UBC Faculty Research and Publications

Regulation of LRRK2 promoter activity and gene expression by Sp1 Wang, Juelu; Song, Weihong Mar 22, 2016

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-13041_2016_Article_215.pdf [ 2.1MB ]
Metadata
JSON: 52383-1.0308627.json
JSON-LD: 52383-1.0308627-ld.json
RDF/XML (Pretty): 52383-1.0308627-rdf.xml
RDF/JSON: 52383-1.0308627-rdf.json
Turtle: 52383-1.0308627-turtle.txt
N-Triples: 52383-1.0308627-rdf-ntriples.txt
Original Record: 52383-1.0308627-source.json
Full Text
52383-1.0308627-fulltext.txt
Citation
52383-1.0308627.ris

Full Text

RESEARCH Open AccessRegulation of LRRK2 promoter activity andgene expression by Sp1Juelu Wang and Weihong Song*AbstractBackground: The dopaminergic neurodegeneration in the nigrostriatal pathway is a prominent neuropathologicalfeature of Parkinson’s disease (PD). Mutations in various genes have been linked to familial PD, and leucine-richrepeat kinase 2 (LRRK2) gene is one of them. LRRK2 is a large complex protein, belonging to the ROCO family ofproteins. Recent studies suggest that the level of LRRK2 protein is one of the contributing factors to PDpathogenesis. However, it remains elusive how LRRK2 is regulated at the transcriptional and translational level.Results: In this study, we cloned a 1738 bp 5’-flanking region of the human LRRK2 gene. The transcriptional startsite (TSS) was located to 135 bp upstream of translational start site and the fragment −118 to +133 bp had theminimum promoter activity required for transcription. There were two functional Sp1- responsive elements on thehuman LRRK2 gene promoter revealed by electrophoretic mobility shift assay (EMSA). Sp1 overexpression promotedLRRK2 transcription and translation in the cellular model. On the contrary, application of mithramycin A inhibitedLRRK2 transcriptional and translational activities.Conclusion: This is the first study indicating that Sp1 signaling plays an important role in the regulation of humanLRRK2 gene expression. It suggests that controlling LRRK2 level by manipulating Sp1 signaling may be beneficial toattenuate PD-related neuropathology.Keywords: LRRK2, Sp1, Parkinson’s disease, Gene regulationBackgroundParkinson’s disease (PD) is the second most commonneurodegenerative disorder, affecting 1–2 % of individ-uals older than 65 years of age and 4–5 % of people whoare 85-year-old [1–3]. Its clinical manifestations arecharacterized by bradykinesia, resting tremor, muscularrigidity and postural instability [4]. Pathologically, thereare two prominent features seen in PD patients. One issevere and relatively selective dopaminergic neurodegen-eration in the nigrostriatal pathway, which underlies thedeficits in the motor systems [5, 6]. The other iscytoplasmic Lewy bodies (LBs), which primarily consistof aggregated alpha-synuclein [7]. Although tremendousefforts have been put into discovering the effective ther-apies, most of the treatments today are only palliativeinstead of modifying disease progression. Over the pastyears, several genes with mutations have been identifiedin the familial PD cases, including alpha-synuclein (SNCA)[8, 9], leucine-rich repeat kinase 2 (LRRK2) [2, 3], Parkin[10], PTEN induced putative kinase 1 (PINK1) [11], DJ-1[12], ATP13A2 or PARK9 [13], and VPS35 [14, 15].Among these key players, mutations in the LRRK2contribute to the most frequent cause of familial PD,and LRRK2 variants are also implicated to increaserisk factors in the sporadic cases [16, 17]. Addition-ally, clinical features of LRRK2-associated PD patientsare indistinguishable from the idiopathic cases, andmost LRRK2 mutation carriers are positive for alpha-synuclein LBs [18]. Moreover, multiple lines of evi-dence support that LRRK2 interacts with other keymolecules in the PD pathogenesis, including SNCA,Parkin, DJ-1 and PINK [19–21].LRRK2 gene contains 51 exons and encodes a large286kD complex protein of 2527 amino acids. It belongsto the ROCO family of proteins, characterized by a cata-lytic Ras of complex proteins (ROC) GTPase domain, a* Correspondence: weihong@mail.ubc.caDepartment of Psychiatry, Townsend Family Laboratories, Graduate Programin Neuroscience, The University of British Columbia, 2255 Wesbrook Mall,Vancouver, BC V6T 1Z3, Canada© 2016 Wang and Song. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Wang and Song Molecular Brain  (2016) 9:33 DOI 10.1186/s13041-016-0215-5C-terminal of ROC (COR) domain and a kinase domain,which phosphorylates serine/threonine residues. Thiscentral tri-domain is flanked by various potentialprotein-protein interaction domains, including armadillo(ARM), ankyrin (ANK), leucine-rich and WD40 repeats[3, 22]. LRRK2 mRNA is widely expressed throughoutthe brain and other organs, including kidney, heart, lung,and liver [23]. In the brain, it is relatively high in thedopaminoceptive regions instead of dopaminergic neu-rons [24, 25].LRRK2, also known as PARK8, was first discovered inautosomal-dominant, late-onset parkinsonism by geneticlinkage analysis in 2002, and two years later, LRRK2gene was cloned and its related mutations were reported[2, 3, 26]. Extensive works have been done to explorethe pathophysiological role of LRRK2. Several pieces ofdata suggest that LRRK2 is involved in regulating neuritegrowth and cytoskeleton dynamics [27–29], maintainingfunctions of autophagy and lysosome [30–34], andmodifying protein translation [35, 36] and vesicle traf-ficking [37–39]. There are over 75 substitutions havebeen found in LRRK2, and seven missense mutations(G2019S, I2020T, N1437H, R1441G/C/H and Y1699C) arepathogenic, all of which are concentrated in the centralcatalytic domains, suggesting an essential role of GTPaseand kinase domains in the PD pathogenesis [40, 41].Carboxyl terminus of HSP70-interacting protein(CHIP) was shown to interact with LRRK2 and be in-volved in regulating steady-state level of LRRK2 throughubiquitin proteasomal degradation pathway. Knockdownof CHIP was capable of exacerbating wildtype (WT) andmutant LRRK2-induced cell toxicity [42]. A more recentstudy implicated that the level of mutant LRRK2 wasmore predicative than kinase activity for its pathogeniceffect and formation of inclusion bodies in neurons, sug-gesting manipulation of cellular level of LRRK2 is an-other option for treating LRRK2-associated PD [43].Dysregulation of transcription was implicated in Alz-heimer’s disease (AD), Huntington’s disease (HD) andPD [44–52]. A study found that LRRK2 mRNA wasdecreased in PD patients with comparison to controlsubjects [53]. However, it is still unknown that howLRRK2 is regulated at the transcriptional and transla-tional level.In this study we functionally analyzed human LRRK2gene transcription. We first identified its transcriptionstart site (TSS) and cloned its 1738 bp promoter region.There were multiple putative transcription factor-bindingsites for various transcription factors, including Sp1,GATA1/2, c-Jun, HNF-3α, and NF-AT1. Furthermore, thetranscription factor Sp1 was shown to promote humanLRRK2 gene promoter activity and gene expression,whereas its inhibitor, mithramycin A (MTM), reduced thepromoter activity and gene expression. This is the firststudy to examine the role of Sp1 signaling in regulatingLRRK2 gene expression.ResultsCloning the human LRRK2 gene