UBC Faculty Research and Publications

Evidence for the activation of pyroptotic and apoptotic pathways in RPE cells associated with NLRP3 inflammasome… Gao, Jiangyuan; Cui, Jing Z; To, Eleanor; Cao, Sijia; Matsubara, Joanne A Jan 12, 2018

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12974_2018_Article_1062.pdf [ 1.88MB ]
Metadata
JSON: 52383-1.0363043.json
JSON-LD: 52383-1.0363043-ld.json
RDF/XML (Pretty): 52383-1.0363043-rdf.xml
RDF/JSON: 52383-1.0363043-rdf.json
Turtle: 52383-1.0363043-turtle.txt
N-Triples: 52383-1.0363043-rdf-ntriples.txt
Original Record: 52383-1.0363043-source.json
Full Text
52383-1.0363043-fulltext.txt
Citation
52383-1.0363043.ris

Full Text

RESEARCH Open AccessEvidence for the activation of pyroptoticand apoptotic pathways in RPE cellsassociated with NLRP3 inflammasome inthe rodent eyeJiangyuan Gao, Jing Z. Cui, Eleanor To, Sijia Cao and Joanne A. Matsubara*AbstractBackground: Age-related macular degeneration (AMD) is a devastating eye disease causing irreversible vision loss inthe elderly. Retinal pigment epithelium (RPE), the primary cell type that is afflicted in AMD, undergoes programmedcell death in the late stages of the disease. However, the exact mechanisms for RPE degeneration in AMD are stillunresolved. The prevailing theories consider that each cell death pathway works independently and without regulationof each other. Building upon our previous work in which we induced a short burst of inflammasome activity in vivo,we now investigate the effects of prolonged inflammasome activity on RPE cell death mechanisms in rats.Methods: Long-Evans rats received three intravitreal injections of amyloid beta (Aβ), once every 4 days, and weresacrificed at day 14. The vitreous samples were collected to assess the levels of secreted cytokines. The inflammasomeactivity was evaluated by both immunohistochemistry and western blot. The types of RPE cell death mechanisms weredetermined using specific cell death markers and morphological characterizations.Results: We found robust inflammasome activation evident by enhanced caspase-1 immunoreactivity, augmented NF-κB nuclear translocalization, increased IL-1β vitreal secretion, and IL-18 protein levels. Moreover, we observed elevatedproteolytic cleavage of caspase-3 and gasdermin D, markers for apoptosis and pyroptosis, respectively, in RPE-choroidtissues. There was also a significant reduction in the anti-apoptotic factor, X-linked inhibitor of apoptosis protein,consistent with the overall changes of RPE cells. Morphological analysis showed phenotypic characteristics ofpyroptosis including RPE cell swelling.Conclusions: Our data suggest that two cell death pathways, pyroptosis and apoptosis, were activated in RPE cellsafter exposure to prolonged inflammasome activation, induced by a drusen component, Aβ. The involvement of twodistinct cell death pathways in RPE sheds light on the potential interplay between these pathways and providesinsights on the future development of therapeutic strategies for AMD.Keywords: Age-related macular degeneration, Retinal pigment epithelium, NLRP3 inflammasome, Cell death, Amyloidbeta* Correspondence: jms@mail.ubc.caDepartment of Ophthalmology and Visual Sciences, Eye Care Centre, Facultyof Medicine, University of British Columbia, 2550 Willow Street, Vancouver,BC V5Z 3N9, Canada© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Gao et al. Journal of Neuroinflammation  (2018) 15:15 DOI 10.1186/s12974-018-1062-3BackgroundAge-related macular degeneration (AMD) is a neurode-generative disease that strikes the macula, causing irre-versible blindness to people over the age of 50 inindustrialized countries. The global prevalence of AMDhas created substantial economic and social burden witha projected estimate of 196 million people living withAMD in 2020 [1]. Clearly, better eye care strategies needto be designed to provide health care services to those inneed. Clinically, AMD can be predicted by a severityscale that is a function of drusen deposition and pigmentabnormalities [2]. The accumulation of drusen both insize and in number has become a hallmark of AMDprogression. As it progresses, AMD transitions fromearly benign stages into advanced vision-threateningstages, presenting with either choroidal neovasculariza-tion (CNV, wet form) and/or geographic atrophy (GA,dry form). Although CNV is the severe subtype of theadvanced AMD, it is clinically managed using the anti-vascular endothelial growth factor (VEGF) therapy [3].However, there is no effective treatment to slow downthe more prevalent dry form, which makes up approxi-mately 90% of all AMD cases. Retinal pigment epithe-lium (RPE) cell death and secondary photoreceptordegeneration are two signature changes that lead tocentral vision loss in GA, the advanced stage of dryAMD. Hence, it is paramount to understand the funda-mental mechanisms underlying these devastatingimpacts to the retina, especially the ones that undermineRPE health.Despite the lack of consensus on the exact cell deathpathway(s) involved, there have been three candidate celldeath mechanisms proposed to underlie RPE atrophy inGA, including necrosis, apoptosis, and pyroptosis [4–6].Necrosis is a classic form of RPE cell death in GA, whichwas reported in earlier clinical-pathological studies bySarks et al. [4], and also in basic research projects withultrastructural and histochemical data [7]. ApoptoticRPE cell death, on the other hand, has gained substantialsupport from the literature in recent years. Using post-mortem human eyes, Kaneko and colleagues identifiedthe activation of caspase-3 in the RPE layer of GA eyes,but not in normal control eyes [5]. Moreover, Dunaiefet al. demonstrated statistically significant differences inthe number of terminal deoxynucleotidyl transferasedUTP nick end-labeling (TUNEL) positive retinal cellsin postmortem retinas with AMD, compared to normalcontrols [8]. The third proposed mechanism of RPEdeath is pyroptosis, which is an inflammatory form ofprogrammed cell death [9]. The cornerstone of pyropto-sis is the activation of an intracellular multi-proteincomplex named the inflammasome. NLR family pyrindomain containing 3 (NLRP3) inflammasome is themost widely studied machinery and consists of NLRP3,active caspase-1, and a bridging adaptor, apoptosis-associated speck-like protein containing a carboxy-terminal CARD (ASC). For the NLRP3 inflammasometo function, it requires sequential treatment of two typesof pathological stimuli, (1) a priming signal to activatenuclear factor kappa B (NF-κB) and upregulate thetranscription of NLRP3 and interleukin (IL)-1βprecursor protein; (2) an activation signal to trigger theinflammasome assembly for the