Open Collections

UBC Faculty Research and Publications

Mesenchymal stem cell-derived angiogenin promotes primodial follicle survival and angiogenesis in transplanted… Zhang, Yaoyao; Xia, Xi; Yan, Jie; Yan, Liying; Lu, Cuilin; Zhu, Xiaohui; Wang, Tianren; Yin, Tailang; Li, Rong; Chang, Hsun-Ming; Qiao, Jie Mar 9, 2017

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12958_2017_Article_235.pdf [ 2.15MB ]
Metadata
JSON: 52383-1.0366276.json
JSON-LD: 52383-1.0366276-ld.json
RDF/XML (Pretty): 52383-1.0366276-rdf.xml
RDF/JSON: 52383-1.0366276-rdf.json
Turtle: 52383-1.0366276-turtle.txt
N-Triples: 52383-1.0366276-rdf-ntriples.txt
Original Record: 52383-1.0366276-source.json
Full Text
52383-1.0366276-fulltext.txt
Citation
52383-1.0366276.ris

Full Text

RESEARCH Open AccessMesenchymal stem cell-derived angiogeninpromotes primodial follicle survival andangiogenesis in transplanted humanovarian tissueYaoyao Zhang1,2,3, Xi Xia1,4, Jie Yan1,2,3, Liying Yan1,2,3, Cuilin Lu1,2,3, Xiaohui Zhu1,2,3, Tianren Wang1,2,5,Tailang Yin1,2,3, Rong Li1,2,3, Hsun-Ming Chang6 and Jie Qiao1,2,3*AbstractBackground: We have recently reported that human bone marrow-derived mesenchymal stem cells (MSCs)facilitate angiogenesis and prevent follicle loss in xenografted human ovarian tissues. However, the mechanismunderlying this effect remains to be elucidated. Thus, determining the paracrine profiles and identifying the keysecreted factors in MSCs co-transplanted with ovarian grafts are essential for the future application of MSCs.Methods: In this study, we used cytokine microarrays to identify differentially expressed proteins associated withangiogenesis in frozen-thawed ovarian tissues co-transplanted with MSCs. The function of specific secreted factorsin MSCs co-transplanted with human ovarian tissues was studied via targeted blockade with short-hairpin RNAi andthe use of monoclonal neutralizing antibodies.Results: Our results showed that angiogenin (ANG) was one of the most robustly up-regulated proteins (among42 protein we screened, 37 proteins were up-regulated). Notably, the targeted depletion of ANG with short-hairpinRNAi (shANG) or the addition of anti-ANG monoclonal neutralizing antibodies (ANG Ab) significantly reversed theMSC-stimulated angiogenesis, increased follicle numbers and protective effect on follicle apoptosis.Conclusion: Our results indicate that ANG plays a critical role in regulating angiogenesis and follicle survival inxenografted human ovarian tissues. Our findings provide important insights into the molecular mechanism bywhich MSCs promote angiogenesis and follicle survival in transplanted ovarian tissues, thus providing a theoreticalbasis for their further application.Keywords: Ovarian tissue transplantation, Mesenchymal stem cell, Follicle survival, Fertility preservation, AngiogeninBackgroundThe transplantation of frozen-thawed ovarian tissue is apromising technique for the restoration of endocrinefunction and fertility [1], especially in cancer patientswho have undergone gonadotoxic therapy [2–6]. How-ever, ischemia-reperfusion injury and insufficient re-vascularization following transplantation, which lead tofailure of follicular survival, are significant obstacles tothe wider application of this technique [7–9]. Therefore,searching for methods to minimize this damage and toinduce adequate revascularization is a critical step forsuccessful ovarian tissue transplantation and the preser-vation of fertility.Mesenchymal stem cells (MSCs), which can be isolatedfrom various tissues [10], are a population of cells pos-sessing pluripotent capabilities. MSCs have been shownto be a promising therapeutic approach to treat aspectrum of diseases, especially in disorders associatedwith insufficient angiogenesis [11, 12]. Recently, wedemonstrated that MSCs from human bone marrow* Correspondence: jie.qiao@263.net1Department of Obstetrics and Gynecology, Center for ReproductiveMedicine, Peking University Third Hospital, No.49 North HuaYuan Road,HaiDian District, Beijing 100191, China2Beijing Key Laboratory of Reproductive Endocrinology and AssistedReproduction, Beijing 100191, ChinaFull list of author information is available at the end of the article© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Zhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 DOI 10.1186/s12958-017-0235-8functioned as a supportive agent for human ovariantissue transplantation, promoting angiogenesis and fol-licle survival [13]. However, the mechanism underlyingthis process is unknown. A better understanding of howco-transplanted MSCs exert their pro-angiogenic effectson ovarian grafts can help optimize the parameters forclinical applications. Therefore, in this study, we soughtto investigate the possible mechanisms by which humanMSCs promote re-vascularization and prevent follicleloss in xenografted ovarian tissues.Angiogenesis is a multi-step process that involves thesurvival, proliferation, migration, and differentiation ofendothelial cells, as well as tube formation and matur-ation. In recent years, several studies have used differentapproaches to investigate the mechanisms by whichMSCs facilitate angiogenesis; however, no consistentconclusion has been reached. Some studies have indi-cated that MSCs are capable of differentiating into endo-thelial cells, pericytes, or even vessel walls to support theformation of blood vessels [14–16]. Other studies havesuggested that MSCs are capable of protecting endothe-lial cells from apoptosis, including from oxidative stress-related apoptosis in the initial phase of angiogenesis[17]. Furthermore, in addition to the early steps ofangiogenesis, such as endothelial cell proliferation,MSCs have been reported to support the late phases ofangiogenesis, including blood vessel maturation [18, 19].However, these proposed mechanistic explanations arestill debated. Conflicting data have shown that morpho-logical and ultrastructural evidence of MSC differenti-ation into endothelial cells or blood vessel wallstructures in vivo is uncommon. In addition, the integra-tion of the transplanted MSCs into host blood vesselshas not been observed in animal studies [20].In the past several years, research has focused on thesecretion-based paracrine regulatory role of MSCs.Studies have shown that MSCs can establish a pro-angiogenic microenvironment by persistently secretingbioactive molecules that promote angiogenesis andmicrovascular network formation [21]. Furthermore,accumulating reports have suggested that the thera-peutic potential of MSCs is largely dependent on theirsecretory capacity rather than on their differentiationcapacity [22]. Studies of MSC secretion profiles haveshown that some pro-angiogenic cytokines, such asVEGF, MCP-1 and FGF-2, can be detected in the condi-tioned medium of MSCs [23]. However, the compositionof the profile of secreted molecules under different con-ditions varies greatly, leading to differences in angiogeniccapacities [24]. For