UBC Faculty Research and Publications

Reduced elastogenesis: a clue to the arteriosclerosis and emphysematous changes in Schimke immuno-osseous… Morimoto, Marie; Yu, Zhongxin; Stenzel, Peter; Clewing, J M; Najafian, Behzad; Mayfield, Christy; Hendson, Glenda; Weinkauf, Justin G; Gormley, Andrew K; Parham, David M; Ponniah, Umakumaran; André, Jean-Luc; Asakura, Yumi; Basiratnia, Mitra; Bogdanović, Radovan; Bokenkamp, Arend; Bonneau, Dominique; Buck, Anna; Charrow, Joel; Cochat, Pierre; Cordeiro, Isabel; Deschenes, Georges; Fenkçi, M S; Frange, Pierre; Fründ, Stefan; Fryssira, Helen; Guillen-Navarro, Encarna; Keller, Kory; Kirmani, Salman; Kobelka, Christine; Lamfers, Petra; Levtchenko, Elena; Lewis, David B; Massella, Laura; McLeod, D R; Milford, David V; Nobili, François; Saraiva, Jorge M; Semerci, C N; Shoemaker, Lawrence; Stajić, Nataša; Stein, Anja; Taha, Doris; Wand, Dorothea; Zonana, Jonathan; Lücke, Thomas; Boerkoel, Cornelius F Sep 22, 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-13023_2012_Article_465.pdf [ 2.58MB ]
Metadata
JSON: 52383-1.0223980.json
JSON-LD: 52383-1.0223980-ld.json
RDF/XML (Pretty): 52383-1.0223980-rdf.xml
RDF/JSON: 52383-1.0223980-rdf.json
Turtle: 52383-1.0223980-turtle.txt
N-Triples: 52383-1.0223980-rdf-ntriples.txt
Original Record: 52383-1.0223980-source.json
Full Text
52383-1.0223980-fulltext.txt
Citation
52383-1.0223980.ris

Full Text

RESEARCH Open AccessReduced elastogenesis: a clue to thearteriosclerosis and emphysematous changes inSchimke immuno-osseous dysplasia?Marie Morimoto1,2, Zhongxin Yu3, Peter Stenzel4, J Marietta Clewing5, Behzad Najafian6, Christy Mayfield7,Glenda Hendson8, Justin G Weinkauf9, Andrew K Gormley10, David M Parham3, Umakumaran Ponniah10,Jean-Luc André11, Yumi Asakura12, Mitra Basiratnia13, Radovan Bogdanović14, Arend Bokenkamp15,Dominique Bonneau16, Anna Buck17, Joel Charrow18, Pierre Cochat19, Isabel Cordeiro20, Georges Deschenes21,M Semin Fenkçi22, Pierre Frange23, Stefan Fründ24, Helen Fryssira25, Encarna Guillen-Navarro26, Kory Keller27,Salman Kirmani28, Christine Kobelka29, Petra Lamfers30, Elena Levtchenko31, David B Lewis32, Laura Massella33,D Ross McLeod34, David V Milford35, François Nobili36, Jorge M Saraiva37, C Nur Semerci38, Lawrence Shoemaker39,Nataša Stajić14, Anja Stein40, Doris Taha41, Dorothea Wand42, Jonathan Zonana27, Thomas Lücke43and Cornelius F Boerkoel1,2*AbstractBackground: Arteriosclerosis and emphysema develop in individuals with Schimke immuno-osseous dysplasia(SIOD), a multisystem disorder caused by biallelic mutations in SMARCAL1 (SWI/SNF-related, matrix-associated,actin-dependent regulator of chromatin, subfamily a-like 1). However, the mechanism by which the vascular andpulmonary disease arises in SIOD remains unknown.Methods: We reviewed the records of 65 patients with SMARCAL1 mutations. Molecular and immunohistochemicalanalyses were conducted on autopsy tissue from 4 SIOD patients.Results: Thirty-two of 63 patients had signs of arteriosclerosis and 3 of 51 had signs of emphysema. Thearteriosclerosis was characterized by intimal and medial hyperplasia, smooth muscle cell hyperplasia andfragmented and disorganized elastin fibers, and the pulmonary disease was characterized by panlobularenlargement of air spaces. Consistent with a cell autonomous disorder, SMARCAL1 was expressed in arterial andlung tissue, and both the aorta and lung of SIOD patients had reduced expression of elastin and alterations in theexpression of regulators of elastin gene expression.Conclusions: This first comprehensive study of the vascular and pulmonary complications of SIOD shows that thesecommonly cause morbidity and mortality and might arise from impaired elastogenesis. Additionally, the effect ofSMARCAL1 deficiency on elastin expression provides a model for understanding other features of SIOD.Keywords: Schimke immuno-osseous dysplasia, SMARCAL1, Elastin, Vascular disease, Pulmonary emphysema* Correspondence: boerkoel@interchange.ubc.ca1Provincial Medical Genetics Program, Department of Medical Genetics,Children's and Women's Health Centre of BC, 4500 Oak Street, Room C234,Vancouver, BC V6H 3N1, Canada2Rare Disease Foundation, Vancouver, British Columbia, CanadaFull list of author information is available at the end of the article© 2012 Morimoto et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70http://www.ojrd.com/content/7/1/70BackgroundSchimke immuno-osseous dysplasia (SIOD, OMIM242900) is an autosomal recessive disorder asso ciatedwith arteriosclerosis [1,2]. It is characterized by prominentskeletal dysplasia, renal failure, T-cell immunodeficiency,facial dysmorphism, and hyperpigmented macules [3-7].Other features include osteoporosis, joint degeneration,hypothyroidism, abnormal dentition, bone marrow failure,thin hair, corneal opacities, atherosclerosis, cerebrovas-cular events (CVEs), and migraine-like headaches [2,6-10].Severely affected patients usually die before 15 years of agefrom renal failure, infection, bone marrow failure, lungdisease, or CVEs [7].SIOD is caused by loss of function mutations in thegene encoding for the chromatin remodeling enzymeSWI/SNF-related, matrix-associated, actin-dependentregulator of chromatin, subfamily a-like 1 (SMARCAL1)[11]. SMARCAL1 functions as an annealing DNA heli-case at single to double strand transitions in DNA [12]and as a DNA stress response protein [13,14]. It alsointeracts with replication protein A, participates in theresolution of stalled DNA replication forks, and modu-lates transcription [14-18]. Despite advances in ourunderstanding of the SMARCAL1 enzyme, the mechan-ism by which SMARCAL1 deficiency leads to SIODremains undefined.As renal transplantation and dialysis have prolongedthe longevity of SIOD patients, cerebral ischemia fromarteriosclerosis has increasingly contributed to mor-bidity and mortality [7,19]. Although treatment withanticoagulant or hemorheological medications can tran-siently decrease the frequency and severity of CVEsand transient ischemic attacks (TIAs), the vascular dis-ease ultimately progresses [7] and is not associatedwith detectable alterations in nitric oxide productionor mitochondrial dysfunction [20,21]. Focal atheros-clerotic plaques, generalized hyperplasia of the tunicamedia, and splitting and fraying of the internal elasticlayer characterize the arterial pathology [1,2].Potential contributors to the arteriosclerosis includehypertension, hyperlipidemia, renal disease, and immunedysfunction [3,7,22,23]. However, the arterial pathologyobserved by Clewing et al. is most similar to thatreported for osteopontin deficiency or for impaired elas-togenesis [1,24-26]. Osteopontin is a cytokine that isinduced by the WNT signaling cascade [27], a cellularpathway that participates in the regulation of vascularsmooth muscle cell proliferation [28]. Impaired elasto-genesis arises either from mutations of ELN or fromimpaired function or expression of enzymes that processor bind elastin [29]. Mice heterozygous for Eln genedeletions show many features in common with SIODpatients, including systemic hypertension, pulmonaryhypertension, aortic valve disease and frequent inguinalhernias [7,30,31]. Further highlighting the possibility ofimpaired elastogenesis, the postmortem lungs of twoSIOD patients showed enlarged air spaces or emphyse-matous changes, a common feature in disorders of elas-togenesis [7,30,31].Given these observations, we hypothesized that osteo-pontin deficiency and/or impaired elastogenesis were theprimary causes of the vascular and pulmonary diseaseassociated with SIOD. To test these hypotheses and todetermine the prevalence of vascular and pulmonarydisease among SIOD patients, we reviewed the recordsof SIOD patients with identified SMARCAL1 mutations,delineated the arterial and pulmonary pathology andprofiled gene expression in postmortem artery and lung.We identify reduced elastin expression and synthesis as apossible basis of the arteriosclerosis and pulmonaryemphysema of SIOD patients.MethodsPatientsPatients referred to this study signed informed consentdocuments approved by the Institutional Review Boardof Baylor College of Medicine (Houston, TX, USA) orthe University of British Columbia (Vancouver, BC,Canada). Clinical data for 65 SIOD patients wereobtained from questionnaires completed by the attendingphysician and from medical records and summaries pro-vided by that physician. Autopsy tissues were obtainedaccording to the protocol approved by the University ofBritish Columbia. The SMARCAL1 mutations of SIODpatients are listed in Table 1.Case reportsPatient SD120The propositus was a 5.4-year old boy with Schimkeimmuno-osseous dysplasia (Additional file 1). Hewas born at 35 weeks gestation to healthy non-consanguineous parents by Cesarean section for intra-uterine growth retardation and oligohydramnios. At 1year of age, he underwent surgery to repair an inguinalhernia. At 3.2 years of age, he had surgery for bilateralhip dysplasia. Beginning in his third year, he developedrecurrent migraine-like headaches with aura, vomitingand hemiplegia. By 4 years of age, he manifested recur-rent TIAs, although he had normal brain magnetic res-onance imaging and angiography as well as normalelectroencephalogram studies. At 4.5 years of age, hedeveloped nephrotic syndrome that progressed to end-stage renal disease requiring dialysis. At 5.4 years, he wasadmitted to hospital for fever, anemia, hypoxia, and re-spiratory distress. His respiratory status rapidly worseneddespite antibiotics and mechanical ventilation. He diedfrom respiratory failure without identification of itscause. Postmortem studies showed alveolar damage,Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 2 of 17http://www.ojrd.com/content/7/1/70Table 1 Summary of pulmonary and vascular findings in SIOD patients with SMARCAL1 mutationsPedigreeNo.SMARCAL1 mutations Sex Pulmonary findings Vascular findings AgeatdeathCause of deathAgeatonsetLung dysfunctionor pathologyAgeatonsetCVA TIA MoyamoyaSD4a c.