UBC Faculty Research and Publications

Functional analysis of the impact of ORMDL3 expression on inflammation and activation of the unfolded… Hsu, Karolynn J; Turvey, Stuart E Feb 1, 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-13223_2012_Article_372.pdf [ 629.34kB ]
Metadata
JSON: 52383-1.0223652.json
JSON-LD: 52383-1.0223652-ld.json
RDF/XML (Pretty): 52383-1.0223652-rdf.xml
RDF/JSON: 52383-1.0223652-rdf.json
Turtle: 52383-1.0223652-turtle.txt
N-Triples: 52383-1.0223652-rdf-ntriples.txt
Original Record: 52383-1.0223652-source.json
Full Text
52383-1.0223652-fulltext.txt
Citation
52383-1.0223652.ris

Full Text

RESEARCH Open AccessFunctional analysis of the impact of ORMDL3expression on inflammation and activation of theunfolded protein response in human airwayepithelial cellsKarolynn J Hsu and Stuart E Turvey*AbstractBackground: The gene ORMDL3 was shown to be associated with early-onset asthma susceptibility in multipleindependent genome-wide and candidate-gene association studies. Asthmatic patients have elevated expressionlevels of this gene. ORMDL3 encodes a transmembrane protein localized in the endoplasmic reticulum (ER) thatmay be involved in ER stress and inflammation. It is essential to validate the genetic associations linking ORMDL3with asthma through functional studies that confirm the biological relevance of this gene in disease. Weinvestigated the effects of manipulating ORMDL3 expression levels in vitro in airway cells on innate immuneinflammatory responses, ER stress and activation of the unfolded protein response (UPR).Methods: ORMDL3 expression levels were manipulated in airway cells using an overexpression plasmid and siRNAtechnologies. Successful modulation of ORMDL3 was confirmed at both the gene and protein level. The functionalimpact of modulation of ORMDL3 expression levels on inflammatory responses and activation of the UPR werequantified using complementary cellular and molecular immunology techniques.Results: Cells with altered ORMDL3 levels responded equally well to innate immune stimuli and produced similarlevels of pro-inflammatory cytokines compared to wild-type cells. Treatment with ER stress inducers, thapsigarginand tunicamycin, resulted in activation of the unfolded protein response (UPR). However, we observed nodifference in UPR activation in cells with ORMDL3 knockdown compared to cells with normal ORMDL3 levels.Conclusions: Our results suggest that ORMDL3 variation in the airway epithelium is unlikely to play a significantrole in modulating innate immune responses and the UPR in the lung.Keywords: Immune response, Epithelium, Cytokines, Chemokines, Host defenseIntroductionAsthma and allergic diseases are rapidly becoming themost common chronic diseases in the developed world.Current asthma therapy treats symptoms of the disease,however it is ineffective in up to 25% of patients [1].Asthma and allergic diseases are complex disorderscaused by the interaction of various genetic and environ-mental factors [2-4].Genome-wide association studies (GWAS) have beenused to identify genes that may be involved in asthmapathogenesis [5]. Moffatt and colleagues first reportedthat multiple single nucleotide polymorphisms (SNPs)on chromosome 17q21 linked ORMDL3 (orosomucoid1-like 3) to the risk of developing childhood asthma [6].This association has since been reproduced in multipleindependent studies [7-14]. However, little work hasbeen done to elucidate the biological and functional rele-vance of this gene in asthma. The disadvantage of theseassociation studies is that they cannot differentiate be-tween true causal SNPs and non-causal variants simplyin linkage disequilibrium with disease-causing genes. It* Correspondence: sturvey@cfri.caDivision of Infectious and Immunological Diseases, Department of Pediatrics,BC Children’s Hospital and Child & Family Research Institute, University ofBritish Columbia, Vancouver, BC, CanadaALLERGY, ASTHMA & CLINICAL IMMUNOLOGY© 2013 Hsu and Turvey; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of theCreative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,distribution, and reproduction in any medium, provided the original work is properly cited.Hsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4http://www.aacijournal.com/content/9/1/4is therefore imperative to validate GWAS data throughfunctional studies that confirm the biological relevanceof a gene in disease.SNP variants have also linked ORMDL3 to inflamma-tory bowel disease (IBD) and Type I diabetes, suggestingthat ORMDL3 may be involved in dysregulation of theimmune system [15,16]. Association of ORMDL3 in bothasthma and IBD is of interest because the lung and gutare composed of similar mucosal surface cells and thesetissues are exposed to many potentially harmful antigensand allergens requiring tight regulation of the mucosalimmune system [17]. This unique system is responsiblefor maintaining a delicate equilibrium between antigen re-sponsiveness and tolerance and is therefore responsible forpreventing hyper-reactivity [17]. Inappropriate immuneresponses to foreign components or commensal bacteriacan lead to inflammation characteristic of asthma and IBD.Furthermore, the polymorphisms may be involved in regu-lation of mRNA expression of 17q21 locus genes, includingORMDL3 [6]. The expression of ORMDL3 was recentlyassociated with elevated levels of IL-17 secretion [18] andORMDL3 