UBC Faculty Research and Publications

Activity of translation regulator eukaryotic elongation factor-2 kinase is increased in Parkinson disease… Jan, Asad; Jansonius, Brandon; Delaidelli, Alberto; Bhanshali, Forum; An, Yi A; Ferreira, Nelson; Smits, Lisa M; Negri, Gian L; Schwamborn, Jens C; Jensen, Poul H; Mackenzie, Ian R; Taubert, Stefan; Sorensen, Poul H Jul 2, 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-40478_2018_Article_554.pdf [ 1.93MB ]
Metadata
JSON: 52383-1.0368790.json
JSON-LD: 52383-1.0368790-ld.json
RDF/XML (Pretty): 52383-1.0368790-rdf.xml
RDF/JSON: 52383-1.0368790-rdf.json
Turtle: 52383-1.0368790-turtle.txt
N-Triples: 52383-1.0368790-rdf-ntriples.txt
Original Record: 52383-1.0368790-source.json
Full Text
52383-1.0368790-fulltext.txt
Citation
52383-1.0368790.ris

Full Text

RESEARCH Open AccessActivity of translation regulator eukaryoticelongation factor-2 kinase is increased inParkinson disease brain and its inhibitionreduces alpha synuclein toxicityAsad Jan1* , Brandon Jansonius3†, Alberto Delaidelli2†, Forum Bhanshali4, Yi Andy An4, Nelson Ferreira5,Lisa M. Smits6, Gian Luca Negri2, Jens C. Schwamborn6, Poul H. Jensen5, Ian R. Mackenzie2, Stefan Taubert4and Poul H. Sorensen2,3*AbstractParkinson disease (PD) is the second most common neurodegenerative disorder and the leadingneurodegenerative cause of motor disability. Pathologic accumulation of aggregated alpha synuclein (AS) protein inbrain, and imbalance in the nigrostriatal system due to the loss of dopaminergic neurons in the substantia nigra-pars compacta, are hallmark features in PD. AS aggregation and propagation are considered to trigger neurotoxicmechanisms in PD, including mitochondrial deficits and oxidative stress. The eukaryotic elongation factor-2 kinase(eEF2K) mediates critical regulation of dendritic mRNA translation and is a crucial molecule in diverse forms ofsynaptic plasticity. Here we show that eEF2K activity, assessed by immuonohistochemical detection of eEF2phosphorylation on serine residue 56, is increased in postmortem PD midbrain and hippocampus. Induction ofaggressive, AS-related motor phenotypes in a transgenic PD M83 mouse model also increased brain eEF2Kexpression and activity. In cultures of dopaminergic N2A cells, overexpression of wild-type human AS or the A53Tmutant increased eEF2K activity. eEF2K inhibition prevented the cytotoxicity associated with AS overexpression inN2A cells by improving mitochondrial function and reduced oxidative stress. Furthermore, genetic deletion of theeEF2K ortholog efk-1 in C. elegans attenuated human A53T AS induced defects in behavioural assays reliant ondopaminergic neuron function. These data suggest a role for eEF2K activity in AS toxicity, and support eEF2Kinhibition as a potential target in reducing AS-induced oxidative stress in PD.Keywords: eEF2K, Parkinson disease, Alpha synuclein, Oxidative stress, NeurotoxicityIntroductionParkinson disease (PD) is the most common neurode-generative cause of motor disability and is estimated toaffect around 10 million people worldwide [33, 53]. Clin-ically, it presents as a movement disorder characterizedby resting tremor, rigidity, and bradykinesia, and in asubstantial number of patients the motor disability iscompounded by non-motor symptoms such as cognitiveimpairment and autonomic dysfunction [33, 53]. Neuro-pathologically, loss of dopamine producing neurons inthe midbrain substantia nigra (SN)-pars compacta, andintraneuronal inclusions of aggregated α-synuclein (AS)protein in multiple brain regions are hallmark featuresin PD [33, 53]. AS is a 14 kDa cytosolic protein (encodedby the SNCA gene) with putative roles in synapticvesicle recycling, mitochondrial functions, andchaperone activity [39, 71]. Deposition of AS in the formof inclusions in neurons and/or nerve terminals, alsoknown as Lewy body pathology, is also seen in otherneurodegenerative diseases such as Alzheimer disease(AD), Lewy body dementia (LBD), and in* Correspondence: ajan@aias.au.dk; psor@mail.ubc.ca†Brandon Jansonius and Alberto Delaidelli contributed equally to this work.1Aarhus Institute of Advanced Studies, Department of Biomedicine, AarhusUniversity, Høegh-Guldbergs Gade 6B, DK-8000 Aarhus, Denmark2Department of Pathology and Laboratory Medicine, University of BritishColumbia, Vancouver, CanadaFull list of author information is available at the end of the article© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Jan et al. Acta Neuropathologica Communications  (2018) 6:54 https://doi.org/10.1186/s40478-018-0554-9oligodendrocytes in Multiple system atrophy (MSA)[67]. Idiopathic (non-inheritable) PD accounts for a vastmajority of cases, while 5–10% of clinically diagnosedPD is attributable to genetic factors [53]. Missense muta-tions in SNCA resulting in N-terminal amino acid sub-stitutions in the AS protein, or multiplications in SNCAgene locus leading to increased AS expression are theearliest known causes of autosomal-dominant inheritedforms of PD [53, 54, 62]. There are additional genes as-sociated with familial PD including autosomal-dominantand recessive inheritance (reviewed by [33, 53]), under-lining the complex etiologic nature of PD.Driven by the neuropathology and genetics, the neuro-toxicity of AS has been a major area of research in PD to-wards the elucidation of disease-associated mechanismsand discovery of novel therapies. Based on studies in ani-mal models and cell cultures, including neuronal cultures,substantial evidence implicates AS aggregation in trigger-ing different alterations including synaptic dysfunction,calcium dyshomeostasis, mitochondrial impairment,endoplasmic reticulum (ER) stress, defective autophagy,neuroinflammation, and oxidative stress [27, 39, 59, 71].In a broader perspective, a pathological role for dysregula-tion of some of these cellular mechanisms is also sup-ported by the discovery of other genetic factors causingPD. For instance, autosomal-dominant mutations in leuci-ne-rich repeat kinase 2 (LRRK2), which account for themost common cause of inherited PD [53], are associatedwith defective autophagy and mitochondrial dysfunction[68]. Similarly, mutations in PARK2 (Parkin, an E3 ubiqui-tin ligase), PINK1 (PTEN-induced putative kinase 1) andPARK7 (DJ-1, a protein deglycase), which are associatedwith early onset (age less than 40 years) PD [33, 53], dir-ectly or indirectly affect mitochondrial function either byregulating mitophagy (Parkin and PINK1) or protectingmitochondria from oxidative stress (DJ-1) [5, 59]. Somestudies have also reported that mitochondrial complex Iprotein expression and/or activity is reduced in PD sub-stantia nigra [29, 60] and platelets [21]. Additionally, cul-tures of induced pluripotent stem cells (iPSCs) derivedfrom PD patients show defects in oxygen consumptionand mitochondrial function [3, 56]. Furthermore, expos-ure to several chemical toxins that inhibit complex I iswell documented to induce dopaminergic neuron degen-eration and a parkinsonian phenotype in humans (e.g.,1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, MPTP) andin animals (e.g., MPTP, rotenone, paraquat etc.) [33, 59].The eukaryotic elongation factor-2 kinase (eEF2K),also known as calcium/calmodulin dependent kinase III,is an important regulatory molecule in cellular proteinsynthesis and also in diverse forms of synaptic plasticity[23]. Upon activation, eEF2K phosphorylates its majorknown substrate, the eukaryotic elongation factor-2(eEF2), on threonine-56 (Thr56), thus leading to thedissociation of eEF2 from ribosomes and stalling ofmRNA translation during the elongation phase [34, 57].eEF2K activity is increased under condition of nutrientstress via the energy sensor AMP-activated kinase(AMPK), which positively regulates eEF2K activity byphosphorylation on serine residue 398 [34, 42]. We andothers have observed increased eEF2K expression and/oractivity in AD post-mortem brains [28, 43, 46], and inthe brains of transgenic AD mice [28, 46]. We have alsoshown that eEF2K inhibition prevents the toxicity ofamyloid-β (Aβ) oligomers in neuronal cultures by acti-vating the NRF2 antioxidant response, and attenuateshuman Aβ-induced deficits in neuronal function in C.elegans [28].Mitochondrial defects (directly or indirectly associatedwith the aggregation of AS protein) and oxidative stressare implicated in PD pathogenesis [5, 59], and eEF2K in-hibition reduces reactive oxygen species (ROS) levels incells [10, 28]. Therefore, we hypothesized that eEF2K in-hibition may mitigate AS induced neurotoxicity byreducing oxidative stress. To test this hypothesis, we firstexamined markers of eEF2K activity,1 i.e., phosphoryal-tion of eEF2 on serine residue 56, in postmortem PDbrains in order to establish its relevance to human path-ology, and subsequent to the induction of AS pathologyin transgenic mouse M83 line expressing PD-associatedmutant Ala53Thr (A53T) AS [20, 58]. Then, we probedthe effects of eEF2K inhibition on cytotoxicity, mito-chondrial function and oxidative stress in AS overex-pressing dopaminergic N2A cells, and on dopaminergicneuronal function in C. elegans expressing mutant A53TAS. By using multiple experimental approaches, we elu-cidate the relevance of eEF2K in AS toxicity, and discussthe potential utility of eEF2K inhibition in PD and re-lated synucleinopathies.Materials and methodsReagents and biochemical assaysPlasmids for overexpression of AS in mammalian cellswere obtained under MTA from Addgene, and in-cluded human wild type AS (pHM6-alphasynu-clein-WT, Addgene #40824) and human mutant A53TAS (pHM6-alphasynuclein-A53T, Addgene #40825).Additional reagents and biochemical assays employedduring these studies include: pool of small interferenceRNAs (SiRNAs) targeting mouse eEF2K (Santa Cruz,#sc-39,012), Cell Titer Glo ATP measurement kit(Promega, #G7570), Lactate dehydrogenase (LDH)fluorometric assay (Novus Biologicals, #NBP2–54851),Seahorse Mito stress test kit (Agilent, #103015–100),2′,7′-dichlorodihydrofluorescein diacetate (DCFDA)fluorescent ROS reagent (ThermoFisher, #D399), andMitoTracker Green fluorescent reagent for