[1930C>T];[410delA] F NR - NR NR 8 Renal failureSD4b c.[1930C>T];[410delA] M NR - NR NR 8 Renal failureSD8 c.[1190delT];[?]A F NR - NR NR 5.7 PneumoniaSD16 c.[1933C>T];[1643T>A] M 34 Mild panlobularemphysema withdyspnea, pulmonaryhypertension,restrictive lungdisease- - -SD18a c.[1756C>T];[1756C>T] M NR NR - NR 43 CryptococcusmeningitisSD18c c.[1756C>T];[1756C>T] F - - - -SD22 c.[2459G>A];[2459G>A] M NR 8 - + - 14.6 CMV infectionSD23 c.[2542G>T];[2542G>T] M NR 4.1 + + - 10.3 UnknownSD24 NT_005403.17: g.[67482574_67497178del]+[67482574_67497178del]F - 7.5 + + NR 9 CVESD25 c.[100C>T];[49C>T] F - 5 + + NR 10.1 CVESD26 c.[2542G>T];[1190delT] M NR Pulmonary edema 5.3 + + - 8 Renal and bonemarrow failureSD27 c.[1940A>C];[1940A>C] F - - - - 25.6 Infectiouspulmonary diseaseSD28 c.[1696A>T;1698G>C;1702delG];[1696A>T;1698G>C;1702delG]M 12 Chronic cough,dyspnea, pulmonaryhypertensionNR - NR 12 PulmonaryhypertensionSD29 c.[1934delG];[862+1G>T] M 3.7 Pulmonary edema,restrictive lungdisease, pulmonaryfibrosis< 3 + + NR 4 Infectiouspulmonary diseaseBSD30 c.[1132G>T];[1132G>T] F NR 5.7 + - + 10 HSV pneumonitisSD31 NT_005403.17: g.[67482574_67497178del]+[67482574_67497178del]F NR 11 + + + 14 Lymphoproliferativedisease (secondary)SD33a c.[1146_1147delAA;1147+1_2delGT];[1097-2A>G]F - - - NR 2.8 Bone marrow failureSD33b c.[1146_1147delAA;1147+1_2delGT];[1097-2A>G]M - < 1 + - NR 3.7 CVESD35 c.[1736C>T];[2321C>A] M NR Pulmonary fibrosis - - - 8 Renal failureSD38 c.[1096+1G>A];[1096+1G>A] M 2 Asthma NR NR + - 10.8 Complications ofblood stem celltransplantSD39 c.[2114C>T];[1402G>C] M NR 11 + + NR 15 CVESD44 c.[2321C>A];[1191delG] M - 9 + + NR 11.9 Digestive bleedingSD47 c.[2459G>A];[?]A M - 7 + + -SD48 c.[1939A>C];[1939A>C] F 6.8 Pulmonaryhypertension4 + + + 6.8 EBV pneumoniaSD49 c.[2321C>A];[1920_1921insG] M 4.8 Pulmonary edema - - - 4.8 UnknownSD50 c.[2542G>T];[2542G>T] F 3 Restrictive lungdisease4.5 + + NR 8 Peritonitis andsepsis posttransverse colonperforationMorimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 3 of 17http://www.ojrd.com/content/7/1/70Table 1 Summary of pulmonary and vascular findings in SIOD patients with SMARCAL1 mutations (Continued)SD51 c.[2542G>T];[2459G>A] F - - - -SD53 c.[2291G>A];[2543G>T] M NR - - NRSD57 c.[955C>T];[955C>T] F < 10 Asthma, wheezing,basilar atelectasia8 + + - 28 PancreatitisSD60 c.[2542G>T];[2542G>T] M NR Pulmonary edema,pulmonaryhypertension,emphysematouschanges uponautopsy8 + + NR 13.7 CVESD61 c.[1146_1147delAA;1147+1_2delGT];[1146_1147delAA;1147 + 1_2delGT]M - - - NR 5 Lymphoproliferativedisease (primary)SD65a c.[2542G>T];[836T>C] M - - - -SD65b c.[2542G>T];[836T>C] M 23 Diffusion andperfusion lungdisorder14 + + -SD66 c.[1933C>T];[1933C>T] M NR Pulmonary edema 7 + + + 13 Congestive heartfailureSD68 c.[1940A>C];[2462T>G] F - 6 + + - 7.1 CVESD70 c.[340_341insAGTCCAC];[836T>C] F - 6 + + - 18 Recurrent ileuspathologySD71 c[1000C>T];[836T>C] M - 6 + + - 9 UnknownSD74 c.[1736C>T];[?]A M - - - -SD78 c.[2264T>G];[1439C>T] F - NR - NR 10 PneumoniaSD79 c.[2459G>A];[?]A F - - - - 10 Complicationsof BMTSD84 c.[2104T>G];[1248_1249insC] M NR Pulmonaryhypertension,emphysematouschanges uponautopsy10 - + + 23 Pulmonaryhypertension withheart failureSD86 c.[2263_2282delATCGATGGCTCCACCTCATC];[1129G>C]F - - - - 5.7 Complicationsfollowing BMTSD96 c.[1427G>A];[1427G>A] M 6 Recurrent lunginfections- - - 6 InfectionCSD99 c.[1402G>C];[1402G>C] F 5.5 Pulmonary edema - - NR 5.5 Pulmonary edemaand left heart failureSD101 c.[2542G>T];[2542G>T] M NR 3 - + -SD102 c.[2542G>T];[2542G>T] M NR NR NR NR 8 Renal failureSD106 c.[1682G>A];[1682G>A] M 4 Chronic coughingand wheezing5.5 - + NR 8 Non-HodgkinLymphomaSD107 c.[2542G>T];[2542G>T] F 3 Restrictive lungdiseaseNR - NR 6 ThrombosisSD108a c.[1798C>T];[1798C>T] M - - - -SD108b c.[1798C>T];[1798C>T] M - - - NRSD111 c.[1129G>C];[1592T>C] M 13 Pulmonaryhypertension,chronic cough,restrictive lungdisease15 + + - 17.5 Respiratory failureSD112a c.[1934G>A];[2542G>T] F - - - -SD112b c.[1934G>A];[2542G>T] F - - - -SD114 c.[1898T>C];[1898T>C] M - 4 + - + 9.5 UnknownMorimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 4 of 17http://www.ojrd.com/content/7/1/70alveolitis, bronchitis, and dilated air spaces as well as ar-teriosclerosis, atherosclerosis, and cardiac left ventricularhypertrophy.Patients SD60 and SD84SD60 was a 13.7-year old boy and SD84 was a 23-yearold man. Both have been described previously [1,2].Patient SD16The propositus is a 36-year old man with mild SIOD(Additional file 1); he was described by Gilchrist et al. at16 years of age [32]. Since then, he has had bilateral hipand aortic valve replacement and respiratory insuffi-ciency requiring oxygen supplementation. He has nohistory of smoking or exposure to cigarette smoke. Hisspirometry and diffusion studies show signs of both re-strictive and obstructive pulmonary disease (Additionalfile 2). The former is consistent with his skeletaldysplasia and the latter is explained by the mild panlobular emphysema identified by computed tomography(Figure 1A, B). The severity of his respiratory distresshas been disproportionate to his lung pathology, and isexplained by Type I pulmonary arterial hypertensiondetected on right heart catheterization.RNA isolation and reverse transcriptionFor cultured cells, RNA was extracted from 1 X 107 cellsusing the RNeasy Mini Kit (Qiagen, Mississauga, ON,Canada). For tissues, RNA was extracted from flash frozentissue pulverized with a Bessman tissue pulverizer andlysed with TRIzol reagent (Invitrogen, Burlington, ON,Canada) according to the manufacturer’s specifications.Subsequently, the RNeasy Mini Kit (Qiagen, Mississauga,ON, Canada) was used to purify the RNA. Residual gen-omic DNA was removed by DNase I digestion.Control aorta RNA pooled from 4 unaffected indivi-duals ranging in age from 27–45 years was purchasedfrom Clontech (636546, Lot no. 9052725A, MountainView, CA, USA). Control lung RNA pooled from 3 un-affected individuals ranging in age from 32–61 years waspurchased from Clontech (636643, Lot no. 8101369A,Mountain View, CA, USA).RNA from formalin-fixed paraffin-embedded umbilicalcord was isolated using the Ambion RecoverAll TotalNucleic Acid Isolation Kit (AM1975, Life Technologies,Burlington, ON, Canada) according to the manufac-turer’s specifications.Reverse transcription was performed with the qScriptTMcDNA Synthesis Kit (Quanta Biosciences, Gaithersburg,MD, USA) or the RT2 First Strand Kit (SABiosciences,Mississauga, ON, Canada) using 500 ng of RNA per reac-tion according to the manufacturer’s specifications.PCRFollowing reverse transcription, 1.5 μl of cDNA servedas template for each reaction and was amplified with theTable 1 Summary of pulmonary and vascular findings in SIOD patients with SMARCAL1 mutations (Continued)SD115 c.[1437_1438insG];[1437_1438insG] F < 0.6 Mild bronchiectasis - - - 1 Pneumonia withrespiratory failureSD119 c.[2449C>T];[2542G>T] F NR NR - NRSD120 c.[2291G>A];[2542G>T] M NR Restrictive lungdisease,emphysematouschanges3 - + - 5.5 Respiratory failureSD121 c.[1382G>A];[2542G>T] F - 3.3 + - - 4.8 CVESD123 c.[49C>T];[49C>T] F - 4 - + -SD124 c.[1920_1921insG];[1920_1921insG] M - - NR -SD127 c.[1736C>T];[1736C>T] F 9 Reactive airwaydisease7 + + +SD131 c.[1026C>A];[2264T>G] M - NR + - - 4.6 CerebralhemorrhageSD133a c.[863-2A>G;2343_2347_delGCTGT];[=;2343_2347_delGCTGT]F - - - - 3 Pulmonaryembolism(secondary)SD133b c.[863-2A>G;2343_2347_delGCTGT];[=;2343_2347_delGCTGT]F TerminatedpregnancySD138 c.