UBC Faculty Research and Publications

Laser microdissection of conifer stem tissues: Isolation and analysis of high quality RNA, terpene synthase… Abbott, Eric; Hall, Dawn; Hamberger, Björn; Bohlmann, Jörg Jun 12, 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12870_2010_Article_600.pdf [ 4.93MB ]
Metadata
JSON: 52383-1.0223547.json
JSON-LD: 52383-1.0223547-ld.json
RDF/XML (Pretty): 52383-1.0223547-rdf.xml
RDF/JSON: 52383-1.0223547-rdf.json
Turtle: 52383-1.0223547-turtle.txt
N-Triples: 52383-1.0223547-rdf-ntriples.txt
Original Record: 52383-1.0223547-source.json
Full Text
52383-1.0223547-fulltext.txt
Citation
52383-1.0223547.ris

Full Text

METHODOLOGY ARTICLE Open AccessLaser microdissection of conifer stem tissues:Isolation and analysis of high quality RNA,terpene synthase enzyme activity and terpenoidmetabolites from resin ducts and cambial zonetissue of white spruce (Picea glauca)Eric Abbott1,2, Dawn Hall1, Björn Hamberger1, Jörg Bohlmann1,2*AbstractBackground: Laser microdissection (LMD) has been established for isolation of individual tissue types fromherbaceous plants. However, there are few reports of cell- and tissue-specific analysis in woody perennials. Whilemicrodissected tissues are commonly analyzed for gene expression, reports of protein, enzyme activity andmetabolite analysis are limited due in part to an inability to amplify these molecules. Conifer stem tissues areorganized in regular patterns with xylem, phloem and cortex development controlled by the activity of thecambial zone (CZ). Defense responses of conifer stems against insects and pathogens involve increasedaccumulation of terpenoids in cortical resin ducts (CRDs) and de novo formation of traumatic resin ducts from CZinitials. These tissues are difficult to isolate for tissue-specific molecular and biochemical characterization and arethus good targets for application of LMD.Results: We describe robust methods for isolation of individual tissue-types from white spruce (Picea glauca) stemsfor analysis of RNA, enzyme activity and metabolites. A tangential cryosectioning approach was important forobtaining large quantities of CRD and CZ tissues using LMD. We report differential expression of genes involved interpenoid metabolism between CRD and CZ tissues and in response to methyl jasmonate (MeJA). Transcript levelsof b-pinene synthase and levopimaradiene/abietadiene synthase were constitutively higher in CRDs, but inductionwas stronger in CZ in response to MeJA. 3-Carene synthase was more strongly induced in CRDs compared to CZ.A differential induction pattern was observed for 1-deoxyxyulose-5-phosphate synthase, which was up-regulated inCRDs and down-regulated in CZ. We identified terpene synthase enzyme activity in CZ protein extracts andterpenoid metabolites in both CRD and CZ tissues.Conclusions: Methods are described that allow for analysis of RNA, enzyme activity and terpenoid metabolites inindividual tissues isolated by LMD from woody conifer stems. Patterns of gene expression are demonstrated inspecific tissues that may be masked in analysis of heterogenous samples. Combined analysis of transcripts, proteinsand metabolites of individual tissues will facilitate future characterization of complex processes of woody plantdevelopment, including periodic stem growth and dormancy, cell specialization, and defense and may be appliedwidely to other plant species.* Correspondence: bohlmann@msl.ubc.ca1Michael Smith Laboratories, University of British Columbia, 2185 East Mall,Vancouver, B.C., V6T 1Z4, CanadaAbbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106© 2010 Abbott et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.BackgroundComplex metabolic processes in plants are often loca-lized to specialized cells or tissues. The woody stem of aconifer contains a large number of specialized tissuesthat are organized in a regular pattern. The outer barktissue (phloem, cortex and periderm) and the inner woodtissue (xylem) are separated by the cambial zone (CZ)[1]. Initial cells within the CZ give rise to sieve cells, par-enchyma cells and fibers towards the phloem and par-enchyma cells and tracheids towards the xylem. Inspruce species (Picea spp.), large cortical resin ducts(CRDs) in the bark carry terpene-rich oleoresin that playsa role in defense against biotic stress such as insect feed-ing, egg deposition, or pathogen inoculation [2,3]. Inresponse to biotic stress, tracheid mother cells in the CZare transiently reprogrammed to produce additional trau-matic resin ducts before resuming tracheid production,which is associated with increased defense and resistance[4,5]. Treatment of spruce stems with methyl jasmonate(MeJA) has been shown to elicit a response that mimicsthe response to biotic stress [6,7].A number of different methods have been developedto isolate and enrich individual cell- or tissue-typesfrom plants. In conifers, which include the economicallyimportant spruce and pine (Pinus spp.) species, and inother tree species such as poplars, enriched cell popula-tions from stem tissues can be obtained by separatingbark from wood [6,8], taking xylem scrapings [9,10] andby tangential cryosectioning across the CZ [11-13].Other methods that have been applied in herbaceousplant species include isolation of glandular trichomes orepidermal cells from plant surfaces by abrasion [14,15]and generation of protoplasts for fluorescence activatedcell sorting [16]. However, these latter methods wouldbe difficult, if not impossible to apply for the isolationof specific cell- or tissue-types from the inner parts ofwoody stems of perennial species.Laser microdissection (LMD) is a specific form oflaser-assisted microdissection that uses a UV cuttinglaser to isolate tissues of interest from thin sections ofbiological samples, which are collected by gravity belowthe sample. LMD and other forms of laser-assistedmicrodissection are being applied widely in both animaland plant research [17,18]. The most common applica-tion of laser-assisted microdissection is for RNA isola-tion and transcript analysis by qRT-PCR and morerecently by sequencing using high-throughput technolo-gies [19]. Protein, enzyme and metabolite analysis hasbeen limited partly because amplification is not possiblefor these molecules. Microdissected tissues have beensuccessfully analyzed