UBC Faculty Research and Publications

Transcriptional Regulation of TMP21 by NFAT Liu, Shengchun; Zhang, Si; Bromley-Brits, Kelley; Cai, Fang; Zhou, Weihui; Xia, Kun; Mittelholtz, Jill; Song, Weihong Mar 7, 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-13024_2010_Article_177.pdf [ 1.58MB ]
Metadata
JSON: 52383-1.0228468.json
JSON-LD: 52383-1.0228468-ld.json
RDF/XML (Pretty): 52383-1.0228468-rdf.xml
RDF/JSON: 52383-1.0228468-rdf.json
Turtle: 52383-1.0228468-turtle.txt
N-Triples: 52383-1.0228468-rdf-ntriples.txt
Original Record: 52383-1.0228468-source.json
Full Text
52383-1.0228468-fulltext.txt
Citation
52383-1.0228468.ris

Full Text

RESEARCH ARTICLE Open AccessTranscriptional Regulation of TMP21 by NFATShengchun Liu1,2*†, Si Zhang2†, Kelley Bromley-Brits2, Fang Cai2, Weihui Zhou2, Kun Xia3, Jill Mittelholtz2,Weihong Song2*AbstractBackground: TMP21 is a member of the p24 cargo protein family, which is involved in protein transport betweenthe Golgi apparatus and ER. Alzheimer’s Disease (AD) is the most common neurodegenerative disorder leading todementia and deposition of amyloid b protein (Ab) is the pathological feature of AD pathogenesis. Knockdown ofTMP21 expression by siRNA causes a sharp increase in Ab production; however the underlying mechanism bywhich TMP21 regulates Ab generation is unknown, and human TMP21 gene expression regulation has not yetbeen studied.Results: In this report we have cloned a 3.3-kb fragment upstream of the human TMP21 gene. The transcriptionstart site (TSS) of the human TMP21 gene was identified. A series of nested deletions of the 5’ flanking region ofthe human TMP21 gene were subcloned into the pGL3-basic luciferase reporter plasmid. We identified the -120 to+2 region as containing the minimal sequence necessary for TMP21 gene promoter activity. Gel shift assaysrevealed that the human TMP21 gene promoter contains NFAT response elements. Expression of NFAT increasedTMP21 gene expression and inhibition of NFAT by siRNA reduced TMP21 gene expression.Conclusion: NFAT plays a very important role in the regulation of human TMP21 gene expression. This studydemonstrates that the human TMP21 gene expression is transcriptionally regulated by NFAT signaling.BackgroundAlzheimer’s disease is the most common neurodegen-erative disorder leading to dementia. Deposition of amy-loid b protein (Ab) in the brain is one of the hallmarksof AD pathogenesis. Ab is generated from a larger b-amyloid precursor protein (APP) by sequential cleavagesof b-secretase and g-secretase [1-4]. Beta-site APP cleav-ing enzyme 1 (BACE1) is the b-secretase in vivo [5,6],and g-secretase activity is catalyzed by a presenilin (PS)-containing macromolecular complex [7]. This highmolecular weight complex also requires nicastrin (Nct)[8], anterior pharynx-defective 1 (Aph-1) [9-11], andpresenilin enhancer 2 (Pen-2) [9,10] for its enzymaticactivity [7,11-13]. CD147 was also found to closelyassociate with the g-secretase complex [14]. Despiterobust expression of the APP gene resulting in a highlevel of APP protein in vivo, Ab production through theamyloidogenic pathway of APP processing is a rareoccurrence under normal conditions [15,16].Missense mutations in PS1 and PS2 are a major causeof early-onset familial AD (FAD). PS mutant forms havebeen shown to increase g-secretase activity, resulting inelevated Ab42 production [17-19]. In addition to itspathogenic g-secretase activity, the PS complex cancleave Notch [20,21] at a separate ε-cleavage site whichmay be involved in learning and memory. Intramembra-nous cleavage of Notch to release the Notch intracellu-lar domain (NICD) is inhibited in PS1-deficient cells[8,20,22-24]. In addition to APP and Notch, the sub-strates for g-secretase include Jagged, Delta, E-cadherin,ErbB-4, Nectin-1a, CD44 and LRP. The ε- and g-secre-tase activities of the presenilin complex seem to be inde-pendently regulated, as certain g-secretase inhibitors canaffect APP cleavage without affecting Notch cleavage,and presenilin mutations can increase Ab-42 productionwhile decreasing Notch cleavage [25,26].Human TMP21, a member of the p24 protein family,is a type I transmembrane protein with a large luminaldomain [27]. It is ubiquitously transcribed with higher* Correspondence: liushengchun1968@163.com; weihong@exchange.ubc.ca† Contributed equally1Department of Surgery, The First Affiliated Hospital, Chongqing Universityof Medical Sciences, Chongqing 410006, China2Townsend Family Laboratories, Department of Psychiatry, Brain ResearchCenter, Graduate Program in Neuroscience, The University of BritishColumbia, 2255 Wesbrook Mall, Vancouver, BC V6T 1Z3, CanadaFull list of author information is available at the end of the articleLiu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21© 2011 Liu et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.protein levels in the pancreas and intestines. The cyto-plasmic tails of p24 family interact with coatomer, amajor component of coat protein complex I (COP-I), tofacilitate transport between the ER and Golgi [28-30].TMP21 cycles through the early secretory pathwaybetween the intermediate and cis-Golgi compartments[31-33], and is necessary for proper organization of theGolgi apparatus [34,35]. TMP21 also plays an essentialand non-redundant role in the earliest stages of mam-malian development [36]. Recently, TMP21 was identi-fied as a new member of the PS-associated complex[37]. Our recent study showed that TMP21 is ubiquiti-nated and that degradation of TMP21, as with the otherPS-associated g-secretase complex members, is mediatedby the ubiquitin-proteasome pathway [38]. Interestingly,TMP21 has been shown to regulate Ab generation butnot Notch processing, suggesting that TMP21 selectivelyregulates g-secretase, but not ε-secretase, activity [37].Gene expression requires tightly controlled gene tran-scription regulated by interaction between cis-acting ele-ments in the promoter region and transcription factors.It is well known that the nuclear factor of activated Tcells (NFAT)/calcineurin family play a central role ininducible gene transcription in various signaling path-ways, regulating cell differentiation, development, adap-tation, immune system response, inflammatory,adipocyte metabolism, and lipolysis, as well as carcino-genesis [39-42]. There are a few NFAT family isoformsin different tissue. NFAT localization in the nucleus isdependent on the import-export balance between theactivity of Ca2+/calmodulin-dependent phosphatase, cal-cinurin, and the activity of serine/threonine kinase [43].NFAT signaling is pivotal during embryogenesis for car-diovascular development [44], and affects the cytokineand immunoregulatory gene transcriptional activator