UBC Faculty Research and Publications

Preventing mutant huntingtin proteolysis and intermittent fasting promote autophagy in models of Huntington… Ehrnhoefer, Dagmar E; Martin, Dale D O; Schmidt, Mandi E; Qiu, Xiaofan; Ladha, Safia; Caron, Nicholas S; Skotte, Niels H; Nguyen, Yen T N; Vaid, Kuljeet; Southwell, Amber L; Engemann, Sabine; Franciosi, Sonia; Hayden, Michael R Mar 6, 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


52383-40478_2018_Article_518.pdf [ 4.15MB ]
JSON: 52383-1.0364167.json
JSON-LD: 52383-1.0364167-ld.json
RDF/XML (Pretty): 52383-1.0364167-rdf.xml
RDF/JSON: 52383-1.0364167-rdf.json
Turtle: 52383-1.0364167-turtle.txt
N-Triples: 52383-1.0364167-rdf-ntriples.txt
Original Record: 52383-1.0364167-source.json
Full Text

Full Text

RESEARCH Open AccessPreventing mutant huntingtin proteolysisand intermittent fasting promoteautophagy in models of HuntingtondiseaseDagmar E. Ehrnhoefer1,2*, Dale D. O. Martin1, Mandi E. Schmidt1, Xiaofan Qiu1, Safia Ladha1, Nicholas S. Caron1,Niels H. Skotte1, Yen T. N. Nguyen1, Kuljeet Vaid1, Amber L. Southwell1, Sabine Engemann1, Sonia Franciosi1and Michael R. Hayden1*AbstractHuntington disease (HD) is caused by the expression of mutant huntingtin (mHTT) bearing a polyglutamine expansion. InHD, mHTT accumulation is accompanied by a dysfunction in basal autophagy, which manifests as specific defects in cargoloading during selective autophagy. Here we show that the expression of mHTT resistant to proteolysis at the caspasecleavage site D586 (C6R mHTT) increases autophagy, which may be due to its increased binding to the autophagyadapter p62. This is accompanied by faster degradation of C6R mHTT in vitro and a lack of mHTT accumulation the C6Rmouse model with age. These findings may explain the previously observed neuroprotective properties of C6R mHTT. Asthe C6R mutation cannot be easily translated into a therapeutic approach, we show that a scheduled feeding paradigm issufficient to lower mHTT levels in YAC128 mice expressing cleavable mHTT. This is consistent with a previous model,where the presence of cleavable mHTT impairs basal autophagy, while fasting-induced autophagy remains functional. InHD, mHTT clearance and autophagy may become increasingly impaired as a function of age and disease stage, becauseof gradually increased activity of mHTT-processing enzymes. Our findings imply that mHTT clearance could be enhancedby a regulated dietary schedule that promotes autophagy.Keywords: Huntington disease, Autophagy, Proteolysis, Caspase, Mutant huntingtin loweringIntroductionHuntington disease (HD) is an autosomal dominant neuro-degenerative disorder that is caused by an expansion of apolyglutamine tract in the huntingtin (HTT) protein [57].Mutant HTT (mHTT) causes dysfunction in different cel-lular compartments and pathways [13] that are difficult totarget individually. The removal of mHTT itself is thereforean attractive therapeutic strategy and is currently being pur-sued in both clinical and pre-clinical studies [61]. Whilemost of these studies aim to lower HTT RNA, changes inmHTT protein levels through increased degradation havealso been shown to ameliorate HD symptoms [31, 59]. Bothsoluble and aggregated forms of mHTT are thought to becleared preferentially through autophagy [47, 49], and bothmTOR-dependent and -independent autophagic pathwayshave been implicated in its degradation [31, 48]. Interest-ingly, a role for HTT in the regulation of autophagy hasrecently been discovered [2, 34, 35, 43, 50]. Both the HTTN- and C-termini play different but inter-dependent rolesin autophagy [43], which may be promoted by the inter-action of the two halves after proteolysis [18]. However,multiple proteolytic events may disrupt the interaction be-tween the HTT N- and C-termini [18]. The cleavage ofmHTT in HD increases with disease progression and age,and may prevent HTT from functioning as an autophagy-promoting factor [21, 35].Here we use the C6R mouse model, which expresses full-length mHTT with a mutation preventing proteolysis atamino acid 586 by caspases 6 and 8 [23, 62], to investigate* Correspondence: ehrnhoefer@bio.mx; mrh@cmmt.ubc.ca1Centre for Molecular Medicine and Therapeutics (CMMT), CFRI, Departmentof Medical Genetics, University of British Columbia, 950 West 28th Avenue,Vancouver, BC V5Z 4H4, CanadaFull list of author information is available at the end of the article© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 https://doi.org/10.1186/s40478-018-0518-0the connection between mHTT cleavage and autophagy.We demonstrate a general increase in autophagy in cellsand tissues from C6R mice compared to the YAC128mouse model expressing fully cleavable full-length mHTT,and show that this is accompanied by reduced accumula-tion of mHTT protein.HTT promotes autophagosome formation under basal,but not fasting conditions [50], suggesting that dietary in-terventions could circumvent mHTT-specific deficits inautophagy. In agreement with this hypothesis, we demon-strate that both fasting and scheduled feeding induce au-tophagy in the brains of HD mouse models, although onlythe longer scheduled feeding paradigm significantly re-duces the levels of cleavable mHTT protein. These resultsprovide a potential molecular mechanism for the benefi-cial effects of nutrient deprivation on neurodegenerativediseases [15, 31, 38, 54] and demonstrate that autophagypathways that are not impacted by the HD pathology canbe harnessed to lower mHTT protein levels in vivo.ResultsThe expression of C6R mHTT promotes autophagyHTT can act as a scaffold mediating cargo loading inbasal autophagy [50], but as this function is dependenton the HTT C-terminus, it could be lost in HD due toproteolytic events [18, 35, 43]. To determine whetherthe expression of cleavable or C6R mHTT alters autoph-agy, we started by comparing mouse embryonic fibro-blast (MEF) cultures derived from wt, YAC128 or C6Rmice. The autophagy protein LC3-II decorates autopha-gosomes and is thus an indicator of autophagosomeabundance, while the autophagy adapter protein p62provides a link between LC3 and cargo proteins and issubsequently degraded together with the cargo [28].Levels of these proteins are therefore commonly used toassess the autophagic state of cells [28].We found that baseline levels of p62 and LC3-II weresimilar between MEFs of all three genotypes, while thenon-lipidated LC3-I was not detectable (Fig. 1a, higher in-tensity blots shown in Additional file 1: Figure S1A). Usingbafilomycin, an inhibitor of autophagic flux, both p62 andLC3-II levels increased, as expected, since their turnoverwas blocked (Fig. 1a). However, the levels of p62 after bafi-lomycin treatment were lower in YAC128 MEFs comparedto wt, while C6R MEFs showed no such deficit (Fig. 1a). Atthe same time, no reduction in LC3-II turnover was ob-served in bafilomycin-treated YAC128 MEFs by Westernblotting (Fig. 1a). To quantify the formation of autophago-somes in more detail, we next analyzed the formation ofpunctae immunopositive for p62 and LC3 by confocal mi-croscopy. While no such punctae were observed underbasal conditions (Additional file 1: Figure S1B), treatmentwith bafilomycin led to an increase in both p62- and LC3-positive structures (Fig. 1b). Quantitative image analysisrevealed that both the density of p62- and LC3-punctaewas increased in cultures derived from C6R mice, whereasMEFs expressing cleavable YAC128 mHTT showed a trendtowards a decrease compared to wt cultures in these mea-sures (Fig. 1b), and were significantly different from C6Rcells. Interestingly, C6R MEFs show an increased numberof LC3 punctae density but lower LC3 signal intensitywithin those punctae (Fig. 1b), indicating that the availableLC3 is distributed over a larger number of autophago-somes. Accordingly, also the density of punctae with colo-calization of p62 and LC3 was increased in C6R MEFs,confirming their identity as autophagosomes (Fig. 1b).In addition to its role as a cargo-binding protein in basaland starvation-induced autophagy, p62 also associateswith misfolded proteins upon proteasomal inhibition andproteotoxic stress [14, 32]. In this context, we found thattreatment with the proteasomal inhibitor MG132 led to adramatic increase in p62-positive structures, which wasagain exacerbated in MEFs expressing C6R but not cleav-able mHTT (Fig. 1c). Proteasomal inhibition leads to anaccumulation of ubiquitinated proteins, which are thenbound by p62 [29]. This can lead to a feedback loop oftranscriptional upregulation of p62 through Nrf2 [14]. In-deed, we observed a strong upregulation of p62 mRNAexpression after MG132 treatment (Fig. 1d), which wasdampened in MEFs derived from YAC128 mice. Taken to-gether, our data therefore suggest that cells derived fromC6R mice upregulate autophagic pathways more effi-ciently than YAC128 cells, both at baseline and underconditions of proteotoxic stress, a situation most relevantto neurodegenerative diseases such as HD.Interestingly, none of these measures were altered inMEFs derived from YAC18 mice overexpressing wild-typehuman HTT [24], suggesting that the changes in autop-hagosome formation are related to the C6R mutation inthe mHTT protein, and not merely overexpression of anon-pathogenic variant of HTT (Additional file 2:Figure S2A + B).Reduced interaction between mHTT and p62 isnormalized with the C6R mutationTo further investigate the role of mHTT in autophagy, wenext assessed its interaction with p62, and found that thepresence of the expanded polyglutamine tract significantlyreduced the binding efficiency of HTT1-1212 to p62 in co-transfected cells (Fig. 2a). As p62-interaction domainshave only been described for the HTT C-terminus [43, 50]which is absent in our expression construct, we next de-cided to map this novel binding site. Using a series oftruncation mutants, we determined that HTT interactswith p62 between amino acids 800-1004 (Fig. 2b), whichis an area known to harbour an ULK1 binding domainand may therefore be involved in binding the ULK1/p62complex during autophagosome formation [50].Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 2 of 16Furthermore, we found that C6R mHTT1-1212 interactsapproximately twice as strongly with p62 compared tocleavable mHTT (Fig. 2c), which was confirmed with co-immunoprecipitation of HTT with p62 (Additional file 3:Figure S3A). Consistent with our findings for wt HTT(Fig. 2b), the interaction between p62 and a mHTT1-586fragment was also barely detectable, confirming that alsofor mHTT the p62 interaction domain is located C-Fig. 1 The expression of C6R mHTT promotes autophagy. a Primary MEF cultures from YAC128, C6R or wt littermate embryos were treated withbafilomycin or DMSO as a control. Levels of p62 and LC3-II were analyzed by Western blot. p62: 2way-ANOVA genotype p < 0.0001, bafilomycinp < 0.0001, LC3-II: 2way-ANOVA genotype p = 0.0239, bafilomycin p < 0.0001. b Primary MEF cultures from YAC128, C6R or wt littermate embryoswere seeded onto coverslips and treated with bafilomycin. Cells were fixed and stained for p62 and LC3, Hoechst dye was used for nuclearcounterstaining. Samples were imaged on a confocal microscope and the density of punctae, staining intensity as well as the co-localization ofLC3 and p62 staining were analyzed. p62 density: 1way-ANOVA p = 0.0167, LC3 density: 1way-ANOVA p = 0.0116, LC3 staining intensity: 1way-ANOVA p = 0.0003, colocalization: 1way-ANOVA p = 0.0051. c Primary MEF cultures from YAC128, C6R or wt littermate embryos were seeded ontocoverslips and treated with MG132 or DMSO as a control. Cells were fixed and stained for p62, Hoechst dye was used for nuclear counterstaining.Samples were imaged on a confocal microscope and the density of punctae was analyzed. 1way-ANOVA p < 0.0001. d Primary MEF cultures fromYAC128, C6R or wt littermate embryos were seeded onto coverslips and treated with MG132 or DMSO as a control. RNA levels of p62 weredetermined by quantitative RT-PCR (qPCR), normalized to the expression level of Rpl13a. 2way-ANOVA: genotype p = 0.0461, treatment p < 0.0001.Representative blots/images and pooled quantification data with S.E.M. are shown, 3-5 independent cultures were analyzed. Number of replicatesis shown as insets for Western blot and qPCR experiments, for imaging experiments 24-30 cells per condition were analyzed. Statistical signifi-cance was determined 2way-ANOVA with post-hoc Bonferroni correction. *: p < 0.05, **: p < 0.01, ***: p < 0.001Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 3 of 16terminal of the D586 caspase cleavage site (Fig. 2c).However, as the interaction is not completely abolishedfor the mHTT-586aa fragment, HTT may have add-itional p62 binding sites or multiple interaction domainsthat can be separated by proteolysis.Immunofluorescence staining confirmed the preferentiallocalization of C6R mHTT to p62-positive areas (Fig. 3a),which was much reduced for cleavable mHTT or themHTT-586aa fragment. This colocalization may relate tothe role of HTT in autophagosome formation [43, 50], butmay also influence the autophagic clearance of HTT itself.We therefore performed cycloheximide-chase experi-ments in COS cells co-transfected with cleavable or C6RmHTT1-1212 and p62. In the absence of p62 overexpres-sion, cleavable mHTT is degraded more slowly than C6RmHTT (Fig. 3b) within the first 4 h of chase time. How-ever, when p62 is overexpressed, the degradation of cleav-able mHTT is accelerated and rendered indistinguishableFig. 2 The C6R mutation improves the binding of mHTT to the autophagy adapter p62. a COS-7 cells were cotransfected with wt or mHTT aa1-1212 andp62 as indicated and treated with bafilomycin to block autophagic flux. After immunoprecipitation of p62, the ratio of co-immunoprecipitated HTT wasquantified (normalized to input to control for transfection efficiency). b COS-7 cells were cotransfected with wt HTT fragments of different lengths and p62as indicated and treated with bafilomycin to block autophagic flux. After immunoprecipitation of p62, the ratio of co-immunoprecipitated HTT wasquantified (normalized to input to control for transfection efficiency). c COS-7 cells were cotransfected with cleavable mHTT1-1212, C6RmHTT1-1212 or mHTT1-586 and p62 as indicated and treated with bafilomycin to block autophagic flux. After immunoprecipitation ofp62, the ratio of co-immunoprecipitated HTT was quantified (normalized to input to control for transfection efficiency). 1way-ANOVAp < 0.0001. Blots and quantification data with S.E.M. from a representative of 3 independent experiments are shown, number oftechnical replicates is shown as insets. Statistical significance was determined by Student’s t-test (a) or 1way-ANOVA with Tukey’spost-hoc correction (c). *: p < 0.05, **: p < 0.01, ***: p < 0.001Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 4 of 16from C6R mHTT (Fig. 3b), suggesting that a sufficientlylarge supply of p62 can overcome degradation deficits ofcleavable mHTT. Overexpressed p62 was almostcompletely degraded within the 4 h timeframe of the ex-periment (Fig. 3b, quantified in Additional file 3: FigureS3B). We furthermore confirmed that the decrease in full-length HTT and p62 levels are not due to proteolysis,since no accumulation of degradation products was ob-served on the fullWestern blots (shown in Additional file 4:Figure S4C).p62 interacts with ubiquitinated substrates, and prefer-entially those that are linked to ubiquitin through lysine63 (K63), promoting their autophagic degradation [4, 53].HTT can be ubiquitinated by K63 or K48 linkages, andboth types of ubiquitinated mHTT accumulate in cell andmouse models of HD, which has been attributed to im-paired clearance by both autophagy and the proteasome[6, 7]. Co-transfection of cleavable or C6R mHTT1-122with either wt ubiquitin, or ubiquitin mutants that canonly bind their target proteins through lysine 48 (K48Fig. 3 C6R mHTT preferentially colocalizes with p62 and is degraded faster than cleavable mHTT. a COS-7 cells were seeded onto coverslips,cotransfected with cleavable mHTT1-1212, C6R mHTT1-1212 or mHTT1-586 and p62 as indicated and treated with bafilomycin to block autophagicflux. Cells were fixed and stained for p62 and HTT, Hoechst dye was used for nuclear counterstaining. Samples were imaged on a confocalmicroscope and the colocalization of HTT and p62 signals was analyzed. 1way-ANOVA p < 0.0001. b COS-7 cells were cotransfected with cleavablemHTT1-1212, C6R mHTT1-1212 and p62 as indicated and treated with MG132 to enforce autophagic degradation. Cycloheximide was added for theindicated periods of time and samples were analyzed by Western blot. Data are graphed in three different versions to better visualize differencesbetween groups: (i) all four conditions, (ii) cleavable mHTT vs. C6R mHTT, 2way-ANOVA mHTT construct p = 0.0146, time p < 0.0001, (iii) cleavablemHTT without/with p62, 2way-ANOVA p62 p = 0.0436, time p < 0.0001. Representative blots/images and pooled quantification data with S.E.M.are shown, for imaging experiments 14-21 cells per condition were analyzed, for Western blotting 3 independent experiments were performedwith 3 technical replicates each. Statistical significance was determined by 1way-ANOVA with Tukey’s post-hoc correction for A and 2way-ANOVAwith Bonferroni’s post-hoc correction for B. *: p < 0.05, **: p < 0.01, ***: p < 0.001Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 5 of 16ubiquitin) or lysine 63 (K63 ubiquitin), revealed that C6RmHTT co-immunoprecipitated with significantly moreubiquitin in general (wt ubiquitin, Additional file 3: FigureS3C). Interestingly, the interaction with K48 ubiquitin wasequal between cleavable and C6R mHTT, but K63ubiquitin preferentially co-immunoprecipitated withC6R mHTT, indicating that the K63 linkage is preferredin the presence of the C6R mutation (Additional file 3:Figure S3C). Increased K63-ubiquitination of C6RmHTT would thus be expected to mediate increasedp62 binding and may therefore account for its preferen-tial autophagic clearance.Fasting-induced autophagy is functional in the presenceof mHTTAs a next step, we decided to investigate autophagy path-ways in vivo. Since the liver heavily relies on autophagy tomaintain its basal function [33], and HD-specific dysfunc-tion in autophagic and metabolic pathways has beenfound in livers from HD mouse models and human pa-tients [9, 36, 58, 59], we decided to focus on both brainand liver tissues from YAC128 and C6R mice.We first compared baseline levels of autophagy with afood deprivation paradigm, which is