using proteomics [20] and metabo-lomics techniques [21], but there are few reports (nonein plants) of isolation of intact protein samples forenzyme assays [22,23]. LMD has recently been appliedsuccessfully for microchemical analysis of stone cellsfrom Norway spruce (P. abies) stems [24], but laser-assisted microdissection has not been widely applied towoody plant tissues. Among recent reports of combinedanalysis of RNA, protein and metabolites from indivi-dual cell-types, at least one study demonstrated the fea-sibility of combined transcript and metabolite analysisfrom laser microdissected samples [25-27].In woody perennials, laser-assisted microdissection hasthe potential to further improve the degree of spatialresolution of sample dissection for the study of dynamic,tissue-specific processes. For example, the CZ controlsseveral processes of interest including the periodicallyalternating events of stem growth and dormancy, wooddevelopment and induced defense of traumatic resinduct formation. In CRDs, we are interested in a betterunderstanding of tissue- and cell-type specific processesof constitutive and possibly induced defense.In this paper, we report the successful use of LMDtechnology for the isolation of individual specialized tis-sues from white spruce (P. glauca) stems suitable for sub-sequent combined analysis of RNA transcript abundance,enzyme activity and metabolite profiles. In validation ofthese combined methods, we show that genes involved interpenoid biosynthesis and defense exhibit differentialgene expression patterns between CRD and CZ tissuesand in response to methyl jasmonate (MeJA) treatment.We further demonstrate that active terpene synthase(TPS) enzyme and terpenoid metabolites can be detectedand analyzed in laser microdissected CRD and CZ tis-sues. The methods for LMD combined with analysis ofgene expression, enzyme activity and metabolite profilesin microdissected samples will enable a more compre-hensive analysis of complex metabolic processes at multi-ple levels of regulation in individual tissues that areotherwise difficult to access in woody plants.Results and DiscussionApplication of LMD technology to spruce stemsTo maximize the number of cells harvested from a sam-ple we required the ability to cut large regions fromrelatively thick tissue sections, which is possible usingthe LMD system as collection is aided by gravity. Planttissue is inherently resistant to laser cutting due to thepresence of cell walls, which can be highly lignified inspruce stem tissues. LMD was not effective in cuttingspruce stem tissue mounted on glass slides because thelaser power required was sufficient to etch the surfaceof a glass polyethylene naphthalate (PEN)-membraneslide resulting in diffusion of the beam and decreasedlaser cutting efficacy. However, the gravity assisted col-lection method of LMD permits the use of glass-free,Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 2 of 16steel frame polyethylene terephthalate (PET)-membraneslides that eliminates the need for glass support, facili-tates the use of increased laser power and also allowscollection of microdissected tissues in an empty PCRtube cap, which is required for metabolite extractions.LMD was used successfully to cut large areas (>1 mmdiameter) from thick sections (>30 μm) mounted onPET-membrane frame slides. For routine LMD applica-tions, we used sections of 25 μm. The LMD platformusing PET-membrane frame slides was determined to bea highly suitable system for microdissection of sprucestem tissue.Overview of LMD from spruce stem samplesSample preparation protocols for LMD can vary sub-stantially depending on the type of tissue and down-stream analysis. We describe here a single method ofmicrodissecting two different specialized tissues fromwhite spruce stems that is suitable for analysis of RNA,protein and metabolites (Figure 1). Briefly, frozen stemsections are taken from 2-year old spruce trees for cryo-sectioning in the tangential plane. Cryosections aremounted on a membrane support and selected tissuesare isolated using LMD.Preparing tangential cryosections for LMDPrior to sectioning, specimens are often fixed andembedded to preserve delicate cell structures [17,18,28].However, fixation can be time consuming, non-uniformly reduces the extractability of molecules fromthe tissue sample [17,29] and can be a source of con-tamination [21]. We found that the morphology of for-malin fixed, paraffin embedded cross-sections of sprucestems was of good quality, but the RNA was degradedcompared to unfixed samples. Sucrose was tested as acryoprotectant to preserve morphology but was foundto interfere with laser cutting. Cryosections withoutcryoprotection or fixation showed reduced quality ofmorphology, but were still of high enough quality toidentify specialized cell types and tissues and gavehigher RNA yield and integrity. Therefore, cryosectionswere taken from unfixed, frozen stem pieces in eithercross-section or tangential section orientation. Cryosec-tions were then transferred onto a PET-membraneframe slide containing 100% ethanol (for RNA extrac-tion) or DTT (for protein or metabolite extraction) andallowed to dry thoroughly.While stem cross-sections allow for the identificationof many different tissue types within a single section(Figure 2, top), there is often damage to the cortex,CRD epithelia and CZ tissue, and these cryosections areprone to curling as they dry on the slide (not shown). Incontrast, we found that tangential cryosections of woodystems are intact (Figure 2A-D, left panel) and do notcurl on the slide unless there is a substantial amount ofxylem tissue present. The quality of cell morphologywas sufficient to identify major tissue types from tan-gential cryosections including CRDs, phloem, CZ andFigure 1 Schematic overview of sample preparation for laser microdissection of spruce stems. (A) 2-year old white spruce harvestedabove the root. (B) Stems were divided into 5 - 10 mm long pieces that were flash frozen in liquid nitrogen. (C) Stem pieces were split in halflongitudinally prior to cryosectioning. (D) Half stem segment mounted for tangential cryosectioning. (E) Tangential cryosections on a PET-membrane frame slide. (F) Laser microdissection: Regions of interest are selected, cut with a laser and selected cells fall by gravity into acollection tube.Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 3 of 16Figure 2 Identification and microdissection of individual tissue types from tangential cryosections. (Top) Schematic diagram and imageof a stem cross-section showing an overview of tissue types. Letters A, B, C and D in the schematic indicate tangential cryosection planescorresponding to the figure panels (A), (B), (C) and (D) below. (A-D) Tissue images of tangential cryosections at different stem depths. For eachhorizontal figure panel (A) - (D), the left image shows tissue cryosection prior to laser cutting; the centre image shows the same tissuecryosection after laser cutting; and the right image shows the laser microdissected tissues in collection tube. Tissue types are indicated by thecolor bar on the left side of panels (A) - (D) where colors correspond to the colors in the schematic of the cross section (Top): Brown is cortex,yellow is cortical resin duct (CRD), orange is phloem, green is cambium zone (CZ), yellow is xylem, and grey is pith. (A) Tangential cryosectioncontaining cortex and CRD tissues. (B) Tangential cryosection containing cortex and phloem tissues. (C) Tangential cryosection containing cortex,phloem, and cambium zone tissues. (D) Tangential cryosection containing phloem, cambium zone, and xylem tissues. CRD: Cortical resin duct;CZ: Cambium zone. Length of scale bar is 200 μm for the cross-section and 400 μm for tangential panels (A) - (D).Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 4 of 16xylem (Figure 2A-D, middle and right panel). By care-fully adjusting the sectioning plane, axially oriented tis-sue can be observed to extend the entire length of atangential section (up to 10 mm long) compared tocross-sections where these same tissues may occupyonly a small percentage of the section area. The mor-phology of tangential cryosections treated with 10 mMDTT was of similar quality but retained pigments suchas chlorophyll in the outer stem tissues that areremoved by ethanol treatment (not shown). Delicate tis-sues such as CZ or CRD epithelia were intact even aftertreatment with 100% ethanol as demonstrated by subse-quent staining for cellular contents in CRD epithelialcells (Figure 3A and 3B). The quality of the morphologyof ethanol dried cryosections was similar that cryosec-tions mounted in 50% glycerol (Figure 3C).A tangential sectioning orientation is well suited forLMD of spruce stems because morphology is well pre-served without cryoprotection or fixation and largerregions of individual tissues are accessible compared tocross-sections, thus requiring fewer cryosections toobtain a large quantity of cells using LMD. Tangentialcryosections with similarly intact morphology have alsobeen successfully produced from white spruce needles(data not shown) suggesting that these techniques maybe successfully applied to a broad range of cell- and tis-sue-types from large or small specimens.LMD of CRD and CZ tissues from tangential cryosectionsof spruce stemsA series of tangential cryosections from the cortex tothe xylem was prepared and mounted on a singleLMD frame slide. CRD and CZ tissues were chosen totest LMD applications and subsequent RNA, proteinand metabolite analysis because they consist of meta-bolically active cells that represent a very small propor-tion of the spruce stem and are thus good candidatesfor high resolution enrichment using LMD. CRDscarry terpene-rich oleoresin and terpene synthaseenzymes have been shown to be localized to CRDepithelial cells [30]. The CZ contains initial cells fordifferentiation of all secondary xylem and secondaryphloem tissue and thus plays a vital role in stemgrowth and development as well as the formation oftraumatic resin ducts.Laser microdissected CRD and CZ tissues were col-lected separately into an empty PCR tube cap and tis-sues were checked for the quality of morphology afterlaser cutting (Figure 2A-D, middle and right panel).CRD tissue included the epithelial cells immediately lin-ing the resin duct lumen as well as the second cell layer(Figure 2A, left panel and Figure 3). CZ tissue includedall thin-walled, light colored cells that could be visuallydistinguished from fully differentiated xylem and phloem(Figure 2C-D, left panel). Laser settings were the samefor cryosections treated with ethanol or DTT. Slideswere mounted on the LMD system with tissue sectionsdried on the bottom surface to prevent microdissectedcells from becoming trapped on top of the membraneafter cutting. Laser cutting was very efficient with ~90%of microdissected regions being released from surround-ing tissue and immediately falling into collection tubes.Regions that did not fall were dislodged using a laserpulse. To avoid cross contamination between differenttissues cut from the same cryosections, each tissue typewas harvested completely before selecting regions forthe next tissue. Cryosections treated with DTT requireda longer time to dry on the slide and sections that werenot completely dried were difficult to cut with the laser.The amount of tissue isolated using laser-assistedmicrodissection is often reported as the number of cellscollected. However, cell size and metabolic state variesbetween different tissues and plant species and the totalnumber of cells is difficult to estimate because the num-ber of partially cut cells contained in thin cryosectionsdepends on the section thickness. To facilitate bettercomparison of methods for laser-assisted microdissec-tion we report the amount of microdissected tissue as“μl LMD volume”, which is calculated as the microdis-sected area multiplied by the section thickness. Thevolume of CRD tissue that could be obtained by LMDfrom a given stem section of two year old white sprucetrees was approximately threefold larger than thevolume of CZ tissue. When calculated for a stem lengthof one centimeter, we obtained CRD with 2.9 ± 0.9 μlLMD volume/cm stem length (n = 7 biological repli-cates) compared to CZ tissue with 1.1 ± 0.3 μl LMDvolume/cm stem length (n = 7).RNA extraction from CRD and CZ tissues isolated by LMDTotal RNA was extracted from CRD and CZ tissue iso-lated by LMD from ethanol treated cryosectionsobtained from a 6 mm long half stem segment. Cryosec-tions were dried in 100% ethanol and microdissected tis-sue was collected in RNA lysis