was expressed at higher levels in the peripheralblood of patients with recurrent wheeze compared to con-trols [19]. This correlation further supports the hypothesisthat ORMDL3 is involved in immunity.The ORMDL3 gene is a member of a family of conservedendoplasmic reticulum (ER)-localized transmembrane pro-teins [20]. The functions of the ORMDL proteins are cur-rently unknown, but a recent study suggested thatORMDL3 is involved in ER-mediated Ca2+ homeostasisand activation of the unfolded protein response (UPR) –ORMDL3 may inhibit sarco/endoplasmic reticulum Ca2+ATPase (SERCA) activity [21,22]. Disruptions to ER Ca2+concentrations can cause protein misfolding, and accumu-lation of these unfolded proteins can lead to ER stress[23,24]. UPR signaling cascades are initiated in response tothis stress and have been shown to activate the JNK-AP-1and NF-κB-IKK pathways [25-27]. The ER stress responseand UPR, caused by changes in ORMDL3 expression,can initiate inflammation through induction of cytokineproduction. This mechanism may explain the role ofORMDL3 in asthma pathogenesis. Indeed, Miller et al.have shown that in mice ORMDL3 is an allergen andcytokine (IL-4 or IL-13) inducible ER gene expressedpredominantly in airway epithelial cells, and that it acti-vates the ATF6 pathway of the ER localized UPR regu-lating expression of metalloprotease, chemokine, andoligoadenylate synthetase genes [28].Although the symptoms of asthma are largely driven bydysregulated T helper type 2 (TH2) responses, innate im-mune responses are also involved in asthma pathogenesis[29,30]. Airway epithelia are central to host defense andimmune regulation. These cells are among the first to en-counter environmental insults and play an important rolein shaping downstream immune responses. Any dysregu-lation of the innate immune response can result in hyper-sensitivity to environmental factors, leading to asthmasymptoms.Given the multiple lines of evidence suggesting thatORMDL3 is involved in immunity, we investigated the roleof the gene in innate immune responses of airway cells.We hypothesized that elevated ORMDL3 levels result inheightened inflammatory responses that are associated withthe asthmatic phenotype. Increased levels of ORMDL3 pro-tein may in turn disrupt ER homeostasis, leading to ERoverload and activation of the UPR, initiating inflamma-tory responses. Using an in vitro model, we manipulatedORMDL3 expression in airway cells to determine whethera difference in basal ORMDL3 expression affected inflam-matory responses or activation of the UPR before and afterstimulation.Materials and methodsCell culture1HAEo¯ (1HAE) cells (SV40-transformed normal humanairway epithelial cells) were cultured in DMEM-high glu-cose medium with 10% fetal calf serum (FCS), 2 mM L-glutamine, and 1 mM sodium pyruvate (HyClone). A549cells (adenocarcinomic human alveolar basal epithelial cells)were cultured in F-12K medium supplemented with 10%fetal calf serum (FCS), 2 mM L-glutamine, and 1 mM so-dium pyruvate (HyClone). Cells were incubated in a 37°C,5% CO2 incubator. All cells were cultured under non-polarizing conditions.Cloning ORMDL3 cDNA into pEGFP-N1 vectorThe ORMDL3 gene was amplified from cDNA using for-ward primer 50-CTAAGAATTCATGAATGTGGGCACAGCGCAC-30 and reverse primer 50-TACTGGTACCCCGTACTTATTGATTCCAAAAATCCGGACT-30, introdu-cing EcoRI and KpnI restriction endonuclease sites, re-spectively. The ORMDL3 PCR product was then insertedinto a pEGFP-N1 eukaryotic expression vector (Clontech).ORMDL3 and eGFP are in frame and produce a fusionprotein with eGFP expressed at the C-terminus ofORMDL3. The construct was verified by sequencing andis denoted as pEGFP-ORMDL3. Protein is denoted asORMDL3-eGFP.Cell transfectionA549 and 1HAE cell lines were transfected with pEGFP-ORMDL3, scramble (non-specific) or ORMDL3-specificsiRNA (pre-designed by Qiagen) using AmaxaW CellLine NucleofectorW Kit T (Lonza). Two ORMDL3-spe-cific siRNAs were used. Concentrations used for trans-fection represent pooled siRNA concentration. Cellswere seeded into a 24-well plate (BD Biosciences) at aHsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 2 of 10http://www.aacijournal.com/content/9/1/4density of 2x105 cells/well for A549 cells or 1x105 cells/well for 1HAE cells.Cell stimulation and immune response quantificationTwenty-four hours post-transfection, cells were stimu-lated with TNF-α (200 ng/ml) (eBioscience), E. coliK12 LPS (100 μg/ml) (InvivoGen), S. typhimurium fla-gellin (10-200 ng/ml) (InvivoGen), or IL-1β (200 ng/ml)(eBioscience). Stimulants and their concentrations werechosen based on published literature or past experiments[31-34]. Cells were stimulated for 24 hours. Supernatantswere collected and analyzed for cytokine secretion. Pro-inflammatory cytokines, IL-6 and IL-8, were detected andquantified using Human IL-6 and IL-8 Ready-Set-Go!WELISA kits (eBioscience). Experiments were repeated threetimes (n = 3).ER stress induction and UPR activationCells were stimulated with tunicamycin (200 μg/mL) (Cal-biochem) or thapsigargin (10 μM) (Sigma) for 2 or 4 hoursto activate the UPR. For ORMDL3 knockdown cells,stimulation was performed 24 hours post-transfection.RNA was extracted and expression of genes XBP-1u,XBP-1s, and CHOP were then quantified as markers ofUPR activation. For measurement of p-eIF2α levels byWestern blot, lysates from unstimulated cells withORMDL3 knockdown