production of twopro-inflammatory cytokines, IL-1β and IL-18. Therelationship between NLRP3 inflammasome and AMDpathology has been an attractive subject in the field, andcurrent knowledge on this subject is reviewed elsewherein detail [10]. Although all three cell death pathwaysdescribed above seems to govern RPE cell fate in GA tosome extent, it is still unclear whether these mechanismsact independently or in synergy.Earlier work, including ours, demonstrated that com-ponents found in drusen, (e.g., amyloid beta, comple-ment cascade products) increase in the aged retina [11,12]. Previously, we have established a rat intraocular in-jection model to mimic the increasing amyloid beta (Aβ)load associated with drusen in human eyes [13]. Wedemonstrated that drusen component, Aβ, triggers ashort lasting pro-inflammatory response in RPE via theactivation of NF-κB and NLRP3 inflammasome [13, 14],which can be specifically abolished by vinpocetine (anNF-κB inhibitor) [15]. Intriguingly, RPE cell loss is not afeature of the short lasting pro-inflammation associatedwith the acute Aβ intravitreal model [13]. In the presentstudy, we extended the duration of outer retina pro-inflammation by making sequential Aβ injections, inorder to better model the chronic pro-inflammatoryevents and associated cell death underlying the patho-genesis of the dry form of AMD.MethodsPreparation of oligomeric AβThe lyophilized, synthetic Aβ1–40 peptide (hereafter re-ferred to as “Aβ”) in the HCl salt form was purchasedfrom American Peptide (Sunnyvale, CA). We choseAβ1–40 peptide over its structurally similar but moretoxic, Alzheimer’s disease (AD)-specific, form of Aβ1–42peptide based on earlier studies that demonstrated thepresence of Aβ1–40 in drusen deposits in postmortemhuman eyes [13]. Oligomeric Aβ was prepared accordingto published protocols [16, 17]. Briefly, the synthetic Aβpeptide was first reconstituted in 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP, Sigma Aldrich, St. Louis, MO) andwas evaporated by speed vacuum, resulting in thin trans-parent Aβ peptide film. The Aβ peptide film was thenreconstituted in 100% dimethyl sulfoxide (DMSO, SigmaAldrich) to a concentration of 1 mM, and further dilutedin pre-warmed phosphate buffered saline (PBS, pH 7.4)Gao et al. Journal of Neuroinflammation  (2018) 15:15 Page 2 of 12to produce the Aβ injection solution of 323 μM, equiva-lent to 1.4 μg/μL. The injection solution was subse-quently incubated at 37 °C for 48 h to form theoligomeric Aβ. Confirmation of successful oligomericAβ formation was achieved by western blot (WB) usingour published protocols [11]. Reverse Aβ40–1 peptide(hereafter, referred to as “control”) served as a sequencecontrol for Aβ and was prepared in the same fashion.The absence of protein bands recognized by a mousemonoclonal anti-Aβ1–16 antibody (clone 6E10, Table 1)in the control solution indicated proper preparation(Additional file 1: Figure S1).AnimalsAdult female Long-Evans rats at the age of 4.5 month(Charles River, Wilmington, MA) were randomly dividedinto two groups. Group 1 (N = 16) comprised rats receiv-ing intravitreal injections of Aβ (5 μL at 1.4 μg/μL aspreviously published [13]) once every 4 days for a totalof three injections. Group 2 (N = 16) rats received intra-vitreal injections of the control solution (reverse Aβ40–1peptide) the same way as described for group 1. All ratswere sacrificed on the 14th day after initial injection(day 14). Eyes were immediately enucleated and frozenfor WB, polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA) or fixed in 4%paraformaldehyde diluted in Dulbecco’s PBS (Invitrogen,Carlsbad, CA) for 48–72 h prior to paraffin embedding.Immunohistochemistry (caspase-1, IL-18, NF-κB, activecaspase-3)Paraffin-embedded rat eye tissues were processed follow-ing established protocols [13]. Sections from both theAβ and the control groups were processed simultan-eously in an effort to minimize variability in immunore-activity conditions (N = 3 per group). Primary antibodiesrecognizing total caspase-1, IL-18, NF-κB, and activecaspase-3 are described in Table 1. Non-specific isotypeIgGs (Sigma Aldrich) matching the species of primaryantibodies are used on negative control tissue sections.For visualization, the slides were developed using theVector® AEC substrate kit (Vector Laboratories, Burling-ton ON, Canada) and were counterstained with Mayer’sHematoxylin (Sigma Aldrich) for the nuclei. Sectionsprocessed simultaneously were analyzed and scored soas to avoid difference in immunostaining due to condi-tions such as temperature and stock of antibodies.Caspase-1, IL-18, and active caspase-3 immunoreactivitywas scored in a masked fashion and semi-quantitativelybased on a 0–3 point scale. A score of 0 indicates nodetectable staining above the background level as com-pared to the negative control sections, whereas a scoreof 1, 2, or 3 suggests weak, intermediate, and robustintensity of the immunoreactivity, respectively. Theimmunoreactivity scores of caspase-1, IL-18, and activecaspase-3 were averaged and normalized to the controlgroup.To detect NF-κB translocalization, an antibody recog-nizing the phosphorylated Ser 276 locus on NF-κB p65subunit was used (Table 1). Immunoreactivity was mea-sured quantitatively, in a masked fashion, using a × 60objective lens and × 10 eyepieces. Positive RPE nucleiwere identified as containing both the red AEC chromo-gen and blue hematoxylin counterstain, thus resulting ina purple appearance distinct from the unlabeled RPEnuclei that were blue in color due to the hematoxylincounterstain alone. The number of NF-κB positive nucleiwas converted to percentage of all RPE nuclei in thesample area and was normalized to the control group.Suspension array for vitreal cytokinesAn ELISA-based cytokine assay for vitreal cytokines wascarried out (Bio-Plex 200 System, Bio-Rad Laboratories,Hercules, CA). The assay targeted the followingTable 1 List of primary antibodiesAntigen Antibody Dilution Source ApplicationsAmyloid-beta amino acid1-16 (Aβ1–16)Mouse monoclonalanti-Aβ1–16 (clone 6E10)1:20001:500BioLegend, Dedham, MA Western blotImmunohistochemistryCaspase-1 Rabbit monoclonal 1:300 Abcam, Cambridge, UK ImmunohistochemistryPhosphorylated NF-κB p65(Ser 276)Rabbit polyclonal 1:75 Santa Cruz Biotechnology,Dallas, TXImmunohistochemistryInterleukin-18 (IL-18) Rabbit polyclonal 1:1001:1000Santa Cruz Biotechnology,Dallas, TXImmunohistochemistryWestern blotActive caspase-3 (aCasp-3) Rabbit monoclonal 1:1000 Cell Signaling Technology,Beverly, MAImmunohistochemistryX-linked inhibitor of apoptosis(XIAP)Mouse monoclonal 1:1000 BD Transduction Laboratories,San Jose, CAWestern blotGasdermin D (GSDMD) Mouse