solution for extraction.For each RNA extraction, the average LMD volumeused was 0.72 ± 0.16 μl (n = 3) for CRD and 0.37 ±0.12 μl (n = 3) for CZ, which was sufficient for use witha standard RNA isolation protocol rather than a modi-fied protocol specifically designed for microdissectedsamples. RNA yield was normalized to the total LMDvolume for each tissue type. CZ yielded 357 ± 58 ngRNA/μl LMD volume (n = 3), which was more thantwice the yield from CRD tissue at 150 ± 12 ng RNA/μlLMD volume (n = 3). Incubation of samples at 42°C inlysis buffer prior to RNA extraction did not increaseyields. RNA samples were DNase treated and concen-trated by ethanol precipitation. There was noAbbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 5 of 16measurable loss of RNA during ethanol precipitation(not shown).RNA integrity was assessed using the BioanalyzerRNA Pico Assay and expressed as an RNA integritynumber (RIN). RNA yield was quantified using theRibogreen assay, which was found to be robust with nointerference from buffer components. High integrityRNA suitable for qRT-PCR analysis and construction ofcDNA libraries was obtained from microdissected tis-sues with CZ RNA being of slightly higher quality thanCRD RNA (Figure 4). RNA samples with an RIN greaterthan 5.0 are suitable for qRT-PCR [31] and an RINgreater than 7.0 is the standard for construction ofcDNA libraries [Personal communication, YungjunZhao, BC Cancer Agency Genome Sciences Centre,Vancouver, BC]. DNase treatment eliminated back-ground genomic DNA contamination (Figure 4) withoutdecreasing RNA integrity, whereas ethanol precipitationresulted in a decrease of 0.7 RIN units. RNA integrity isof particular concern during LMD because each slidemay be at room temperature for over an hour whileregions of interest are selected and cut. To assess RNAdegradation during this time, whole cross-sections weredried in ethanol on a PET-membrane frame slide andcollected in RNA lysis buffer immediately or after incu-bation at room temperature. There was no detectabledecrease in RNA integrity for slides left at room tem-perature for up to four hours (data not shown). SlidesC DA BFigure 3 Characterization of CRD morphology in cryosections before and after treatment with 100% ethanol. (A) Tangential section ofCRD treated with 100% ethanol. (B) Tangential section of CRD treated with 100% ethanol and stained with Safranin O. (C) Tangential section ofCRD stained with Safranin O in 50% glycerol. (D) For orientation purposes, a cross-section of CRD and surrounding cortex tissue stained withSafranin O in 50% glycerol. Length of scale bar is 50 μm.Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 6 of 16were also stored at -80°C for eight days with nodecrease in RNA integrity (data not shown). However,cryosections may fall off the slide during storage andslides must be stored in a dry, airtight container to pre-vent condensation when they are warmed to roomtemperature.To test if RNA integrity can be affected by LMD weapplied extensive laser cutting to whole cross-sectionsbut only observed a slightly lower RNA integrity (<1.0RIN units) compared to RNA extractions from intactwhole cross-sections. We found that RNA integrity fromCRD and CZ tissue after microdissection, DNase treat-ment and ethanol precipitation is of sufficient qualityfor downstream applications. It was not necessary toapply any specific treatments to remove polysaccharidesor polyphenols from LMD tissue and the use of thePlant RNA Isolation Aid (Ambion, USA) to removethese compounds was found to substantially reduceRNA yields. These results suggest that polysaccharidesor polyphenols may not be abundant in CRD and CZtissue or that these compounds may have been effi-ciently removed during sample preparation and RNAextraction.Transcript analysis from CRD and CZ tissue isolated byLMDqRT-PCR is the most common method of quantitativetranscript analysis. When transcript abundance isreported as a normalized value relative to a referencegene it is critical to carefully evaluate the reference geneto ensure that it is expressed at constant levels underexperimental conditions being tested. We evaluatedthree candidate reference genes, translation initiationfactor (TIF), elongation factor (ELF) and tubulin a-sub-unit (TUB), for expression in spruce stem CRD, CZ andwhole cross-sections (Figure 5A). TIF was the mostappropriate reference gene because it had the loweststandard deviation across the tissue types tested. Primersspecific to a white spruce TPS gene (b-pinene synthase)[GenBank:BT105745] were used to compare relativeFigure 4 RNA integrity of untreated, DNase treated and DNase/ethanol precipitated RNA samples from CRD and cambial zone tissue.RNA integrity number (left) and a representative Bioanalyzer electropherogram (right) is shown for each treatment. (A) Untreated, (B) DNasetreated, (C) DNase treated and ethanol precipitated RNA samples. Error bars represent standard error of three biological replicates. The dottedline in untreated samples (A) represents a region of genomic DNA background contamination that is removed by DNase treatment (B and C).RIN: RNA integrity number; FU: Fluorescence units.Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 7 of 16transcript abundance for a representative monoterpenesynthase gene involved in terpenoid defense metabolism[32] between CRD, CZ and whole cross-section tissuesby qRT-PCR. b-Pinene synthase transcripts were 12-foldmore abundant in CRD tissue, the primary site for con-stitutive terpenoid accumulation, compared to CZ andwhole cross-section tissues (Figure 5B). Similarly,transcripts for levopimaradiene/abietadiene synthase(LAS) representing a major diterpene synthase for diter-pene resin acid biosynthesis was more abundant in CRDthan in CZ in untreated trees (Figure 6).MeJA-inducible changes in transcript abundance wereevaluated for four different genes involved in terpenoidbiosynthesis, including two monoterpene synthases, a05101520250510152025A BCZ Whole cross-sectionsCRDTissue typeTIF ELF TUBGeneCRDCZWhole cross-sectionRelative transcript abundanceRelative transcript abundanceβ-Pinene synthaseFigure 5 Validation of reference genes and tissue-specific analysis of b-pinene synthase expression between CRD, CZ and wholecross-section tissues. (A) Relative mRNA abundance of candidate