UBC Faculty Research and Publications

Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae) as inferred from SSU and LSU rDNA… Hoppenrath, Mona; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F; Leander, Brian S May 25, 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


52383-12862_2009_Article_1030.pdf [ 2.72MB ]
JSON: 52383-1.0223778.json
JSON-LD: 52383-1.0223778-ld.json
RDF/XML (Pretty): 52383-1.0223778-rdf.xml
RDF/JSON: 52383-1.0223778-rdf.json
Turtle: 52383-1.0223778-turtle.txt
N-Triples: 52383-1.0223778-rdf-ntriples.txt
Original Record: 52383-1.0223778-source.json
Full Text

Full Text

ralssBioMed CentBMC Evolutionary BiologyOpen AcceResearch articleMolecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae) as inferred from SSU and LSU rDNA sequencesMona Hoppenrath*1,4, Tsvetan R Bachvaroff2, Sara M Handy3, Charles F Delwiche3 and Brian S Leander1Address: 1Departments of Botany and Zoology, University of British Columbia, 6270 University Boulevard, Vancouver, BC, V6T 1Z4, Canada, 2Smithsonian Environmental Research Center, Edgewater, MD 21037-0028, USA, 3Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD 20742-4407, USA and 4Current address : Forschungsinstitut Senckenberg, Deutsches Zentrum für Marine Biodiversitätsforschung (DZMB), Südstrand 44, D-26382 Wilhelmshaven, GermanyEmail: Mona Hoppenrath* - mhoppenrath@senckenberg.de; Tsvetan R Bachvaroff - bachvarofft@si.edu; Sara M Handy - shandy@umd.edu; Charles F Delwiche - delwiche@umd.edu; Brian S Leander - bleander@interchange.ubc.ca* Corresponding author    AbstractBackground: Dinoflagellates represent a major lineage of unicellular eukaryotes with unparalleled diversity andcomplexity in morphological features. The monophyly of dinoflagellates has been convincingly demonstrated, butthe interrelationships among dinoflagellate lineages still remain largely unresolved. Warnowiid dinoflagellates areamong the most remarkable eukaryotes known because of their possession of highly elaborate ultrastructuralsystems: pistons, nematocysts, and ocelloids. Complex organelles like these are evolutionary innovations foundonly in a few athecate dinoflagellates. Moreover, the taxonomy of warnowiids is extremely confusing andinferences about the evolutionary history of this lineage are mired by the absence of molecular phylogenetic datafrom any member of the group. In this study, we provide the first molecular phylogenetic data for warnowiids andcouple them with a review of warnowiid morphological features in order to formulate a hypothetical frameworkfor understanding character evolution within the group. These data also enabled us to evaluate the evolutionaryrelationship(s) between warnowiids and the other group of dinoflagellates with complex organelles: polykrikoids.Results: Molecular phylogenetic analyses of SSU and LSU rDNA sequences demonstrated that warnowiids forma well-supported clade that falls within the more inclusive Gymnodinium sensu stricto clade. These data alsoconfirmed that polykrikoids are members of the Gymnodinium sensu stricto clade as well; however, a specific sisterrelationship between the warnowiid clade and the polykrikoid clade was unresolved in all of our analyses.Nonetheless, the new DNA sequences from different isolates of warnowiids provided organismal anchors forseveral previously unidentified sequences derived from environmental DNA surveys of marine biodiversity.Conclusion: Comparative morphological data and molecular phylogenetic data demonstrate that the polykrikoidand the warnowiid clade are closely related to each other, but the precise branching order within theGymnodinium sensu stricto clade remains unresolved. We regard the ocelloid as the best synapomorphy forwarnowiids and infer that the most recent common ancestor of polykrikoids and warnowiids possessed bothnematocysts and photosynthetic plastids that were subsequently lost during the early evolution of warnowiids.Our summary of species and genus concepts in warnowiids demonstrate that the systematics of this poorlyunderstood group is highly problematic and a comprehensive revision is needed.Published: 25 May 2009BMC Evolutionary Biology 2009, 9:116 doi:10.1186/1471-2148-9-116Received: 24 February 2009Accepted: 25 May 2009This article is available from: http://www.biomedcentral.com/1471-2148/9/116© 2009 Hoppenrath et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 15(page number not for citation purposes)BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116BackgroundDinoflagellates represent a major lineage of unicellulareukaryotes with unparalleled diversity and complexity inmorphological features, molecular processes, nutritionalmodes and symbioses with distantly related organisms [1-3]. The ecological importance of dinoflagellates is alsoextraordinary; members of the group play key roles asmarine primary producers, coral reef zooxanthellae, and(micro)consumers in aquatic communities around theglobe. The monophyly of dinoflagellates and their rela-tionship to other alveolate taxa – particularly apicomplex-ans and ciliates – have been convincingly demonstratedwith congruent molecular phylogenetic data [e.g., [1,4-9]]. However, the interrelationships among dinoflagellatelineages still remain largely unresolved, especially nearthe phylogenetic backbone of the group [e.g., [10-12]].Although significant events in the evolutionary radiationof dinoflagellate diversity have been inferred from com-parative analyses of morphological characters alone [e.g.,[13]], the coupling of these data with molecular phyloge-netic data, including environmental DNA surveys of bio-diversity, has more robustly demonstrated delimitationsbetween 'species' and the monophyly of several dinoflag-ellate subgroups [e.g., [10,11,14]].Brief history of athecate dinoflagellate systematicsUnderstanding the phylogenetic relationships of athecate(syn. unarmored or naked) dinoflagellates has been prob-lematic for more than a century, because of difficulties inidentifying reliable morphological characters with lightmicroscopy. For instance, overlapping and ambiguous cri-teria, such as episome dimensions and the displacementof the cingulum, have been used in the past to distinguishgenera from one another. Improved methods incorporat-ing both molecular and morphological data have beenused to re-investigate the type species of different athecategenera that have long been recognized to be polyphyletic,such as Gymnodinium Stein, Gyrodinium Kofoid et Swezy,and Amphidinium Claparède et Lachmann [10,15-18].More precise re-definitions of these genera have causedmany of the species that were formerly assigned to themto be considered "sensu lato taxa". Accordingly, severalnew genera have been established over the past decade toaccommodate these newly recognized lineages, such asAkashiwo Hansen and Moestrup,Karenia Hansen and Moe-strup, Karlodinium Larsen, Takayama de Salas, Bolch, Boteset Hallegraeff, Togula Flø Jørgensen, Murray et Daugbjerg,Prosoaulax Calado et Moestrup, and Apicoporus Sparmann,Leander et Hoppenrath [10,19-22].Apical surface structures found in athecate dinoflagellatesusing electron microscopy, such as 'acrobases' (apicalgrooves) and apical pores with hook-like protrusions,systems [10,19,22-24]. Moreover, variable features ofchloroplasts (or more generally 'plastids') can be diagnos-tic at both the generic level, such as Karenia and Lepidodin-ium, and the species level, such as within Gymnodiniumand Polykrikos Bütschli [e.g., [25-27]]. Characters like theformation of pseudocolonies and the possession of com-plex organelles are evolutionary innovations found onlyin a few athecate dinoflagellates, namely polykrikoids andwarnowiids [27-29]. Although the value of these charac-teristics for establishing robust phylogenetic hypotheses isexpected to be high, molecular phylogenetic data are stillunavailable for most of these lineages. This is mainly dueto the fact that polykrikoids and warnowiids are unculti-vated and difficult to both find and isolate from naturalmarine samples [27,28,30].Complex organelles in athecate dinoflagellatesPolykrikoids and warnowiids are among the most remark-able eukaryotes on the planet because of their possessionof highly elaborate ultrastructural systems: pistons, nema-tocysts, nematocyst-taeniocyst complexes and ocelloids[29] (Figure 1). A piston is a relatively long posterior 'ten-tacle' with an exaggerated capacity for rapid and repeatedcontraction and is, so far, known only in two genera(Erythropsidinium and Greuetodinum) [29]. The function ofthe piston remains unknown. Dinoflagellate nematocystsare found only in some polykrikoids and warnowiids, andare composed of one or several extrusive filaments. Thedetailed morphology of the nematocysts differs in the twogroups [29] (see also Figures 1f and 1l), and in Polykrikos,the nematocysts are linked to additional extrusiveorganelles called 'taeniocysts' [29,31]. The nematocyst-taeniocyst complex of Polykrikos species is a synapomor-phy for the genus, but the presence of nematocysts in war-nowiids suggests that these two lineages are closely related(i.e., dinoflagellate nematocysts are homologous)[27,28]. Another formal possibility is that nematocystsevolved twice independently within athecate dinoflagel-lates: once in polykrikoids and once in warnowiids. Thisscenario is not unprecedented, because cnidarians, whichare very distantly related to dinoflagellates, also possessdifferent kinds of cnidae (e.g., nematocysts and spiro-cysts) within cells called 'cnidocytes' that presumablyevolved independently from those found in athecatedinoflagellates. However, a scenario involving kleptocni-dae is also possible, whereby nematocysts were horizon-tally transferred between cnidarians and dinoflagellatesduring evolutionary history [32]. Regardless, molecularphylogenetic data from warnowiid species are required toshed additional light onto these hypotheses, which wasone of the main aims of this study.Perhaps the most complex organelle found in any dino-Page 2 of 15(page number not for citation purposes)have turned out to be phylogenetically meaningful fea-tures that are consistent with more natural classificationflagellate so far happens to be synapomorphic for war-nowiids, namely a distinctive multilayered photoreceptorBMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116Page 3 of 15(page number not for citation purposes)Light micrographs of the investigated warnowiid and polykrikoid taxaFi ure 1Light micrographs of the investigated warnowiid and polykrikoid taxa. (a)-(f) Images representing isolates 1 and 2 of 'Proterythropsis' sp. (a) Lateral view, median focus showing the large nucleus (n), the ocelloid (double arrowhead), and the pos-terior cell 'extension' (arrow). (b) Lateral view, showing the nematocysts (arrowheads). (c) Left ventral view showing the pos-terior cell 'extension' (arrow) and the ocelloid (double arrowhead). (d) Dividing cell with partly reassembled ocelloids/hyalosomes (double arrowheads) in the developing daughter cells. (e) Ocelloid. (f) Nematocysts. (g)-(i) Images representing the isolate of Warnowia sp. (British Columbia). (g) Lateral view of a free swimming cell showing the ocelloid (double arrow-head). (h) Lateral view of a cell in a hyaline cyst (arrow) showing the ocelloid (double arrowhead). (i) Dividing cell in a hyaline cyst (arrow) showing the ocelloids (double arrowheads). (j)-(k) Images showing the isolate of "Warnowia sp." (Florida) used for single cell PCR. (j) Ventral view, surface focus, showing the ocelloid (double arrowhead). (k) Mid cell focus showing the large nucleus (n). (l) An extruded nematocyst of Polykrikos kofoidii. (m)-(p) Images representing the two isolates of 'Nematodin-ium' sp. (m) Lateral to ventral view of a free swimming cell showing the large nucleus (n), the ocelloid (double arrowhead), and the brownish chloroplast color. (n) Lateral view of a cell in a hyaline cyst (arrow) showing the ocelloid (double arrowhead). (o) Dividing cell in a hyaline cyst (arrow). (p) Image showing recently divided daughter cells within the hyaline cyst (arrow). (q)-(r) Images of Erythropsidinium sp. showing the ocelloid (double arrowheads), and the piston (arrows). (s) Image represent-ing the isolate of 'Pheopolykrikos' hartmannii showing the two large nuclei in the pseudo-colony. (t) Image representing the iso-late of Polykrikos kofoidii undergoing division of the pseudo-colony. (u) Images of Polykrikos lebourae showing the two nuclei within the pseudo-colony. Scale bars 10 μm in (a)-(d), (g)-(i), (l)-(p), (t), (u), 20 μm in (j), (k), (q)-(s), 5 μm in (e), (f).BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116called an 'ocelloid' [29] (see also Figure 1e). Ocelloids arecomposed entirely of subcellular components and arehighly reminiscent in general organization to the multi-cellular camera eyes that evolved independently in severaldifferent lineages of metazoans (e.g. cubozoans, scallops,cephalopods and vertebrates) [33]. The complexity ofthese subcellular systems is so distinctive that ocelloidshave been described as "the most extraordinarily sophisti-cated differentiations of grouped structures for a singlefunction in protists" [13]. Ocelloids are comprised of twomain components: a hyalosome and a melanosome [29].The translucent haylosome consists of a layered cornea-like structure and a lens-like inclusion that are bounded atthe base by iris-like constriction rings; the melanosome isa highly ordered and pigmented retina-like body that isseparated from the hyalosome by a seawater chamber. Infact, the melanosome (syn. pigment cup or retinal body)appears to be a highly derived plastid with thylacoids thatcan be recognized when the melanosome becomes rela-tively unordered during cell division and daughter cellformation; by contrast, the hyalosome appears to be syn-thesized by the cell and is disassembled during cell divi-sion before being reassembled in each daughter cell [[29];this study]. The structural details of ocelloids are specificto different warnowiid lineages (e.g. the number of con-striction rings and the position of the ocelloid in the dino-flagellate cell) [29], and this variation provides importantinsights into the evolutionary history of the clade.Other general features of warnowiidsAlthough most are heterotrophic, three of the about 40described species of polykrikoids and warnowiids arephotosynthetic, namely Pheopolykrikos hartmannii (Zim-mermann) Matsuoka et Fukuyo, Polykrikos lebourae Herd-man, and Nematodinium armatum (Dogiel) Kofoid etSwezy [e.g., [27,28,34,35]]. The cingulum in warnowiidsis always displaced and encircles the cells at least once andsometimes more than twice. Some warnowiids producemucoid hyalin cysts (Figures 1h, n), probably vegetativedivision cysts, as shown in our Figures 1i, o and 1p. Thetaxonomy of warnowiids is poorly understood and con-fusing, and many of the species described by Kofoid andSwezy [36] are probably conspecific. Some reports indi-cate that the structure, color and position of the ocelloidcan change during the course of cell division and develop-ment [37], and that these ocelloid features are unreliabletaxonomic criteria for delimiting species and genera[37,38]. Accordingly, different authors have adopted dif-ferent classification systems when discussing the group(Table 1) [6,39-41].In order to more clearly outline the taxonomic challengesassociated with understanding warnowiid diversity, we53]. Currently, Erythropsidinium and Greuetodinium arecharacterized by having a piston, and Greuetodinium isseparated from Erythropsidinium by possessing the onlyocelloid of the composite type (multiplication of 'lenses')at the anterior end of the cell; Proterythropsis also has a pro-jection off of the posterior end of the cell, but it is immo-bile and called a 'posterior extension'. Nematocysts haveonly been found in Nematodinium and Proterythropsis.Although Warnowia Lindemann lacks plastids, nemato-cysts, a piston and a posterior extension, a relatively broadspectrum of cell morphologies associated with the acro-base, cingulum, sulcus, and position of the ocelloid hasbeen described within this genus; thus, Warnowia proba-bly represents an artificial assemblage of species. None-theless, inferences about the evolutionary history ofwarnowiids, in general, are mired by the absence ofmolecular phylogenetic data from any member of thegroup.In this study, we provide the first molecular phylogeneticdata for warnowiids: small subunit (SSU) rDNAsequences were