expected to activateautophagy [12]. A fasting period of 24 h was sufficient toobserve significant changes in hepatic levels of key au-tophagy proteins in wt, YAC128 and C6R mice: fasting de-creased p62 levels, in agreement with its increasedautophagic turnover following food deprivation (Fig. 4a)[28]. Furthermore, LC3-II levels were increased by fasting(Fig. 4b), indicating enhanced autophagosome formation.Interestingly, LC3-I levels were strikingly elevated in C6Rmice under fed conditions (Fig. 4b). Fasting eliminatedthis increase (Fig. 4b), suggesting that fasting leads to arapid conversion of available LC3-I pools into LC3-II. Thiswas further analyzed by qRT-PCR, which showed similarexpression levels of LC3 for mice of all three genotypes atbaseline (Additional file 5: Figure S5A), demonstratingthat the differences observed by Western blotting arepost-transcriptional.To determine whether alterations in autophagy had animpact on the degradation of mHTT, we next assessedHTT protein levels in the liver of YAC128 and C6R mice.We found a strong age-dependent increase in wt andmHTT protein that reached statistical significance at12 months in YAC128 animals (Fig. 4c). On the other hand,C6R mice showed no age-dependent alterations in wt ormHTT levels, suggesting that this change is specific to theexpression of cleavable mHTT (Fig. 4c). To confirm thatthe changes are post-transcriptional, we performed qRT-PCR analyses on liver tissues from 12 month old mice.Interestingly, mHTT mRNA levels are higher in C6R com-pared to YAC128 liver tissues (Additional file 5: FigureS5B), confirming that the lack of mHTT accumulationobserved by Western blot are not due to decreased expres-sion, but rather due to post-transcriptional effects such asincreased protein degradation.Fasting-induced autophagy in the liver was paralleledby a significant reduction of mHTT protein in YAC128mice (Fig. 4d), while the levels of wt HTT remained un-changed (Additional file 5: Figure S5C). mRNA levels ofthe mHTT transgene were also not affected by fasting,confirming that this intervention likely reduced mHTTprotein through autophagic degradation (Additional file5: Figure S5D). Fasting also had an impact on hepaticmHTT protein levels in C6R mice, although the reduc-tion was more subtle in this genotype (Additional file 5:Figure S5E). This is not surprising, given the already lowlevels of mHTT protein in C6R compared to YAC128mice. Nevertheless, the trend towards a further decreasesuggests that fasting-induced autophagy can still lowermHTT even in C6R mice.Taken together, these findings demonstrate that basal au-tophagy is altered in the liver of C6R mice and may beresponsible for the lack of age-dependent mHTT accumula-tion in this mouse model. Fasting-induced autophagy mech-anisms on the other hand are intact and can be activated inthe liver of both YAC128 and C6R mice. Furthermore, ourdata suggest that the age-dependent accumulation of mHTTcan be reversed by activating such protein degradation path-ways simply through dietary changes.Prolonged regulation of food intake induces mHTTclearance in the brainRecent studies have demonstrated that acute fasting alsoinduces autophagy in the CNS [1, 10]. We therefore ex-amined LC3 and p62 levels in cortical tissues fromfasted as well as mice fed ad libitum, and found that a24 h fasting period increased LC3-I, LC3-II and p62 pro-tein levels in the cortex of both wt and YAC128 animals(Additional file 6: Figure S6A). While both the increasedcortical p62 and LC3-I levels differ from our findings inthe liver (Fig. 4a and b), this may suggest different tim-ing of autophagy induction in the two organs. These dif-ferences not only manifest on the protein level, but arealso observed transcriptionally: While YAC128 miceshow a trend towards reduced p62 expression in boththe liver and the cortex at baseline (Additional file 6:Figure S6B + C), fasting induces a reduction in p62mRNA in the liver but not the cortex of wt animals(Additional file 6: Figure S6B + C). Furthermore, unlikehepatic mHTT (Fig. 4d), cortical mHTT levels remainedunaffected by a 24 h fasting period (Additional file 6:Figure S6D). We therefore hypothesized that the lack ofmHTT degradation after acute fasting may be due to thedelayed induction of autophagy in the brain comparedto the liver, and designed a fasting schedule that couldbe maintained for a longer period of time.Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 6 of 16In our paradigm, mice were fasted for 18 h andallowed full access to food for 6 h periods. We hypothe-sized that this schedule would induce autophagy in vivodaily, without necessarily reducing caloric intake. Long-term caloric restriction has beneficial effects on agingand neurodegenerative phenotypes [11, 42], and previousstudies have implicated both mTOR inhibition andSIRT1 activation in these phenomena [11, 20, 25, 26].Consistent with these reports, we observed that ourscheduled feeding diet decreased phosphorylated mTOR(Fig. 5a), an indication of mTOR inhibition similar tothe effect of nutrient deprivation [64]. In addition, RNAlevels of SIRT1 were increased in mice subjected toscheduled feeding (Fig. 5b), which can further contributeto the downregulation of mTOR signaling [20] and thusinduce autophagy.While the steady-state cortical p62 protein levels werenot altered by scheduled feeding (Additional file 7: FigureS7A), we observed a significant induction of p62 expressionat the RNA level (Fig. 5c). This is consistent with theFig. 4 mHTT levels increase in aging YAC128 liver and can be reduced by fasting-induced autophagy. a, b+ d 12 month old YAC128 and C6R mice, aswell as their wt littermates, were subjected to a 24 h fasting period, sacrificed immediately and liver samples were compared to littermates with ad libitumaccess to food. p62 (a) and LC3 (b) protein levels were analyzed by Western blot. p62: 2way-ANOVA genotype p = 0.0103, fasting p< 0.0001, LC3-I:2way-ANOVA genotype p = 0.0043, fasting p = 0.3161, LC3-II: 2way-ANOVA genotype p = 0.2012, fasting p = 0.0151. c Liver tissues from YAC128 and C6Rmice at different ages were analyzed for HTT expression using the MAB2166 antibody. mHTT 2way-ANOVA genotype p = 0.0047, age p = 0.0342; wt HTT2way-ANOVA genotype p = 0.3168, age p = 0.0232. d HTT protein levels in YAC128 liver were analysed by Western blot using the MAB2166 antibody.Representative blots and pooled quantification data with S.E.M. are shown, number of replicates is shown as insets. Statistical significance was determinedby 2way-ANOVA with Bonferroni’s post-hoc correction for a - c, or two-tailed Student’s t-test for d. *: p< 0.05, **: p< 0.01, ***: p< 0.001Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 7 of 16previously demonstrated replenishing of p62 protein levelsthrough increased expression during long-term fasting [5,51]. Although LC3-I levels were not altered by scheduledfeeding (Additional file 7: Figure S7B), C6R mice respondedto the paradigm with significantly lower levels of LC3-IIcompared to wt or YAC128 animals (Fig. 6a). Furthermore,confocal microscopy demonstrated a strong reduction inLC3 punctae in C6R mice at baseline, with levels that areonly reached after scheduled feeding in wt and YAC128mice (Fig. 6b). Taken together, these data point towardshigher autophagic flux in the CNS of C6R mice, but alsosuggest that it is possible to reach similar autophagy levelsin YAC128 animals through scheduled feeding.Next, EM analysis was performed to quantify theformation of autophagosomes and autophagolyso-somes in the cortex of scheduled-fed mice. In this ex-periment we observed predominantly autolysosomeswith electron-dense content with some remainingultrastructure [28], which are the most abundant formof autophagic vesicles (AVs) in neurons [8]. We foundthat the overall number of AVs per cell significantlyincreased after scheduled feeding, confirming thatautophagosomes are successfully transported to theneuronal soma and cargo degradation increased (Fig.6c). Consistent with this data we found that the sched-uled feeding paradigm also significantly reduced thelevels of cortical mHTT protein in YAC128 mice (Fig.6d), similar to the effect of short-term fasting onmHTT the liver (Fig. 4d). No changes were observedfor wt HTT protein (Additional file 7: Figure S7C) ormHTT mRNA (Additional file 7: Figure S7D). Takentogether our data therefore suggests that scheduledfeeding increases mHTT clearance in the brainthrough the upregulation of autophagy, and that thismechanism is functional in a mouse model expressingcleavable mHTT.Fig. 5 Scheduled feeding alters nutrient-sensing pathways in the brain. a - c YAC128 mice and their wt littermates were subjected to 1 week ofscheduled feeding and compared to littermates with ad libitum access to food. a Levels of total and phosphorylated mTOR were analyzed byWestern blot. 2way-ANOVA genotype p = 0.6796, feeding p = 0.0082. b + c mRNA levels of SIRT1 (b) and p62 (c) were analyzed by qRT-PCR. SIRT1:2way-ANOVA genotype p = 0.7651, feeding p < 0.0001, p62: 2way-ANOVA genotype p = 0.4121, feeding p < 0.0001. Representative blots andpooled quantification data with S.E.M. are shown. Statistical significance was determined by 2way-ANOVA with Bonferroni’s post-hoc correction,number