UBC Faculty Research and Publications

Androgen-regulated genes differentially modulated by the androgen receptor coactivator L-dopa decarboxylase… Margiotti, Katia; Wafa, Latif A; Cheng, Helen; Novelli, Giuseppe; Nelson, Colleen C; Rennie, Paul S Jun 6, 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12943_2007_Article_246.pdf [ 1.59MB ]
Metadata
JSON: 52383-1.0223608.json
JSON-LD: 52383-1.0223608-ld.json
RDF/XML (Pretty): 52383-1.0223608-rdf.xml
RDF/JSON: 52383-1.0223608-rdf.json
Turtle: 52383-1.0223608-turtle.txt
N-Triples: 52383-1.0223608-rdf-ntriples.txt
Original Record: 52383-1.0223608-source.json
Full Text
52383-1.0223608-fulltext.txt
Citation
52383-1.0223608.ris

Full Text

ralssBioMed CentMolecular CancerOpen AcceResearchAndrogen-regulated genes differentially modulated by the androgen receptor coactivator L-dopa decarboxylase in human prostate cancer cellsKatia Margiotti†2,3, Latif A Wafa†1,2, Helen Cheng2, Giuseppe Novelli3, Colleen C Nelson1,2 and Paul S Rennie*1,2Address: 1Department of Pathology and Laboratory Medicine, Faculty of Medicine, University of British Columbia, Vancouver, BC, V6T 2B5, Canada, 2The Prostate Centre at Vancouver General Hospital, 2660 Oak Street, V6H 3Z6, Vancouver, BC, Canada and 3Department of Biopathology and Diagnostic Imaging, Tor Vergata University of Rome, Viale Oxford, 81-00133, Rome, ItalyEmail: Katia Margiotti - katia.margiotti@vch.ca; Latif A Wafa - latif@interchange.ubc.ca; Helen Cheng - helen.cheng@vch.ca; Giuseppe Novelli - novelli@med.uniroma2.it; Colleen C Nelson - colleen.nelson@ubc.ca; Paul S Rennie* - prennie@interchange.ubc.ca* Corresponding author    †Equal contributorsAbstractBackground: The androgen receptor is a ligand-induced transcriptional factor, which plays animportant role in normal development of the prostate as well as in the progression of prostatecancer to a hormone refractory state. We previously reported the identification of a novel ARcoactivator protein, L-dopa decarboxylase (DDC), which can act at the cytoplasmic level toenhance AR activity. We have also shown that DDC is a neuroendocrine (NE) marker of prostatecancer and that its expression is increased after hormone-ablation therapy and progression toandrogen independence. In the present study, we generated tetracycline-inducible LNCaP-DDCprostate cancer stable cells to identify DDC downstream target genes by oligonucleotidemicroarray analysis.Results: Comparison of induced DDC overexpressing cells versus non-induced control cell linesrevealed a number of changes in the expression of androgen-regulated transcripts encodingproteins with a variety of molecular functions, including signal transduction, binding and catalyticactivities. There were a total of 35 differentially expressed genes, 25 up-regulated and 10 down-regulated, in the DDC overexpressing cell line. In particular, we found a well-known androgeninduced gene, TMEPAI, which wasup-regulated in DDC overexpressing cells, supporting its knownco-activation function. In addition, DDC also further augmented the transcriptional repressionfunction of AR for a subset of androgen-repressed genes. Changes in cellular gene transcriptiondetected by microarray analysis were confirmed for selected genes by quantitative real-time RT-PCR.Conclusion: Taken together, our results provide evidence for linking DDC action with ARsignaling, which may be important for orchestrating molecular changes responsible for prostatecancer progression.Published: 6 June 2007Molecular Cancer 2007, 6:38 doi:10.1186/1476-4598-6-38Received: 27 March 2007Accepted: 6 June 2007This article is available from: http://www.molecular-cancer.com/content/6/1/38© 2007 Margiotti et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 11(page number not for citation purposes)Molecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38BackgroundProstate cancer is the most commonly diagnosed invasivemale cancer in North America and in other Western coun-tries [1]. In most cases prostate cancer begins as an andro-gen-dependent tumor that undergoes clinical regressionin response to pharmacological and surgical strategies thatreduce testosterone concentration. This form of therapy isgenerally used to treat advanced cancer or those that recurafter radiation or surgical procedures to remove the pri-mary cancer. Despite androgen withdrawal therapy mostpatients develop lethal androgen-independent (AI)tumors [2,3]. At present, no effective therapy is availablefor this latter group of patients [4]. The underlying molec-ular mechanism involved in androgen-independent pros-tate cancer and the therapies aimed at this are the activeareas of current research.The actions of androgen within the prostate are mediatedby the androgen receptor (AR), a member of the nuclearreceptor family of ligand-activated transcription factors[5]. Upon binding hormone, AR binds to androgenresponse elements in androgen receptor-responsive pro-moters, recruits multiple coregulators, and activates tran-scription of androgen-regulated genes involved in cellgrowth and survival [4,6,7]. In the majority of AI tumors,AR continues to be expressed and seems to be activatedunder androgen-depleted conditions [8]. Alterations inAR or the AR signaling pathway are potential explanationsfor progression to androgen independence [9,10]. A largenumber of coactivators and corepressors involved in theregulation of AR-driven transcription have been identified[11]. They function as signaling intermediaries betweenAR and general transcriptional machinery. Furthermore,an increase in coactivator levels has been shown in AI dis-ease [12-16]. Coactivator proteins have been shown toenhance the activity of AR through a variety of mecha-nisms, including use of alternative ligands, sensitizationof the receptor to lower levels of androgens, and ligand-independent activation [14,17].Using the repressed transactivator (RTA) yeast two-hybridsystem, we previously identified a novel AR-coactivatorprotein, L-dopa decarboxylase (DDC) [18], also referredto as aromatic L-amino acid decarboxylase (AADC). DDCis responsible for decarboxylating both L-dopa and L-5-hydroxytryptophan into dopamine and serotonin, respec-tively [19]. The human gene encoding the L-dopa decar-boxylase enzyme, referred to as DDC, maps tochromosome band 7p11 and is composed of 15 exonsspread out over at least 85 kb of genomic DNA [20]. DDCis widely distributed in neural tissues, where it plays aneuron-specific role as a neurotransmitter