[2542G>T];[2542G>T] M - NA NA NA NAAbbreviation: +, feature present; -, feature not present; BMT, bone marrow transplant; CVE, cerebrovascular event; CMV, cytomegalovirus; EBV, Epstein-Barr virus; F,female; HSV, herpes simplex virus; M, male; NA, not applicable; NR, not reported; TIA, transient ischemic attack.A[?] represents alleles with noncoding SMARCAL1 mutations as described by Clewing et al. [60].BNo bacteriologic or viral proof.CInfection of peritoneal dialysis fluid.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 5 of 17http://www.ojrd.com/content/7/1/70HotStarTaq Master Mix Kit (Qiagen, Toronto, ON,Canada). The following conditions were used for amplifi-cation: 1 cycle of 95°C for 15 min, followed by 30 cyclesof 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, and afinal extension at 72°C for 10 min. PCR was performedusing the primers listed in Additional file 3.Gene expression arrayThe Atherosclerosis (PAHS-038) RT2 Profiler™ PCRArray from SABiosciences (Mississauga, ON, Canada)was used to assess differences in gene expression be-tween control and SIOD aortic mRNA according to themanufacturer’s instructions.Quantitative PCRSsoFast EvaGreen Supermix (Bio-rad Laboratories,Mississauga, ON, Canada) or RT2 Real-Time™ SYBRGreen/Rox PCR master mix (SABiosciences, Mississauga,ON, Canada) was used with the ABI 7500 Fast Real-Time PCR System for quantitative PCR. The primersequences are listed in Additional file 3.ELN mutation analysisGenomic DNA was extracted from the aorta of SD120using the DNeasy Tissue Kit (Qiagen, Toronto, ON,Canada) according to the manufacturer’s specifications.The 34 exons of ELN were amplified with the HotStar-Taq Plus Master Mix Kit (Qiagen, Toronto, ON,Canada). The following conditions were used for amplifi-cation: 1 cycle of 95°C for 5 min, followed by 35 cyclesof 94°C for 30 s, 55°C or 60°C for 30 s, 72°C for 45 s,and a final extension at 72°C for 10 min. PCR was per-formed using the primers listed in Additional file 3. Un-incorporated primers and nucleotides were removedusing ExoSAP-IT reagent (USB, Cleveland, OH, USA).Sanger capillary sequencing was used to sequence thePCR products (Macrogen, Seoul, Korea), and thesequences were aligned and analyzed using Sequencherv.4.10.1 (Gene Codes, Ann Arbor, MI, USA). Mutationinterpretation analysis was conducted using Alamut 2.0(Interactive Biosoftware, San Diego, CA, USA).Cell cultureAortic smooth muscle cells (AoSMCs, CC-2571, Lonza,Walkersville, MD, USA) were grown in smooth musclebasal medium (SmBM) supplemented with 5% fetal bo-vine serum (FBS), epidermal growth factor (EGF), basicfibroblast growth factor (FGF-B), insulin, gentamicin,and amphotericin B (SmGM-2 BulletKit, CC-3182,Lonza, Walkersville, MD, USA).Human iliac artery endothelial cells (HIAECs, CC-2545, Lonza, Walkersville, MD, USA) were grown inendothelial basal medium (EBM-2) supplemented with5% FBS, EGF, FGF-B, vascular endothelial growth factor(VEGF), R3 insulin-like growth factor 1 (R3-IGF-1),hydrocortisone, ascorbic acid, gentamicin, and ampho-tericin B (EGM-2-MV BulletKit, CC-3202, Lonza, Walk-ersville, MD, USA).Aortic adventitial fibroblasts (AoAFs, CC-7014, Lonza,Walkersville, MD, USA) were grown in stromal cell basalmedium (SCBM) supplemented with 5% FBS, FGF-B, in-sulin, gentamicin, and amphotericin B (SCGM BulletKit,CC-3205, Lonza, Walkersville, MD, USA).Normal human lung fibroblasts (NHLFs, CC-2512,Lonza, Walkersville, MD, USA) were grown in fibroblastbasal medium (FBM) supplemented with 2% FBS, FGF-B, insulin, gentamicin, and amphotericin B (FGM-2 Bul-letKit, CC-3132, Lonza, Walkersville, MD, USA).ImmunofluorescenceImmunostaining of cultured cells was performed as pre-viously described [33]. 5 x 105 cells were grown over-night on a coverslip in a 6-well plate. With the exceptionof the aortic smooth muscle cells (AoSMCs), all cellswere fixed with 4% paraformaldehyde (PFA) for 15 minat room temperature and permeabilized with 0.5% TritonX-100 for 15 min at room temperature. AoSMCs werefixed with 4% PFA and 0.15% picric acid for 20 min atroom temperature, and permeabilized with 0.1% TritonFigure 1 Emphysematous lung changes in an SIOD patient. (A, B) Consecutive axial computerized tomography images of the chest of patientSD16 at age 34 years. The images were captured 1 mm apart. Note the lung blebs (arrows).Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 6 of 17http://www.ojrd.com/content/7/1/70X-100, 1% bovine serum albumin (BSA), and 10% normalhorse serum in 1X phosphate buffered saline (PBS). Allcells were blocked overnight with Blocker Casein in PBS(Pierce, Rockford, IL, USA) containing 10% normal horseserum at 4°C. The cells were then incubated with anti-SMARCAL1 (1:200) [33], anti-α-smooth muscle actin(1:20, 1A4, Dako, Mississauga, ON, Canada), anti-VE-cadherin (1:100, 33E1, Leica, Richmond Hill, ON,Canada), anti-prolyl 4-hydroxylase (1:50, 5B5, Abcam,Cambridge, MA, USA), or anti-α-tubulin (1:400, DM 1A,Sigma-Aldrich, Oakville, ON, Canada) diluted in block-ing buffer at 4°C for 24 h. Cells then were gently washed4 times with PBS and incubated with Alexa Fluor-conjugated secondary antibodies Alexa 488 and Alexa555 (1:1000, Molecular Probes, Burlington, ON, Canada)for 1 h at room temperature. Cells next were washed 4times with PBS and mounted in Vectashield containing4’,6-diamidino-2-phenylindole (DAPI, Vector Laborator-ies, Burlington, ON, Canada). Images were acquiredusing a 100×/1.30 oil Plan-NEOFLUAR objective lens, aZeiss Axiovert 200 inverted microscope, a Zeiss Axio-camMR camera, and the Zeiss Axiovision imagingsystem.Immunoblot analysisImmunoblot analysis on cell lysates was performed aspreviously described [33]. Cell lysates were fractionatedby 12% sodium dodecyl sulfate polyacrylamide gelelectrophoresis (SDS-PAGE) and transferred to a poly-vinylidene fluoride (PVDF) membrane. The membranewas blocked overnight at 4°C, using gentle agitation, inPBS containing 0.2% I-Block (Applied Biosystems,Foster City, CA, USA) and 0.1% Tween 20 overnight.Anti-SMARCAL1 (1:2000) [33] and anti-glyceraldehyde3-phosphate dehydrogenase (GAPDH, 1:2000, 6C5,Advanced ImmunoChemical Inc., Long Beach, CA, USA)were used as primary antibodies. Alkaline phosphatase-conjugated secondary antibodies (1:10000, Bio-radLaboratories, Mississauga, ON, Canada) were used to de-tect the primary antibodies. The bound antibody wasdetected by chemiluminescence using CDP-Star (AppliedBiosystems, Streetsville, ON, Canada) according to themanufacturer’s specifications. GAPDH was detected as aloading control.Immunoblot analysis on human tissue was performedas previously described [33]. Anti-elastin binding protein(EBP, 1:200, a kind gift from Dr. Amelia Morrone, Uni-versity of Florence, Florence, Italy) [34,35] and anti-GAPDH were used as primary antibodies. EBP expres-sion in the aortas of two SIOD patients was comparedto that of a control aorta protein medley pooled from49 unaffected individuals ranging in age from 15–65years and purchased from Clontech (635310, Lot no.5110079, Mountain View, CA, USA). EBP expressionwas normalized to expression of GAPDH for each sam-ple. Densitometry of three independent replicates wasconducted using the Kodak 1D Image Analysis Softwareversion 3.6.Tissue immunohistochemistry and stainingFormalin-fixed, paraffin-embedded sections were cut at 5microns. Following deparaffinization and rehydration,heat induced epitope retrieval was conducted with so-dium citrate buffer (10 mM sodium citrate, 0.05% Tween20, pH 6) or tris-ethylene diamine tetraacetic acid(EDTA) buffer (10 mM Tris base, 1 mM EDTA, 0.05%Tween 20, pH 9). For immunohistochemical detection ofelastin, proteolytic induced epitope retrieval was con-ducted with 0.4% pepsin at 37°C for 15 min. Endogenousperoxidases were inactivated by preincubating the sec-tions with 0.3% H2O2 in methanol. Non-specific proteinbinding was blocked by preincubation at 4°C with block-ing buffer (10% horse serum in TBS-T (10 mM Tris–HCl, 150 mM NaCl, 0.01% Tween 20, pH 7.4)) for 24 h.Sections were then incubated with anti-SMARCAL1(1:200) [33], anti-CD3 (1:50, MRQ-39, Cell Marque,Rocklin, CA, USA), anti-CD20 (1:50, L26, Cell Marque,Rocklin, CA, USA), anti-CD68 (1:250, KP1, Dako,Mississauga, ON, Canada), anti-α-smooth muscle actin(1:500, 1A4, Dako, Mississauga, ON, Canada), or anti-elastin (1:50, BA-4, Abcam, Cambridge, MA, USA)diluted in blocking buffer at 4°C for 24 h. Sections werethen washed 5 times with TBS-T and incubated withhorseradish peroxidase (HRP)-conjugated secondaryantibodies (EnVision+ System, Dako, Mississauga, ON,Canada) for 30 min at room temperature. Sections werethen washed 3 times with TBS-T and 3,3’-diaminobenzi-dine (DAB, EnVision+ System, Dako, Mississauga, ON,Canada) was subsequently used as an HRP substrate.Sections were counterstained in Mayer’s Hematoxylin(Sigma, Oakville, ON, Canada).Histochemical stains on tissue sections included amodified Verhoeff van Geison elastic stain (HT25A,Sigma, Oakville, ON, Canada) for elastic fibers and aperiodic acid-Schiff stain (395B, Sigma, Oakville, ON,Canada) for