of replicates is shown as insets. *: p < 0.05, **: p < 0.01, ***: p < 0.001Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 8 of 16DiscussionThe expansion of the CAG tract in HTT is the singlecause for HD. Recent efforts in therapeutic developmenthave therefore focused on different strategies to lowerthe levels of mHTT [61]. While a major focus of theseefforts lies on the reduction of mHTT expression, thereis strong evidence for dysfunction of mHTT clearancepathways in HD [30]. In particular, impaired autophagyhas been linked to the well-documented accumulation ofmHTT in the CNS [30, 39].Here, we show that the expression of mHTT resistantto proteolytic cleavage at D586 (C6R mHTT) leads toincreased basal and proteotoxicity-induced autophagy inprimary MEFs. Together with the finding that autophagyis normal in MEFs derived from mice overexpressing wtHTT (YAC18), our data therefore suggest that the C6Rmutation in particular causes the observed alterations inautophagy pathways. This may be due to an alteredstructure of C6R compared to cleavable mHTT, since wealso find that C6R mHTT preferentially interacts withp62 compared to the full-length form of cleavablemHTT. As this interaction site localizes to an area alsobound by ULK1 [50], the aa800-1004 region of HTTmay form an ULK1/p62/HTT complex that can initiateautophagosome formation [34, 35, 50]. At the sametime, the increased interaction may promote the autoph-agic degradation of C6R mHTT itself. This mechanismmay explain why C6R mice fail to accumulate mHTT inFig. 6 Scheduled feeding induces autophagy and lowers mHTT protein in the brain. a - d YAC128 and C6R mice as well as their wt littermateswere subjected to 1 week of scheduled feeding and cortical tissue was compared to littermates with ad libitum access to food. a LC3-II levels incortical lysates were determined by Western blotting. 2way-ANOVA genotype p = 0.0034, feeding p = 0.6776. b Cortical brain sections werestained for LC3 and confocal images were analyzed. 2way-ANOVA genotype p = 0.0815, feeding p = 0.0006. c Brain sections of the motor cortexwere analyzed by EM, and autophagic vesicles (AV) surrounding the nuclei were counted in a blinded fashion. 2way-ANOVA genotype p = 0.0636,feeding p = 0.0006. d mHTT protein levels in cortical tissues were analyzed by Western blotting using antibody MAB2166. Representative images/blots and pooled quantification data with S.E.M. are shown, number of replicates is shown as insets. Statistical significance in a - c wasdetermined by 2way-ANOVA with Bonferroni’s post-hoc correction, in D by two-tailed Student’s t-test. *: p < 0.05, **: p < 0.01, ***: p < 0.001Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 9 of 16the liver with age, despite sufficient expression levelsand in contrast to YAC128 animals. C6R mice are thusbetter protected from the accumulation of toxic, aggre-gated forms of mHTT compared to YAC128 animals,which may shed light on the remarkable lack of HD phe-notypes in the former mouse model [21, 23, 40, 45].We only observe very subtle and specific deficits in au-tophagy in MEFs derived from YAC128 mice: Westernblotting revealed a decrease in p62 turnover, with no def-icit in LC3, while defects in autophagosome formationmonitored by immunofluorescence were also less pro-nounced. However, the cargo recognition failure and spe-cific defects in selective, but not bulk autophagy reportedpreviously for HD model systems [36, 50] may be relatedto the decreased ability of mHTT to bind p62. This defectmay not only prevent the degradation of mHTT, butthrough impaired formation of p62/ULK1/HTT com-plexes could impact selective autophagy in general. Recentstudies have shown that the C-terminus of the HTT pro-tein can act as a scaffold similar to Atg11, and promoteautophagosome formation [43]. This function is regulatedby an interaction between the HTT N- and C-termini[43], which is disrupted in the case of multiple proteolyticevents within the HTT protein [18]. We therefore proposea model in which the negative effects of mHTT N-terminal fragments on autophagosome formation, trans-port and fusion are repaired in C6R mice since mHTTcleavage at D586 is prevented (Fig. 7). This furthermoreboosts the normal function of the intact HTT C-terminusin promoting autophagosome formation and more effi-cient degradation of mHTT itself (Fig. 7). Supporting thishypothesis, increased autophagy and reduced mHTTlevels have been demonstrated previously in HD mousemodels crossed to a C6−/− line, an intervention that re-duces (but does not completely abolish) mHTT cleavageat D586 [19, 62].Although the C6R mutation is beneficial, it is not directlytranslatable to human HD patients. We therefore set out totest a therapeutic intervention that has the potential to alterautophagy pathways in vivo and to monitor its effects inthe presence of cleavable mHTT. Caloric restriction canslow aging in a large variety of animal models [37] and up-regulate key transcription factors such as SIRT1 that arebeneficial in different neurodegenerative conditions includ-ing HD [11, 25, 26]. However, such an intervention is notadvisable for human patients, since HD already leads to asignificant reduction in body weight [3] which may be exac-erbated by further caloric reduction. We show here thatscheduled feeding is sufficient to upregulate SIRT1 expres-sion and activate the mTOR pathway in a mouse model ofHD. Importantly, intermittent fasting can still triggerstarvation-induced autophagy and mHTT clearance in theYAC128 mouse model of HD, even though the overall cal-orie intake was not restricted. Furthermore, subtle deficitsin autophagic pathways caused by the expression of cleav-able mHTT did not prevent autophagy induction, suggest-ing that any such defects can be overcome by strongautophagy-inducing stimuli.Circadian rhythms are disrupted in HD patients as wellas in animal models of the disease, and this phenotype canbe ameliorated by forcing a circadian pattern of food intakein mice, even at late stages of the disease [38]. SinceFig. 7 Schematic representation of the effects of cleavable or C6R mHTT on autophagy. mHTT is subject to proteolysis by different proteases,with a number of cleavage sites clustering in the PEST2 domain [17]. Cleavage at D552 and D586 liberate a small fragment that is myristoylatedat G553 [34] and induces autophagosome formation. However, both the N-terminal and C-terminal fragments resulting from mHTT doublecleavage are toxic and interfere with autophagic cargo loading and autophagosome transport and fusion [18, 36, 43, 63]. In the C6R mice,cleavage at D586 is prevented, and we observed enhanced autophagy as well as improved degradation of C6R mHTT. In both YAC128 and C6Rmice, autophagic flux and mHTT degradation can be enhanced in peripheral tissues by fasting and in the CNS by scheduled feedingEhrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 10 of 16autophagy follows a circadian pattern in the brain [1], it ispossible that the disruption of circadian rhythms in neuro-degenerative disease may cause autophagic dysfunction andcontribute to the accumulation of autophagy substratessuch as mHTT. Furthermore, treating disruptions in circa-dian rhythm through lifestyle changes may amelioratesymptoms such as depression, anxiety and cognitive dys-function in human HD patients [41], and our data suggestthat such an intervention has the potential to lower mHTTprotein levels through increased autophagy.ConclusionsIn this study, we provide evidence that not only pro-longed fasting but also scheduled feeding without for-cibly reducing calorie intake alters nutrient-sensingpathways and activates autophagy in mouse brain. Thisintervention furthermore reduces the amounts of mHTTprotein, and may thus contribute to its clearance. AsmHTT levels are closely correlated with pathology, thesefindings therefore correlate environmental influenceswith disease in a mouse model of HD.In addition, we show that dysregulation of autophagycaused by the expression of mHTT is not observedwhen the protein is rendered resistant to cleavage atD586 (C6R mHTT). Age-dependent accumulation ofmHTT is curtailed in C6R mice, and increased autoph-agy observed in cells derived from this mouse modelmay be responsible for the puzzling lack of HD pheno-types in these animals [21, 23, 40, 45].Materials and methodsAnimal models and statisticsAll mouse experiments were carried out in accordancewith protocols (Animal protocol A07-0106) approved bythe UBC Committee on Animal Care and the CanadianCouncil on Animal Care. Mice are derived from in-housebreeding pairs, maintained under a 12 h light:12 h darkcycle in a clean facility and given free access to food andwater except otherwise indicated (for fasting and sched-uled feeding protocols). YAC128 (line HD53 [56]) andC6R (line W13 [23]) mice are on a FVB/N background,mixed sexes were analyzed. Cortex and liver tissue wasdissected and snap-frozen on dry ice for protein analyses.Sample sizes were chosen based on extensive experiencewith biochemical differences between YAC128 mice andtheir WT littermates for experiments using mouse tissues[21–23, 44, 46, 58, 62]. Cell culture experiments were re-peated independently at least three times to ensure repro-ducibility. Samples were