monoclonal 1:100 Santa Cruz Biotechnology,Dallas, TXWestern blotGAPDH Mouse monoclonal 1:10,000 EMD Millipore, Billerica, MA Western blotGao et al. Journal of Neuroinflammation  (2018) 15:15 Page 3 of 12cytokines: erythropoietin (EPO), granulocyte colonystimulating factor (G-CSF), granulocyte macrophage col-ony stimulating factor (GM-CSF), chemokine (C-X-Cmotif ) ligand 1 (GRO/KC), interferon-gamma (IFN-γ),IL-1α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12p70,IL-13, IL-17, IL-18, macrophage colony stimulating fac-tor (M-CSF), macrophage inflammatory protein 1alpha(MIP-1α), MIP-3α, regulated on activation, normal T cellexpressed and secreted (RANTES), TNF-α, and vascularendothelial growth factor (VEGF). Vitreous from rat eyesin the same group (either Aβ or control) were pooled(N = 7). Experiments were carried out following methodsin our earlier publication [15].Western blotTo determine the level of X-linked inhibitor of apoptosis(XIAP), whole retina tissues (including neuroretina,RPE, Bruch’s membrane, and choroid) from each of thetwo injection groups were used (N = 5). To investigateIL-18 secretion and gasdermin D (GSDMD) cleavage,RPE-choroid tissues from each of the two injectiongroups were dissected out and pooled to use (N ≥ 3).Tissues were homogenized in ice-cold RIPA buffer(Thermo Fisher Scientific, Waltham, MA) containingprotease inhibitor cocktail (Roche Diagnostics,Indianapolis, IN). Protein lysates were run under redu-cing conditions and established blotting procedures werefollowed. Detailed information on the primary antibodiesused in western blotting can be found in Table 1 [11].As an internal protein loading control, GAPDH was de-tected either on the stripped membrane or using freshlythawed protein lysates (Table 1). The protein band in-tensity of XIAP (57 kDa), IL-18 (18 kDa), pro-GSDMD(53 kDa), N-GSDMD (30 kDa), and GAPDH (36 kDa)was individually measured using ImageJ (NIH, Bethesda,MD) and was converted into ratios relative to GAPDH.The final relative intensity of XIAP, IL-18, pro-GSDMD,or N-GSDMD was normalized to the control group.Reverse transcription PCR (RT-PCR)Total RNA of RPE-choroid was isolated from pooled rateye tissues (N ≥ 3) using ultRNA Column Purification kit(Applied Biological Materials, Richmond BC, Canada).200 ng total RNA from each injection group was reversetranscribed into cDNA using the High-Capacity cDNAReverse Transcription kit (Applied Biosystems, Carlsbad,CA). RT-PCR was carried out on the 7500 FastReal-time PCR System (Applied Biosystems) using thefollowing cycling conditions: 95 °C for 30 s, 50 °C for30 s, 72 °C for 30 s, 40 cycles. RT-PCR primer sequencescan be found in Table 2. Melting curve analysis wasautomatically performed right after the cycles’ comple-tion. The results were expressed as mRNA fold-changerelative to the control group after normalization to thereference gene, GAPDH, using the 2−ΔΔCT method.RPE morphological assessmentTo evaluate the morphological changes of RPE cells dueto induced inflammasome activity, we developed a cus-tom Photoshop algorithm to measure the area of a setlength of RPE monolayer based on RPE pigmentation.For each animal group, a total of nine sections fromeach animal were used for the analysis. All RPE micro-graphs were taken under × 60 magnification and subse-quently cropped into 12 cm × 2 cm rectangular areas forfurther processing. Next, choroidal pigments weremanually removed and the RPE-only areas were selectedby applying “fuzziness”. Then, the pixel count for thecropped area was obtained. The RPE area measurementwas expressed as number of pixels. This area measurewas equivalent to, but more accurate than measuringthe thickness of RPE monolayer.RPE cell nuclei count and retinal thickness measurementFollowing our established protocol, retinal cross sectionswithin 200 μm distance from the optic disc were chosenfor the analysis because of their uniform retinal thick-ness regardless of embedding orientation [13, 18].Briefly, RPE nuclei were counted by scanning the wholeretinal section under × 20 magnification in 103 μmincrements. Retinal thickness was measured from theinner limiting membrane to the photoreceptor outersegments/RPE junction. The mean values of RPE nucleicount per increment, retinal thickness as well as ONLthickness were averaged over a minimum of 4–6 retinalsections per animal at each time point.Statistical analysesData are presented as mean ± SD. Non-parametric testswere used throughout the study except the vitrealcytokine levels and RT-PCR were analyzed by one-tailedStudent’s t test. For the non-parametric comparisonsbetween the two groups (Aβ vs control), one-tailedMann-Whitney U tests were used. All analyses wereconducted with GraphPad Prism version 6 (GraphPadSoftware, La Jolla, CA). Statistical significance was set atp ≤ 0.05.Table 2 List of primer sequencesGene Forward primer(5′-3′)Reverse Primer(5′-3′)X-linked inhibitor ofapoptosis (XIAP)CACACAGTCTACATCTCCTCTACAACCTGTCCAGTTCTGlyceraldehyde 3-phosphatedehydrogenase (GAPDH)CTCTTGTGACAAAGTGGACCCATTTGATGTTAGCGGGAGao et al. Journal of Neuroinflammation  (2018) 15:15 Page 4 of 12ResultsPro-inflammatory cytokine secretion in vitreousTo understand the overall inflammatory status in the rateyes, we collected and examined the vitreous samplesusing an ELISA-based cytokine profile assay. We foundmonocytes chemoattractant protein 1 (MCP-1), chemo-kine (C-X-C motif ) ligand 1 (GRO/KC), vascularendothelial growth factor (VEGF), and macrophage in-flammatory protein 3 alpha (MIP-3α) were increasedmore than 50% in the Aβ injected eyes compared tothose in the reverse Aβ injected (hereafter, referred to as“control”) eyes (Fig. 1). A smaller, but significant,increase was associated with vitreal IL-1β, a maturesecreted product following NLRP3 inflammasome acti-vation. However, IL-18, another NLRP3 inflammasomeproduct, was downregulated in the vitreous sample fromthe Aβ injection group compared to the control (Aβ1142.67 ± 64.15 pg/mL; control 1258.13 ± 56.49 pg/mL),which led us to further look at the inflammasomeactivity in Aβ-injected rat eyes. Measurements of theadditional cytokines studied here are given inAdditional file 2: Figure S2.NLRP3 inflammasome activation by multiple Aβ injectionsNLRP3 inflammasome activation is achieved by asequential stimulation of a priming signal and an activa-tion signal. To examine inflammasome activation inRPE, we first looked at the nuclear translocalization ofNF-κB, a signature event of NF-κB activation. Using anantibody specifically targeting the phosphorylated p65subunit of NF-κB, we found strong immunoreactivity inthe nuclei of RPE cells in Aβ-injected eyes compared tocontrol eyes (Fig. 2a–c). Next, we