mitochon-drial mass (ThermoFisher, #M7514). BiochemicalJan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 2 of 17assays (LDH and ATP), Seahorse assays and flow cy-tometry assays were performed according to manufac-turer’s recommendations and are also outlined indetails below.Immunohistochemistry (IHC) and immunofluorescencestudies on postmortem human brain sectionsFive-micrometer formalin-fixed paraffin embedded sep-arate post-mortem sections from midbrain and hippo-campus of control or PD patients were provided by thelaboratory of IM (co-author), as approved by the Univer-sity of British Columbia Ethics Committee. Anonymizedbrain sections from 3 control individuals and 6 clinicallyand pathologically confirmed PD patients were obtained atautopsy and used in these experiments (Additional file 1:Table S1).IHC on brain sections from human tissue was per-formed after deparaffinization and antigen retrieval. Thefollowing antibodies were employed to stain serial tissuesections, as indicated: antibody against phospho-eEF2(Thr56) (Novus Biologicals, #NB100–92518) [28, 42],and antibody against phospho-alpha synuclein (pSer129;EMD Millipore, #MABN826), using the alkaline phos-phatise conjugated streptavidin-biotin ABC kit (VectorLabs, # AK-5000). For destaining/bleaching neuromela-nin in substantia nigra in the midbrain sections, the IHCprotocol was modified slightly, as described [52] . Briefly,sections mounted on slides were incubated in a 60 °Cdegrees oven for 30 min and then were transferred intoambient distilled water. Then, the slides were placed in0.25% potassium permanganate solution for 5 min. Sub-sequently, the slides were rinsed with distilled water.This was followed by incubation in 5% oxalic acid untilsection became clear. A final rinse in distilled water wasperformed before proceeding with the normal IHC stain-ing as described above. Sections were counterstainedwith hematoxylin (Vector Labs, #H-3401). High reso-lution panoramic images of tissue sections for p-eEF2and p-ASyn IHC analysis were acquired using a LeicaAperio digital slide scanner. IHC staining for p-eEF2was quantified by manual counting of the DAB (3,3′-di-aminobenzidine; Vector Labs, #SK-4100) positive cells.For the detection of p-eEF2 (T56) and p-ASyn (S129)in the same tissue section, i.e., colocalization studies, im-munofluorescence labelling was performed. For this pur-pose, after incubation of the tissue sections with primaryantibodies as in the staining protocol described above,Alexa Fluor conjugated secondary fluorescent antibodies(Alexa Fluor 488 Goat anti-Mouse IgG, Thermo Fisher #A32723 and Alexa Fluor 594 Goat anti-Rabbit IgG,Thermo Fisher # R37119) were used for the detection.Image acquisition was performed using a Nikon EclipseTE2000 confocal microscope.Animal studiesHusbandryTransgenic M83+/+ PD mice [B6; C3-Tg (Prnp-SNCA*A53T)83Vle/J] were kindly provided by the laboratory of BenoitGaisson at the Centre for Translation Research in Neurode-generative Diseases, University of Florida, USA to the labora-tory of PHJ (co-author). These mice express the mutanthuman A53T AS under the direction of the mouse prionprotein promoter [20]. The mice were housed at the AarhusUniversity Bartholin animal facility under conditions of 12 hlight/dark cycles and received ad libitum standard laboratorychow diet. All procedures were performed in accordancewith National rules and the European Communities CouncilDirective for the care and handling of laboratory animals.Both male and female mice were used for biochemical ana-lyses. All genotypes were determined by PCR.Intramuscular injections of alpha synuclein fibrilsFibrillar mouse AS was prepared essentially according toan established protocol [58]. Tg M83+/+ were bilaterallyinjected with recombinant mouse AS preformed fibrils(PFF) as described [58]. Briefly, 2–3 month-old micewere anesthetized with isoflurane (1–5%) inhalation andinjected intramuscularly into the hindlimb bicepsfemoris bilaterally. The inoculum (5 μL of 2 mg/mL PFFor PBS) was injected using a 10-μL Hamilton syringewith a 25-gauge needle. Separate syringes were used foreach type of inoculums (PBS or PFF) to avoid anycross-contamination. After the injection, mice wereallowed to recover under close observation before beingreturned to their original cage.Hindlimb claspingAssessment of hindlimb clasping behaviour was per-formed with a modified tail suspension test [22]. Freelymoving, non-anesthesized, Tg M83+/+ were held by thetail and lifted in air for 10 s. Severity of clasping wasassessed as follows: 1) No clasping (score 0), hindlimbswere consistently spread outward and away from theabdomen; 2) Mild clasping (score 1), one hindlimb wasretracted toward the abdomen for more than 50% of thetime; 3) Moderate clasping (score 2), both hindlimbswere partially retracted toward the abdomen for morethan 50% of the time suspended; and 4) Severe clasping(score 3), hindlimbs were entirely retracted and touchingthe abdomen for more than 50% of the time suspended.Quantitative RT-PCRTotal RNA from the whole brain homogenates was ex-tracted using a commercial kit (Qiagen, #74134), and cDNAwas synthesized using high capacity reverse transcriptase kit(Applied Biosystems, #4368814). The following gene specificprimer pairs were used in qRT-PCR: Mouse eef2k (forward,5’-CGCTTTGTACCGGGGATTCT-3′; reverse, 5′- AAGGJan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 3 of 17ATGGTCCTCCCACAGT-3′) and Mouse Gapdh (forward,5′- CCCTTAAGAGGGATGCTGCC-3′; reverse, 5’-TACGGCCAAATCCGTTCACA-3′). The data were analyzed byrelative ΔΔCT quantification method using Gapdh CTvalues as internal reference in each sample.Cell cultureMidbrain organoid culturesMidbrain organoids were generated with a modifiedprotocol as reported previously [49], from human iPSCsessentially as described [3]. After 35 days of differenti-ation, RNA from snap frozen wild type or A53T muta-tion carrying organoids was isolated using a commercialkit (Qiagen, # 74104), and cDNA was synthesized usingApplied Biosystems high capacity reverse transcriptasekit (Thermo Fisher, # 4368814). Following gene specificprimer pairs were used in qRT-PCR: Human EEF2K,forward 5′- CCCAAGCAGGTGGACATCAT-3′ andreverse 5’-TTGCCCTCGATGTAGTGCTC-3′ and hu-man glyceraldehyde 3-phosphate dehydrogenase(GAPDH), forward 5′- GACAGTCAGCCGCATCTTCT-3′ and reverse 5′- ACCAAATCCGTTGACTCCGA -3′.N2A culturesN2A neuroblastoma cells were obtained from ATCC(#CCL-131), and maintained in DMEM (4.5 g/L glu-cose; Gibco, #11965–084) supplemented with 1%antibiotic-antimycotic solution (Gibco, #15240062)and 10% Fetal Bovine Serum (FBS), Cells were cul-tured in 6-well (500, 000 cells/well) 12-well (250,000cells/well) or 96-well (50,000 cells/well) plates. DNAplasmid transfections were performed using Lipofecta-mine 2000 (Invitrogen, #11668019), and Lipofecta-mine RNAiMAX (Invitroge, #13778150) for siRNAs,according to the recommended procedures. After24 h, cells were briefly washed with phosphate-buffersaline (PBS) and allowed to differentiate into neuronsin a modified culture medium [59] containing DMEM(Gibco, #21969035) supplemented with 500 μM L-gluta-mine, 1% antibiotic-antimycotic, 2% FBS and 500 μMDibutyryladenosine 3′,5′-cyclic monophosphate (dbcAMP; Sigma, #D0627) [28, 63]. Unless indicatedotherwise, differentiated N2A cells which were mocktransfected, or transfected with AS plasmids (ASyn-WTor ASyn-A53T; Addgene plasmid #40824 and #40825respectively) +/− eEF2K kd, were used in the variousassays described below after 72–76 h post-transfection.Cytotoxicity assaysFor the lactate dehydrogenase (LDH) release, 50 μl of cul-ture medium was collected from each well into steriletubes and cell debris was removed by centrifugation(1100 rpm, 10 min; 4 °C) in a tabletop centrifuge. Then,5 μl of the supernatant were carefully transferred into a96-well black microplate cooled and kept on ice. Then,the assay reagents, as recommended by the manufacturerwere added to the wells. Fluorescence (Ex/Em= λ535/λ587 nm) was measured in a Tecan microplate readerequipped with necessary filters at room temperature. Mea-surements were acquired in a kinetics mode every minute,after 5 s of gentle shaking, over 20 min. Stabilized fluores-cence signal from each sample was collected and analyzed.For the propidium iodide (PI) cell death detection assay,the cells were gently trypsinized (0.05% Trypsin-EDTA;Gibco, #25300054), centrifuged (1100 rpm, 5 min, 4 °C)and resuspended in 500 μl of sterile ice-cold PBS contain-ing 20% FBS and 0.001% PI (ThermoFisher, #P3566). Aftertransferring into FACS tubes, on ice, the cells wereanalyzed on a FACSCalibur-Tangerine flow cytometry in-strument, as described [28]. Cellular ATP levels were mea-sured using a bioluminescence firefly luciferase assay (CellTiter Glo, Promega) with minor modifications to the man-ufacturer’s instructions. Briefly, the cells were resuspendedin the assay mix by thorough pipetting and transferredinto a 96-well white assay plate, previously cooled on ice.Then luminescence signal was measured in a Tecan mi-croplate reader at room temperature. Measurements wereacquired in a kinetics mode every 3 min, after 5 s of gentleshaking, over 30 min. Stabilized luminescence signal fromeach sample was collected and analyzed.Mitochondrial respiration and cellular mitochondrialcontentCellular oxygen consumption rate (OCR) was measuredusing the Seahorse Mito stress kit according to thesupplier’s instructions. Apart from the basal OCR, acombination of pharamcological agents (components ofthe Seahorse Mito Stress test) enables the assessment ofdifferent aspects of cellular respiration. These includenon-mitochondrial (NM) respiration, maximal respir-ation (MR) and spare respiratory capacity (SRC). Opti-mal cell density and concentrations of drugs for theassay were established according to the kit instructions/parameters. Then, 30,000 cells/well were seeded in a 96-wellmicroplate (included in the kit) and transfections were car-ried out (Mock, ASyn-WT or ASyn-A53, all ± eEF2KsiRNA). OCR measurements were performed in a SeahorseXF analyzer according to the assay