only excluded if technical issueswere apparent (i.e. bubble on a Western blot) or if deter-mined statistical outliers using Grubb’s outlier test (α =0.05, no more than one sample per group was excluded).For randomization, mice were assigned numbers not re-lated to genotype. Scientists performing experiments wereblinded for genotypes, unless it was necessary to ensurethe appropriate order of samples on a gel. Data analyseswas performed by a separate person in possession of thegenotype information. For image analysis of electron mi-croscopy and confocal microscopy data, unblinding wasperformed after all quantitation was complete.Statistical significance was assessed using Student’s t-test for comparison of two groups, one-way ANOVA withpost-hoc Tukey’s correction for the comparison of onevariable between more than two groups, and two-wayANOVA with post-hoc Bonferroni correction for thecomparison of two variables between groups. Variancesbetween groups were similar. All analyses were performedusing the GraphPad Prism 5.01 software package.Generation of primary cell culturesPrimary MEF and neuronal cultures from YAC128 (line53, [56]), YAC18 (line 212 [24]) and C6R (line W13,[23]) embryos, as well as their wt littermates were set upas described previously [16, 55]. In brief, embryos werecollected on day 15.5–16.5 of gestation for neuronal cul-tures and at day 12.5 for MEF cultures. Tissues were ex-tracted and transferred to Hibernate E (Invitrogen) forup to 24 h, during which time samples from theremaining embryonic tissues were genotyped [55]. ForMEFs, the body without head, limbs, liver, lung andheart was minced, digested with 0.25% trypsin-EDTAand taken up in MEF medium (Dulbeccos’s modifiedEagle medium with high glucose, 10% fetal calf serum,2 mM L-Glutamine, 100 μM non-essential amino acids,1 mM sodium pyruvate, 1 μ M β-mercaptoethanol).Cells were triturated with a pipette tip, digested withDNAse I and a single cell suspension without clumpswas seeded. When indicated, cells were treated with20 nM bafilomycin A1 (Cayman Chemicals) or DMSOfor 16 h. Cells were harvested by scraping and lysed forWestern blot analysis as described [16] or fixed forimmunofluorescence.For neuronal cultures, cortices were micro-dissected inice-cold Hank’s balanced salt solution (HBSS+; Gibco),then diced and pooled for each genotype. Cells were disso-ciated with 0.05% trypsin-EDTA (Gibco), followed byneutralization with 10% fetal calf serum in neuro basalmedium (NBM+) and DNAse I treatment (153 U/mL).Tissue was triturated with a pipette five to six times. Cellswere plated on poly-D-lysine coated 6-well plates with2 ml of Neurobasal media (Gibco #21103-049), B27(Gibco #17504-044), 100 U/mLpenicillin-streptomycin(PS) (Gibco), 0.5 mM L-glutamine and maintained at 37°C, 5% CO2 with humidity. Cells were fed with 200 mLfresh medium every fifth day. On day 9-11 in culture, cellswere treated with 10 nM bafilomycin A1 (Cayman Chemi-cals) or DMSO for 2 h. Cells were harvested by scrapingand lysed for Western blot analysis as described [16].Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 11 of 16Western blottingWestern blots were performed on samples lysed in SDPlysis buffer (50 mM Tris pH 8, 150 mM NaCl, 1% Igepalwith ‘Complete’ protease inhibitor cocktail (Roche)). Proteinconcentration was measured using the DC protein assay kit(Bio Rad, USA) and equal amounts were separated on 7%Bis-Tris gels for the detection of HTT, or 4-12% gradientgels (Invitrogen, USA) for the detection of LC3 and p62.Protein was transferred to PVDF Immobilon-FL mem-branes by electroblotting and membranes were developedwith primary antibodies in 5% bovine serum albumin/phos-phate buffered saline. The following antibodies were usedfor immunoblotting: anti-HTT BKP1 (1:100) generated in-house [27], anti-HTT 2166 (1:1000) from Millipore(MAB2166), anti-polyglutamine expansion antibody (1C2,MAB1574) from Millipore (1:2000), anti-p62 (1:1000) fromENZO (BML-PW9860), anti-LC3b (1:1000) from Cell Sig-naling Technologies (2775), anti-mTOR (1:1000) from CellSignaling Technologies (2983), anti-phospho-mTOR(1:1000) from Cell Signaling Technologies (5536), anti-HA(1:1000) from COVANCE (MMS-101R), anti-Actin(1:10,000) from Sigma (A2103), anti-calnexin (1:5000) fromSigma (C4731), anti-spectrin (1:4000) from ENZO (bm-FG6090). Fluorescently labelled secondary antibodies conju-gated to either 700 or 800 IR dye (1:5000; Rockland, USA)and the LiCor Odyssey Infrared Imaging system were usedfor detection. The following antibodies were used for im-munocytochemistry experiments: anti-p62 from R&D Sys-tems (MAB8028; 1:200), anti-LC3β from Cell Signaling(2775S; 1:200), anti-polyglutamine expansion antibody(1C2, MAB1574;1:1000) from Millipore, Alexa Fluor 488goat anti-mouse IgG from Invitrogen (A11001; 1:500), andAlexa Fluor 568 goat anti-rabbit IgG from Invitrogen(A11011; 1:500).ImmunocytochemistryCells (MEFs or COS-7) were cultured on coverslips in 24-well plates and treated with bafilomycin (16 h; 20 nM),MG132 (4 h; 10 μM), or DMSO followed by fixation with4% paraformaldehyde in PBS for 15 min at roomtemperature (RT). Cells were treated with ice-cold metha-nol for 5 min at − 20 °C, washed 3× in PBS, permeabilizedin 0.03% Triton-X/PBS for 5 min at RT, washed 3× in PBS,and incubated in blocking buffer (0.2% gelatin/PBS) at RTfor 30 min. Coverslips were transferred to primary antibodysolution made up in blocking buffer and incubated over-night at 4 °C, followed by 3xPBS washes and incubationwith secondary antibody in blocking buffer at RT for 1.5 h.Coverslips were washed and mounted on slides with Pro-Long Gold antifade reagent with DAPI (Molecular Probes).Confocal imaging and image analysisSingle z-plane images were acquired on a Leica TCS SP8confocal laser scanning microscope at 63X objectivemagnification. Images were imported into Image J, back-ground subtracted using a rolling ball radius of 15 pixels,and de-speckled. 1-3 cells per image were analysed byselecting 3 random regions of interest (ROIs) within thecytosol of each cell, manually thresholding punctae fromeach channel, and evaluating punctae size, density, andoverlap using the Image J Colocalization plugin and theAnalyse Particles function. All data were normalized to themean of the appropriate wild-type littermate control values.For COS cell analysis, punctae analysis was not pos-sible due to the diffuse staining pattern of transfectedHTT. Instead, 1-3 cells per image were outlined to gen-erate ROIs, and the Coloc2 plugin was utilized to calcu-late a Pearson correlation coefficient as measures ofcolocalization between channels.COS-7 cell transfection and immunoprecipitationCOS-7 cells were maintained in DMEM with 10% FBS, 1%L-glutamine, 100 U/mL penicillin and 0.1 mg/mL strepto-mycin at 37 °C and 5% CO2 in a humidified incubator.HTT expression constructs aa1-1212 and 1-586 were de-scribed previously [60], fragments aa1-800 and aa1-1004were generated from HTT1-1212 15Q using the Q5 site-directed mutagenesis kit (NEB) with the following primers:HTT 800 For: 5′ -AACCCTCACATGAAATACATTTTCTTTG - 3’HTT 800 Rev.: 5′ - CTAATGGTGCCCATCCAATC - 3’HTT 1004 For: 5′ - AAATAACCTTTGAAGAGTTATTGCAG - 3’HTT 1004 Rev.: 5′ - TCCATAGTGACGTCTGTTATG - 3’Correct insertion of the stop codons was verified bysequencing.Cells were transiently cotransfected with the aa1-121215Q, aa1-586 15Q, aa1-800 15Q, aa1-1004 15Q, aa1-1212128Q (cleavable), aa1-1212 138Q-C6R or aa1-586 Q128HTT constructs (11) together with RFP-p62 (obtainedfrom Addgene (12)) or HA-ubiquitin wt, K63 or K48 (ob-tained from Addgene (13)). The Xtreme gene 9 transfec-tion reagent (Roche Applied Science, Quebec, Canada)was used according to the manufacturer’s protocol.The day after transfection, cells were treated with100 nM bafilomycin for 4 h to prevent HTT-p62 andHTT-ubiquitin complexes from degradation. Cell lysateswere prepared in SDP buffer and immunoprecipitatedover night at 4 °C using anti-p62 (MBL PM045) or anti-HTT 2166 antibodies (Millipore MAB2166). Immuno-precipitates and cell lysates were subjected to SDS-PAGE and Western blot as described above.Cycloheximide chase assayCOS-7 cells were transfected as above. 6 h after trans-fection, 10 μM MG132 were added to preventEhrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 12 of 16proteasomal degradation and enforce autophagic clear-ance of mHTT. 16 h later, 0 h timepoints were harvestedand 100 μg/ml cycloheximide were added for the indi-cated timepoints. Samples were lysed and analyzed byWestern blotting as described above.qRT-PCRRNA was extracted using the PureLink mini RNA ex-traction kit (Life Technologies). RNA was treated withDNase I (Invitrogen) and 500 ng of RNA were reversetranscribed using SuperScript III (Invitrogen) and oligo-dT primers according to manufacturer’s instructions togenerate cDNA for qRT-PCR. The PCR was run withSYBR Green Power master mix (Applied Biosystems) onthe ABI Prism 7500 Sequence Detection System.Each sample was run in triplicate. Relative gene ex-pression was determined by using the ΔΔCT method,normalizing to Rpl13a mRNA levels in cortical tissuesand MEF cells and to Pgk1 mRNA levels in liver. Thefollowing primers were used:Human Htt forward: 5′-GAAAGTCAGTCCGGGTAGAAC -3’Human Htt reverse: 5′-CAGATACCCGCTCCATAGCAA -3′mouse Rpl13a forward: 5’-GGAGGAGAAACGGAAGGAAAAG-3′mouse Rpl13a reverse: 5′-CCGTAACCTCAAGATCTGCTTCTT-3′mouse Pgk1 forward: 5′ -ACCTGCTGGCTGGATGG - 3′mouse Pgk1 reverse: 5′ -CACAGCCTCGGCATATTTCT - 3′mouse Sirt1 forward: 5′-CAGTGTCATGGTTCCTTTGC -3′mouse Sirt1 reverse: 5′–CACCGAGGAACTACCTGAT -3′mouse p62 forward: 5′-CTCAGCCCTCTAGGCATTG – 3′mouse p62 reverse: 5′-TCCTTCCTGTGAGGGGTCT – 3′mouse LC3b1 forward: 5′ -CTCACTCGTGGTCTGAGGACTTC - 3′mouse LC3b1 reverse: 5′ -GGTGGCTATGCTGGCTTCA - 3′Transmission electron microscopy (TEM)Mice were anesthetized with avertin and injected with15 μL of heparin intracardially. Mice were perfused with4% paraformaldehyde and 0.125% glutaraldehyde for20 min at a rate of 6 mL/min. Brains were dissected and leftovernight in fixative at room temperature. 