΔptpA M. tuberculosis when compared to the phosphorylation status of these isoforms in uninfected macrophages (Table 5). This data is similar to the results obtained from our previous kinome analysis when comparing the phosphorylation status of the isoforms in M. bovis BCG-infected cells versus uninfected cells (21). It appears that the attenuation caused by the ΔptpA mutation (8) makes it behave more like the avirulent M. bovis BCG strain.   GSK3α and GSK3β play an essential role in the regulation of the apoptotic pathway which functions as a host defence mechanism in mycobacterial infection (29). Studies have shown that phosphorylation of GSK3 Y279/216 is critical for the full activation of the kinases (19) and the induction of apoptosis (20). We showed that infection of macrophages with an attenuated mycobacterial strain primes macrophages for apoptosis via increased phosphorylation of Y279/216 and activation of the isoforms (21). Results from both kinome analyses suggest that the apoptotic pathway is turned on in macrophages infected with the attenuated strains, i.e. in M. bovis BCG and ΔptpA M. tuberculosis, via phosphorylation of GSK3α and GSK3β Y279/216. Alternatively, our study demonstrates that the virulent strain M. tuberculosis H37Rv inactivates GSK3α and GSK3β by dephosphorylation of Y279/216 which promotes survival of the host cell (Table 5).    Several in vitro studies have shown that the apoptosis rate is increased in macrophages infected with mycobacteria (30,31). However, virulent strains of mycobacteria seem to induce less apoptosis compared to avirulent or attenuated strains (32,33), reinforcing the idea that M. tuberculosis has developed strategies to block apoptosis to promote host cell survival. The ability of M. tuberculosis to block apoptosis is of great importance for the pathogen as death of the host cell removes its supportive growth environment (33). In agreement with this, our experiments have shown that GSK3α dephosphorylation on Y279 can be interpreted as an anti-apoptotic signal targeted by this pathogen. Mycobacterium tuberculosis dephosphorylation of human GSK3α   9   Transcriptional levels of caspase-3, a protease that plays a critical role in the execution-phase of apoptosis of the host, were suppressed in M. tuberculosis-infected cells (Fig. 7A), indicating that M. tuberculosis blocks early expression of caspase-3 to prevent apoptosis. Moreover, a significant difference in transcript levels exists between cells infected with M. tuberculosis and those infected with ΔptpA M. tuberculosis (Fig. 7A) confirming that this suppression is PtpA-dependent. This phenomenon might not necessarily be a direct effect of PtpA, but rather a result of ΔptpA mutant attenuation.    Dephosphorylation of host GSK3α by PtpA leads to prevention of host cell apoptosis during early stages of infection. PtpA's anti-apoptotic role fades at later stages of infection but does not necessarily signify resumption of host macrophages apoptosis. To the contrary, we found that activation of caspase-3 by proteolytic cleavage in M. tuberculosis-infected macrophages is blocked 48 h post-infection despite PtpA’s non-engagement. As shown in Figure 8, inactive caspase-3 is expressed in all four treatments, but is only cleaved to active caspase-3 in two treatments: in uninfected cells and in cells infected with ΔptpA M. tuberculosis. On the other hand, macrophages infected with M. tuberculosis and the complemented mutant strain show no cleavage and limited cleavage of caspase-3 respectively.       