neutral glycosaminoglycans. Images wereacquired using a 5x/0.15 Plan-NEOFLUAR, 10x/0.45Plan-APOCHROMAT, 20x/0.75 Plan-APOCHROMAT,63x/1.4 oil Plan-APOCHROMAT, or 100x/1.30 oil Plan-NEOFLUAR objective lens on a Zeiss Axiovert 200inverted microscope, a Zeiss AxiocamHR camera, andthe Zeiss Axiovision imaging system.Fastin elastin assayThe elastin content of arterial tissue was quantified usingthe Fastin Elastin Assay Kit (F2000, Bicolor Life ScienceAssays, United Kingdom). Tissue samples were flashfrozen and pulverized with a Bessman tissue pulverizer,Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 7 of 17http://www.ojrd.com/content/7/1/70weighed and digested with 0.25 M oxalic acid at 95°C forsix 1 h time periods. Elastin concentration in pooledsupernatants was calculated from the elastin standardcurve and the total elastin per wet weight of each samplewas determined according to the manufacturer’sspecifications.Arterial thickness analysisAnalysis of the aortic intimal and medial thicknesswas carried out using the Zeiss Axiovision imaging sys-tem and software to measure the width of the tunica in-tima and the tunica media. Four random images of eachsample were taken and 5 random measures were takenfor both the tunica intima and tunica media for eachimage. Measures of the tunica intima were takenfrom the luminal edge of the endothelium to the internalelastic lamina perpendicular to the internal elastic lam-ina; measures of the tunica media were taken fromthe internal elastic lamina to the boundary between thetunica media and the tunica adventitia perpendicularto the internal elastic lamina. Ratios were calculatedcomparing the widths of the tunica intima and tunicamedia of SIOD patient aortas to that of age-matchedcontrol aortas.Echocardiogram measurementsA transthoracic echocardiogram was obtained by a Phi-lips iE33 echocardiography machine using an S8 phasedarray ultrasound transducer probe with the patient in thesupine and left lateral position. M-mode, 2D, color Dop-pler, pulse wave Doppler and continuous wave Dopplerwere obtained. Standard views including long axis view,short axis view, four chambers, subcostal and supraster-nal notch views were obtained.The following measurements of the aorta in systolewere obtained in accordance to the American Society ofEchocardiogram guidelines in real time and confirmedpostmortem [36]: the aortic valve, the aortic root atthe sinus of Valsalva, the sinotubular junction and theascending aorta. Body surface area and Z scores werecalculated offline using the Haycock and Halifax formula,respectively [37,38].Pulmonary function testingPatient SD16 performed complete pulmonary functiontests that met the American Thoracic Society (ATS) cri-teria for acceptability [39]. This included spirometery,lung volumes measured via plethsysmography, and diffu-sion capacity measured via nitrogen washout.Statistical analysisQuantitative data are presented as the mean ± 1 standarddeviation calculated from a minimum of 3 independentreplicates. Data were analyzed by the paired 2-tailedStudent’s t-test or the one-way analysis of variance(ANOVA) followed by the Tukey post hoc test where ap-propriate. A p-value of less than 0.05 was considered sta-tistically significant.ResultsPulmonary and vascular disease is common in SIODAmong SIOD patients with SMARCAL1 mutations, 22of 51 (43.1%) patients had lung disease (Table 1). Ob-structive lung disease was present in 7 (13.7%) patients,including 3 (5.9%) with asthma or reactive airway dis-ease, 1 (2.0%) with bronchiectasis, and 3 (5.9%) withemphysematous changes (Table 1).Regarding the vascular disease, 32 of 63 (50.8%)patients had clinical symptoms of cerebral ischemia and6 of 51 (11.8%) patients had documented pulmonaryhypertension. Twenty-five of 58 (43.1%) patients hadCVEs and 27 of 59 (45.8%) patients had TIAs (Table 1).For 7 patients, the onset of cerebral ischemia precededthe development of renal disease or hypertension, andamong patients who received a renal transplant, cerebralischemia worsened despite renal transplantation (datanot shown).Of the 65 patients with SMARCAL1 mutations, 47have died. Six (12.8%) died from pulmonary complica-tions, and 7 (14.9%) died from vascular disease (Table 1).Histopathology of the SIOD aorta shows fragmentedelastin fibers and hyperplasia of the tunica intima and mediaTo define better the histopathology of SIOD blood ves-sels, we analyzed postmortem arterial tissue from threeindividuals with SIOD (SD60, SD84 and SD120). Ver-hoeff van Gieson staining showed fragmented elastinfibers compared to age-matched controls (Figure 2 andAdditional file 4). The aorta, common iliac, and pulmon-ary arteries of SD60, SD84 and SD120 had marked in-timal and medial hyperplasia accompanied by anincreased number of elastic lamellae compared to age-matched controls (Figure 2 and Additional file 4). Theaortic tunica intima of SD60 and SD120 were 2.6-fold(p-value = 3.5 × 10-13) and 1.4-fold (p-value = 2.1 × 10-3)thicker than age-matched controls, respectively; the tu-nica media of SD60 and SD120 were 1.3-fold (p-values =5.6 × 10-21 and 7.2 × 10-15, respectively) thicker than age-matched controls. By echocardiogram, SD120 hadincreased diameter of the sinotubular junction comparedto normal using the Halifax formula, although measuresat other levels of the aortic root were within the normalrange (Additional file 5). Immunostaining for α-smoothmuscle actin showed an increased number of positivecells suggesting smooth muscle cell hyperplasia in theaortic intima of SD60 and SD120 (Additional file 6).Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 8 of 17http://www.ojrd.com/content/7/1/70Inflammation is not increased in the SIOD aortaSince SIOD patients have an immune disorder and theinflammation of atherosclerosis causes smooth musclecell hyperplasia [40,41], we also looked for evidence ofarterial inflammation. Using CD68 as a macrophage mar-ker, CD3 as a T-cell marker, and CD20 as a B-cell marker,immunostaining did not detect an inflammatory infiltratewithin the arterial walls (Additional file 7) except for theCD68+ macrophages within the atherosclerotic lesions ofSD84 (Additional file 7).Histopathology of the SIOD umbilical cord shows afragmented internal elastic laminaAs longstanding hypertension, renal failure and hyper-lipidemia of individuals SD60, SD84 and SD120 couldbe a cause of the arterial disease and are not presentin individuals with SIOD at birth, we tested this hy-pothesis by studying the umbilical artery of a 15-weekgestation fetus (SD133b) with biallelic SMARCAL1mutations (Table 1). Compared to age-matched con-trols, the fetal umbilical arteries of SD133b had inter-rupted circumferential expression of tropoelastin andelastin suggesting an intrinsic problem with elastogen-esis (Figure 3). Moreover, analysis of ELN mRNAexpression in the umbilical cord of SD133b and twoage-matched controls showed that the umbilical cordof both controls had 1.75- to 2.95-fold higher ELNmRNA expression compared to that of SD133b (Add-itional file 8).SMARCAL1 is expressed in the vascular smooth muscle,endothelial, and adventitial fibroblast cells of the arterialwallThe above findings suggest a local or cell autonomousbasis for the arteriosclerosis in SIOD, and consistent withthis mechanism, arteriosclerosis does not recur in thetransplanted kidneys of SIOD patients [1,2]. As a first re-quirement for a cell autonomous mechanism, SMAR-CAL1 must be expressed within the affected tissues, andindeed, SMARCAL1 was expressed in the adventitialfibroblasts, smooth muscle cells, and endothelium of thenormal human aorta, common iliac and pulmonary arter-ies (Figure 4A-C). It was also expressed in the nuclei ofcultured aortic smooth muscle cells (AoSMCs), iliac ar-tery endothelial cells (HIAECs), and aortic adventitialfibroblasts (AoAFs) (Figure 4D-K and Additional file 9).Given these findings, we hypothesized that the cell au-tonomous mechanisms of osteopontin deficiency orimpaired elastogenesis could give rise to arteriosclerosis.Figure 2 Photomicrographs of Verhoeff van Gieson stained aortas from SIOD patients and age-matched controls. Compared toage-matched controls, note the decreased elastin fiber staining, the fragmentation and splitting of the elastin fibers, the marked hyperplasia of thetunica intima and the tunica media in the aorta from three individuals with SIOD. Arteries are oriented with the tunica adventitia on the left andthe tunica intima on the right; the age of death is in parentheses. Scale bars: 50 μm.