example, it has been reported thatunder hypoxic conditions, the secretion of pro-angiogenic factors can be significantly increased [25].Due to these variations and the limited knowledge re-garding the cytokine production of MSCs followingtransplantation (a hypoxic condition), determining theparacrine profiles and identifying the key secreted cyto-kines in MSCs co-transplanted with ovarian tissues areessential steps before further (pre)clinical studies can beperformed. Therefore, in the present study, we designedan antibody-based cytokine microarray to investigate theexpression profiles of angiogenesis-related proteins infrozen-thawed ovarian tissues co-transplanted withMSCs. We found that a panel of proteins, includingangiogenin (ANG), was significantly up-regulated.Hence, we sought to suppress ANG secretion in MSCsvia RNAi with an ANG-specific short-hairpin RNA(shANG) or using ANG monoclonal antibodies toexplore the role of ANG in angiogenesis and folliclesurvival induced by MSCs in ovarian transplantation.MethodsIdentification and isolation of human MSCsThe protocols for the collection of human MSCs andovarian samples were approved by the Ethics Committeeof the Peking University Third Hospital. Informed con-sent was obtained from all subjects. Human MSCs wereisolated by density gradient centrifugation (Additionalfile 1: Figure S1). The detailed methods were describedpreviously [26]. Human MSCs were isolated from thebone marrow of a healthy female (age: 28 years old) whounderwent bone marrow harvesting for allogeneic bonemarrow transplantation at our hospital. Human MSCswere cultured in alpha minimum essential Eagle’smedium (α-MEM) supplemented with 20% humanserum albumin (Life Technologies, Carlsbad, CA), L-glutamine and penicillin-streptomycin (Invitrogen, LifeTechnologies, Grand Island, NY) and used for experi-ments during passages 3 to 8. For identification, theMSCs were stained with antibodies against CD34, CD44,CD45, CD19, CD90, and CD105 (Biolegend, San Diego,CA). The detail information about surface marker selec-tion and stemness potential characterization of humanMSCs were provided previously [26].Lentivirus production and infectionAn ANG-specific short-hairpin RNAi (shANG) was syn-thesized and cloned into a lentiviral GV248 vector (Gen-echem, China). The sequences for RNAi were designedto knock down the gene expression of ANG (shANG) orwere control particles (shCTRL) and were obtainedusing the shRNA library of the RNAi Codex(www.codex.cshl.edu).The target sequences were as follows: shANG: 5′- CCACTTGGATCAGTCAATT -3′ and shCTRL: 5′-AACAGTCGCGTTTGCTACTTT-3′. Lentivirus preparation,infection and selection were performed according to thetechnical manual for the vector.Zhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 2 of 12Quantitative real-time PCR and ELISATotal RNA was extracted from MSCs transfected withshANG or shCTRL using a Total RNA Purification PlusKit (Norgen, Canada), according to the manufacturer’sinstructions. A total of 1.0 μg of RNA was reverse-transcribed using the SuperScript III First-strand Synthe-sis System. PCR amplification was carried out in an ABI7500 Detection System using Power SYBR (Applied Bio-systems, Carlsbad, CA) under the following conditions:50 °C for 2 min; 95 °C for 2 min; and 40 cycles of 95 °Cfor 15 s, 60 °C for 15 sec, and 72 °C for 1 min. GAPDHwas used as a reference gene for normalization. Thelevel of ANG mRNA expression was calculated using thefollowing formula: 2(ΔCt Test – ΔCt Control). The Ct ofANG was compared with that of the internal controlGAPDH gene.The primer sequences used for PCR were as follows:GAPDH sense: 5′- TGACTTCAACAGCGACACCCA-3′ and antisense: 5′- CACCCTGTTGCTGTAGCCAAA -3′; ANG sense: 5′- CCTCCATGCCAGTACCGAG-3′ and antisense: 5′- GGACGACGGAAAATTGACTGA -3′.We used an ELISA kit (R&D, Abingdon, UK) for thequantitative measurement of human ANG in the condi-tioned media of MSCs transfected with specific shANGor shCTRL after 24 h of culture. MSCs were plated on a6-well plate at a density of 105 cells/well. ELISAs wereperformed according to the manufacturer’s instructions.Each sample was analyzed in triplicate.Collection and treatment of human ovarian tissueThe use of human ovarian tissues was reviewed andapproved by the ethics committee of Peking University(registration number: 2009005). Human ovarian tissuewas obtained from a 26-year-old female patient whounderwent gender reassignment surgery. One biopsyfrom each ovary was obtained and cut into small piecesafter removing the medulla tissues. The ovarian tissueswere cryopreserved and thawed as previously described[26]. Briefly, the ovarian tissue was transported from theoperating room to the laboratory in Leibovitz’s L-15medium (Invitrogen, Carlsbad, CA) supplemented with1% human serum albumin (Life Technologies, Carlsbad,CA), 100 IU/mL penicillin (Sigma, St. Louis, MO) and100 μg/mL streptomycin (Sigma, St. Louis, MO). Afterenucleating the medulla with surgical scissors and a scal-pel, the ovarian cortical tissues were manually cut intosmall pieces with a size of 5 mm × 5 mm × 1 mm(thickness).Two slices of ovarian cortical tissues were placed in a1.8-mL cryovial (Nunc, Roskilde, Denmark) containing1 mL of 1.5 mol/L DMSO (Sigma-Aldrich, St. Louis,MO), 0.1 mol/L sucrose (Sigma-Aldrich, St. Louis, MO)and 10% HSA (Life Technologies, Carlsbad, CA) inLeibovitz medium. After 30 min of exposure to the cryo-protective agent at 4 °C, the cryovial was transferred to aprogram freezer (Biomed Freezer Kryo 10, series II;Planer, Middlesex, UK). The freezing and thawing proce-dures were carried out according to the techniquesdescribed by Andersen [27].Ovarian transplantation in severe combined immunedeficiency miceAll animal procedures were approved by the Institu-tional Animal Care and Use Committee of the PekingUniversity Third Hospital. A total of 30 8-week-oldfemale ovariectomized mice with severe combinedimmune deficiency (SCID) (Animal Center of MedicalCollege of Peking University) were used in the study.Consistently with previous reports [13, 28, 29], eachovarian fragment was co-transplanted with 5 × 105 MSCsin our study,.For the array analysis, 6 mice were randomly assignedto one of 2 groups: (1) Graft +MSC group: each ovarianfragment was transplanted with 5 × 105 MSCs packagedin 10 μL of Matrigel (Corning, USA); and (2) Graftgroup (control): each ovarian fragment was transplantedin 10 μL of Matrigel. The grafts were retrieved and rap-idly frozen in liquid nitrogen for cytokine array analyses7 days after transplantation.For the shRNA blockade experiment, 12 mice weredivided into 4 equal groups: (1) Graft group: each ovar-ian fragment was transplanted with 10 μL of Matrigel;(2) Graft +MSC group: each ovarian fragment was trans-planted with 5 × 105 MSCs packaged in 10 μL of Matri-gel; (3) Graft + shCTRL MSC group: each ovarianfragment was transplanted with 5 × 105 shCTRL- trans-fected MSCs packaged in 10 μL of Matrigel; and (4)Graft + shANG