To summarize, our study presents for the first time evidence that M. tuberculosis modulates host macrophage apoptosis using PtpA dephosphorylation of GSK3α early in infection. This provides novel insight into M. tuberculosis’ pathogenicity within macrophages and better mechanistic understanding of how it is able to circumvent the macrophage’s killing machinery.                                        ACKNOWLEDGEMENTS  Funding for this research was provided by the Canadian Institute of Health Research operating grant MOP-106622 (to Y.A-G.) We thank Stefan Szary for his help with graphical illustrations, Jeffrey Helm for proof reading of our manuscript, and Louise Creagh for her technical assistance. We also thank Kinexus Bioinformatics Corporation for their multiphosphoprotein analysis and the British Columbia Centre for Disease Control for the use of the containment level 3 facility.                                Mycobacterium tuberculosis dephosphorylation of human GSK3α   10  REFERENCES  1. Dolin, P. J., Raviglione, M. C., and Kochi, A. (1994) Global tuberculosis incidence and mortality during 1990–2000. W.H.O. Bull 72, 213 2. Hestvik, A. L., Hmama, Z., and Av-Gay, Y. (2005) Mycobacterial manipulation of the host cell. FEMS Microbiol. Rev. 29, 1041-1050 3. Armstrong, J. A., and Hart, P. D. (1971) Response of cultured macrophages to Mycobacterium tuberculosis, with observations on fusion of lysosomes with phagosomes. J. Exp. Med. 134, 713-740 4. Sturgill-Koszycki, S., Schaible, U. E., and Russell, D. G. (1996) Mycobacterium-containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis. EMBO J. 15, 6960-6968 5. Clemens, D. L., and Horwitz, M. A. (1995) Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J. Exp. Med. 181, 257-270 6. Hoflack, B., and Kornfeld, S. (1985) Lysosomal enzyme binding to mouse P388D1 macrophage membranes lacking the 215-kDa mannose 6-phosphate receptor: evidence for the existence of a second mannose 6-phosphate receptor. Proc. Natl. Acad. Sci. 82, 4428-4432 7. Xu, S., Cooper, A., Sturgill-Koszycki, S., van Heyningen, T., Chatterjee, D., Orme, I., Allen, P., and Russell, D. G. (1994) Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J. Immunol. 153, 2568-2578 8. Bach, H., Papavinasasundaram, K. G., Wong, D., Hmama, Z., and Y., A.-G. (2008) Mycobacterium tuberculosis virulence is mediated by PtpA dephosphorylation of human vacuolar protein sorting 33B. Cell Host Microbe 3, 316-322 9. Bach, H., Sun, J., Hmama, Z., and Av-Gay, Y. (2006) Mycobacterium avium subsp. paratuberculosis PtpA is an endogenous tyrosine phosphatase secreted during infection. Infect. Immun. 74, 6540-6546 10. Banta, L. M., Robinson, J. S., Klionsky, D. J., and Emr, S. D. (1988) Organelle assembly in yeast: characterization of yeast mutants defective in vacuolar biogenesis and protein sorting. J. Cell Biol. 107, 1369-1383 11. Wong, D., Bach, H., Hmama, Z., and Av-Gay, Y. (2011) Mycobacterium tuberculosis protein tyrosine phosphatase A disrupts phagosome acidification by exclusion of host vacuolar H+-ATPase. Proc. Natl. Acad. Sci. 108, 19371-19376 12. Hackam, D. J., Rotstein, O. D., Zhang, W. J., Demaurex, N., Woodside, M., Tsai, O., and Grinstein, S. (1997) Regulation of phagosomal acidification. Differential targeting of Na+/H+ exchangers, Na+/K+-ATPases, and vacuolar-type H+-ATPases. J. Biol. Chem. 272, 29810-29820 13. Mukherjee, S., Ghosh, R. N., and Maxfield, F. R. (1997) Endocytosis. Physiol Rev. 77, 759-803 14. Wong, D., Chao, J. D., and Av-Gay, Y. (2013) Mycobacterium tuberculosis-secreted phosphatases: from pathogenesis to targets for TB drug development. Trends Microbiol. 