promoter and mappingits transcriptional start siteTo define the region of LRRK2 gene promoter, totalRNA was extracted from HEK293 cell and 5’-rapid amp-lification of cDNA ends (RACE) assay was applied toidentify the transcriptional start site of human LRRK2gene. After amplifying the full length of LRRK2 cDNA,two pairs of primers were used to perform nested poly-merase chain reaction (PCR). An ~300 bp band wasyielded after inner PCR on 1.5 % agarose gel and the se-quencing results indicated that the TSS was located135 bp upstream of translational start site (ATG) (Fig. 1a,b). The transcriptional start site began with guanine andwas designated as +1. To study the human LRRK2 genepromoter, a 1738 bp 5’-flanking region of human LRRK2gene was cloned from HEK293 cell gDNA and thefragment was sequenced. A computational transcriptionfactor search (PROMO, online tool) for 5’-flanking re-gion of the human LRRK2 gene revealed that the humanLRRK2 promoter contains several putative regulatoryelements, including Sp1, GATA1/2, c-Jun, HNF-3α, andNF-AT1 (Fig. 1c).Functional analyses of the human LRRK2 gene promoterTo investigate the activity of human LRRK2 gene pro-moter, ten deletion fragments of its 5’-flanking regionwere cloned into pGL3-Basic vector (Fig. 2a). The con-struction of plasmids was verified by enzyme digestion(Fig. 2b). This vector lacks eukaryotic promoter and en-hancer, but contains a firefly luciferase reporter gene.The expression of luciferase gene is driven by the cor-rectly inserted promoter upstream of it. Constructedplasmids were transfected into cells and the insertedpromoters’ activities were evaluated by the biolumines-cent measurement of luciferase protein. The promoteractivity of pLRRK2-A plasmid covering from −1738 bpto +133 bp was 8.27 ± 0.35 RLU, significantly higher thanpGL3-Basic (P < 0.0001, Fig. 2c), indicating that this frag-ment worked as a functional promoter. To validate lucif-erase assay, four plasmids lacking TSS in its promoterregion, including pLRRK2-B, pLRRK2-D, pLRRK2-Hand pLRRK2-I, were served as experimental negativecontrols. As expectedly, all of four plasmids did not havepromoter activities when comparing with pGL3-Basic(p > 0.05). A 944 bp deletion from pLRRK2-A to con-struct pLRRK2-C significantly increased promoter activ-ities to 11.25 ± 0.38 RLU (p < 0.0001). Promoter activityof pLRRK2-E, containing a fragment −495 to +133 bp,was 7.70 ± 0.29 RLU, significantly weaker than pLRRK2-C(p < 0.0001). A further deletion from −495 bp (pLRRK2-E)Wang and Song Molecular Brain  (2016) 9:33 Page 2 of 13to −413 bp (pLRRK2-F) drastically increased promoter ac-tivity to 15.52 ± 0.23 RLU (p < 0.0001) and a deletion of295 bp from pLRRK2-F to create pLRRK2-G significantlylowered promoter activity to 9.89 ± 0.56 RLU (p < 0.0001).Importantly, when the fragment from −118 to −34 bp wasdeleted from pLRRK2-G to generate pLRRK2-J, promoteractivity became negligible (0.78 ± 0.02 RLU). These datasuggest that the fragment −118 to +133 bp has theminimum promoter activity required for transcription.Additionally, promoter regions from −1738 to −794 bpand −495 to −413 bp have negatively regulatory cis-act-ing elements and promoter region from −794 to−495 bp and −413 to −118 bp have upregulatory cis-acting elements.The human LRRK2 gene contains Sp1 binding sitesComputational transcription factor search (PROMO, on-line tool) the human LRRK2 gene revealed three putativeFig. 1 Identification of TSS and sequence features of the human LRRK2 gene promoter. a Smarter RACE cDNA amplification kit was used toamplify full-length cDNA from HEK293 cells. Nested PCR was performed and the product was resolved on 1.5 % agarose gel. b TSS was locatedby sequencing PCR product. The first base pair after SMARTer oligonucleotide is the TSS, which is indicated by arrow in Figure. c Sequence of thehuman LRRK2 promoter from -1865 bp to + 213 bp of the TSS (+1) is illustrated here. The putative transcription factor binding sites are underlinedby computational searchWang and Song Molecular Brain  (2016) 9:33 Page 3 of 13sp1 binding sites in its promoter region, including −537to −529 bp, −263 to −254 bp and −51 to −43 bp (Fig. 1c).To examine the effect of Sp1 on human LRRK2 genepromoter, the promoter activities of pLRRK2-C, whichcontained all three putative Sp1 binding sites, were mea-sured in HEK293 cells cotransfected with Sp1 expressionplasmids. The promoter activities of pLRRK2-J with noputative Sp1 binding sites were also examined to serveas a negative control (Fig. 3a). The results showed thatthe promoter activity of pLRRK2-C significantly in-creased from 10.43 ± 0.68 RLU to 34.79 ± 2.01 RLU afterSp1 overexpression (p < 0.001), but not for the promoteractivity of pLRRK2-J (p > 0.05), demonstrating that Sp1upregulated LRRK2 gene promoter activity in HEK293cells. To confirm the specificity of Sp1’s effect on LRRK2promoter activity, Sp1 siRNA was used to knock downall three isoforms for human Sp1, and a scrambledsiRNA serves as a negative control. The endogenous Sp1expression was significantly decreased in the HEK293 bythe siRNA treatment cells (Fig. 4j). Knockdown ofendogenous Sp1 significantly reduced the promoteractivities of pLRRK2-C from 11.57 ± 0.46 RLU to 2.53 ±0.01 RLU (p < 0.0001), but had no effect on plasmidpLRRK2-J (p > 0.05) (Fig. 3b).To determine whether all three putative Sp1 bindingsites were functional, EMSA was conducted to examinethe binding between Sp1 and these promoter regions invitro (Fig. 3c). Sp1 expression plasmid pCGN-Sp1 wastransfected into HEK293 cells followed by extractingnuclear proteins from cell lysate. Double-stranded nucle-otides containing the Sp1 consensus binding sequence(attcgatcgGGGCGGGgcgagc) were synthesized andlabelled with IRD700 dye. Therefore, a free probe bandcan be observed on DNA polyacrylamide gel electro-phoresis (PAGE) gel as shown in the first lane in Fig. 3c.A shifted band was visualized on DNA PAGE gel afteradding Sp1- enriched nuclear extract (Fig. 3c, Lane 2).To ensure the specificity of this shifted band, WT oligo-nucleotides, containing Sp1 consensus binding sequencewithout labeling, and unlabeled mutant oligonucleotideswere added to EMSA system. As expectedly, unlabeledWT oligonucleotides with 2- fold concentration oflabelled probe successfully competed shifted band(Fig. 3c, Lane 3) and more excess of WT competitorsfurther decreased intensity of the shifted band (Fig. 3c,Lane 4). On the contrary, mutant oligonucleotides with2-fold and 20-fold concentration of labelled probe hadlittle competing effect (Fig. 3c, Lane 5 and 6).Fig. 2 Functional deletion analyses of the human LRRK2 gene promoter. a Schematic illustration of human LRRK2 promoter constructs consistinga serial deletion fragments, which were cloned into pGL3-Basic plasmid. The arrows represent the direction of transcription and the numbersindicate the start and ending point of each construct with respect to TSS. b LRRK2 promoter constructs were verified by restriction enzymedigestion and the digested products were resolved on 1.5 % agarose gel. The size of vector is 4.8 kb and the size of inserts ranges from 84 to1871 bp, which was further confirmed by sequencing. c Plasmids with different LRRK2 promoter constructs were cotransfected with pCMV-Lucinto HEK293 