obtained from two species of 'Warnowia'(one from British Columbia and one from Florida), twoisolates of 'Nematodinium sp.' (both from British Colum-bia), and two isolates of 'Proterythropsis sp.' (both fromBritish Columbia); partial large subunit (LSU) rDNAsequences were obtained from one species of 'Nematodin-ium' (from British Columbia) and one species of War-nowia (from British Columbia). Moreover, we obtainedpartial LSU rDNA sequences from three polykrikoid spe-cies: Polykrikos kofoidii (from British Columbia), Polykrikoslebourae (from British Columbia), and 'Pheopolykrikos'hartmannii (from Maryland). These molecular phyloge-netic data were coupled with a review of warnowiid mor-phological data (Table 2) in order to formulate ahypothetical framework for understanding character evo-lution within the group.MethodsCollection of organisms and light microscopyNear surface plankton samples were collected in themorning hours with a small net (mesh-size 20 μm) at thedocks of the Bamfield Marine Sciences Center, VancouverIsland, BC (48°50.0' N, 125°8.0' W) in June 2005, April2006, April 2007 and May 2007. Immediately after sam-pling, single cells of the species were identified at 40× to250× magnifications and isolated from the mixed plank-ton sample by micropipetting for the preparationsdescribed below. Cells were observed directly and micro-manipulated with a Leica DMIL inverted microscope con-nected to a PixeLink Megapixel color digital camera. ForDIC light microscopy, micropipetted cells were placed ona glass specimen slide and covered with a cover slip.Page 4 of 15(page number not for citation purposes)have summarized the morphological features describedfor each warnowiid genus in Table 2[24,29,30,34-38,42-Images were produced directly with either the PixeLinkMegapixel color digital camera or a Zeiss Axioplan 2 imag-BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116ing microscope connected to a Leica DC500 color digitalcamera. Sand samples containing Polykrikos lebourae werecollected with a spoon during low tide at CentennialBeach, Boundary Bay, BC (49°0.0' N, 123°8.0' W) in May2007. The sand samples were transported directly to thelaboratory, and the flagellates were separated from thesand by extraction through a fine filter (mesh size 45 μm)using melting seawater-ice [54]. The flagellates accumu-lated in a Petri dish beneath the filter and were then iden-tified at 40× to 250× magnifications. Cells were isolatedby micropipetting for the preparations described below.Samples containing Erythropsidinium and an unidentified"Warnowia sp." (Florida) were collected from the GulfStream off of Ft. Pierce, Florida (N27° 28.25' and W79°53.62') on August 28, 2007. Pheopolykrikos hartmannii wascollected from the Rhode River, MD at the SmithsonianEnvironmental Research Center (SERC) dock (N38° 53.1'W 76° 32.5') on July 31, 2007. A horizontal plankton towwas taken from the surface layer using a net with a mesh-size of 35 μm. Samples were held at ambient temperatureand transported to the lab. The sample was screened usinga 250 μm-mesh Nitex sieve to remove large zooplankton,and diluted with seawater to enhance viability duringtransport. Cells were visualized through a dissectingmicroscope and individually picked using drawn glasstubing and mouth aspiration. Each cell was washed sixtimes with 0.2 μm filtered station water, photographed,placed into a sterile 1.5-mL microfuge tube containing 40μL of lysis buffer, amended with Igepal instead of nonidetP40, and frozen at -80°C [55].Scanning electron microscopyCells were transferred onto a 5-μm polycarbonate mem-brane filter (Corning Separations Div., Acton, MA),washed with distilled water, dehydrated with a gradedseries of ethanol and critical point dried with CO2. The fil-ter was mounted on a stub, sputter-coated with gold andviewed under a Hitachi S4700 Scanning Electron Micro-scope.DNA extraction, PCR amplification and sequencingCells collected in British Columbia were manually iso-lated and washed three times in f/2-medium. Three differ-ent methods for DNA extraction were used over the years.(1) Collected cells were placed directly into 400 μL CTABextraction buffer (1.12 g Tris, 8.18 g NaCl, 0.74 g EDTA, 2g CTAB, 2 g Polyvinylpyrolidone, 0.2 mL 2-mercaptoeth-anol in 100 ml water) in 1.5 mL Eppendorf tube. The tubewas placed in a heat-block and incubated at 63°C for 20min with several vigorous shakes in between. After separa-tion with chloroform:isoamyl alcohol (24:1), the aqueousphase was precipitated in 70% ethanol. The dry DNA pel-lets were stored in the freezer and transported to the Uni-versity of British Columbia on ice. Distilled water wasadded to each sample prior to PCR. (2) Genomic DNAwas extracted by making a final washing step in distilledwater, and the osmotically disrupted cells were useddirectly for PCR. (3) Genomic DNA was extracted usingthe MasterPure Complete DNA and RNA Purification Kit(EPICENTRE, Madison, WI, USA). The small subunitrDNA sequence was PCR amplified using puReTaq Ready-to-go PCR beads (GE Healthcare, Quebec, Canada), withan error rate of 1 per 20,000–40,000 bases, and universaleukaryotic primers reported previously [[56]; Table 3].The large subunit rDNA sequence was also PCR amplifiedTable 1: Systematics of warnowiid genera (Warnowiaceae Lindemann 1928).Fensome et al. 1993 [6] Sournia 1986 [39] Steidinger & Tangen 1997 [40] Gómez 2005 [41]Warnowia Lindemann 1928 (type genus) Warnowia Warnowia WarnowiaSyn.: Pouchetia Schütt 1895 Syn.: Pouchetia Syn.: Pouchetia Syn.: PouchetiaSyn.: Protopsis Syn.: Protopsis Syn.: ProtopsisSyn.: ? Proterythropsis partimErythropsidinium Silva 1960 Erythropsidinium Erythropsidinium ErythropsidiniumSyn.: Erythropsis Hertwig 1884 Syn.: Erythropsis Syn.: Erythropsis Syn.: ErythropsisSyn.: Pouchetia partim Syn.: Pouchetia partimGreuetodinium Loebl. III 1980 Greuetodinium taxon of doubtful validitySyn.: Leucopsis Greuet 1968 Syn.: Leucopsis taxon of doubtful validityNematodinium Kof. et Sw. 1921 Nematodinium Nematodinium NematodiniumSyn.: Nematopsides Syn.: NematopsidesSyn.: Pouchetia Syn.: PouchetiaNematopsides Greuet 1973 taxon of doubtful validityProterythropsis Kof. et Sw. in Kofoid 1920 Proterythropsis Kof. et Sw. 1921Protopsis Kof. et Sw. 1921 taxon of doubtful validityLoebl. = Loeblich; Kof. et Sw. = Kofoid et SwezyPage 5 of 15(page number not for citation purposes)A mixed-extraction sample containing 'Proterythropsis' sp.was fixed with OsO4 for 30 min at room temperature.using puReTaq Ready-to-go PCR beads and D1R-R2 prim-ers published by Scholin et al. [57] and Yamaguchi et al.BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116[58] (Table 3). Information about the date of collection,number of isolated cells, method of DNA extraction andprimer combination for each DNA sequence is shown inTable 4 [GenBank accession codes FJ947036–FJ947046].PCR products of the expected size were gel isolated andcloned into pCR2.1 vector using a TOPO TA cloning kit(Invitrogen Corporation, CA, USA). One clone for eachspecies was completely sequenced with ABI big-dye reac-tion mix using both vector primers and two internal prim-ers oriented in both directions.Warnowiid cells collected from the east coast of NorthAmerica were frozen in microfuge tubes before beingthawed and sonicated using a probe tipped sonicator(Heat Systems Ultrasonic, Inc. Model W-225R, PlainView, NY) set to a power level of 3 and a 30% duty cycle.The sonicator probe was immersed in the sample, andthree to five pulses of sonication were used over ~5 sec-onds. The probe was washed between each sample withwere sonicated and used as negative controls. RibosomalDNA regions were amplified with the following primercombinations EukA-EukB (SSU), Dino1662F-25R1 (ITSand part of LSU) and 25F1-LSUR2 (last part of LSU) for'Pheopolykrikos' hartmannii (Table 3) [58-62]. The resultingproducts were sequenced with the same primers they wereamplified with and the primers D3A and DLSUR2 (Table3) [63] and assembled into a contig of 3,637 bases cover-ing the SSU-ITS-LSU region. For the "Warnowia sp." (Flor-ida), the EukA-EukB PCR product was used as a templatefor the following nested PCR amplifications: EukA-DinoR, SR4–SR9 and SR8–SR12 (Table 3) [58,59,61,63];single PCR bands derived from each primer pair weresequenced with internal primers shown in Table 3. PCRexperiments were run in 20-μL volumes with the follow-ing final concentrations: 500 mg/mL BSA (Sigma A2053),50 mM Tris HCl (pH 8.3), 3 mM Mg, 10 μM dNTPs, 0.12units of Promega Go-Taq, and 4 μL of sample (1 μL in thecase of nested PCR). Cycling conditions were 95°C for 2Table 2: Morphological features of warnowiid dinoflagellate genera.Nematodinium1 Proterythropsis2 Warnowia3 Erythropsidinium4 Greuetodinium5ocelloidposition in the cell posterior posterior ~cell middle or posterioranterior Anteriordirected ventral ventral ventral to anteriorly anteriorly Anteriorlyrelative size small small medium large very large# constriction rings 1 ? 