MSC group: each ovarian fragment wastransplanted with 5 × 105 stably shANG-transfectedMSCs packaged in 10 μL of Matrigel.For the antibody blockade experiment, 12 mice weredivided into 4 equal groups:(1) Graft group: transplantation of ovarian tissues with10 μL of Matrigel; (2) Graft +MSC group: each ovarianfragment was transplanted with 5 × 105 MSCs packagedin 10 μL of Matrigel; (3) Graft +MSC + Control antibody(Ab) group: each ovarian fragment was transplanted with5 × 105 MSCs with 200 μg/mL of a control isotype IgGantibody (Thermo Fisher Scientific, Carlsbad, CA) pack-aged in 10 μL of Matrigel; and (4) Graft +MSC + ANGAb group: each ovarian fragment was transplanted with5 × 105 MSCs with 200 μg/mL of the ANG monoclonalantibody 26-2 F (Millipore, Germany) packaged in 10 μLof Matrigel.The detailed transplantation procedure has been de-scribed previously [13]. Briefly, before transplantation,the SCID mice were anesthetized via intraperitonealZhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 3 of 12injection of 2,2,2-tribromoethyl alcohol (Sigma, St.Louis, MO) and tertamyl alcohol (Sigma, St. Louis,MO). Two skin incisions were made in the lower thirdof the abdominal wall on both sides after sterilizing thearea. The ovarian tissues were randomly chosen andxenografted into the subcutaneous interspace, where thecortical side adhered to the skin and the medullar sideadhered to the fascia. Two pieces of ovarian tissue werethen placed in each mouse. The skin incisions were sub-sequently closed with absorbable 5/0 Prolene (Ethicon,Somerville, NJ). All procedures were performed underaseptic conditions. The animals were euthanized via cer-vical dislocation after 7 days (3 mice in each group).Ovarian cortical tissues were retrieved and fixed in 4%formaldehyde for histological and immunohistochemicalexamination.Human angiogenesis arrayA human antibody-based array kit was purchased fromRaybiotech (Raybiotech Inc, Norcross GA); in the kit,glass slides were printed as sub-arrays consisting of 42antigen-specific antibodies against angiogenesis-relatedfactors. The antibody array was used according to themanufacturer’s instructions. The results were normalizedto internal positive controls for comparison. Two repli-cates per antibody were spotted, and the average of themedian signal intensity from each spot (minus localbackground subtraction) was used for the calculation.The arrays were visualized using ImageQuant LAS4000software (GE Healthcare) and analyzed using ImageJ(National Institutes of Health).Assessment of ovarian histologyOvarian histology was evaluated based on hematoxylinand eosin (HE) staining. The detailed procedures havebeen described previously [13]. After fixation, xeno-grafted ovarian tissues were processed for routine paraf-fin embedding, and 5-μm-thick serial sections wereprepared. One from every five serial sections was usedfor HE staining, and follicles were counted in five ran-domly selected fields at × 400 magnification. To avoidcounting follicles more than once, only follicles with avisible nucleus were counted. Follicle stages were classi-fied as previously described [30]. The number of primor-dial follicles in each group was expressed as the sum ofthe follicles in 25 different sections.Immunohistochemistry and Immunofluorescence studyImmunohistochemistry was performed using the ABCStaining System (Zhongshan Golden Bridge Biotechnol-ogy, Inc., Beijing, China). The detailed procedures havebeen described previously [31]. For CD-31 staining,human fetal villus tissues (10-week-old) were used as apositive control. For AC-3 staining, thawed humanovaries (female, age: 21) were used as a positive control.The primary antibody was omitted in the negative con-trol. The follicles with positive staining (brown stainingin the cytoplasm/nucleus) and the total number of folli-cles were counted in five random fields (×400) of eachsection in 25 different sections in each sample. To evalu-ate vascular density, CD31-positive vessels were countedin five random fields (×400 magnification) of eachsection and in 5 different sections from each sample.Immunofluorescence staining of CD31 and Ki67 wereperformed as described previously [32].Statistical analysisAll experiments were repeated three times unless speci-fied otherwise. Analyses were performed using SPSS13.0 software (SPSS, Inc., Chicago, IL, USA). For themicroarray, qPCR and ELISA data, statistical significancewas determined with a two-tailed Student’s t test. Thevascular density, follicle count and AC-3 percentage datawere analyzed via one-way or two-way analysis of vari-ance (ANOVA), followed by pairwise comparisons usingthe LSD method. All P values were two-sided. A P value< 0.05 was considered statistically significant.ResultsANG levels are significantly increased uponco-transplantation of MSCs with ovarian tissuesThe characterization of MSCs was shown in Additionalfile 2: Figure S2. The isolated MSCs were negative forCD34, CD45, and CD19 and positive for CD44, CD90,and CD105. IHC study showed scattered positive expres-sion of CD90 and CD105 in the ovarian tissue co-transplanted with MSCs (Additional file 3: Figure S3).To investigate whether certain secreted factors were spe-cifically increased in the co-transplanted ovarian tissuesand MSCs, we analyzed 42 angiogenesis-related proteinsvia protein microarray analysis (Fig. 1). The results werecompared with the Graft group (xenografted ovariantissues only). In total, the expression levels of 37 pro-teins were higher in the Graft +MSC group, whereas theexpression levels of 5 proteins were higher in the Graftgroup. Twelve proteins were at least two-fold moreabundant in co-transplanted ovarian tissue and MSCsthan in solely ovarian grafts (Fig. 1b). The remainingproteins exhibited non-significant changes. By contrast,no proteins were at least twice as abundant in solelyovarian grafts as in co-transplanted ovarian tissue andMSCs. We were intrigued that ANG exhibited a markedincrease in expression (up to 4.49-fold) in co-transplanted ovarian tissue and MSCs, particularly as ithas been reported that ANG plays an essential role inendothelial cell proliferation and angiogenesis [33].Although the expression of angiopoietin-2 was evenhigher (by up to 5.76-fold), angiopoietin-2 has beenZhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 4 of 12associated with endothelial cell death and vascular re-gression [34]. Therefore, we focused on ANG in oursubsequent experiments.Blockade of ANG suppresses MSC-stimulated ovarianangiogenesisBecause ANG was robustly increased in MSCs co-transplanted with ovarian grafts, we speculated thatANG might play a key role in angiogenesis and folliclesurvival in MSCs co-transplanted with ovarian grafts. Totest our hypothesis, we specifically inhibited ANG func-tion in MSCs using either shANG or an anti-ANG neu-tralizing antibody. The results of RT-PCR indicated thatshANG significantly suppressed the mRNA expressionof ANG, with a 