biosyntheticenzyme, and in non-neuronal tissues (adrenals, kidney,undetermined functions [21]. Our recent studies using tis-sue microarrays and dual immunofluoresence indicatethat in prostate cancer, DDC is not only a neuroendocrine(NE) marker, but is also co-expressed with AR in a subsetof NE tumor cells [22]. DDC-positive prostate cancer cellsshow a dramatic increase in number after extended peri-ods of neoadjuvant hormone withdrawal (> 6 months)and in metastatic tumors that have progressed to the AIphenotype [22]. The enhancement of AR transactivationby DDC is likely restricted to the AR-positive subset of NEcells. The mechanism of DDC-mediated regulation of ARsignaling in prostate carcinogenesis remains unknown,but may involve sensitization of AR to limiting concentra-tion of androgen [18].In the past few years, newly developed technologies suchas gene microarrays [23] have enabled the determinationof molecular differences between normal and trans-formed cells at the genome wide-level. Microarrays havebeen used to study androgen regulated genes involved inthe development of prostate cancer [24], and to character-ize molecular function of AR or other steroid receptorinteracting proteins [25-27]. In particular, microarrayanalysis has been used to better define the molecular func-tion of Ebp1 protein, an AR corepressor [25], and to studyAIB1 protein, a steroid receptor coactivator [27], as well asto characterize a novel modulator of AR activity, the malegerm cell-associated kinase (MAK) [26]. These studies sug-gest that microarray analysis is a useful means for studyingthe effects on gene expression of steroid receptor interact-ing proteins. Here, in an effort to better understand themolecular function of DDC as a coactivator of AR-medi-ated signaling and to identify novel targets of prostate car-cinogenesis, we evaluated the effects of regulated DDCexpression in an inducible manner in LNCaP cells usinggene microarray analysis.ResultsInducible expression of DDC in LNCaP human prostate cancer cellsThe identification of AR-regulated genes that are affectedby DDC overexpression may provide important cluesregarding the biology of this catecholamine synthesisenzyme and its influence on AR function. Toward thisend, the change in gene expression of androgen-regulatedgenes caused by sustained DDC overexpression were ana-lyzed in vitro by the generation of LNCaP cells stablyexpressing Dox-inducible DDC. We used human andro-gen-dependent prostate cancer cells (LNCaP), since ourprimary goal was to assess the co-activation function ofDDC, known to enhance AR activity through an andro-gen-dependent mechanism [18]. To verify the effects ofDox treatment on expression of the DDC gene, LNCaPPage 2 of 11(page number not for citation purposes)liver, gastrointestinal tract and lungs), where it acts as anon-specific decarboxylating enzyme and may have othercells, stably expressing Dox-inducible DDC (LNCaP-DDC) or the vector control (LNCaP-pDEST) were treatedMolecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38for 48 hours under mock-induced (-Dox) and Dox-induced (+Dox) conditions. With Dox treatment, weobserved an optimal 6-fold increase in DDC protein levelswhen compared with mock-induced (-Dox) LNCaP-DDCcells. No detectable DDC protein was found under theDox-induced (+Dox) or mock-induced (-Dox) conditionin the LNCaP-pDEST cell line, confirming the fact thatendogenous DDC protein expression levels in this cellline are below detection when directly compared toectopic overexpression (Figure 1A) [18]. To investigate theextent of DDC overexpression at the RNA level, we com-pared by RT-PCR the mRNA levels in DDC overexpressingcells, with the vector control cells after Dox stimulation. Inthe LNCaP-DDC cells, higher levels of DDC mRNA wereobserved than in the vector control LNCaP-pDEST cells,where only a faint band was detected (Figure 1B).Influence of DDC on the androgen-regulated gene expression profileThe availability of the LNCaP-DDC cell line afforded usan opportunity to study the influence of DDC overexpres-sion on global gene expression using the Human Operon21 K oligonucleotide array. Our goal in this study was toidentify which genes among the AR-regulated genes, areaffected by DDC overexpression. We prepared total RNAfrom DDC overexpressing cells (LNCaP-DDC) and fromthe LNCaP control cell lines (LNCaP-DDC-Dox, LNCaP-pDEST- Dox, and LNCaP-pDEST+Dox) after 48 h treat-ment with or without Dox, 24 h of which was in the pres-ence or absence of R1881 synthetic hormone (Figure 2).Independent probe synthesis from different batches ofRNA and hybridizations were performed in duplicate. Toaccount for dye bias a dye swap was also performed. Toidentify the androgen-regulated genes in both LNCaP-DDC and LNCaP control cells, total RNA isolated fromhormone treated (+R1881) samples was combined withtotal RNA isolated from hormone-untreated (-R1881)samples and the relative abundance of each gene was cal-culated as a ratio between hormone-treated and hor-mone-untreated samples. The data set was normalized,and a filter was applied to select only those genes whoseexpression level was significant (p ≤ 0.05) in at least 1 outof the 2 conditions. A total of 3,127 genes were identified,and presented as a scatter correlation plot in Figure 3.Genes that showed significant expression levels across celltypes (p ≤ 0.05) were further analyzed to characterizethose genes whose expression levels were increased orrepressed by at least 2-fold during hormone treatment (±R1881). Genes showing an expression level > 0.5 and < 2were classified as unchanged and not considered further.In this study, we focused on those genes that were hor-mone up-or down-regulated in both LNCaP-DDC andLNCaP control cells.LNCaP-DDC cell line displays regulated DDC expression with Dox treatmentFigure 1LNCaP-DDC cell line displays regulated DDC expression with Dox treatment. Shown are the results from (A) Western blot and (B) semiquantitative RT-PCR analysis of the expression of DDC protein and mRNA, respectively. In A, LNCaP-DDC and LNCaP-pDEST (vector control) cells were treated for 48 hours under mock-induced (-Dox) and Dox-induced (+Dox) conditions before protein lysate preparation. No visible expression was detected in the LNCaP-pDEST con-trol cells regardless of Dox treatment status (lines 3–4). A 6 fold increased DDC expression level was detected in the Dox-induced LNCaP-DDC cells compared to the mock-induced cells (lines 1–2), after β-actin normalization. In