reference genes normalized to RNA concentration. TIF: Translation initiationfactor; ELF: Elongation factor; TUB: Tubulin a-subunit. (B) Relative transcript abundance of b-pinene synthase in different tissue types relative toTIF expression. Error bars represent the standard error of three biological replicates.Figure 6 Relative transcript abundance of selected terpenoid biosynthetic genes. PIN: b-pinene synthase; 3-CAR: 3-carene synthase; LAS:levopimaradiene/abietadiene synthase; DXPS: 1-deoxyxyulose-5-phosphate synthase. Each gene is normalized to TIF expression. Error bars are thestandard error of three biological replicates for all CRD and MeJA treated CZ but was restricted to two biological replicates for untreated CZ duepoor template quality for one sample and limited quantity of biological material. Statistical significance represents a Student’s T-test comparisonof MeJA treated versus untreated samples with (*) p < 0.05, (**) p < 0.01 and (***) p < 0.001.Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 8 of 16diterpene synthase, and one gene encoding 1-deoxyxyu-lose-5-phosphate synthase (DXPS) (Figure 6). CRD andCZ tissue were harvested eight days after MeJA treatmentas this timepoint has been shown in Norway spruce to bethe peak of TPS transcript abundance [32]. The TPS genestested showed unique spatial expression patterns inresponse to MeJA treatment. In CZ tissue, expression ofb-pinene synthase and LAS was up-regulated in responseto MeJA treatment, but induction was not significant for3-carene synthase. TPS induction in CZ tissue was likelyassociated with localized traumatic resin duct formation.In CRD tissue, a slight up-regulation was observed for b-pinene synthase and LAS reanscripts, but this induction isnot significant and there were already high levels of tran-scripts for these genes prior to MeJA treatment. However,a significant induction was observed for 3-carene synthasein CRD tissue where constitutive expression is low for thisTPS gene. Since CRDs are preformed prior to biotic stressthey are also sometimes referred to as constitutive resinducts [6,33,34]. The MeJA-inducible change of geneexpression in CRD tissue indicates that these constitutivelyformed anatomical defense structures can be activated atthe molecular level by MeJA, and possibly other stress.We have recently confirmed this result of CRD activationin independent work with Sitka spruce (P. sitchensis) byimmunofluorescence localization of TPS protein [K. Zulakand J. Bohlmann, unpublished results].DXPS transcript levels were also up-regulated in CRDtissue in response to MeJA treatment, but surprisinglyDXPS transcript levels were down-regulated in CZ tis-sue in response to MeJA treatment. The particularDXPS gene tested here is 100% identical at the nucleo-tide level to a type II inducible DXPS from Norwayspruce that was found to be up-regulated in the outerstem tissue (including bark and CZ tissue) in responseto mechanical wounding, MeJA treatment and inocula-tion with fungal elicitors [35]. DXPS up-regulation inCRD tissue is consistent with a role in terpenoid oleore-sin production. Down-regulation of DXPS transcripts inCZ tissue suggests subfunctionalization of this genebetween these tissues. Since tracheid formation is transi-ently arrested during traumatic resin duct formation it ispossible that this DXPS gene is involved in xylem devel-opment during constitutive growth. White sprucehomologues have been identified for each of the threeNorway spruce DXPS genes [35] and it is likely that oneof these genes plays a role in terpenoid oleoresin pro-duction in developing traumatic resin duct tissue. Inprevious analysis of DXPS transcripts in Norway spruce[32,35], individual tissues were not separated and anydetectable down-regulation of DXPS in CZ tissue mayhave been masked by the up-regulation of DXPS inCRD and other more abundant tissues. It is only byLMD isolation of CZ tissue from other tissues thatDXPS down-regulation could be observed in the presentstudy. Thus, LMD is an effective tool for elucidating tis-sue-specific gene expression patterns that is not possibleusing more conventional techniques of tissue separation.Protein extraction from CRD and CZ tissue isolated byLMD and detection of TPS enzyme activity inmicrodissected CZ tissueTwo-year old, MeJA treated white spruce trees used forprotein extraction were harvested 8 days post-induction.This time point coincides with the peak of protein abun-dance for TPS enzymes in MeJA-induced Norway spruce[32]. For protein extractions, two stem pieces (13-15 mmtotal length) were taken from the apical end of the firstinterwhorl (previous year’s growth) for LMD of CRD andCZ tissues from three independent biological replicates.The average LMD volume used for protein extractionwas 5.14 ± 1.44 μl (n = 3) for CRD tissue and 1.44 ± 0.25μl (n = 3) for CZ tissue. The protein extraction protocolwas optimized to isolate active enzymes instead of apply-ing higher yield protocols that use solvent extractionsoptimized for general proteomics analysis where activeenzymes are not required. CZ yielded 31 ± 5 μg protein/μl LMD volume (n = 3), double the yield from CRD (16± 2 μg protein/μl LMD volume (n = 3)). A higher proteinyield from CZ compared to CRD tissue correlates wellwith RNA yield from these tissues.Monoterpene synthase assays were performed usingapproximately 30 μg total protein for CRD tissue, 15 μgfor CZ tissue and 10 μg for whole cross-sections. Theamount of protein used for each assay varied based onthe total protein yield obtained from each tissue type.Monoterpene synthase enzyme activity was detected inassays with protein extracts from CZ samples and fromwhole cross-sections. Due to high levels of endogenousmonoterpenes that were co-purified during the proteinextraction, we could not detect monoterpene formationabove background in assays with protein from CRDsamples. However, monoterpene synthase enzyme activ-ity was detectable in microdissected CZ tissue. Themonoterpene synthase specific activity in MeJA-inducedCZ tissue was 1.92 ± 0.31 pkat/mg total protein (n = 3),which was twice as large as in whole cross-sections(0.98 ± 0.29 pkat/mg total protein (n = 3)). The pro-ducts of monoterpene synthase activity detected in CZand whole cross-section extracts are shown in Table 1.Monoterpene synthase