were collected 24 hours post-trans-fection. Experiments were repeated three times (n = 3).RNA isolation and reverse transcriptionRNA was extracted from lysates using E.Z.N.A.W TotalRNA Kit (Omega Bio-Tek) according to the manufac-turer’s protocol. Extracted RNA was reverse transcribedinto cDNA using the SuperScriptW VILO™ cDNA Syn-thesis Kit (Invitrogen). Complement DNA was diluted to200 ng/μl prior to quantification of gene expression byqPCR. This method was followed for all samples, unlessotherwise stated (see PCR Array).Quantification of ORMDL3 mRNA expressionGene expression was calculated relative to GAPDH orPPIA (encoding cyclophilin A) and was quantified bySYBR Green chemistry (PerfeCTa™ qPCR SuperMix,Quanta Biosciences) using a 7300 Real Time PCR Sys-tem (Applied Biosystems). Reactions were performed intriplicate using the following cycling conditions: 50°C for 2mins, 95°C for 10 mins, [95°C for 15 s, 60°C for 1 min] x 40.The relative expression of the measured gene was calcu-lated by the Pfaffl method [35]. The primers used arelisted in Table 1.Western blot analysisCells were lysed in 50 μl RIPA Buffer + 1x HALT™ prote-ase inhibitor (Thermo Scientific). Cell debris were removedby centrifugation: 18,000 x g for 10 min at 4°C. Proteinswere analyzed by standard Western blotting protocolswhere they were transferred onto ImmobilonW-FL transfermembrane (Millipore). Antibodies used for Western blotTable 1 Quantitative PCR primer sequencesGene NCBI accession Forward (50→ 30) Reverse (50→ 30) CDS region† Product sizeGAPDH NM_002046.4 GCACCGTCAAGGCTGAGAACGG CGACGTACTCAGCGCCAGCATC c.173-286 114PPIA NM_021130 TAAAGCATACGGGTCCTGGCATCT ATCCAACCACTCAGTCTTGGCAGT c.269-369 101ACTB NM_001101.3 GTTGCGTTACACCCTTTCTT ACCTTCACCGTTCCAGTTT c.*16-*162 147DDIT3 NM_001195053.1 GAAATGAAGAGGAAGAATCA TTCTCCTTCATGCGCT c.197-437 241XBP-1s NM_001079539.1 ATGGATGCCCTGGTTGCTGAAGA TGCACCTGCTGCGGACTCA c.415-504 90XBP-1u NM_005080.3 AGCACTCAGACTACGTGCACCTCT CCAGAATGCCCAACAGGATATCAG c.495-624 130ORMDL1 NM_016467.4 AATGGCTGGTCCTTCAAGTGCT ACCCTCACTGTGATGCCCTTTA c.*121-*269 149ORMDL2 NM_014182.4 ACACACTGGGAGCAAATGGACT AGTGCGCAGCATCATACTTGGT c.250-370 121ORMDL3 NM_139280.2 TCAGGCAGCCAAAGCACTTTAACC ACCCATCCCACACTTGCTTCCATA c.*358-*496 139BCL6 NM_001706.4 ACAATCCCAGAAGAGGCACGAAGT GCTCGAAATGCAGGGCAATCTCAT c.790-952 163CCL2 NM_002982.3 TCGCTCAGCCAGATGCAATCAATG TGGAATCCTGAACCCACTTCTGCT c.65-259 195CCL5 NM_002985.2 TGCCTGTTTCTGCTTGCTCTTGTC TGTGGTAGAATCTGGGCCCTTCAA c.*36-*127 92CSF2 NM_000758.3 AAATGTTTGACCTCCAGGAGCCGA GGTGATAATCTGGGTTGCACAGGA c.185-357 173IL12A NM_000882.3 ATGATGGCCCTGTGCCTTAGTAGT AGGGCCTGCATCAGCTCATCAATA c.457-611 155IL13RA1 NM_001560.2 GTCCCAGTGTAGCACCAATGA CAGTCACAGCAGACTCAGGAT c.297-391 95ADRB2 NM_000024.5 TCATCATGGGCACTTTCACCCTCT AGCTCCTGGAAGGCAATCCTGAAA c.830-1016 187VEGFA NM_001025366.2 TTCAGGACATTGCTGTGCTTTGGG TGGGCTGCTTCTTCCAACAATGTG c.*778-*969 192IL23A NM_016584.2 TCGGTGAACAACTGAGGGAACCAA TGGAATCTCTGCCCACTTCCACTT c.-140- -54 87† c.-number if in the 50UTR, c.*number if in the 30UTR.Hsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 3 of 10http://www.aacijournal.com/content/9/1/4analysis were: monoclonal anti-GFP antibody 1:10,000(Clontech), anti-ACTB antibody 1:6,000 (Cell Signaling),anti-p-eIF2α 1:500 (Cell Signaling) and IRDyeW 680 or800 secondary antibodies 1:8000 (Li-cor). Western blotswere visualized using an Odyssey Infrared Imaging Sys-tem (Li-cor).PCR array1HAE cells co-transfected with pEGFP-ORMDL3 andORMDL3 siRNA (low ORMDL3 expression) were com-pared to cells co-transfected with pEGFP-ORMDL3 andscramble siRNA (high ORMDL3 expression) at two time-points (2 and 24 hours) after TNF-α stimulation. ExtractedRNA was reverse transcribed into first strand cDNA usingthe RT2 First Strand Kit (SABiosciences, Qiagen). Protocolas described by the manufacturer was followed.Two RT2 Profiler PCR arrays (SABiosciences, Qiagen),profiling expression of 84 genes each, were used: HumanCytokines & Chemokines and Allergy & Asthma (seeAdditional file 1 for complete list). Complementary DNAtemplate was mixed with RT2 SYBRW Green qPCR Mas-termix (SABiosciences, Qiagen) as follows: 1350 μL SYBRGreen Master Mix, 1248 μL nuclease-free H2O, and102 μL cDNA (~200 ng/μL). Note: these volumes wereused as recommended by the manufacturer for use with a7300 Real Time PCR System (Applied Biosystems). Tem-plate was then aliquoted into PCR plates containing pre-dispensed primers. Cycler program as provided by themanufacturer was used. Results were analyzed using thePCR Array Data Analysis Web Portal.Statistical analysisData are shown as mean ± SEM of three separate experi-ments. Results were analyzed using one-way ANOVA withBonferroni post-test. Statistical analysis was performedusing GraphPad Prism5 (GraphPad Software, Inc.). Differ-ences with p < 0.05 were considered significant.ResultsORMDL3 modulation in airway cellsIn order to determine functional impact of ORMDL3modulation, knockdown of the gene was performed usingsiRNAs. A549 and 1HAE cells were transfected withscramble (non-specific) or ORMDL3-specific siRNA.Modeling variation expected to occur in the human popu-lation, we achieved 40-70% knockdown of ORMDL3 geneexpression using siRNA concentrations of 50 nM-500 nM.We also confirmed that ORMDL3-specific siRNA did notaffect expression of genes in the same family, ORMDL1 orORMDL2 (Additional file 2). Sequences of primers usedfor qPCR are listed