inT cells, as well as various other physiological activitiesbeyond the immune system. It is also involved in regula-tion of cell growth, differentiation, and cell cycle pro-gression in diverse cell types after birth [45,46].NFAT proteins are phosphorylated and constitutivelyexpressed in resting cells [47,48]. Phosphorylated NFATnormally resides in the cytoplasm and has low affinityfor DNA binding [49,50]. The anastomosis of cell sur-face receptors to the calcium-signaling pathway activatesphospholipase C-g, causing phosphatidylinosito-4,5-biphosphate, a plasma membrane component, to behydrolyzed, producing cytosolic inosito-1,4,5-trispho-sphate (IP3) and membrane-bound diacylglycerol. IP3induces calcium release from the ER, stimulating cal-cium-activated calcium channels on the plasma mem-brane to open, which then maintains the increased levelof intracellular calcium. The ratio of calcium/calmodulintriggers Ser/Thr-phosphatase calcineurin (CaN), whichcan dephosphorylate NFAT [51]. DephosphorylatedNFAT protein can be translocated to the nucleus andhas a high affinity for DNA binding, inducing NFAT-dependent gene transcription [48,52-54]. The calci-neurin inhibitors CsA or FK506 can block NFAT activa-tion. The NFAT binding site in the promoter of targetgenes has a 9 bp consensus sequence (A/T)GGAAA(A/N)(A/T/C)N [47]. The calcineurin inhibitors CsA orFK506 can block NFAT activation. The mechanismunderlying the transcriptional regulation of humanTMP21 and its role in neuropsychiatric disorder patho-genesis is unknown. In order to study the molecularmechanism of human TMP21 gene transcription regula-tion, we cloned and functionally characterized thehuman TMP21 gene promoter. We found that tran-scription factor NFAT plays a pivotal role in regulationof TMP21 gene transcription.ResultsCloning the human TMP21 gene promoter and mappingits transcription start siteHuman TMP21 is ubiquitously transcribed with higherprotein levels in the pancreas and intestines. Thehuman TMP21 gene is located on chromosome 14q24.3and spans 45,179 base pairs. It has five exons andencodes for a 21-kD protein of 219 amino acids (Figure1A). To examine its transcriptional regulation, 3333 bpof the 5’ flanking region of the human TMP21 gene wascloned from human genomic DNA. To determine thetranscription start site of TMP21, RNA Ligase MediatedRapid Amplification of cDNA Ends (RLM-RACE) assaywas performed. A 182 bp major cDNA product fromthe nested-PCR was amplified and cloned into pcDNA4vector (Figure 1B). DNA sequencing indicates that themajor transcription start site is located at 43 bpupstream of the translation start site ATG. This tran-scription initiation site is designated as +1 and beginswith cytosine (Figure 1C). Sequence analysis and a com-puter-based transcription factor binding site search(MatInspector 2.2, Genomartrix, Oakland, CA, USA)reveals that the human TMP21 gene has a complextranscriptional unit. The human TMP21 gene promoterlacks typical CAAT and TATA boxes and contains sev-eral putative regulatory elements, such as AP1, SP1,CREB, NFAT, HIF-1, GATA as well as STAT (Figure1D).Functional characterization of the TMP21 promoterTo determine whether the 3.3-kb fragment from -3108to +225 bp of the TMP21 5’ flanking region containsthe human TMP21 promoter, the pTMP-3108+225 plas-mid was constructed to contain this fragment upstreamof a luciferase reporter gene in the promoterless plasmidpGL3-basic. The pGL3-basic vector lacks a eukaryoticpromoter and enhancer sequences upstream of theLiu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 2 of 11reporter luciferase gene. Expression of luciferase in cellstransfected with this plasmid depends on a functionalpromoter upstream of the luciferase gene. Plasmid DNAwas transfected into HEK293 cells and luciferase activitywas measured with a luminometer to determinepromoter activity. Promoterless empty vector pGL3-basic was used as negative control and CMV promoter-luciferase construct pGL3-promoter was transfected as apositive control. Compared with cells transfected withpGL3-basic or pGL3-promoter controls, cells transfectedFigure 1 Sequence features of the human TMP21 gene promoter and identification of the transcription start site. (A) The genomicorganization of human TMP21 gene on Chromosome 14q24.3. E represents exon. ATG is the translation start codon and TAA the stop codon.(B) RLM-RACE experiment was performed to map the TMP21 transcription start site. Neuronal RNA was extracted by TRI-Reagent from SH-SY5Ycells. Total RNA was treated with Calf Intestine Alkaline Phosphatase to remove free 5’-phosphates and the RNA was then treated with TobaccoAcid Pyrophosphatase (TAP) to remove the cap structure from full-length mRNA, leaving a 5’-monophosphate. A 45 base RNA Adapteroligonucleotide was ligated to the RNA population using T4 RNA ligase. A random-primed reverse transcription reaction and nested PCR thenamplified the 5’ end of a specific transcript. The product was analyzed on a 1.5% agarose gel. (C) The PCR product was cloned into pcDNA4-mycHis at BamHI and XhoI sites. DNA sequencing was performed to identify the insert sequence. The first base pair after the adapter was thetranscription start site (TSS). The arrow indicates the TSS. (D) The nucleotide sequence of the human TMP21 gene promoter. A 3333-bp fragmentof the 5’ flanking region of the human TMP21 gene was isolated from a human BAC genomic clone and sequenced by the primer walkingstrategy. The cytosine +1 represents the TSS mapped by RLM-RACE. The putative transcription factor binding sites are underlined in bold face.Amino acid codons were boxed in boldface. Genbank™accession number is JF694939.Liu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 3 of 11with pTMP-3108+225 had significantly higher luciferaseactivity (57.03 ±6.83 RLU, P < 0.001) (Figure 2B). Thisresult indicated that the 3.3 kb 5’ flanking region of theTMP21 gene contains the functional promoter forhuman TMP21 gene transcription.To functionally analyze the TMP21 promoter andidentify the minimal promoter region needed forTMP21 gene expression, a series of deletions of the 5’flanking fragments of TMP21 were subcloned intopGL3-basic (Figure 2A). Deletion of 1047 bp upstreamfrom pTMP-3018+225 had no significant effect on theluciferase activity of cells transfected with plasmidpTMP-2061+225 (66.02 ± 11.51RLU) (P > 0.05 relativeto pTMP3018+225). However, further deletions (pTMP-1260+33) had significantly higher promoter activity(94.70 ± 2.54 RLU, P < 0.005), suggesting the deletedregion might contain inhibitory cis-acting elements.Inserting the -1260+33 fragment in the reverse directionupstream of luciferase reporter gene (plasmid pTMP+33-1260) resulted