2 3 ?'pigment ring' band, continuity with upper retinal body? ring, isolated from retinal bodyring, totally independent from retinal body?# per cell 1 1 1 1 (or 2*) ~15 lensesintegrate type integrate type integrate type integrate type composite typenematocysts yes (and no, see Hulburt 1957yes (and no, see Kofoid & Swezy 1921)no no (but see Hertwig 1884)nofeeding apparatus ? ? ? stomopharyngian complex?chloroplasts yes and no no no (but see Hulburt 1957)no nonucleus position upper cell half upper cell half middle or upper cell halfright upper cell half median upper cell halfacrobase outward left spiral, 1 turn (or little more) = loop in Gymn. s.s.outward left spiral, 1 turn (or little more) = loop in Gymn. s.s.inward left spiral, 1.5–2.0 turns, some species plus outward left spiralangled left 'spiral', 2 turns? (ventral below the cingulum)cingulum ~1.5–2.25 turns ~1.25–2.0 turns ~1.0–2.5 turns 1.5 turns 1 turn, steep descending dorsallysulcus < 1–2.0 turns < 1 turn 0.5–1.75 turns straight nearly one turncell 'extension' (tentacle)no yes no no ? maybepiston non non non 1 (seldom 2*) 1terminal stylet - - - sometimes ?1 [24,29,34-37,42,43,47,49]; 2 [36,38], present study;3 [24,29,36,37,45]; 4 [24,29,30,36,37,44-46,48,50-52]; 5 [53]; * [30]; ? = no data; Gymn. s.s. = Gymnodinium sensu stricto.Page 6 of 15(page number not for citation purposes)10% bleach solution, rinsed with distilled water, andwiped dry with a kimwipe. Dummy samples without cellsmin, followed by 40 cycles of the following: 95°C for 30s, 55°C for 30 s, 72°C for 1.5 min. This was followed withBMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116a 72°C step for 5 min after which the reactions were heldat 4°C. The products from these reactions were visualizedon ethidium bromide stained 1.5% agarose gels, precipi-tated using PEG (20% w/v polyethylene glycol, mw 8000,2.5 M NaCl solution), washed with 70% ethanol, brieflyair dried, resuspended in 10 μL of distilled water, andsequenced using Big Dye Terminator Cycle SequencingReady Reaction Kit (Applied Biosystem, Foster City, Cali-fornia) and an ABI 3730 sequencer. Sequence identity wasevaluated initially by BLAST using the NCBI nonredun-dant database [64] and then by phylogenetic analyses.Alignments and molecular phylogenetic analysesThe new SSU and LSU rDNA sequences were aligned withother alveolate sequences using MacClade 4 [65], forminga 45-taxon and 36-taxon alignment respectively. How-ever, we also analyzed our new LSU sequences within thecontext of several shorter-length sequences retrieved fromGenBank, forming a 47-taxon alignment, and concate-nated our SSU-LSU rDNA sequences where possible,forming a 17-taxon alignment. These four alignments areavailable on request. Maximum likelihood (ML) andBayesian methods using the General Time Reversible(GTR) model of nucleotide substitutions were performedon all four alignments, this model was selected withMODELTEST version 3.06 [66]. All gaps were excludedfrom the alignments prior to phylogenetic analysis. Thealpha shape parameters were estimated from the datausing GTR, a gamma distribution with invariable sites andfour rate categories (45-taxon SSU alignment with 1693Table 3: Primers used for PCR.Primer name sequence 5'-3' Target CitationPF1 GCGCTACCTGGTTGATCCTGCC SSU [56] (modified)R4 GATCCTTCTGCAGGTTCACCTAC SSU [56] (modified)D1R ACCCGCTGAATTTAAGCATA LSU [57]R2 ATTCGGCAGGTGAGTTGTTAC LSU [58]Euk A AACCTGGTTGATCCTGCCAGT SSU [59] (modified)Euk B GATCCWTCTGCAGGTTCACCTAC SSU [59]Dino1662 F CCGATTGAGTGWTCCGGTGAATAA SSU [60]SR 4 AGGGCAAGTCTGGTGCCAG SSU [61]SR 9 AACTAAGAACGGCCATGCAC SSU [61]SR 8 GGATTGACAGATTGAKAGCT SSU [63]SR 12 CCTTCCGCAGGTTCACCTAC SSU [58]Dino R TTATTCACCGGAWCACTCAATCGG SSU this manuscript25 F1 CCGCTGAATTTAAGCATAT LSU [62]25 R1 CTTGGTCCGTGTTTCAAGAC LSU [61]LSU D3A GACCCGTCTTGAAACACGGA LSU [63]LSU R2 ATTCGGCAGGTGAGTTGTTAC LSU [58]DLSU CTGTTAAAATGAACCAACACCYTTT LSU this manuscriptTable 4: Date of collection, number of isolated cells, method of DNA extraction and primer combination for each DNA sequence reported in this study.Species isolation date # of cells DNA extraction primer combinationSSU'Proterythropsis' sp. 1 24. June 2005 12 CTAB PF1-R4'Proterythropsis' sp. 2 25. June 2005 27 CTAB PF1-R4'Nematodinium' sp. 1 27. April 2006 2 Distilled water PF1-R4'Nematodinium' sp. 2 28. April 2006 3 Distilled water PF1-R4Warnowia sp. (BC) 02. May 2007 3 Kit PF1-R4"Warnowia sp." (Florida) 28. Aug. 2007 1 Sonication EukA-EukBLSU'Nematodinium' sp. 28. April 2007 3 Kit D1R-R2Polykrikos kofoidii 28. April 2007 28 Kit D1R-R2Warnowia sp. (BC) 02. May 2007 3 Kit D1R-R2Polykrikos lebourae 18. May 2007 8 Kit D1R-R2'Pheopolyk.' hartmannii 31. July 2007 1 Sonication Dino1662F-25R125F1-LSUR2Page 7 of 15(page number not for citation purposes)"1" and "2" after species names refer to different isolates; primers sequences are listed in Table 3.BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116sites: ∝ = 0.378, i = 0.282; 36-taxon LSU alignment with855 sites: ∝ = 0.509, i = 0.115; 47-taxon LSU alignmentwith 358 sites: ∝ = 0.742, i = 0.132; 17-taxon SSU-LSUalignment with 2549 sites: ∝ = 0.469, i = 0.339). ML treesanalyzed using the parameters listed above were con-structed with PhyML [67,68]. ML bootstrap analyses werealso performed with PhyML (GTR+I+G model) on fivehundred re-sampled datasets (one heuristic search perdataset) from each of the four alignments.The four alignments were analyzed with Bayesian meth-ods using the MrBayes program 3.1.2 [69,70]. The pro-gram was set to operate with a gamma distribution andfour Monte-Carlo-Markov chains (MCMC) starting from arandom tree. A total of 2,000,000 generations were calcu-lated with trees sampled every 50 generations and with aprior burn-in of 100,000 generations (2000 sampled treeswere discarded; burn-in was checked manually). A major-ity rule consensus tree was constructed from 38,001 post-burn-in trees. Posterior probabilities correspond to thefrequency at which a given node was found in the post-burn-in trees. Independent Bayesian runs on each align-ment yielded similar results.Results & DiscussionWarnowiids evolved from within the Gymnodinium sensu stricto cladeThe SSU- and LSU-rDNA sequences reported here werederived from cells like those shown in Figure 1. The gen-eral surface morphology of warnowiids, as represented by'Proterythropsis' sp. (British Columbia), consisted of manysmall alveoli, a loop-shaped acrobase, an obliquely ori-ented cingulum and an ocelloid (Figure 2). These mor-phological data are consistent with the only other knownSEMs of warnowiids, namely Erythropsidinium, Warnowiaand Nematodinium [24]. The phylogenetic position of thewarnowiid sequences within the dinoflagellates is shownin the following figures: Figure 3 – the SSU rDNA align-ment of 45 taxa and 1693 sites containing many athecatedinoflagellates and environmental sequences; Figure 4 –the LSU rDNA alignment of 36 taxa and 855 sites; Addi-tional file 1 – the shorter-length LSU rDNA alignment of47 taxa including only 358 sites; and Additional file 2 –the combined SSU- and LSU-rDNA alignment of 17 taxaand 2549 sites. These molecular phylogenetic data dem-onstrated that warnowiids form a moderately supportedclade that falls within the Gymnodinium sensu stricto (s.s.)clade with very strong statistical support (Figures 3 and 4,Additional files 1 and 2). Although the nearest sister line-age to the warnowiid clade was unresolved in all of ouranalyses, the following taxa also clustered strongly withinthe Gymnodinium s.s.: Pheopolykrikos beauchampii, thePolykrikos clade and several species of Gymnodinium andinium s.s. clade contains several well delimited genera inaddition to Gymnodinium [26-28].The phylogenetic relationships within the warnowiidclade were poorly resolved near the backbone (Figure 3).However, the molecular phylogenetic analyses did dem-onstrate that the two isolates of 'Nematodinium' groupedstrongly together, and this clade formed the nearest sistergroup to the Warnowia sp. collected from British Colum-bia (Figures 3 and 4, Additional files 1 and 2). The twoisolates of 'Proterythropsis' also grouped strongly togetherwith an environmental sequence, namely EF527120, col-lected from Framvaren Fjord, Norway, (Figure 3) [A.Behnke, pers. comm.]