cells. Cell lysates were harvested 24 h post-transfection, and the luciferase activity of pCMV-luc was used for normalizing transfectionefficiency. The RLU of pGL3-Basic (marked as N) was designated as 1. The values represent means ± SEM, n =3, *p < 0.001, by analysis of variance(ANOVA) with Sidak’s multiple comparison test. Comparisons were made between all other columns and the pGL3-basic control columnWang and Song Molecular Brain  (2016) 9:33 Page 4 of 13To test the functionality of three putative Sp1 bind-ing sites located in the human LRRK2 gene promoter,double-stranded oligonucleotides were used to com-pete for the Sp1 consensus binding sequence. The oli-gonucleotides containing the first Sp1 binding sitecompeted shifted band in a dosage-dependent manner(Fig. 3c, Lane 7 and 8). Similarly, the oligonucleotidescontaining the third Sp1 binding site also lowered theintensity of shifted band (Fig. 3c, Lane 9 and 10).However, the second Sp1 binding site did not showobvious competitive effect (Fig. 3c, Lane 11 and 12).Taken together, these data suggest that there are twofunctional Sp1 binding sites in human LRRK2 genepromoter and the binding between Sp1 and cis-actingelements on human LRRK2 promoter upregulated itspromoter activities.Sp1 upregulates the LRRK2 gene expressionTo determine whether Sp1 regulates LRRK2 gene ex-pression, endogenous LRRK2 mRNA levels were mea-sured after transfecting either pCGN-Sp1 expressionplasmid or control vector into HEK293 cells. Sp1 over-expression resulted in a significant increase of LRRK2mRNA level by 83.1 ± 18.4 % compared with control de-tected by reverse transcription (RT)-PCR (p < 0.05,Fig. 4a, b). Next, a dopaminergic cell line MN9D wasused to confirm the effect. Similarly, the LRRK2 mRNAlevel was elevated to 144.10 ± 2.28 % with Sp1Fig. 3 Regulation of the human LRRK2 gene promoter by Sp1. a pGL3-Basic, pLRRK2-C and pLRRK2-J plasmids were cotransfected with eithervector or Sp1 expression plasmid into HEK293 cells. Cell harvesting and the measurement of luciferase activities were performed as mentionedbefore. Sp1 overexpression significantly increased the promoter activity of pLRRK2-C but had no effect on pLRRK2-J nor pGL3-basic control. Thevalues represent means ± SEM. n =3, *p < 0.01 by two way ANOVA with Sidak’s multiple comparison test. b pGL3-Basic, pLRRK2-C and pLRRK2-Jplasmids were cotransfected with either negative control or Sp1 siRNA into HEK293 cells. Knockdown of Sp1 significantly decreased the promoteractivity of pLRRK2-C but had no effect on pLRRK2-J. The values represent means ± SEM. n =3, *p < 0.01 by two-way ANOVA with Sidak’s multiplecomparison test. c EMSA was performed as described in detail in Material and Methods. Sp1 consensus binding sequence was labelled by fluorescentIR700 Dye. Lane1 is the labelled probe alone without nuclear protein extract. Incubation the probes with Sp1-enriched nuclear protein extracts formeda shifted DNA-protein complex band (lane 2). Competition assays were conducted by adding various concentrations of molar excess of unlabeledcompetitive oligonucleotides, including consensus Sp1 oligonucleotides (lane 3 and 4), mutant Sp1 consensus oligonucleotides (lane 5 and 6) andputative Sp1-responsive elements in the human LRRK2 promoter (lane 7 to 12)Wang and Song Molecular Brain  (2016) 9:33 Page 5 of 13overexpression in MN9D cells (p < 0.001, Fig. 4c, d). Onthe contrary, inhibition of endogenous Sp1 protein bysiRNA led to significantly lower expression of LRRK2mRNA in HEK293 cells (p < 0.01, Fig. 4e, f ).Although Sp1 drastically enhanced endogenous LRRK2mRNA expression, it is not necessary that Sp1 canincrease its protein level. Therefore, expression of en-dogenous LRRK2 protein was detected by immunoblot-ting after pCGN-Sp1 plasmid or control vector beingtransfected into HEK293 cells. In consistent with mRNAdata, Sp1 significantly augmented LRRK2 protein level by81.7 ± 6.21 % (p < 0.005, Fig. 4g, h). However, when Sp1Fig. 4 Sp1 upregulates the LRRK2 gene expression. a-d Sp1 overexpression increased LRRK2 mRNA expression level. Sp1 expression plasmid wastransfected into HEK293 cells (a) or MN9D cells (c). Cell lysates were harvested 48 h after transfection and total RNA was isolated for RT-PCR. Theproducts of amplified LRRK2 and β-actin genes were analyzed on a 1.5 % agarose gel. Quantification was performed by ImageJ software andendogenous LRRK2 mRNA level was normalized against β-actin. e HEK292 cells were transfected with scrambled siRNA or Sp1 siRNA, andendogenous LRRK2 mRNA level was measured by RT-PCR after 48 h and analyzed on a 1.5 % agarose gel. g HEK293 cells were transfected asmentioned before and cell lysates were harvested 48 h after transfection. Endogenous LRRK2 protein and overexpressed Sp1 were examined byimmunoblotting. i HEK293 cells were transfected with negative control siRNA or Sp1 siRNA. After 48 h, cell lysate was harvested for determiningLRRK2 and Sp1 protein level by immunoblotting. Quantification of the band intensity in (f), (h), and (j) was performed by ImageJ software. Thevalues in this figure represent means ± SEM. n =3, *p < 0.05, analyzed by Student’s t-testWang and Song Molecular Brain  (2016) 9:33 Page 6 of 13was overexpressed in MN9D cells, measurement ofLRRK2 protein level was failed as endogenous LRRK2protein cannot be detected in this cell line by any anti-bodies we tried (data not shown). Knockdown of endogen-ous Sp1 significantly lowered LRRK2 protein level by74.52 ± 9.09 % (p < 0.005, Fig. 4i, j). Overall, the datasuggested that Sp1 can not only promote LRRK2 genepromoter activity and also facilitate its gene expressionboth at transcriptional and translational level.Mithramycin A (MTM) inhibits human LRRK2 promoteractivity and gene expressionTo further validate Sp1’s effect on LRRK2 gene expres-sion, MTM, a selective Sp1 inhibitor competing withSp1 to bind to a GC-rich DNA sequence [54], was usedto treat cells. After HEK293 cells were transfected withpLRRK2-C or pLRRK2-J plasmids, MTM was applied tocells for either 24 or 48 h. With MTM treatment(125nM), the promoter activities of the pLRRK2-C plas-mid, containing Sp1 binding sites, were significantlyreduced from 9.72 ± 0.22 RLU to 4.40 ± 0.16 RLUafter 24 h and further to 3.53 ± 0.08 RLU after 48 h(p < 0.0001 for both 24 and 48 h). Neither pLRRK2-Jnor pGL3-Basic’s promoter activities was affected byMTM treatment (p > 0.05, Fig. 5a). To further con-firm the effect of MTM treatment, various concentra-tions of MTM were applied to HEK293 cells, rangingfrom 25nM to 125nM. After 24 h treatment, promoter ac-tivities of pLRRK2-C plasmid were significantly downreg-ulated from 9.35 ± 0.41 RLU to 3.53 ± 0.14 RLU in 25nMMTM treatment, further decreased to 1.37 ± 0.09 RLU in75nM, and 0.38 ± 0.02 RLU in 125nM, respectivelyFig. 