in Table 1.ORMDL3 has 84% and 80% protein sequence homologyto ORMDL1 and ORMDL2, respectively. This presented achallenge for confirming knockdown of ORMDL3 proteinbecause commercially available antibodies detect all threeproteins. Therefore, we were unable to show ORMDL3protein knockdown in cells transfected with siRNAalone. To overcome this limitation, we constructed afusion protein, where ORMDL3 is tagged with aneGFP protein. Co-transfection of this overexpression plas-mid with ORMDL3-specific siRNA enabled us to knock-down ORMDL3 and detect changes at the protein levelusing an anti-GFP antibody.Airway cells were co-transfected with both pEGFP-ORMDL3 and siRNA (scramble or ORMDL3). Protein andmRNA were analyzed for gene knockdown. At the tran-script level, we observed (Figure 1) a small but significantincrease (p < 0.05) in ORMDL3 expression in the cellstransfected with pEGFP-ORMDL3 and scramble siRNAcompared to cells alone, confirming successful overexpres-sion of the ORMDL3 gene. Transfection with pEGFP-ORMDL3 and increasing concentrations of ORMDL3siRNA resulted in a titration effect of increasing ORMDL3knockdown. One advantage to constructing a fusion pro-tein, ORMDL3-eGFP, is that eGFP is only expressed withexpression of ORMDL3. Therefore, when cells are co-transfected with pEGFP-ORMDL3 and siRNA, knockdownof ORMDL3 protein could subsequently be detected byimmunoblot analysis using the anti-GFP antibody. Expres-sion of the ORMDL3-eGFP protein was confirmed byFigure 1 Experimental manipulation of ORMDL3 expression.Graph (top) shows relative ORMDL3 transcript levels. Data representsthe mean ± SEM of three experimental repeats. Statistical analysiswas performed using one-way ANOVA with Bonferroni post-test.* p < 0.05, *** p < 0.001. Western blot analysis (bottom) showsprotein expression of ORMDL3-eGFP and β-actin as a loadingcontrol. Blot is representative of three independent experiments.Hsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 4 of 10http://www.aacijournal.com/content/9/1/4Western blot of whole cell lysate collected from the cellsin each condition. Figure 1 shows knockdown ofORMDL3-eGFP protein, confirming that ORMDL3 siRNAaffects protein expression. The double band may beexplained by either variation in mRNA splicing or post-translational modifications to the fusion protein, such asacetylation, methylation, myristylation, phosphorylation,or glycosylation.ORMDL3 knockdown does not affect IL-6 or IL-8production following innate immune activation1HAE cells transfected with pEGFP-ORMDL3 andscramble or ORMDL3-specific siRNA were stimulated24 hours post-transfection and supernatants were col-lected 48 hours post-transfection. Stimuli used wereTNF-α, IL-1β, LPS, and flagellin. TNF-α and IL-1β werechosen because both are early response cytokines thatperpetuate acute inflammatory processes. LPS and flagel-lin, in contrast, are common microbial antigens recog-nized by the innate immune system. Two classic andbiologically-relevant NF-κB-induced cytokines with im-portant roles in innate immunity, interleukin-6 (IL-6) andinterleukin-8 (IL-8), were measured by ELISA. Despiteconfirmation of ORMDL3 mRNA and protein knockdown,we did not observe any impact on IL-6 or IL-8 productionafter stimulation as shown in Figure 2A-B. Although thecells have low baseline responsiveness to LPS and flagellin,our results indicate that ORMDL3 knockdown does notenhance sensitivity to these stimuli. Similar results wereobtained in A549 cells, as well as 1HAE cells transfectedwith siRNA alone (Additional file 2).ORMDL3 knockdown does not enhance UPR activationupon stimulationWe next explored the effects of ORMDL3 expression onactivation of the UPR. Initiation of the UPR is mediatedby one or more of the ER-membrane protein sensors:PKR-like eukaryotic initiation factor 2α kinase (PERK),inositol requiring enzyme 1 (IRE1), and activating tran-scription factor-6 (ATF6) [23]. Activation of any of thethree pathways initiates signaling cascades that mediatechanges to relieve ER stress. The gene XBP-1 is a sub-strate for IRE1 ribonuclease [24]. Upon activation of theIRE1 pathway, the IRE1 ribonuclease removes a 26-bpintron from the unspliced variant, XBP-1u, which resultsin the spliced variant, XBP-1s [36]. This spliced variantis the active form of the gene that contributes to ERstress responses. CHOP transcription, in contrast, can beinduced by the PERK and ATF6 pathways [24]. Phos-phorylated eIF2α (p-eIF2α) is an early marker of PERKpathway activation and is upstream of CHOP induction[23]. Expression changes in these three genes that signifyUPR activation, XBP-1u, XBP-1s, and CHOP, were deter-mined by qPCR. We also evaluated phosphorylation ofeukaryotic initiation factor 2α (eIF2α) by Western blot,as modulation of ORMDL3 expression has been reportedto influence eIF2α phosphorylation [21].A BFigure 2 Cytokine production in cells with ORMDL3 knockdown. A) Secreted IL-6 and B) IL-8 levels after cell stimulation. 