in little luciferase expression. Thesedata further supported that the 5’ flanking region con-tains the functional human TMP21 gene promoter.To identify the minimal region containing TMP21 pro-moter activity, further deletion plasmids were con-structed. Plasmid pTMP-596+33, pTMP-225+33 andpTMP-120+33 had luciferase activity at 49.78 ± 1.16,43.51 ± 0.41, and 58.16 ± 3.11 RLU, respectively (Figure2B). A 31 bp deletion from the 3’ end of the -120 to +33bp fragment significantly reduced the luciferase activityfrom 58.16 ± 3.11 RLU in pTMP-120+33 to 37.07 ± 1.85RLU in pTMP-120+2 (P < 0.005). However, a further 58bp 3’ deletion resulted in little luciferase activity inpTMP-120-57 (P < 0.001) (Figure 2B). The results indi-cate that the 5’ flanking region from -120 to +2 bp, con-taining the transcription initiation site, is the minimalpromoter region necessary for basal transcription ofTMP21, and the fragment from -120 to -57, lacking thetranscription start site, has no promoter activation ability.The human TMP21 gene promoter contains NFAT cis-acting response elementsNFAT signaling regulates gene transcription by translo-cation of activated dephosphorylated NFAT into nucleusto bind an NFAT response element in the promoter oftarget genes. The NFAT binding element contains a 9bp consensus sequence (A/T)GGAAA(A/N)(A/T/C)N[49]. Sequence analysis indicates that there are eightputative NFAT binding sites in the 3.1 kb promoterregion of the human TMP21 gene (Figure 1B). To inves-tigate whether those putative NFAT elements are func-tional NFAT binding sites, gel shift assays wereperformed. A 12-bp consensus double-stranded NFAToligonucleotide probe was synthesized and end labeledwith IRDye-680 (Li-COR, Biosciences). A shifted pro-tein-DNA complex band was detected after incubatingthe labeled NFAT probe with HEK293 nuclear extract(Figure 3, lane2 of panel ABCD). The intensity of theshifted band was significantly reduced by adding 10 foldexcess of unlabeled NFAT consensus competition oligo-nucleotides (Wt-NFAT), and the band was almostentirely abolished by applying a 100-fold excess of unla-beled NFAT consensus oligonucleotides (Figure 3, lane3,4 of panel ABCD). Applying a 10-fold excess ofmutant NFAT consensus oligonucleotides (Mt-NFAT),which contain a binding site mutation, had no compet-ing effect on the NFAT protein-DNA binding complexshifted band (Figure 3, Lane 5 of Panel ABCD). 100-foldMt-NFAT oligos could show some non-specific compe-tition (Lane 6). Only a 10-fold and 100-fold excess ofthe 7th putative NFAT response element (TMP21-NFAT-7) could markedly reduce the intensity and com-pletely abolish the signal of the shifted bands, respec-tively, when compared to preincubation of the 8unlabeled TMP21-NFAT probes with HEK293 nuclearextract, (Figure 3D). This result indicated that a NFATbinding site is located at -502 bp to -476 bp of thehuman TMP21 promoter region.To investigate the interaction between transcriptionfactor NFAT and the human TMP21 promoter inHEK293 (Figure 4A) and SH-SY5Y (Figure 4B) cells,chromatin immunoprecipitation (ChIP) assay was per-formed. As positive control, TMP21 promoter andb-actin DNA fragment were amplified from the shearedchromatin samples (lane 2). Only TMP21 promoterfragment can be amplified from the sheared chromatinFigure 2 Deletion analysis of the human TMP21 genepromoter. (A) Schematic diagram of the TMP21 promoterconstructs consisting of the 5’ flanking region with serial deletionscloned into the pGL3-basic vector. Arrow shows the direction oftranscription. The numbers represent the end points of eachconstruct. The deletion plasmids were confirmed by sequencingand restriction enzyme digestion. (B) The plasmid constructs wereco-transfected with pRLuc into HEK293 and SH-SY5Y cells byLipofectamine 2000R. After 48 hour transfections the cells wereharvested and luciferase activity was measured with a luminometerand expressed in Relative Luciferase Units (RLU). Renilla luciferaseactivity was used to normalize for transfection efficiency. The valuesrepresent means ± SEM. *, P < 0.001 by analysis of variance withthe post hoc Newman-Keuls test.Liu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 4 of 11sample immunoprecipitated by NFAT antibody (lane 4,but not from the chromatin sample incubating withnon-NFAT antibody solution control (lane 3). No b-actin DNA fragment was pulled down from those twosamples either. The results clearly showed that NFATproteins are associated with TMP21 promoter region inboth HEK293 and SH-SY5Y cells.NFAT expression increases and pyrrolidinedithiocarbamates (PDTC) decreases human TMP21promoter activityTo examine the role of NFAT signaling in the regula-tion of human TMP21 transcription and expression, wefirst examined TMP21 promoter activity in cells overex-pressing NFAT protein. Either pTMP-1260+33 or pGL3promoter were co-transfected with NFAT expressionplasmid or empty vector into HEK293 or N2a cells.pRLuc was also transfected for transfection efficiencynormalization. The cells were harvested with lysis buffer48 later after transfection and luciferase activity wasmeasured. The luciferase activity of pTMP-1260+33was significantly increased by 2.40-fold in cells co-transfected with NFAT expression plasmid (P < 0.001)(Figure 5A). To further demonstrate that NFAT site inTMP21 promoter mediates NFAT’s effect on TMP21expression, pTMP-120+33 was also co-transfected withNFAT expression plasmid or empty vector. pTMP-120+33 promoter plasmid lacks NFAT binding site and ourresults showed that NFAT overexpression had no signif-icant effect on its luciferase activity (P > 0.05) (Figure5A). These results indicate that human TMP21 genepromoter activity can be significantly up-regulated byNFAT over-expression via its NFAT response element.Pyrrolidine dithiocarbamates (PDTC) is an antioxidantcompound which strongly inhibits NF-B and activatesAP-1 signaling. PDTC was also shown to have a stronginhibitory effect on NFAT signaling and its downstreamgene transcription [55]. To further examine NFAT’seffect on TMP21 transcription, HEK293 and N2a weretransfected with plasmid pTMP-596+33. The cells werethen treated with 100 μM PDTC for varying times anddoses of PDTC for 24 hours. Cell lysates were assayed forluciferase activity. PDTC treatment significantly reducedTMP21 promoter activity. Addition of 50, 100, 200 uMof PDTC for 16 hours decreased promoter activity to84.99 ± 4.72%, 26.25 ± 8.11% and 15.15 ± 2.48%, respec-tively (P < 0.001) (Figure 5C). 