immunolabeledcaspase-1 in the RPE layer of both Aβ-injected andcontrol eyes, revealing that caspase-1 immunoreactivitywas enhanced by 77% compared to the control eyes(Fig. 3a). Consistent with the elevation of IL-1β in thevitreous, we found the other inflammasome activationproduct, IL-18, was also upregulated, showing more than6-fold higher immunoreactivity in the RPE layer ofAβ-injected eyes (Fig. 3b–c) and a 58% increase of IL-18band intensity in protein lysates from the Aβ injectedeyes, compared to the control eyes (Fig. 3d–e).Cell death pathways triggered by Aβ injectionsTo study the forms of RPE cell death often seen in lateAMD, especially GA, we next analyzed morphologicalchanges in RPE after Aβ injections. Using a customPhotoshop algorithm, we first applied a pigment thresh-old to identify the area occupied by RPE within a stand-ard 12 cm × 2 cm boxed area centered on the RPEmonolayer. Next, the number of pixels within thepigment threshold of that area was obtained as an indexof the area measurement occupied by the RPE. HigherFig. 1 Vitreal cytokine secretion following sequential intraocularinjections. An ELISA-based rat cytokine assay was used to measurethe vitreal cytokine levels. Cytokines with significant increase in theAβ-treated eyes compared to the controls were graphed. Sequentialinjections of Aβ led to a robust increase in chemokines (MCP-1,MIP-3α, GRO/KC), inflammasome product (IL-1β), and growth factor(VEGF). N = 7, Student’s t test, *p < 0.05Fig. 2 Activation of NF-κB pathway in retinal pigment epithelium (RPE).a–c In retinal cross sections, injections of Aβ enhanced the nucleartranslocalization of NF-κB phosphorylated p65 subunit in RPE (garnetred, arrows, a), compared to the light purple RPE nuclei in the controlgroup (arrows, b). By counting the number of RPE nuclei with garnetred (AEC) labeling, there was a ~ 50% increase in the positive RPE nucleiover the control group (c). BM, Bruch’s membrane; Ch, choroid. Scalebar 10 μm. N = 3, Mann-Whitney, *p < 0.05Gao et al. Journal of Neuroinflammation  (2018) 15:15 Page 5 of 12pixel values indicated thicker RPE monolayers. Bycomparing the Aβ-injected to the control groups, weobserved a 2-fold increase in the number of pixels,suggesting a significant area increase in the RPE,presumably due to swelling of the RPE cells (Fig. 4).To understand what caused the RPE to enlarge or swell,we prepared RPE-choroid tissue homogenates from bothinjection groups and tested them for gasdermin D(GSDMD), a protein executing pyroptosis and whoseproteolytic cleavage is triggered by both canonical andnon-canonical inflammasome activation in immune cells[19–21]. The cleaved GSDMD N-terminal fragment(N-GSDMD) at 30 kDa was increased, while the uncleavedpro-GSDMD full-length protein at 53 kDa was decreased,in the Aβ group compared to the control group (Fig. 5).Next, we also tested for apoptosis involvement usingcaspase-3 activation as a surrogate marker. By immuno-histochemistry, we found 2.5- to 4.5-fold higher immu-noreactivity levels of active caspase-3 in photoreceptorinner segments and RPE of the Aβ group, respectively,compared to the control group (Fig. 6a–b). Two exam-ples of active caspase-3 immunoreactivity from bothAβ-injected and control eyes were provided to demon-strate the enhanced red AEC labeling in photoreceptorinner segments and RPE from Aβ-injected eyes (Fig. 6c).To further support this finding, we measured the mRNAand protein levels of X-chromosome-linked inhibitor ofapoptosis (XIAP), a classic anti-apoptosis factor. At thetranscriptional level, there was a 10-fold reduction in theAβ group compared to the controls (Fig. 7a).Fig. 3 Sequential Aβ injections promote NLRP3 inflammasome activation. a Immunoreactivity of total caspase-1 showed a 77% increase in RPE of theAβ-injected eyes compared to the control group. b–c The Aβ-injected animals had a 6-fold higher IL-18 immunoreactivity than the control group (c).Representative micrographs exhibit an overall more intense IL-18 labeling (AEC, red, panel i and ii), particularly in the RPE layer (iii and iv) (b). NFL, nervefiber layer; RGC, retinal ganglion cells; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, innersegments; OS, outer segments; RPE, retinal pigment epithelium; BM, Bruch’s membrane; Ch, choroid. Scale bars 20 μm. (d–e) IL-18 western blottingshowed a 58% increase of band intensity (MW= 18 kDa) in Aβ injected animals compared to the controls. Bands shown are technical triplicates of thesame-pooled sample. N≥ 3, Mann-Whitney, *p < 0.05Gao et al. Journal of Neuroinflammation  (2018) 15:15 Page 6 of 12Concomitant with the mRNA data, there was a 33% re-duction in XIAP protein compared to the control group(Fig. 7b–c).Finally, to determine whether the activation of pyrop-totic and apoptotic pathways caused overt anatomicalchanges to the retina, we counted the RPE nuclei andassessed retinal thickness. Our results showed that therewas no significant RPE nuclei loss or retinal thicknesschanges, including the ONL thickness, in the retinalcross sections of Aβ-injected eyes compared to thecontrol eyes (Fig. 8). These measurements indicated noovert anatomical/histological changes were evident atthe time point studied here.DiscussionIn late stage AMD, RPE cells die, yet the cell deathpathways responsible remain a mystery. Based on patho-logical specimens of AMD donor eyes, atrophic RPEcells were thought to die from a necrotic cell death path-way, in which hypopigmented RPE cells filled withmembrane-bound melanolipofuscin were eliminated,resulting in the increased pigmentation and cell bodyenlargement in adjacent RPE cells [4]. More recently,reports from Kaneko et al. [5] and Tarallo et al. [6] high-light other cell death mechanisms (such as apoptosisand pyroptosis) that also likely contribute to atrophicRPE demise. However, the question remains as to whatfactors initiate the cell death cascades in AMD. In thisstudy, using an animal model in which we mimickedpro-inflammation due to prolonged (14 days) exposureFig. 