B, total cellular RNA was isolated from LNCaP-DDC and LNCaP-pDEST cells after 48 hours of Dox treatment. After reverse transcription, PCR was performed with DDC and β-actin specific primers. The up-regulation of the 209-bp DDC-specific band was detected in LNCaP-DDC cells (line 2). A 100 bp DNA ladder (Promega) was used for size markers.A           B Page 3 of 11(page number not for citation purposes)Molecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38Among the androgen-regulated genes we identified, usingVenn diagram analysis, 130 genes that were androgen-reg-ulated in LNCaP-DDC and LNCaP control cells (Figure4A). The hormone induction response of these 130 geneswas substantiated by the altered expression of the classi-cally androgen-regulated genes, such as PSA, FKBP5,NKX3A, TMEPAI, KLK2, ODC1, and TMPRSS2 (data notshown). Comparison of LNCaP-DDC and LNCaP controlcells revealed a number of changes in the expression pro-file of these androgen-regulated genes. Out of the 130genes, 35 were differentially regulated as shown in TableDDC overexpression. In particular, among the set of 35genes, we could identify four different responses to hor-mone treatment and DDC overexpression: i) 2 genes werehormone and DDC up-regulated ii) 4 genes were hor-mone and DDC down-regulated iii) 23 genes were hor-mone down-regulated in control cells and hormone up-regulated in DDC overexpressing cells iv) 6 genes werehormone up-regulated in control cells and hormonedown-regulated in DDC overexpressing cells (Figure 4B).Gene ontology classification of these 35 differentiallyexpressed genes was performed by using GeneBank acces-sion number, Operon ID, and annotation tools databaseavailable on-line [28,29]. The gene sets were classifiedaccording to their putative main molecular function.While the list of 35 genes contained 15 unclassified tran-scripts, of the remaining 20, ontological molecular func-tion analyses revealed signal transducer, binding, andcatalytic activity as the predominant divergences betweenDDC overexpressing cells and controls (Table 1). Geneontology classifications with overlapping gene lists werecombined. The signal transducer classification definesMicroarray analysis of DDC-regulated genesFigure 2Microarray analysis of DDC-regulated genes. Experi-mental outline of microarray studies to identify DDC down-stream targets using LNCaP-DDC stable and control LNCaP-pDEST cells. In the presence of Dox (grey triangle, + Dox) the tetracycline Tet repressor (tetR) is released from the TetO2 sequence in the promoter of the lentiviral con-struct containing the DDC gene. The dissociation of the tetR allows induction of transcription for the gene of interest. LNCaP-DDC and LNCaP-pDEST (vector control) cell lines were plated in medium containing 5% charcoal-stripped serum and incubated overnight. The next day, cells were treated for 48 hours under mock-induced (-Dox) and Dox-induced (+Dox) conditions, 24 h of which was in the pres-ence or absence of 0.1 nM R1881. Total RNA samples were isolated from each condition, labeled and hybridized on the microarrays. The relative mRNA abundance of each gene was calculated as a ratio between hormone-treated (+R1881) and hormone-untreated (- R1881) samples. The comparison of the expression data obtained from LNCaP-DDC+Dox stable cells (left) with the expression data from the three LNCaP control cells (right: LNCaP-DDC-Dox, LNCaP-pDEST- Dox, and LNCaP-pDEST+Dox) yielded the identification of genes that are androgen- and DDC-regu-lated.Scatter plot of entire gene set considered expressed (p val-ues = 0.05) in the microarray analysisFigure 3Scatter plot of entire gene set considered expressed (p values = 0.05) in the microarray analysis. The posi-tion of each dot on the scatter plot corresponds to the nor-malized average signal intensity (log scale) of a single gene. The normalized average signal intensity under the DDC overexpression conditions are shown on the x and y axes (controls = no DDC overexpression and DDC = DDC over-expression). The middle line indicates values that represent a DDC/controls ratio of 1.0 (similar levels of expression in both cell lines). The outer lines represent a DDC/controls ratio of 2.0 (upper line; 2-fold greater expression in DDC compared to controls) and of 0.5 (lower line; 2-fold greater expression in controls compared to DDC).Page 4 of 11(page number not for citation purposes)1. Of these, 25 genes were up-regulated at least two foldand 10 were down-regulated by at least two fold withthose transcripts that mediate the transfer of a signal fromthe outside to the inside of a cell by a means other thanMolecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38the introduction of a signal molecule itself into the cell.The binding activity category defines those transcriptsencoding for proteins capable of selective, often stoichio-metric, interaction with one or more specific sites onanother protein. The catalytic activity group refers to thoseproteins able to perform the catalysis of a biochemicalreaction. Further annotation analysis of the transcriptsinvolved in signal transduction, subclassified four genesinto the G-protein-coupled receptors (GPCRs) signalingpathway (DRD3, PTGDR, GPR15, and GABRE). Interest-ingly, we found a 4.3-fold down-regulation of the DRD3gene in DDC overexpressing cells when compared withcontrols. The DRD3 gene encodes the D3 subtypedopamine receptor which binds dopamine, one of theenzymatic products of DDC [30]. The D3 receptor, alongwith the other GPCRs, are known to modulate a plethoraof signal transduction pathways that can cross-talk withknown AR activation pathways [4]. Among the genes up-regulated by DDC overexpression, there was a well estab-lished androgen regulated TMEPAI gene [31,32] (Table1). Another gene up-regulated by DDC overexpressionwas TGM2, which belongs to the transglutaminase(hTGP) enzyme family (EC 2.3.2.13) [33]. Interestingly,the expression of one of these family members, prostatetransglutaminase enzyme (TGM4), has been shown to beandrogen-regulated [34]. SYTL2 was among the androgendown-regulated genes, and has been previously shown tobe differentially regulated by AR reduction in prostatecancer cells [35]. Overall, our results indicated that 35genes were differentially expressed after induced overex-pression of DDC in LNCaP cells, including genes knownto be up- or down-regulated by AR.Verification of microarray results by quantitative RT-PCRTo verify the results of our