5 MTM inhibits the LRRK2 gene expression. a pGL3-Basic, pLRRK2-C or pLRRK2-J was transfected into HEK293 cells. After 24 h, transfectedcells were treated with MTM at 125 nM or vehicle for 24 or 48 h. Luciferase activities were determined as mentioned before, and pCMV-Luc lucif-erase activity was used for transfection efficiency normalization. b HEK293 cells were transfected with pGL3-Basic, pLRRK2-C or pLRRK2-J. The nextday, cells were exposed to MTM at 25, 75 and 125 nM for 24 h. Luciferase activities were measured. The values in (a) and (b) represent the mean± SEM. n = 3, *p < 0.001 by two-way ANOVA with Sidak’s multiple comparison test. c HEK293 cells were treated with 125 nM MTM or vehicle for24 h. The LRRK mRNA levels were determined by RT-PCR and normalized against the levels of β-actin. d Quantification of LRRK2 and β-actinmRNA levels in HEK293 cell were completed by ImageJ software. e Cell lysates harvested from HEK293 cells treated with 125 nM MTM or vehiclefor 24 h were analyzed by immunoblotting with anti-LRRK2 antibody. β-actin was used as the internal control for protein loading. f Quantificationof LRRK2 and β-actin protein levels in HEK293 cell was completed by ImageJ software. g Dopaminergic MN9D cells were treated with 125 nMMTM or vehicle for 24 h. The LRRK mRNA levels were determined by RT-PCR and normalized against the levels of β-actin. h LRRK2 and β-actinmRNA level in MN9D cell was quantified by ImageJ software. The values in (d), (f) and (h) represent the mean ± SEM. n = 3, *p < 0.001 byStudent’s t-testWang and Song Molecular Brain  (2016) 9:33 Page 7 of 13(p < 0.0001 for 25, 75 and 125nM. Fig. 5b). Thesedata indicate that MTM treatment inhibits LRRK2promoter activities in a time -dependent and dosage-dependent manner.To examine LRRK2 mRNA expression in MTM treat-ment, HEK293 cells were administrated with 125nMMTM for 24 h. RT-PCR results showed that endogenousLRRK2 mRNA level was significantly downregulated to63.43 ± 1.66 % (p < 0.0001, Fig. 5c, d). Endogenous LRRK2protein expression was also detected in HEK293 cells after125nM MTM treatment for 24 h. LRRK2 protein was re-duced to 38.30 ± 2.18 % (p < 0.0001, Fig. 5e, f ). LRRK2mRNA expression after MTM treatment was confirmedin MN9D cells, which was significantly reduced to 52.44± 2.07 % (p < 0.001, Fig. 5g, h). Consistent with Sp1’s effecton LRRK2 gene, inhibition of Sp1’s activity by MTM issufficient to reduce LRRK2 promoter activity and geneexpression.DiscussionLRRK2 is one of the key players in the pathogenesis ofPD, and its physiological and pathophysiological func-tions are studied extensively. LRRK2 is widely expressedwith relative low expression in dopamine-producing area[24]. LRRK2 mRNA was found to be increased in thePD subjects and a study suggests that the level of mu-tant LRRK2 is associated with its toxic effect in neurons[43, 53]. However, the transcriptional and translationalregulation of LRRK2 gene is still not known. In thisstudy, we cloned and functionally characterized LRRK2promoter. The transcription stat site of the humanLRRK2 promoter was identified and the minimal pro-moter required for transcriptional initiation was located.Two Sp1-responsive elements were mapped in its pro-moter region and Sp1 was capable of promoting en-dogenous LRRK2 mRNA and protein expression in thecellular models. Contrarily, application of MTM reducedLRRK2 gene expression.LRRK2 is a complex protein, featuring a central ROC-COR domain and a kinase domain. Its cellular functionswere revealed by various loss-of-function studies. It wasshowed that deletion of LRRK2 in primary neurons re-sulted in longer neurites and elevated branching, themechanisms of which were involved decreased phos-phorylation of ezrin, radixin, and moesin (ERM) and fila-mentous actin [27, 28]. Deficiency of LRK1, homolog ofthe human LRRK2 in C. elegans, led to the disturbanceof polarized location of synapses, suggesting that LRRK2plays a role in vesicle trafficking [55]. Additional dataemerging from LRRK2 knockout mice indicated thatthey actually did not severely compromise dopaminergicfunctions, including normal dopaminergic synthesis, re-lease and storage [56]. However, the deficit was obviousin kidney with striking degeneration. This observationwas confirmed by another study, and the abnormalitiesin the study were also seen in lung, both of which wascaused by impaired autophagy-lysosomal pathway [34].As most of the pathogenic mutations are concentratedin the central tri-domain, LRRK2’s kinase and GTPaseactivities have garnered significant attention [41]. Over-expression of mutant LRRK2 resulted in cell death andinclusion formation in neuronal cells and primary neu-rons, and increased kinase activities were linked to theunderlying mechanisms, especially for LRRK2 G2019Smutant with consistently findings of its elevated kinaseactivities [19, 57–59]. LRRK2 mutants with reduced kin-ase activities were correlated with decreased neuronaltoxicities and kinase-dead versions blocked inclusionformation and attenuated cell death [57, 60]. However, itis challenging to conclude that kinase activity is themajor culprit of cell toxicity, as kinase activities of otherLRRK2 mutants are controversial, sometimes no influ-ence, and sometimes decreased [61]. Another candidatefor pathogenic effect of LRRK2 mutations is the GTPaseROC domain. It is well established that LRRK is an au-thentic GTPase and PD-associated mutations located inthe ROC domain (R1441G/C/H) and COR domain(Y1699C) decrease the rate of GTP hydrolysis [62–66].Multiple lines of evidence supported that both GTPbinding and GTP hydrolysis were required for kinase ac-tivity, but kinase-dead mutant did not have impact onGTP binding [67, 68]. Expression of GTPase domainalone was sufficient to impair yeasts’ viability, but thefragment only containing kinase domain produced muchless toxic effect. Moreover, the fragment containing thecomplete central tri-domain was the most toxic one,suggesting kinase domain may have a modulating effecton GTPase activity [69]. Collectively, it remains unclearthat whether kinase activity or GTPase activity is thereadout of LRRK2’s pathogenic effect, but it is certainthat both of them play an essential role in regulating theoverall function of LRRK2.Although LRRK2 has become a hot topic in the fieldof PD-related studies, the features of human LRRK2 pro-moter has not been studied in detail. A previous studysuggested that there were at least six TSSs, ranging from48 to 120 bp upstream of the first Kozak sequence, forLRRK2 promoter by using human brain cDNA [58]. Ouridentified TSS was 15 bp further, possibly due to cell-type or tissue-type specific effect [70]. In the humanLRRK2 promoter sequence we cloned, there were mul-tiple putative binding sites for various transcription fac-tors including Sp1, c-Jun, HNF-3α, GATA-1/2, andNFAT1. Dysregulation of Sp1 was reported in variousneurodegenerative disorders. Sp1 mRNA and proteinlevel were increased in frontal cortex of AD brains, andthe same results were also found in frontal cortex andhippocampus of AD model mouse [71]. It wasWang and Song Molecular Brain  (2016) 9:33 Page 8 of 13discovered that huntingtin interacted with Sp1 and itscoactivator, TAFII130, by using the yeast two-hybridassay, and the interaction between Sp1 and TAFII130was inhibited by mutant huntingtin in HD subjects [44].Additionally, our lab determined that Sp1 was able toregulate several AD- and HD- associated genes, includ-ing BACE1, huntingtin and SNAP-25 [48, 72, 73].Sp1 was one of the first transcription factors to be clonedin the 1980s [74]. It was originally discovered as a transcrip-tion activator for simian virus 40 (SV40) by binding tomultiple GC-boxes in its early promoter [75]. Sp1 is ubiqui-tously expressed