400 μm sectionswere cut on a vibratome and 1 mm2 tissue blocks of motorcortex were dissected. Postfixing, embedding, sectioningand staining were performed at the University of BritishColumbia BioImaging facility. Briefly, samples were rinsedin 0.1 M sodium cacodylate buffer and secondary fixed in1% osmium tetroxide with 1.5% potassium ferricyanide in0.1 M sodium cacodylate for 2 h. Tissue was washed twotimes in distilled water and dehydrated in a series of etha-nol dilutions, followed by graded resin infiltration and em-bedding. Ultrathin sections were prepared on a LeicaUltracut 7 using 45 degree diamond histoknife. Thin sec-tions were counterstained with Sato’s lead. Images weretaken using a Hitachi H7600 Transmission Electron Micro-scope and analyzed using Image J. 10-15 cells per mousewere identified and pictures taken systematically aroundthe nucleus, covering all visible cytoplasm. 4-5 mice pergenotype from 2 to 4 separate litters of YAC and wt micewere analyzed in a randomized and blinded fashion. AVwere identified as either autophagosomes with a doublemembrane and visible cytoplasmic content such as mito-chondria, or autolysosomes (vesicles with electron-densecontent and some remaining ultrastructure) [28] andcounted manually. The number of AV/cell was calculatedand normalized to wt littermates. Imaging and countingwere performed by separate blinded investigators.Immunohistochemistry and image analysisSamples from the same mouse brains as used in electronmicroscopy were mounted on slides and stained with anti-LC3b (1:1000) from Cell Signaling Technologies (2775).Slides were imaged on a Leica SP5 laser-scanning confocalmicroscope with a 63X immersion plan-apochromat ob-jective. Fixed and stained mouse cortices were imaged at100 Hz with a 1024 × 1024 pixel scan format, a zoom fac-tor of 1 and a pinhole size of 75 μm. LC3 staining was im-aged using the 543 laser at 15% laser power (50% intensityand 100% gain) and DAPI was imaged using the UV laserat full laser power (25% intensity and 10% gain).Background subtraction on the LC3 image stack was per-formed using the rolling ball method using a radius of 10pixels. A threshold mask was then applied to the imagestack based on intensities ranging from 100 to 255 to gen-erate binary images. Subsequently, ImageJ [52] automatedparticle analysis was performed on the image stack and par-ticle counts, size and area were measured for all images.Additional filesAdditional file 1: Figure S1. LC3 and p62 are barely detectable atbaseline in MEF cultures. A Higher exposure of blots shown in Fig. 1ademonstrates low baseline levels of p62 and LC3 in MEF cells. BImmunofluorescent staining for LC3 and p62 is barely detectable in MEFsin the absence of bafilomycin. (TIFF 2834 kb)Additional file 2: Figure S2. Autophagy pathways are not altered inMEFs derived from YAC18 mice. A Primary MEF cultures from YAC18 orwt littermate embryos were seeded onto coverslips and treated withbafilomycin. Cells were fixed and stained for p62 and LC3, Hoechst dyeEhrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 13 of 16was used for nuclear counterstaining. Samples were imaged on a confocalmicroscope and the density of punctae as well as the co-localization of LC3and p62 staining were analyzed. B Primary MEF cultures from YAC18 or wtlittermate embryos were seeded onto coverslips and treated with MG132 orDMSO as a control. Cells were fixed and stained for p62, Hoechst dye wasused for nuclear counterstaining. Samples were imaged on a confocalmicroscope and the density of punctae were analyzed. Representative im-ages and pooled quantification data with S.E.M. are shown, 3 independentcultures were analyzed. Number of replicates is shown as insets for Westernblot experiments, for imaging experiments 24-30 cells per condition wereanalyzed. Statistical significance was determined by Student’s t-test. No sta-tistically significant differences were found. (TIFF 5239 kb)Additional file 3: Figure S3. Increased association of p62 and K63ubiquitin with C6R mHTT. A COS-7 cells were cotransfected with mHTTaa 1-1212 (cleavable or C6R) or mHTT aa 1-586 and p62 as indicated.After immunoprecipitation of HTT, the ratio of co-immunoprecipitatedp62 was quantified (normalized to input to control for transfection effi-ciency). B COS-7 cells were cotransfected with cleavable mHTT1-1212, C6RmHTT1-1212 and p62 as indicated and treated with MG132 to enforce au-tophagic degradation. Cycloheximide was added for the indicated pe-riods of time and samples were analyzed by Western blot. Representativeblots are shown as part of Fig. 3b. 2way-ANOVA HTT construct p=0.1451,time p<0.0001. C COS-7 cells were cotransfected with mHTT aa1-1212(cleavable or C6R) and HA-tagged wt, K63 or K48 ubiquitin (allowing all,only K63 or only K48 linkage to target proteins) as indicated. After immu-noprecipitation of HTT, the ratio of co-immunoprecipitated ubiquitin/HTTwas quantified (normalized to input to control for transfection efficiency).Blots and quantification data with S.E.M. from a representative of 3 inde-pendent experiments are shown, number of technical replicates is shownas insets. Statistical significance was determined by 1way ANOVA withTukey’s post-hoc correction (A), 2way-ANOVA with Bonferroni’s post-hoccorrection (B) or Student’s t-test (D). *: p<0.05, **: p<0.01, ***: p<0.001.(TIFF 2089 kb)Additional file 4: Figure S4. Full blots corresponding to Fig. 3b.(TIFF 4590 kb)Additional file 5: Figure S5. 24h fasting does not alter wt HTT proteinor mHTT RNA levels while it reduces C6R mHTT in the liver. A Liver tissuefrom 12 month old YAC128 and C6R mice as well as their wt littermateswas analyzed for mRNA expression of LC3b by qRT-PCR. Data were nor-malized to the expression of Pgk1. 1way-ANOVA p=0.6552. B Liver tissuefrom 12 month old YAC128 and C6R mice was analyzed for mRNA ex-pression of mHTT by qRT-PCR. Data were normalized to the expression ofPgk1. C - E 12 month old YAC128 and C6R mice as well as their wt litter-mates were subjected to a 24h fasting period, sacrificed immediately andliver samples were compared to littermates with ad libitum access tofood. C Protein levels for wt HTT were analyzed by Western blotting withantibody MAB2166 in liver tissues derived from YAC128 mice. D mRNAlevels for transgenic human mHTT were analyzed by qRT-PCR in liver tis-sues derived from YAC128 mice. E Protein levels for mHTT were analyzedby Western blotting with antibody MAB2166 in liver tissues derived fromC6R mice. Representative blots and pooled quantification data with S.E.M.are shown, the blot matching panel C is shown in Fig. 5d. Statistical sig-nificance was determined by 1way-ANOVA (A) or two-tailed Student’s t-test (B-E), number of replicates is shown as insets. (TIFF 1130 kb)Additional file 6: Figure S6. 24h fasting increases autophagy but doesnot cause mHTT degradation in the brain. A + B 3 month old YAC128and C6R mice as well as their wt littermates were subjected to a 24hfasting period, sacrificed immediately and cortical samples werecompared to littermates with ad libitum access to food. A Protein levelsof p62, LC3-I and LC3-II were analyzed by Western blotting in cortical tis-sues of wt and YAC128 mice. p62: 2way-ANOVA genotype p=0.2568,feeding p=0.0002, LC3-I: 2way-ANOVA genotype p=0.7914, feedingp<0.0001, LC3-II: 2way-ANOVA genotype p=0.5499, feeding p=0.0039. BProtein levels of mHTT were analyzed by Western blotting with antibodyMAB2166 in cortical tissues of YAC128 mice. Representative blots andpooled quantification data with S.E.M. are shown, number of replicates isshown as insets. Statistical significance was determined by 2way-ANOVAwith Bonferroni’s post-hoc correction for A, or two-tailed Student’s t-testfor B. *: p<0.05, **: p<0.01, ***: p<0.001. (TIFF 1574 kb)Additional file 7: Figure S7. Cortical p62, LC3-I and wt HTT proteinlevels as well as mHTT mRNA are not altered by scheduled feeding. AYAC128 and C6R mice as well as their wt littermates were subjected toone week of scheduled feeding and compared to littermates with ad libi-tum access to food. Protein levels of p62 were analyzed by Western blot-ting in cortical tissues. 2way-ANOVA, genotype p=0.2138, feedingp=0.5807. B YAC128 and C6R mice as well as their wt littermates weresubjected to one week of scheduled feeding and compared to litter-mates with ad libitum access to food. Protein levels of LC3-I were ana-lyzed by Western blotting in cortical tissues. 