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 9 of 17http://www.ojrd.com/content/7/1/70Osteopontin expression is not decreased in the SIOD aortaOsteopontin is a direct target of the WNT pathwayand deficient WNT signaling can lead to osteopontin defi-ciency [27]. Therefore, since the histopathology of aortasfrom Opn−/−;Ldlr−/− mice resembles that of SIOD patients[26], we measured levels of SPP1 mRNA, which encodesosteopontin. Contrary to our hypothesis, SPP1 mRNAlevels were increased by 2.6-fold in the aorta of SD120compared to controls (Figure 5A and Additional file 10).Elastin binding protein is not decreased in the SIOD aortaBased on the preceding, we hypothesized that the arterio-sclerosis primarily arose from a defect of elastogenesisand was accentuated by hypertension, hyperlipidemia, andrenal failure. One mechanism for impaired elastin fiberassembly is a reduction in the protective chaperone elastinbinding protein (EBP) [42,43]. Elevated levels of glycosa-minoglycans, which are found in the mucopolysacchari-doses like Morquio syndrome, Costello syndrome andHurler’s disease, induce premature shedding of EBP andlead to impaired elastin fiber assembly [44-46]. Althoughlater studies have not confirmed mucopolysacchariduriaas a consistent feature of SIOD [6], we tested EBP levelssince chondroitin-6-sulphaturia was initially described asa feature of SIOD by Schimke et al. [5]. Immunoblottingshowed that EBP levels in the aortic lysate from SD60 andFigure 3 Elastin expression analysis of the umbilical cord from SIOD and unaffected fetuses at 15-weeks gestation. Note that theimmunohistochemical analysis shows marked discontinuity and reduced expression of elastin in the internal elastic lamina in SD133b comparedto that of 2 age-matched controls. This difference in expression of elastin precedes the development of hypertension, hypercholesterolemia, andrenal disease. Abbreviations: A, artery; V, vein. Scale bars: 50 μm.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 10 of 17http://www.ojrd.com/content/7/1/70SD120 were comparable to those of controls (Additionalfile 11), and PAS staining did not show evidence of theincreased deposition of neutral glycosaminoglycans that ischaracteristic of mucopolysaccharidoses [46,47] (Additionalfile 11).Elastin mRNA and protein are markedly reduced in theSIOD aortaTo test whether the elastin fiber pathology directly arisesfrom altered expression of ELN mRNA, we profiled itsexpression using the Atherosclerosis RT2 ProfilerTM PCRFigure 4 SMARCAL1 mRNA and protein are expressed in arterial and pulmonary tissue. (A-C) Photomicrographs of immunohistochemicaldetection of SMARCAL1 in the aorta, common iliac and pulmonary arteries. (D) Photograph of an immunoblot showing expression of SMARCAL1in aortic smooth muscle cells (AoSMCs), human iliac artery endothelial cells (HIAECs) and aortic adventitial fibroblasts (AoAFs). (E) Photograph ofan agarose gel of RT-PCR products showing expression of SMARCAL1 mRNA and cell-specific markers in AoSMCs, HIAECs, and AoAFs. Note thatsmooth muscle actin (ACTA2) is a marker of myofibroblasts and smooth muscle cells; VE-cadherin (CDH5) is a marker of endothelial cells; andprolyl 4-hydroxylase (P4HA3) is expressed in fibroblasts as well as multiple other cell types [59]. (F-H) Photomicrographs showingimmunofluorescent localization of SMARCAL1 (red) and α-tubulin (green) in cultured AoSMCs, HIAECs, and AoAFs. (I-K) Photomicrographsshowing immunofluorescent localization of SMARCAL1 (red) and the cell-specific markers smooth muscle actin (I), VE-cadherin (J), and prolyl4-hydroxylase (K) in AoSMCs, HIAECs, and AoAFs (green), respectively. (L) Photomicrograph of immunohistochemical detection of SMARCAL1 inthe lung. (M) Photograph of an immunoblot showing SMARCAL1 expression in normal human lung fibroblasts (NHLFs). (N) Photograph of anagarose gel of RT-PCR products showing expression of SMARCAL1 mRNA and cell-specific markers in NHLFs. GAPDH was used as a control. (O)Photomicrographs showing immunofluorescent localization of SMARCAL1 (red) and α-tubulin (green) in cultured NHLFs. (P) Photomicrographsshowing immunofluorescent localization of SMARCAL1 (red) and prolyl 4-hydroxylase (green) and in NHLFs. Scale bars: (A-C, L) 50 μm, 25 μm forinset; (F-K, O, P) 10 μm.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 11 of 17http://www.ojrd.com/content/7/1/70Array. ELN mRNA levels were 121-fold reduced in theaorta of SD120 (p-value = 0.0033; Figure 5A and Add-itional file 10), and total elastin protein, including solubleand insoluble elastin, was reduced by 63.7% in the aortictissue lysate of SD120 (Figure 5B).SMARCAL1 is expressed in lung myofibroblasts and ELNexpression is markedly reduced in SIOD lungGiven that impaired elastogenesis may serve as a poten-tial primary and cell autonomous cause of the arterio-sclerosis in SIOD, we hypothesized that it might also bea predisposing factor for the emphysematous changes orenlarged air spaces observed in the lungs of SIODpatients. SMARCAL1 was expressed in pneumocytesand lung myofibroblast cells and in the nuclei of culturednormal human lung myofibroblasts (NHLFs) (Figure 4L-P and Additional file 9). Consistent with observations inthe aorta, ELN mRNA was decreased 156-fold in thelung of SD120 compared to that of unaffected controls(p-value = 0.0023, Figure 5C).ELN gene mutations are not the cause of the reducedelastogenesis in SIODTo determine whether the decreased ELN mRNA inSD120 arises from mutations in ELN, we sequenced theELN gene in the aorta of patient SD120. Among the 34exons of the ELN gene, none were found to have patho-genic mutations. A heterozygous non-synonymouschange was found in exon 20 (c.1264G>A, p.Gly422Ser).However, the nucleotide and amino acid of interest areweakly conserved; Align-GVGD and SIFT algorithmspredict this variant unlikely to be pathogenic, and thisvariant has been reported as a single nucleotide poly-morphism (SNP, rs2071307) in dbSNP XML build 135with an average heterozygosity of 0.41. A homozygousintronic change was found in intron 20 (c.1315+17C>T),however this change was not predicted to alter splicingand has been reported as a SNP (rs2856728) with anaverage heterozygosity of 0.38.Expression of ELN transcription factors is significantlyaltered in SIOD aorta and lungWe hypothesized that SMARCAL1 deficiency altered theexpression of ELN either by direct effects on the ELNpromoter or by alteration of ELN transcription factor ex-pression. Compared to controls, the expression of ELNrepressors MYBL2, JUN, and TNF was increased 9.9-,4.2- and 3.0-fold, respectively, in the aorta of SD120(Figure 6A and Additional file 12). Also, in the lung, theexpression of all tested ELN activators was decreased1.3- to 5.0-fold and the expression of the negative regula-tor FOSL1 was increased 3.4-fold (Figure 6B and Add-itional file 12).DiscussionWe have shown that SIOD patients have clinical andhistopathological features of impaired vascular and pul-monary elastogenesis. This pathology correlates withdecreased ELN gene expression and altered expression ofELN transcriptional regulators.Figure 5 Elastin expression is significantly decreased in the aorta and lung of an SIOD patient. (A) Volcano plot comparing expression ofatherosclerosis-related genes in the aorta of SD120 to control aorta. Note the markedly reduced expression of elastin (ELN). Solid grey lines: 4-foldchange; solid black line: no change; dotted line: p = 0.01. Grey dots depict genes with decreased expression and black dots depict those withincreased expression. (B) Relative elastin protein in the aortic wall of SD120 compared to control. Total elastin protein was measured with theFastin Elastin Assay. Error bars represent one standard deviation. (C) Plot showing the level of ELN mRNA in SD120 and control lung tissuemeasured by qRT-PCR. The mRNA levels were standardized to GAPDH mRNA levels and plotted relative to the control. Note the markedlydecreased ELN expression. Error bars represent one standard deviation. ** = p < 0.01.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 12 of 17http://www.ojrd.com/content/7/1/70Considering the biochemical role of SMARCAL1 [12],we hypothesized that the altered expression of ELN arisesfrom direct and indirect effects of SMARCAL1 deficiencyon the ELN gene. SMARCAL1 deficiency could directlyaffect ELN gene expression by altering the local DNAstructure of the ELN gene. As an annealing helicase [12],SMARCAL1 might maintain the local DNA structure oftranscribed regions and thereby regulate gene expressionby modulating transcription factor binding [48]. Alterna-tively, SMARCAL1 deficiency could indirectly alter ELNgene expression by modulating the expression of up-stream transcriptional regulators of the ELN gene.Consistent with the latter, we observed altered expressionof negative and/or positive regulators of ELN transcrip-tion within the aorta and lung of patient SD120.The histopathology of the arteries from SIOD patientsrevealed increased elastic lamellae, increased aortic wallthickness, and fragmented elastin fibers in SIOD. SinceSIOD is a multisystem disease characterized by immunedeficiency, hypertension, hyperlipidemia, and renal dis-ease [7], we explored cell non-autonomous mechanismsfor the basis of the vascular disease. However, as sug-gested by the lack of recurrence of vascular disease intransplanted kidneys [1,2], we observed onset of vascularFigure 6 Expression of known ELN transcriptional activators and repressors in patient tissues. (A, B) Plots showing the relative mRNAlevels of known ELN transcriptional activators and repressors in SD120 aorta tissue (A) and in SD120 lung tissue (B) compared to controls. ThemRNA levels of three independent replicates were standardized to GAPDH mRNA levels and plotted relative to the control. Error bars representone standard deviation. Abbreviations: NS, not significant; * = p< 0.05, ** = p < 0.01.