guidelines. Basal OCRwas measured over 20 min (4 cycles, 5 min/cycle), followedby exposure to oligomycin, ATP synthase inhibitor (2 μM),carbonilcyanide p-triflouromethoxyphenylhydrazone-FCCP,oxidative phosphorylation uncoupler (0.5 μM) and rote-none/antimycin, complex I and III inhibitor respectively(0.5 μM). After injection with each drug, OCR was mea-sured over 15 min (4 cycles, 5 min/cycle). After the assaycompletion, the cells were gently rinsed with PBS andhomogenized by pipetting in ice cold 50 μl RIPA lysis bufferJan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 4 of 17(25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1%sodium deoxycholate, 0.1% SDS, protease inhibitors andphosphatase inhibitors cocktail). Then, the cell lysate wastransferred into microtubes, centrifuged (10,000 rpm,10 min, 4 °C) and 25 μl of supernatant was transferred intoa 96-well assay plate. Total protein in samples was deter-mined by BCA protein assay (Pierce, #23225). OCR datawas normalized to the protein content/well.Mitochondrial content (mass) in differentiated N2Acells ± eEF2K kd was determined by labelling withMitotracker fluorescent dye, and by quantification ofmitochondrial DNA copy number. For the Mitotrackerassay, cells were incubated with 50 nM MitotrackerGreen FM reagent for 30 min in fresh medium. The cellswere trypsinized, and centrifuged as described under thePI assay, and resuspended in 500 μl of sterile ice-coldPBS containing 20% FBS. Control cells without Mito-tracker dye treatment were used as the backgroundfluorescence signal. Separately, mitochondrial DNA(mtDNA) quantification was carried out by RT-PCR asdescribed [47]. Briefly, nuclear DNA and mtDNA wereisolated from differentiated N2A cells ± eEF2K using aQiagen All Prep kit (#80204). Isolated samples were son-icated, then diluted to contain either 10 ng or 1 ng ofDNA. This was used as an internal control to ensurethat the ratio of mtDNA to nuclear DNA remained con-stant at different concentrations. qPCR was run on aQuant Studio 6 instrument using Fast SYBR Green MasterMix (ThermoFisher, #4309155). The primer sequences usedfor qPCR are as follows: mouse mitochondrial marker-mMito (forward, 5’-CTAGAAACCCCGAAACCAAA-3′;reverse, 5’-CCAGCTATCACCAAGCTCGT-3′) and mousebeta-2-microglobulin- mB2M (forward, 5’-ATGGGAAGCCGAACATACTG-3′; reverse: 5’-CAGTCTCAGTGGGGGTGAAT-3′). In each sample, mtDNA was quantified as aratio of mtDNA to nuclear DNA (mtDNA/N) and wereexpressed as mtDNA copy numbers.ROS measurementsFor ROS detection, cells were incubated with 5 μg/mL 2,7-dichlorofluorescein diacetate- DCFDA for 30 min infresh medium. The cells were gently trypsinized (0.05%Trypsin-EDTA), centrifuged (1100 rpm, 5 min, 4 °C) andresuspended in 500 μl of sterile ice-cold PBS containing20% FBS and 0.001% PI. After transferring into FACS tubes,on ice, the cells were analyzed on a FACSCalibur-Tangerineflow cytometry instrument as described previously [28].During the analysis, dead cells were excluded from analysisbased on PI staining. Control cells without DCDFA treat-ment were used as the background fluorescence signal.Western blottingWhole brain tissue homogenates from euthanized M83+/+mice were prepared in RIPA buffer (25 mM Tris-HClpH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate,0.1% SDS, protease inhibitors and phosphatase inhibitorscocktail). For cellular assays, the cells were washed (ice coldPBS, 2–3 times) and lysed in RIPA buffer. Then, the mousebrain homogenates or cell lysates were briefly sonicated onice and centrifuged (12,000 rpm, 15 min, 4 °C). Supernatantwas collected and protein quantitation was done using BCAprotein assay (Pierce, #23225). Then 25–40 μg of total pro-teins per sample were electrophoresed on 8% or 10%Bis-Tris acrylamide gels. Proteins were transferred onto anitrocellulose membrane, incubated in blocking buffer(Li-Cor, #927–50,100]), and probed with following primaryantibodies: eEF2K (Abcam, #46787), p-eEF2 Thr56 (CellSignalling, #2331), eEF2 (Cell Signalling, #2332), ASyn(Santa Cruz #sc-12,767), p-ASyn Ser129 (Abcam, #168381,MJF-R13), and GAPDH (Cell Signaling 2118). Detectionwas performed using goat anti-mouse (Li-Cor, #925–32,210)or goat anti-rabbit (Li-Cor, #925–68,071) secondary anti-bodies conjugated with fluorescent infrared dyes using anOdyssey scanner (Li-Cor). Densitometry analysis was per-formed using ImageJ (NIH) [28].C. elegans studiesNematode strains and culture methodsC. elegans strains N2 wild-type (referred to asWT-N2), RB2588 efk-1(ok3609), [28] (referred to asefk-1del), JVR107 Pdat-1::a-synuclein[A53T], [12] ((re-ferred to as ASyn (A53T)), and STE120 efk-1(ok3609);Pdat-1::a-synuclein[A53T] ((generated herein, referredto as ASyn (A53T)/efk-1del)) were grown on NematodeGrowth Medium (NGM) lite plates at 20 °C and with E.coli OP50 as food source, as described [28]. We usedstandard sodium hypochlorite bleaching and L1 stage star-vation to generate synchronized populations, which werethen allowed to grow for 72 h, i.e. until day two of adult-hood; all assays were performed at that stage.Dopamine-dependent behaviour assaysEthanol avoidance assayEthanol avoidance assays were done as described [12], on anunseeded 15 mm×60 mm plate divided into four quadrantswith a circle of 1 cm in diameter in between. Then, 1cm3agarose chunks were soaked in ice-cold ethanol overnight,and placed 0.5 cm from the edge of the plate in the centreof two opposing quadrants, while the other two quadrantsremained untreated. Ethanol was allowed to diffuse in mediafor 2 h. Actively growing day 2 old adult worms werewashed five times with M9 buffer, and 150–200 worms wereplaced in the centre of the plate, and allowed to move for1 h at 20 °C. Then, worms were counted manually andethanol avoidance was calculated as [(number of worms incontrol quadrants)− (number of worms in ethanol quad-rants))/(total number of worms)]. Three assay plates wereJan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 5 of 17used for each strain, and a minimum of three biological rep-licates was performed.Pharyngeal pumping assayThe pharyngeal pumping rate was measured by manuallycounting the number of pumps made by each worm onseeded plate for 30 s using a Leica M205FA microscope. Atotal of 10–15 worms were used for each replicate. Theassay was repeated at least three times on separate worms.Area-restricted searching assayArea-restricted searching assays were done as described[13]. Worms were washed very quickly to remove bacteria,and 10–15 worms were placed on an unseeded plate. Torecord the turning frequency, worms were videotaped at in-tervals of 5 and 30 min for one minute using a MoticamXcamera mounted on a Leica M205FA microscope. Video-tapes were analyzed manually to count the number ofhigh-angled turns, i.e. those that exceeded 90°, including re-versals and omega turns. The area-restricted searching ratiowas calculated as [(number of turns/worm at 5 min)/(num-ber of turns per worm at 30min)]. A minimum of threereplicates was performed for this assay.StatisticsThe data were analyzed in Graphpad Prism software(version 5) or Microsoft Excel 2010, and graphs weremade in Microsoft Excel 2010. Statistical differencesbetween two sets of data were calculated by Mann-Whitneynonparametric test or unpaired T-test, as indicated in thefigure legends. Multiple column datasets were analyzed byOne-way ANOVA followed by Bonferonni posthoc analysis.Longitudinal analysis was performed by Two-way ANOVA.ResultseEF2K expression and activity are increased in PD brainUsing postmortem brain sections from midbrain andhippocampus of controls and PD patients (Additional file 1:Table S1), we performed immunohistochemistry (IHC) ana-lysis of eEF2 phosphorylation on threonine residue 56(p-eEF2, T56), which reflects eEF2K activity [42, 57]. Inparallel, using serial sections, we also assessed the phos-phorylation of AS on serine residue 129 (p-ASyn, S129) byIHC, as it is a robust marker for AS Lewy pathology (~ 90%S129 phosphorylated AS is found in inclusions) [2, 65]. Toavoid ambiguity with neuromelanin pigment found indopaminergic neurons in substantia nigra (SN) with DABIHC staining, we employed a modified IHC protocol [52]in order to effectively destain/bleache neuromelanin inmidbrain sections without adversely affecting p-eEF2 (T56)IHC staining (Additional file 1: Figure S1a-b). Our datashow that p-eEF2 (T56) immunostaining is increased in SNand periaqueductal gray (PAG) matter (gray matter sur-rounding cerebral aqueduct) in PD midbrain sectionscompared to controls (Fig. 1a-b; additional controls shownin Additional file 1: Figure S2a; additional PD cases areshown in Additional file 1: Figure S3a; quantitation ofp-eEF2 IHC staining is presented in Fig. 3a). We observedthat p-eEF2 IHC staining was predominantly in neurons inSN and PAG in PD cases, and in some glial cells in SN (forinstance in PD-2, Fig. 1b; PD-3 and PD-4, Additional file 1:Figure S3a). As expected, we observed Lewy body path-ology (p-ASyn, S129) characteristic of PD in both of thesemidbrain regions in PD cases but not in controls (Fig. 1a-b;Additional file 1: Figure S2a, S3a). Accordingly, Lewy bodyinclusion pathology was seen in most PD cases both in SNand PAG, with some lewy neurites in SN (PD-2, Fig. 1b;PD-6, Additional file 1: Figure S3a) and PAG area (PD-2,Fig. 1b; PD-3 and PD-5, Additional file 1: Figure S3a). Then,by using immunofluorescence, we assessed whether p-eEF2(T56) immunopositivity potentially colocalizes with p-ASyn(S129), or p-eEF2 (T56) is a possible component of lewybody pathology. While we observed some neurons in PDSN which were clearly positive for both p-eEF2 (T56) andp-ASyn (S129), we also found substantial p-eEF2 (T56)immunopositivity in cells without p-ASyn (S129) and viceversa (Additional file 1: Figure S4b).Previous reports, including our own published data,show that phosphorylation of eEF2 (p-eEF2, T56) isstrongly increased in postmortem hippocampus andmesial temporal cortex in AD, the major neurodegen-erative disease with dementia [28, 43, 46]. Among thePD cases examined here, PD-1 and PD-5 were alsoclinically diagnosed with