1HAE cells werestimulated with TNF-α, LPS, flagellin, or IL-1β for 24 hours. Data represent the mean ± SEM of three experimental repeats. Statistical analysis wasperformed using one-way ANOVA with Bonferroni post-test.Hsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 5 of 10http://www.aacijournal.com/content/9/1/4As positive controls for UPR activation, we stimulated1HAE cells with tunicamycin and thapsigargin. Both areinducers of ER stress – tunicamycin inhibits N-linked gly-cosylation and thapsigargin inhibits the SERCA pumpcausing ER calcium stores to be depleted [37]. Quantita-tive measurement of transcript levels showed that bothXBP-1s and CHOP increased, while XBP-1u decreasedupon stimulation with either tunicamycin or thapsigargin(Figure 3A-B). This confirmed the utility of measuringthese genes to monitor UPR activation.At baseline (unstimulated cells), variation in ORMDL3expression did not induce UPR activation in A549 or1HAE cells (Additional file 2). 1HAE cells withORMDL3 knockdown were also stimulated with tunica-mycin or thapsigargin (Figure 3C-D). In both condi-tions, ORMDL3 knockdown did not show increasedUPR activation compared to the negative control. Fur-thermore, levels of phosphorylated-eIF2α were indis-tinguishable between ORMDL3 knockdown cells andcontrols (Figure 3E).A BC DEFigure 3 Unfolded protein response activation in cells with ORMDL3 knockdown. ER stress was induced in 1HAE cells by stimulation withA) tunicamycin or B) thapsigargin for 2 or 4 hours. Relative expression levels of XBP-1u, XBP-1s, and CHOP were quantified and compared tounstimulated cells. 1HAE cells with ORMDL3 knockdown were stimulated with C) tunicamycin or D) thapsigargin for 4 hours. Relative geneexpression levels were quantified and compared to cells transfected with scramble (a non-specific) siRNA. Data represent the mean ± SEM ofthree experimental repeats. Statistical analysis was performed using one-way ANOVA with Bonferroni post-test. *** p < 0.001, ** p < 0.01,* p < 0.05. E) Western blot analysis of p-eIF2α with β-actin loading control. Lysates are from unstimulated 1HAE cells 24 hours after ORMDL3knockdown. Blot is representative of three independent experiments.Hsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 6 of 10http://www.aacijournal.com/content/9/1/4Impact of ORMDL3 knockdown on the expression ofmultiple genes involved in inflammation, asthma & allergyTo expand our search for immune functions potentiallyaltered by ORMDL3, the expression of 168 genes wasdetermined at two time points (2 and 24 hours) follow-ing stimulation with TNF-α. We performed PCR arraysto profile expression of cytokines, chemokines, and keygenes involved in asthma and allergy (a complete list ofgenes that were studied can be found in Additional file 1).Gene expression was compared between 1HAE cellswith high (plasmid + 500 nM scramble siRNA) and low(plasmid + 500 nM of ORMDL3 siRNA) ORMDL3 ex-pression that were stimulated for 24 hours with TNF-α.Stimulation with TNF-α induced a robust inflammatory re-sponse in the cells, enabling us to observe whether vari-ation in basal ORMDL3 levels impacts the immuneresponse. These arrays identified eight genes (CCL2, TSLP,CSF2, CCL5, VEGFA, ADRB2, IL1RL1, and IL13RA1),shown in Figure 4, that appeared to be differentially regu-lated by more than 1.5 fold and that were expressed at rela-tively high levels (average threshold cycle <30). However,upon replication to validate these results, we determinedthat the differences were not statistically significant.The same arrays were performed on cells stimulated for2 hours with TNF-α. The same conditions for “high” and“low” ORMDL3 expression were used. From our results,we identified only one gene, IL23A, that was differentiallyregulated by more than 1.5 fold (fold regulation −2.37)and amplified at cycle <30. Replication and comparison ofIL23A expression between knockdown conditions yieldedno significant difference. No other genes, as identified inthe previous arrays, were found to be differentially regu-lated at this time point. These results suggest thatORMDL3 variation does not have a meaningful impact onexpression of a large panel of immune-related genes in air-way epithelial cells.DiscussionAsthma is a complex disease affecting many individualsin the developed world. Genome-wide association stud-ies have recently been used to identify genetic causes forsuch complex diseases. One particular gene, ORMDL3,is of interest because of its association with asthma, IBD,and Type I diabetes – all of which are caused byimmune-mediated pathology [6,10,22,38,39]. The geneORMDL3 is an ER-membrane protein and is potentiallyinvolved in Ca2+-signaling in the ER and sphingolipidsynthesis [20,21,40]. It has also been correlated to activa-tion of the UPR, though the mechanisms remain unclear[21]. Activation of the UPR may be biologically relevant,as ER stress, the UPR, and inflammation have all beenlinked [23]. However, the functional role ORMDL3 inthe pathogenesis of asthma has yet to be elucidated.Airway epithelial cells play an important role in innateimmunity and in the development of asthma. Currentfindings in literature indicate that ORMDL3 is involvedin immunity and that asthmatics have higher expressionof the gene than non-asthmatics [18,21,22]. A recentstudy by Miller et al. also investigated the role ofORMDL3 in airway epithelial cells. They reported thatin vitro overexpression of ORMDL3 activated the ATF6pathway of the UPR and induced expression of severalgenes with potential importance in the pathogenesis ofasthma [28]. Our investigation, in contrast, focuses on theeffect of variation of ORMDL3 expression levels, at base-line, on the innate immune responsiveness of airway epi-thelial cells. By manipulating ORMDL3 expression in vitroto mimic differences in gene