and involved in cell growth, cell differenti-ation, embryogenesis, and preventing CpG islands frommethylation [76–78]. There are four major domains (A, B,C and D), featuring by two classic zinc fingers located indomain C for sequence-specific DNA binding and do-main A and B at the N-terminal for transcription acti-vation [79, 80]. As a classic transcription factor, Sp1can bind to GC-box and GT/CACCC-box [81, 82]. Itsconsensus binding sequence is (G/T)GGGCGG(G/A)(G/A)(C/T) [82]. Our data show that in humanLRRK2 promoter, the first putative binding site has se-quence of GGGCGGTGC, the second CGTCCGCCCG,and the third GGGGCGGGGA. The first putative bind-ing site has two mismatched base pairs, the second withthree mismatched base pairs, and the third with only onemismatched base pair. In consistent with prediction, onlythe first and the third were functional binding sites.MTM, an anti-tumor and antibiotic drug, was dis-covered to bind to GC-rich sequence with high affin-ity [83]. It competitively binds to Sp1 consensusbinding site on the SV40 promoter, working as a site-specific inhibitor for Sp1 [84]. As expectedly, applica-tion of MTM resulted in significantly reduced LRRK2promoter activity and gene expression. It was re-ported that LRRK2 WT or G2019S transgenic micealone did not develop neuropathological features seenin the SNCA A53T transgenic mice, including astro-cytosis, microgliosis, and neurodegeneration. However,SNCA A53T/LRRK2 WT double transgenic micedisplayed increased reactive astrocytosis, microgliosisand neuronal death. Furthermore, the severity of neu-rodegeneration in the double transgenic mice was as-sociated with expression level of WT LRRK2 proteins,suggesting an essential role of LRRK2 expression levelin promoting mutant SNCA-induced neuropathology[85]. Therefore, decreasing the LRRK2 level by MTMcould be beneficial to alleviate the PD-related patho-logical alterations, although the off-target effects ofSp1 inhibition should be taken into consideration.Further studies will be necessary to explore the effectof manipulating Sp1 signaling, for example by appli-cation of MTM, on LRRK2 WT or mutant-inducedtoxicity in PD model mice.ConclusionsIn summary, we functionally analyzed human LRRK2gene transcription, identified its TSS and cloned its1738 bp promoter region. Furthermore, the transcriptionfactor Sp1 was shown to promote human LRRK2 genepromoter activity and gene expression, whereas its in-hibitor, MTM, reduced the promoter activity and geneexpression. This is the first study to demonstrate thatSp1 signaling plays an important role in regulatingLRRK2 gene expression.MethodsCloning and plasmidsLRRK2 gene promoter fragments were amplified fromgenomic DNA of human embryonic kidney (HEK) 293cells by PCR and then cloned into pGL3-Basic expres-sion vector (Promega) upstream of the luciferase re-porter gene by restriction enzymes. Ten promoterdeletion plasmids for 5’ flanking region of humanLRRK2 gene were generated to cover from −1738 bp up-stream to +133 bp downstream of TSS at guanine (+1).The primers, including restriction enzyme sites, weresynthesized as follows: forward, 1) - 1738NheI: ctagctagcgaaacaacttagaaaataatacactg, 2) -794NheI: ctagctagccccaagtatcaggatcctgcc, 3) -495 BglII: cttagatctggagataggcggc,4) -413Nhe: ctagctagcggtcgcggagggtggccggc, 5) -118XhoI: ccgctcgagtcgtttttgggcctgagt, and 6) -34XhoI: ccgctcgagtccttcctcataaacaggcg; reverse, 1) -794HindIII: cccaagcttggcaggatcctgatacttggg, 2) -413HindIII: cccaagcttgccggccaccctccgcgacc, 3) -34HindIII: cccaagcttaggcagctccccgccccgcgt, 4) -4HindIII: cccaagcttgcgcccacgcccgcctgttta,and 5) +133HindIII: cccaagctttggcacctgcttccaacccgccg.Cell culture, transfection, luciferase reporter assay andMTM treatmentHEK293 cells and MN9D cells were cultured in Dulbec-co’s modified Eagle’s medium (DMEM) supplementedwith 10 % fetal bovine serum, 1 mM of sodium pyruvate,2 mM of L-glutamine, 50 units of penicillin and 50 μg ofstreptomycin (Invitrogen). MN9D cells were cultured onthe plates coated with 10 μg/mL poly-D-lysine (Sigma).All cells were maintained at 37 °C in an incubator con-taining 5 % CO2. Sp1 expression plasmid was con-structed by inserting Sp1 cDNA with hemagglutinin(HA) tag into pCGN-expression plasmid under the con-trol of the cytomegalovirus promoter [86]. Transfectionfor overexpressing Sp1 in the HEK293 and MN9D cellswere performed with Lipofectamine 2000 (Invitrogen)following manufacturer’s instruction.For luciferase assays, cells were first cotransfected with500 ng firefly luciferase plasmid (pGL3-Basic) with inser-tion of various promoter fragments and 1 ng Renilla lucif-erase plasmid pCMV-Luc which was used to normalizefor transfection efficiency. Cells were harvested by passiveWang and Song Molecular Brain  (2016) 9:33 Page 9 of 13lysis buffer 24 h post-transfection. Firefly luciferase andRenilla luciferase activities were measured by using thedual-luciferase reporter assay system (Promega). The fire-fly luciferase activities were normalized to Renilla lucifer-ase activities and the promoter activities of variousdeletion fragments were represented as relative luciferaseunits (RLU) after normalizing to pGL3-Basic.MTM (Sigma) was dissolved in 100 % methanol tomake a stock concentration of 250 mM. In dosage ex-periments, HEK293 cells were treated with MTM at 0,25, 75 and 125 nM for 24 h after 1 day transfection.Similarly, for time course experiments, cells were treatedwith MTM at 125 nM for 24 or 48 h. For RT-PCR andimmunoblotting, HEK293 and MN9D cells were treatedwith 125 nM MTM for 24 h and then lysed for mRNAand protein extraction.5’- RACE assayTotal RNA was extracted from HEK293 cells by TRI re-agent following the manufacturer’s instructions (Sigma).5’- RACE was conducted using the Smarter RACEcDNA amplification kit (Clotech) according to its proto-col. In the reverse transcription, a patent SMARTScribeReverse Transcriptase was employed to generate full-length first-strand cDNA and 3-5 bp residues wereadded to its 3’ tailing. The SMARTer oligonucleotidewas annealed to the extended cDNA tail, and the oligo-nucleotide was then worked as a template to amplify acomplete cDNA copy of the original RNA with the add-itional SMARTer sequence at the end. The outer andinner reverse primers were designed based on humanLRRK2 gene sequence, which were 5’-atcccagccatcatcca-gacc and 5’- caggatttggaccagcgtttct, respectively. NestedPCR was performed and PCR product was sequencedto locate the TSS of the human LRRK2 gene, whichwas the first base pair after SMARTer oligonucleotidesequence.EMSAEMSA was performed as previously described [87].HEK293 cells were transfected with pCGN-Sp1 expressionplasmid and lysed in a series of hypotonic buffers for nu-clear protein extraction. Probe oligonucleotides were la-belled with IR700 Dye (LI-COR Biosciences) and annealedto produce double- stranded probes. The labelled probeswere incubated with or without nuclear extract at 22 °Cfor 20 min in the EMSA binding buffer (4 % glycerol,1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mMNaCl, 10 mM Tris-HCl (pH 7.4), and 50 μg/mL poly(dI-dC)). For the competition assay, nuclear extract was firstincubated with 100 fmol (2 times excess) or 10 pmol (20times excess) of unlabeled competition oligonucleotidesfor 10 min followed by