100 μM PDTC treatmentfor 1, 4, 16 and 20 hours reduced TMP21 promoter activ-ity to 68.32 ± 8.84%, 60.67 ± 18.23% and 11.63 ± 2.01%and 6.80 ± 0.06%, respectively (P < 0.001) (Figure 5D).These data demonstrated that NFAT inhibitor PDTC caninhibit human TMP21 promoter activation in a time-and dosage-dependent manner.Regulation of TMP21 expression by NFAT activityTo examine the effect of NFAT on endogenous TMP21mRNA and protein levels, HEK293 and SH-SY5Y cellsFigure 3 Gel mobility shift assay for the TMP21 genepromoter. Gel shift assays were performed as described in theMaterial and Methods. Double stranded NFAT oligonucleotideprobes labeled wuth IRDye-680 were applied. Lane 1 is labeledprobe alone without nuclear extract. Incubation with nuclearextracts retarded the migration rate of the labeled probe, forming anew shifted DNA-protein complex band (lane 2). Competition assayswere performed by further adding different concentrations of molarexcess of unlabeled competition oligonucleotides, consensus NFAT(lane 3, 4), binding sequence mutant NFAT (lane 5, 6) and TMP21NFAT elements (lane 7, 8, 9, 10).Figure 4 ChIP assay to show that NFAT proteins are associatedwith human TMP21 promoter. ChIP assay was performed asdescribed in the Material and Methods. The chromatin was isolatedHEK293 (A) or SH-SY5Y cells (B), and then sheared from the cellstreated with cross-link reagent formaldehyde. For isolation of NFATbinding complex, the chromatin solution was incubated with NFATantibody (Santa Cruz). PCR amplifications were performed usingTMP21 promoter-specific primers, with samples from the shearedchromatin alone (lane 2), non-NFAT antibody control (lane 3) andNFAT-immunoprecipitating chromatin sample (lane 4). b-actin wasused as internal control.Liu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 5 of 11were transfected with NFAT expression plasmid andNFAT-specific siRNA. The samples were analyzed bysemi-quantitative RT-PCR and Western blot with b-actin levels as the internal control. RT-PCR showed thatNFAT expression significantly increased endogenousTMP21 mRNA levels (151.73 ± 1.36%, P < 0.001), whileknockdown of NFAT expression by siRNA markedlyreduced endogenous TMP21mRNA levels (58.94 ±0.63%, P < 0.001) in HEK293 cells (Figure 6A and 6C).Similar results were also observed in SH-SY5Y cells:NFAT overexpression increased TMP21 mRNA levels to128.00 ± 0.66% and NFAT siRNA reduced the levels to30.98 ± 0.34% (P < 0.001 relative to control) (Figure 6Band 6C). Consistent with the transcription data, Westernblot analysis showed that TMP21 protein levels weresignificantly increased by NFAT expression in HEK293cells (155.78 ± 1.075%) (Figure 6D and 6F) and SH-SY5Y cells (141.62 ± 1.64%) (Figure 6E and 6F), andknockdown of NFAT expression markedly decreasedTMP21 protein levels in HEK293 (49.29 ± 0.64%) (Fig-ure 6D) and SH-SY5Y cells (64.83 ± 0.96%) (Figure 6E),respectively (P < 0.001 relative to control) (Figure 6F).Taken together, these results clearly demonstrate thatNFAT signaling regulates human TMP21 geneexpression.DiscussionBeta-secretase cleavage of APP by BACE1 produces APPC-terminal fragment C99, which can be cleaved by theg-secretase complex to form Ab and subsequently aggre-gate to form classic AD plaques. The g-secretase com-plex requires PS1, Nct-1, Aph-1, and Pen-2 for itsenzymatic activity [7]. Recently, TMP21 was identifiedas a member of the g-secretase complex [37]. Knock-down of TMP21 with siRNA increased g-secretase activ-ity and Ab production without altering the relativeamounts of g-secretase complex components or APPsubstrate, suggesting that TMP21 is a selective regulatorof g-secretase [37]. TMP21 is a type I transmembraneprotein involved in ER/Golgi transport [27]. Interest-ingly, the cDNA sequence of TMP21 is similar to cDNAclone S31iii125, which was identified within the AD3Figure 5 Regulation of TMP21 promoter activity by NFAT andPDTC. Transcriptional activation of the TMP21 promoter ispotentiated by NFAT. Empty vector and TMP21 promoter plasmidpTMP-1260+33 or pTMP-120+33 were cotransfected with NFATexpression plasmid pHA-NFAT1 into HEK293 cells (A) or N2a cells(B). Overexpression of NFAT significantly increased pTMP21-1260+33or promoter activity and had no effect on pTMP-120+33 or controlplasmid in both HEK293 and N2a cells. n = 4, * p < 0.0001. (C, D)Inhibition of TMP21 promoter activity by PDTC. TMP21 promoterconstruct pTMP21-1260+33 and pRluc were cotransfected intoHEK293 and N2a cells. After 24 h cells were treated with varyingdosages of PDTC for 16 hours (C) or at 100uM for varying times (D).Cells were harvested at the same time for luciferase assay. Renillaluciferase activity was used to normalize for transfection efficiency.The values represent means ± SEM relative to control promoteractivity. *, P < 0.001 relative to control by ANOVA with the post hocNewman-Keuls test.Figure 6 NFAT facilitates TMP21 gene expression at both themRNA and protein level. HEK293 (A) and SH-SY5Y (B) cells weretransfected with NFAT expression plasmid or NFAT siRNA (sc-29412,Santa Cruz Biotechnology, Inc.). Total RNA was extracted. Semiquantitative RT-PCR was performed to detect the mRNA levels ofTMP21 and b-actin. Specific TMP21 and b-actin coding sequenceprimers were used to amplify the TMP21 and b-actin cDNA, asdescribed in Materials and Methods. The RT-PCR products wereanalyzed on 1% agarose gels. b-actin was used as internal control.(C) The ratio of TMP21 to b-Actin mRNA was quantitated by KodakImage Analysis. Shown is the Mean+S.E.M., and n = 4. *p < 0.001relative to controls by ANOVA with post-hoc Newmann-Keuls test.(D and E) Western blot assay was then performed to analyze celllysates from NFAT-transfected cells and NFAT siRNA on 16% Tris-Glycine gel. TMP21 protein was detected using rabbit anti-mouseanti-TMP21 ployclonal antibody T21 and b-actin was used as aninternal protein control. Overexpression of NFAT increased TMP21protein generation and NFAT siRNA decreased the protein levels inHEK293 (D) and SH-SY5Y (E) cells. (F) Quantitative analysis of thegeneration of TMP21. Values are Means ± S.E.M. and n = 4. Theprotein levels are expressed as a percentage of the levels in controlcells. * p < 0.001 relative to controls by ANOVA with post-hocNewmann-Keuls test.Liu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 6 of 11locus on chromosome 14q24.3, which is associated withaggressive, early-onset AD [56]. This, coupled with itsrole as a selective regulator of g-secretase activity,strongly suggests that TMP21 may play an as of yetundetermined role in AD pathogenesis.The TMP21 gene is prolifically expressed in the pan-creas, nervous system, and digestive tract. To define themolecular mechanism underlying human TMP21 genetranscription and expression, we cloned 3.3 kb of the 5’flanking region of the human TMP21 gene. We used 5’-RACE to map the major transcription start site ofTMP21 at 43 bp upstream of the first ATG translationcodon. The