activity in the MeJA-induced CZmay be associated with the onset of traumatic resin ductdevelopment [6] and the differences in the product pro-files of the monoterpene synthase activity in CZ tissueand whole cross-sections suggests differential expressionof TPS gene family members in these tissues.Treatment of cryosections with DTT was foundto be critical to preserving enzyme activity. UsingAbbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 9 of 16concentrations lower than 10 mM DTT or volumes lowerthan 2 μl resulted in browning of sections due to oxida-tion. Protein extractions from oxidized cryosections weredegraded with smeared bands on silver stained SDS-PAGEgel (not shown) and no detectable monoterpene synthaseenzyme activity. We did not observe a decrease in thelevel of specific monoterpene synthase enzyme activitydue to laser cutting.Extraction and analysis of terpenoid metabolites in CRDand CZ tissue isolated by LMDSample preparation for metabolite extraction was similarto protein extraction. Tangential cryosections were takenfrom two-year old stems harvested 8 days after treatmentwith MeJA. Metabolite extractions were performed froma single stem piece (5-9 mm long) from the apical end ofthe first interwhorl of three independent biological repli-cates. The average LMD volume used for metaboliteextraction was 2.68 ± 1.37 μl (n = 3) for CRD and 0.70 ±0.25 μl (n = 3) for CZ. Microdissected tissues were trans-ferred to a 2 ml glass gas chromatography vial using apipette tip that had been dipped in water to reduce static.Metabolites were extracted in 500 μl methyl tert-butylether (MTBE) and split into two samples for independentanalysis of mono- and diterpenes by gas chromatogra-phy-mass spectrometry (GC/MS).The total monoterpene yield was higher from CRDtissue with 2.39 ± 0.42 μg monoterpenes/μl LMDvolume (n = 3) compared to 1.81 ± 0.41 μg monoter-penes/μl LMD volume (n = 3) from CZ tissue. Thistrend supports the observation that CRDs are the pri-mary specialized tissues for oleoresin terpenoid accumu-lation in conifer stems [3]. The relative abundance ofspecific monoterpenes is similar between CRD, CZ andwhole cross-section tissue, but the total monoterpeneabundance is higher in the specialized tissues found inmicrodissected CRD and CZ samples (Figure 7). Whilethis result is consistent with the general observation thatterpenoids accumulate in CRDs and in the MeJA-induced traumatic resin ducts formed from initials inthe CZ [3,6,7], to the best of our knowledge, theseresults are the first to specifically localize terpenoid pro-files in these tissues. The most abundant monoterpenesdetected from CZ tissue [(+)-a-pinene, (-)-a-pinene,(-)-b-pinene and (-)-b-phellandrene] correspond withthe most abundant monoterpenes produced by TPSactivity from GPP in cell free extracts isolated from thistissue (Table 1). However, the most abundant monoter-penes detected in whole cross-sections (including CRDtissue) do not correspond to the most abundant enzymeproducts. Monoterpenes are present in large quantitiesin the constitutive CRD oleoresin, so it is possible thatnewly induced TPS enzymes in this tissue may not havecontributed substantially to the accumulated monoter-pene composition at the time point measured.Monoterpenes are volatile compounds and also may dif-fuse to some degree into the drop of 10 mM DTT duringsample preparation. Therefore, it was necessary to evaluatethe effect of sample processing on the terpenoid profile.Metabolite extractions were performed on cross sectionsimmediately after sectioning or after drying on a drop of10 mM DTT. As expected, the total monoterpene yieldwas lower in dried samples, which can be attributed tomonoterpene volatility (Additional File 1: Figure S1A), butthe relative abundance of individual monoterpenes wasnot changed substantially (Additional File 1: Figure S1B).The extent of monoterpene diffusion was evaluated by pla-cing a series of tangential cryosections on 4 μl drops of 10mM DTT, pipetting up and down, and then collecting theaqueous phase and tangential sections for separate meta-bolite extractions. Approximately 2-3% of individualmonoterpenes were found in the aqueous phase (Data notshown). This is an upper limit for monoterpene diffusionsince cryosections are normally placed on a smaller dropof DTT and are not agitated by pipetting. Since volatilityand diffusion do not substantially alter the relative mono-terpene composition it is likely that the monoterpene pro-files measured in microdissected tissues is representativeof their relative abundance in vivo. However, due to thevolatility of monoterpenes we caution that the measure-ment of absolute abundance of monoterpenes using thesemethods requires the additional use of internal standards.We also tested the feasibility of a qualitative analysisof diterpenoids, the principal non-volatile component ofconifer oleoresin [30], in CRD and CZ tissues isolatedby LMD from stem cryosections. The diterpene com-pounds detected in laser microdissected CRD and CZtissues were predominantly the diterpene resin acidsabietic acid, dehydroabietic acid, isopimaric acid, levopi-maric acid, neoabiatic acid, palustric acid, and sandara-copimaric acid, along with minor amounts of thecorresponding diterpene aldehydes, alcohols and olefins.Table 1 Monoterpenes formed from geranyl diphosphatein cell-free enzyme assays of total protein extracts fromCZ laser microdissected tissue and whole cross sections.Cambial Zone Whole Cross SectionsProduct % Total St. Error % Total St. Error(-)-a-Pinene 22.2 1.0 3.9 0.8(+)-a-Pinene 19.0 0.8 2.9 0.5(-)-b-Phellandrene 28.4 0.7 12.3 3.7(-)-b-Pinene 20.7 1.0 8.4 0.3(+)-3-Carene 8.1 1.2 25.6 2.2(-)-Limonene 1.7 0.9 15.6 2.1(a-Terpinolene nd nd 14.9 2.1(+)-Sabinene nd nd 11.9 2.4Myrcene nd nd 4.5 1.9Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 10 of 16ConclusionsLaser-assisted microdissection has previously beenapplied in several herbaceous plant species, mostly forthe analysis of RNA transcripts [17,18]. We describemethods for the isolation of individual tissue-types fromthe stem of white spruce, a woody perennial species thatis particularly recalcitrant to tissue- and cell-type speci-fic analysis using conventional techniques. Sample pre-paration is simple, robust and may be broadly applicableto RNA, protein