PD with dementia (PDD),which is usually seen in longstanding PD [1, 2]. There-fore, we assessed p-eEF2 (T56) in postmortem hippo-campus sections from control and PD cases. Wefound increased p-eEF2 IHC staining in hippocampalCA1 and CA2 (CA, cornu ammonis) fields in PD casescompared to controls, predominantly in neurons(Fig. 2a-b; additional controls shown in Additional file1: Figure S5a-b; additional PD cases shown in Add-itional file 1: Figure S6a, panoramic views; Additionalfile 1: Figure S7a-b, magnified field views; quantitationof p-eEF2 IHC staining in areas CA1-CA2 is presentedin Fig. 3a). There was little or none p-eEF2 immuno-positivity in CA3 and dentate gyrus (DG) in all PDcases, except PD-1 and PD-3 (CA3, Additional file 1:Figure S7a-b). We also assessed Lewy body pathologyin hippocampal sections from these control and PDcases, since Lewy pathology in hippocampus is foundat advanced neuropathological stages of PD (Braak PDstaging, stages 4–6) [1, 36]. Our IHC analysis forp-ASyn (S129) showed varying degrees of Lewy bodyinclusions (PD-1 and PD-2, Fig. 2b; PD-3 and PD-6,Additional file 1: Figure S7b) and Lewy neurites path-ology (PD-1 and PD-2, Fig. 2b; PD-6, Additional file 1:Figure S7b), with pronounced involvement of hippocampalJan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 6 of 17CA2 field in most PD cases (Fig. 2a-b and Additional file 1:Figure S7a-b).We also queried multiple transcriptome datasetspublicly available in the National Center for Biotech-nology Information (NCBI) Gene Expression Omnibus(GEO) platform for eEF2K mRNA expression in PDbrain. Significantly increased eEF2K mRNA expressionwas found in Striatum (Fig. 3b, GEO accession #GSE28894), medial substantia nigra (Fig. 3c, GEO ac-cession # GSE8397), and dorsal nucleus of vagus(dmX) (Fig. 3d, GEO accession # GSE43490). Collect-ively, these data provide strong evidence for aberranteEF2K expression and activity in PD brain. Finally, wealso performed quantitative PCR in cultured midbrainorganoids derived from human iPSCs [3, 49], andfound significantly increased eEF2K mRNA expressionin A53T mutant AS carrying organoids compared towild type controls (Fig. 3e).eEF2K expression and activity are increased in M83+/+transgenic PD mouse brains subsequent to induction ofAS neuropathologyTo further establish the relevance of eEF2K to AS-relatedpathology in PD, we analyzed brain eEF2K expression intransgenic PD M83+/+ mice, subsequent to induction of ASpathology by intramuscular injection of pre-formed fibrillarPFF AS [20, 58]. Within 8–10 weeks post-injection, the PFFAS injected M83+/+ mice show profound motor neuronloss, AS inclusions, progressive motor deficits and reducedsurvival at much earlier ages than native M83+/+ mice [58].For these analyses, PFF AS injected M83+/+ mice (injectedat 2–3 months of age) were used after 8–10 weeksabFig. 1 Immunostaining for phospho-eEF2 (p-eEF2, Thr56) and phospho-AS (p-ASyn, Ser129) in postmortem control and PD midbrain serial sections.a-b p-eEF2 (T56) and p-ASyn (S129) IHC in postmortem midbrain serial sections from one control (a) and two PD cases (b). IHC stainingfor p-eEF2 is predominantly seen in neurons in both cases, and possibly glial cells in substantia nigra in PD-2. Substantia nigra in both cases showsinvolvement by lewy body-LB pathology (p-ASyn, S129); while in periaqueductal gray matter, LB inclusions are seen in PD-1 and some lewy neuritesare seen in PD-2. Additional control and PD midbrain IHC data are presented in Additional file 1: Figure S2-S3, and case details are included inAdditional file 1: Table S1. (SN- substantia nigra; PAG- periaqueductal gray matter; scale bar, 100 μm; insets show 40× magnified view in each image)Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 7 of 17post-injection when typical motor abnormalities such ashindlimb paralysis (Additional file 1: Figure S8a) and severehindlimb clasping behaviour (Additional file 1: FigureS8b-c) were evident. Our data show that compared to PBSinjected M83+/+ mice, brain eEF2K mRNA expression is re-markably increased (~ 5–6 fold) in PFF AS injected M83+/+moribund (clasping score 3, see Materials and Methods)mice (Fig. 4a). Accordingly, we also found increased eEF2Kactivity (p-eEF2, T56) and induction of pathological ASphosphorylation (p-ASyn, S129) by western blotting in PFFAS injected M83+/+ (Fig. 4b-c). These data further supportour hypothesis regarding a role of eEF2K in ASneurotoxicity.AS overexpression increases eEF2K activity, while eEF2Kinhibition reduces AS cytotoxicity in dopaminergic N2A cellsAs mentioned above, AS-induced neurotoxicity is con-sidered to play an important role in neurodegenerationin PD [39, 71]. Indeed, overexpression of AS in culturedcells promotes AS aggregation, increases oxidative stress,and reduces cell survival [4, 8]. This has been observedfor the wild-type and mutant forms of AS, including theA53T mutant AS, which accelerates AS aggregation andpathology [39, 41]. To study the effects of eEF2K inhibitionon AS toxicity, we employed differentiated mouse neuro-blastoma N2A cells overexpressing either wild-type AS(ASyn-WT) or the A53T mutant (ASyn-A53T) +/− siRNAmediated eEF2K knockdown (kd), and measured cytotox-icity in these cells. Differentiated N2A cells exhibit manyfeatures of mature dopaminergic neurons including func-tional neurotransmitter receptors [63], and are widely usedto study the toxicity of amyloid proteins [14, 28].Overexpression of ASyn-WT or ASyn-A53T increasedp-eEF2 (T56) levels in N2A cells, which was reduced byeEF2K kd (Fig. 5a-b). We then assessed AS cytotoxicity bymeasuring the activity of lactate dehyrogenase (LDH) inabFig. 2 Immunostaining for phospho-eEF2 (p-eEF2, Thr56) and phospho-AS (p-ASyn, Ser129) in postmortem control and PD hippocampus serialsections. a-b p-eEF2 (T56) and p-ASyn (S129) IHC in postmortem hippocampus serial sections from one control (a) and two PD cases (b). IHC stainingfor p-eEF2 in PD cases is seen predominantly in CA1 and CA2 neurons. Lewy body inclusions and neurites (p-ASyn, S129) are seen in both PD cases,with pronounced involvement of CA2. IHC data concerning CA3 and dentate gyrus from PD-1 and PD-2 are included in Additional file 1: Figure S7a.Additional control and PD hippocampus IHC data are presented in Additional file 1: Figure S5-S7, and case details are included in Additional file 1:Table S1 (CA1 and CA2- hippocampal cornu ammonis fields 1 and 2 respectively; scale bar, 100 μm; insets show 40× magnified view in each image)Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 8 of 17the culture medium. LDH is a cytoplasmic enzyme re-leased under conditions of cell membrane damage andduring toxic stress in neuronal cultures [37]. As expected,overexpression of ASyn-WT or ASyn-A53T led to in-creased LDH release (72 h post-transfection), which wasreduced significantly by eEF2K kd in both ASyn-WT orASyn-A53T expressing cells (Fig. 5c). Next, we measuredcytotoxicity in these cultures by labelling with propidiumiodide (PI), another cell permeable marker of cell death.Overexpression of ASyn-WT or ASyn-A53T resulted inincreased cell death (72 h post-transfection), as measuredby flow cytometry analysis of PI staining, and eEF2K kdsignificantly improved viability in these cultures (Fig. 5d).eEF2K inhibition mitigates AS induced mitochondrialdysfunction and oxidative stress in N2A cellsNext, we assessed whether the cytoprotective effectsof eEF2K inhibition against AS toxicity are mediatedby changes in mitochondrial function, since AS in-hibits mitochondrial respiration and complex I activity[8, 55]. First, we characterized cellular respiration(oxygen consumption rate, OCR) in differentiatedN2A cells following eEF2K kd without ASyn overex-pression. This is important since eEF2K regulateshighly energy consuming process of elongation duringmRNA translation, and we wanted to assess if pos-sible metabolic reprogramming in cells due to eEF2Kinhibition does not impair mitochondrial function [15,34]. Intriguingly, N2A cells with eEF2K kd exhibitedsignificantly higher OCR under basal conditions, andmaximal respiration subsequent to the treatment withFCCP (uncoupler of oxidative phosphorylation) thancontrol cells (Additional file 1: Figure S9a). To inves-tigate if the increased respiration in eEF2K kd cellsunder basal conditions is linked to an increase in themitochondrial mass, we quantified mitochondrial con-tent in control and eEF2K kd cells. However, therewere no significant differences in mitochondrial massby flow cytometry analysis using the fluorescent Mito-tracker reagent (Additional file 1: Figure S9b), or by mito-chondrial mtDNA quantification (Additional file 1: FigureS9c). These data demonstrate healthy mitochondrial func-tion in eEF2K kd cells, and suggest that, compared tocontrol cells, cellular respiration in eEF2K kd cells isincreased predominantly due to enhanced mitochon-drial respiration (Additional file 1: Figure S9a; com-pare changes in basal respiration and maximalrespiration in control vs. eEF2K kd cells) without sig-nificant changes in mitochondrial content (Additionalfile 1: Figure S9b-c).Having established that eEF2K kd per se does notnegatively affect mitochondrial function in N2A cells,we proceeded to assess the effects of eEF2K kd on ASinduced mitochondrial dysfunction [8, 27]. We investi-gated this activity in differentiated N2A cells with over-expression of ASyn-WT or ASyn-A53T +/− eEF2K kd(72 h post-transfection). There was a noticeable reduc-tion in basal OCR in cells overexpressing ASyn-WT, orASyn-A53T compared to mock transfected cellsac d ebFig. 