4 RPE morphological changes following sequential Aβ injections.a Sequential Aβ injections caused RPE swelling, which was quantifiedby RPE area measurements using a custom Photoshop algorithmidentifying the stippled area of RPE pigment. b Animals receivingsequential control solution injections possessed thinner RPE layercompared to the Aβ group, indicated by the stippled area of RPEpigment. c The number of pixels is a surrogate marker for RPE areameasurement, which showed about 2-fold increase in Aβ groupcompared to the control group. N = 3, Mann-Whitney, *p < 0.05Fig. 5 Activation of GSDMD mediated pyroptosis in response to Aβ stimulation. RPE-choroid protein lysates from animals receiving either Aβ orcontrol injections were probed with a GSDMD antibody. Compared to the control samples, Aβ significantly promoted the proteolytic cleavage ofpro-GSDMD (53 kDa) into N-terminal GSDMD fragment (N-GSDMD, 30 kDa), a signature event indicating the activation of the pyroptotic pathway.GAPDH served as a loading control (36 kDa). Bands shown are technical triplicates of the same-pooled sample. N≥ 3, Mann-Whitney, *p < 0.05Gao et al. Journal of Neuroinflammation  (2018) 15:15 Page 7 of 12to a drusen component, Aβ, we assessed the level ofinvolvement of pyroptotic and apoptotic pathways.RPE inflammasome activation is a feature of the modelNLRP3 inflammasome activation, one of the fundamen-tal innate immune defense mechanisms, has recentlybeen studied for its role in the development of AMD[22]. Our earlier study indicated that a single Aβ injec-tion resulted in a peak in pro-inflammation at 4 dayspost injection, but then dramatically subsided [13]. Inthe current study, we extended the duration of pro-inflammation from 4 to 14 days by making sequentialinjections of Aβ every 4 days to achieve better retinalpenetration and mimic a chronic inflammatory micro-environment in the outer retina (Additional file 3: FigureS3). Our results demonstrated that longer exposure topro-inflammation triggered robust NF-κB p65 subunittranslocalization in RPE nuclei, elevated levels of totalcaspase-1 immunoreactivity, and enhanced secretion ofIL-1β in vitreous and increased IL-18 presence in retina.Collectively, these results support inflammasome activityin the RPE (Fig. 3, Additional file 3: Figure S3). Whencompared with other inflammasome studies on RPE cellsincluding ours, the current study demonstrated signifi-cant increase of IL-18 in neuroretina and RPE-choroid,but not in the vitreous where IL-1β was found upregu-lated by more than 50% (Figs. 1 and 3, Additional file 2:Figure S2). This secretion pattern is unique in that itdiversifies the downstream biological events of theseinflammasome cytokines: in our previous acute model ofsingle Aβ injection, vitreal IL-18 increased by more than3-fold at day 14 whereas vitreal IL-1β elevated by lessthan 50% compared to the controls [13]. Such discrep-ancy in IL-1β/18 vitreal levels can be partially explainedby the “distinct licensing requirements” for processingthese two cytokines by NLRP3 inflammasomes, whichmight involve further regulation of caspase-11 and/orreactive oxygen species (ROS), as evident in immunecells [23]. This mechanism is also very likely to be truein RPE cells since Aβ has recently been shown to induceNLRP3 inflammasome activation via NADPH oxidase-and mitochondria-dependent ROS pathway in vitro [24].Other studies suggest that a high level of retinal IL-18(including RPE-choroid) is more related to the cell deathevents in GA [6, 25], which support our findings thathigher IL-18 immunoreactivity levels in Aβ-injectedretina are correlated with the activation of pyroptoticpathway.Sequential injections of Aβ also provide a good modelto study Aβ’s role in inflammasome activation in the eye.Considered as one of the pathological hallmarks in AD,the deposition of Aβ in the AD brain is associated withelevated NLRP3 inflammasome activity, particularly theelevation of IL-1β production [26–28]. Using microgliaculture models, Halle et al. demonstrated the import-ance of NLRP3 inflammasome activation for the recruit-ment of microglia to Aβ deposits in the AD brain [29].Heneka et al. further discovered that in the absence ofFig. 6 Caspase-3 activation in the outer retina of Aβ-stimulated eyes. a–b Immunoreactivity of active/cleaved caspase-3 was 2.5- and 4.5-foldhigher in the Aβ-injected eyes for photoreceptors’ inner segments (IS) and RPE, respectively, compared to the control eyes. N = 3, Mann-Whitney,*p < 0.05. c Representative micrographs illustrated examples of the semi-quantitative grading of active caspase-3’s immunoreactivity in bothAβ-injected and control animals. Robust caspase-3 immunoreactivity in the IS was seen in the Aβ-injected retina, whereas weak and intermediatecaspase-3 immunoreactivity was seen in the control eyes. ONL, outer nuclear layer; OS, outer segments. Scale bar 20 μmGao et al. Journal of Neuroinflammation  (2018) 15:15 Page 8 of 12NLRP3 or caspase-1, mice carrying mutations associatedwith familial AD were largely protected from spatialmemory loss, and demonstrated reduced IL-1β secretionand enhanced Aβ clearance [27]. However, the involve-ment of these pathways has not been well established inthe eye tissue. As a continuation from our previous stud-ies [13], our current Aβ multi-injection model recapitu-lates seminal features associated with each step of theNLRP3 inflammasome activation cascades. Therefore, bygiving the animals sequential Aβ injections, we were ableto sustain Aβ-induced pro-inflammatory responses inthe neuroretina and RPE at a comparably high level untilday 14, when the presence of Aβ was much diminishedin the single Aβ injection model [13].Pyroptosis and apoptosis may contribute to RPE celldeath in this modelThe involvement of NLRP3 inflammasome activation inRPE has been studied in many different AMD models[30–33]. However, once the inflammasome is activated,little is known of the exact biological events that occurand whether these events lead to cell death. Usingrodent and non-human primate models, Doyle andcolleagues demonstrate the efficacy of IL-18 treatmentas a potential alternative, adjuvant therapy for CNV[34–36]. On the other side, Ambati and collaboratorsshowed evidence that IL-18 drives RPE degenerationafter NLRP3 inflammasome activation in murine models[6, 37]. In the current study, we also assessed thechanges after activation of the NLRP3 inflammasome byAβ. Intriguingly, after prolonged pro-inflammation inouter retina, we found enlarged or swollen RPE cells andsignificant increases in the proteolytic cleavage of full-length GSDMD in the RPE-choroid tissues. As reportedby earlier studies, the cytolytic effects of pyroptosis aremediated by the oligomerization of the GSDMD’sN-terminal fragments (N-GSDMD) in cellular mem-brane, resulting in the cell-burst pore formation [38].Hence, it confirms the activation of pyroptotic pathwayin the Aβ-injected animals [19]. Therefore, we havedemonstrated the co-existence of two events that occurafter inflammasome activation: the secretion of maturepro-inflammatory cytokines, including the inflamma-some products (IL-18 and IL-1β) and morphological andFig. 