. The "Warnowia sp." collected fromFlorida was much more divergent and clustered stronglywith several environmental sequences collected from Sar-gasso Sea (Figure 3) [Armbrust et al., unpublished]; two ofthe environmental sequences, namely AY664983 andAY665026, formed the nearest sister lineages to this "War-nowia sp." (Florida) (Figure 3). The molecular phyloge-netic analyses of SSU rDNA also indicated that thefollowing environmental sequences probably represent asingle, potentially undescribed, warnowiid species:AY664914, AY664912, AY664911 and AY664896 (Figure3). The generated SSU rDNA sequence for Erythropsidin-ium was too divergent to be included into the analysis.Daugbjerg et al. [10] hypothesized that the warnowiidNematodinium armatum is related to the Gymnodinium s.s.,because of the presence of a nuclear fibrous connector andthe loop-shaped acrobase. This is the only publishedhypothesis about the possible relationship of a warnowiidtaxon to other dinoflagellate taxa, and our molecular phy-logenetic analyses reinforced this hypothesis. The charac-teristic feature for the Gymnodinium s.s. clade is the loop-shaped acrobase which has been demonstrated in theGymnodinium species within this clade, Lepidodinium, 'Phe-opolykrikos' hartmannii, Polykrikos spp., and Nematodiniumarmatum [e.g., [24,26-28]]. We have shown for the firsttime that a loop-shaped acrobase is also present in 'Proter-ythropsis' sp. (Figure 2) and hypothesize, based on ourmolecular phylogenetic data, that a similar acrobase mor-phology is present in the 'Nematodinium' and Warnowiaspecies isolated from British Columbia (Figure 3).We present the first LSU rDNA sequence for P. lebourae.Although a strongly supported Polykrikos clade, within theGymnodinium s.s. clade, was shown previously in SSU phy-logenies [27,28] (Figure 3), this clade did not receivestrong statistical support in our phylogenetic analyses ofLSU rDNA sequences (Figure 4 and Additional file 1) [71].Character evolution in warnowiidsPage 8 of 15(page number not for citation purposes)Lepidodinium (e.g. G. impudicum, G. fuscum, G. dorsalisul-cum, G. catenatum, L. chlorophorum and L. viride) (Figures3 and 4, Additional files 1 and 2). Therefore, the Gymnod-The presence of nematocysts in both warnowiids andpolykrikoids suggests that the most recent commonancestor of both lineages already possessed these complexBMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116organelles [28]. This hypothesis would be significantlybolstered if it were demonstrated in molecular phyloge-netic analyses that the two clades are indeed closelyrelated to one another. Our results strongly demonstratedthat warnowiids and polykrikoids are both members ofthe Gymnodinium s.s. clade; however, a specific sister rela-tionship between the two subgroups, to the exclusion ofGymnodinium and Lepidodinium sequences, remainedunresolved in all four datasets (Figures 3 and 4, Addi-tional files 1 and 2). Regardless, when considering theoverall phylogenetic distribution of nematocysts withinthe Gymnodinium s.s. clade, the most parsimonious expla-nation requires that nematocysts originated once in themost recent ancestor of polykrikoids and warnowiids andwere subsequently lost, at least once, within the warnow-iid clade (Figure 5). Although less parsimonious scenarioscan also explain the distribution of nematocysts inpolykrikoids and warnowiids (e.g., several independentgains or kleptocnidae), there is currently no evidence tosupport these alternatives.The ocelloid is perhaps the most striking feature of alldinoflagellates and is the best synapomorphy for the war-nowiid clade as inferred from SSU- and LSU-rDNAsequences (Figures 3, 4 and 5). Greuet [42] performed thepioneering ultrastructural research on warnowiids, andthe structural diversity found in different ocelloids ledhim to formulate a hypothesis about character evolutionwithin the group; variations of ocelloids have beensized that during the evolution of warnowiids, the ocel-loid increased in complexity:(1) the number of (iris-like) constriction rings increasedfrom 1 → 2 → 3, (2) the ocelloid increased in size, and (3)the position of the ocelloid gradually shifted toward theanterior end of the cell (Table 2, Figure 5). We haveextended this hypothesis by incorporating the followingevents: (4) the presence of nematocysts is an ancestralstate that was subsequently lost in more derived lineages,(5) the piston was gained in the most recent ancestor ofErythropsidinium and Greuetodinium, and (6) the lenseregion or 'hyalosome' of the ocelloid was multiplied inthe most recent ancestor of Greuetodinium (Figure 5).Moreover, because Nematodinium armatum containsnematocysts and is the only known photosynthetic spe-cies, we hypothesize that photosynthesis involving typicalperidinin-containing dinoflagellate plastids is an ances-tral state for warnowiids that was subsequently lost earlyin the history of the clade (Figure 5). Mornin and Francis[35] wrote that the plastids of N. armatum lack thylakoids,which would preclude photosynthesis; however, one ofthe TEM images published in this study (namely, Figure"a" on plate III) shows a plastid with many thylakoids.Because the relatively low magnification of this imagedoes not allow us to determine whether the plastids havethe usual dinoflagellate morphology (i.e., thylakoids instacks of three and three outer membranes), an ultrastruc-tural reinvestigation of this species is needed.The species from which we were able to acquire SSU- andLSU-rDNA sequences represent only a part of the mor-phological diversity found in warnowiid dinoflagellates.All of the species we examined possessed an ocelloidlocated near the posterior end of the cell, which is inferredto be an ancestral state for the group. However, one spe-cies, namely 'Proterythropsis' sp., possessed nematocysts,and one species, namely 'Nematodinium' sp., was photo-synthetic. Interestingly, the taxa without nematocysts,namely 'Nematodinium' sp. and Warnowia sp. (BritishColumbia), clustered together in the phylogenies inferredfrom SSU rDNA sequences, albeit with weak support (Fig-ure 3); these taxa also clustered together in the phyloge-neis inferred from LSU rDNA sequences, but they were theonly two warnowiid species in the analyses (Figure 4 andAdditional files 1 and 2). The "Warnowia sp." (Florida)showed the most divergent position in the phylogeniesinferred from SSU rDNA sequences and clustered stronglywith environmental sequences (Figure 3). Although all ofthese results are consistent with the hypothetical frame-work(s) shown in Figure 5, SSU- and LSU-rDNAsequences from relatively scarce planktonic warnowiids –like Warnowia morphotype II, Erythropsidinium, andScanning electron micrographs of 'Proterythropsis' sp. (British Columbia)Fig re 2Scanning electron micrographs of 'Proterythropsis' sp. (British Columbia). These micrographs show a hundreds of small alveoli, a loop-shaped acrobase (black arrow), the cingulum (black arrowheads), a posterior cell 'extension' (white arrow), and the ocelloid (white double arrowheads). (a) Right lateral to ventral view (b) Dorsal view. Scale bars 10 μm.Page 9 of 15(page number not for citation purposes)described in Nematodinium, 'Warnowia morphotype II',and Erythropsidinium [35,42-48]. Greuet [42] hypothe-Greuetodinium – will be required to more comprehen-sively evaluate character evolution within the group.BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116Page 10 of 15(page number not for citation purposes)SSU rDNA phylogenyFigu e 3SSU