adding 50 fmol labelled probes.The sequences of the oligonucleotides were: consensusSp1-forward: 5’-attcgatcggggcggggcgagc; consensus Sp1-reverse: 5’-gctcgccccgccccgatcgaat; mutant Sp-1 forward:5’-cccttggtgggttgggggcctaagctgcg; mutant Sp-1 reverse: 5’-cgcagcttaggcccccaacccaccaaggg ; LRRK2-Sp1-PROBE1-forward: 5’-gccatctgggcggtgtcctc; LRRK2-Sp1-PROBE1-re-verse: 5’gaggacaccgcccagatggc; LRRK2-Sp1-PROBE2-for-ward: 5’-gcggcgtccgcccggggtcc; LRRK2-Sp1-PROBE2-reverse: 5’-ggaccccgggcggacgccgc; LRRK2-SP1-PROBE3-forward: 5’-caacgcggggcggggagctg; LRRK2-Sp1-PROBE3-reverse: 5’-cagctccccgccccgcgttg. The EMSA samples wereanalyzed on 4 % non-denaturing polyacrylamide gels andthe gels were scanned using the Odyssey scanner (LI-CORBiosciences) at a wavelength of 700 nm.Sp1 knockdownHEK293 cells were maintained at 30 % confluence fortransfection. For luciferase assay, the cells were cotrans-fected either 50nM Silencer® Select negative controlsiRNA or Sp1 siRNA (Thermofisher) with other pro-moter plasmids by Lipofectamine 2000 (Invitrogen) fol-lowing manufacturer’s instruction. Cells were analyzed48 h after transfection. For RT-PCR and immunoblot-ting, 50nM negative control siRNA or Sp1siRNA wastransfected into HEK293 cells by Lipofectamine 2000.Cells were harvested 48 h after transfection. The sensesequence of Sp1 siRNA is 5’-gcaacaugggaauuaugaatt andthe antisense sequence is 5’-uucauaauucccauguugctg.RT-PCRTotal RNA was extracted from HEK293 or MN9D cells byTRI reagent (Sigma). Thermoscript™ RT-PCR system (Invi-trogen) was applied to amplify the first strand cDNA byusing 1.0 μg of total RNA as the template and then thenewly synthesized cDNA was further amplified by TaqDNA polymerase. The specific primers for human LRRK2gene were as follows: forward, 5’- gagcacgcctccaagttat, andreverse, 5’- gtgattttacctgaagttag. This pair of primers wasused to amplify a 302 bp fragment of the human LRRK2gene coding sequence in the HEK293 cells. Additionally,the pair of primers for amplifying a 115 bp fragment ofmouse LRRK2 gene coding sequence in MN9D cells was asfollows: forward, 5’- aggagctgcccccttgaagaca, and reverse,5’- tgtgccacaccctccccatgt. β-actin was used as an internalcontrol, and two pairs of gene specific primers for HEK293and MN9D cells were: forward, 5’- ggacttcgagcaagagatgg,reverse, 5’-gaagcatttgcggtggag, forward, 5’-gacaggatgcagaag-gagat, and reverse, 5’-ttgctgatccacatctgctg, respectively. Allsamples were analyzed on 1.5 % agarose gels.ImmunoblottingHEK293 and MN9D cells were lysed in triton lysis buffer(150 mM sodium chloride, 1.0 % Triton X-100, 50 mMTris-HCl (pH 8.0) and protease inhibitor cocktail (Roche),followed by brief sonication. Protein concentration wasWang and Song Molecular Brain  (2016) 9:33 Page 10 of 13measured by Bradford assay (Bio-rad) and 4x sodiumdodecyl sulfate (SDS) sample buffer was added to eachsample. Cell lysates were resolved by 6 % Tris-glycineSDS-PAGE for detecting LRRK2 and 8 % Tris-glycineSDS-PAGE was used to detect endogenous Sp1 and Sp1-HA. Rabbit anti-LRRK2 monoclonal antibody MJFF C81-8 (Abcam), rabbit anti-Sp1 polyclonal antibody PEP2(Santa Cruz), mouse anti-β-actin monoclonal antibodyAC-15 (Sigma) and mouse anti-HA monoclonal antibody12CA5 (Abcam) were used as primary antibodies. IRDye680RD-labelled goat anti-rabbit antibodies and IRDye800CW-labelled goat anti-mouse antibodies were appliedas secondary antibodies. The gels were scanned in theOdyssey system (LI-COR Biosciences).Competing interestsThe authors declare that they have no competing interests.Authors’ contributionsJW and WS conceived and designed the experiments; JW performed theexperiments; JW and WS analyzed and contributed reagents/materials/analysis tools; JW and WS wrote the paper. All authors reviewed themanuscript. Both authors read and approved the final manuscript.AcknowledgementsWe thank Dr Michael J. Zigmond of University of Pittsburgh for providingMN9D cells. We thank Lindsay Swinton, Yili Wu and Fang Cai for theirtechnical assistance and helpful comments. This work was supported byCanadian Institutes of Health Research (CIHR) Operating Grant.W.S. is theholder of the Tier 1 Canada Research Chair in Alzheimer’s Disease. J. W. is therecipient of the Chinese Scholarship Council award.Received: 29 December 2015 Accepted: 14 March 2016References1. Healy DG, Falchi M, O'Sullivan SS, Bonifati V, Durr A, Bressman S, Brice A,Aasly J, Zabetian CP, Goldwurm S, et al. Phenotype, genotype, andworldwide genetic penetrance of LRRK2-associated Parkinson’s disease: acase-control study. Lancet Neurol. 2008;7(7):583–90.2. Paisan-Ruiz C, Jain S, Evans EW, Gilks WP, Simon J, van der Brug M, Lopezde Munain A, Aparicio S, Gil AM, Khan N, et al. Cloning of the genecontaining mutations that cause PARK8-linked Parkinson’s disease. Neuron.2004;44(4):595–600.3. Zimprich A, Biskup S, Leitner P, Lichtner P, Farrer M, Lincoln S, Kachergus J,Hulihan M, Uitti RJ, Calne DB, et al. Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron. 2004;44(4):601–7.4. Fahn S. Description of Parkinson’s disease as a clinical syndrome. Ann N YAcad Sci. 2003;991:1–14.5. Fearnley JM, Lees AJ. Ageing and Parkinson’s disease: substantia nigraregional selectivity. Brain. 1991;114(Pt 5):2283–301.6. German D, Manaye K, Smith W, Woodward D, Saper C. Midbraindopaminergic cell loss in Parkinson’s disease: computer visualization. AnnNeurol. 1989;26(4):507–14.7. Spillantini M, Schmidt M, Lee V, Trojanowski J, Jakes R, Goedert M. Alpha-synuclein in Lewy bodies. Nature. 1997;388(6645):839–40.8. Polymeropoulos MH. Mutation in the -Synuclein Gene Identified in Familieswith Parkinson’s Disease. Science. 1997;276(5321):2045–7.9. Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J,Hulihan M, Peuralinna T, Dutra A, Nussbaum R, et al alpha-Synuclein locustriplication causes Parkinson’s disease. Science. 2003;302(5646):841.10. Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S,Yokochi M, Mizuno Y, Shimizu N. Mutations in the parkin gene causeautosomal recessive juvenile parkinsonism. Nature. 1998;392(6676):605–8.11. Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S, Ali Z,Del Turco D, Bentivoglio AR, Healy DG, et al. Hereditary early-onset Parkinson’sdisease caused by mutations in PINK1. Science. 2004;304(5674):1158–60.12. Bonifati V, Rizzu P, Squitieri F, Krieger E, Vanacore N, van Swieten JC,Brice A, van Duijn CM, Oostra B, Meco G, et al. DJ-1(PARK7), a novelgene for autosomal recessive, early onset parkinsonism. Neurol Sci.2003;24(3):159–60.13. Ramirez A, Heimbach A, Grundemann J, Stiller B, Hampshire D, Cid LP,Goebel I, Mubaidin AF, Wriekat AL, Roeper J, et al. Hereditary parkinsonismwith dementia is caused by mutations in ATP13A2, encoding a lysosomaltype 5 P-type ATPase. Nat Genet. 2006;38(10):1184–91.14. Vilarino-Guell C, Wider C, Ross OA, Dachsel JC, Kachergus JM, Lincoln SJ,Soto-Ortolaza AI, Cobb SA, Wilhoite GJ, Bacon JA, et al. VPS35 Mutations inParkinson Disease. Am J Hum Genet. 2011;89(1):162–7.15. Zimprich A, Benet-Pages A, Struhal W, Graf E, Eck SH, Offman MN,Haubenberger D, Spielberger S, Schulte EC, Lichtner P, et al. A mutation inVPS35, encoding a subunit of the retromer complex, causes late-onsetParkinson disease. Am J Hum Genet. 