3 eEF2K expression and activity in PD brain. a Quantitation of p-eEF2(T56) IHC (3,3′-Diaminobenzidine-DAB staining) in postmortemhippocampus- Hip (CA1 and CA2 fields) and midbrain- MB (SN-substantianigra, and PAG-peri-aqueductal gray matter) sections from 3 control and 6PD cases (Additional file 1: Table S1; counts from at least 6 high powerfields from each control or PD section; Mann–Whitney test, *p < 0.05,***p < 0.005; error bars indicate Mean ± S.D.). b-d eEF2K mRNAexpression in control and PD striatum (b), medial substantia nigra (b)and dorsal nucleus of vagus nerve (d). The following publicly availabletranscriptomic profile datasets were analyzed on the National Centerfor Biotechnology Information (NCBI) Gene Expression Omnibus (GEO)platform: Striatum (b)- dataset GEO accession # GSE28894, Illuminahuman Ref-8 v2.0 expression beadchip platform, probe ID ILMN_1789171,controls n= 15 and PD n= 15; Medial substantia nigra (c)- dataset GEOaccession # GSE8397, Affymetrix Human Genome U133B Array, probe ID225546_at, controls n = 8 and PD n = 15; Dorsal nucleus of vagus(d)- dataset GEO accession # GSE43490, Agilent-014850 Whole HumanGenome Microarray, probe ID A_24_P716162, controls n=6 and PD n= 7.(Mann–Whitney test, *p< 0.05; error bars in 3b-d indicate Mean± S.D.). eRelative eEF2K mRNA expression in human iPSCs derived culturedmidbrain control (WT, n= 3) or A53T (n=2) mutation carrying organoids(T-test, *p< 0.05; error bars indicate Mean± S.D.)Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 9 of 17(Fig. 6a). eEF2K kd led to significant improvement ofthe OCR under all conditions (compare Mock controlvs. Mock+sieEF2K, ASyn-WT vs. ASyn-WT + sieEF2Kand ASyn-A53T vs. ASyn-A53T + sieEF2K; Fig. 6a).Then, we measured cellular ATP levels under identicalconditions, and found that overexpression of ASyn-WTor ASyn-A53T significantly reduced cellular ATP con-tent reflecting AS toxicity (Fig. 6b). While eEF2K kdhad negligible effect on ATP content in mock trans-fected cells, it attenuated the loss of ATP in ASyn over-expressing cells (compare ASyn-WT vs. ASyn-WT +sieEF2K and ASyn-A53T vs. ASyn-A53T + sieEF2K; Fig.6b). Together, these data suggest that transient AS (WTor A53T) overexpression is associated with mitochon-drial dysfunction in these dopaminergic cultures, whichis rescued by eEF2K kd.Mitochondrial dysfunction, including complex I in-hibition, is associated with increased production of re-active oxygen species (ROS) and oxidative stress in cells[44]. As mentioned earlier, these processes, i.e., im-paired mitochondrial function and increased ROS, arealso implicated in AS toxicity [4]. Indeed, previousstudies have shown that ROS levels are increased in ASoverxpressing cells [27, 32]. Accordingly, we found thatoverexpression of ASyn-WT or ASyn-A53T increasedROS levels compared with mock transfected cells, asmeasured by flow cytometry analysis of the ROS detec-tion reagent, DCFDA (Fig. 6c). Moreover, we found thateEF2K kd significantly reduced ROS in these cultures,in line with previously reported effects of eEF2K inhib-ition on cellular ROS levels [10, 28]. Collectively, thesedata suggest a role of eEF2K in AS toxicity (Fig. 5a-b),and demonstrate that eEF2K inhibition reduces AS tox-icity by improving mitochondrial function and reducingROS (Fig. 6a-c).Deletion of efk-1 improves dopaminergic neuronal functionin a C. elegans model of AS neurotoxicityTo assess the in vivo impact of eEF2K inhibition as a meansof improving AS-mediated neurotoxicity, we used a C.elegans model of PD. C. elegans possess four bilaterallysymmetric pairs of dopaminergic neurons that are criticalfor adaptations to mechanosensory stimuli, and for theregulation of complex behaviours such as foraging, move-ment, and egg-laying [50, 69]. Accordingly, this wormmodel is widely used in PD research to investigate the sig-nificance of specific mutations and variations, and to screenfor candidate disease-modifying small molecules [70]. Westudied a previously generated C. elegans strain that trans-genically expresses human AS A53T mutant, which resultsin age-related degeneration of dopaminergic neurons andin defects in dopaminergic function in these worms [12].Using this strain, we assessed dopaminergic neuron functionwith or without concomitant deletion of efk-1, the eEF2Kortholog in worms [(ASyn (A53T) and ASyn (A53T)/efk-1delstrains; see Materials and Methods)]. We assessed the effectsof efk-1 deletion in A53T AS expressing worms in threebehavioural responses that are considered to be mediatedpredominantly by dopaminergic neurons in worms: ethanolavoidance, pharyngeal pumping, and area restricted search-ing (see Materials and Methods). We hypothesized that, inview of the cytoprotective effects of eEF2K inhibition againstAS toxicity in cultured dopaminergic N2A cells (Figs. 5-6),efk-1 deletion would improve AS-A53T-induced dopamin-ergic neuron dysfunction in worms.In ethanol avoidance assays, worms exhibit an aversiveresponse to acute ethanol exposure and this response isdependent on adequate sensory motor co-ordination[40]. Notably, efk-1 deletion alone had no significanteffects on this response (Fig. 7a; compare WT (N2)worms with efk-1del), while, as previously reported,a b cFig. 4 Brain eEF2K expression and activity in transgenic M83+/+ PD mice. a eEF2K mRNA levels in whole brain homogenates from transgenic M83+/+ PD miceintramuscularly (IM) injected bilaterally with phosphate buffered saline (PBS, n=10) or pre-formed fibrillar (PFF, n=13) mouse wild type AS. (Mann–Whitney test,***p < 0.005; error bars indicate Mean ± S.D.). b-c Western blot analysis of p-eEF2 (T56) and p-ASyn (S129) in whole brain homogenates fromtransgenic M83+/+ PD mice intramuscularly (IM) injected bilaterally with phosphate buffered saline (PBS) or pre-formed fibrillar (PFF) mouse wild typeAS (b), and corresponding densitometry analysis (c) (n = 7/group; Mann–Whitney test, *p < 0.05, ***p < 0.005; error bars indicate Mean ± S.D.)Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 10 of 17expression of ASyn-A53T led to a worsened response(Fig. 7a) [12]. Importantly, loss of efk-1 completelyrescued the reduced ethanol avoidance of ASyn-A53Texpressing worms [(Fig. 7a; compare ASyn (A53T) withASyn (A53T)/efk-1del)]. In pharyngeal pumping assays,rhythmic contractions (pumping) of the pharynx serveas marker of neuromuscular function and rely on a com-plex neural integration within the autonomic activity[64]. This response is essential for feeding and gener-ation of consequent isthmus peristalsis. As expected, weobserved no difference in the pharyngeal pumping activ-ity between wild type worms and worms lacking efk-1[(Fig. 7b; compare WT (N2) with efk-1del)]. ASyn-A53Texpressing worms showed a modest, but significant, re-duction in pumping activity, which was restored signifi-cantly in ASyn-A53T worms with efk-1 deletion [(Fig.7b; compare ASyn (A53T) with ASyn (A53T)/efk-1del)].Finally, the area-restricted search behaviour reflects for-aging, such that the worms show an adaptive responseby reducing turning frequency to the presence of food;this response is mediated by neural circuits involving dopa-minergic and glutamatergic signalling [24]. As seen with theother two assays, efk-1 deletion alone negligibly affected theperformance of worms in the area restricted search assay[(Fig. 7c; compare WT (N2) worms with efk-1del)], whereasASyn-A53T mutant expressing worms showed significantdefects in this assay (Fig. 7c) as reported previously [12]. Crit-ically, this defect was completely rescued in ASyn-A53Tworms lacking efk-1 [(Fig. 7c; compare ASyn (A53T) withASyn (A53T)/efk-1del)]. Taken together, efk-1 deletion im-proves three independent behaviours known to rely domin-antly on normal dopaminergic neuron function. These datasupport our hypothesis and demonstrate that efk-1 deletionmitigates the deleterious effects of ASyn (A53T) on theac dbFig. 5 Effects of eEF2K inhibition on human AS cytotoxicity in differentiated N2A cells. a-b Western blot analysis of p-eEF2 (T56) levels in N2Acells subsequent to transient overexpression of human wild type or mutant A53T AS, with or without siRNA mediated eEF2K knockdown (a), andcorresponding densitometry analysis (b) (n = 6–9/group from three independent experiments; One-way ANOVA post-hoc Bonferroni test, *p < 0.05,***p < 0.005; error bars indicate Mean ± S.E.M). c Measurements of cytotoxicity by lactate dehydrogenase-LDH release in the culture medium (c) andFACS analysis of propidium iodide-PI staining (d) in N2A cells subsequent to transient overexpression of human wild type or mutant A53T AS, with orwithout siRNA mediated eEF2K knockdown (n = 9–12/group from three independent experiments; One-way ANOVA post-hoc Bonferronitest, *p < 0.05, **p < 0.01, ***p < 0.005, NS = not significant; error bars indicate Mean ± S.D.)Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 11 of 17function of neural circuits involving dopaminergic neuronsin C. elegans, and further point to an in vivo role for eEF2Ksignaling in AS-mediated neurotoxicity.DiscussionPrincipally driven by the early genetic findings in inheritedPD and PD neuropathology, a significant effort in thediscovery of novel therapies in PD and other synucleino-pathies has been to target AS production and/or aggrega-tion [39, 71]. Although such studies have shownpromising results in preclinical research, their translationinto clinically implementable therapies has yet to be real-ized [71]. An additional area of research in potential ther-apies in PD has been to address AS neurotoxicity, and totarget cellular mechanisms that potentially render neuronssusceptible to AS neurotoxicity [38].Our data suggest that eEF2K is one possible mechanismthat is pathologically involved in AS-mediated toxicity, andthat its inhibition represents a novel therapeutic strategy inPD. Our findings demonstrate that eEF2K activity is in-creased in postmortem PD midbrain (substantia nigra andperiaqueductal gray matter) and in hippocampus (CA1 andCA2 regions), with the concomitant presence of Lewypathology (phosphorylation of AS on Ser-129). Additionally,analysis of publicly available microarray datasets revealed in-creased eEF2K expression in striatum, medial substantianigra and dorsal nucleus of vagus (dmX) in PD. Hence, dys-regulated eEF2K expression and/or activity are observed inmultiple brain regions that are affected in PD. We furthershow that induction of aggressive AS pathology in M83+/+transgenic PD mice, by intramuscular PFF AS injection, isassociated with enhanced brain eEF2K expression andactivity. In addition, transient overexpression of AS (WT orA53T mutant) is associated with cytotoxicity and oxidativestress in dopaminergic N2A cells, and leads to eEF2K activa-tion in these cultures. Moreover, eEF2K inhibition mitigatedthe cytotoxic effects of AS overexpression in cells and pre-vented the deficits in dopaminergic function in C. elegansdue to transgenic AS-A53T expression. These observationsare supported by previous reports showing that eEF2KabcFig. 