72.4% knockdown efficiency (P < 0.01,Additional file 4: Figure S4A). In addition, secreted ANGwas measured in the cell culture media using a commer-cial ELISA. As expected, a significantly lower secretedANG level was observed in the shANG-transfectedMSCs than in the shCTRL-transfected MSCs (P < 0.01,Additional file 4: Figure S4B).Ovarian angiogenesis in each group in the shRNA andantibody blockade experiments was assessed via CD31staining and microvascular density counts (Fig. 2a, c).Similar to our previous study, by day 7, co-transplantation of MSCs with the graft (Graft +MSCgroup) had significantly promoted the density of CD31-positive microvessels compared with the densities in theFig 1 Angiogenin level is significantly increased in co-transplanted of ovarian tissues and MSCs. a List of antibodies against angiogenesis relatedcytokine factors by RayBiotech human antibody array; b Comparison of the panel of protein expression profiles in ovarian graft and MSCs co-transplantation (Graft + MSC group) versus Graft group. (Left) Heat maps were developed with the hierarchical clustering algorithm between thetwo groups. For each protein, signals from all conditions were averaged to generate the baseline. Signals above baseline are red; signals belowbaseline are green. The heat map key shows log2-fold changes from baseline. (Right) Lists of differential expressed protein that was abundant inGraft + MSC group or in MSC group. MSC, mesenchymal stem cells. POS, positive control. NEG, negative controlZhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 5 of 12Graft group (Additional file 5: Figure S5) in both theshRNA (6.23 ± 0.55 vs. 4.13 ± 0.61, respectively, P < 0.05,Fig. 2b) and ANG antibody blockade experiments (6.97± 0.59 vs. 4.43 ± 0.38, respectively, P < 0.05, Fig. 2d). Inthe shRNA blockade experiment, the microvasculardensity was significantly decreased in the Graft +MSCshANG group (5.03 ± 0.51) compared with those of theGraft +MSC (6.23 ± 0.55, P < 0.05, Fig. 2b) and Graft +MSC shCTRL groups (6.47 ± 0.60, P < 0.05, Fig. 2b). Thisfinding showed that ovarian angiogenesis induced byMSCs was significantly suppressed by shANG, mostlikely due to the suppression of ANG secretion. Al-though shCTRL did not suppress MSC-inducedangiogenesis, the microvascular density in the Graft +MSC shCTRL groups (6.47 ± 0.60) was not signifi-cantly different from that in the Graft + MSC groups(6.23 ± 0.55, P = 0.63, Fig. 2b). In the antibody block-ade experiment, we found that the microvasculardensity was significantly decreased in the Graft +MSC + ANG Ab group (5.2 ± 0.46) compared withthose in the Graft +MSC group (6.97 ± 0.59, P < 0.05,Fig. 2d) and the Graft +MSC +CTRL Ab group (6.70 ±0.80, P < 0.05, Fig. 2d), which showed that the ANG Absufficiently blocked MSC-induced angiogenesis, probablyvia the neutralization of ANG secretion. By contrast, theCTRL IgG Ab had no influence on the effect of MSCs onovarian angiogenesis, as the microvascular density in theGraft +MSC +CTRL Ab group (6.70 ± 0.80) was notsignificantly different from that in the Graft +MSC group(6.97 ± 0.59, P = 0.45, Fig. 2d).Blockade of ANG neutralizes MSC-stimulated follicularsurvivalBefore transplantation, the average number of primodialfollicles in ovarian tissue is 63.17 ± 9.52. Next we exam-ined the number of primordial follicles in xenograftedovarian tissues after ANG blockade in MSCs using eithershRNA or a neutralizing antibody. Representative HE-stained follicles from each group are shown in Fig. 3 andAdditional file 6: Figure S6. Consistent with our previousstudy, the co-transplantation of MSCs with ovariantissues (Graft + MSC group) significantly increased thefollicle count compared with that of the Graft groupin both the shRNA (36.27 ± 2.85 vs. 27.13 ± 2.32,respectively, P < 0.05, Fig. 3b) and antibody blockadeexperiments (34.57 ± 1.60 vs. 26.73 ± 2.07, respectively,P < 0.05, Fig. 3d). In the shRNA experiment, the num-bers of primordial follicles in the Graft + MSC shANGFig 2 Angiogenin-blockade suppressed MSCs-stimulated ovarian angiogenesis. a Representative figures showing microvascular density of ovariantissues in shRNA blockage analysis, as determined by CD31 immunoactivity, at post-transplantation day-7 in each group. b Quantitative analysisof microvascular densities between different groups in shRNA blockage analysis, c Representative figures showing microvascular density of ovariantissues in antibody blockage experiment, as determined by CD31 immunoactivity, at post-transplantation day-7 in each groups. d Quantitativeanalysis of microvascular density between different groups in antibody blockage experiment. Data shown are means ± SEM of triplicates in arepresentative experiment. MSC, mesenchymal stem cells; ANG, angiogenin; CTRL, control; Ab, antibody; shANG, ANG specific short hairpin RNA;shCTRL, control short hairpin RNA, * P < 0.05. Scale bar = 100 μmZhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 6 of 12group (29.27 ± 2.05) were significantly lower than those inthe Graft +MSC (36.27 ± 2.85, P < 0.05, Fig. 3b) and theGraft +MSC shCTRL groups (35.03 ± 1.99, P < 0.05,Fig. 3b). This result indicates that the suppression of ANGsecretion by shANG significantly neutralized the ability ofMSCs to enhance follicular survival. However, shCTRLdid not attenuate the effect of MSCs on the enhancementof follicular survival, as the numbers of primordial folliclesin the Graft +MSC +CTRL Ab group (35.03 ± 1.99) wasnot significantly different from that in the Graft +MSCgroup (36.27 ± 2.85, Fig. 3b). In the antibody blockade ex-periment, the number of primordial follicles in theGraft + MSC + ANG Ab group (30.10 ± 2.43) was sig-nificantly lower than those in the Graft + MSC (34.57± 1.60, P < 0.05, Fig. 3d) and Graft + MSC + CTRL Abgroups (35.40 ± 2.78, P < 0.05, Fig. 3d), indicating thatthe suppression of ANG secretion by the ANG anti-body significantly neutralized the ability of MSCs toenhance follicular survival. However, the CTRL IgGAb did not have a neutralizing effect, as the numberof primordial follicles in the Graft + MSC + CTRL Abgroups (35.40 ± 2.78) was not significantly differentfrom that in the Graft +MSC group (34.57 ± 1.60, P =0.66, Fig. 3d).Blockade of ANG increases follicular apoptosis after theco-transplantation of MSCsActive caspase 3 (AC-3) was used as a marker of apop-tosis in IHC experiments, and representative images ofAC-3 expression in each group are presented in Fig. 4aand c. Similar to our previous study, MSC co-transplantation significantly reduced follicular apoptosisin the Graft +MSC group compared with that in theGraft group in both the shRNA (12.3 ± 2.5% vs. 18.7 ±3.3%, respectively, P < 0.05. Fig. 4b) and antibody block-ade experiments (9.7 ± 3.4% vs. 20.0 ± 3.1%, respectively,P < 0.05. Fig. 4d). We hypothesized that ANG blockademay increase follicular apoptosis with co-transplantationof MSCs. Indeed, in the shRNA blockade experiment,shANG significantly increased follicular