2way-ANOVA, genotypep=0.5798, feeding p=0.2548. C + D YAC128 mice and their wt littermateswere subjected to one week of scheduled feeding and compared to lit-termates with ad libitum access to food. C Protein levels of wt HTT wereanalyzed by Western blotting with antibody MAB2166 in cortical tissues.2way-ANOVA genotype p=0.6115, feeding p=0.1818. D mRNA levels fortransgenic human mHTT were analyzed by qRT-PCR in cortical tissues de-rived from YAC128 mice. Representative blots and pooled quantificationdata with S.E.M. are shown, number of replicates is shown as insets. Theblot corresponding to panel B is shown in Fig. 6a, the blot correspondingto panel C is shown in Fig. 6d. Statistical significance was determined by2way ANOVA (A-C) or Student’s t-test (D). (TIFF 1304 kb)AcknowledgementsThe authors thank Dr. Ana-Maria Cuervo for assistance in the identification ofAVs and Mandi Schmidt for assistance with image analysis. We thank PiersRuddle, Mahsa Amirabbasi, Sheng Yu, Mark Wang, Yun Ko, Yuanyun Xie andQingwen Xia for their technical support. DDOM and NHS were supported bypostdoctoral fellowships from CIHR. DDOM was also supported by MichaelSmith Foundation for Health Research and the Bluma Tischler Fellowshipfrom UBC. MS was supported by a Vanier Canada Graduate Scholarship. SLwas supported by a doctoral scholarship from CIHR. NSC was supported bypostdoctoral fellowships from CIHR and the James Family. This work wassupported by the Canadian Institutes of Health Research (CIHR 20R90174)and a sponsored research agreement with Teva Pharmaceuticals.Authors’ contributionsDEE designed and performed experiments, coordinated author contributionsand wrote the manuscript. DDOM designed and performed experiments,provided intellectual input and edited the manuscript. MS, XQ, SL, NSC, NHS,YTNN, KV, ALS, SE and SF performed experiments. MRH supervised theproject and edited the manuscript. All authors read and approved the finalmanuscript.Competing interestsM.R.H. was an employee of Teva Pharmaceuticals, Inc. Teva did not play arole in the design, analysis or interpretation of this study. All other authorsdeclare no competing financial interests.Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.Author details1Centre for Molecular Medicine and Therapeutics (CMMT), CFRI, Departmentof Medical Genetics, University of British Columbia, 950 West 28th Avenue,Vancouver, BC V5Z 4H4, Canada. 2Present address: BioMed X InnovationCenter, Im Neuenheimer Feld 515, 69120 Heidelberg, Germany.Received: 23 August 2017 Accepted: 12 February 2018References1. Alirezaei M, Kemball CC, Flynn CT, Wood MR, Whitton JL, Kiosses WB (2010)Short-term fasting induces profound neuronal autophagy. Autophagy 6:702–7102. Atwal RS, Xia J, Pinchev D, Taylor J, Epand RM, Truant R (2007)Huntingtin has a membrane association signal that can modulatehuntingtin aggregation, nuclear entry and toxicity. Hum Mol Genet 16:2600–2615. https://doi.org/10.1093/hmg/ddm2173. Aziz NA, van der Burg JM, Landwehrmeyer GB, Brundin P, Stijnen T, GroupES, Roos RA (2008) Weight loss in Huntington disease increases with higherEhrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 14 of 16CAG repeat number. Neurology 71:1506–1513. https://doi.org/10.1212/01.wnl.0000334276.09729.0e4. Babu JR, Seibenhener ML, Peng J, Strom AL, Kemppainen R, Cox N, Zhu H,Wooten MC, Diaz-Meco MT, Moscat J et al (2008) Genetic inactivation ofp62 leads to accumulation of hyperphosphorylated tau andneurodegeneration. J Neurochem 106:107–120. https://doi.org/10.1111/j.1471-4159.2008.05340.x5. Bae SH, Sung SH, Oh SY, Lim JM, Lee SK, Park YN, Lee HE, Kang D, Rhee SG(2013) Sestrins activate Nrf2 by promoting p62-dependent autophagicdegradation of Keap1 and prevent oxidative liver damage. Cell Metab 17:73–84. https://doi.org/10.1016/j.cmet.2012.12.0026. Bennett EJ, Shaler TA, Woodman B, Ryu KY, Zaitseva TS, Becker CH, Bates GP,Schulman H, Kopito RR (2007) Global changes to the ubiquitin system inHuntington's disease. Nature 448:704–708. https://doi.org/10.1038/nature060227. Bhat KP, Yan S, Wang CE, Li S, Li XJ (2014) Differential ubiquitination anddegradation of huntingtin fragments modulated by ubiquitin-protein ligase E3A.Proc Natl Acad Sci U S A 111:5706–5711. https://doi.org/10.1073/pnas.14022151118. Boland B, Kumar A, Lee S, Platt FM, Wegiel J, Yu WH, Nixon RA (2008)Autophagy induction and autophagosome clearance in neurons:relationship to autophagic pathology in Alzheimer's disease. J Neurosci28:6926–6937. https://doi.org/10.1523/JNEUROSCI.0800-08.20089. Carroll JB, Bates GP, Steffan J, Saft C, Tabrizi SJ (2015) Treating thewhole body in Huntington's disease. Lancet Neurol 14:1135–1142.https://doi.org/10.1016/S1474-4422(15)00177-510. Chen X, Kondo K, Motoki K, Homma H, Okazawa H (2015) Fastingactivates macroautophagy in neurons of Alzheimer's disease mousemodel but is insufficient to degrade amyloid-beta. Sci Rep 5:12115.https://doi.org/10.1038/srep1211511. Cunha-Santos J, Duarte-Neves J, Carmona V, Guarente L, Pereira de AlmeidaL, Cavadas C (2016) Caloric restriction blocks neuropathology and motordeficits in Machado-Joseph disease mouse models through SIRT1 pathway.Nat Commun 7:11445. https://doi.org/10.1038/ncomms1144512. Czaja MJ, Ding WX, Donohue TM Jr, Friedman SL, Kim JS, Komatsu M,Lemasters JJ, Lemoine A, Lin JD, Ou JH et al (2013) Functions ofautophagy in normal and diseased liver. Autophagy 9:1131–1158.https://doi.org/10.4161/auto.2506313. De Souza RA, Leavitt BR (2015) Neurobiology of Huntington’s disease. CurrTop Behav Neurosci 22:81–100. https://doi.org/10.1007/7854_2014_35314. Dikic I (2017) Proteasomal and Autophagic degradation systems. Annu RevBiochem 86:193–224. https://doi.org/10.1146/annurev-biochem-061516-04490815. Duan W, Guo Z, Jiang H, Ware M, Li XJ, Mattson MP (2003) Dietaryrestriction normalizes glucose metabolism and BDNF levels, slows diseaseprogression, and increases survival in huntingtin mutant mice. Proc NatlAcad Sci U S A 100:2911–2916. https://doi.org/10.1073/pnas.053685610016. Ehrnhoefer DE, Skotte NH, Savill J, Nguyen YT, Ladha S, Cao LP,Dullaghan E, Hayden MR (2011) A quantitative method for thespecific assessment of caspase-6 activity in cell culture. PLoS One 6:e27680. https://doi.org/10.1371/journal.pone.002768017. Ehrnhoefer DE, Sutton L, Hayden MR (2011) Small changes, big impact:posttranslational modifications and function of huntingtin in Huntingtondisease. Neuroscientist 17:475–492. https://doi.org/10.1177/107385841039037818. El-Daher MT, Hangen E, Bruyere J, Poizat G, Al-Ramahi I, Pardo R, Bourg N,Souquere S, Mayet C, Pierron G et al (2015) Huntingtin proteolysis releasesnon-polyQ fragments that cause toxicity through dynamin 1 dysregulation.EMBO J 34:2255–2271. https://doi.org/10.15252/embj.20149080819. Gafni J, Papanikolaou T, Degiacomo F, Holcomb J, Chen S, Menalled L, KudwaA, Fitzpatrick J, Miller S, Ramboz S et al (2012) Caspase-6 activity in a BACHDmouse modulates steady-state levels of mutant huntingtin protein but is notnecessary for production of a 586 amino acid proteolytic fragment. J Neurosci32:7454–7465. https://doi.org/10.1523/JNEUROSCI.6379-11.201220. Ghosh HS, McBurney M, Robbins PD (2010) SIRT1 negatively regulatesthe mammalian target of rapamycin. PLoS One 5:e9199. https://doi.org/10.1371/journal.pone.000919921. Graham RK, Deng Y, Carroll J, Vaid K, Cowan C, Pouladi MA, Metzler M,Bissada N, Wang L, Faull RL et al (2010) Cleavage at the 586 amino acidcaspase-6 site in mutant huntingtin influences caspase-6 activation in vivo. JNeurosci 30:15019–15029. https://doi.org/10.1523/JNEUROSCI.2071-10.201022. Graham RK, Deng Y, Pouladi MA, Vaid K, Ehrnhoefer DE, Southwell AL,Bissada N, Franciosi S, Hayden MR (2012) Caspase-6-resistant mutanthuntingtin does not rescue the toxic effects of caspase-cleavable mutanthuntingtin in vivo. J Huntington’s Dis 1:243–26023. Graham RK, Deng Y, Slow EJ, Haigh B, Bissada N, Lu G, Pearson J, Shehadeh J,Bertram L, Murphy Z et al (2006) Cleavage at the caspase-6 site is required forneuronal dysfunction and degeneration due to mutant huntingtin. Cell 125:1179–1191. https://doi.org/10.1016/j.cell.2006.04.02624. Hodgson JG, Smith DJ, McCutcheon K, Koide HB, Nishiyama K, Dinulos MB,Stevens ME, Bissada N, Nasir J, Kanazawa I et al (1996) Human huntingtinderived from YAC transgenes compensates for loss of murine huntingtin byrescue of the embryonic lethal phenotype. Hum Mol Genet 5:1875–188525. Jeong H, Cohen DE, Cui L, Supinski A, Savas JN, Mazzulli JR, Yates JR 3rd,Bordone L, Guarente L, Krainc D (2011) Sirt1 mediates neuroprotection frommutant huntingtin by activation of the TORC1 and CREB transcriptionalpathway. Nat Med 18:159–165. https://doi.org/10.1038/nm.255926. Jiang M, Wang J, Fu J, Du L, Jeong H, West T, Xiang L, Peng Q, Hou Z, Cai Het al (2011) Neuroprotective role of Sirt1 in mammalian models ofHuntington's disease through activation of multiple Sirt1 targets. Nat Med18:153–158. https://doi.org/10.1038/nm.255827. Kalchman MA, Graham RK, Xia G, Koide HB, Hodgson JG, Graham KC,Goldberg YP, Gietz RD, Pickart CM, Hayden MR (1996) Huntingtin isubiquitinated and interacts with a specific ubiquitin-conjugatingenzyme. J Biol Chem 271:19385–1939428. Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, AcevedoArozena A, Adachi H, Adams CM, Adams PD, Adeli K et al (2016) Guidelines forthe use and interpretation of assays for monitoring autophagy (3rd edition).Autophagy 12:1–222. https://doi.org/10.1080/15548627.2015.110035629. Korolchuk VI, Mansilla A, Menzies FM, Rubinsztein DC (2009) Autophagyinhibition compromises degradation of ubiquitin-proteasome pathwaysubstrates. Mol Cell 33:517–527. https://doi.org/10.1016/j.molcel.2009.01.02130. Krainc D (2010) Clearance of mutant proteins as a therapeutic targetin neurodegenerative diseases. Arch Neurol 67:388–392. https://doi.org/10.1001/archneurol.2010.4031. Lee JH, Tecedor L, Chen YH, Monteys AM, Sowada MJ, Thompson LM,Davidson BL (2015) Reinstating aberrant mTORC1 activity inHuntington's disease mice improves disease phenotypes. Neuron 85:303–315. https://doi.org/10.1016/j.neuron.2014.12.01932. Lim J, Lachenmayer ML, Wu S, Liu W, Kundu M, Wang R, Komatsu M, Oh YJ,Zhao Y, Yue Z (2015) Proteotoxic stress induces phosphorylation of p62/SQSTM1by ULK1 to regulate selective autophagic clearance of protein aggregates. PLoSGenet 11:e1004987. https://doi.org/10.1371/journal.pgen.100498733. Ma D, Panda S, Lin JD (2011) Temporal orchestration of circadianautophagy rhythm by C/EBPbeta. EMBO J 30:4642–4651. https://doi.org/10.1038/emboj.2011.32234. Martin DD, Heit RJ, Yap MC, Davidson MW, Hayden MR, Berthiaume LG(2014) Identification of a post-translationally myristoylated autophagy-inducing domain released by caspase cleavage of huntingtin. Hum MolGenet 23:3166–3179. https://doi.org/10.1093/hmg/ddu02735. Martin DD, Ladha S, Ehrnhoefer DE, Hayden MR (2015) Autophagy inHuntington disease and huntingtin in autophagy. Trends Neurosci 38:26–35.https://doi.org/10.1016/j.tins.2014.09.00336. Martinez-Vicente M, Talloczy Z, Wong E, Tang G, Koga H, Kaushik S, de Vries R,Arias E, Harris S, Sulzer D et al (2010) Cargo recognition failure is responsible forinefficient autophagy in Huntington's disease. Nat Neurosci 13:567–576.https://doi.org/10.1038/nn.252837. Mattison JA, Colman RJ, Beasley TM, Allison DB, Kemnitz JW, Roth GS,Ingram DK, Weindruch R, de Cabo R, Anderson RM (2017) Caloric restrictionimproves health and survival of rhesus monkeys. Nat Commun 8:14063.https://doi.org/10.1038/ncomms1406338. Maywood ES, Fraenkel E, McAllister CJ, Wood N, Reddy AB, HastingsMH, Morton AJ (2010) Disruption of peripheral circadian timekeepingin a mouse model of Huntington's disease and its restoration bytemporally scheduled feeding. J Neurosci 30:10199–10204. https://doi.org/10.1523/JNEUROSCI.1694-10.201039. Menzies FM, Fleming A, Rubinsztein DC (2015) Compromisedautophagy and neurodegenerative diseases. Nat Rev Neurosci 16:345–357. https://doi.org/10.1038/nrn396140. Metzler M, Gan L, Mazarei G, Graham RK, Liu L, Bissada N, Lu G, Leavitt BR,Hayden MR (2010) Phosphorylation of huntingtin at Ser421 in YAC128neurons is associated with protection of YAC128 neurons from NMDA-mediated excitotoxicity and is modulated by PP1 and PP2A. J Neurosci 30:14318–14329. https://doi.org/10.1523/JNEUROSCI.1589-10.201041. Morton AJ (2013) Circadian and sleep disorder in Huntington's disease. ExpNeurol 243:34–44. https://doi.org/10.1016/j.expneurol.2012.10.014Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 15 of 1642. Ntsapi C, Loos B (2016) Caloric restriction and the precision-control ofautophagy: a strategy for delaying neurodegenerative disease progression.Exp Gerontol 83:97–111. https://doi.org/10.1016/j.exger.2016.07.01443. Ochaba J, Lukacsovich T, Csikos G, Zheng S, Margulis J, Salazar L, Mao K, LauAL, Yeung SY, Humbert S et al (2014) Potential function for the huntingtinprotein as a scaffold for selective autophagy. Proc Natl Acad Sci U S A 111:16889–16894. https://doi.org/10.1073/pnas.142010311144. Okamoto S, Pouladi MA, Talantova M, Yao D, Xia P, Ehrnhoefer DE,Zaidi R, Clemente A, Kaul M, Graham RK et al (2009) Balance betweensynaptic versus extrasynaptic NMDA receptor activity influencesinclusions and neurotoxicity of mutant huntingtin. Nat Med 15:1407–1413. https://doi.org/10.1038/nm.205645. Pouladi MA, Graham RK, Karasinska JM, Xie Y, Santos RD, Petersen A,Hayden MR (2009) Prevention of depressive behaviour in the YAC128mouse model of Huntington disease by mutation at residue 586 ofhuntingtin. Brain 132:919–932. https://doi.org/10.1093/brain/awp00646. Pouladi MA, Xie Y, Skotte NH, Ehrnhoefer DE, Graham RK, Kim JE, Bissada N,Yang XW, Paganetti P, Friedlander RM et al (2010) Full-length huntingtin levelsmodulate body weight by influencing insulin-like growth factor 1 expression.Hum Mol Genet 19:1528–1538. https://doi.org/10.1093/hmg/ddq02647. Ravikumar B, Duden R, Rubinsztein DC (2002) Aggregate-prone proteins withpolyglutamine and polyalanine expansions are degraded by autophagy. HumMol Genet 11:1107–111748. Rose C, Menzies FM, Renna M, Acevedo-Arozena A, Corrochano S, Sadiq O,Brown SD, Rubinsztein DC (2010) Rilmenidine attenuates toxicity ofpolyglutamine expansions in a mouse model of Huntington's disease. HumMol Genet 19:2144–2153. https://doi.org/10.1093/hmg/ddq09349. Rubinsztein DC (2006) The roles of intracellular protein-degradation pathways inneurodegeneration. Nature 443:780–786. https://doi.org/10.1038/nature0529150. Rui YN, Xu Z, Patel B, Chen Z, Chen D, Tito A, David G, Sun Y, Stimming EF,Bellen HJ et al (2015) Huntingtin functions as a scaffold for selectivemacroautophagy. Nat Cell Biol 17:262–275. https://doi.org/10.1038/ncb310151. Sahani MH, Itakura E, Mizushima N (2014) Expression of the autophagysubstrate SQSTM1/p62 is restored during prolonged starvation dependingon transcriptional upregulation and autophagy-derived amino acids.Autophagy 10:431–441. https://doi.org/10.4161/auto.2734452. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH image to ImageJ: 25 yearsof image analysis. Nat Methods 9:671–67553. Seibenhener ML, Babu JR, Geetha T, Wong HC, Krishna NR, Wooten MW(2004) Sequestosome 1/p62 is a polyubiquitin chain binding proteininvolved in ubiquitin proteasome degradation. Mol Cell Biol 24:8055–8068.https://doi.org/10.1128/MCB.24.18.8055-8068.200454. Skillings EA, Wood NI, Morton AJ (2014) Beneficial effects of environmentalenrichment and food entrainment in the R6/2 mouse model of Huntington'sdisease. Brain Behav 4:675–686. https://doi.org/10.1002/brb3.23555. Skotte NH, Southwell AL, Ostergaard ME, Carroll JB, Warby SC, Doty CN,Petoukhov E, Vaid K, Kordasiewicz H, Watt AT et al (2014) Allele-specificsuppression of mutant huntingtin using antisense oligonucleotides:providing a therapeutic option for all Huntington disease patients. PLoSOne 9:e107434. https://doi.org/10.1371/journal.pone.010743456. Slow EJ, van Raamsdonk J, Rogers D, Coleman SH, Graham RK, Deng Y,Oh R, Bissada N, Hossain SM, Yang YZ et al (2003) Selective striatalneuronal loss in a YAC128 mouse model of Huntington disease. HumMol Genet 12:1555–156757. The Huntington's disease Collaborative Research Group (1993) A novel genecontaining a trinucleotide repeat that is expanded and unstable on Huntington'sdisease chromosomes. Huntington’s Dis Collab Res Group Cell 72:971–98358. Van Raamsdonk JM, Gibson WT, Pearson J, Murphy Z, Lu G, Leavitt BR, HaydenMR (2006) Body weight is modulated by levels of full-length huntingtin. HumMol Genet 15:1513–1523. https://doi.org/10.1093/hmg/ddl07259. Walter C, Clemens LE, Muller AJ, Fallier-Becker P, Proikas-Cezanne T, Riess O,Metzger S, Nguyen HP (2016) Activation of AMPK-induced autophagyameliorates Huntington disease pathology in vitro. Neuropharmacology.https://doi.org/10.1016/j.neuropharm.2016.04.04160. Warby SC, Doty CN, Graham RK, Carroll JB, Yang YZ, Singaraja RR, OverallCM, Hayden MR (2008) Activated caspase-6 and caspase-6-cleavedfragments of huntingtin specifically colocalize in the nucleus. Hum MolGenet 17:2390–2404. https://doi.org/10.1093/hmg/ddn13961. Wild EJ, Tabrizi SJ (2014) Targets for future clinical trials inHuntington's disease: what's in the pipeline? Movement Disord 29:1434–1445. https://doi.org/10.1002/mds.2600762. Wong BK, Ehrnhoefer DE, Graham RK, Martin DD, Ladha S, Uribe V, StanekLM, Franciosi S, Qiu X, Deng Y et al (2015) Partial rescue of some features ofHuntington disease in the genetic absence of caspase-6 in YAC128 mice.Neurobiol Dis 76:24–36. https://doi.org/10.1016/j.nbd.2014.12.03063. Wong YC, Holzbaur EL (2014) The regulation of autophagosomedynamics by huntingtin and HAP1 is disrupted by expression of mutanthuntingtin, leading to defective cargo degradation. J Neurosci 34:1293–1305. https://doi.org/10.1523/JNEUROSCI.1870-13.201464. Young JE, Martinez RA, La Spada AR (2009) Nutrient deprivationinduces neuronal autophagy and implicates reduced insulin signaling inneuroprotective autophagy activation. J Biol Chem 284:2363–2373.https://doi.org/10.1074/jbc.M806088200•  We accept pre-submission inquiries •  Our selector tool helps you to find the most relevant journal•  We provide round the clock customer support •  Convenient online submission•  Thorough peer review•  Inclusion in PubMed and all major indexing services •  Maximum visibility for your researchSubmit your manuscript atwww.biomedcentral.com/submitSubmit your next manuscript to BioMed Central and we will help you at every step:Ehrnhoefer et al. Acta Neuropathologica Communications  (2018) 6:16 Page 16 of 16


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items