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 13 of 17http://www.ojrd.com/content/7/1/70ischemia prior to the onset of hypertension and renalfailure in some SIOD patients, no detectable inflamma-tory infiltrate in the aortic wall, and altered distributionof tropoelastin and elastin in a 15-week gestation SIODfetus. We concluded therefore that a local or cell autono-mous mechanism was the most likely cause of thearteriosclerosis.Such potential mechanisms included osteopontin defi-ciency, EBP deficiency and impaired elastogenesis. Con-trary to the first two hypotheses, the expression ofosteopontin mRNA was increased and EBP levels wereunaltered in SIOD arteries. Consistent with the third hy-pothesis, however, we found significantly decreased elas-tin expression in the aortic tissue of two SIOD patients,which was not a consequence of pathogenic mutationsin the ELN gene. Based on these findings, we concludethat a primary defect in elastogenesis is a parsimoniousmechanism of the vascular and pulmonary diseaseobserved in SIOD.Elastogenesis is critical for arterial and lung develop-ment and maintenance [49,50]. Besides being requiredfor the proper development of the arterial wall, elastinfibers maintain the tensile and elastic integrity of bloodvessel walls and regulate the proliferation, migration, andmaturation of vascular smooth muscle cells [51,52]. Inthe lung, elastin fibers are also required for proper devel-opment and for elastic recoil [53,54]. Haploinsufficiencyfor ELN causes arterial stenosis and hypertension insupravalvular aortic stenosis and Williams-Beuren syn-drome (WBS) as well as mild respiratory symptoms inWBS [55-57]. Elastin deficiency also causes vascular dis-ease, bronchiectasis, and emphysema in cutis laxa, amore severe defect of elastogenesis [24]. Similarly, miceheterozygous for deletion of the Eln gene have systemicand pulmonary hypertension, aortic valve disease, andfrequent inguinal hernias [30,31]; all of which areobserved with increased frequency in SIOD patients [7].The increase in the number of elastic lamellae and theincreased thickness of the tunica media observed inWBS and of mice heterozygous for deletion of the Elngene were also seen in the SIOD arteries [52,58]. Ofnote, consistent with the later onset of arterial and lungdisease in SIOD, the pathology in the SIOD tissue ismilder than that typically observed for WBS; none-theless, these pathological correlations suggest thatimpaired elastogenesis is a mechanism warranting fur-ther investigation as the cause of the arteriosclerosis andemphysematous pulmonary changes of SIOD.ConclusionsVascular and pulmonary disease are common causes ofmorbidity and mortality in SIOD, and consequently,individuals with SIOD should be evaluated and moni-tored for the development of vascular and pulmonarydisease. Regarding the molecular basis of this pathology,we find that SMARCAL1 deficiency is associated withaltered expression of ELN transcriptional regulators,severely decreased expression of elastin mRNA and pro-tein and impaired elastogenesis. These observations sug-gest a mechanism by which SMARCAL1 deficiencyaffects the pathogenesis of SIOD and await confirmationin additional patients.Additional filesAdditional file 1: Table S1: Summary of the patients’ clinical signs andsymptoms.Additional file 2: Table S2: Lung function parameters for SD16.Additional file 3: Table S3: Oligonucleotide primers used in this study.Additional file 4: Figure S1: Histopathology of the common iliac andpulmonary arteries of two SIOD patients. Verhoeff van Geison staining ofthese arteries reveals fragmented and reduced elastin fibers. Arteries areoriented with the tunica adventitia on the left and the tunica intima onthe right; the age of death is in parentheses. Scale bars: 50 μmAdditional file 5: Table S4: Summary of echocardiogram data forSD120.Additional file 6: Figure S2: Immunohistochemical detection ofsmooth muscle actin in the aortic tissue of three SIOD patients. Smoothmuscle actin is a marker of smooth muscle cells. Smooth muscle cellhyperplasia was observed in the aortas of SD120 and SD60. Arteries areoriented with the tunica adventitia on the left and the tunica intima onthe right; the age of death is in parentheses. Scale bars: 50 μm.Additional file 7: Figure S3: Immunohistochemical detection ofCD3+, CD20+, and CD68+ cells in aortic tissue of three SIOD patients. CD3,CD20, and CD68 are markers of T cells, B cells, and macrophages,respectively. Inflammatory infiltrates were not observed in the threepatients with the exception of macrophages within an atheroscleroticplaque of the aorta of patient SD84. Arteries are oriented with the tunicaadventitia on the left and the tunica intima on the right; the age of deathis in parentheses. Lymph node tissue sections were used as a positivecontrol. Scale bars: 50 μm.Additional file 8: Figure S4: ELN mRNA expression analysis of theumbilical cord from SIOD and unaffected fetuses at 15-weeks gestation.Plot showing relative ELN mRNA expression of the umbilical cord of twoage-matched controls compared to that of SD133b by qRT-PCR. ThemRNA levels of three independent replicates were standardized toGAPDH mRNA levels and plotted relative to the ELN mRNA expression ofthe umbilical cord of SD133b. Error bars represent one standarddeviation. ** = p < 0.01.Additional file 9: Figure S5: SMARCAL1 is expressed in the vascularsmooth muscle (AoSMC), endothelial (HIAEC), and adventitial fibroblast(AoAF) cells of the arterial wall, and in the myofibroblast (NHLF) cells ofthe lung. (A-H) Photomicrographs showing immunofluorescentlocalization of SMARCAL1 (red) and α-tubulin (green) in cultured AoSMCs(A), HIAECs (C), AoAFs (E), and NHLFs (G), and photomicrographs showingimmunofluorescent localization of SMARCAL1 (red) and the cell-specificmarkers (green) smooth muscle actin, VE-cadherin, and prolyl 4-hydroxylase in AoSMCs (B), HIAECs (D), AoAFs (F), and NHLFs (H). Scalebars: 10 μm.Additional file 10: Table S5: Gene expression changes ofatherosclerosis-related genes in SMARCAL1-deficient aorta determined bythe Atherosclerosis RT2 ProfilerTM PCR Array relative to control aorta.Additional file 11: Figure S6: Molecular and histopathological analysisof elastin binding protein expression and periodic acid-Schiff staining ofSMARCAL1-deficient aorta. (A) Photograph of an immunoblot showingunaltered elastin binding protein (EBP) expression in aortic lysates ofSD120 and SD60 compared to a pooled lysate of 49 unaffectedindividuals; GAPDH was used as a loading control. (B) Periodic acid-SchiffMorimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 14 of 17http://www.ojrd.com/content/7/1/70(PAS) staining of the aorta of two patients did not show altered PASstaining compared to age-matched controls. Arteries are oriented withthe tunica adventitia on the left and the tunica intima on the right; theage of death is in parentheses. Scale bars: 50 μm.Additional file 12: Table S6: Gene expression analysis of transcriptionalactivators and repressors of ELN in SMARCAL1-deficient aorta and lungdetermined by qRT-PCR relative to control aorta and lung.Competing interestsThe authors declare that they have no competing interests.Authors’ contributionsExperiments and statistical analyses: MM; data interpretation: MM, ZY, PS, CFB;patient ascertainment: ZY, PS, MC, BN, CM, JGW, AKG, DMP, UP, JLA, YA, MB,RB, AB, DB, AB, JC, PC, IC, GD, MSF, PF, SF, HF, EGN, KK, SK, CK, PL, EL, DBL,LM, DRM, DVM, FN, JMS, CNS, LS, NS, AS, DT, DW, JZ, TL, CFB; provision oftissues and technical support for histopathological studies: ZY, PS, GH;manuscript writing: MM, UP, JGW, CFB; study design: CFB. All authors readand approved the final version of the paper.AcknowledgementsWe are grateful to all of our patients and family members who havecontributed to this study. We thank Theresa Sturby, Barbara A. Antalffy andPauline Grennan for preparation of tissue. This work was supported in partby grants from the March of Dimes (6-FY02-136 to CF Boerkoel), the GillsonLongenbaugh Foundation (CF Boerkoel), the Dana Foundation (CF Boerkoel)and the New Development Award, Microscopy, and Administrative Cores ofthe Mental Retardation and Developmental Disabilities Research Center atBaylor College of Medicine (CF Boerkoel), the Burroughs WellcomeFoundation (1003400 to CF Boerkoel), the National Institute of Diabetes,Digestive, and Kidney Diseases, National Institutes of Health (R03 DK062174and R21DK065725 to CF Boerkoel), New Investigator Award from the SickKidsFoundation – Canadian Institutes of Health Research: Institute of HumanDevelopment, Child and Youth Health (CF Boerkoel), the Michael SmithFoundation for Health Research (CI-SCH-O1899(07–1) to CF Boerkoel), theAssociation Autour D’Emeric et D’Anthony (CF Boerkoel) and The Little GiantsFoundation (CF Boerkoel). CF Boerkoel is a scholar of the Michael SmithFoundation for Health Research and a Clinical Investigator of the Child &Family Research Institute.Author details1Provincial Medical Genetics Program, Department of Medical Genetics,Children's and Women's Health Centre of BC, 4500 Oak Street, Room C234,Vancouver, BC V6H 3N1, Canada. 