rDNA phylogeny. Gamma-corrected maximum likelihood tree (-lnL = 8391.020304, α = 0.378, 4 rate categories) inferred using the GTR model of substitution on an alignment of 45 SSU rDNA sequences and 1693 unambiguously aligned sites. Numbers at the branches denote bootstrap percentages using maximum likelihood – GTR (top) and Bayesian posterior probabilities – GTR (bottom). Black dots on branches denote bootstrap percentages and posterior probabilities of 95% or higher. Accession numbers represent environmental sequences of unknown identity. Sequences derived from this study are highlighted in black boxes and the image/s in Fig 1 representing the taxon are cited. I = morphotype I of the genus Warnowia; c = containing chloroplasts; n = possessing nematocysts.BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116Page 11 of 15(page number not for citation purposes)LSU rDNA phylogenyFigu e 4LSU rDNA phylogeny. Gamma-corrected maximum likelihood tree (-lnL = 8068.27939, α = 0.509, 4 rate categories) inferred using the GTR model of substitution on an alignment of 36 LSU rDNA sequences and 855 unambiguously aligned sites. Numbers at the branches denote bootstrap percentages using maximum likelihood – GTR (top) and Bayesian posterior proba-bilities – GTR (bottom). Black dots on branches denote bootstrap percentages and posterior probabilities of 95% or higher. Sequences derived from this study are highlighted in black boxes and the image/s in Fig 1 representing the taxon are cited. I = morphotype I of the genus Warnowia; c = containing chloroplasts.BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116Taxonomic considerationsA survey of the literature on warnowiids reveals severaltaxonomic problems associated with the genera War-nowia, Nematodinium, and Proterythropsis (Table 2). Forinstance, Warnowia currently contains two very differentmorphotypes with respect to the cingulum, sulcus, acro-base(s), and the position of the ocelloid [24,29,36,37](Table 2). Species in the genus are characterized by theabsence of features, such as plastids, nematocysts, pistons,and posterior cell extensions (Table 2). Warnowia mor-photype I is similar to Nematodinium armatum, and thecells of Warnowia morphotype II are distinctively elon-gated (Figure 5). Nematodinium species also show a widerange of cingulum and sulcus morphologies, but aredefined by the presence of nematocysts and a posteriorocelloid and the absence of a posterior cell extension(Table 2). However, Hulburt [49] reported specimens ofNematodinium armatum without nematocysts. These cellsalso fit the circumscription of Warnowia type I, but theyare photosynthetic [34,35,49]. The genus Proterythropsis isrecognized by the presence of a posterior cell extensionand is circumscribed as having a posterior ocelloid andnematocysts (Table 2, Figure 5) [36,38]; however, Kofoidand Swezy [36] reported Proterythropsis cells withoutnematocysts. Therefore, it is unclear whether nematocystsare a stable taxonomic character at any level in the phylo-genetic hierarchy. In fact, it is not even clear whether allspecimens of a species possess nematocysts during allstages of their life cycle or whether there are situationswhen nematocysts are simply unrecognizable with lightmicroscopy during some developmental stages [e.g.,[29]].Species concepts within warnowiids are also highly prob-lematic. It has been shown that the structure, color andposition of the ocelloid can change during the course ofHypothetic framework(s) for understanding character evolution in warnowiid dinoflagellates as inferred from known morpho-logical diversity and the molecular phylogenetic esults of this study (partly after Greu t 1978)Fi ure 5Hypothetic framework(s) for understanding character evolution in warnowiid dinoflagellates as inferred from known morphological diversity and the molecular phylogenetic results of this study (partly after Greuet 1978). Darker grey cells are photosynthetic. Characters of interest are parsimoniously mapped onto the framework. Arrows refer to possible trajectories of character state lossess and transformations; where phylogenetic relationships are unknown, more than one possible transformation is indicated (e.g. the origin of pistons and anterior ocelloids from either a Proterythropsis-like ances-Page 12 of 15(page number not for citation purposes)tor or a Warnowia morphotype II-like ancestor).BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116cell development and division [37] (also see our Figures1a and 1d of the same species). Because of this variability,many previously described species probably representconspecifics [e.g., [36-38]].These taxonomic ambiguities have made the identifica-tion of warnowiid genera and species extremely challeng-ing for us when isolating cells from natural samples.Therefore, in this study, we have decided not to name thetaxa to the species level and to demarcate ambiguousgenus assignments with quotation marks. Our 'Proteryth-ropsis' sp. has a relatively short posterior cell 'extension'and nematocysts (Figures 1a, b, c, d, e and 1f); it essen-tially possesses morphological features that are intermedi-ate between Proterythropsis sensu stricto and heterotrophicNematodinium cells. Although our 'Nematodinium' sp.looks most like Nematodinium armatum, we were unableto detect nematocysts (Figures 1m, n, o and 1p). It is pos-sible that this species best represents an undescribed pho-tosynthetic version of Warnowia morphotype I; however,because these cells could also represent Nematodiniumarmatum without detectible nematocysts, as observed byHulburt [49], we decided to tentatively assign this speciesto Nematodinium. The "Warnowia sp." (Florida) (Figures 1jand 1k) possessed morphological features that were inter-mediate between morphotypes I and II, but we are notable to confirm the presence or absence of nematocysts;only one specimen was available for our investigations.The Warnowia sp. (British Columbia) possessed the mor-phological features of morphotype I (Figures 1g, h and 1i)and divided within hyaline cysts. The genus Erythropsidin-ium was the easiest to identify due to the conspicuous pis-ton and the anterior position of the ocelloid (Figures 1qand 1r).Warnowiid environmental sequencesThe DNA sequences we report here demonstrate that war-nowiid dinoflagellates have been unknowingly recordedin previous environmental PCR surveys of biodiversity(Figure 3, accession numbers represent environmentalsequences of uncultured eukaryotes with unknown mor-phology/identity). 'Proterythropsis' sp. or a very close rela-tive (EF527120, Figure 2) was sequenced/detected in asample from Framvaren Fjord, Norway, in September2005 (A. Behnke, pers. comm.). The sampled water wasanoxic with measurable H2S (unpublished data, A.Behnke, pers. comm.). To the best of our knowledge, thisis the first report of a warnowiid from anoxic habitats. Rel-atives of "Warnowia sp." (Florida) were sequenced fromnanoplankton samples taken from Sargasso Sea eddies(Armbrust et al. unpublished, from GenBank, acc. no.AY664983 and AY665026). Four additional sequences ofthat survey (Armbrust et al. unpublished, from GenBank,ids could be part of the nanoplankton fraction of a watersample is difficult to explain with present data and mightindicate a more complex lifecycle involving nanoflagel-lated stages; all described species of warnowiids belong tothe microplankton (> 20 μm). Contamination of the nan-oplankton sample with free-floating DNA from rupturedmicroplanktonic organisms could also explain these find-ings. Nonetheless, the warnowiid environmentalsequences demonstrate previously undetected diversity inthe group and the sequences that we report here help pro-vide cellular identities to these clades.ConclusionThis study reports the first molecular phylogenetic datafrom uncultivated warnowiid dinoflagellates collectedfrom both the Pacific and Atlantic Oceans, namely SSU-and LSU-rDNA sequences from probably three differentgenera of warnowiids ('Nematodinium', Warnowia and'Proterythropsis'), and partial LSU-rDNA sequences fromthree different species of polykrikoids (P. kofoidii, P. lebou-rae, and 'Pheopolykrikos' hartmannii). All of the investigatedspecies clustered within the Gymnodinium sensu stricto(s.s.) clade