apoptosis, as asignificantly elevated number of AC-3-positive primor-dial follicles was observed in the Graft +MSC shANGgroup (17.2 ± 2.4%) in comparison to the number in theGraft +MSC (12.3 ± 2.5%, P < 0.05. Fig 4b) and the Graft+ shCTRL MSC groups (11.2 ± 2.0%, P < 0.05. Fig 4b). Itis not surprising that shCTRL did not affect follicularapoptosis in xenografted ovarian tissues after the co-transplantation of MSCs, as the follicular apoptosis ratein the Graft +MSC shCTRL group (11.2 ± 2.0%) was notFig 3 Blockade of angiogenin neutralized MSC-stimulated follicular survival after co-transplantation of MSCs. a Representative images of HE-stainedsection showing number of primodial follicles in ovarian tissue at post-transplant day-7 of each group in the shANG blockage experiment. b Quantitativeanalysis of follicular numbers in different groups in shANG blockage experiment. c Representative images of HE-stained section showing number ofprimodial follicles in ovarian tissue at post-transplant day-7 of each group in antibody blockage experiment. d Quantitative analysis of primodial follicularnumbers in different groups in antibody blockage experiment. Data shown are means ± SEM of triplicates in a representative experiment.MSC, mesenchymal stem cells; ANG, angiogenin; CTRL, control; Ab, antibody; shANG, ANG specific short hairpin RNA; shCTRL, control shorthairpin RNA, * P < 0.05. Scale bar = 50 μmZhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 7 of 12significantly different from that of the Graft +MSCgroup (12.3 ± 2.5%, P = 0.61, Fig. 4b).In the antibody blockade experiment, the ANG anti-body significantly increased follicular apoptosis, and sig-nificantly elevated numbers of AC-3-positive follicleswere observed in the Graft +MSC + ANG Ab group(17.9 ± 2.1%) compared with the numbers in the Graft +MSC group (9.7 ± 3.4%, P < 0.05. Fig 4d) and the Graft +MSC + CTRL Ab group (11.5 ± 2.6%, P < 0.05. Fig 4d). Itis not surprising that the CTRL IgG Ab did not affectfollicular apoptosis in xenografted ovarian tissues afterthe co-transplantation of MSCs; the follicular apoptosisrate in the Graft +MSC + CTRL Ab group (11.5 ± 2.6%)was not significantly different from that of the Graft +MSC group (9.7 ± 3.4%, P = 0.47, Fig. 4d).DiscussionOur study highlights several important findings. Thefirst is that the expression levels of a panel of proteins,including ANG, were significantly increased upon theco-transplantation of MSCs with ovarian tissues. Thesecond is that the blockade of ANG using either the spe-cific shANG or an ANG neutralizing antibody couldsuppress MSC-induced ovarian angiogenesis and folliclesurvival. These results indicated that MSC-derived ANGinduced angiogenesis and follicle survival in xenograftedhuman ovarian tissues. Our study is the first to demon-strate the crucial role of ANG in mediating the pro-angiogenic effect of MSCs co-transplanted with ovariantissue, and these results provide a theoretical basis forfurther research on and the application of MSCs in ovar-ian tissue transplantation.The ability of MSCs to release paracrine factors withpro-angiogenic functions has been observed in manystudies. Umbilical cord MSC-derived microvesicles con-taining several angiogenic factors, including EGF andVEGF, contribute to the pro-angiogenic effect of MSCs[35]. Placental chorionic villus MSCs showing a highcapacity to release angiogenic factors, including VEGFand hepatocyte growth factor, have been found to con-tribute to the functional improvement of ischemic hindlimbs of nude mice after transplantation [36]. Pre-clinical and clinical studies have also shown that MSCscan augment cardiac function upon implantation intothe ischemic/infarcted myocardium [37, 38]. These stud-ies have suggested that pro-angiogenic factors releasedby MSCs could stimulate angiogenesis and increaseregional perfusion. In our model of MSC and ovariantissue co-transplantation, MSCs were packaged in Matri-gel surrounding the ovarian graft, providing a suitableFig 4 Blockade of angiogenin increased primordial follicular apoptosis after co-transplantation of MSC. a Representative images showing primordialfollicular apoptosis as determined by AC3 staining of ovarian tissues at post-transplantation day-7 in different groups in shANG blockage experiment.b Quantitative analysis of primordial follicular apoptosis between different groups in shANG blockage experiment. c Representative images showingprimordial follicular apoptosis as determined by AC3 staining of ovarian tissues at post-transplantation day-7 in different groups in antibody blockageexperiment. d Quantitative analysis of primordial follicular apoptosis between different groups in antibody blockage experiment. Data shown aremeans ± SEM of triplicates in a representative experiment. MSC, mesenchymal stem cells; ANG, angiogenin; Ab, antibody, shANG, ANG specific shorthairpin RNA, shCTRL, control short hairpin RNA, * P < 0.05. Scale bar = 50 μmZhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 8 of 12microenvironment for the release of pro-angiogenic pro-teins. Antibody-based cytokine array technology offers anovel approach for gaining insight into changes in pro-tein expression profiles. Our array results reflected thesecretion profiles of MSCs co-transplanted with ovariantissues. Further analyses showed that despite the varietyof angiogenic factors in the paracrine profiles of MSCs,the targeted inhibition of ANG had a substantial effecton the angiogenic ability of MSCs in ovarian transplant-ation. One possible explanation for this finding is that,as previously reported, the presence of ANG could beessential for other angiogenic factors, including VEGFand bFGF, to functionally induce angiogenesis [33].ANG, also known as ribonuclease 5, is a secretedprotein. In the past several years, studies have shown thatANG has angiogenic [39], neurogenic [40], and immune-regulatory [41] functions. Several pro-angiogenic factors,including ANG, have been isolated from the follicularfluid, and a positive association with follicular growth hasalso been suggested [42–45]. The present study suggests acritical role for ANG in establishing vascularization andpromoting follicle survival in ovarian grafts co-transplanted with MSCs. It should be acknowledged thatangiogenesis is a complicated process and that the pro-angiogenic effects of MSCs involve a variety of secretedfactors. In our study, after the blockade of ANG, the pro-angiogenic effect of MSCs was attenuated. This inhibitionwas not complete, as the microvascular density after eithershRNA or antibody blockade was still higher than in theGraft group; however, this difference did not reach statis-tical significance. This phenomenon might be explainedby the fact that other factors independent of ANG mayalso be involved in the pro-angiogenic effect of MSCs.Interestingly, the array result suggests induced expressionof both MMPs and TIMP-2 in MSCs transplanted ovary.MMPs were speculated to