2Rare Disease Foundation, Vancouver, BritishColumbia, Canada. 3Department of Pathology, University of Oklahoma HealthSciences Center, Oklahoma City, Oklahoma, United States of America.4Department of Pathology, Oregon Health and Science University, Portland,Oregon, United States of America. 5Department of Molecular and HumanGenetics, Baylor College of Medicine, Houston, Texas, United States ofAmerica. 6Department of Pathology, University of Washington, Seattle,Washington, United States of America. 7Warren Clinic, Tulsa, Oklahoma,United States of America. 8Department of Anatomic Pathology, University ofBritish Columbia and Children’s and Women’s Health Centre of BritishColumbia, Vancouver, British Columbia, Canada. 9Department of Medicine,University of Alberta, Edmonton, Alberta, Canada. 10Department of Pediatrics,University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma,United States of America. 11Néphrologie Pédiatrique, Hôpital d’Enfants,Centre Hospitalier Universitaire de Nancy, Vandoeuvre lés Nancy Cedex,France. 12Department of Endocrinology & Metabolism, Kanagawa Children’sMedical Center, Yokohama, Japan. 13Department of Pediatric Nephrology,Nephro-Urology Research Center, Shiraz University of Medical Sciences,Shiraz, Iran. 14Institute of Mother and Child Healthcare of Serbia, Belgrade,Serbia. 15Department of Pediatric Nephrology, VU University Medical Center,Amsterdam, The Netherlands. 16Département de Génétique, CentreHospitalier Universitaire d’Angers, Angers, France. 17Medizinische HochschuleHannover, Kinderklinik, Hannover, Germany. 18Division of Genetics, BirthDefects and Metabolism, Children's Memorial Hospital, Chicago, Illinois,United States of America. 19Centre de Référence des Maladies Rènales Rares,Hospices Civils de Lyon and Université de Lyon, Bron Cedex, France.20Serviço de Genética, Hospital Santa Maria, Centro Hospitalar Lisoboa Norte,Lisbon, Portugal. 21Département de Pédiatrie, Hôpital Robert Debré, Paris,France. 22Department of Internal Medicine, Division of Endocrinology andMetabolism, Cerrahi Hospital, Denizli, Turkey. 23Pediatric Immunology &Hematology Unit, Necker Hospital, Paris, France. 24Department of GeneralPediatrics, Pediatric Nephrology, University Children’s Hospital Münster,Münster, Germany. 25Department of Medical Genetics, “Aghia Sophia”Children’s Hospital, Athens University Medical School, Athens, Greece.26Unidad de Genética Médica, Servicio de Pediatría, Hospital UniversitarioVirgen de la Arrixaca, Murcia, Spain. 27Oregon Institute on Disability &Development, Child Development and Rehabilitation Center, Oregon Health& Science University, Portland, Oregon, United States of America. 28MedicalGenetics, Mayo Clinic, Rochester, Minnesota, United States of America.29Department of Genetics, Kaiser Permanente, San Francisco, California,United States of America. 30Mercy Pediatrics and Adolescent Clinic, ClearLake, Iowa, United States of America. 31Department of Pediatric Nephrology,University Hospitals Leuven, Leuven, Belgium. 32Department of Pediatrics,Immunology Program and Institute for Immunity, Transplantation, andInfection, Stanford University, Stanford, California, United States of America.33Divison of Nephrology, Bambino Gesù Children’s Hospital and ResearchInstitute, Rome, Italy. 34Department of Medical Genetics, Alberta Children’sHospital, Calgary, Alberta, Canada. 35Department of Nephrology, BirminghamChildren’s Hospital, Birmingham, United Kingdom. 36Service de Pédiatrie,Centre Hospitalier Régional Universitaire Hôpital Saint-Jacques, BesançonCedex, France. 37Consulta de Genética, Hospital Pediátrico de Coimbra,Coimbra, Portugal. 38Department of Medical Genetics, Pamukkale UniversityHospital, Denizli, Turkey. 39Division of Nephrology, Department of Pediatrics,Kosair Children’s Hospital, School of Medicine, University of Louisville,Louisville, Kentucky, United States of America. 40Universitätsklinikum Essen,Kinderklinik, Essen, Germany. 41Cape Breton Regional Hospital, Sydney, NovaScotia, Canada. 42Institut für Humangenetik, Martin-Luther-UniversitätHalle-Wittenberg, Halle, Germany. 43Department of Neuropediatrics,Children’s Hospital, Ruhr-University Bochum, Bochum, Germany.Received: 15 March 2012 Accepted: 14 September 2012Published: 22 September 2012References1. Clewing JM, Antalfy BC, Lücke T, Najafian B, Marwedel KM, Hori A, PowelRM, Safo Do AF, Najera L, SantaCruz K, et al: Schimke immuno-osseousdysplasia: a clinicopathological correlation. J Med Genet 2007,44:122–130.2. Lücke T, Marwedel KM, Kanzelmeyer NK, Hori A, Offner G, Kreipe HH, EhrichJH, Das AM: Generalized atherosclerosis sparing the transplanted kidneyin Schimke disease. Pediatr Nephrol 2004, 19:672–675.3. Ehrich JH, Burchert W, Schirg E, Krull F, Offner G, Hoyer PF, Brodehl J:Steroid resistant nephrotic syndrome associated withspondyloepiphyseal dysplasia, transient ischemic attacks andlymphopenia. Clin Nephrol 1995, 43:89–95.4. Baradaran-Heravi A, Thiel C, Rauch A, Zenker M, Boerkoel CF, Kaitila I: Clinicaland genetic distinction of Schimke immuno-osseous dysplasia andcartilage-hair hypoplasia. Am J Med Genet A 2008,146A:2013–2017.5. Schimke RN, Horton WA, King CR: Chondroitin-6-sulphaturia, defectivecellular immunity, and nephrotic syndrome. Lancet 1971, 2:1088–1089.6. Spranger J, Hinkel GK, Stoss H, Thoenes W, Wargowski D, Zepp F: Schimkeimmuno-osseous dysplasia: a newly recognized multisystem disease.J Pediatr 1991, 119:64–72.7. Boerkoel CF, O’Neill S, Andre JL, Benke PJ, Bogdanovic R, Bulla M, Burguet A,Cockfield S, Cordeiro I, Ehrich JH, et al: Manifestations and treatment ofSchimke immuno-osseous dysplasia: 14 new cases and a review of theliterature. Eur J Pediatr 2000, 159:1–7.8. da Fonseca MA: Dental findings in the Schimke immuno-osseousdysplasia. Am J Med Genet 2000, 93:158–160.9. Kilic SS, Donmez O, Sloan EA, Elizondo LI, Huang C, Andre JL, Bogdanovic R,Cockfield S, Cordeiro I, Deschenes G, et al: Association of migraine-likeheadaches with Schimke immuno-osseous dysplasia. Am J Med Genet A2005, 135:206–210.10. Saraiva JM, Dinis A, Resende C, Faria E, Gomes C, Correia AJ, Gil J, daFonseca N: Schimke immuno-osseous dysplasia: case report and reviewof 25 patients. J Med Genet 1999, 36:786–789.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 15 of 17http://www.ojrd.com/content/7/1/7011. Boerkoel CF, Takashima H, John J, Yan J, Stankiewicz P, Rosenbarker L, AndreJL, Bogdanovic R, Burguet A, Cockfield S, et al: Mutant chromatinremodeling protein SMARCAL1 causes Schimke immuno-osseousdysplasia. Nat Genet 2002, 30:215–220.12. Yusufzai T, Kadonaga JT: HARP is an ATP-driven annealing helicase. Science2008, 322:748–750.13. Postow L, Woo EM, Chait BT, Funabiki H: Identification of SMARCAL1 as acomponent of the DNA damage response. J Biol Chem 2009, .14. Yusufzai T, Kong X, Yokomori K, Kadonaga JT: The annealing helicase HARPis recruited to DNA repair sites via an interaction with RPA. Genes Dev2009, 23:2400–2404.15. Bansbach CE, Betous R, Lovejoy CA, Glick GG, Cortez D: The annealinghelicase SMARCAL1 maintains genome integrity at stalled replicationforks. Genes Dev 2009, 23:2405–2414.16. Ciccia A, Bredemeyer AL, Sowa ME, Terret ME, Jallepalli PV, Harper JW,Elledge SJ: The SIOD disorder protein SMARCAL1 is an RPA-interactingprotein involved in replication fork restart. Genes Dev 2009,23:2415–2425.17. Yuan J, Ghosal G, Chen J: The annealing helicase HARP protects stalledreplication forks. Genes Dev 2009, 23:2394–2399.18. Baradaran-Heravi A, Cho KS, Tolhuis B, Sanyal M, Morozova O, Morimoto M,Elizondo LI, Bridgewater D, Lubieniecka J, Beirnes K, et al: Penetrance ofbiallelic SMARCAL1 mutations is associated with environmental andgenetic disturbances of gene expression. Hum Mol Genet 2012,21:2572–2587.19. Boerkoel