6 Effects of eEF2K inhibition on mitochondrial dysfunction andoxidative stress induced by human AS in differentiated N2A cells. a-bMeasurements of basal oxygen consumption rate-OCR (b) and ATP levels(c) in N2A cells subsequent to transient overexpression of human wild typeor mutant A53T AS, with or without siRNA mediated eEF2Kknockdown (n = 9–12/group from three independent experiments;Unpaired T-test, *p < 0.05, **p < 0.01, ***p < 0.005; error barsindicate Mean ± S.D.). c Flow cytometry analysis of reactive oxygenspecies (ROS), measured by DCFDA staining, in N2A cells subsequentto transient overexpression of human wild type or mutant A53T AS,with or without siRNA mediated eEF2K knockdown (n = 9/group fromthree independent experiments; Unpaired T-test, *p < 0.05, **p < 0.01,***p < 0.005; error bars indicate Mean ± S.D.)Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 12 of 17inhibition reduces oxidative and ER stress, processes associ-ated with AS toxicity [6, 10, 28].It is noteworthy that brain areas showing increasedeEF2K activity in PD cases examined here are part ofdistinct neurotransmitter networks that are affected at dif-ferent neuropathological stages in PD [7, 65]. Consideringthe neuronal populations found in these distinct anatom-ical brain areas and their connectivity, it has been postu-lated that the clinical spectrum of PD symptoms (i.e.,motor, autonomic or cognitive) may arise depending onthe extent of Lewy pathology and/or cell loss [7, 33]. Froma neurological perspective, it is commonly thought thatthe lesions in the striatum or substantia nigra underlie themotor symptoms due to neurotransmitter imbalance inthe nigrostriatal system causing defective motor controland muscle tone, and this assertion is supported by thestudies in animal models [18]. Furthermore, the loss ofcholinergic projections from dorsal nucleus of vagus(dmX) is implicated in the autonomic dysfunction in PD[65]. The periaqueductal gray (PAG) matter is also af-fected with AS inclusions in PD, Dementia with Lewybodies (DLB), and Multiple system atrophy (MSA) [61].This cell dense region harbours many distinct neuronalpopulations with projections linking forebrain and lowerbrain stem, and in mammals is involved in autonomiccontrol, cardiovascular function, pain modulation, wake-fulness, rapid eye movement (REM) sleep and vocalization[55]. Finally, Lewy body pathology is present in hippocam-pus at advanced neuropathological stages in PD, andthought to underlie cognitive symptoms [7, 33, 65].The significance of enhanced eEF2K expression and/or ac-tivity in the aforementioned brain areas in PD remains un-known. Given the critical role of eEF2K in dendritic mRNAtransaltion and synaptic integrity [34], it is plausible that ab-errant eEF2K activity may underlie the dysfunction in theseneuronal populations. Supporting this, some studies suggesta role for eEF2K in synaptic plasticity, in particularmGluR5-mediated long-term depression [66], a mechanismpurported to underlie synaptic dysfunction in AD and otherneuropsychiatric conditions [11]. Furthermore, eEF2K activ-ity is also increased upon exposure to excitatory stimuli inneuronal cultures [23, 35, 66], and in response to nutrientdeprivation (by energy sensor AMP-activated kinase). How-ever, it remains to be established whether some of the afore-mentioned stimuli enhancing eEF2K activity also underlieincreased eEF2K activity in PD. In this regard, activity ofAMP-kinase, an important regulator of eEF2K in responseto metabolic stimuli, is increased in cells and/or rodentsafter exposure to mitochondrial toxins (e.g., MPTP, rote-none) [9, 36]. In postmortem PD brain, activated AMPK hasbeen detected near the rim of Lewy bodies in the cytoplasmas opposed to nuclear staining in controls [30]. However,the beneficial effects of AMPK inhibition in PD models havenot been conclusively established [17], and in some studiesabcFig. 7 Effects of efk-1 deletion on ethanol avoidance, pharyngealpumping, and area restricted searching behavior in C. elegans expressinghuman AS-A53T. a-c Analysis of ethanol avoidance (n=100–150 worms/measurement) (a), pharyngeal pumping (n=10–15 worms/measurement)(b), and area restricted searching behavior (n=10–15 worms/measurement) (c) in control (wild type N2) worms, in efk-1(ok3609) nullmutant worms (efk-1del), in worms expressing human mutant AS-A53T(Pdat-1::a-synuclein[A53T]), and in efk-1(ok3609) null mutant wormsexpressing AS-A53T (efk-1(ok3609); Pdat-1::a-synuclein[A53T]). Statisticalanalysis: one-way ANOVA with post-hoc Bonferroni test; *p < 0.05,***p < 0.005, NS = not significant; error bars indicate mean ± S.E.M.from at least three independent experimentsJan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 13 of 17AMPK activation is protective [51]. A recent report showedaberrations in the expression of factors controlling proteinsynthesis (e.g., ribosomal proteins, translation initiation andelongation factors) in postrmortem PD brain, including re-duced eEF2 levels in PD midbrain and cortex [19], support-ing the notion of dysregulated mRNA translation in PD.Determining whether increased eEF2K activity plays a rolein the synaptic defects of PD, or occurs due to aberrationswithin the translational machinery, represents a challengingtask due to the complex nature of PD etiology and the pos-sible involvement of multiple neurotransmitter systems asthe disease progresses. For simplicity, it is plausible to sug-gest that increased eEF2K activity may be part of somestress-adaptive pathway, which plays a protective role in theshort term under disturbed cellular homeostasis. However,chronic overactivation of this pathway in pathological statesmay be detrimental due to aberrations in mRNA transla-tion and dendritic protein synthesis [28, 46].From a therapeutic perspective, development ofnovel eEF2K inhibitors is actively being pursued to-wards novel experimental therapies in cancer due toits role in metabolic adaptations in cancer cells forsurvival under nutrient deprivation, including nervoussystem malignancies [16, 34, 42]. Here, we show thateEF2K inhibition augments mitochondrial respiration,reduces oxidative stress and prevents AS toxicity indopaminergic N2A cells. The mechanism of increasedmitochondrial function subsequent to eEF2K inhib-ition in dopaminergic N2A cells remains to be deci-phered. We previously reported that eEF2K inhibitionin dopaminergic N2A cells induces an NRF2 antioxi-dant response, and blocks the toxicity of Aβ oligo-mers in neuronal cultures [28]. NRF2 is a masterregulator of cellular redox homeostasis under physio-logical and pathological conditions due to its abilityin controlling the expression of antioxidant genes[31]. However, NRF2 is also known to regulate cellu-lar metabolism (e.g., glutamine biogenesis), and affectsmitochondrial structure and function such as ATP pro-duction, fatty acid oxidation and structural integrity [26,48]. Accordingly, cells and mitochondria derived fromNRF2 knockout mice show reduced respiration, lowerATP levels and impairments in mitochondrial fatty acidoxidation [25, 45]. Furthermore, several small moleculesactivators of NRF2 pathway have shown beneficial effectsin restoring mitochondrial function under conditions ofredox stress in cell cultures, and also in models of neuro-degenerative diseases [26]. One such therapeutic mol-ecule, dimethyl fumarate (DMF, Tecfidera), used to treatmultiple sclerosis, exerts anti-inflammatory and antioxi-dant effects in cell culture and animal studies by activatingNRF2 antioxidant response [1]. DMT administration pre-vents neurodegeneration in mice treated with MPTP [71],a mitochondrial toxin associated with chemically inducedparkinsonism in humans and animals [1]. In this context,our findings raise the possibility that eEF2K can also betargeted in PD to mitigate AS-induced oxidative stress,and potentially neuronal dysfunction in this disease.ConclusionBy employing multiple experimental models, our data sup-port the relevance of eEF2K in PD, and of eEF2K inhibitionin mitigating AS-induced oxidative stress and neuronaldysfunction. We anticipate that our findings will stimulatefurther mechanistic studies and a careful evaluation ofeEF2K inhibition in PD, and potentially other neuro-degenerative diseases.Endnotes1The term eEF2K activity in this manuscript denotesphosphorylation of eEF2, the major known substrate foreEF2K, on serine residue 56 assessed by immunohistochem-istry, immunofluorescence or western blot.Additional fileAdditional file 1: Table S1. Control and PD cases; Figure S1. Melaninbleaching in postmortem midbrain sections and immunostaining forphospho-eEF2 (p-eEF2, Thr56); Figure S2. Immunostaining for phospho-eEF2 (p-eEF2, Thr56) and phospho-AS (p-ASyn, Ser129) in postmortemcontrol midbrain sections; Figure S3. Immunostaining for phospho-eEF2(p-eEF2, Thr56) and phospho-AS (p-ASyn, Ser129) in postmortem PD mid-brain sections; Figure S4. Detection of phospho-eEF2 (p-eEF2, Thr56) andphospho-AS (p-ASyn, Ser129) in postmortem control and PD midbrainsections by immunofluorescence; Figure S5. Immunostaining forphospho-eEF2 (p-eEF2, Thr56) and phospho-AS (p-ASyn, Ser129) in post-mortem control hippocampus sections; Figure S6. Immunostaining forphospho-eEF2 (p-eEF2, Thr56) in postmortem PD hippocampus sections-Panoramic views; Figure S7. Immunostaining for phospho-eEF2 (p-eEF2,Thr56) and phospho-AS (p-ASyn, Ser129) in postmortem PD hippocam-pus sections; Figure S8. Effects of intramuscularly injected pre-formed fi-brillar (PFF) AS on motor phenotype and survival of transgenic M83+/+PD mice and Figure S9. Mitochondrial respiration and mitochondrialmass in differentiated N2A cells