promoter sequence does not contain TATAor CATA boxes, typical features of most type II eukar-yotic gene promoters. The promoter also does not havehigh GC content, such as in APP and BACE1 gene pro-moters [57], and does not resemble many housekeepinggene promoters [58]. Sequence analysis suggested sev-eral putative regulatory elements of the TMP21 promo-ter, including NFAT, HIF, CREB, YY1F, AP1 and STAT.A series of nested deletions of the 5’ flanking region ofthe TMP21 promoter were subcloned into pGL3-Basic,a luciferase reporter plasmid vector, and the luciferaseactivity of TMP21 fragment was assayed. Our studyshowed that the 5’ flanking region from -120 to +2 bpcontains the minimal promoter region necessary forbasal transcription of the human TMP21 gene. Gel shiftassays confirmed that a NFAT binding site is located at-502 bp to -476 bp of the human TMP21 promoterregion. Furthermore, our results showed that humanTMP21 promoter activity can increase with co-expres-sion of exogenous NFAT, and decrease after inhibitionof NFAT by PDTC. Finally we showed that overexpres-sion of NFAT could increase endogenous TMP21mRNA and protein levels, while knockdown decreasedthem. These results clearly demonstrate that humanTMP21 gene expression is regulated by NFAT signalingvia its effect on a functional NFAT response element inthe human TMP21 gene promoter region. Our studyindicates that NFAT regulates TMP21 gene expressionat the transcription level and the human TMP21 gene isone of the downstream target genes of NFAT signalingpathway.Abnormal regulation of gene transcription has beenimplicated in the AD pathogenesis and pancreas endo-crine function [16,59]. One of the pharmaceutical strate-gies in AD therapy is to reduce Ab production. TMP21protein is a new member of p24 cargo proteins andplays an important role in Ab production in AD patho-genesis. It was reported that reduction of TMP21 cansignificantly increase Ab production [38]. Our studyprovides new insights on the molecular mechanismunderlying transcriptional regulation of the humanTMP21 gene and we found that NFAT plays animportant role in the regulation of TMP21 gene expres-sion both in neuronal and non-neuronal cells. Futureresearch will determine additional cis-acting elements inthe TMP21 promoter responsible for its neuronal andpancreatic tissue-specific expression pattern, and howdysregulation of TMP21 expression plays a role in thepathogenesis of neuronal-endocrine disorders.ConclusionIn this report we have cloned a 3.3-kb fragment upstreamof the human TMP21 gene. The transcription start site(TSS) of the human TMP21 gene was identified. A seriesof nested deletions of the 5’ flanking region of the humanTMP21 gene were subcloned into the pGL3-basic lucifer-ase reporter plasmid. We identified the -120 to +2 regionas containing the minimal sequence necessary forTMP21 gene promoter activity. Gel shift assays revealedthat the human TMP21 gene promoter contains NFATresponse elements. Expression of NFAT increasedTMP21 gene expression and inhibition of NFAT bysiRNA reduced TMP21 gene expression. These resultsdemonstrated that NFAT plays a very important role inthe regulation of human TMP21 gene expression.MethodsCloning of TMP21 promoter and construction of chimericluciferase reporter plasmidsThe 5’-flanking region of the human TMP21 gene wasamplified by PCR from human BAC DNA NM_006827gDNA-74712811-74722811R. The primers weredesigned with restriction enzymes sites compatible withthe multi-cloning site of vector pGL3-basic (Promega).Various 5’ flanking regions of TMP21 were clonedupstream of the luciferase reporter gene in pGL3-basic.The fragment of TMP21 was constructed from -3108 bpupstream to +225 bp downstream of transcription startsite. The primers were used for deletion promoter con-structs: forward, -3108: 5’-ccggtaccaaggtcaggatgttcaagac-cagc, -2061: 5’-cgcgagctcctttaacagtataattatttggcctc, -1260:5’-ccgctcgagttcaagcaattctctgcctc, -596: 5’-gctatgggacat-gaaccggatgtc-3’, and -120: 5’- ccgctagccctatcctttcttccc;reverse, -2061: 5’-cgcgagctcgaggccaaataattatactgttaaag,-1159 5’-gaaaccccgtctctactaaaaatac, -561: 5’- cccaagc-ttgttttaggggtcacctgatg, -148: 5’- gttaaagaagctttaatagaatac-tattgc, -57: 5’-ccctcgag tggagactggcatgtagag, -38: 5’-cccaagctttgatgccgtccgcgcc, -23: 5’- ccctcgagctcacctct-gaccttc, 2: 5’-cccaagcttccggaaccggggggac, -10: 5’-ccctcgagggacccacgtgactcac, and 33: 5’- ccctcgagactcgtt-caccaccg. In order to construct the longest promoterfragment of TMP21, -2061 Kpn I 5’-cgcgagctcctttaacag-tataattatttggcctc and 225: 5’- ggtcggagatctcgtacgcgccagwere used to amplify -2061 to +225 bp region ofTMP21 promoter gene using BAC DNA. The fragmentwas cloned into PGL3 basic at Kpn I and Bgl II toLiu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 7 of 11generate pTMP21-B, and then the fragment -3108 to-2061 was inserted in pTMP21-B at Kpn I to constructpTMP21-A containing the fragment of -3108 to +225bp of TMP21 gene.Cell culture, transfection and luciferase assayHEK293 cells, SH-SY5Y and N2a cells were cultured inDulbecco’s modified Eagle’s medium containing 1 mMsodium pyruvate, 10% fetal bovine serum, 2 mM of L-glutamine and 50 units of penicillin and 50 ug of strep-tomycin (Invitrogen, Carlsbad, CA USA). All cells werecultured in an incubator at 37°C containing 5% CO2.Cells were seeded in 24-well plats 24 hours before trans-fection and grown to near 70% confluence by the day oftransfection. Cells were transfected with 0.5 ug plasmidDNA per well using 1 μL Lipofectamine 2000 (Invitro-gen). The Renilla (sea pansy) luciferase vector pRluc wascotransfected to normalize for the transfection efficiencyof various luciferase reporter constructs. Cells were har-vested at 48 hour after transfection and lysed in 50 μL1× passive lysis buffer (Promega) per well. Firefly lucifer-ase activities and Renilla luciferase activities wereassayed using the Dual-luciferase reporter assay system(Promega). The firefly luciferase activity was normalizedaccording to Renilla luciferase activity and expressed asrelative luciferase units to reflect the promoter activity.Plasmid HA-NFAT1 expresses HA-tagged murineNFAT1 in pcDNA4 [60].RNA Ligase Mediated Rapid Amplification of cDNA Ends(RLM-RACE) of TMP21 geneTotal RNA was extracted from SH-SY5Y cells with TRIreagent following the manufacturer’s protocol (Sigma, StLouis, MO, USA). RLM-RACE was performed accordingto the Instruction Manual: Poly (A) selected RNA is trea-ted with Calf Intestine Alkaline Phosphatase (CIP) toremove free 5’-phosphates from molecules. The RNA isthen treated with Tobacco Acid Pyrophosphatase (TAP)to remove the cap structure from full-length mRNA, leav-ing a 5’-monophosphate. A 45 base RNA Adapter oligonu-cleotide