2011;89(1):168–75.16. Satake W, Nakabayashi Y, Mizuta I, Hirota Y, Ito C, Kubo M, Kawaguchi T,Tsunoda T, Watanabe M, Takeda A, et al. Genome-wide association studyidentifies common variants at four loci as genetic risk factors for Parkinson’sdisease. Nat Genet. 2009;41(12):1303–7.17. Simon-Sanchez J, Schulte C, Bras JM, Sharma M, Gibbs JR, Berg D, Paisan-Ruiz C, Lichtner P, Scholz SW, Hernandez DG, et al. Genome-wideassociation study reveals genetic risk underlying Parkinson’s disease. NatGenet. 2009;41(12):1308–12.18. Haugarvoll K, Wszolek ZK. Clinical features of LRRK2 parkinsonism.Parkinsonism Relat Disord. 2009;15 Suppl 3:S205–8.19. Smith WW, Pei Z, Jiang H, Moore DJ, Liang Y, West AB, Dawson VL, DawsonTM, Ross CA. Leucine-rich repeat kinase 2 (LRRK2) interacts with parkin, andmutant LRRK2 induces neuronal degeneration. Proc Natl Acad Sci U S A.2005;102(51):18676–81.20. Venderova K, Kabbach G, Abdel-Messih E, Zhang Y, Parks RJ, Imai Y, GehrkeS, Ngsee J, Lavoie MJ, Slack RS, et al. Leucine-Rich Repeat Kinase 2 interactswith Parkin, DJ-1 and PINK-1 in a Drosophila melanogaster model ofParkinson’s disease. Hum Mol Genet. 2009;18(22):4390–404.21. Taymans JM, Cookson MR. Mechanisms in dominant parkinsonism:The toxic triangle of LRRK2, alpha-synuclein, and tau. Bioessays. 2010;32(3):227–35.22. Mata IF, Wedemeyer WJ, Farrer MJ, Taylor JP, Gallo KA. LRRK2 in Parkinson’sdisease: protein domains and functional insights. Trends Neurosci. 2006;29(5):286–93.23. Biskup S, Moore DJ, Rea A, Lorenz-Deperieux B, Coombes CE, Dawson VL,Dawson TM, West AB. Dynamic and redundant regulation of LRRK2 andLRRK1 expression. BMC Neurosci. 2007;8:102.24. Galter D, Westerlund M, Carmine A, Lindqvist E, Sydow O, Olson L. LRRK2expression linked to dopamine-innervated areas. Ann Neurol. 2006;59(4):714–9.25. Giesert F, Hofmann A, Burger A, Zerle J, Kloos K, Hafen U, Ernst L, Zhang J,Vogt-Weisenhorn DM, Wurst W. Expression analysis of Lrrk1, Lrrk2 and Lrrk2splice variants in mice. PLoS ONE. 2013;8(5):e63778.26. Funayama M, Hasegawa K, Kowa H, Saito M, Tsuji S, Obata F. A new locusfor Parkinson’s disease (PARK8) maps to chromosome 12p11.2-q13.1. AnnNeurol. 2002;51(3):296–301.27. MacLeod D, Dowman J, Hammond R, Leete T, Inoue K, Abeliovich A. Thefamilial Parkinsonism gene LRRK2 regulates neurite process morphology.Neuron. 2006;52(4):587–93.28. Parisiadou L, Xie C, Cho HJ, Lin X, Gu XL, Long CX, Lobbestael E, BaekelandtV, Taymans JM, Sun L, et al. Phosphorylation of ezrin/radixin/moesinproteins by LRRK2 promotes the rearrangement of actin cytoskeleton inneuronal morphogenesis. J Neurosci. 2009;29(44):13971–80.29. Samann J, Hegermann J, von Gromoff E, Eimer S, Baumeister R,Schmidt E. Caenorhabditits elegans LRK-1 and PINK-1 actantagonistically in stress response and neurite outgrowth. J Biol Chem.2009;284(24):16482–91.30. Plowey ED, Cherra 3rd SJ, Liu YJ, Chu CT. Role of autophagy in G2019S-LRRK2-associated neurite shortening in differentiated SH-SY5Y cells.J Neurochem. 2008;105(3):1048–56.31. Alegre-Abarrategui J, Christian H, Lufino MM, Mutihac R, Venda LL, AnsorgeO, Wade-Martins R. LRRK2 regulates autophagic activity and localizes tospecific membrane microdomains in a novel human genomic reportercellular model. Hum Mol Genet. 2009;18(21):4022–34.32. Orenstein SJ, Kuo SH, Tasset I, Arias E, Koga H, Fernandez-Carasa I, Cortes E,Honig LS, Dauer W, Consiglio A, et al. Interplay of LRRK2 with chaperone-mediated autophagy. Nat Neurosci. 2013;16(4):394–406.Wang and Song Molecular Brain  (2016) 9:33 Page 11 of 1333. Dodson MW, Zhang T, Jiang C, Chen S, Guo M. Roles of the DrosophilaLRRK2 homolog in Rab7-dependent lysosomal positioning. Hum Mol Genet.2012;21(6):1350–63.34. Tong Y, Yamaguchi H, Giaime E, Boyle S, Kopan R, Kelleher RJ, 3rd, Shen J.Loss of leucine-rich repeat kinase 2 causes impairment of proteindegradation pathways, accumulation of alpha-synuclein, and apoptotic celldeath in aged mice. Proc Natl Acad Sci U S A. 2010;107(21):9879–84.35. Gehrke S, Imai Y, Sokol N, Lu B. Pathogenic LRRK2 negatively regulatesmicroRNA-mediated translational repression. Nature. 2010;466(7306):637–41.36. Imai Y, Gehrke S, Wang HQ, Takahashi R, Hasegawa K, Oota E, Lu B.Phosphorylation of 4E-BP by LRRK2 affects the maintenance ofdopaminergic neurons in Drosophila. EMBO J. 2008;27(18):2432–43.37. Arranz AM, Delbroek L, Van Kolen K, Guimaraes MR, Mandemakers W,Daneels G, Matta S, Calafate S, Shaban H, Baatsen P, et al. LRRK2 functionsin synaptic vesicle endocytosis through a kinase-dependent mechanism. JCell Sci. 2015;128(3):541–52.38. MacLeod DA, Rhinn H, Kuwahara T, Zolin A, Di Paolo G, McCabe BD, MarderKS, Honig LS, Clark LN, Small SA, et al. RAB7L1 interacts with LRRK2 tomodify intraneuronal protein sorting and Parkinson’s disease risk. Neuron.2013;77(3):425–39.39. Matta S, Van Kolen K, da Cunha R, van den Bogaart G, Mandemakers W,Miskiewicz K, De Bock PJ, Morais VA, Vilain S, Haddad D, et al. LRRK2controls an EndoA phosphorylation cycle in synaptic endocytosis. Neuron.2012;75(6):1008–21.40. Dachsel JC, Farrer MJ. LRRK2 and Parkinson disease. Arch Neurol. 2010;67(5):542–547.41. Martin I, Kim JW, Dawson VL, Dawson TM. LRRK2 pathobiology inParkinson’s disease. J Neurochem. 2014;131(5):554–65.42. Ko HS, Bailey R, Smith WW, Liu Z, Shin JH, Lee YI, Zhang YJ, Jiang H, RossCA, Moore DJ, et al. CHIP regulates leucine-rich repeat kinase-2ubiquitination, degradation, and toxicity. Proc Natl Acad Sci U S A. 2009;106(8):2897–902.43. Skibinski G, Nakamura K, Cookson MR, Finkbeiner S. Mutant LRRK2 Toxicityin Neurons Depends on LRRK2 Levels and Synuclein But Not Kinase Activityor Inclusion Bodies. J Neurosci. 2014;34(2):418–33.44. Dunah AW, Jeong H, Griffin A, Kim YM, Standaert DG, Hersch SM,Mouradian MM, Young AB, Tanese N, Krainc D. Sp1 and TAFII130transcriptional activity disrupted in early Huntington's disease. Science.2002;296(5576):2238–2243.45. Sugars KL, Rubinsztein DC. Transcriptional abnormalities in Huntingtondisease. Trends Genet. 2003;19(5):233–238.46. Santpere G, Nieto M, Puig B, Ferrer I. Abnormal Sp1 transcription factorexpression in Alzheimer disease and tauopathies. Neurosci Lett. 2006;397(1-2):30–34.47. Chen CH, Zhou W, Liu S, Deng Y, Cai F, Tone M, Tone Y, Tong Y, Song W.Increased NF-kappaB signalling up-regulates BACE1 expression and itstherapeutic potential in Alzheimer’s disease. Int J Neuropsychopharmacol.2012;15(01):77–90.48. Christensen MA, Zhou W, Qing H, Lehman A, Philipsen S, Song W.Transcriptional regulation of BACE1, the beta-amyloid precursor proteinbeta-secretase, by Sp1. Mol Cell Biol. 2004;24(2):865–74.49. Ly PT, Wu Y, Zou H, Wang R, Zhou W, Kinoshita A, Zhang M, Yang Y,Cai F, Woodgett J, et al. Inhibition of GSK3beta-mediated BACE1expression reduces Alzheimer-associated phenotypes. J Clin Invest. 2013;123(1):224–35.50. Xu Q, Guo H, Zhang X, Tang B, Cai F, Zhou W, Song W. Hypoxia regulationof ATP13A2 (PARK9) gene transcription. J Neurochem. 2012;122(2):251–9.51. Wang K, Liu S, Wang J, Wu Y, Cai F, Song W. Transcriptional regulation of humanUSP24 gene expression by NF-kappa B. J Neurochem. 2014;128(6):818–28.52. Wang R, Luo Y, Ly PT, Cai F, Zhou W, Zou H, Song W. Sp1 regulates humanhuntingtin gene expression. J Mol Neurosci. 2012;47(2):311–21.53. Simunovic F, Yi M, Wang Y, Macey L, Brown LT, Krichevsky AM, Andersen SL,Stephens RM, Benes FM, Sonntag KC. Gene expression profiling ofsubstantia nigra dopamine neurons: further insights into Parkinson’s diseasepathology. Brain. 