CF, Nowaczyk MJ, Blaser SI, Meschino WS, Weksberg R: Schimkeimmunoosseous dysplasia complicated by moyamoya phenomenon. AmJ Med Genet 1998, 78:118–122.20. Lücke T, Ehrich JH, Das AM: Mitochondrial function in Schimkeimmunoosseous dysplasia. Metab Brain Dis 2005, 20:237–242.21. Lücke T, Tsikas D, Kanzelmeyer NK, Boerkoel CF, Clewing JM, Vaske B, EhrichJH, Das AM: Vaso-occlusion in Schimke immuno-osseous dysplasia: is theNO pathway involved? Horm Metab Res 2006, 38:678–682.22. Smith FR: Hyperlipidemia and premature arteriosclerosis. Lipids 1978,13:375–377.23. Zieg J, Krepelova A, Baradaran-Heravi A, Levtchenko E, Guillen-Navarro E,Balascakova M, Sukova M, Seeman T, Dusek J, Simankova N, et al: Rituximabresistant Evans syndrome and autoimmunity in Schimke immuno-osseous dysplasia. Pediatr Rheumatol Online J 2011, 9:27.24. Milewicz DM, Urban Z, Boyd C: Genetic disorders of the elastic fibersystem. Matrix Biol 2000, 19:471–480.25. Bateman JF, Boot-Handford RP, Lamande SR: Genetic diseases ofconnective tissues: cellular and extracellular effects of ECM mutations.Nat Rev Genet 2009, 10:173–183.26. Shao JS, Sierra OL, Cohen R, Mecham RP, Kovacs A, Wang J, Distelhorst K,Behrmann A, Halstead LR, Towler DA: Vascular calcification and aorticfibrosis: a bifunctional role for osteopontin in diabetic arteriosclerosis.Arterioscler Thromb Vasc Biol 2011, 31:1821–1833.27. Rohde F, Rimkus C, Friederichs J, Rosenberg R, Marthen C, Doll D, HolzmannB, Siewert JR, Janssen KP: Expression of osteopontin, a target gene ofde-regulated Wnt signaling, predicts survival in colon cancer. Int J Cancer2007, 121:1717–1723.28. Bedel A, Negre-Salvayre A, Heeneman S, Grazide MH, Thiers JC, Salvayre R,Maupas-Schwalm F: E-cadherin/beta-catenin/T-cell factor pathway isinvolved in smooth muscle cell proliferation elicited by oxidizedlow-density lipoprotein. Circ Res 2008, 103:694–701.29. Sandberg LB, Soskel NT, Leslie JG: Elastin structure, biosynthesis, andrelation to disease states. N Engl J Med 1981, 304:566–579.30. Pezet M, Jacob MP, Escoubet B, Gheduzzi D, Tillet E, Perret P, Huber P,Quaglino D, Vranckx R, Li DY, et al: Elastin haploinsufficiency inducesalternative aging processes in the aorta. Rejuvenation Res 2008, 11:97–112.31. Dietz HC, Mecham RP: Mouse models of genetic diseases resulting frommutations in elastic fiber proteins. Matrix Biol 2000, 19:481–488.32. Gilchrist DM, Harley FL: Schimke immuno-osseous dysplasia. J Pediatr 1992,120:497.33. Deguchi K, Clewing JM, Elizondo LI, Hirano R, Huang C, Choi K, Sloan EA,Lucke T, Marwedel KM, Powell RD Jr, et al: Neurologic phenotype ofSchimke immuno-osseous dysplasia and neurodevelopmental expressionof SMARCAL1. J Neuropathol Exp Neurol 2008, 67:565–577.34. Caciotti A, Donati MA, Boneh A, d’Azzo A, Federico A, Parini R, Antuzzi D,Bardelli T, Nosi D, Kimonis V, et al: Role of beta-galactosidase and elastinbinding protein in lysosomal and nonlysosomal complexes of patientswith GM1-gangliosidosis. Hum Mutat 2005, 25:285–292.35. Malvagia S, Morrone A, Caciotti A, Bardelli T, d’Azzo A, Ancora G, ZammarchiE, Donati MA: New mutations in the PPBG gene lead to loss of PPCAprotein which affects the level of the beta-galactosidase/neuraminidasecomplex and the EBP-receptor. Mol Genet Metab 2004, 82:48–55.36. Lopez L, Colan SD, Frommelt PC, Ensing GJ, Kendall K, Younoszai AK, LaiWW, Geva T: Recommendations for quantification methods during theperformance of a pediatric echocardiogram: a report from the PediatricMeasurements Writing Group of the American Society ofEchocardiography Pediatric and Congenital Heart Disease Council. J AmSoc Echocardiogr 2010, 23:465–495. quiz 576–467.37. Haycock GB, Schwartz GJ, Wisotsky DH: Geometric method for measuringbody surface area: a height-weight formula validated in infants, children,and adults. J Pediatr 1978, 93:62–66.38. Warren AE, Boyd ML, O’Connell C, Dodds L: Dilatation of the ascendingaorta in paediatric patients with bicuspid aortic valve: frequency, rate ofprogression and risk factors. Heart 2006, 92:1496–1500.39. Miller MR, Crapo R, Hankinson J, Brusasco V, Burgos F, Casaburi R, Coates A,Enright P, van der Grinten CP, Gustafsson P, et al: General considerationsfor lung function testing. Eur Respir J 2005, 26:153–161.40. Libby P, Hansson GK: Involvement of the immune system in humanatherogenesis: current knowledge and unanswered questions. Lab Invest1991, 64:5–15.41. Ross R: Atherosclerosis-an inflammatory disease. N Engl J Med 1999,340:115–126.42. Hinek A, Mecham RP, Keeley F, Rabinovitch M: Impaired elastin fiberassembly related to reduced 67-kD elastin-binding protein in fetal lambductus arteriosus and in cultured aortic smooth muscle cells treated withchondroitin sulfate. J Clin Invest 1991, 88:2083–2094.43. Hinek A, Rabinovitch M: 67-kD elastin-binding protein is a protective“companion” of extracellular insoluble elastin and intracellulartropoelastin. J Cell Biol 1994, 126:563–574.44. Hinek A, Zhang S, Smith AC, Callahan JW: Impaired elastic-fiber assemblyby fibroblasts from patients with either Morquio B disease or infantileGM1-gangliosidosis is linked to deficiency in the 67-kD spliced variant ofbeta-galactosidase. Am J Hum Genet 2000, 67:23–36.45. Hinek A, Smith AC, Cutiongco EM, Callahan JW, Gripp KW, Weksberg R:Decreased elastin deposition and high proliferation of fibroblasts fromCostello syndrome are related to functional deficiency in the 67-kDelastin-binding protein. Am J Hum Genet 2000, 66:859–872.46. Hinek A, Wilson SE: Impaired elastogenesis in Hurler disease: dermatansulfate accumulation linked to deficiency in elastin-binding protein andelastic fiber assembly. Am J Pathol 2000, 156:925–938.47. Hinek A, Teitell MA, Schoyer L, Allen W, Gripp KW, Hamilton R, Weksberg R,Kluppel M, Lin AE: Myocardial storage of chondroitin sulfate-containingmoieties in Costello syndrome patients with severe hypertrophiccardiomyopathy. Am J Med Genet A 2005, 133A:1–12.48. Hatfield GW, Benham CJ: DNA topology-mediated control of global geneexpression in Escherichia coli. Annu Rev Genet 2002, 36:175–203.49. Hsu-Wong S, Katchman SD, Ledo I, Wu M, Khillan J, Bashir MM, RosenbloomJ, Uitto J: Tissue-specific and developmentally regulated expression ofhuman elastin promoter activity in transgenic mice. J Biol Chem 1994,269:18072–18075.50. Hirano E, Knutsen RH, Sugitani H, Ciliberto CH, Mecham RP: Functionalrescue of elastin insufficiency in mice by the human elastin gene:implications for mouse models of human disease. Circ Res 2007,101:523–531.51. Karnik SK, Brooke BS, Bayes-Genis A, Sorensen L, Wythe JD, Schwartz RS,Keating MT, Li DY: A critical role for elastin signaling in vascularmorphogenesis and disease. Development 2003, 130:411–423.52. Urban Z, Riazi S, Seidl TL, Katahira J, Smoot LB, Chitayat D, Boyd CD, HinekA: Connection between elastin haploinsufficiency and increased cellproliferation in patients with supravalvular aortic stenosis and Williams-Beuren syndrome. Am J Hum Genet 2002, 71:30–44.53. Shifren A, Mecham RP: The stumbling block in lung repair of emphysema:elastic fiber assembly. Proc Am Thorac Soc 2006, 3:428–433.54. Shifren A, Durmowicz AG, Knutsen RH, Hirano E, Mecham RP: Elastinprotein levels are a vital modifier affecting normal lung developmentand susceptibility to emphysema. Am J Physiol Lung Cell Mol Physiol 2007,292:L778–L787.Morimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 16 of 17http://www.ojrd.com/content/7/1/7055. Wan ES, Pober BR, Washko GR, Raby BA, Silverman EK: Pulmonary functionand emphysema in Williams-Beuren syndrome. Am J Med Genet A 2010,152A:653–656.56. Williams JC, Barratt-Boyes BG, Lowe JB: Supravalvular aortic stenosis.Circulation 1961, 24:1311–1318.57. Beuren AJ, Apitz J, Harmjanz D: Supravalvular aortic stenosis in associationwith mental retardation and a certain facial appearance. Circulation 1962,26:1235–1240.58. Li DY, Faury G, Taylor DG, Davis EC, Boyle WA, Mecham RP, Stenzel P, BoakB, Keating MT: Novel arterial pathology in mice and humans hemizygousfor elastin. J Clin Invest 1998, 102:1783–1787.59. Esterre P, Melin M, Serrar M, Grimaud JA: New specific markers of humanand mouse fibroblasts. Cell Mol Biol 1992, 38:297–301.60. Clewing JM, Fryssira H, Goodman D, Smithson SF, Sloan EA, Lou S, Huang Y,Choi K, Lucke T, Alpay H, et al: Schimke immunoosseous dysplasia:suggestions of genetic diversity. Hum Mutat 2007, 28:273–283.doi:10.1186/1750-1172-7-70Cite this article as: Morimoto et al.: Reduced elastogenesis: a clue to thearteriosclerosis and emphysematous changes in Schimke immuno-osseous dysplasia? Orphanet Journal of Rare Diseases 2012 7:70.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitMorimoto et al. Orphanet Journal of Rare Diseases 2012, 7:70 Page 17 of 17http://www.ojrd.com/content/7/1/70

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0223980/manifest

Comment

Related Items