microarray analyses, weselected seven representative genes from the list in Table 1and determined their expression profiles by quantitativereal-time RT-PCR. TMEPAI, SYTL2, TGM2, DRD3, andPTGDR were chosen because of the above consideration,whereas UNC5C and YME1L1 genes were selected basedon the large magnitude of change (Table 1) and GAPDHwas used as an endogenous control. The same RNA sam-ples used for the microarray hybridization were exam-ined. For simplicity we did not consider the mock-induced (-Dox) samples, but compared the RNA extractedfrom LNCaP-DDC Dox-induced cells (+Dox) versus theRNA extracted from the empty vector LNCaP-pDEST Dox-induced cells (+Dox). Although the magnitudes of up-ordown-regulation of the TMEPAI, SYTL2, TGM2, DRD3,YME1L1 and PTGDR genes in the array analysis were dif-ferent than that observed by real time RT-PCR, there wasa similar trend in the changes with respect to both R1881treatment and DDC overexpression (Table 2). A constantTable 1: Differentially expressed genes in response to DDC overexpression*. The genes shown here are those whose expressions are increased (≥ 2) or decreased (≤ -2).Genbank Acc Gene Symbol & Name DDC/CTRLsBindingBC016658 E2F7; E2F transcription factor 7 -13.60AK024500 MICAL1; microtubule associated monoxygenase+7.92BC009212 MTA1; metastasis associated 1 +9.50NM_032943 SYTL2; synaptotagmin-like 2 -2.02AK027128 ZNF277; zinc finger protein 277 -3.88AK054916 ZNF333; zinc finger protein 333 +4.67AK056666 ZNF488; zinc finger protein 488 +6.76Binding and catalytic activityNM_019885 CYP26B1; cytochrome P450, family 26, subfamily B, polypeptide 1+4.29NM_022819 PLA2G2F; phospholipase A2, group IIF+30.10NM_004613 TGM2; transglutaminase 2 +2.10AK022930 YME1L1; YME1-like 1 (S. cerevisiae)+21.40Binding and signal transducer activityNM_000796 DRD3; dopamine receptor D3 -4.28U92285 GABRE;Gamma-aminobutyric acid (GABA) A receptor, epsilon+10.02NM_004532 MUC4; mucin 4, tracheobronchial -6.39AF070577 OPCML; opioid binding protein/cell adhesion molecule-like-3.87NM_003728 UNC5C; unc-5 homolog C (C. elegans)+18.48Catalytic activityAK055136 C2orf11; chromosome 2 open reading frame 11+5.79AK054688 PON2; paraoxonase 2 +6.99Signal transducer activityNM_005290 GPR15; G protein-coupled receptor 15+7.47AK026202 PTGDR; prostaglandin D2 receptor (DP)+5.26UnclassifiedAL110152 CD109; CD109 antigen (Gov platelet alloantigens)+6.20NM_006408 AGR2; anterior gradient 2 homolog (Xenopus laevis)-5.31NM_004312 ARR3; arrestin 3, retinal (X-arrestin) -8.08NM_032149 C4orf17; chromosome 4 open reading frame 17-6.81AK024536 CADPS; Ca2+-dependent secretion activator+8.45BC015117 DEPDC4; DEP domain containing 4 +7.83AK057372 FLJ32810; hypothetical protein FLJ32810-14.32AF305616 TMEPAI; transmembrane, prostate androgen induced RNA+2.06AK025272 Unkown +15.27AK021730 Unkown +31.81AF130053 Unkown +23.33AL080106 Unkown +4.04AK021569 Unkown +16.22AK001133 Unkown +7.59AK055083 Unkown +6.91Page 5 of 11(page number not for citation purposes)level of GAPDH was observed. Unfortunately no volubletemplate was obtained for the UNC5C gene. Overall, the*Bold indicated genes investigated further by RT-PCRMolecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38above results verify the data observed in our microarraystudies.DiscussionOur laboratory has shown that DDC is a coactivator of AR[18] and a neuroendocrine marker of prostate cancer thatincreases in expression during hormone-ablation therapyand after progression to AI [22]. Coregulator proteins playa crucial role in modulating transactivation of AR andconsequently may be important in regulating aberrantactivity of AR during prostate cancer progression. In thisstudy, we explored the effect of overexpression of DDC onthe gene expression profile of an androgen-dependentprostate cancer cell line. We employed a tetracycline-regu-an oligonucleotide array with 21 K individual humangenes. In particular, we first selected a list of genes thatwere androgen-regulated regardless of DDC status. To thisend, in both DDC overexpressing and control cells, weselected all the genes that were significantly expressed (p ≤0.05) and which displayed at least a 2 fold increased ordecreased expression due to hormone treatment (±R1881). Our interest was then focused on the identifica-tion of those genes that were differentially regulated byDDC overexpression.Comparison of DDC overexpressing cells (LNCaP-DDC)versus controls cells revealed a number of changes in theexpression of androgen-regulated transcripts encodingAndrogen-regulated and DDC-regulated genesFigure 4Androgen-regulated and DDC-regulated genes. A) A Venn diagram analysis showing in yellow, the genes (130) with two fold induction in response to R1881 treatment in DDC overexpressing and control cells. The genes up- and down-regu-lated only in DDC overexpressing cells are represented in red (DDC; left) and the genes up- and down-regulated only in the control cells are represented in the green (controls; right). B) Reported here are 35 androgen-regulated genes differentially expressed at least 2-fold in DDC overexpressing cells (LNCaP-DDC) compared with the controls cells (LNCaP-CTRLs). The colors represent the ratio of gene expression levels in each cell line after R1881 treatment (red = hormone up-regulated and green = hormone down-regulated).Page 6 of 11(page number not for citation purposes)lated system to inducibly overexpress DDC and screen forpotential downstream target genes in LNCaP cells usingproteins with a variety of molecular functions, includingsignal transduction, binding and catalytic activities.Molecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38Although the classically androgen-regulated gene, pros-tate-specific antigen (PSA), was on the chip and was foundin the hormone up-regulated genes group, it did not showany significant difference in gene expression levels whenDDC was overexpressed. This may be due to the possibil-ity that PSA expression is not DDC-specific or long-term(> 2 days) overexpression of DDC, may be required toincrease PSA expression. This was not entirely unexpectedsince most classical coactivators, such as SRC/p160 familymembers, have not been reported to increase androgen-induced expression of endogenous PSA in LNCaP cells.In this study, 25 up-regulated and 10 down-regulatedgenes were identified in DDC overexpressing cells com-pared with control cells (Table 1). Real-time RT-PCR con-firmed and validated the microarray gene expression data.The difference in