subsequent to eEF2K knockdown. (PDF2444 kb).AbbreviationsAD: Alzheimer disease; AS: Alpha synuclein; eEF2: Eukaryotic elongationfactor-2; eEF2K: Eukaryotic elongation factor-2 kinase; MPTP: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; PD: Parkinson disease; PFF: Pre-formedfibrils; ROS: Reactive oxygen speciesAcknowledgementsThe authors would like to thank following individuals their help andassistance during the study: (BCCRC) Amy Li, Jordan Cran, Bo Rafn, andShawn Chafe, (PHJ lab) Rikke Hahn Kofoed.FundingThis work was supported by funding to AJ in the form of AIAS-COFUNDfellowship from European Union’s Horizon 2020 Research and InnovationProgramme under the Marie Skłodowska-Curie agreement (grant #754513)and the Lundbeckfonden, Denmark (grant #R250–2017-1131), Researchgrants to PHS from the Ride2Survive Brain Cancer Impact Grant of theCanadian Cancer Society and Brain Canada (grant #703205) and funds fromthe BC Cancer Foundation, Research support to ST by the Canadian ResearchChair in Transcriptional Regulatory Networks and Canadian Institutes ofHealth Research Project Grant (grant #PJT-153199), NSERC USRA scholarshipJan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 14 of 17to YAN, and support to PHJ by Lundbeckfonden Grant (grant # DANDRITE-R248–2016-2518 and R171–2014-591).Availability of data and materialsThe transcriptomic datasets analyzed during this study can be accessed onthe National Center for Biotechnology Information (NCBI) Gene ExpressionOmnibus (GEO) platform (hyperlink: https://www.ncbi.nlm.nih.gov/geo/) withfollowing accession IDs: GSE28894 (Platform, Illumina human Ref-8 v2.0expression beadchip; eEF2K probe ID, ILMN_1789171), GSE8397 (Platform,Affymetrix Human Genome U133B Array; eEF2K probe ID, 225546_at), andGSE43490 (Agilent-014850 Whole Human Genome Microarray; eEF2K probeID, A_24_P716162). Otherwise, all data generated and analyzed during thisstudy are included in the main manuscript file or the supplementary files.Authors’ contributionsAJ, AD, BJ, ST and PHS designed the research, AJ, AD, BJ, FB, YAN, LMS andNF performed research, GLN helped with experimental design and datasetanalysis, IM provided human postmortem research material, JCS providedresearch material from iPSCs derived midbrain organoids, and AJ, ST andPHS wrote the manuscript. AD and BJ contributed equally to this work. Allauthors read and approved the final manuscript.Authors’ informationAJ was formerly a Postdoctoral Fellow in the research laboratory of PHS at theUniversity of British Columbia (Canada), and since October 2017 is affiliated withAarhus University (Denmark) as AIAS-COFUND Junior Research Fellow.Competing interestsThe authors declare that they have no competing interests.Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.Author details1Aarhus Institute of Advanced Studies, Department of Biomedicine, AarhusUniversity, Høegh-Guldbergs Gade 6B, DK-8000 Aarhus, Denmark.2Department of Pathology and Laboratory Medicine, University of BritishColumbia, Vancouver, Canada. 3British Columbia Cancer Research Centre, 675West 10th Avenue, Vancouver, BC V5Z 1L3, Canada. 4Centre for MolecularMedicine and Therapeutics, BC Children’s Hospital Research Institute,Department of Medical Genetics, University of British Columbia, Vancouver,BC V5Z 4H4, Canada. 5Danish Research Institute of TranslationalNeuroscience, Department of Biomedicine, Aarhus University, Ole Worms Allé3, DK-8000 Aarhus, Denmark. 6Developmental and Cellular Biology,Luxembourg Centre for Systems Biomedicine (LCSB), University ofLuxembourg, 7, avenue des Hauts-Fourneaux, 4362 Esch-sur-Alzette,Luxembourg.Received: 6 May 2018 Accepted: 10 June 2018References1. Ahuja M, Ammal Kaidery N, Yang L, Calingasan N, Smirnova N, Gaisin A,Gaisina IN, Gazaryan I, Hushpulian DM, Kaddour-Djebbar I et al (2016)Distinct Nrf2 Signaling Mechanisms of Fumaric Acid Esters and Their Role inNeuroprotection against 1-Methyl-4-Phenyl-1,2,3,6-Tetrahydropyridine-Induced Experimental Parkinson's-Like Disease. J Neurosci 36:6332–6351.https://doi.org/10.1523/JNEUROSCI.0426-16.20162. Anderson JP, Walker DE, Goldstein JM, de Laat R, Banducci K, Caccavello RJ,Barbour R, Huang J, Kling K, Lee M et al (2006) Phosphorylation of Ser-129 isthe dominant pathological modification of alpha-synuclein in familial andsporadic Lewy body disease. J Biol Chem 281:29739–29752. https://doi.org/10.1074/jbc.M6009332003. Arias-Fuenzalida J, Jarazo J, Qing X, Walter J, Gomez-Giro G, Nickels SL,Zaehres H, Scholer HR, Schwamborn JC (2017) FACS-assisted CRISPR-Cas9genome editing facilitates Parkinson's disease modeling. Stem Cell Rep 9:1423–1431. https://doi.org/10.1016/j.stemcr.2017.08.0264. Behbehani MM (1995) Functional characteristics of the midbrainperiaqueductal gray. Prog Neurobiol 46:575–6055. Bose A, Beal MF (2016) Mitochondrial dysfunction in Parkinson's disease. JNeurochem 139(Suppl 1):216–231. https://doi.org/10.1111/jnc.137316. Boyce M, Py BF, Ryazanov AG, Minden JS, Long K, Ma D, Yuan J (2008)A pharmacoproteomic approach implicates eukaryotic elongation factor2 kinase in ER stress-induced cell death. Cell Death Differ 15:589–599.https://doi.org/10.1038/sj.cdd.44022967. Braak H, Del Tredici K, Rub U, de Vos RA, Jansen Steur EN, Braak E (2003)Staging of brain pathology related to sporadic Parkinson's disease.Neurobiol Aging 24:197–2118. Chinta SJ, Mallajosyula JK, Rane A, Andersen JK (2010) Mitochondrialalpha-synuclein accumulation impairs complex I function indopaminergic neurons and results in increased mitophagy in vivo.Neurosci Lett 486:235–239. https://doi.org/10.1016/j.neulet.2010.09.0619. Choi JS, Park C, Jeong JW (2010) AMP-activated protein kinase isactivated in Parkinson's disease models mediated by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. Biochem Biophys Res Commun 391:147–151.https://doi.org/10.1016/j.bbrc.2009.11.02210. Chu HP, Liao Y, Novak JS, Hu Z, Merkin JJ, Shymkiv Y, Braeckman BP,Dorovkov MV, Nguyen A, Clifford PM et al (2014) Germline quality control:eEF2K stands guard to eliminate defective oocytes. Dev Cell 28:561–572.https://doi.org/10.1016/j.devcel.2014.01.02711. Collingridge GL, Peineau S, Howland JG, Wang YT (2010) Long-term depressionin the CNS. Nat Rev Neurosci 11:459–473. https://doi.org/10.1038/nrn286712. Cooper JF, Dues DJ, Spielbauer KK, Machiela E, Senchuk MM, VanRaamsdonk JM (2015) Delaying aging is neuroprotective in Parkinson'sdisease: a genetic analysis in C. Elegans models. NPJ Parkinsons Dis 1:15022.https://doi.org/10.1038/npjparkd.2015.2213. Cooper JF, Machiela E, Dues DJ, Spielbauer KK, Senchuk MM, Van Raamsdonk JM(2017) Activation of the mitochondrial unfolded protein response promoteslongevity and dopamine neuron survival in Parkinson's disease models. Sci Rep 7:16441. https:/ /doi.org/10.1038 /s415 98-017-16637-214. Dahlgren KN, Manelli AM, Stine WB Jr, Baker LK, Krafft GA, LaDu MJ (2002)Oligomeric and fibrillar species of amyloid-beta peptides differentially affectneuronal viability. JBiolChem 277:32046–3205315. De Gassart A, Martinon F (2017) Translating the anticancer properties of eEF2K.Cell Cycle 16:299–300. https://doi.org/10.1080/15384101.2016.125497416. Delaidelli A, Negri GL, Jan A, Jansonius B, El-Naggar A, Lim JKM, Khan D, Zarni OoH, Carnie CJ, Remke M et al (2017) MYCN amplified neuroblastoma requires themRNA translation regulator eEF2 kinase to adapt to nutrient deprivation. CellDeath Differ 24:1564–1576. https://doi.org/10.1038/cdd.2017.7917. Domise M, Vingtdeux V (2016) AMPK in neurodegenerative diseases. EXS107:153–177. https://doi.org/10.1007/978-3-319-43589-3_718. Duty S, Jenner P (2011) Animal models of Parkinson's disease: a source ofnovel treatments and clues to the cause of the disease. Br J Pharmacol 164:1357–1391. https://doi.org/10.1111/j.1476-5381.2011.01426.x19. Garcia-Esparcia P, Hernandez-Ortega K, Koneti A, Gil L, Delgado-Morales R,Castano E, Carmona M, Ferrer I (2015) Altered machinery of proteinsynthesis is region- and stage-dependent and is associated with alpha-synuclein oligomers in Parkinson's disease. Acta Neuropathol Commun 3:76.https://doi.org/10.1186/s40478-015-0257-420. Giasson BI, Duda JE, Quinn SM, Zhang B, Trojanowski JQ, Lee VM (2002)Neuronal alpha-synucleinopathy with severe movement disorder in miceexpressing A53T human alpha-synuclein. Neuron 34:521–53321. Haas RH, Nasirian F, Nakano K, Ward D, Pay M, Hill R, Shults CW (1995) Low plateletmitochondrial complex I and complex II/III activity in early untreated Parkinson'sdisease. Ann Neurol 37:714–722. https://doi.org/10.1002/ana.41037060422. Hatzipetros T, Kidd JD, Moreno AJ, Thompson K, Gill A, Vieira FG (2015)A Quick Phenotypic Neurological Scoring System for Evaluating DiseaseProgression in the SOD1-G93A Mouse Model of ALS. J Vis Exp.https://doi.org/10.3791/5325723. Heise C, Gardoni F, Culotta L, di Luca M, Verpelli C, Sala C (2014)Elongation factor-2 phosphorylation in dendrites and the regulation ofdendritic mRNA translation in neurons. Front Cell Neurosci 8:35.https://doi.org/10.3389/fncel.2014.0003524. Hills T, Brockie PJ, Maricq AV (2004) Dopamine and glutamate control area-restricted search behavior in Caenorhabditis elegans. J Neurosci 24:1217–1225. https://doi.org/10.1523/JNEUROSCI.1569-03.200425. Holmstrom KM, Baird L, Zhang Y, Hargreaves I, Chalasani A, Land JM, Stanyer L,Yamamoto M, Dinkova-Kostova AT, Abramov AY (2013) Nrf2 impacts cellularbioenergetics by controlling substrate availability for mitochondrial respiration.Biol Open 2:761–770. https://doi.org/10.1242/bio.20134853Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 15 of 1726. Holmstrom KM, Kostov RV, Dinkova-Kostova AT (2016) The multifaceted roleof Nrf2 in mitochondrial function. Curr Opin Toxicol 1:80–91. https://doi.org/10.1016/j.cotox.2016.10.002 S2468-2020(16)30025-027. Hsu LJ, Sagara Y, Arroyo A, Rockenstein E, Sisk A, Mallory M, Wong J,Takenouchi T, Hashimoto M, Masliah E (2000) Alpha-synuclein promotesmitochondrial deficit and oxidative stress. Am J Pathol 157:401–41028. Jan A, Jansonius B, Delaidelli A, Somasekharan SP, Bhanshali F, VandalM, Negri GL, Moerman D, MacKenzie