expression established be-tween asthmatics and healthy individuals, we aimed tounderstand the role of ORMDL3 on the innate immuneresponse and UPR activation status in airway epithelialcells. This method ensured control and the confidencethat any effect on the innate immune response was in factcorrelated with a change in ORMDL3 expression levels. Ifthe same experiments were performed on ex vivo airwaycells of patients, genetic and other differences betweenindividuals could have affected the results.After knockdown of ORMDL3 in vitro, cells were stimu-lated with cytokines (TNF-α, IL-1β) or common microbialcomponents (LPS, flagellin). We monitored production ofinterleukin-6 (IL-6) and interleukin-8 (IL-8) (alias CXCL8),two pro-inflammatory cytokines produced by airway cellsFigure 4 PCR array. Results shown are 168 genes profiled fromtwo PCR arrays: Allergy & Asthma and Human Cytokines &Chemokines (Qiagen). 1HAE cells with high or low ORMDL3expression were stimulated with TNF-α for 24 hours and differencesin gene expression were compared. Comparing low ORMDL3expression to high ORMDL3 expression, circles are genes with lessthan 1.5 fold change and triangles are genes down-regulated bymore than 1.5 fold.Hsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 7 of 10http://www.aacijournal.com/content/9/1/4that are relevant in asthma pathogenesis. Specifically, IL-6is elevated in individuals with asthma [41] and is also regu-lated by ATF6 during activation of the UPR [42]. Similarly,transfection of ORMDL3 into human airway epithelial cellstriggers ATF6 activation and IL-8 secretion [28]. However,in our experimental system, variation in ORMDL3 expres-sion levels did not affect NF-κB-induced innate immuneproduction of IL-6 and IL-8 in airway epithelial cells.We next explored the effects of ORMDL3 expression onactivation of the UPR. UPR signaling cascades are initiatedin response to ER stress, and restoration of homeostasis isachieved by attenuating translation, restoring protein fold-ing, or degrading misfolded proteins [24]. Although oftenassociated with abnormal physiological conditions, theUPR plays a central beneficial role in normal physiology;as illustrated by the role of the UPR in terminal B cell dif-ferentiation which requires a massive increase in the bio-synthetic capacity to synthesize antibodies in response toinfection [43]. However, the ER stress response and UPRcan also initiate inflammation through induction of cyto-kine production or activation of transcriptional regulatorsof inflammatory genes. Cytokines IL-6 and IL-8 are exam-ples of genes that may be induced by UPR activation [23].ER stress and the UPR have been implicated in manyimmune-related diseases including IBD, diabetes, chronicobstructive pulmonary disease (COPD), arthritis, and neu-rodegenerative inflammatory diseases [44]. It is poorlyunderstood whether ER stress is an underlying cause ofdisease or if its induction is a result of chronic inflamma-tion. Indeed, it is possible that environment factors suchas infection or inhalation of smoke particles can activatethe UPR, triggering the onset of lung disease in geneticallypredisposed individuals [45]. However, it is also possiblethat ER stress is exacerbated by inflammation and contri-butes to the perpetuation of the disease.Cantero-Recasens et al. previously reported thatORMDL3 overexpression activated the PERK pathway, butdid not affect the IRE1 pathway of the UPR [21]. In con-trast, Miller et al. reported that ORMDL3 overexpressionactivated the ATF6 pathway, but not the PERK or IRE1pathways [28]. In our study, we chose four markers ofUPR activation: XBP-1u, XBP-1s, CHOP, and p-eIF2α.With activation of the UPR, we expect downregulation ofXBP-1u and upregulation of XBP-1s and CHOP. However,our results demonstrate that knockdown of ORMDL3does not activate the UPR, in either unstimulated or sti-mulated cells. Immunoblot analysis also showed nochange in p-eIF2α levels with ORMDL3 knockdown. Fur-thermore, downstream markers of UPR activation, IL-6and IL-8 cytokines, were produced at similar levels in un-stimulated cells with varying ORMDL3 levels. This furthersupports our results that ORMDL3 does not activate theUPR. Differences in our results compared to previouswork might be due to the different types of cells,conditions, or markers used. It is possible that the effectsof variation in ORMDL3 expression are a cell type-dependent phenomenon. While no effect on the inflam-matory response was detected in airway cells, other cellstypes such as dendritic cells or T cells may be affected byaltered ORMDL3 expression. Observations made by Lluiset al. suggest that the 17q21 locus may potentially play arole in T-cell development [18].Taking a broader approach, PCR arrays looking at ex-pression of 168 common immunity genes were per-formed. We reasoned that although ORMDL3 levels maynot affect the production of IL-6 or IL-8 cytokines, per-haps they were impacting gene expression of other im-portant immune genes, such as IL-33, IL-25 and TSLP,which have all been implicated in asthma pathogenesis[46]. Verification of differential expression of these genesat a transcript level, however, did not show any significantchanges between the ORMDL3 knockdown conditions.This suggests that altering ORMDL3 expression does nothave a profound effect on the expression of innate im-mune genes upon stimulation in the airway