magnitude observed between microarrayfindings and quantitative RT-PCR is likely due to differenttechnique efficiency and/or primers specificity (Table 2).Among the genes that were hormone and DDC up-regu-lated, there was a well established androgen regulatedgene,TMEPAI [31]. In a previous study, evaluation ofTMEPAI (also referred to as PMEPA1) expression inLNCaP cells demonstrated induction by androgen in atime- and dose-dependent manner. Interestingly, theauthors also showed that TMEPAI was overexpressed in AItumors when compared with androgen sensitive tumors[31]. Another gene found to be hormone and DDC up-regulated is the TGM2 gene, which belongs to the trans-glutaminases (TGases) family (EC 2.3.2.13) [33]. Thetransglutaminases are calcium-dependent enzymes cata-lyzing the post-translational cross-linking of proteins.Even though no direct androgen regulation has beenreported for the TGM2 gene, another transglutaminaseenzyme (TGM4) has been found to be androgen regulatedin human prostate cancer cell lines [34]. Androgen andDDC induced expression of TMEPAI and TGM2 may rep-resent direct evidence of the androgen-dependent co-acti-vation function of DDC on AR.Among the hormone and DDC down-regulated genes wasthe SYTL2 gene, which was previously shown to be posi-tively regulated by AR reduction in androgen-ablatedprostate cancer cells [35]. In particular, a 2 fold up-regula-tion of the SYTL2 gene was found after 48 h reduction ofAR [35], demonstrating that SYTL2 is normally an andro-gen-repressed gene. In our study, overexpression of DDCfurther reduced the expression of SYTL2, suggesting thatthis AR-binding protein may also augment the repressivetranscriptional function of AR. The SYTL2 gene encodesfor the vesicular transport protein synaptotagmin 2,which regulates exocytosis of synaptic vesicles andappears to serve as a calcium sensor to trigger neurotrans-mitter release [36]. A possible explanation of this findingcould be related to the increased synthesis of neurotrans-mitters produced by DDC inside the cell, and subsequentnegative feedback on these vesicular transporter relatedproteins.Among the genes differentially regulated in DDC overex-pressing cells, were four genes encoding GPCR proteins(DRD3, PTGDR, GPR15, and GABRE). The GPCRs sharesignificant structural homology [37,38] and are known tomodulate numerous of signal transduction pathways thatcan cross-talk with known AR activation pathways [4]. Ageneral model for GPCR activity has been postulatedwhere GPCRs are in equilibrium between active and inac-tive states, and that interaction with a GPCR agonist, sta-bilizes a conformational change in these receptors whichin turn promote signal generation inside the cell [39].Recently, it has been shown that transition of prostatecancer to the AI stage is associated with increased expres-sion of GPCRs [40-42]. Furthermore, in vitro stimulationof endogenous GPCRs (e.g. LPA, B1R) induces mitogenicsignaling and growth of AI prostate cancer [42-44]. Pros-tate cancers also express elevated levels of GPCR ligands,which may contribute to progression of disease[40,41,45]. Therapies targeting GPCRs represent the sin-gle largest drug class [46], suggesting that they may beeffective in limiting pathologic growth of the prostate.Table 2: Confirmation of microarray findings by real-time RT-PCR*R1881 ± R1881 ± Symbol ARRAY DDC ARRAY controls RT-PCR DDC RT-PCR control ARRAY DDC/controls RT-PCR DDC/controlTGM2 4.7 2.2 36.7 25.2 +2.1 +1.5TMEPAI 4.8 2.3 17.8 10.6 +2.1 +1.7PTGDR 2.2 0.4 1.5 0.5 +5.3 +3.0YME1L1 2.6 0.1 1.3 0.8 +21.4 +2.5SYTL2 0.3 0.5 0.2 0.3 - 2.0 - 1.5DRD3 0.1 0.3 0.5 0.9 - 4.3 - 1.8Page 7 of 11(page number not for citation purposes)* In bold are represented the fold changes of hormone up-regulated genes and in italic the fold changes of hormone down-regulated genes, after R1881 treatment. The symbols +/- indicate the fold induction (+) or repression (-) due to DDC overexpression.Molecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38Further studies are required to establish any relationshipsbetween prostate cancer progression and increased expres-sion levels of PTGDR, GPR15, and GABRE genes. In con-trast, the DRD3 gene was found to be down-regulated inDDC overexpressing cells when compared with controlcells. The DRD3 gene encodes the D3 subtype dopaminereceptor for which the DDC neurotransmitter product,dopamine, is an agonist. D3 receptor is classified as amember of the D2-like dopamine receptor family, whichalso includes the D2 and D4 dopamine receptor subtypes[47,48]. Interestingly, it has been shown that D2-likereceptors can modulate many signal transduction path-ways (e.g. MAPK, PKA, PKC) [49-51] that are also knownto stimulate AR activation [4,52,53]. Altered regulation ofthis receptor in prostate cancer cells could lead to indirectactivation of the AR signaling pathway. Since D2-likereceptors can mediate inhibition of cAMP and PKA signal-ing [51], one can speculate that in the presence ofdopamine, decreased expression of the D3 receptor sub-type could reduce its inhibitory effect on the cAMP andPKA pathways when DDC is overexpressed. This mayresult in high level activation of PKA signaling that canenhance AR activity [4]. Overall, the altered expression ofGPCRs by DDC may result in increased mitogenesis andgrowth of prostate tumors.ConclusionThis study demonstrates that overexpression of the DDCgene in the LNCaP cells leads to differential expression ofa total of 35 genes. More detailed studies examining theassociation between the AR-DDC interaction and thesegenes are necessary to better understand the functionalrelationships. Potentially all these putative hormone-reg-ulated genes are directly or indirectly downstream targetsof DDC and they may be important for orchestration ofmolecular changes that are responsible for prostate cancerprogression. Also since DDC expression increases withlong-term neo-adjuvant hormone therapy (> 6 months)and in metastatic tumors that have progressed to the AIphenotype [22], future studies could utilize castratedpotential effects of DDC on the expression profile of genesassociated with growth, regression, and progression to AI.MethodsLNCaP cells expressing tetracycline-inducible DDCLNCaP cells stably expressing tetracycline-inducible DDC(LNCaP-DDC) were generated using ViraPower T-RExLentiviral Expression System and Gateway Technologyvectors, according to the manufacturer's protocol (Invitro-gen) (Wafa LA, 2007 manuscript in preparation). Briefly, 