21, 100-109 15. Pelech, S., and Zhang, H. (2002) Plasticity of the kinomes in monkey and rat tissues. Sci STKE 162, PE50 16. Embi, N., Rylatt, D. B., and Cohen, P. (1980) Glycogen synthase kinase-3 from rabbit skeletal muscle. Separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase. Eur. J. Biochem. 107, 519-527 Mycobacterium tuberculosis dephosphorylation of human GSK3α   11  17. Woodgett, J. R. (1990) Molecular cloning and expression of glycogen synthase kinase-3/factor A. EMBO J 9, 2431-2438 18. Plyte, S. E., Hughes, K., Nikolakaki, E., Pulverer, B. J., and Woodgett, J. R. (1992) Glycogen synthase kinase-3: functions in oncogenesis and development. Biochim. Biophys. Acta 1114 147–162 19. Hughes, K., Nikolakaki, E., Plyte, S.E., Totty, N.F., Woodgett, J.R. (1993) Modulation of the glycogen synthase kinase-3 family by tyrosine phosphorylation. EMBO J. 12, 803-808. 20. Bhat, R. V., Shanley, J., Correll, M. P., Fieles, W. E., Keith, R. A., Scott, C. W., and Lee, C. M. (2000) Regulation and localization of tyrosine216 phosphorylation of glycogen synthase kinase-3 beta in cellular and animal models of neuronal degeneration. Proc. Natl. Acad. Sci. 97, 11074-11079 21. Hestvik, A. L., Hmama, Z., and Av-Gay, Y. (2003) Kinome analysis of host response to mycobacterial infection: a novel technique in proteomics. Infection and Immunity 71, 5514-5522 22. Karim, A. F., Chandra, P., Chopra, A., Siddiqui, Z., Bhaskar, A., Singh, A., and Kumar, D. (2011) Express path analysis identifies a tyrosine kinase Src-centric network regulating divergent host responses to Mycobacterium tuberculosis infection. J. Biol. Chem. 286, 40307-40319 23. Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M., and Hemmings, B. A. (1995) Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature Cell Biology 378, 785–789 24. Hoeflich, K. P., Luo, J., Rubie, E. A., Tsao, M. S., Jin, O., and Woodgett, J. R. (2000) Requirement for glycogen synthase kinase-3beta in cell survival and NF-kappaB activation. Nature Cell Biology 406, 86–90 25. Wang, Z. B., Liu, Y. Q., and Cui, Y. F. (2005) Pathways to caspase activation. Cell Biol Int. 29, 489-496 26. Poirier, V., and Av-Gay, Y. (2012) Mycobacterium tuberculosis modulators of the macrophage's cellular events. Microbes Infect. 14, 1211-1219 27. Behr, M. A., Wilson, M. A., Gill, W. P., Salamon, H., Schoolnik, G. K., Rane, S., and Small, P. M. (1999) Comparative genomics of BCG vaccines by wholegenome DNA microarray. Science 284, 1520–1523 28. Mahesh, Y., and Schorey, J. S. (2006) The β-glucan receptor dectin-1 functions together with TLR2 to mediate macrophage activation by mycobacteria. Blood 108, 3168-3175 29. Oddo, M., Renno, T., Attinger, A., Bakker, T., MacDonald, H. R., and Meylan, P. R. (1998) Fas ligand-induced apoptosis of infected human macrophages reduces the viability of intracellular Mycobacterium tuberculosis. J Immunol. 160, 5448-5454 30. Fratazzi, C., Arbeit, D. R., Carini, C., and Remold, H. G. (1997) Programmed cell death of Mycobacterium avium serovar 4-infected human macrophages prevents the mycobacteria from spreading and induces mycobacterial growth inhibition by freshly added, uninfected macrophages. J. Immunol. 158, 4320-4327 31. Riendeau, C. J., and Kornfeld, H. (2003) THP-1 cell apoptosis in response to mycobacterial infection. Infect. Immun. 71, 254–259 32. Balcewicz-Sablinska, M. K., Keane, J., Kornfeld, H., and Remold, H. G. (1998) Pathogenic Mycobacterium tuberculosis evades apoptosis of host macrophages by release of TNF-R2, resulting in inactivation of TNF-alpha. J. Immunol. 