be induced by the hypoxic con-dition of ovarian grafts. Since TIMP-2 is an known antag-onist of MMPs and endogenous inhibitor of angiogenesis,the induction of TIMP-2 may suppress excess formationof microvessels and non-functional microvessels. Add-itionally, it is worth noting that other secreted factors thathave been reported to exhibit an anti-angiogenic capacity,such as angiopoietin-2, were significantly increased, aswell, according to our microarray results. This resultmight be attributed to the equilibrium between angiogenicstimulators and inhibitors in the angiogenically balancedmicroenvironment established by the MSCs, whichprecisely regulates the rate of blood vessel formation.Ischemia–reperfusion injury after ovarian tissue trans-plantation has been shown to lead to considerablefollicular loss and to shorten the duration of ovarianfunction [46]. Graft angiogenesis following ovarian tissuetransplantation is critical for graft viability. The re-establishment of vascularization in xenografted ovariantissues is observed within 48 h of grafting, and thisprocess lasts for approximately 1 week [47]. In an ovar-ian autograft study using mice, blood perfusion could beobserved on day 3 after transplantation, and functionalvessels could be detected on day 7 post-transplantation[48, 49]. Similarly, in a human study, microvesselsstarted to form 48 h post-transplantation, whereas func-tional vessels required approximately 7 days to generate;thus, 7 days was proposed as an important landmarkafter transplantation [31, 50]. Therefore, in the presentstudy, xenografted ovarian tissues were retrieved on day7 post-transplantation. We selected the subcutaneousroute for transplantation in this study since the subcuta-neous areas of the abdominal wall have been reported tobe one of the most preferable options for folliculardevelopment in ovarian transplantation [51, 52].In recent years, numerous studies have focused on in-terventions to facilitate angiogenesis in transplantedovarian tissue. Labied et al. [53] suggested that VEGF111could stimulate vascular endothelial cell proliferationand functional angiogenesis, thereby increasing theviability of the ovarian cortex. Experimental data havealso shown that basic fibroblast growth factor and fibrinhydrogel can improve angiogenesis and promote follicledevelopment in mice [31]. However, none of these fac-tors have been successfully utilized in a clinical settingthus far. Further investigation of methods for improvingangiogenesis in ovarian tissue transplantation is re-quired. Our previous study showed that MSCs showpromise for the improvement of ovarian tissue trans-plantation and follicle growth [13, 26]. Although MSCscan be obtained from bone marrow, readily cultured andpreserved for future use, further research is needed todevelop methods for their use. Our findings suggestmechanistic explanations for the angiogenic effect ofMSCs in ovarian transplantation, providing importantinformation for further applications.Previous studies have indicated that the therapeuticapplication of secreted molecules as a possible replace-ment for stem cells might lead to the development ofsafe and effective therapeutic strategies with predictableoutcomes [22]. Therefore, practical interventions tofacilitate angiogenesis, including treatment with exogen-ous angiogenic factors, might be promising in clinicalsettings, as this approach will circumvent the ethical andsafety constraints associated with the direct use ofhuman MSCs. In our preliminary study, the treatment ofxenografted ovarian tissues with exogenous recombinantANG enhanced angiogenesis, even without MSCs (datanot shown). However, due to the scarcity of humanovarian tissue samples available for research, we wereunable to comprehensively investigate the outcomes ofovarian transplantation through treatment with exogen-ous recombinant ANG protein. Additional studies of theZhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 9 of 12use of human ovarian cortical grafts with long-termANG treatment are necessary to elucidate the effectsand functional mechanism of ANG in mediating theangiogenesis of xenografted ovarian tissue. Continuingresearch on this topic will help elucidate the efficacy andsafety of exogenous ANG intervention in ovarian tissuetransplantation in clinical settings.ConclusionsIn conclusion, our findings are the first to suggest thatMSCs mediate angiogenesis and follicle survival in xeno-grafted human ovarian tissue through ANG. Our resultsprovide a theoretical basis and important informationfor the further application of MSCs in ovarian tissuetransplantation and could eventually aid patients inpreserving fertility.Additional filesAdditional file 1: Figure S1. Isolation of MSCs from human bonemarrow tissues by density gradient centrifugation. (JPG 727 kb)Additional file 2: Figure S2. Identification of MSCs by Flow Cytometry.(A) Representative histogram of FACS results showing the MSCs surfacemarker profile. The blue peak indicated the specific antibodies: CD34,CD45, CD19, negative cocktail (including CD44, CD90 and CD105). Thered peak represented the isotope antibodies. (B) Positive expression ofCD34, CD45, CD19 and negative cocktail (including CD44, CD90 andCD105) in five individuals as examined by flow cytometry wasexpressed as mean ± SD. The proportion of cells expressing CD44,CD90, CD105 and negative cocktail, which were analyzed from 5independent samples, were 96.6% ± 2.1%, 96.4% ± 2.2%, 97.2% ± 2.0%and 2.9% ± 0.6%. (JPG 418 kb)Additional file 3: Figure S3. Representative images showing expressionof CD90 and CD105 in ovarian sections after co-transplantation of MSCsin both high and low magnification. MSC, mesenchymal stem cells. Scalebar = 200 μm in A and C, Scale bar = 50 μm in B and D. (JPG 453 kb)Additional file 4: Figure S4. The MSC clones stably knocking downANG were identified and verified on qPCR and ELISA analysis. A) Resultsof quantitative PCR showed a significant knock-down of ANG mRNAexpression in the shANG transfected MSCs (n = 3). B) Secreted ANGprotein level in the shANG and shCTRL transfected MSCs groups weredetermined by ELISA (n = 3). Data are shown as means ± SEM oftriplicates in a representative experiment. MSC, mesenchymal stemcells; ANG, angiogenin; shANG, ANG specific short hairpin RNA,shCTRL: control short hairpin RNA, * P < 0.01. (TIF 7881 kb)Additional file 5: Figure S5. Representative images showing triplestaining of Ki67, DAPI and CD31 in ovarian graft with or withoutco-transplantation of MSCs. Vasculature is shown in red, cell nucleiare shown in blue and Ki67 positive nuclei are shown in green.Scale bar = 50 μm. (JPG 299 kb)Additional file 6: Figure S6. Representative images showing HEstaining of ovarian sections in ovarian graft with or withoutco-transplantation of MSCs in both high and low magnification.MSC, mesenchymal stem cells. Scale bar = 200 μm in A and C,Scale bar = 50 μm in B and D. (JPG 507 kb)AbbreviationsAb: Antibody; ANG: Angiogenin; CTRL: control; MSC: Mesenchymal stem cells;shANG: ANG specific short hairpin RNA; shCTRL: Control short hairpin RNA;shRNA: Short hairpin RNAAcknowledgementsThe authors thank Dr. Jijun Wang and Lei Tian for their support in collectingbone marrow tissue. The authors are grateful to Dr. Liyuan Tao for technicalsupport in statistical analyses.FundingThis work was supported by the National Science Foundation of China(No. 31230047; No. 81471508; No. 81571386;No. 81471427;No.31429004;No. 81300456), National Key Technology R&D Program of China (No.2015BAI13B06, 2014BAI05B04), Guangdong Natural Science Foundation(2014A03031379),Guangdong Medical Scientific Foundation (A2014665)and Research Fund for Distinguished Experts, Guangxi, China.Availability of data and materialsThe datasets used and/or analysed during the current study available fromthe corresponding author on reasonable request.Authors’ contributionsYZ and XX wrote the manuscript. XX, JY and JQ designed the experiments;YZ, JY, TW, TY and CL performed the experiments; XZ、RL and HMCparticipated in the analysis and discussion of the results. All authors read andapproved the final version of the manuscript.Competing interestsThe authors declare that they have no competing interests.Consent for publicationNot applicable.Ethics approvalAll experiments were performed in strict accordance with the EthicsCommittee at the Peking University Third Hospital. Informed consent wasobtained from all subjects. The Institutional Committee of the PekingUniversity approved the experimental protocols (registration number:2009005). All efforts were made to minimize the number of animals usedand their suffering.Author details1Department of Obstetrics and Gynecology, Center for ReproductiveMedicine, Peking University Third Hospital, No.49 North HuaYuan Road,HaiDian District, Beijing 100191, China. 2Beijing Key Laboratory ofReproductive Endocrinology and Assisted Reproduction, Beijing 100191,China. 3Key Laboratory of Assisted Reproduction, Ministry of Education,Beijing 100191, China. 4Department of Obstetrics and Gynecology, Center forReproductive Medicine, Peking University Shenzhen Hospital, No.1120 LotusRoad, FuTian District, Shenzhen, Guangdong 518000, China. 5Department ofObstetrics and Gynecology, Center for Reproductive Medicine, ShengjingHospital of China Medical University, Shenyang 100004, China. 6Departmentof Obstetrics and Gynaecology, Child and Family Research Institute,University of British Columbia, Vancouver V5Z4H4, Canada.Received: 8 November 2016 Accepted: 23 February 2017References1. Qiao J, Li R. Fertility preservation: challenges and opportunities. Lancet.2014;384:1246–7.2. Bastings L, Beerendonk CC, Westphal JR, Massuger LF, Kaal SE, van LeeuwenFE, Braat DD, Peek R. Autotransplantation of cryopreserved ovarian tissue incancer survivors and the risk of reintroducing malignancy: a systematicreview. Hum Reprod Update. 2013;19:483–506.3. Grynberg M, Poulain M, Sebag-Peyrelevade S, le Parco S, Fanchin R,Frydman N. Ovarian tissue and follicle transplantation as an option forfertility preservation. Fertil Steril. 2012;97:1260–8.4. Gracia CR, Chang J, Kondapalli L, Prewitt M, Carlson CA, Mattei P, Jeffers S,Ginsberg JP. Ovarian tissue cryopreservation for fertility preservation incancer patients: successful establishment and feasibility of amultidisciplinary collaboration. J Assist Reprod Genet. 2012;29:495–502.5. Fabbri R, Vicenti R, Magnani V, Pasquinelli G, Macciocca M, Parazza I, ParadisiR, Battaglia C, Venturoli S. Cryopreservation of ovarian tissue in breastcancer patients: 10 years of experience. Future Oncol. 2012;8:1613–9.Zhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 10 of 126. Lambertini M, Del Mastro L, Pescio MC, Andersen CY, Azim Jr HA, PeccatoriFA, Costa M, Revelli A, Salvagno F, Gennari A, et al. Cancer and fertilitypreservation: international recommendations from an expert meeting.BMC Med. 2016;14:1.7. Yang H, Lee HH, Lee HC, Ko DS, Kim SS. Assessment of vascular endothelialgrowth factor expression and apoptosis in the ovarian graft: can exogenousgonadotropin promote angiogenesis after ovarian transplantation? FertilSteril. 2008;90:1550–8.8. Van Eyck AS, Bouzin C, Feron O, Romeu L, Van Langendonckt A, Donnez J,Dolmans MM. Both host and graft vessels contribute to revascularization ofxenografted human ovarian tissue in a murine model. Fertil Steril. 2010;93:1676–85.9. Abtahi NS, Eimani H, Vosough A, Shahverdi A, Fathi R, Hayati N, Nasiri N.Effect of therapeutic ultrasound on folliculogenesis, angiogenesis andapoptosis after heterotopic mouse ovarian transplantation. UltrasoundMed Biol. 2014;40:1535–44.10. Hu H, Zou C. Mesenchymal stem cells in renal ischemia-reperfusion injury:Biological and therapeutic perspectives. Curr Stem Cell Res Ther. 2016;24.[Epub ahead of print]11. Spees JL, Lee RH, Gregory CA. Mechanisms of mesenchymal stem/stromalcell function. Stem Cell Res Ther. 2016;7:125.12. Sherman LS, Shaker M, Mariotti V, Rameshwar P. Mesenchymal stromal/stemcells in drug therapy: New perspective. Cytotherapy. 2017;19(1):19–27.13. Xia X, Yin T, Yan J, Yan L, Jin C, Lu C, Wang T, Zhu X, Zhi X, Wang J, et al.Mesenchymal Stem Cells Enhance Angiogenesis and Follicle Survival inHuman Cryopreserved Ovarian Cortex Transplantation. Cell Transplant. 2015;24:1999–2010.14. Foronjy RF, Majka SM. The potential for resident lung mesenchymal stemcells to promote functional tissue regeneration: understandingmicroenvironmental cues. Cells. 2012;1:874.15. Au P, Tam J, Fukumura D, Jain RK. Bone marrow-derived mesenchymal stemcells facilitate engineering of long-lasting functional vasculature. Blood.2008;111:4551–8.16. Lee RH, Seo MJ, Reger RL, Spees JL, Pulin AA, Olson SD, Prockop DJ.Multipotent stromal cells from human marrow home to and promote repairof pancreatic islets and renal glomeruli in diabetic NOD/scid mice. Proc NatlAcad Sci U S A. 2006;103:17438–43.17. Liu SH, Huang JP, Lee RK, Huang MC, Wu YH, Chen CY, Chen CP.Paracrine factors from human placental multipotent mesenchymalstromal cells protect endothelium from oxidative injury via STAT3and manganese superoxide dismutase activation. Biol Reprod. 2010;82:905–13.18. Sorrell JM, Baber MA, Caplan AI. Influence of adult mesenchymal stem cellson in vitro vascular formation. Tissue Eng Part A. 2009;15:1751–61.19. Duffy GP, Ahsan T, O’Brien T, Barry F, Nerem RM. Bone marrow-derived mesenchymal stem cells promote angiogenic processes ina time- and dose-dependent manner in vitro. Tissue Eng Part A. 2009;15:2459–70.20. Wu Y, Chen L, Scott PG, Tredget EE. Mesenchymal stem cells enhancewound healing through differentiation and angiogenesis. Stem Cells. 2007;25:2648–59.21. Caplan AI, Correa D. The MSC: an injury drugstore. Cell Stem Cell. 2011;9:11–5.22. Kupcova Skalnikova H. Proteomic techniques for characterisation ofmesenchymal stem cell secretome. Biochimie. 