2009;132(Pt 7):1795–809.54. Gidoni D, Kadonaga JT, Barrera-Saldana H, Takahashi K, Chambon P, Tjian R.Bidirectional SV40 transcription mediated by tandem Sp1 bindinginteractions. Science. 1985;230(4725):511–7.55. Sakaguchi-Nakashima A, Meir JY, Jin Y, Matsumoto K, Hisamoto N. LRK-1, aC. elegans PARK8-related kinase, regulates axonal-dendritic polarity of SVproteins. Curr Biol. 2007;17(7):592–8.56. Hinkle KM, Yue M, Behrouz B, Dachsel JC, Lincoln SJ, Bowles EE, Beevers JE,Dugger B, Winner B, Prots I, et al. LRRK2 knockout mice have an intactdopaminergic system but display alterations in exploratory and motor co-ordination behaviors. Mol Neurodegener. 2012;7:25.57. Greggio E, Jain S, Kingsbury A, Bandopadhyay R, Lewis P, Kaganovich A, vander Brug MP, Beilina A, Blackinton J, Thomas KJ, et al. Kinase activity isrequired for the toxic effects of mutant LRRK2/dardarin. Neurobiol Dis. 2006;23(2):329–41.58. West AB, Moore DJ, Biskup S, Bugayenko A, Smith WW, Ross CA, DawsonVL, Dawson TM. Parkinson’s disease-associated mutations in leucine-richrepeat kinase 2 augment kinase activity. Proc Natl Acad Sci U S A. 2005;102(46):16842–7.59. Jaleel M, Nichols RJ, Deak M, Campbell DG, Gillardon F, Knebel A, Alessi DR.LRRK2 phosphorylates moesin at threonine-558: characterization of howParkinson’s disease mutants affect kinase activity. Biochem J. 2007;405(2):307–17.60. Smith WW, Pei Z, Jiang H, Dawson VL, Dawson TM, Ross CA. Kinase activity ofmutant LRRK2 mediates neuronal toxicity. Nat Neurosci. 2006;9(10):1231–3.61. Greggio E, Cookson MR. Leucine-rich repeat kinase 2 mutations andParkinson’s disease: three questions. ASN Neuro. 2009;1(1).62. Guo L, Gandhi PN, Wang W, Petersen RB, Wilson-Delfosse AL, Chen SG. TheParkinson’s disease-associated protein, leucine-rich repeat kinase 2 (LRRK2),is an authentic GTPase that stimulates kinase activity. Exp Cell Res. 2007;313(16):3658–70.63. Lewis PA, Greggio E, Beilina A, Jain S, Baker A, Cookson MR. The R1441Cmutation of LRRK2 disrupts GTP hydrolysis. Biochem Biophys Res Commun.2007;357(3):668–71.64. Li X, Tan YC, Poulose S, Olanow CW, Huang XY, Yue Z. Leucine-rich repeatkinase 2 (LRRK2)/PARK8 possesses GTPase activity that is altered in familialParkinson’s disease R1441C/G mutants. J Neurochem. 2007;103(1):238–47.65. Daniels V, Vancraenenbroeck R, Law BM, Greggio E, Lobbestael E, Gao F, DeMaeyer M, Cookson MR, Harvey K, Baekelandt V, et al. Insight into the modeof action of the LRRK2 Y1699C pathogenic mutant. J Neurochem. 2011;116(2):304–15.66. Liao J, Wu CX, Burlak C, Zhang S, Sahm H, Wang M, Zhang ZY, Vogel KW,Federici M, Riddle SM, et al. Parkinson disease-associated mutation R1441Hin LRRK2 prolongs the “active state” of its GTPase domain. Proc Natl AcadSci U S A. 2014;111(11):4055–60.67. West AB, Moore DJ, Choi C, Andrabi SA, Li X, Dikeman D, Biskup S, Zhang Z,Lim KL, Dawson VL, et al. Parkinson’s disease-associated mutations in LRRK2link enhanced GTP-binding and kinase activities to neuronal toxicity. HumMol Genet. 2007;16(2):223–32.68. Biosa A, Trancikova A, Civiero L, Glauser L, Bubacco L, Greggio E, Moore DJ.GTPase activity regulates kinase activity and cellular phenotypes ofParkinson’s disease-associated LRRK2. Hum Mol Genet. 2013;22(6):1140–56.69. Xiong Y, Coombes CE, Kilaru A, Li X, Gitler AD, Bowers WJ, Dawson VL,Dawson TM, Moore DJ. GTPase activity plays a key role in the pathobiologyof LRRK2. PLoS Genet. 2010;6(4):e1000902.70. FANTOM Consortium and the RIKEN PMI and CLST (DGT), Forrest AR, KawajiH, Rehli M, Baillie JK, de Hoon MJ, Haberle V, Lassmann T, et al. A promoter-level mammalian expression atlas. Nature. 2014;507(7493):462–70.71. Citron BA, Dennis JS, Zeitlin RS, Echeverria V. Transcription factor Sp1dysregulation in Alzheimer's disease. J Neurosci Res. 2008;86(11):2499–2504.72. Cai F, Chen B, Zhou W, Zis O, Liu S, Holt RA, Honer WG, Song W. SP1 regulatesa human SNAP-25 gene expression. J Neurochem. 2008;105(2):512–23.73. Li Y, Zhou W, Tong Y, He G, Song W. Control of APP processing and Abetageneration level by BACE1 enzymatic activity and transcription. FASEB J.2006;20(2):285–292.74. Kadonaga JT, Carner KR, Masiarz FR, Tjian R. Isolation of cDNA encodingtranscription factor Sp1 and functional analysis of the DNA binding domain.Cell. 1987;51(6):1079–90.75. Dynan WS, Tjian R. The promoter-specific transcription factor Sp1 binds toupstream sequences in the SV40 early promoter. Cell. 1983;35(1):79–87.76. Black AR, Jensen D, Lin SY, Azizkhan JC. Growth/cell cycle regulation of Sp1phosphorylation. J Biol Chem. 1999;274(3):1207–15.77. Brandeis M, Frank D, Keshet I, Siegfried Z, Mendelsohn M, Nemes A, TemperV, Razin A, Cedar H. Sp1 elements protect a CpG island from de novomethylation. Nature. 1994;371(6496):435–8.78. Marin M, Karis A, Visser P, Grosveld F, Philipsen S. Transcription factor Sp1 isessential for early embryonic development but dispensable for cell growthand differentiation. Cell. 1997;89(4):619–28.Wang and Song Molecular Brain  (2016) 9:33 Page 12 of 1379. Courey AJ, Tjian R. Analysis of Sp1 in vivo reveals multiple transcriptionaldomains, including a novel glutamine-rich activation motif. Cell. 1988;55(5):887–98.80. Kadonaga JT, Courey AJ, Ladika J, Tjian R. Distinct regions of Sp1 modulateDNA binding and transcriptional activation. Science. 1988;242(4885):1566–70.81. Giglioni B, Comi P, Ronchi A, Mantovani R, Ottolenghi S. The same nuclearproteins bind the proximal CACCC box of the human beta-globin promoterand a similar sequence in the enhancer. Biochem Biophys Res Commun.1989;164(1):149–55.82. Kadonaga JT, Jones KA, Tjian R. Promoter-Specific Activation of RnaPolymerase-Ii Transcription by Sp1. Trends Biochem Sci. 1986;11(1):20–3.83. Van Dyke MW, Dervan PB. Chromomycin, mithramycin, and olivomycinbinding sites on heterogeneous deoxyribonucleic acid. Footprinting with(methidiumpropyl-EDTA)iron(II). Biochemistry. 1983;22(10):2373–7.84. Ray R, Snyder RC, Thomas S, Koller CA, Miller DM. Mithramycin blocksprotein binding and function of the SV40 early promoter. J Clin Invest. 1989;83(6):2003–7.85. Lin X, Parisiadou L, Gu XL, Wang L, Shim H, Sun L, Xie C, Long CX, Yang WJ,Ding J, et al. Leucine-rich repeat kinase 2 regulates the progression ofneuropathology induced by Parkinson’s-disease-related mutant alpha-synuclein. Neuron. 2009;64(6):807–27.86. Parks CL, Shenk T. The serotonin 1a receptor gene contains a TATA-lesspromoter that responds to MAZ and Sp1. J Biol Chem. 1996;271(8):4417–30.87. Liu S, Zhang S, Bromley-Brits K, Cai F, Zhou W, Xia K, Mittelholtz J, Song W.Transcriptional Regulation of TMP21 by NFAT. Mol Neurodegener. 2011;6:21.•  We accept pre-submission inquiries •  Our selector tool helps you to find the most relevant journal•  We provide round the clock customer support •  Convenient online submission•  Thorough peer review•  Inclusion in PubMed and all major indexing services •  Maximum visibility for your researchSubmit your manuscript atwww.biomedcentral.com/submitSubmit your next manuscript to BioMed Central and we will help you at every step:Wang and Song Molecular Brain  (2016) 9:33 Page 13 of 13

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0308627/manifest

Comment

Related Items