161, 2636-2641 33. Keane, J., Remold, H. G., and Kornfeld, H. (2000) Virulent Mycobacterium tuberculosis strains evade apoptosis of infected alveolar macrophages. J. Immunol. 164, 2016–2020 Mycobacterium tuberculosis dephosphorylation of human GSK3α   12  34. Pappin, D. J., Hojrup, P., and Bleasby, A. J. (1993) Rapid identification of proteins by peptide-mass fingerprinting. Curr Biol. 3, 327-332                                               Mycobacterium tuberculosis dephosphorylation of human GSK3α   13  FIGURE LEGENDS Fig. 1. Phosphoproteomic Analysis of Host Macrophage Proteins Dephosphorylated by PtpA Revealed by 2D Gel Electrophoresis. A cellular extract of differentiated THP-1 cells was incubated with γ32P-ATP in a kinase buffer for 30 min at 30 °C. Recombinant PtpA was added to one of the samples for 15 min and mixtures were electrophoresed onto 2D SDS-Polyacrylamide gels using a 4-7 pH gradient for the first dimension and 10% SDS-PAGE for the second dimension. The radiolabeled spot profile was obtained by exposing overnight to a PhosphorImager screen. Sixteen spots demonstrating reduced phosphorylation upon addition of PtpA were identified by mass spectrometry (Table 4).   Fig. 2. Global Kinome Analysis of THP-1 Cells Infected with M. tuberculosis and ΔptpA M. tuberculosis. Simultaneous detection of selected host proteins and their activation status using a multiple immunoblotting technique. Accurate intensity values for each protein are the accumulated signal obtained over a given scan time for each blot. These are shown as numerical values in Table 5. The three gels represent uninfected THP-1 cells (A), THP-1 cells infected with M. tuberculosis (B), and THP-1 cells infected with ΔptpA M. tuberculosis (C). Each lane was probed with one or more antibodies. The highlighted proteins are host signaling proteins showing a phosphorylation change greater than 25%. Antibodies against the phosphorylated proteins were as follows: lane 1, molecular size standard; lane 2, NR1 (S896); lane 3, PKR1 (T451); lane 4, STAT5A (Y694); lane 5, PKCα (S657), Src (Y418); lane 6, JNK (T183+Y185), RSK1/3 (T359+S363/T356+S360); lane 7, MEK3/6 (S189/S207), PKCα/β2 (T638+T641); lane 8, Erk1 (T202+Y204), Erk2 (T185+Y187), S6Kα p70 (T389), S6Kα p85 (T389); lane 9, PKCε (S729), Smad1/5/9 (S463+S363/S463+S465/S465+S467); lane 10, STAT3 (S727); lane 11, Jun (S73); lane 12, Raf1 (S259), STAT1α (Y701), STAT1β (Y701); lane 13, PKBα (Akt1) (T308), PKCδ (T507); lane 14, PKBα (Akt1) (S473); lane 15, GSK3α (S21), GSK3β (S9), Msk1 (S376); lane 16, adducin α (S726), adducin γ (S693), CDK1/2 (Y15), Src (Y529); lane 17, GSK3α (Y279), GSK3β (Y216); lane 18, p38α MAPK (T180+Y182), Rb (S780); lane 19, NPM (S4), MEK1/2 (S218+S222); lane 20, CREB1 (S133), Rb (S807+S811).   Fig. 3. Transcriptional Levels of GSK3α Post-Infection. Quantitative PCR analysis comparing mRNA levels of GSK3α from different infection conditions. RNA from uninfected and treated THP-1 cells (treated with M. tuberculosis and ΔptpA M. tuberculosis) was extracted 4 h (A) and 18 h (B) after infection and reversed transcribed. Data observed show the expression levels of GSK3α. Transcript abundance was determined relative to housekeeping gene gapdh. Data shown are the means ± standard deviation of three independent experiments. The difference in GSK3α transcript levels between M. tuberculosis- and ΔptpA M. tuberculosis-infected cells was not significant (p-value of 0.8868 for A and 0.5193 for B).   