was ligated to the RNA samples using T4 RNAligase. A random-primed reverse transcription reactionand nested PCR then amplifies the 5’ end of a TMP21transcript. The outer and inner primers, which were usedin nested PCR, were 5’-ggtcggagatctcgtacgcgccag and 5’-cccctcgagaag gagatggcaaggaccaatc, respectively. The PCRproduct was inserted into pcDNA4-mycHis with BamH Iand Xho I. The plasmid sequence was analyzed. The firstbase pair after the adapter is identified as the transcriptionstart site of the human TMP21 gene.Nuclear extraction and gel shift assayTo prepare NFAT-enriched nuclear extract, HEK293cells were transiently transfected with pHA-NFAT1expression plasmid for 48 hours. The cells were washedwith phosphate-buffered saline and harvested with fivevolumes of buffer A [10 mM HEPES pH7.9, 10 mMKCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothrei-tol (DTT), 0.5 mM phenylmethylsulfonyl fluoride(PMSF)]. After gentle pipeting the cells were incubatedon ice for 15 min. The cells were ruptured by 10 pestlestrokes in a Kontes all glass Dounce tissue grinder. 10%NP40 was added to the homogenates on ice to a finalNP40 concentration of 0.5% for an additional 15 minprior to 5 more strokes. Crude nuclei were collected bycentrifugation at 2 000 × g for 10 min. The nuclei werewashed three times with buffer A with 0.5% NP40 andresuspended in buffer C [20 mM HEPES pH7.9, 0.4 MNaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol,1 mM phenylmethylsulfonyl fluoride, 10% Glycerol] at4°C for 15 min. The supernatant, which contains nuclearproteins, was collected by centrifugation at 12 000 Xgfor 5 min at 4°C and stored -80°C.Electrophoretic mobility shift assay (EMSA), alsoknown as gel shift assay (GSA), was performed as pre-viously described [58]. Both sense and anti-sense NFAToligonucleotides, end-labeled with IRDye-680 (Li-COR),were annealed to generate double-stranded probes. Thesequences for the sense strand probes were: consensusNFAT (Wt-NFAT): 5’-gaggaaaatttg; NFAT mutant oli-gonucleotides (Mt-NFAT): 5’-gaggaccctttg; TMP21-NFAT-1: 5’-tatttccttttagtaattttccatc; TMP21- NFAT-2:5’-ccctacttttccttgtatttgga; TMP21- NFAT-3: 5’-acct-cggtttcctcatctgt; TMP21- NFAT-4: 5’-gatggaaatttaaag-gaaacac; TMP21- NFAT-5: 5’-catttctaggaaaataact;TMP21- NFAT-6: 5’-tctttctttccttctttcttt; TMP21- NFAT-7: 5’-gaaatctttcctcgaaattttcctct; and TMP21- NFAT-8: 5’-gtggctgtttcctattgggg. The end-labeled probes were incu-bated with or without nuclear extract at 22°C in bindingbuffer (100 mM Tris, 500 mM KCl, 10 mM DTT; pH7.5)with 25 mM/L DTT, 2.5% Tween-20, and 1 μg poly(dI-dC)/μl in 10 mM Tris and 1 mM EDTA (pH 7.5)for 30 minutes, and the samples were analyzed on a 4%nondenaturing polyacrylamide gel. For the competitionassays, the binding reaction was incubated with 10 pmol(10 times) and 100 pmol (100 times) of unlabeled com-petition oligonucleotides. For supershifting assay, thepolyclonal TMP21 antibody raised from rabbit [38] wasadded to the EMSA reaction mixture.Chromatin Immunoprecipitation (ChIP) assayChIP assay was performed as described previously [61]with modification. Cross-link between protein and chro-matin was achieved by addition of formaldehyde to thefinal concentration of 1.42% in NFAT-enriched HEK293cells or SH-SY5Y cells for 15 min at room temperature(22°C). Cross-link was quenched with glycine at finalconcentration of 125 mM for 5 min at roomLiu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 8 of 11temperature. Cells were then harvested in cold PBS andlysed with IP buffer containing 150 mM NaCl, 50 mMTris-HCl (pH 7.5), 5 mM EDTA, NP-40 (0.5% vol/vol),Triton X-100 (1.0% vol/vol), and 0.5 mM phenylmethyl-sulfonyl fluoride (PMSF). The nuclear pellets were iso-lated by centrifugation at 12,000g for 1 min, andresuspended with the IP buffer. The chromatin was thensheared by sonication on ice. For isolation of NFATbinding complex, the chromatin solution was incubatedwith NFAT antibody (Santa Cruz) or equal volume ofPBS overnight at 4°C. After immunoprecipitation, cross-link was reversed by adding Chelex100 and boilingbeads for 10 min. The supernatant containing DNAfragments was isolated by centrifugation at 12,000g for 1min, which was then used as template for PCR analysisof the chromatin fragment. “Primers” were used toamplify NFAT putative consensus binding site (need toconfirm with Fang) located on the TMP21 promoterregion. Actin was used as internal control.Quantitative RT-PCRTotal RNA was isolated from cells using TRI reagent(Sigma). ThermoscripTM RT-PCR system (Invitrogen)was used to synthesize the first strand cDNA using 5 μg oftotal RNA as template following the manufacurer’sinstructions. The newly synthesized cDNA templates werefurther amplified by Platinum Taq DNA polymerase (Invi-trogen) in a 50 μl reaction. The human TMP21 gene spe-cific primers 5’-cgggatccgccaccatgtctggtttgtctggcccacforward, and 5’-ggaattcctcaatcaatttcttggccttg reverse, wereused to amplify a 660-bp fragment of the TMP21 codingregion. b-actin was used as an internal control. b-actingene-specific primers were: forword: 5’- cgaggatccggacttc-gagcaagagatgg; reverse: 5’- cagtctagagaagcatttgcggtggacg.All PCR products were analyzed on 1.5% agarose gels.ImmunoblottingCell lysates were resolved by 16% Tris-glycine sodiumdodecyl sulfate-polyacryamide gel electrophoresis andimmunblotting analysis was performed as described pre-viously [38]. A rabbit anti-TMP21 polyclonal antibodyT21 raised against the TMP21 protein was used todetect TMP21 expression [38]. Internal control b-actinexpression was analyzed with monoclonal anti-b-actinantibody AC-15 (Sigma).AcknowledgementsWe thank Dr. Alex Toker of Harvard Medical School for providing the pHA-NFAT1 expression plasmid. This work was supported by the CanadianInstitutes of Health Research (CIHR), the Jack Brown and Family Alzheimer’sResearch Foundation, Michael Smith Foundation for Health Research, theTownsend Family, and The National Natural Science Foundation of China(NSFC) (Distinguished Young Scholars (Oversea) Fund, 30528015) (W.S.) andNSFC (30871295) (S.L.) and CSTC (2009BB5065) (S.L.). W.S. is the holder of theCanada Research Chair in Alzheimer’s Disease and the recipient of theChang Jiang Scholar award. S.L was supported by the CIHR STIHR program,and K.B. was supported by the NSERC and Michael Smith Foundation forHealth Research Scholarship. K.X. was supported by grants from NSFC(30630062) and 973 program (2004CB518601).Author details1Department of Surgery, The First Affiliated Hospital, Chongqing Universityof Medical Sciences, Chongqing 410006, China. 2Townsend FamilyLaboratories, Department of Psychiatry, Brain Research Center, GraduateProgram in Neuroscience, The University of British Columbia, 2255 WesbrookMall, Vancouver, BC V6T 1Z3, Canada. 