I, Calon F et al (2017) eEF2Kinhibition blocks Abeta42 neurotoxicity by promoting an NRF2antioxidant response. Acta Neuropathol 133:101–119. https://doi.org/10.1007/s00401-016-1634-129. Janetzky B, Hauck S, Youdim MB, Riederer P, Jellinger K, Pantucek F,Zochling R, Boissl KW, Reichmann H (1994) Unaltered aconitase activity, butdecreased complex I activity in substantia nigra pars compacta of patientswith Parkinson's disease. Neurosci Lett 169:126–12830. Jiang P, Gan M, Ebrahim AS, Castanedes-Casey M, Dickson DW, Yen SH(2013) Adenosine monophosphate-activated protein kinase overactivationleads to accumulation of alpha-synuclein oligomers and decrease ofneurites. Neurobiol Aging 34:1504–1515. https://doi.org/10.1016/j.neurobiolaging.2012.11.00131. Johnson DA, Johnson JA (2015) Nrf2–a therapeutic target for the treatmentof neurodegenerative diseases. Free Radic Biol Med 88:253–267. https://doi.org/10.1016/j.freeradbiomed.2015.07.14732. Junn E, Mouradian MM (2002) Human alpha-synuclein over-expressionincreases intracellular reactive oxygen species levels and susceptibility todopamine. Neurosci Lett 320:146–15033. Kalia LV, Lang AE (2015) Parkinson's disease. Lancet 386:896–912. https://doi.org/10.1016/S0140-6736(14)61393-334. Kenney JW, Moore CE, Wang X, Proud CG (2014) Eukaryotic elongationfactor 2 kinase, an unusual enzyme with multiple roles. Adv Biol Regul 55:15–27. https://doi.org/10.1016/j.jbior.2014.04.00335. Kenney JW, Sorokina O, Genheden M, Sorokin A, Armstrong JD, Proud CG(2015) Dynamics of elongation factor 2 kinase regulation in cortical neuronsin response to synaptic activity. J Neurosci 35:3034–3047. https://doi.org/10.1523/JNEUROSCI.2866-14.201536. Kim TW, Cho HM, Choi SY, Suguira Y, Hayasaka T, Setou M, Koh HC, HwangEM, Park JY, Kang SJ et al (2013) (ADP-ribose) polymerase 1 and AMP-activated protein kinase mediate progressive dopaminergic neuronaldegeneration in a mouse model of Parkinson's disease. Cell Death Dis 4:e919. https://doi.org/10.1038/cddis.2013.44737. Koh JY, Choi DW (1987) Quantitative determination of glutamate mediatedcortical neuronal injury in cell culture by lactate dehydrogenase efflux assay.J Neurosci Methods 20:83–9038. Kones R (2010) Mitochondrial therapy for Parkinson's disease:neuroprotective pharmaconutrition may be disease-modifying. ClinPharmacol 2:185–198. https://doi.org/10.2147/CPAA.S12082 cpaa-2-18539. Lashuel HA, Overk CR, Oueslati A, Masliah E (2013) The many faces of alpha-synuclein: from structure and toxicity to therapeutic target. Nat RevNeurosci 14:38–48. https://doi.org/10.1038/nrn340640. Lee J, Jee C, McIntire SL (2009) Ethanol preference in C. Elegans. GenesBrain Behav 8:578–585. https://doi.org/10.1111/j.1601-183X.2009.00513.x41. Lee MK, Stirling W, Xu Y, Xu X, Qui D, Mandir AS, Dawson TM, Copeland NG,Jenkins NA, Price DL (2002) Human alpha-synuclein-harboring familialParkinson's disease-linked Ala-53 –> Thr mutation causesneurodegenerative disease with alpha-synuclein aggregation in transgenicmice. Proc Natl Acad Sci U S A 99:8968–8973. https://doi.org/10.1073/pnas.13219759942. Leprivier G, Remke M, Rotblat B, Dubuc A, Mateo AR, Kool M, Agnihotri S, El-Naggar A, Yu B, Somasekharan SP et al (2013) The eEF2 kinase confersresistance to nutrient deprivation by blocking translation elongation. Cell153:1064–1079. https://doi.org/10.1016/j.cell.2013.04.05543. Li X, Alafuzoff I, Soininen H, Winblad B, Pei JJ (2005) Levels of mTOR and itsdownstream targets 4E-BP1, eEF2, and eEF2 kinase in relationships with tauin Alzheimer's disease brain. FEBS J 272:4211–4220. https://doi.org/10.1111/j.1742-4658.2005.04833.x44. Lin MT, Beal MF (2006) Mitochondrial dysfunction and oxidative stress inneurodegenerative diseases. Nature 443:787–795. https://doi.org/10.1038/nature0529245. Ludtmann MH, Angelova PR, Zhang Y, Abramov AY, Dinkova-Kostova AT(2014) Nrf2 affects the efficiency of mitochondrial fatty acid oxidation.Biochem J 457:415–424. https://doi.org/10.1042/BJ2013086346. Ma T, Chen Y, Vingtdeux V, Zhao H, Viollet B, Marambaud P, Klann E (2014)Inhibition of AMP-activated protein kinase signaling alleviates impairmentsin hippocampal synaptic plasticity induced by amyloid beta. J Neurosci 34:12230–12238. https://doi.org/10.1523/JNEUROSCI.1694-14.201447. Malik AN, Czajka A, Cunningham P (2016) Accurate quantification of mousemitochondrial DNA without co-amplification of nuclear mitochondrial insertionsequences. Mitochondrion 29:59–64. https://doi.org/10.1016/j.mito.2016.05.00348. Mitsuishi Y, Taguchi K, Kawatani Y, Shibata T, Nukiwa T, Aburatani H,Yamamoto M, Motohashi H (2012) Nrf2 redirects glucose and glutamineinto anabolic pathways in metabolic reprogramming. Cancer Cell 22:66–79.https://doi.org/10.1016/j.ccr.2012.05.01649. Monzel AS, Smits LM, Hemmer K, Hachi S, Moreno EL, van Wuellen T, JarazoJ, Walter J, Bruggemann I, Boussaad I et al (2017) Derivation of HumanMidbrain-Specific Organoids from Neuroepithelial Stem Cells. Stem CellReports 8:1144–1154. https://doi.org/10.1016/j.stemcr.2017.03.01050. Nass R, Blakely RD (2003) The Caenorhabditis elegans dopaminergic system:opportunities for insights into dopamine transport and neurodegeneration.Annu Rev Pharmacol Toxicol 43:521–544. https://doi.org/10.1146/annurev.pharmtox.43.100901.13593451. Ng CH, Guan MS, Koh C, Ouyang X, Yu F, Tan EK, O'Neill SP, Zhang X,Chung J, Lim KL (2012) AMP kinase activation mitigates dopaminergicdysfunction and mitochondrial abnormalities in Drosophila models ofParkinson's disease. J Neurosci 32:14311–14317. https://doi.org/10.1523/JNEUROSCI.0499-12.201252. Orchard GE, Calonje E (1998) The effect of melanin bleaching onimmunohistochemical staining in heavily pigmented melanocyticneoplasms. Am J Dermatopathol 20:357–36153. Poewe W, Seppi K, Tanner CM, Halliday GM, Brundin P, Volkmann J, SchragAE, Lang AE (2017) Parkinson disease. Nat Rev Dis Primers 3:17013. https://doi.org/10.1038/nrdp.2017.1354. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A,Pike B, Root H, Rubenstein J, Boyer R et al (1997) Mutation in thealpha-synuclein gene identified in families with Parkinson's disease.Science 276:2045–204755. Reeve AK, Ludtmann MH, Angelova PR, Simcox EM, Horrocks MH, KlenermanD, Gandhi S, Turnbull DM, Abramov AY (2015) Aggregated alpha-synuclein andcomplex I deficiency: exploration of their relationship in differentiated neurons.Cell Death Dis 6:e1820. https://doi.org/10.1038/cddis.2015.16656. Ryan SD, Dolatabadi N, Chan SF, Zhang X, Akhtar MW, Parker J, Soldner F,Sunico CR, Nagar S, Talantova M et al (2013) Isogenic human iPSC Parkinson'smodel shows nitrosative stress-induced dysfunction in MEF2-PGC1alphatranscription. Cell 155:1351–1364. https://doi.org/10.1016/j.cell.2013.11.00957. Ryazanov AG (2002) Elongation factor-2 kinase and its newly discoveredrelatives. FEBS Lett 514:26–2958. Sacino AN, Brooks M, Thomas MA, McKinney AB, Lee S, Regenhardt RW,McGarvey NH, Ayers JI, Notterpek L, Borchelt DR et al (2014) Intramuscularinjection of alpha-synuclein induces CNS alpha-synuclein pathology and arapid-onset motor phenotype in transgenic mice. Proc Natl Acad Sci U S A111:10732–10737. https://doi.org/10.1073/pnas.132178511159. Schapira AH (2008) Mitochondria in the aetiology and pathogenesis ofParkinson's disease. Lancet Neurol 7:97–109. https://doi.org/10.1016/S1474-4422(07)70327-760. Schapira AH, Cooper JM, Dexter D, Jenner P, Clark JB, Marsden CD (1989)Mitochondrial complex I deficiency in Parkinson's disease. Lancet 1:126961. Seidel K, Mahlke J, Siswanto S, Kruger R, Heinsen H, Auburger G, Bouzrou M,Grinberg LT, Wicht H, Korf HW et al (2015) The brainstem pathologies ofParkinson's disease and dementia with Lewy bodies. Brain Pathol 25:121–135. https://doi.org/10.1111/bpa.1216862. Spillantini MG, Schmidt ML, Lee VM, Trojanowski JQ, Jakes R, Goedert M(1997) Alpha-synuclein in Lewy bodies. Nature 388:839–840. https://doi.org/10.1038/4216663. Tremblay RG, Sikorska M, Sandhu JK, Lanthier P, Ribecco-Lutkiewicz M, Bani-Yaghoub M (2010) Differentiation of mouse Neuro 2A cells into dopamine neurons.J Neurosci Methods 186:60–67. https://doi.org/10.1016/j.jneumeth.2009.11.00464. Trojanowski NF, Raizen DM, Fang-Yen C (2016) Pharyngeal pumping inCaenorhabditis elegans depends on tonic and phasic signaling from thenervous system. Sci Rep 6:22940. https://doi.org/10.1038/srep2294065. Uchihara T, Giasson BI (2016) Propagation of alpha-synuclein pathology:hypotheses, discoveries, and yet unresolved questions from experimentaland human brain studies. Acta Neuropathol 131:49–73. https://doi.org/10.1007/s00401-015-1485-1Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 16 of 1766. Um JW, Kaufman AC, Kostylev M, Heiss JK, Stagi M, Takahashi H, Kerrisk ME,Vortmeyer A, Wisniewski T, Koleske AJ et al (2013) Metabotropic glutamatereceptor 5 is a coreceptor for Alzheimer abeta oligomer bound to cellularprion protein. Neuron 79:887–902. https://doi.org/10.1016/j.neuron.2013.06.03667. Vekrellis K, Xilouri M, Emmanouilidou E, Rideout HJ, Stefanis L (2011)Pathological roles of alpha-synuclein in neurological disorders. LancetNeurol 10:1015–1025. https://doi.org/10.1016/S1474-4422(11)70213-768. Wang X, Yan MH, Fujioka H, Liu J, Wilson-Delfosse A, Chen SG, Perry G,Casadesus G, Zhu X (2012) LRRK2 regulates mitochondrial dynamics andfunction through direct interaction with DLP1. Hum Mol Genet 21:1931–1944. https://doi.org/10.1093/hmg/dds00369. White JG, Southgate E, Thomson JN, Brenner S (1986) The structure of thenervous system of the nematode Caenorhabditis elegans. Philos Trans RSoc Lond Ser B Biol Sci 314:1–34070. Wolozin B, Gabel C, Ferree A, Guillily M, Ebata A (2011) Watching wormswhither: modeling neurodegeneration in C. elegans. Prog Mol Biol Transl Sci100:499–514. https://doi.org/10.1016/B978-0-12-384878-9.00015-771. Wong YC, Krainc D (2017) Alpha-synuclein toxicity inneurodegeneration: mechanism and therapeutic strategies. Nat Med 23:1–13. https://doi.org/10.1038/nm.4269Jan et al. Acta Neuropathologica Communications  (2018) 6:54 Page 17 of 17

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.52383.1-0368790/manifest

Comment

Related Items