and secondary metabolite analysis. Theuse of tangential cryosections was instrumental inobtaining sufficient quantities of microdissected tissuesfor protein and metabolite analysis, which is often chal-lenging due to the inability to amplify these molecules.Microdissected tissue quantities were sufficient for RNAisolation using standard protocols designed for larger,non-microdissected samples and transcript analysis byqRT-PCR without RNA amplification. Terpenoid bio-synthetic genes were shown to exhibit differential pat-terns of gene expression between CRD and CZ tissuesand in response to MeJA treatment. The detection ofTPS enzyme activity from laser microdissected tissuessuggests that sample preparation and LMD do not inter-fere with sensitive downstream biochemical analyses.Successful extraction and quantification of volatilemonoterpenes and detection of a range of diterpenoidssuggests that metabolite analysis could also be amenableto different classes of metabolites.The combined analysis of RNA, protein, enzyme activ-ity and metabolite profiles from individual conifer stemtissues will be extremely powerful when combined withthe use of genomics resources [36,37] and the applicationof transcriptomics [10,38], proteomics [32,39,40] andmetabolite profiling [32]. Tissue-specific analysis sup-ported by LMD has the potential to substantially improveour understanding of complex processes including celldifferentiation and specialization associated with stemgrowth, wood development and the inducible formationand activation of defense-related structures such as resinducts. The methods described here should be broadlyapplicable to both woody and herbaceous species andwill be of particular value for those perennial woody sys-tems where genomics resources are already availablesuch as poplar [41,42] and grapevines [43,44].Materials and methodsPlant material, methyl jasmonate (MeJA) treatment, andcollection of stem samplesWhite spruce (Picea glauca) seedlings of the geno-type PG653 were clonally propagated by somaticFigure 7 Monoterpenes detected by GC/MS in metabolite extracts from CRD, CZ and whole cross-section tissue after MeJA treatment.Only monoterpenes representing >1% total monoterpene content are shown. Error bars are the standard error of three biological replicates.Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 11 of 16embryogenesis and provided by Dr. Krystyna Klimas-zewska (Natural Resources Canada, Canadian Forest,Sainte-Foy, Québec). Two-year old trees were main-tained outside at the University of British Columbiagreenhouse and moved, prior to experiments, into con-trolled greenhouse environments as previously described[8]. Trees were used for experiments at the beginning ofthe third year growth season and were actively growingwith flushing buds present. Untreated trees for RNAextractions were harvested on April 27, 2009. MeJAtreated trees for RNA, protein and metabolite extractionwere induced on June 1, 2009 by applying a fine sprayof 100 ml of 0.1% MeJA (Aldrich, USA) in 0.1% Tween20 (Fisher Scientific, USA) over the entire stem asdescribed previously [8] and samples were harvestedeight days post-induction. Trees were cut at the baseand the lateral branches and basal-most 2 cm of thestem were removed and discarded. The remaining stemwas divided into pieces of 6 to 8 mm length using athin razor blade (Wilkinson Sword, Classic), immedi-ately flash frozen in liquid nitrogen and individuallystored in 1.5 ml microcentrifuge tubes at -80°C.CryosectioningAn individual stem piece was transferred to a Leicamodel CM3050 cryostat (Leica Microsystems, Germany)and allowed to equilibrate in the cryostat chamber(chamber temperature -15°C and object temperature -25°C) (Figure 1B). For subsequent LMD applications, thestem piece was divided in half along the longitudinal axisusing a thin razor blade (Wilkinson Sword, Classic) (Fig-ure 1C). Care was taken to ensure that any stem defectsor buds were oriented away from the cryosectioning sur-face of the specimen. Each half stem segment was quicklyand gently placed flat side down onto a small drop ofOptimal Cutting Temperature embedding medium(Sakura Finetek USA, Inc., USA) (Figure 1D). Tangentialcryosections of 25 μm thickness were taken with thestem axis oriented vertically during sectioning. Cryosec-tions were immediately transferred to either a pool ofcold 100% ethanol for RNA extractions or a 2 μl drop of10 mM DTT for protein and metabolite extractions on aPET-membrane frame slide (#11505151, Leica Microsys-tems, Germany). Cryosections for morphological charac-terization were stained with 0.05% Safranin O in 50%glycerol. For other applications not involving LMD, thestem was mounted upright and four to eight cross sec-tions, each of 25 μm thickness, were taken and trans-ferred to a PET-membrane frame slide as formicrodissected samples and collected using forceps.Laser microdissection (LMD)Cryosections on PET-membrane frame slideswere allowed to dry at room temperature beforemicrodissection using a Leica model LMD6000 LaserMicrodissection Microscope (Leica Microsystems, Ger-many) with 5× magnification, laser intensity between110-128 and speed of 2. Laser microdissected CRD orCZ tissues were collected into the caps of nucleasefree 0.5 ml PCR tubes (Axygen, USA) containing theappropriate buffer for RNA and protein extractions(described below) or into empty caps for metaboliteextractions. Buffer crystallization on the LMD collec-tion tube holder was reduced by adding buffer to thecap before mounting it on the holder. When microdis-secting multiple tissues from a single cryosection, dis-section of one tissue type was completed beforestarting to cut the next tissue type to avoid cross con-tamination of tissue samples. The LMD volume for agiven sample collection was calculated by multiplyingthe section thickness by the total area of all microdis-sected regions for each tissue. Standard deviations arereported for LMD volume.RNA extractionsRNA was extracted independently from three separatetrees using the standard-volume protocol (non-LCM)for the RNAqueous-Micro RNA Isolation Kit (Ambion,USA). Briefly, laser microdissected tissues were col-lected in 30 μl of RNA lysis solution in a 0.5 ml PCRtube cap and stored at -80°C. PCR tubes were thawedupside down on ice and microdissected tissues