3μg of each lentiviral vector, pLenti4/TO/V5-DEST carryingthe DDC gene or the empty vector pLenti4/TO/V5-DESTand the pLenti6/TR containing the TetR gene, togetherwith 9 μg of the ViraPower packaging mix, were trans-fected into 293T cells, using Lipofectamine 2000 reagent(Invitrogen, Carlsbad, CA). The DNA- Lipofectamine2000 complexes diluted in Opti-MEM I Medium (Gibco-BRL) were allowed to form for 20 min at room tempera-ture before addition to 293T cells. Cells were maintainedfor 24 hours at 37°C and 5% CO2 before removing themedia containing the DNA-Lipofectamine 2000 com-plexes and replacing with DMEM media (10% FBS, 2 mML-glutamine, 0.1 mM MEM Non-Essential Amino Acids,1% penicillin/streptomycin, and 1 mM MEM SodiumPyruvate).Resulting retroviral particles were harvested by removingmedium 72 hours after transfection and used to generatea stably co-transduced LNCaP cell lines. Two cell lineswere created: the LNCaP-DDC line, which expresses tetra-cycline-inducible DDC, and the LNCaP-pDEST line,which contains the empty vector control and the tetRgene. To induce tetracycline-regulated DDC expression 1μg/ml of doxycycline hyclate (Dox) (Sigma-Aldrich) wasadded to the cell culture media.RNA isolation and expression profilingLNCaP-DDC, and LNCaP-pDEST cell lines were plated in10-cm plates (2 × 106 per plate) in RPMI 1640 containing5% charcoal-stripped serum (CSS; HyClone, VWR, WestTable 3: Primers for real time RT-PCR analysisGene Forward primer Reverse primerTMEPAI TGCCGTTCCATCCTGGTT AGACAGTGACAAGGCTAGAGAAAGCYME1L1 GAGCTTGGACACAACCGATAACT CCGCAGTGTACAGGGATTGASYTL2 TCTGCCTTGAGAAAACAAACAGTT GCCAGTGGGTGGCACTAAAAUNC5C GGCCGTCCAGGTGAATCA TGCATTCTTGCCTGTGAAGTGTGM2 TCTCTGGGCCTTTGTTTCCTT GATCCTTGGAGATGAGCTGGTTPTGDR TCAGGACTCCAAGGTGCAAAG TCTGGCTGGAGGTCTTGAGATCDRD3 GAATTCCCTGAGTCCCACCAT CCATTGCTGAGTTTTCGAACTTCGAPDH GAAGGTGAAGGTCGGAGT GAAGATGGTGATGGGATTTCPage 8 of 11(page number not for citation purposes)(hormone-deprived) mice in the LNCaP xenograft modelas an in vivo experimental system for monitoring theChester, PA). When the cells reached 60% confluence,they were seeded in presence of 1 μg/ml of Dox (Dox-Molecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38induced) or in the absence of Dox (mock-induced). After24 hours the cells were stimulated with or without 0.1 nMof synthetic androgen (± R1881) for an additional 24hours. Total RNA was extracted using Trizol reagent by fol-lowing the manufacturer's instructions (Invitrogen). TotalRNA from each hormone-treated sample (+R1881) wascompared with that of hormone-untreated sample (-R1881) on the same microarray slide. Two independentbiological replicates were assayed for each sample and adye swap was performed to account for dye bias. Microar-rays of 21,521 (70-mer) human oligos representing21,521 genes (Operon Technologies, Inc., Alameda, CA)printed on aminosilane coated microarray slides (MatrixTechnologies; Hudson, NH) were supplied by the ArrayFacility of The Prostate Centre at Vancouver General Hos-pital. Microarrays were hybridized with 10 μg of total RNAfrom duplicate samples of LNCaP-DDC or LNCaP-pDESTcells treated with or without (±) Dox, and with or without(±) R1881, using the 3DNA Array 350™ Expression ArrayDetection Kit and according to the manufacturer's instruc-tions (Genisphere, Hatfield, PA) (Figure 2). The arrayswere immediately scanned on a Scan Array Express Micro-array Scanner (Perkin Elmer). Signal quality and quantitywere assessed using ImaGene 7.0 software (BioDiscovery,San Diego, CA).Western blot analysisThe DDC antibody was purchased from Chemicon(Chemicon Inc., Temecula, CA) and the polyclonal anti-body to actin was obtained from Sigma (Sigma ChemicalCo., St. Louis, MO). LNCaP-DDC and LNCaP-pDEST cellswere plated in six-well plates (3 × 105 per well), treatedwith Dox as described above and immunoblotted as pre-viously reported [18]. Total cell protein (50 μg), measuredby BCA™ Protein Assay (PIRCE, Rockford, IL), was usedfor immunoblotting. Band intensity was quantified usinga Bio-Rad Gel Doc 2000 software (Bio-Rad Laboratories,USA).Bioinformatics analysisRaw signal data files obtained with ImaGene 7.0 softwarewere subsequently analyzed on GeneSpring 7.2 software(Silicon Genetics, Redwood City, CA) for profiling signifi-cant changes in gene expression. The fluorescent signal ratios(+R1881/-R1881) were subjected to Lowess normalizationwith background correction. Experimental error was basedon replicated dye pair values. Comparison analysis of thegene expression data from LNCaP-DDC+Dox cells, andLNCaP-DDC-Dox, LNCaP-pDEST-Dox, and LNCaP-pDEST+Dox cells, treated with or without R1881, was con-ducted to first identify androgen-regulated genes in all exper-imental conditions, and then the differentially regulatedgenes due to DDC overexpression.Only genes with a p value of ≤ 0.05 in at least one out of twoconditions were analyzed further. Data was transformed toa normalized expression value ≥ 2 or ≤ 0.5 were classified asandrogen up- or down-regulated, respectively. Genes show-ing a normalized expression value between 0.5- and 2- wereclassified as unchanged and not considered further. Lists ofandrogen-regulated genes (both up-regulated and down-reg-ulated) were created for each of the cell lines and were com-pared by Venn diagram analysis. Genes were considereddifferentially expressed as a result of DDC overexpression ifnormalized values from induced LNCaP-DDC cells were atleast 2-fold greater or 2-fold less than those from the controlcells (LNCaP-DDC-Dox, LNCaP-pDEST- Dox, and LNCaP-pDEST+Dox). Functional classifications were based on geneontology (GO) annotation obtained through the GeneToolsdatabase [28,29].Real-time quantitative RT-PCR and semiquantitative RT-PCRComplementary DNA (cDNA) for real time PCR and sem-iquantitative RT-PCR was made using 2 μg of total RNAtreated with RNase-free DNase according to the manufac-turer's instructions (Promega). First-strand cDNA was syn-thesized using random hexamers (Perkin-Elmer AppliedBiosystems, Branchburg, NJ) with 20U of Moloneymurineleukemia virus reverse transcriptase, M-MLV (Invitrogen).The ABI PRISM 7700 Sequence Detection System (Perkin-Elmer Applied Biosystems, Foster City, CA) was used forreal time monitoring of PCR amplification of cDNA. Theforward and reverse primers used for the real time RT-PCRare listed in Table 3. All primers were selected by PRIMEREXPRESS v.3 software and were commercially synthesizedby Integrated DNA Technologies laboratories (IDT, Cor-alville IA). A SYBR green PCR kit was used following themanufacturer's instructions and the analyses were per-formed in triplicate (Invitrogen). In brief, RT-PCR ampli-fication mixtures (25 μl) containing 25 ng templatecDNA, 2x SYBR Green I Master Mix buffer (12.5 μl), and300 nM forward and reverse primer was prepared. TargetmRNA values were normalized using GAPDH mRNA asan internal control. A comparative threshold cycle (Ct)was used to determine gene expression relative to a cali-brator. For each sample, the Ct values were calculatedusing the formula ΔCT = Ct sample- Ct GAPDH. To determinerelative expression levels, the following formula was usedΔΔCT = ΔCT sample- ΔCT calibrator and the value used to indi-cate relative gene expression was calculated using the for-mula 2-ΔΔCT. Primers for the semiquantitative PCR weresynthesized by Integrated DNA Technologies laboratories(IDT, Coralville IA); DDC, sense 5'- ACA CCA TGA ACGCAA GTG AA-3' and antisense 5'- CAC CCC AGG CATGAT TAT CT-3'. The PCR products (209 bp) were resolvedby electrophoresis using 1.5% agarose gels containingethidium bromide.Competing interestsThe author(s) declare that they have no competing inter-ests.Page 9 of 11(page number not for citation purposes)log ratio (Log10) for display and analysis. All genes showingMolecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/38Authors' contributionsK.M. performed the study and drafted the manuscript;L.A.W. helped to design the study and to draft the manu-script; H.C. helped to perform the study; G.N. criticallycommented on the drafted manuscript; C.C.N partici-pated in the design of the study and critically commentedon the drafted manuscript; P.S.R. provided overall direc-tion for the project and revised the final version of themanuscript; G.N., C.C.N., and P.S.R obtained funding forthe project. All authors read and approved the final man-uscript.AcknowledgementsWe thank Robert Bell for assistance with gene expression data analysis and Anne Haegert for technical assistance with the microarray experiments. This work was supported by the Canadian Cancer Society and the National Cancer Institute of Canada (NCIC), and in part by funds from AIRC (Asso-ciazione Italiana per la Ricerca sul Cancro) Regional Grant to G.N.References1. Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, FeuerEJ, Thun MJ: Cancer statistics, 2005.  CA Cancer J Clin 2005,55(1):10-30.2. Klotz L: Hormone therapy for patients with prostate carci-noma.  Cancer 2000, 88(12 Suppl):3009-3014.3. Long RJ, Roberts KP, Wilson MJ, Ercole CJ, Pryor JL: Prostate can-cer: a clinical and basic science review.  J Androl 1997,18(1):15-20.4. Feldman BJ, Feldman D: The development of androgen-inde-pendent prostate cancer.  Nat Rev Cancer 2001, 1(1):34-45.5. Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Ber-revoets CA, Trapman J: Mechanisms of androgen receptor acti-vation and function.  J Steroid Biochem Mol Biol 1999, 69:307-313.6. Alen P, Claessens F, Verhoeven G, Rombauts W, Peeters B: Theandrogen receptor amino-terminal domain plays a key rolein p160 coactivator-stimulated gene transcription.  Mol CellBiol 1999, 19(9):6085-6097.7. McKenna NJ, O'Malley BW: Combinatorial control of geneexpression by nuclear receptors and coregulators.  Cell 2002,108(4):465-474.8. Chen CD, Welsbie DS, Tran C, Baek SH, Chen R, Vessella R, Rosen-feld MG, Sawyers CL: Molecular determinants of resistance toantiandrogen therapy.  Nat Med 2004, 10(1):33-39.9. Koivisto P, Kononen J, Palmberg C, Tammela T, Hyytinen E, Isola J,Trapman J, Cleutjens K, Noordzij A, Visakorpi T, Kallioniemi OP:Androgen receptor gene amplification: a possible molecularmechanism for androgen deprivation therapy failure in pros-tate cancer.  Cancer Res 1997, 57(2):314-319.10. Miyamoto H, Yeh S, Wilding G, Chang C: Promotion of agonistactivity of antiandrogens by the androgen receptor coactiva-tor, ARA70, in human prostate cancer DU145 cells.  Proc NatlAcad Sci U S A 1998, 95(13):7379-7384.11. Janne OA, Moilanen AM, Poukka H, Rouleau N, Karvonen U, KotajaN, Hakli M, Palvimo JJ: Androgen-receptor-interacting nuclearproteins.  Biochem Soc Trans 2000, 28(4):401-405.12. Ngan ES, Hashimoto Y, Ma ZQ, Tsai MJ, Tsai SY: Overexpressionof Cdc25B, an androgen receptor coactivator, in prostatecancer.  Oncogene 2003, 22(5):734-739.13. Fujimoto N, Yeh S, Kang HY, Inui S, Chang HC, Mizokami A, ChangC: Cloning and characterization of androgen receptor coac-tivator, ARA55, in human prostate.  J Biol Chem 1999,274(12):8316-8321.14. Gregory CW, He B, Johnson RT, Ford OH, Mohler JL, French FS, Wil-son EM: A mechanism for androgen receptor-mediated pros-tate cancer recurrence after androgen deprivation therapy.Cancer Res 2001, 61(11):4315-4319.15. Debes JD, Sebo TJ, Lohse CM, Murphy LM, Haugen DA, Tindall DJ:16. Comuzzi B, Lambrinidis L, Rogatsch H, Godoy-Tundidor S, KnezevicN, Krhen I, Marekovic Z, Bartsch G, Klocker H, Hobisch A, Culig Z:The transcriptional co-activator cAMP response element-binding protein-binding protein is expressed in prostate can-cer and enhances androgen- and anti-androgen-inducedandrogen receptor function.  Am J Pathol 2003, 162(1):233-241.17. Scher HI, Sawyers CL: Biology of progressive, castration-resist-ant prostate cancer: directed therapies targeting the andro-gen-receptor signaling axis.  J Clin Oncol 2005, 23(32):8253-8261.18. Wafa LA, Cheng H, Rao MA, Nelson CC, Cox M, Hirst M, SadowskiI, Rennie PS: Isolation and identification of L-dopa decarboxy-lase as a protein that binds to and enhances transcriptionalactivity of the androgen receptor using the repressed trans-activator yeast two-hybrid system.  Biochem J 2003, 375(Pt2):373-383.19. Berry MD, Juorio AV, Li XM, Boulton AA: Aromatic L-amino aciddecarboxylase: a neglected and misunderstood enzyme.Neurochem Res 1996, 21(9):1075-1087.20. Craig SP, Thai AL, Weber M, Craig IW: Localisation of the genefor human aromatic L-amino acid decarboxylase (DDC) tochromosome 7p13-->p11 by in situ hybridisation.  CytogenetCell Genet 1992, 61(2):114-116.21. Zhu MY, Juorio AV: Aromatic L-amino acid decarboxylase: bio-logical characterization and functional role.  Gen Pharmacol1995, 26(4):681-696.22. Wafa LA, Palmer J, Fazli L, Hurtado-Coll A, Bell RH, Nelson CC,Gleave ME, Cox ME, Rennie PS: Comprehensive expression anal-ysis of l-dopa decarboxylase and established neuroendocrinemarkers in neoadjuvant hormone-treated versus varyingGleason grade prostate tumors.  