Fig. 4. Western Blot Analyses of PtpA Dephosphorylation of GSK3α In Vivo and In Vitro. (A) THP-1 cells were infected with M. tuberculosis or ΔptpA M. tuberculosis. Cellular extracts were harvested 18 h post-infection and 50 μg of it was used for Western blotting in which the anti-phosphoGSK3α (pY279) antibody was utilized. The bottom panel represents the membrane probed with anti-GSK3α. The molecular weight of GSK3α is 50.981 kDa. (B) Different concentrations of GSK3α (1, 2, 3 and 4 μM) with and without PtpA (0.04 μM) were incubated and developed by enhanced chemiluminescence. The bottom panel represents the Ponçeau stained membrane showing equal loading of samples. (C, D) A fixed concentration of GSK3α (3 μM) with and without PtpA (0.04 μM) was incubated with the tyrosine phosphatase inhibitor Na3VO4 (1.5 mM) or BVT 948 (5 μM) and developed by enhanced chemiluminescence. The bottom panels represent the Ponçeau stained membranes showing equal loading of samples.   Mycobacterium tuberculosis dephosphorylation of human GSK3α   14  Fig. 5. Kinase Assays of PtpA Dephosphorylation of GSK3α In Vitro. (A) Dephosphorylation of GSK3α by PtpA was tested in an in vitro kinase assay. GSK3α (1 and 2 μM) was autophosphorylated in a kinase buffer containing 10 μCi γ32P-ATP with or without PtpA (0.04 μM) and was resolved onto a 12% SDS gel and exposed to a PhosphorImager screen for radiolabeled band localization. After drying the gel, bands corresponding to phosphorylated GSK3α were cut from the gel, and the radioactive incorporation was measured by a scintillation counter. This graph represents the radioactivity of the dried gel. Results are expressed as ± standard deviation of three independent experiments. The p-value of 2 μM GSK3α with PtpA is 0.0214. (B, C) The inhibiting effect of PtpA on GSK3α’s activity was tested by radiometric analysis. GSK3α (2, 3 and 4 μM) was autophosphorylated in a reaction containing kinase buffer and 10 μCi γ32P-ATP. PtpA (0.04 μM) and Na3VO4 (1.5 mM) or PtpA (0.04 μM) and BVT 948 (5 μM) were added to the sample mixtures and were spotted onto phosphocellulose paper. Radioactivity levels were measured by a scintillation apparatus. *, p < 0.05; **, p < 0.001; ***, p < 0.0001. Significant difference compared by Student’s t test.   Fig. 6. PtpA Interacts with GSK3α In Vitro. Protein-protein interaction between GSK3α and PtpA was determined using ALPHAScreen technology. (A) The Kd was calculated using biotinylated PtpA and increasing concentration of His-tagged GSK3α. His-tagged Rab5c protein served as the negative control. Curve fitting yielded a Kd of 4.023 x 10-9 M. (B) The reciprocal experiment with increasing concentration of PtpA yielded a Kd of 3.125 x 10-9 M. GST was used as negative control.   Fig. 7. PtpA Reduces Trancriptional Levels of Caspase-3 Early in Infection. Quantitative PCR analysis comparing mRNA levels of caspase-3 from different infection conditions. RNA from uninfected and treated THP-1 cells (treated with M. tuberculosis, ΔptpA M. tuberculosis and ΔptpA::ptpA M. tuberculosis) was extracted 18 h (A) and 48 h (B) after infection and reversed transcribed. Data observed show the expression levels of caspase-3. Transcript abundance was determined relative to housekeeping gene gapdh. Data shown are the means ± standard deviation of three independent experiments. The difference in transcript levels in cells infected with M. tuberculosis and ΔptpA M. tuberculosis 18 and 48 h post-infection were significant (p-value of 0.0179 for A and 0.0097 for B).   