with very strong support, which was concord-ant with comparative morphological data. The warnowiidsequences clustered together in one well-supported clade,which reinforced the ocelloid as the best synapomorphyfor this group. Comparative morphological data andmolecular phylogenetic data demonstrate that thepolykrikoid clade and the warnowiid clade are closelyrelated to each other, but the precise branching orderwithin the Gymnodinium s.s. clade remains unresolved.Nonetheless, the most parsimonious scenario of characterevolution suggests that the most recent common ancestorof polykrikoids and warnowiids possessed nematocysts,and probably photosynthetic plastids, that were subse-quently lost during the early evolution of the warnowiidclade. Species and genus concepts in warnowiids arehighly problematic and a comprehensive taxonomic revi-sion is needed in order to better understand the evolu-tionary history of the group. However, additionalmolecular and morphological data is severely hindered bythe extraordinary rarity that these planktonic dinoflagel-lates are encountered in natural samples. Accordingly, thisstudy represents a first step toward meeting these aimsand provides a set of preliminary DNA barcodes for war-nowiids that not only helps advance the systematics of thegroup, but also improves inferences about the evolution-ary history that gave rise to some of the most sophisticatedorganelles ever discovered in eukaryotic cells: ocelloids.List of abbreviationsGTR model: general time-reversable model; HKY model:Hasegawa-Kishino-Yano model; LSU rDNA: large subunitPage 13 of 15(page number not for citation purposes)acc. no. AY664911, AY664912, AY664914, andAY664896) clustered together as sister lineage(s) to the"Warnowia sp." (Florida) clade (Figure 3). How warnowi-ribosomal DNA; MCMC: Monte-Carlo-Markov chains;ML: maximum likelihood; PCR: polymerase chain reac-tion; SSU rDNA: small subunit ribosomal DNA.BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/116Authors' contributionsMH did the collection, identification, photographing, andsequencing of dinoflagellate taxa from British Columbia,Canada; reviewed the literature, formulated the hypothe-sis, wrote the first draft of the manuscript and assembledthe Figures.TRB and SMH participated in the collection, identifica-tion, photographing, and sequencing of samples takenfrom Maryland and Florida, USA.CFD supervised the collection from FL, helped with pho-tography, data analysis, and funded the collections fromFL and MD.BSL funded and supervised the collection of data fromBritish Columbia, Canada; constructed the multiplesequence alignments; performed the phylogenetic analy-ses and SEM work; and helped write and edit the manu-script.All authors have read and approved the final manuscript.Additional materialAcknowledgementsTRB and SH would like to thank Dr. D. Wayne Coats for help with sample hungsgemeinschaft (grant Ho3267/1-1) and operating funds from the National Science Foundation – Assembling the Tree of Life (NSF #EF-0629624) and the National Science and Engineering Research Council of Canada (NSERC 283091-04). BSL is a fellow of the Canadian Institute for Advanced Research, Program in Integrated Microbial Biodiversity.References1. Taylor FJR: The biology of dinoflagellates Oxford: Blackwell ScientificPublications; 1987. 2. Hackett JD, Anderson DM, Erdner DL, Bhattacharya D: Dinoflagel-lates: a remarkable evolutionary experiment.  Am J Bot 2004,91(10):1523-1534.3. Taylor FJR, Hoppenrath M, Saldarriaga JF: Dinoflagellate diversityand distribution.  Biodivers Conserv 2008, 17:407-418.4. Maroteaux L, Herzog M, Soyer-Gobillard MO: Molecular organiza-tion of dinoflagellate ribosomal DNA: molecular implica-tions of the deduced 5.8S rRNA secondary structure.Bioystems 1985, 18:307-319.5. Cavalier-Smith T: Kingdom Protozoa and its 18 phyla.  MicrobiolRev 1993, 57:953-994.6. Fensome RA, Taylor FJR, Norris G, Sarjeant WAS, Wharton DI, Wil-liams GL: A classification of living and fossil dinoflagellates.  AmMus Nat Hist 1993, 7:1-351.7. Patterson D: The diversity of eukaryotes.  Am Nat 1999,154:96-124.8. Leander BS, Keeling PJ: Morphostasis in alveolate evolution.Trends Ecol Evol 2003, 18:395-402.9. Leander BS, Keeling PJ: Early evolutionary history of dinoflagel-lates and apicomplexans (Alveolata) as inferred from hsp90and actin phylogenies.  J Phycol 2004, 40:341-350.10. Daugbjerg N, Hansen G, Larsen J, Moestrup Ø: Phylogeny of someof the major genera of dinoflagellates based on ultrastruc-ture and partial LSU rDNA sequence data, including theerection of three new genera of unarmoured dinoflagellates.Phycologia 2000, 39:302-317.11. Saldarriaga JF, Taylor FJR, Cavalier-Smith T, Menden-Deuer S, KeelingPJ: Molecular data and the evolutionary history of dinoflagel-lates.  Europ J Protistol 2004, 40:85-111.12. Murray S, Flø Jørgensen M, Ho SYW, Patterson DJ, Jermiin LS:Improving the analysis of dinoflagellate phylogeny based onrDNA.  Protist 2005, 156:269-286.13. Taylor FJR: On dinoflagellate evolution.  BioSystems 1980,13:65-108.14. Taylor FJR: Illumination or confusion? Dinoflagellate molecu-lar phylogenetic data viewed from a primarily morphologicalstandpoint.  Phycol Res 2004, 52:308-324.15. Hansen G, Moestrup O, Roberts KR: Light and electron micro-scopical observations on the type species of Gymnodinium, G.fuscum (Dinophyceae).  Phycologia 2000, 39:365-376.16. Hansen G, Daugbjerg N: Ultrastructure of Gyrodinium spirale,the type species of Gyrodinium (Dinophyceae), including aphylogeny fo G. dominans, G. rubrum and G. spirale deducedfrom partial LSU rDNA sequences.  Protist 2004, 155:271-294.17. Takano Y, Horiguchi T: Surface ultrastructure and molecularphylogenetics of four unarmored heterotrophic dinoflagel-lates, including the type species of the genus Gyrodinium(Dinophyceae).  Phycol Res 2004, 52:107-116.18. Flø Jørgensen M, Murray S, Daugbjerg N: Amphidinium revisited. I.Redefinition of Amphidinium (Dinophyceae) based on cladis-tic and molecular phylogenetic analyses.  J Phycol 2004,40:351-365.19. De Salas MF, Bolch CJS, Botes L, Nash G, Wright SW, Hallegraeff GM:Takayama gen. nov. (Gymnodiniales, Dinophyceae), a newgenus of unarmored dinoflagellates with sigmoid apicalgrooves, including the description of two new species.  J Phycol2003, 39:1233-1246.20. Flø Jørgensen M, Murray S, Daugbjerg N: A new genus of athecateinterstitial dinoflagellates, Togula gen. nov., previouslyencompassed within Amphidinium sensu lato: Inferred fromlight and electron microscopy and phylogenetic analyses ofpartial large subunit ribosomal DNA sequences.  Phycol Res2004, 52:284-299.Additional file 1LSU rDNA phylogeny. Gamma-corrected maximum likelihood tree (-lnL = 4115.21736, α = 0.742, 4 rate categories) inferred using the GTR model of substitution on an alignment of 47 LSU rDNA sequences and 358 unambiguously aligned sites. Numbers at the branches denote boot-strap percentages using maximum likelihood – GTR (top) and Bayesian posterior probabilities – GTR (bottom). Black dots on branches denote bootstrap percentages and posterior probabilities of 95% or higher. Sequences derived from this study are highlighted in black boxes.Click here for file[http://www.biomedcentral.com/content/supplementary/1471-2148-9-116-S1.zip]Additional file 2Concatenated SSU and LSU rDNA phylogeny. Gamma-corrected max-imum likelihood tree (-lnL = 10274.67788, α = 0.496, 4 rate categories) inferred using the GTR model of substitution on an alignment of 17 com-bined SSU and LSU rDNA sequences and 2549 unambiguously aligned sites. Numbers at the branches denote bootstrap percentages using maxi-mum likelihood – GTR (top) and Bayesian posterior probabilities – GTR (bottom). Black dots on branches denote bootstrap percentages and poste-rior probabilities of 95% or higher. Sequences derived from this study are highlighted in black boxes.Click here for file[http://www.biomedcentral.com/content/supplementary/1471-2148-9-116-S2.zip]Page 14 of 15(page number not for citation purposes)isolation and photography. This article is contribution number 780 from the Smithsonian Marine Station in Ft. Pierce, FL, U.S.A. This work was sup-ported by a postdoctoral research salary to MH from the Deutsche Forsc-21. Calado AJ, Moestrup Ø: On the freshwater dinoflagellates pres-ently includeed in the genus Amphidinium, with a descriptionof Prosoaulax gen. nov.  