7 Decline of XIAP gene expression levels in Aβ-stimulated eyes.a Reverse transcriptional PCR revealed a 90% reduction of XIAP mRNA inAβ-stimulated eyes compared to controls. N≥ 3, Student’s t test, *p< 0.05.b–c In whole retina protein lysates, there was a significant 33% decreaseof the XIAP protein level in Aβ-stimulated eyes compared to reverse Aβcontrols. Bands shown are technical triplicates of the same-pooled sample.N= 5, Mann-Whitney, *p < 0.05Fig. 8 No changes in RPE nuclei number and retinal thickness in Aβ-stimulated eyes. The number of RPE nuclei per 103 μm (a), ONL thickness(b), and retinal thickness (c) were measured in both the Aβ-stimulated and control animals’ eyes. No significant difference was found betweenthe two groups in all three analytical categories (N = 3, Mann-Whitney)Gao et al. Journal of Neuroinflammation  (2018) 15:15 Page 9 of 12western blot evidence that supports the GSDMD-mediated pyroptotic pathway activation in RPE cells.Such an orchestrated response has also been seen innon-ocular cell types [39].Unlike pyroptosis, which rapidly lyses the cell, apoptosisis considered as a non-inflammatory and non-cytolyticform of programmed cell death. From a canonical point ofview, pyroptosis is biochemically characterized ascaspase-1 dependent and caspase-3 independent, whereasapoptosis is often caspase-3 dependent and caspase-1independent. Interestingly, in the current study, weobserved parallel cleavage of both caspase-1 and caspase-3 in the RPE tissue, challenging the dogma of their mutualexclusiveness. Although it is biologically impossible forone single cell to undergo both distinctive cell death path-ways, it is still likely for one type of tissue, such as the RPEmonolayer in the retina, to accommodate these pathwaysin a spatially discrete and stimulus dose-dependentmanner. One study using murine bone marrow-derivedmacrophages exploited the potential of crosstalk betweenpyroptosis and apoptosis. The authors exhibited aDNA-dose dependent integral model for cell death, withapoptosis seen at a lower-dose of DNA stimulation andpyroptosis at higher doses. They further concluded thatsuch an explicit response is regulated through caspase-8activation [40].Despite the fact that our data supported the activationof both pyroptotic and apoptotic pathways in the RPE-choroid tissue of multiple Aβ-injected eyes, there wereno significant anatomical changes as indicated by RPEnuclei counts and retinal thickness measurements(Fig. 8). All the biochemical markers used in this study(IL-18, IL-1β, NF-κB, caspase-1, caspase-3, GSDMD,XIAP) proved changes leading towards RPE atrophy viaboth cell death pathways. Combined with the anatomicaldata, our results suggest a transition between early andmiddle-to-late stage of dry AMD, where RPE cells beginto show early biochemical signs of cell death and beforeany observable retinal structural changes.RPE-specific vs choroidal macrophage-mediatedresponses in vivoThe ability to dissect RPE-choroid from neuroretinawas demonstrated in our earlier work [11, 13] andthose of others [41]. However, it is possible that in theRPE-choroid sample, the choroidal component withmacrophages, may also contribute to the inflammasomeactivity in our in vivo work. Testing for activated mac-rophages by immunohistochemistry in paraffin sectionsor by microdissection of choroidal tissue alone [42]may help us better understand the migration ofimmune cells from choroid in our Aβ-injected animalgroups. It is possible that the choroidal macrophages,important immune cells associated with AMD [43, 44]in combination with RPE may both work to exacerbate thechronic inflammatory milieu in the AMD eye. Therefore,future in vitro work on cultured RPE cells and choroidalmacrophages will allow us to define the role of each celltype without the confounding effects from the other.ConclusionsIn conclusion, we have demonstrated the activation of twodistinct cell death pathways in RPE following prolongedpro-inflammation induced by drusen component, Aβ. Forthe first time, we show that GSDMD cleavage is associatedwith inflammasome activation in RPE, providing themolecular basis for pyroptosis participation in this model.Consistent with other studies using postmortem humanAMD donor eye tissues [6], our model recapitulates thekey events in the NLRP3 inflammasome cascade. Further-more, the presence of swollen, enlarged RPE cells in thismodel represents another prominent feature of RPE mor-phological changes during AMD progression [10, 45].Even though the retinal morphological analysis found noevidence of ultimate RPE cell loss or retinal thinning inthis model, the biochemical events revealed here pointtowards a critical transitional stage that may further leadto the occurrence of RPE cell death. Understanding thedetailed molecular mechanisms associated with this stagewill benefit future endeavors in the search of therapeuticagents to slow down, or even prevent, RPE cell death inAMD.Additional fileAdditional file 1: Figure S1. Preparation of oligomeric Aβ. (A) Variousincubation conditions were tested for the optimal oligomeric Aβ generation.Small oligomeric (dimeric and trimeric) and monomeric Aβ species weregenerated after a shorter period of incubation time (24 h, 100 μM). Note thatthe higher molecular Aβ species began to increase after 48 h (MW>170 kDa). (B) Western blot of the 48 h-incubated oligomeric Aβ solution,prepared for intraocular injections (7 μg/5 μL). The control peptide wasprepared the same way as Aβ, but was non-reactive to the 6E10 antibodydetection. (EPS 5439 kb)Additional file 2: Figure S2. Additional vitreal cytokine levels followingsequential Aβ injections. A list of rat cytokines in addition to Fig. 1 wasexamined in vitreous samples from both the Aβ-stimulated and thecontrol animals’ eyes using the ELISA-based premade assay. Unlike Fig. 1’sdata, all these cytokines showed less than 50% change of concentrationlevels between the two animal groups, many of which had even lowermeasurements in the Aβ-stimulated group, for instance, IL-18. N = 7,Student’s t test, *p < 0.05. RANTES, regulated on activation normal T cellexpressed and secreted; GM-CSF, granulocyte macrophage colony stimulatingfactor; EPO, erythropoietin; G-CSF, granulocyte colony stimulating factor;M-CSF, macrophage colony stimulating factor. (EPS 170 kb)Additional file 3: Figure S3. Retinal distribution of injected Aβ. Toensure the effectiveness of sequential Aβ injections, retinal cross-sectionsfrom day 14 (indicated as “3X Aβ day 14”) were stained for the injectedAβ using the 6E10 antibody (Table 1). As visualized by the red AEC, Aβexhibited good penetration of all retinal layers from retinal ganglion celllayer to RPE. Compared to its counterpart from our previous acute Aβmodel (indicated as “1X Aβ day 14”), the current 3X Aβ day 14 retinalcross-sections showed much stronger Aβ immunoreactivity, suggesting ahigher