Fig. 8. M. tuberculosis Blocks Activation of Caspase-3 In Vivo. THP-1 cells were uninfected (NI), infected with M. tuberculosis (WT), the ΔptpA mutant (KO) or the complement ΔptpA mutant (CO) and cellular extracts were harvested 48 h post-infection. A total of 50 μg of cellular extracts was used for Western blotting in which the anti-caspase-3 antibody was utilized. The molecular weight of inactive caspase-3 is 31.608 kDa and 17/19 kDa for active caspase-3. The cellular extract of RAW 264.7 cells treated with 5 μM staurosporine for 5 h was used as the positive control (+ve). The bottom panel represents the Ponçeau stained membrane showing equal loading of samples.            Mycobacterium tuberculosis dephosphorylation of human GSK3α   15  TABLES   Oligonucleotides Sequence (5’ → 3’) Caspase-3 F TGAGGCGGTTGTAGAAGAGTTT Caspase-3 R GCTCGCTAACTCCTCACGG GAPDH F GAAGGTGAAGGTCGGAGTC GAPDH R GAGGGATCTCGCTCCTGGAAGA GSK3α F GCTCACCCCTGGACAAAGGTGTT GSK3α R CGCACAGGCCTCTAGTGGGGA  Table 1. Oligonucleotides Used for Quantitative PCR.           Plasmids Characteristics Resistance Gene Source pET22b pBO1 pGEX-6P-3 Produces C-term His6-tagged proteins Produces N-term His6-tagged proteins Produces N-term GST-tagged proteins Ampicillin Ampicillin Ampicillin Millipore Corporation GeneCopoeia Inc. GE Healthcare  Table 2. Plasmids Used for DNA Cloning and Protein Expression           Oligonucleotides Sequence (5’ → 3’) Restriction Site GSK3α F TATATAGGATCCATGAGCGGCGGCGGGCCTTCG BamHI GSK3α R TATATAGAATTCGGAGGAGTTAGTGAGGGTAGG EcoRI PtpA F ATATATGAATTCCGTGTCTGATCCGCTG EcoRI PtpA R ATATATCTCGAGTCAACTCGGTCCGTTC XhoI Rab7 F TATATAGGATCCATGACCTCTAGGAAGAAAGTG BamHI Rab7 R TATATACTCGAGTCAGCAACTGCAGCTTTC XhoI *The recognition sequence for the restriction site is underlined.  Table 3. Oligonucleotides Used for DNA Cloning. Mycobacterium tuberculosis dephosphorylation of human GSK3α   16  Spot No. Protein identification* MOWSE Score^ MW  (pI) Coverage (%) 1 Xin B (CAF25191) Phosphoinositide 3-Kinase Class 3 (NP002638) 5.8e+16 3.17e+15 122.1 (5.2) 101.5 (6.4) 15 12 2 Rabaptin (NP004694) Rabaptin-5 (AAC70781) Rabaptin-4 (3832516) 3.25e+07 3.25e+07 1.63e+07 99.3 (4.9) 95.6 (4.9) 95.5 (4.9) 21 19 19  VPS39 (AAH15817) 1.61e+07 90.3 (6.6) 19 3 Exocyst Complex Component Sec6 (O60645) cGMP-Dependent Protein Kinase 1 (Q13976) Gamma Adducin (Q9UEY8) 1.31e+02 1.21e+02 1.56e+02 86.8 (5.8) 76.3 (5.7) 79.1 (5.9) 12 11 7 4 Unknown  (AAH04303) 3.1e+103 52.5 (5.9) 64  Hypothetical Protein  8.36e+97 52.4 (5.5) 51 5 MHC Class I Antigen Cw*7 (P10321) 5.31e+01 40.7 (5.6) 7  MHC Class I Antigen Cw*1 (P30499) 2.36e+01 40.9 (5.5) 6 6 Not Determined    7 GTPase, IMAP Family Member 7 (Q8NHV1)  1.06e+16 34.5 (6.1) 63 8 Annexin A13 (P27216) 1.19e+31 35.5 (5.5) 60 9 N-Myc Interactor-STAT Interactor (Q13287) Cdc42 Effector Protein 4 (Q9H3Q1) 3.64e+43 3.7e+42 35.1 (5.2) 37.9 (5.1) 57 41 10 Not Determined    11 Vacuolar Protein Sorting 33B (AAF91174) 6.7e+52 70.6 (6.3) 64 12 Ras-Related Protein Rab-7L1 (O14966) 2.15e+69 23.1 (6.7) 70 13 Ras-Related Protein Rab-28 (Rab-26) (P51157) 6.5e+48 24.9 (5.7) 44 14 Syntaxin 18 (Q9P2W9) MHC Class I Antigen Cw*3 (70076)  1.34e+04 38.7 (5.4) 40.7 (6.0) 21 15 15 Arfaptin-1 (P53367) 1.86e+01 41.7 (6.2) 10 16 MHC Class I Antigen Cw*17 (Q95604) 1.63e+01 41.2 (6.3) 19 * Accession numbers are shown in parenthesis, ^ Score based on peptide frequency.  Table 4. Identification of Proteins Dephosphorylated by the Addition of Recombinant PtpA to a Phosphorylated THP-1 Cellular Extract. A cellular extract of differentiated THP-1 cells was incubated with recombinant PtpA. The phosphorylation status of several THP-1 cell proteins was modulated by PtpA. These proteins were identified by mass spectrometry. The numbers seen in this table corresponds to spots shown in Figure 1. Molecule Weight Search (MOWSE) score allows to calculate the probability of matching N peaks by random chance (34). Accession numbers are shown in parenthesis.                 