epithelia.However, there may be other genes that are affected thatwere not investigated in this study. Pfeifer et al. recentlyshowed that IL-17C cytokine is expressed by human bron-chial epithelial cells and is induced by bacterial infection[47]. It may be worthwhile in future experiments to inves-tigate a broader range of immune-related genes. Interest-ingly, we did not observe changes to expression of thegenes reported by Miller et al., MMP-9, CCL-20, CXCL-10, CXCL-11, or IL-8. This variance may be explained bydifferences in experimental conditions. Our study exam-ined outcomes in gene expression after stimulation of cellsco-transfected with ORMDL3 and ORMDL3-specificsiRNA, while the other study used a different experimentalapproach.Although this study focused exclusively on the poten-tial role of ORMDL3 in asthma pathogenesis, it is pos-sible that neighboring genes such as GSDML contributeto disease susceptibility at this locus. Many groups con-sider ORMDL3 as an ‘asthma gene’; however, it shouldbe acknowledged that the identified SNPs associatingthis gene to asthma susceptibility are not located in thegene itself. Even so, these polymorphisms have beenconsistently correlated with increased odds of asthmarisk, highlighting the importance of this locus in diseasesusceptibility [6-11,13,14].Our data show that variation in ORMDL3 expression isnot correlated with differential innate immune responsesto stimuli or activation of the UPR in vitro in airway epi-thelial cells. Taken together, our results are biologicallyrelevant because they suggest that normal human vari-ation of ORMDL3 expression is not likely an importantfactor in increasing the innate immune response of airwaycells we observe in asthmatics. Despite these results, thisHsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 8 of 10http://www.aacijournal.com/content/9/1/4gene remains an important candidate for asthma suscepti-bility. More research is required to elucidate its role inasthma pathogenesis and its potential role as an initialtrigger of inflammation. By increasing our understandingof the mechanisms responsible for allergic and atopic dis-ease development, new treatments can then be developed.Thus, we can reduce inflammatory responses by targetingthe potential triggers, rather than the symptoms, of thedisease. In doing so, we will ultimately reduce the morbid-ity, mortality, and socio-economic burden of asthma andrelated allergic diseases.Additional filesAdditional file 1: Genes analyzed by PCR array.Additional file 2: Additional figures.Competing interestsThe authors declare that they have no competing interests.Authors’ contributionsKJH performed the research. All authors designed the research, analyzed thedata, and drafted the manuscript. Both authors read and approved the finalmanuscript.AcknowledgementsKJH was funded by the Child & Family Research Institute and AllerGenNetworks of Centers of Excellence. SET holds the Aubrey J TingleProfessorship in Pediatric Immunology and is a clinical scholar of the MichaelSmith Foundation for Health Research. This work was supported by fundingfrom the AllerGen Networks of Centers of Excellence.Received: 3 December 2012 Accepted: 7 January 2013Published: 1 February 2013References1. Cho SH: Pharmacogenomic approaches to asthma treatment. AllergyAsthma Immunol Res 2010, 2(3):177–182.2. Davies DE, Djukanovic R, Holgate ST: Application of functional genomicsto study of inflammatory airways disease. Thorax 1999, 54(1):79–81.3. Gu ML, Dong XQ, Zhao J: New insight into the genes susceptible toasthma. J Asthma 2010, 47(2):113–116.4. Ober C, Hoffjan S: Asthma genetics 2006: the long and winding road togene discovery. Genes Immun 2006, 7(2):p. 95–p. 100.5. Vercelli D: Discovering susceptibility genes for asthma and allergy.Nat Rev Immunol 2008, 8(3):169–182.6. Moffatt MF, et al: Genetic variants regulating ORMDL3 expressioncontribute to the risk of childhood asthma. Nature 2007,448(7152):470–473.7. Galanter J, et al: ORMDL3 gene is associated with asthma in threeethnically diverse populations. Am J Respir Crit Care Med 2008,177(11):1194–1200.8. Halapi E, et al: A sequence variant on 17q21 is associated with age atonset and severity of asthma. Eur J Hum Genet 2010, 18(8):902–908.9. Hirota T, et al: Genetic polymorphism regulating ORM1-like 3(Saccharomyces cerevisiae) expression is associated with childhoodatopic asthma in a Japanese population. J Allergy Clin Immunol 2008,121(3):769–770.10. Moffatt MF, et al: A large-scale, consortium-based genomewideassociation study of asthma. N Engl J Med 2010, 363(13):1211–1221.11. Ferreira MA, et al: Association between ORMDL3, IL1RL1 and a deletion onchromosome 17q21 with asthma risk in Australia. Eur J Hum Genet 2011,19(4):458–464.12. Sleiman PM, et al: ORMDL3 variants associated with asthma susceptibilityin North Americans of European ancestry. J Allergy Clin Immunol 2008,122(6):1225–1227.13. Tavendale R, et al: A polymorphism controlling ORMDL3 expression isassociated with asthma that is poorly controlled by current medications.J Allergy Clin Immunol 2008, 121(4):860–863.14. Wu H, et al: Genetic variation in ORM1-like 3 (ORMDL3) and gasdermin-like (GSDML) and childhood asthma. Allergy 2009, 64(4):629–635.15. Barrett JC, et al: Genome-wide association study and meta-analysis findthat over 40 loci affect risk of type 1 diabetes. Nat Genet 2009,41(6):703–707.16. Barrett JC, et