retinal Aβ concentration maintained by the sequential AβGao et al. Journal of Neuroinflammation  (2018) 15:15 Page 10 of 12injections. Such robust Aβ immunoreactivity in the 3X Aβ day 14 tissue(neuroretina + RPE) was comparable to those of 1X Aβ retinal tissues atdays 1 and 4, with even more enhanced labeling in the outer nucleilayer. RGC, retinal ganglion cell; IPL, inner plexiform layer; INL, inner nucleilayer; OPL, outer plexiform layer; ONL, outer nuclei layer; IS/OS, inner/outer segments. Scale bar 20 μm. (EPS 13727 kb)AbbreviationsAD: Alzheimer’s disease; AEC: 3-amino-9-ethylcarbazole; AMD: Age-relatedmacular degeneration; ASC: Apoptosis-associated speck-like proteincontaining a carboxy-terminal CARD; Aβ: Amyloid beta; CNV: Choroidalneovascularization; DMSO: Dimethyl sulfoxide; ELISA: Enzyme-linkedimmunosorbent assay; GA: Geographic atrophy; GRO/KC: Chemokine (C-X-Cmotif) ligand 1; GSDMD: Gasdermin D; HFIP: 1,1,1,3,3,3-hexafluoro-2-propanol;IL-18: Interleukin-18; IL-1β: Interleukin-1beta; MCP-1: Monocyteschemoattractant protein 1; MIP-3α: Macrophage inflammatory protein3 alpha; NF-κB: Nuclear factor kappa B; N-GSDMD: GSDMD N-terminalfragment; NLRP3: NLR family pyrin domain containing 3; PBS: Phosphatebuffered saline; PCR: Polymerase chain reaction;RIPA: Radioimmunoprecipitation assay; RPE: Retinal pigment epithelium;TUNEL: Terminal deoxynucleotidyl transferase dUTP nick end-labeling;VEGF: Vascular endothelial growth factor; WB: Western blot; XIAP: X-chromosome linked inhibitor of apoptosisAcknowledgementsThe authors acknowledge the technical assistance provided by Alison Fong,Elliott To, Cyrus Thomas, Aikun Wang, and Matthew Wong.FundingThe study was funded by a Canadian Institutes of Health Research operatinggrant to J.A.M. (MOP126195). The funding body did not participate in thedesign of the study, collection, analysis, and interpretation of data, andwriting the manuscript in any forms.Availability of data and materialsAll data generated or analyzed during this study are included in thispublished article.Authors’ contributionsJG performed the experiments, analyzed and interpreted the data, and wrotethe manuscript. JZC designed the study, helped with the experiments anddata analysis/interpretation, and contributed to manuscript revision. ETassisted with data collection, analysis, and interpretation, and edited themanuscript. SC assisted with data collection and interpretation, providedsupport for statistical analysis, and edited the manuscript. JAM conceivedand designed the study, obtained funding, analyzed and interpreted thedata, and critically revised the manuscript. All authors read and approved thefinal manuscript.Ethics approvalAll animal procedures were approved by the Animal Care Committee of theUniversity of British Columbia, conformed to the guidelines of the CanadianCouncil on Animal Care and in accordance with the Resolution on the Useof Animals in Research of the Association of Research in Vision andOphthalmology. Efforts were made to ensure animal welfare and tominimize their pain, distress, and discomfort whenever possible.Competing interestsThe authors declare that they have no competing interests.Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.Received: 24 August 2017 Accepted: 9 January 2018References1. Wong WL, Su X, Li X, Cheung CM, Klein R, Cheng CY, Wong TY. Globalprevalence of age-related macular degeneration and disease burdenprojection for 2020 and 2040: a systematic review and meta-analysis. LancetGlob Health. 2014;2:e106–16.2. Age-Related Eye Disease Study Research G. A simplified severity scale forage-related macular degeneration: AREDS report no. 18. Arch Ophthalmol.2005;123:1570–4.3. Amoaku WM, Chakravarthy U, Gale R, Gavin M, Ghanchi F, Gibson J, HardingS, Johnston RL, Kelly SP, Lotery A, et al. Defining response to anti-VEGFtherapies in neovascular AMD. Eye (Lond). 2015;29:721–31.4. Sarks JP, Sarks SH, Killingsworth MC. Evolution of geographic atrophy of theretinal pigment epithelium. Eye (Lond). 1988;2(Pt 5):552–77.5. Kaneko H, Dridi S, Tarallo V, Gelfand BD, Fowler BJ, Cho WG, Kleinman ME,Ponicsan SL, Hauswirth WW, Chiodo VA, et al. DICER1 deficit induces AluRNA toxicity in age-related macular degeneration. Nature. 2011;471:325–30.6. Tarallo V, Hirano Y, Gelfand BD, Dridi S, Kerur N, Kim Y, Cho WG, Kaneko H,Fowler BJ, Bogdanovich S, et al. DICER1 loss and Alu RNA induce age-related macular degeneration via the NLRP3 inflammasome and MyD88.Cell. 2012;149:847–59.7. Hageman GS, Luthert PJ, Victor Chong NH, Johnson LV, Anderson DH, MullinsRF. An integrated hypothesis that considers drusen as biomarkers of immune-mediated processes at the RPE-Bruch’s membrane interface in aging andage-related macular degeneration. Prog Retin Eye Res. 2001;20:705–32.8. Dunaief JL, Dentchev T, Ying GS, Milam AH. The role of apoptosis inage-related macular degeneration. Arch Ophthalmol. 2002;120:1435–42.9. Bergsbaken T, Fink SL, Cookson BT. Pyroptosis: host cell death andinflammation. Nat Rev Microbiol. 2009;7:99–109.10. Gao J, Liu RT, Cao S, Cui JZ, Wang A, To E, Matsubara JA. NLRP3inflammasome: activation and regulation in age-related maculardegeneration. Mediat Inflamm. 2015;2015:690243.11. Zhao T, Gao J, Van J, To E, Wang A, Cao S, Cui JZ, Guo JP, Lee M, McGeerPL, Matsubara JA. Age-related increases in amyloid beta and membraneattack complex: evidence of inflammasome activation in the rodent eye. JNeuroinflammation. 2015;12:121.12. Hoh Kam J, Lenassi E, Jeffery G. Viewing ageing eyes: diverse sites ofamyloid Beta accumulation in the ageing mouse retina and the up-regulation of macrophages. PLoS One. 2010;5(10):e13127.13. Liu RT, Gao J, Cao S, Sandhu N, Cui JZ, Chou CL, Fang E, Matsubara JA.Inflammatory mediators induced by amyloid-beta in the retina and RPE invivo: implications for inflammasome activation in age-related maculardegeneration. Invest Ophthalmol Vis Sci. 2013;54:2225–37.14. Kurji KH, Cui JZ, Lin T, Harriman D, Prasad SS, Kojic L, Matsubara JA.Microarray analysis identifies changes in inflammatory gene expression inresponse to amyloid-beta stimulation of cultured human retinal pigmentepithelial cells. Invest Ophthalmol Vis Sci. 2010;51:1151–63.15. Liu RT, Wang A, To E, Gao J, Cao S, Cui JZ, Matsubara JA. Vinpocetineinhibits amyloid-beta induced activation of NF-kappaB, NLRP3inflammasome and cytokine production in retinal pigment epithelial cells.Exp Eye Res. 2014;127:49–58.16. Sarroukh R, Cerf E, Derclaye S, Dufrene YF, Goormaghtigh E, Ruysschaert JM,Raussens V. Transformation of amyloid beta(1-40) oligomers into fibrils ischaracterized by a major change in secondary structure. Cell Mol Life Sci.2011;68:1429–38.17. Stine WB, Jungbauer L, Yu C, LaDu MJ. Preparing synthetic Abeta indifferent aggregation states. Methods Mol Biol. 2011;670:13–32.18. Guo L, Normando EM, Nizari S, Lara D, Cordeiro MF. Tracking longitudinalretinal changes in experimental ocular hypertension using the cSLO andspectral domain-OCT. Invest Ophthalmol Vis Sci. 2010;51:6504–13.19. Shi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, Zhuang Y, Cai T, Wang F,Shao F. Cleavage of GSDMD by inflammatory caspases determinespyroptotic cell death. Nature. 