Mycobacterium tuberculosis dephosphorylation of human GSK3α   17  Protein Full Name Abbreviation Epitopes Control ΔptpA M. tuberculosis Fold Change Uninfected        M. tuberculosis Adducin Alpha (ADD1)     Adducin Gamma (ADD3) B23 (Nucleophosmin, Numatrin, Nucleolar Protein NO38) Cyclin-Dependent Protein Kinase 1/2 cAMP Response Element Binding Protein 1  Extracellular Regulated Protein Kinase 1 (p44 MAP Kinase)  Extracellular Regulated Protein Kinase 2 (p42 MAP Kinase)  Glycogen Synthase Kinase 3 Alpha  Glycogen Synthase Kinase 3 Alpha  Glycogen Synthase Kinase 3 Beta  Glycogen Synthase Kinase 3 Beta  Jun N-Terminus Protein Kinase (Stress-Activated Protein Kinase (SAPK)) 1/2/3  Jun Proto-Oncogene-Encoded AP1 Transcription Factor S73 MAPK/ERK Protein Kinase 1/2 (MKK1/2)  MAP Kinase Protein Kinase 3/6 (MKK3/6)  MAP Kinase Protein Kinase 6 (MKK6)  Mitogen- and Stress-Activated Protein Kinase 1  N-Methyl-D-Aspartate (NMDA) Glutamate Receptor 1 Subunit Zeta  Mitogen-Activated Protein Kinase p38 Alpha  Protein Kinase B Alpha (Akt1)  Protein Kinase B Alpha (Akt1)  Protein Kinase C Alpha  Protein Kinase C Alpha/Beta 2  Protein Kinase C Delta  Protein Kinase C Epsilon  Double-Stranded RNA-Dependent Protein Kinase  Raf 1Proto-Oncogene-Encoded Protein Kinase  Retinoblastoma-Associated Protein  Retinoblastoma-Associated Protein  Ribosomal S6 Protein Kinase 1/3   p85 Ribosomal Protein S6 Kinase 2  p70 Ribosomal Protein S6 Kinase Alpha  SMA- and Mothers Against Decapentaplegic Homologs 1/5/9   Src Proto-Oncogene-Encoded Protein Kinase  Src Proto-Oncogene-Encoded Protein Kinase  Signal Transducer and Activator of Transcription 1 Alpha Signal Transducer and Activator of Transcription 1 Beta Signal Transducer and Activator of Transcription 3  Signal Transducer and Activator of Transcription 5  α-Adducin γ-Adducin B23 [NPM] CDK1/2 CREB1 Erk1 Erk2 GSK3α GSK3α GSK3β GSK3β JNK  Jun MEK1/2 [MAP2K1/2] MEK3/6 [MAP2K3/6] MEK6 [MAP2K6] Msk1 NR1 p38α MAPK PKBα [Akt1] PKBα [Akt1] PKCα PKCα/β2 PKCδ PKCε PKR1 Raf1 Rb Rb RSK1/3  S6K2 p85 S6Kα p70 Smad1/5/9  Src Src STAT1α STAT1β STAT3 STAT5 S726 S693 S4 Y15 S133 T202 + Y204 T185 + Y187 S21 Y279 S9 Y216 T183 + Y185  S73 S217 + S221 S189/S207 S207 S376 S896 T180 + Y182 T308 S473 S657 T638/T641 T507 S729 T451 S259 S780 S807 + S811 T359 + S363/ T356 +  S360 T412 T389 S463 + S465/S463 + S465/S465 + S467 Y418 Y529 Y701 Y701 S727 Y694 0 0 0 1 1 0 0 0 1 0 1 1  0 0 0 0 1 1 0 0 0 1 1 1 0 1 1 1 0 0  1 1 0  0 1 1 1 1 0    2.00 0.70    0.65  0.93 ND      0.57 0.85    1.50 0.94 0.81  1.31 0.88 0.45    1.16 1.03    0.89 0.56 1.04 0.79    ND 0.84    0.33  0.61 1.15      0.67 0.90    1.25 0.62 0.51  1.54 0.47 0.78    0.88 0.85    1.57 0.86 0.90 0.86 ND, not determined.  Table 5. Kinome Analysis of Host Signaling Proteins Affected by PtpA. A total of 38 phospho-specific antibodies targeting key host signaling proteins were used. The trace quantity of each protein band was measured by the area under its intensity profile curve and corrected for the individual scan times (recorded time before saturation occurs). Values for the control samples were set to 1 or 0. A value of 0 indicates that no immunoreactive signal was detected for this protein. An immunoreactive signal was detected for only 17 proteins. Values for uninfected THP-1 cells and cells infected with M. tuberculosis show the fold change relative to their respective control samples (ΔptpA M. tuberculosis).          

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.42591.1-0075838/manifest

Comment

Related Items