al: Genome-wide association defines more than 30 distinctsusceptibility loci for Crohn’s disease. Nat Genet 2008, 40(8):955–962.17. Neurath MF, Finotto S, Glimcher LH: The role of Th1/Th2 polarization inmucosal immunity. Nat Med 2002, 8(6):567–573.18. Lluis A, et al: Asthma-associated polymorphisms in 17q21 influence cordblood ORMDL3 and GSDMA gene expression and IL-17 secretion.J Allergy Clin Immunol 2011, 127(6):p. 1587–p. 1594. e6.19. Jin R, et al: Mechanisms elevating ORMDL3 expression in recurrentwheeze patients: role of Ets-1, p300 and CREB. Int J Biochem Cell Biol2012, 44(7):1174–1183.20. Hjelmqvist L, et al: ORMDL proteins are a conserved new family ofendoplasmic reticulum membrane proteins. Genome Biol 2002,3(6):p. RESEARCH0027.21. Cantero-Recasens G, et al: The asthma-associated ORMDL3 gene productregulates endoplasmic reticulum-mediated calcium signaling andcellular stress. Hum Mol Genet 2009, 19(1):111–121.22. McGovern DP, et al: Genome-wide association identifies multipleulcerative colitis susceptibility loci. Nat Genet 2010, 42(4):332–337.23. Hotamisligil GS: Endoplasmic reticulum stress and the inflammatory basisof metabolic disease. Cell 2010, 140(6):900–917.24. McGuckin MA, et al: ER stress and the unfolded protein response inintestinal inflammation. Am J Physiol Gastrointest Liver Physiol 2010,298(6):G820–G832.25. Cullinan SB, Diehl JA: Coordination of ER and oxidative stress signaling:the PERK/Nrf2 signaling pathway. Int J Biochem Cell Biol 2006,38(3):317–332.26. Deng J, et al: Translational repression mediates activation of nuclearfactor kappa B by phosphorylated translation initiation factor 2. Mol CellBiol 2004, 24(23):10161–10168.27. Hu P, et al: Autocrine tumor necrosis factor alpha links endoplasmicreticulum stress to the membrane death receptor pathway throughIRE1alpha-mediated NF-kappaB activation and down-regulation ofTRAF2 expression. Mol Cell Biol 2006, 26(8):3071–3084.28. Miller M, et al: ORMDL3 is an inducible lung epithelial gene regulatingmetalloproteases, chemokines, OAS, and ATF6. Proc Natl Acad Sci USA2012, 109(41):16648–16653.29. Kim HY, DeKruyff RH, Umetsu DT: The many paths to asthma: phenotypeshaped by innate and adaptive immunity. Nat Immunol 2010, 11(7):577–584.30. Umetsu DT, et al: Asthma: an epidemic of dysregulated immunity. NatImmunol 2002, 3(8):715–720.31. Palmberg L, et al: Induction of IL-8 production in human alveolarmacrophages and human bronchial epithelial cells in vitro by swinedust. Thorax 1998, 53(4):260–264.32. Shanks KK, et al: Interleukin-8 production by human airway epithelial cellsin response to Pseudomonas aeruginosa clinical isolates expressing typea or type b flagellins. Clin Vaccine Immunol 2010, 17(8):1196–1202.33. Yang Y, et al: Regulation of interleukin-1beta and interleukin-1betainhibitor release by human airway epithelial cells. Eur Respir J 2004,24(3):360–366.34. Nagaraju K, et al: A variety of cytokines and immunologically relevantsurface molecules are expressed by normal human skeletal muscle cellsunder proinflammatory stimuli. Clin Exp Immunol 1998, 113(3):407–414.35. Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001, 29(9):e45.36. Isler JA, Skalet AH, Alwine JC: Human cytomegalovirus infection activatesand regulates the unfolded protein response. J Virol 2005, 79(11):6890–6899.37. Samali A, et al: Methods for monitoring endoplasmic reticulum stress andthe unfolded protein response. Int J Cell Biol 2010, 2010:830307.38. Lees CW, et al: New IBD genetics: common pathways with other diseases.Gut 2011, 60(12):1739–1753.39. Saleh NM, et al: Genetic association analyses of atopic illness andproinflammatory cytokine genes with type 1 diabetes. Diabetes Metab ResRev 2011, 27(8):838–843.Hsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 9 of 10http://www.aacijournal.com/content/9/1/440. Han S, et al: Orm1 and Orm2 are conserved endoplasmic reticulummembrane proteins regulating lipid homeostasis and protein qualitycontrol. Proc Natl Acad Sci USA 2010, 107(13):5851–5856.41. Broide DH, et al: Cytokines in symptomatic asthma airways. J Allergy ClinImmunol 1992, 89(5):958–967.42. Shi Y, et al: Role of GRP78/BiP degradation and ER stress indeoxynivalenol-induced interleukin-6 upregulation in the macrophage.Toxicol Sci 2009, 109(2):247–255.43. Ma Y, Hendershot LM: The stressful road to antibody secretion. NatImmunol 2003, 4(4):310–311.44. Hasnain SZ, et al: The interplay between endoplasmic reticulum stress andinflammation. Immunol Cell Biol 2012, 90(3):260–270.45. Adair-Kirk TL, Atkinson JJ, Senior RM: Smoke particulates stress lung cells.Nat Med 2008, 14(10):1024–1025.46. Paul WE, Zhu J: How are T(H)2-type immune responses initiated andamplified? Nat Rev Immunol 2010, 10(4):225–235.47. Pfeifer P, et al: IL-17C is a Mediator of Respiratory Epithelial InnateImmune Response. Am J Respir Cell Mol Biol 2012, [Epub ahead of print].doi:10.1186/1710-1492-9-4Cite this article as: Hsu and Turvey: Functional analysis of the impact ofORMDL3 expression on inflammation and activation of the unfoldedprotein response in human airway epithelial cells. Allergy, Asthma &Clinical Immunology 2013 9:4.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitHsu and Turvey Allergy, Asthma & Clinical Immunology 2013, 9:4 Page 10 of 10http://www.aacijournal.com/content/9/1/4

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0223652/manifest

Comment

Related Items