2013;95:2196–211.23. Bronckaers A, Hilkens P, Martens W, Gervois P, Ratajczak J, Struys T,Lambrichts I. Mesenchymal stem/stromal cells as a pharmacological andtherapeutic approach to accelerate angiogenesis. Pharmacol Ther. 2014;143:181–96.24. Hsieh JY, Wang HW, Chang SJ, Liao KH, Lee IH, Lin WS, Wu CH, Lin WY,Cheng SM. Mesenchymal stem cells from human umbilical cord expresspreferentially secreted factors related to neuroprotection, neurogenesis,and angiogenesis. PLoS One. 2013;8:e72604.25. Aranha AM, Zhang Z, Neiva KG, Costa CA, Hebling J, Nor JE. Hypoxiaenhances the angiogenic potential of human dental pulp cells. J Endod.2010;36:1633–7.26. Xia X, Wang T, Yin T, Yan L, Yan J, Lu C, Zhao L, Li M, Zhang Y, Jin H, et al.Mesenchymal Stem Cells Facilitate In Vitro Development of HumanPreantral Follicle. Reprod Sci. 2015;22:1367–76.27. Ernst E, Bergholdt S, Jorgensen JS, Andersen CY. The first woman to givebirth to two children following transplantation of frozen/thawed ovariantissue. Hum Reprod. 2010;25:1280–1.28. Yoshimatsu G, Sakata N, Tsuchiya H, Minowa T, Takemura T, Morita H, HataT, Fukase M, Aoki T, Ishida M, et al. The co-transplantation of bone marrowderived mesenchymal stem cells reduced inflammation in intramuscularislet transplantation. PLoS One. 2015;10:e0117561.29. Ahn SY, Chang YS, Sung DK, Sung SI, Yoo HS, Im GH, Choi SJ, Park WS.Optimal Route for Mesenchymal Stem Cells Transplantation after SevereIntraventricular Hemorrhage in Newborn Rats. PLoS One. 2015;10:e0132919.30. Gougeon A, Testart J. Germinal vesicle breakdown in oocytes of humanatretic follicles during the menstrual cycle. J Reprod Fertil. 1986;78:389–401.31. Gao JM, Yan J, Li R, Li M, Yan LY, Wang TR, Zhao HC, Zhao Y, Yu Y, Qiao J.Improvement in the quality of heterotopic allotransplanted mouse ovariantissues with basic fibroblast growth factor and fibrin hydrogel. Hum Reprod.2013;28:2784–93.32. Niu G, Sun X, Cao Q, Courter D, Koong A, Le QT, Gambhir SS, Chen X.Cetuximab-based immunotherapy and radioimmunotherapy of head andneck squamous cell carcinoma. Clin Cancer Res. 2010;16:2095–105.33. Kishimoto K, Liu S, Tsuji T, Olson KA, Hu GF. Endogenous angiogenin inendothelial cells is a general requirement for cell proliferation andangiogenesis. Oncogene. 2005;24:445–56.34. Fagiani E, Christofori G. Angiopoietins in angiogenesis. Cancer Lett. 2013;328:18–26.35. Chen J, Liu Z, Hong MM, Zhang H, Chen C, Xiao M, Wang J, Yao F, Ba M, LiuJ, et al. Proangiogenic compositions of microvesicles derived from humanumbilical cord mesenchymal stem cells. PLoS One. 2014;9:e115316.36. Du W, Li X, Chi Y, Ma F, Li Z, Yang S, Song B, Cui J, Ma T, Li J, et al. VCAM-1+ placenta chorionic villi-derived mesenchymal stem cells display potentpro-angiogenic activity. Stem Cell Res Ther. 2016;7:49.37. Liu XH, Bai CG, Xu ZY, Huang SD, Yuan Y, Gong DJ, Zhang JR. Therapeuticpotential of angiogenin modified mesenchymal stem cells: angiogeninimproves mesenchymal stem cells survival under hypoxia and enhancesvasculogenesis in myocardial infarction. Microvasc Res. 2008;76:23–30.38. Huang SD, Lu FL, Xu XY, Liu XH, Zhao XX, Zhao BZ, Wang L, Gong DJ,Yuan Y, Xu ZY. Transplantation of angiogenin-overexpressing mesenchymalstem cells synergistically augments cardiac function in a porcine model ofchronic ischemia. J Thorac Cardiovasc Surg. 2006;132:1329–38.39. Fett JW, Strydom DJ, Lobb RR, Alderman EM, Bethune JL, Riordan JF,Vallee BL. Isolation and characterization of angiogenin, an angiogenicprotein from human carcinoma cells. Biochemistry. 1985;24:5480–6.40. Subramanian V, Feng Y. A new role for angiogenin in neurite growth andpathfinding: implications for amyotrophic lateral sclerosis. Hum Mol Genet.2007;16:1445–53.41. Hooper LV, Stappenbeck TS, Hong CV, Gordon JI. Angiogenins: a new classof microbicidal proteins involved in innate immunity. Nat Immunol. 2003;4:269–73.42. Malamitsi-Puchner A, Sarandakou A, Baka S, Hasiakos D, Kouskouni E,Creatsas G. In vitro fertilization: angiogenic, proliferative, and apoptoticfactors in the follicular fluid. Ann N Y Acad Sci. 2003;997:124–8.43. Kawano Y, Zeineh Hasan K, Fukuda J, Mine S, Miyakawa I. Production ofvascular endothelial growth factor and angiogenic factor in human follicularfluid. Mol Cell Endocrinol. 2003;202:19–23.44. Stouffer RL, Martinez-Chequer JC, Molskness TA, Xu F, Hazzard TM.Regulation and action of angiogenic factors in the primate ovary.Arch Med Res. 2001;32:567–75.45. Malamitsi-Puchner A, Sarandakou A, Baka SG, Tziotis J, Rizos D, Hassiakos D,Creatsas G. Concentrations of angiogenic factors in follicular fluid andoocyte-cumulus complex culture medium from women undergoing in vitrofertilization: association with oocyte maturity and fertilization. Fertil Steril.2001;76:98–101.46. Israely T, Nevo N, Harmelin A, Neeman M, Tsafriri A. Reducing ischaemicdamage in rodent ovarian xenografts transplanted into granulation tissue.Hum Reprod. 2006;21:1368–79.47. Wu D, Lei Y, Tong Y, Tang F, Qian Y, Zhou Y. Angiogenesis of the frozen-thawed human fetal ovarian tissue at the early stage after xenotransplantationand the positive effect of Salviae miltiorrhizae. Anat Rec (Hoboken). 2010;293:2154–62.48. Kim SS. Assessment of long term endocrine function after transplantationof frozen-thawed human ovarian tissue to the heterotopic site: 10 yearlongitudinal follow-up study. J Assist Reprod Genet. 2012;29:489–93.49. Nugent D, Newton H, Gallivan L, Gosden RG. Protective effect of vitamin Eon ischaemia-reperfusion injury in ovarian grafts. J Reprod Fertil. 1998;114:341–6.Zhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 11 of 1250. Dath C, Dethy A, Van Langendonckt A, Van Eyck AS, Amorim CA, Luyckx V,Donnez J, Dolmans MM. Endothelial cells are essential for ovarian stromaltissue restructuring after xenotransplantation of isolated ovarian stromalcells. Hum Reprod. 2011;26:1431–9.51. Poirot C, Abirached F, Prades M, Coussieu C, Bernaudin F, Piver P. Inductionof puberty by autograft of cryopreserved ovarian tissue. Lancet. 2012;379:588.52. Lee DM, Yeoman RR, Battaglia DE, Stouffer RL, Zelinski-Wooten MB,Fanton JW, Wolf DP. Live birth after ovarian tissue transplant. Nature.2004;428:137–8.53. Labied S, Delforge Y, Munaut C, Blacher S, Colige A, Delcombel R, Henry L,Fransolet M, Jouan C, Perrier d’Hauterive S, et al. Isoform 111 of vascularendothelial growth factor (VEGF111) improves angiogenesis of ovariantissue xenotransplantation. Transplantation. 2013;95:426–33.•  We accept pre-submission inquiries •  Our selector tool helps you to find the most relevant journal•  We provide round the clock customer support •  Convenient online submission•  Thorough peer review•  Inclusion in PubMed and all major indexing services •  Maximum visibility for your researchSubmit your manuscript atwww.biomedcentral.com/submitSubmit your next manuscript to BioMed Central and we will help you at every step:Zhang et al. Reproductive Biology and Endocrinology  (2017) 15:18 Page 12 of 12

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0366276/manifest

Comment

Related Items