Phycologia 2005, 44:112-119.BMC Evolutionary Biology 2009, 9:116 http://www.biomedcentral.com/1471-2148/9/11622. Sparmann SF, Leander BS, Hoppenrath M: Comparative morphol-ogy and molecular phylogeny of taxa of the new marine ben-thic dinoflagellate genus Apicoporus, classified formerlywithin Amphidinium sensu lato.  Protist 2008, 159:383-399.23. Biecheler B: Recherches sur les péridiniens.  Bull Biol FranceBelgique, Suppl 1952, 36:1-149.24. Takayama H: Apical grooves of unarmored dinoflagellates.  BullPlankton Soc Japan 1985, 32(2):129-140.25. De Salas MF, Bolch CJS, Hallegraeff GM: Karenia umbella sp. nov.(Gymnodiniales, Dinophyceae), a new potentially ichthyo-toxic dinoflagellate species from Tasmania, Australia.  Phyco-logia 2004, 43(2):166-175.26. Hansen G, Botes L, de Salas M: Ultrastructure and large subunitrDNA sequences of Lepidodinium viride reveal a close rela-tionship to Lepidodinium chlorophorum comb. nov. (= Gym-nodinium chlorophorum).  Phycol Res 2007, 55:25-41.27. Hoppenrath M, Leander BS: Morphology and phylogeny of thepseudocolonial dinoflagellates Polykrikos lebourae andPolykrikos herdmanae n. sp.  Protist 2007, 158:209-227.28. Hoppenrath M, Leander BS: Character evolution in polykrikoiddinoflagellates.  J Phycol 2007, 43:366-377.29. Greuet C: Complex organelles.  In The Biology of Dinoflagellates Vol-ume 21. Edited by: Taylor FJR. Oxford: Blackwell Science Publishers,Botanical Monographs; 1987:119-142. 30. Gómez F: Erythropsidinium (Gymnodiniales, Dinophyceae) inthe Pacific Ocean, a unique dinoflagellate with an ocelloidand a piston.  Eur J Prostistol 2008, 44(4):291-298.31. Westfall JA, Bradbury PC, Townsend JW: Ultrastructure of thedinoflagellate Polykrikos.  J Cell Sci 1983, 63:245-261.32. Shostak S, Kolluri V: Symbiogenetic origins of cnidarian cnido-cysts.  Symbiosis 1995, 19(1):1-29.33. Leander BS: Different modes of convergent evolution reflectphylogenetic distances.  Trends Ecol Evol 2008, 23:481-482.34. Dogiel V: Beiträge zur Kenntnis der Peridineen.  Mitt ZoolStaatsinst Neapel 1906, 18:1-45.35. Mornin L, Francis D: The fine structure of Nematodinium arma-tum, a naked dinoflagellate.  J Microscopie 1967, 6:759-772.36. Kofoid CA, Swezy O: The free-living unarmored Dinoflagellata.Volume 5. Berkeley, University of California Press; Memoirs of theUniversity of California; 1921:1-559. 37. Elbrächter M: On the taxonomy of unarmoured dinophytes(Dinophyta) from the Northwest African upwelling region."Meteor" Forsch-Ergebnisse 1979, D(30):1-22.38. Greuet C: Les critères de determination chez les PéridiniensWarnowiidae Lindemann.  Protistologica 1972, 8(4):461-469.39. Sournia A: Atlas du Phytoplankton Marin. Vol. I: Introduction,Cyanophycées, Dictyochophycées, Dinophycées et Raphido-phycées.  Edition du CNRS, Paris; 1986:26-98. 40. Steidinger KA, Tangen K: Dinoflagellates.  In Identifying Marine Phy-toplankton Edited by: Tomas CR. San Diego: Academic Press;1997:387-584. 41. Gómez F: A list of free-living dinoflagellate species in theworld's oceans.  Acta Bot Croat 2005, 64(1):129-212.42. Greuet C: Organisation ultrastructurale de l'ocelloide deNematodinium. Aspect phylogénétique de l'évolution du pho-torécepteur des Péridiniens Warnowiidae Lindemann.  Cyto-biologie 1978, 17:114-136.43. Francis D: On the eyespot of the dinoflagellate, Nematodin-ium.  J Exp Biol 1967, 47:495-501.44. Greuet C: Structure fine de l'ocelle d'Erythropsis pavillardiHertwig, Péridinien Warnowiidae Lindemann.  C R Acad ScParis 1965, 261:1904-1907.45. Greuet C: Organisation ultrastructurale de l'ocelle de deuxPéridiniens Warnowiidae, Erythropsis pavillardi Kofoid etSwezy et Warnowia pulchra Schiller.  Protistologica 1968,4(2):209-230.46. Greuet C: Étude morphologique et ultrastructurale du tro-phonte d'Erythropsis pavillardi Kofoid et Swezy.  Protistologica1969, 5(4):481-503.47. Greuet C: Étude ultrastructurale et évolution des cnidocystesde Nematodinium, Péridinien Warnowiidae Lindemann.  Pro-tistologica 1971, 7(3):345-355.48. Greuet C: Évolution structurale et ultrastructurale de l'ocel-loide d'Erythropsis pavillardi Kofoid et Swezy (Péridinien49. Hulburt EM: The taxonomy of unarmored Dinophyceae ofshallow embayments on Cape Cod, Massachusetts.  Biol Bull1957, 112(2):196-219.50. Hertwig R: Erythropsis agilis. Eine neue Protozoe.  Gegenb Mor-phol Jahrb 1884, 10:204-212.51. Kofoid CA, Swezy O: On the orientation of Erythropsis.  Univ CalifPubl Zool 1917, 18(6):89-102.52. Greuet C: Organisation ultrastructurale du tentacule d'Eryth-ropsis pavillardi Kofoid et Swezy Péridinien WarnowiidaeLindemann.  Protistologica 1967, 3(3):335-345.53. Greuet C: Leucopsis cylindrica, nov. gen., nov. sp., PéridinienWarnowiidae Lindemann considerations phylogénétiquessur les Warnowiidae.  Protistologica 1968, 4(2):419-422.54. Uhlig G: Eine einfach Methode zur Extraktion der vagilen,mesopsammalen Mikrofauna.  Helgol Wiss Meeresunters 1964,11:178-185.55. Galluzzi L, Penna A, Bertozzini E, Vila M, Garces E, Magnani M: Devel-opment of a real-time PCR assay for rapid detection andquantification of Alexandrium minutum (a dinoflagellate).  ApplEnviron Microb 2004:1199-1206.56. Leander BS, Clopton RE, Keeling PJ: Phylogeny of gregarines(Apicomplexa) as inferred from small subunit rDNA andbeta-tubulin.  Int J Syst Evol Microbiol 2003, 53:345-354.57. Scholin CA, Herzog M, Sogin M, Anderson DM: Identification ofgroup- and strain-specific genetic markers for globally dis-tributed Alexandrium (Dinophyceae). II. Sequence analysis ofa fragment of the LSU rRNA gene.  J Phycol 1994, 30:999-1011.58. Yamaguchi A, Kawamura H, Horiguchi T: A further phylogeneticstudy of the heterotrophic dinoflagellate genus, Protoperidin-ium (Dinophyceae) based on small and large subunit ribos-omal RNA gene sequences.  Phycol Res 2006, 54:317-329.59. Medlin L, Elwood HJ, Stickel S, Sogen ML: The characterization ofenzymatically amplified eukaryotic 16S-like rRNA-codingregions.  Gene 1988, 71:491-499.60. Handy SM, Demir E, Hutchins DA, Portune KJ, Whereat EB, Hare CE,Rose JM, Warner M, Farestad M, Cary SC, Coyne KJ: Using quanti-tative real-time PCR to study competition and communitydynamics among Delaware Inland Bays harmful algae in fieldand laboratory studies.  Harmful Algae 2008, 7:599-613.61. Yamaguchi A, Horiguchi T: Molecular phylogenetic study of theheterotrophic dinoflagellate genus Protoperidinium (Dino-phyceae) inferred from small subunit rRNA gene sequences.Phycol Res 2005, 53:30-42.62. Kogame K, Horiguchi T, Masuda M: Phylogeny of the order Scy-tosiphonales (Phaeophyceae) based on DNA sequences ofrbcL, partial rbcS, and partial LSU rDNA.  Phycologia 1999,38:496-502.63. Takano Y, Horiguchi T: Acquiring scanning electron microscop-ical, light microscopical and multiple gene sequence datafrom a single dinoflagellate cell.  J Phycol 2006, 42:251-256.64. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic localalignment search tool.  J Mol Bio 1990, 215:403-410.65. Maddison DR, Maddison WP: MacClade Sunderland, MA. SinauerAssociates, Inc.; 2000. 66. Posada D, Crandall KA: MODELTEST: testing the model ofDNA substitution.  Bioinformatics 1998, 14:817-818.67. Guindon S, Gascuel O: A simple, fast, and accurate algorithmto estimate large phylogenies by maximum likelihood.  SystBiol 2003, 52:696-704.68. Guindon S, Lethiec F, Duroux P, Gascuel O: PHYML Online – aweb server for fast maximum likelihood-based phylogeneticinference.  Nucleic Acids Res 2005, W:557-559.69. Huelsenbeck JP, Ronquist F: MrBayes: Bayesian inference of phy-logenetic trees.  Bioinformatics 2001, 17:754-755.70. Ronquist F, Huelsenbeck JP: MrBAYES 3: Bayesian phylogeneticinference under mixed models.  Bioinformatics 2003,19:1572-1574.71. Kim K-Y, Iwataki M, Kim C-H: Molecular phylogenetic affilia-tions of Dissodinium pseudolunula, Pheopolykrikos hartmannii,Polykrikos cf. schwartzii and Polykrikos kofoidii to Gymnodin-ium sensu stricto species (Dinophyceae).  Phycol Res 2008,56:89-92.Page 15 of 15(page number not for citation purposes)Warnowiidae Lindemann) au cours des divisions binaire etpalintomiques.  Protistologica 1977, 13(1):127-143.


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items