Hum Pathol 2007,38(1):161-170.23. Schena M, Shalon D, Davis RW, Brown PO: Quantitative monitor-ing of gene expression patterns with a complementary DNAmicroarray.  Science 1995, 270(5235):467-470.24. Velasco AM, Gillis KA, Li Y, Brown EL, Sadler TM, Achilleos M,Greenberger LM, Frost P, Bai W, Zhang Y: Identification and vali-dation of novel androgen-regulated genes in prostate can-cer.  Endocrinology 2004, 145(8):3913-3924.25. Zhang Y, Akinmade D, Hamburger AW: The ErbB3 binding pro-tein Ebp1 interacts with Sin3A to repress E2F1 and AR-mediated transcription.  Nucleic Acids Res 2005,33(18):6024-6033.26. Ma AH, Xia L, Desai SJ, Boucher DL, Guan Y, Shih HM, Shi XB,Devere White RW, Chen HW, Tepper CG, Kung HJ: Male GermCell-Associated Kinase, a Male-Specific Kinase Regulated byAndrogen, Is a Coactivator of Androgen Receptor in Pros-tate Cancer Cells.  Cancer Res 2006, 66(17):8439-8447.27. Yan J, Yu CT, Ozen M, Ittmann M, Tsai SY, Tsai MJ: Steroid recep-tor coactivator-3 and activator protein-1 coordinately regu-late the transcription of components of the insulin-likegrowth factor/AKT signaling pathway.  Cancer Res 2006,66(22):11039-11046.28. Beisvag V, Junge FK, Bergum H, Jolsum L, Lydersen S, Gunther CC,Ramampiaro H, Langaas M, Sandvik AK, Laegreid A: GeneTools--application for functional annotation and statistical hypothe-sis testing.  BMC Bioinformatics 2006, 7:470.29. GeneTools:  [http://www.genetools.no].30. Sokoloff P, Giros B, Martres MP, Bouthenet ML, Schwartz JC: Molec-ular cloning and characterization of a novel dopamine recep-tor (D3) as a target for neuroleptics.  Nature 1990,347(6289):146-151.31. Xu LL, Shanmugam N, Segawa T, Sesterhenn IA, McLeod DG, MoulJW, Srivastava S: A novel androgen-regulated gene, PMEPA1,located on chromosome 20q13 exhibits high level expressionin prostate.  Genomics 2000, 66(3):257-263.32. Rae FK, Hooper JD, Nicol DL, Clements JA: Characterization of anovel gene, STAG1/PMEPA1, upregulated in renal cell carci-noma and other solid tumors.  Mol Carcinog 2001, 32(1):44-53.33. Wang M, Kim IG, Steinert PM, McBride OW: Assignment of thehuman transglutaminase 2 (TGM2) and transglutaminase 3(TGM3) genes to chromosome 20q11.2.  Genomics 1994,23(3):721-722.34. Dubbink HJ, Verkaik NS, Faber PW, Trapman J, Schroder FH, RomijnJC: Tissue specific and androgen-regulated expression ofPage 10 of 11(page number not for citation purposes)p300 in prostate cancer proliferation and progression.  CancerRes 2003, 63(22):7638-7640.human prostate-specific transglutaminase.  Biochem J 1996,315 ( Pt 3):901-908.Publish with BioMed Central   and  every scientist can read your work free of charge"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."Sir Paul Nurse, Cancer Research UKYour research papers will be:available free of charge to the entire biomedical communitypeer reviewed and published immediately upon acceptancecited in PubMed and archived on PubMed Central Molecular Cancer 2007, 6:38 http://www.molecular-cancer.com/content/6/1/3835. Haag P, Bektic J, Bartsch G, Klocker H, Eder IE: Androgen receptordown regulation by small interference RNA induces cellgrowth inhibition in androgen sensitive as well as in andro-gen independent prostate cancer cells.  J Steroid Biochem Mol Biol2005, 96(3-4):251-258.36. Geppert M, Archer BT 3rd, Sudhof TC: Synaptotagmin II. A noveldifferentially distributed form of synaptotagmin.  J Biol Chem1991, 266(21):13548-13552.37. Lania AG, Mantovani G, Spada A: Mechanisms of disease: Muta-tions of G proteins and G-protein-coupled receptors in endo-crine diseases.  Nat Clin Pract Endocrinol Metab 2006, 2(12):681-693.38. Hollmann MW, Strumper D, Herroeder S, Durieux ME: Receptors,G proteins, and their interactions.  Anesthesiology 2005,103(5):1066-1078.39. Perez DM, Karnik SS: Multiple signaling states of G-protein-coupled receptors.  Pharmacol Rev 2005, 57(2):147-161.40. Daaka Y: G proteins in cancer: the prostate cancer paradigm.Sci STKE 2004, 2004(216):re2.41. Nelson JB, Nabulsi AA, Vogelzang NJ, Breul J, Zonnenberg BA, DalianiDD, Schulman CC, Carducci MA: Suppression of prostate cancerinduced bone remodeling by the endothelin receptor Aantagonist atrasentan.  J Urol 2003, 169(3):1143-1149.42. Taub JS, Guo R, Leeb-Lundberg LM, Madden JF, Daaka Y: Bradykininreceptor subtype 1 expression and function in prostate can-cer.  Cancer Res 2003, 63(9):2037-2041.43. Kue PF, Taub JS, Harrington LB, Polakiewicz RD, Ullrich A, Daaka Y:Lysophosphatidic acid-regulated mitogenic ERK signaling inandrogen-insensitive prostate cancer PC-3 cells.  Int J Cancer2002, 102(6):572-579.44. Sivashanmugam P, Tang L, Daaka Y: Interleukin 6 mediates thelysophosphatidic acid-regulated cross-talk between stromaland epithelial prostate cancer cells.  J Biol Chem 2004,279(20):21154-21159.45. Porter AT, F ACRO, Ben-Josef E: Humoral mechanisms in pros-tate cancer: A role for FSH.  Urol Oncol 2001, 6(4):131-138.46. Nambi P, Aiyar N: G protein-coupled receptors in drug discov-ery.  Assay Drug Dev Technol 2003, 1(2):305-310.47. Civelli O, Bunzow JR, Grandy DK: Molecular diversity of thedopamine receptors.  Annu Rev Pharmacol Toxicol 1993,33:281-307.48. Gingrich JA, Caron MG: Recent advances in the molecular biol-ogy of dopamine receptors.  Annu Rev Neurosci 1993, 16:299-321.49. Sidhu A, Niznik HB: Coupling of dopamine receptor subtypesto multiple and diverse G proteins.  Int J Dev Neurosci 2000,18(7):669-677.50. Zanassi P, Paolillo M, Feliciello A, Avvedimento EV, Gallo V, SchinelliS: cAMP-dependent protein kinase induces cAMP-responseelement-binding protein phosphorylation via an intracellularcalcium release/ERK-dependent pathway in striatal neurons.J Biol Chem 2001, 276(15):11487-11495.51. Yan Z, Feng J, Fienberg AA, Greengard P: D(2) dopamine recep-tors induce mitogen-activated protein kinase and cAMPresponse element-binding protein phosphorylation in neu-rons.  Proc Natl Acad Sci U S A 1999, 96(20):11607-11612.52. Sadar MD, Hussain M, Bruchovsky N: Prostate cancer: molecularbiology of early progression to androgen independence.Endocr Relat Cancer 1999, 6(4):487-502.53. Gioeli D, Ficarro SB, Kwiek JJ, Aaronson D, Hancock M, Catling AD,White FM, Christian RE, Settlage RE, Shabanowitz J, Hunt DF, WeberMJ: Androgen receptor phosphorylation. Regulation andidentification of the phosphorylation sites.  J Biol Chem 2002,277(32):29304-29314.yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralPage 11 of 11(page number not for citation purposes)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0223608/manifest

Comment

Related Items