2015;526:660–5.20. He WT, Wan H, Hu L, Chen P, Wang X, Huang Z, Yang ZH, Zhong CQ, Han J.Gasdermin D is an executor of pyroptosis and required for interleukin-1betasecretion. Cell Res. 2015;25:1285–98.21. Kayagaki N, Stowe IB, Lee BL, O'Rourke K, Anderson K, Warming S, Cuellar T,Haley B, Roose-Girma M, Phung QT, et al. Caspase-11 cleaves gasdermin Dfor non-canonical inflammasome signalling. Nature. 2015;526:666–71.22. Celkova L, Doyle SL, Campbell M. NLRP3 inflammasome and pathobiologyin AMD. J Clin Med. 2015;4:172–92.23. Schmidt RL, Lenz LL. Distinct licensing of IL-18 and IL-1beta secretion inresponse to NLRP3 inflammasome activation. PLoS One. 2012;7:e45186.24. Wang K, Yao Y, Zhu X, Zhang K, Zhou F, Zhu L. Amyloid β inducesNLRP3 inflammasome activation in retinal pigment epithelial cells viaGao et al. Journal of Neuroinflammation  (2018) 15:15 Page 11 of 12NADPH oxidase- and mitochondria-dependent ROS production. J BiochemMol Toxicol. 2016;31:e21887.25. Kim Y, Tarallo V, Kerur N, Yasuma T, Gelfand BD, Bastos-Carvalho A, Hirano Y,Yasuma R, Mizutani T, Fowler BJ, et al. DICER1/Alu RNA dysmetabolisminduces caspase-8-mediated cell death in age-related macular degeneration.Proc Natl Acad Sci U S A. 2014;111:16082–7.26. Olsen I, Singhrao SK. Inflammasome involvement in Alzheimer’s disease. JAlzheimers Dis. 2016;54:45–53.27. Heneka MT, Kummer MP, Stutz A, Delekate A, Schwartz S, Vieira-SaeckerA, Griep A, Axt D, Remus A, Tzeng TC, et al. NLRP3 is activated inAlzheimer’s disease and contributes to pathology in APP/PS1 mice.Nature. 2013;493:674–8.28. Salminen A, Ojala J, Suuronen T, Kaarniranta K, Kauppinen A. Amyloid-betaoligomers set fire to inflammasomes and induce Alzheimer’s pathology. JCell Mol Med. 2008;12:2255–62.29. Halle A, Hornung V, Petzold GC, Stewart CR, Monks BG, Reinheckel T,Fitzgerald KA, Latz E, Moore KJ, Golenbock DT. The NALP3 inflammasome isinvolved in the innate immune response to amyloid-beta. Nat Immunol.2008;9:857–65.30. Tseng WA, Thein T, Kinnunen K, Lashkari K, Gregory MS, D’Amore PA,Ksander BR. NLRP3 inflammasome activation in retinal pigment epithelialcells by lysosomal destabilization: implications for age-related maculardegeneration. Invest Ophthalmol Vis Sci. 2013;54:110–20.31. Anderson OA, Finkelstein A, Shima DT. A2E induces IL-1ss production inretinal pigment epithelial cells via the NLRP3 inflammasome. PLoS One.2013;8:e67263.32. Kerur N, Hirano Y, Tarallo V, Fowler BJ, Bastos-Carvalho A, Yasuma T,Yasuma R, Kim Y, Hinton DR, Kirschning CJ, et al. TLR-independent andP2X7-dependent signaling mediate Alu RNA-induced NLRP3inflammasome activation in geographic atrophy. Invest Ophthalmol VisSci. 2013;54:7395–401.33. Kauppinen A, Niskanen H, Suuronen T, Kinnunen K, Salminen A, KaarnirantaK. Oxidative stress activates NLRP3 inflammasomes in ARPE-19cells—implications for age-related macular degeneration (AMD). ImmunolLett. 2012;147:29–33.34. Doyle SL, Campbell M, Ozaki E, Salomon RG, Mori A, Kenna PF, Farrar GJ,Kiang AS, Humphries MM, Lavelle EC, et al. NLRP3 has a protective role inage-related macular degeneration through the induction of IL-18 by drusencomponents. Nat Med. 2012;18:791–8.35. Doyle SL, Ozaki E, Brennan K, Humphries MM, Mulfaul K, Keaney J, Kenna PF,Maminishkis A, Kiang AS, Saunders SP, et al. IL-18 attenuates experimentalchoroidal neovascularization as a potential therapy for wet age-relatedmacular degeneration. Sci Transl Med. 2014;6:230ra244.36. Doyle SL, Lopez FJ, Celkova L, Brennan K, Mulfaul K, Ozaki E, Kenna PF,Kurali E, Hudson N, Doggett T, et al. IL-18 immunotherapy for neovascularAMD: tolerability and efficacy in nonhuman primates. Invest Ophthalmol VisSci. 2015;56:5424–30.37. Hirano Y, Yasuma T, Mizutani T, Fowler BJ, Tarallo V, Yasuma R, Kim Y,Bastos-Carvalho A, Kerur N, Gelfand BD, et al. IL-18 is not therapeutic forneovascular age-related macular degeneration. Nat Med. 2014;20:1372–5.38. Liu X, Zhang Z, Ruan J, Pan Y, Magupalli VG, Wu H, Lieberman J.Inflammasome-activated gasdermin D causes pyroptosis by formingmembrane pores. Nature. 2016;535:153–8.39. Sborgi L, Ruhl S, Mulvihill E, Pipercevic J, Heilig R, Stahlberg H, Farady CJ,Muller DJ, Broz P, Hiller S. GSDMD membrane pore formation constitutesthe mechanism of pyroptotic cell death. EMBO J. 2016;35:1766–78.40. Sagulenko V, Thygesen SJ, Sester DP, Idris A, Cridland JA, Vajjhala PR,Roberts TL, Schroder K, Vince JE, Hill JM, et al. AIM2 and NLRP3inflammasomes activate both apoptotic and pyroptotic death pathways viaASC. Cell Death Differ. 2013;20:1149–60.41. Woodell A, Coughlin B, Kunchithapautham K, Casey S, Williamson T, FerrellWD, Atkinson C, Jones BW, Rohrer B. Alternative complement pathwaydeficiency ameliorates chronic smoke-induced functional andmorphological ocular injury. PLoS One. 2013;8:e67894.42. Newman AM, Gallo NB, Hancox LS, Miller NJ, Radeke CM, Maloney MA,Cooper JB, Hageman GS, Anderson DH, Johnson LV, Radeke MJ.Systems-level analysis of age-related macular degeneration revealsglobal biomarkers and phenotype-specific functional networks. GenomeMed. 2012;4:16.43. Ardeljan D, Chan CC. Aging is not a disease: distinguishing age-relatedmacular degeneration from aging. Prog Retin Eye Res. 2013;37:68–89.44. McLeod DS, Bhutto I, Edwards MM, Silver RE, Seddon JM, Lutty GA.Distribution and quantification of choroidal macrophages in human eyeswith age-related macular degeneration. Invest Ophthalmol Vis Sci. 2016;57:5843–55.45. Bressler SB, Bressler, N.M.: Age-related macular degeneration: non-neovascular early AMD, intermediate AMD, and geographic atrophy. InRetina (Ryan SJ ed., vol. 2, 5th edition. London: Elsevier; 2014. p. 1150–82.•  We accept pre-submission inquiries •  Our selector tool helps you to find the most relevant journal•  We provide round the clock customer support •  Convenient online submission•  Thorough peer review•  Inclusion in PubMed and all major indexing services •  Maximum visibility for your researchSubmit your manuscript atwww.biomedcentral.com/submitSubmit your next manuscript to BioMed Central and we will help you at every step:Gao et al. Journal of Neuroinflammation  (2018) 15:15 Page 12 of 12

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0363043/manifest

Comment

Related Items