3The State Key Lab of MedicalGenetics of China, Central South University, Changsha, Hunan 410078, China.Authors’ contributionsSL and WS conceived the study and designed the experiments, SL, SZ, KB,FC, WZ and JM performed the experiments and evaluated the data, and KXprovided reagents. SL, SZ, KB and WS wrote the paper. All authors have readand approved the final manuscript.Competing interestsThe authors declare that they have no competing interests.Received: 3 July 2010 Accepted: 7 March 2011 Published: 7 March 2011References1. Goldgaber D, Lerman MI, McBride OW, Saffiotti U, Gajdusek DC:Characterization and chromosomal localization of a cDNA encodingbrain amyloid of Alzheimer’s disease. Science 1987, 235(4791):877-880.2. Kang J, Lemaire HG, Unterbeck A, Salbaum JM, Masters CL, Grzeschik KH,Multhaup G, Beyreuther K, Muller-Hill B: The precursor of Alzheimer’sdisease amyloid A4 protein resembles a cell-surface receptor. Nature1987, 325(6106):733-736.3. Robakis NK, Ramakrishna N, Wolfe G, Wisniewski HM: Molecular cloningand characterization of a cDNA encoding the cerebrovascular and theneuritic plaque amyloid peptides. Proc Natl Acad Sci USA 1987,84(12):4190-4194.4. Tanzi RE, Gusella JF, Watkins PC, Bruns GA, St George-Hyslop P, VanKeuren ML, Patterson D, Pagan S, Kurnit DM, Neve RL: Amyloid betaprotein gene: cDNA, mRNA distribution, and genetic linkage near theAlzheimer locus. Science 1987, 235(4791):880-884.5. Sun X, Wang Y, Qing H, Christensen MA, Liu Y, Zhou W, Tong Y, Xiao C,Huang Y, Zhang S, et al: Distinct transcriptional regulation and functionof the human BACE2 and BACE1 genes. Faseb J 2005, 19(7):739-749.6. Sun X, He G, Song W: BACE2, as a novel APP theta-secretase, is notresponsible for the pathogenesis of Alzheimer’s disease in Downsyndrome. Faseb J 2006, 20(9):1369-1376.7. Takasugi N, Tomita T, Hayashi I, Tsuruoka M, Niimura M, Takahashi Y,Thinakaran G, Iwatsubo T: The role of presenilin cofactors in the gamma-secretase complex. Nature 2003, 422(6930):438-441.8. Yu G, Nishimura M, Arawaka S, Levitan D, Zhang L, Tandon A, Song YQ,Rogaeva E, Chen F, Kawarai T, et al: Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing.Nature 2000, 407(6800):48-54.9. Steiner H, Winkler E, Edbauer D, Prokop S, Basset G, Yamasaki A, Kostka M,Haass C: PEN-2 is an integral component of the gamma-secretasecomplex required for coordinated expression of presenilin and nicastrin.J Biol Chem 2002, 277(42):39062-39065.10. Francis R, McGrath G, Zhang J, Ruddy DA, Sym M, Apfeld J, Nicoll M,Maxwell M, Hai B, Ellis MC, et al: aph-1 and pen-2 are required for Notchpathway signaling, gamma-secretase cleavage of betaAPP, andpresenilin protein accumulation. Dev Cell 2002, 3(1):85-97.11. Edbauer D, Winkler E, Regula JT, Pesold B, Steiner H, Haass C:Reconstitution of gamma-secretase activity. Nat Cell Biol 2003,5(5):486-488.12. Kimberly WT, LaVoie MJ, Ostaszewski BL, Ye W, Wolfe MS, Selkoe DJ:Gamma-secretase is a membrane protein complex comprised ofpresenilin, nicastrin, Aph-1, and Pen-2. Proc Natl Acad Sci USA 2003,100(11):6382-6387.13. Luo WJ, Wang H, Li H, Kim BS, Shah S, Lee HJ, Thinakaran G, Kim TW, Yu G,Xu H: PEN-2 and APH-1 coordinately regulate proteolytic processing ofpresenilin 1. J Biol Chem 2003, 278(10):7850-7854.Liu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 9 of 1114. Zhou S, Zhou H, Walian PJ, Jap BK: CD147 is a regulatory subunit of thegamma-secretase complex in Alzheimer’s disease amyloid beta-peptideproduction. Proc Natl Acad Sci USA 2005, 102(21):7499-7504.15. Li Y, Zhou W, Tong Y, He G, Song W: Control of APP processing andAbeta generation level by BACE1 enzymatic activity and transcription.FASEB J 2006, 20(2):285-292.16. Zhou W, Song W: Leaky scanning and reinitiation regulate BACE1 geneexpression. Mol Cell Biol 2006, 26(9):3353-3364.17. Borchelt DR, Ratovitski T, van Lare J, Lee MK, Gonzales V, Jenkins NA,Copeland NG, Price DL, Sisodia SS: Accelerated amyloid deposition in thebrains of transgenic mice coexpressing mutant presenilin 1 and amyloidprecursor proteins. Neuron 1997, 19(4):939-945.18. Borchelt DR, Thinakaran G, Eckman CB, Lee MK, Davenport F, Ratovitsky T,Prada CM, Kim G, Seekins S, Yager D, et al: Familial Alzheimer’s disease-linked presenilin 1 variants elevate Abeta1-42/1-40 ratio in vitro and invivo. Neuron 1996, 17(5):1005-1013.19. Scheuner D, Eckman C, Jensen M, Song X, Citron M, Suzuki N, Bird TD,Hardy J, Hutton M, Kukull W, et al: Secreted amyloid beta-protein similarto that in the senile plaques of Alzheimer’s disease is increased in vivoby the presenilin 1 and 2 and APP mutations linked to familialAlzheimer’s disease. Nat Med 1996, 2(8):864-870.20. Song W, Nadeau P, Yuan M, Yang X, Shen J, Yankner BA: Proteolyticrelease and nuclear translocation of Notch-1 are induced by presenilin-1and impaired by pathogenic presenilin-1 mutations. Proc Natl Acad SciUSA 1999, 96(12):6959-6963.21. Strooper BD, Annaert W, Cupers P, Saftig P, Craessaerts K, Mumm JS,Schroeter EH, Schrijvers V, Wolfe MS, Ray WJ, et al: A presenilin-1-dependent gamma-secretase-like protease mediates release of Notchintracellular domain. Nature 1999, 398(6727):518-522.22. De Strooper B, Annaert W, Cupers P, Saftig P, Craessaerts K, Mumm JS,Schroeter EH, Schrijvers V, Wolfe MS, Ray WJ, et al: A presenilin-1-dependent gamma-secretase-like protease mediates release of Notchintracellular domain. Nature 1999, 398(6727):518-522.23. Zhang Z, Nadeau P, Song W, Donoviel D, Yuan M, Bernstein A, Yankner BA:Presenilins are required for gamma-secretase cleavage of beta-APP andtransmembrane cleavage of Notch-1. Nat Cell Biol 2000, 2(7):463-465.24. Herreman A, Serneels L, Annaert W, Collen D, Schoonjans L, De Strooper B:Total inactivation of gamma-secretase activity in presenilin-deficientembryonic stem cells. Nat Cell Biol 2000, 2(7):461-462.25. Kukar TL, Ladd TB, Bann MA, Fraering PC, Narlawar R, Maharvi GM, Healy B,Chapman R, Welzel AT, Price RW, et al: Substrate-targeting gamma-secretase modulators. Nature 2008, 453(7197):925-929.26. Chen F, Gu Y, Hasegawa H, Ruan X, Arawaka S, Fraser P, Westaway D,Mount H, George-Hyslop PS: Presenilin 1 mutations activate gamma 42-secretase but reciprocally inhibit epsilon-secretase cleavage of amyloidprecursor protein (APP) and S3-cleavage of notch. J Biol Chem 2002,277(39):36521-36526.27. Blum R, Feick P, Puype M, Vandekerckhove J, Klengel R, Nastainczyk W,Schulz I: Tmp21 and p24A, two type I proteins enriched in pancreaticmicrosomal membranes, are members of a protein family involved invesicular trafficking. J Biol Chem 1996, 271(29):17183-17189.28. Dominguez M, Dejgaard K, Füllekrug J, Dahan S, Fazel A, Paccaud JP,Thomas DY, Bergeron JJ, Nilsson T: gp25L/emp24/p24 protein familymembers of the cis-Golgi network bind both COP I and II coatomer. JCell Biol 1998, 140(4):751-765.29. Fiedler K, Veit M, Stamnes MA, Rothman JE: Bimodal interaction ofcoatomer with the p24 family of putative cargo receptors. Science 1996,273(5280):1396-1399.30. Sohn K, Orci L, Ravazzola M, Amherdt M, Bremser M, Lottspeich F, Fiedler K,Helms JB, Wieland FT: A major transmembrane protein of Golgi-derivedCOPI-coated vesicles involved in coatomer binding. J Cell Biol 1996,135(5):1239-1248.31. Blum R, Pfeiffer F, Feick P, Nastainczyk W, Kohler B, Schäfer KH, Schulz I:Intracellular localization and in vivo trafficking of p24A and p23. J CellSci 1999, 112(Pt 4):537-548.32. Gommel D, Orci L, Emig EM, Hannah MJ, Ravazzola M, Nickel W, Helms JB,Wieland FT, Sohn K: p24 and p23, the major transmembrane proteins ofCOPI-coated transport vesicles, form hetero-oligomeric complexes andcycle between the organelles of the early secretory pathway. FEBS Lett1999, 447(2-3):179-185.33. Nickel W, Sohn K, Bünning C, Wieland FT: p23, a major COPI-vesiclemembrane protein, constitutively cycles through the early secretorypathway. Proc Natl Acad Sci USA 1997, 94(21):11393-11398.34. Barr FA, Preisinger C, Kopajtich R, Körner R: Golgi matrix proteins interactwith p24 cargo receptors and aid their efficient retention in the Golgiapparatus. J Cell Biol 2001, 155(6):885-891.35. Rojo M, Emery G, Marjomäki V, McDowall AW, Parton RG, Gruenberg J: Thetransmembrane protein p23 contributes to the organization of the Golgiapparatus. J Cell Sci 2000, 113(Pt 6):1043-1057.36. Denzel A, Otto F, Girod A, Pepperkok R, Watson R, Rosewell I, Bergeron JJ,Solari RC, Owen MJ: The p24 family member p23 is required for earlyembryonic development. Curr Biol 2000, 10(1):55-58.37. Chen F, Hasegawa H, Schmitt-Ulms G, Kawarai T, Bohm C, Katayama T,Gu Y, Sanjo N, Glista M, Rogaeva E, et al: TMP21 is a presenilin complexcomponent that modulates gamma-secretase but not epsilon-secretaseactivity. Nature 2006, 440(7088):1208-1212.38. Liu S, Bromley-Brits K, Xia K, Mittelholtz J, Wang R, Song W: TMP21degradation is mediated by the ubiquitin-proteasome pathway. Eur JNeurosci 2008, 28(10):1980-1988.39. Horsley V, Pavlath GK: NFAT: ubiquitous regulator of cell differentiationand adaptation. J Cell Biol 2002, 156(5):771-774.40. Serfling E, Chuvpilo S, Liu J, Hofer T, Palmetshofer A: NFATc1autoregulation: a crucial step for cell-fate determination. Trends Immunol2006, 27(10):461-469.41. Pessler F, Dai L, Cron RQ, Schumacher HR: NFAT transcription factors–newplayers in the pathogenesis of inflammatory arthropathies? AutoimmunRev 2006, 5(2):106-110.42. Holowachuk EW: Nuclear factor of activated T cell (NFAT) transcriptionproteins regulate genes involved in adipocyte metabolism and lipolysis.Biochem Biophys Res Commun 2007, 361(2):427-432.43. Crabtree GR: Generic signals and specific outcomes: signaling throughCa2+, calcineurin, and NF-AT. Cell 1999, 96(5):611-614.44. Schulz RA, Yutzey KE: Calcineurin signaling and NFAT activation incardiovascular and skeletal muscle development. Dev Biol 2004,266(1):1-16.45. Lipskaia L, Lompre AM: Alteration in temporal kinetics of Ca2+ signalingand control of growth and proliferation. Biol Cell 2004, 96(1):55-68.46. Teixeira LK, Fonseca BP, Vieira-de-Abreu A, Barboza BA, Robbs BK, Bozza PT,Viola JP: IFN-gamma production by CD8+ T cells depends on NFAT1transcription factor and regulates Th differentiation. J Immunol 2005,175(9):5931-5939.47. Rao A, Luo C, Hogan PG: Transcription factors of the NFAT family:regulation and function. Annu Rev Immunol 1997, 15:707-747.48. Shaw KT, Ho AM, Raghavan A, Kim J, Jain J, Park J, Sharma S, Rao A,Hogan PG: Immunosuppressive drugs prevent a rapid dephosphorylationof transcription factor NFAT1 in stimulated immune cells. Proc Natl AcadSci USA 1995, 92(24):11205-11209.49. Feske S, Draeger R, Peter HH, Eichmann K, Rao A: The duration of nuclearresidence of NFAT determines the pattern of cytokine expression inhuman SCID T cells. J Immunol 2000, 165(1):297-305.50. Hogan PG, Chen L, Nardone J, Rao A: Transcriptional regulation bycalcium, calcineurin, and NFAT. Genes Dev 2003, 17(18):2205-2232.51. Crabtree GR, Schreiber SL: SnapShot: Ca2+-calcineurin-NFAT signaling. Cell2009, 138(1):210, 210 e211.52. Loh C, Carew JA, Kim J, Hogan PG, Rao A: T-cell receptor stimulationelicits an early phase of activation and a later phase of deactivation ofthe transcription factor NFAT1. Mol Cell Biol 1996, 16(7):3945-3954.53. Loh C, Shaw KT, Carew J, Viola JP, Luo C, Perrino BA, Rao A: Calcineurinbinds the transcription factor NFAT1 and reversibly regulates its activity.J Biol Chem 1996, 271(18):10884-10891.54. Lee M, Park J: Regulation of NFAT activation: a potential therapeutictarget for immunosuppression. Mol Cells 2006, 22(1):1-7.55. Martinez-Martinez S, Gomez del Arco P, Armesilla AL, Aramburu J, Luo C,Rao A, Redondo JM: Blockade of T-cell activation by dithiocarbamatesinvolves novel mechanisms of inhibition of nuclear factor of activated Tcells. Mol Cell Biol 1997, 17(11):6437-6447.56. Sherrington R, Rogaev EI, Liang Y, Rogaeva EA, Levesque G, Ikeda M,Chi H, Lin C, Li G, Holman K: Cloning of a gene bearing missensemutations in early-onset familial Alzheimer’s disease. Nature 1995,375(6534):754-760.Liu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 10 of 1157. Christensen MA, Zhou W, Qing H, Lehman A, Philipsen S, Song W:Transcriptional regulation of BACE1, the beta-amyloid precursor proteinbeta-secretase, by Sp1. Mol Cell Biol 2004, 24(2):865-874.58. Basler K, Oesch B, Scott M, Westaway D, Walchli M, Groth DF, McKinley MP,Prusiner SB, Weissmann C: Scrapie and cellular PrP isoforms are encodedby the same chromosomal gene. Cell 1986, 46(3):417-428.59. Sun X, He G, Qing H, Zhou W, Dobie F, Cai F, Staufenbiel M, Huang LE,Song W: Hypoxia facilitates Alzheimer’s disease pathogenesis by up-regulating BACE1 gene expression. Proc Natl Acad Sci USA 2006,103(49):18727-18732.60. Yoeli-Lerner M, Yiu GK, Rabinovitz I, Erhardt P, Jauliac S, Toker A: Akt blocksbreast cancer cell motility and invasion through the transcription factorNFAT. Mol Cell 2005, 20(4):539-550.61. Nelson JD, Denisenko O, Bomsztyk K: Protocol for the fast chromatinimmunoprecipitation (ChIP) method. Nat Protoc 2006, 1(1):179-185.doi:10.1186/1750-1326-6-21Cite this article as: Liu et al.: Transcriptional Regulation of TMP21 byNFAT. Molecular Neurodegeneration 2011 6:21.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitLiu et al. Molecular Neurodegeneration 2011, 6:21http://www.molecularneurodegeneration.com/content/6/1/21Page 11 of 11

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0228468/manifest

Comment

Related Items