weretransferred with lysis solution to a nuclease free 1.5 mlmicrocentrifuge tube containing an additional 30 μllysis buffer. The PCR cap was washed twice with 20 μllysis solution to give a total volume of 100 μl lysate fora silica column-based purification according to themanufacturer’s protocol with elution of total RNAusing 3 × 20 μl elution buffer heated to 75°C. DNasetreatment was performed with reagents provided asdescribed in the manufacturer’s protocol. RNA sampleswere concentrated by ethanol precipitation by adding0.1 volumes of DEPC treated 3 M sodium acetate and2.5 volumes of cold 100% ethanol before freezing at-80°C for at least 30 minutes. RNA pellets were col-lected by centrifugation (18,000 × g, 30 min, 4°C),supernatant was removed by pipetting and pellets werewashed with 100 μl of 70% ethanol made with DEPC-treated water. Centrifugation (18,000 × g, 10 min, 4°C)and removal of supernatant was repeated and the pel-let was dried at room temperature for 10 min beforeresuspension in 10 μl DEPC-treated water. RNA qual-ity was assessed using the RNA Pico Assay for the2100 Bioanalyzer (Agilent, USA). RNA yield was deter-mined by two replicate measurements using the Ribo-green assay (Invitrogen, USA). Standard deviation isreported for RNA yield in order to represent the varia-tion of the extraction protocol.Abbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 12 of 16Quantitative Real Time PCR (qRT-PCR)RNA from three independent trees was reverse tran-scribed in separate reactions using random hexamersand Superscript III reverse transcriptase (Invitrogen,USA). Gene targets were translation initiation factor(TIF), elongation factor (ELF), tubulin a-subunit (TUB),b-pinene synthase (PIN), 3-carene synthase (3CAR),levopimaradiene/abietadiene synthase (LAS) and 1-deox-yxyulose-5-phosphate synthase (DXPS) with the follow-ing sequences: ELF-f GTTGCTGTAACAAGATGGATGC; ELF-r CCCTCAAAACCAGAGATAGGC; TIF-f CATCCGCAAGAACGGCTACATC; TIF-r GTAA-CATGAGGGACATCGCAG; TUB-f TATGATGCC-CAGTGATACGTCG; TUB-r ATGGAAGAGCTGCCGGTATGC; PIN-f CTACAAGGCGGACAGAGCC;PIN-r TGATCATGGCGTTGATATGGTC; 3CAR-fGGCTCTCCGTAGACCAACCTCAACTG; 3CAR-rGCACAAACAATATCTCTCCCAGGTCCAATG; LAS-fGGACGATCTCAAGTTGTTTTCCGATTC; LAS-rTGAGAACCACTGTTCCCAGCGC; DXPS-f AGAAACTCCCTGTGAGATTTGCCCTT; DXPS-r CAACAG-TAACTGATATGCCCTGCTGAG. qRT-PCR reactionswere performed in 96-well plate (HSP9655, BioRad,USA) sealed with a plastic film (MSB1001, BioRad,USA) using a DNA Engine Opticon 2 (MJ Research,USA) as follows: Reaction mix: 0.1 μl cDNA (1.5-14 ng/μl), 3.65 μl DEPC-treated water, 3.75 μl pre-mixed pri-mers (1.2 μM each), 0.03 μl HK-UNG thermolabile ura-cil N-glycosylase (Epicentre Biotechnologies, USA) and7.5 μl DyNAmo HS SYBR Green qPCR 2x master mix(Finnzymes, Finland). PCR program: 30 minutes at 37°C,15 minutes at 95°C followed by 45 cycles of (10 s at 94°C, 30 s at 56°C, 30 s at 72°C followed by measurementof reaction fluorescence) and a 10 minute final exten-sion at 72°C. A melting curve was generated from 65°Cto 95°C at 0.2°C intervals holding each temperature for1 s before measuring reaction fluorescence. Data wasanalyzed using Real Time PCR Miner [45]. Relativetranscript abundance was calculated using the equation1/(1+E)CT where the cycle threshold (CT) is the averageof four technical PCR replicates and the efficiency (E) isthe average of all reactions across all templates for eachprimer set. Relative transcript abundance was then nor-malized to TIF expression. Product identity and specifi-city were confirmed by sequencing amplicons fromrepresentative reactions. Reactions with non-discretemelting curves or other anomalies were excluded fromanalysis.Protein extractionsProtein was extracted independently from three separatetrees treated with MeJA. For each tree, microdissectedtissue from two stem pieces (~16 mm combined length)was collected in four 0.5 ml PCR tube caps eachcontaining 30 μl protein extraction buffer (50 mMHEPES pH 7.2, 5 mM DTT, 5 mM ascorbic acid, 5 mMsodium bisulfite, 10 mM MgCl2, 10% glycerol, 1% poly-vinylpyrrolidone (PVPP), 0.1% Tween 20) and stored at-80°C. Samples from each tree were thawed upsidedown on ice and contents were pooled into a 1.5 mlmicrofuge tube and the PCR tube caps were eachwashed with 20 μl protein extraction buffer for a totalvolume of 200 μl. This volume was then supplementedwith PVPP (1% w/v) and the protease cocktail describedin Lippert et al., (2009) [40] modified by adding 10 mM1,10-phenanthroline (Sigma, USA), 0.5 mM PMSF(Sigma, USA) and by using 1 μM E64 and 0.5 mMAEBSF. The sample was then ground by hand with amicrotube pellet pestle (Kontes, USA) for 1 min, gentlyvortexed intermittently for 1 min and sonicated for 10min in a 4°C water bath sonicator (Model 1510, Bran-son, USA). Homogenized samples were centrifuged at120 × g for 10 min at 4°C and 130 μl of supernatantwas desalted using a PD25 spintrap desalting column(#28-9180-04, GE Healthcare, USA) equilibrated withmetal ion free desalting buffer (25 mM HEPES pH 7.2,100 mM KCl, 10% glycerol). Protein concentration wasdetermined by Bradford assay. Standard deviation isreported for protein yield in order to represent the var-iation of the extraction protocol.Monoterpene synthase enzyme assaysEnzyme assays were performed on protein samples fromthree separate MeJA-treated trees based on previouslypublished methods developed for large volume biologi-cal samples [6,46,47] with minor modifications for lasermicrodissected tissue samples. Briefly, 40-55 μl cell freetotal protein extract with a protein content of 10-30 μgwas combined with geranyl pyrophosphate (GPP, Eche-lon Biosciences Inc., USA) and monoterpene synthasebuffer (25 mM HEPES pH 7.2, 100 mM KCl, 10 mMMnCl2, 10% glycerol, 5 mM DTT) to a total volume of500 μl and a final substrate concentration of 50 μM in a2 ml GC vial. As a control, protein samples were boiledfor 10 min prior to assay. The aqueous assay mixturewas overlaid with 0.5 ml pentane containing 2.5 μM iso-butyl benzene as an internal standard and incubated at30°C for 100 minutes. Assays were vortexed for 20 sand immediately stored for at least 30 min at -80°Cbefore centrifugation (1000 × g, 4°C, 30 min) and GC/MS analysis as described below. Standard error isreported for enzyme activity.Metabolite extractionsTerpenoid metabolites were extracted from three sepa-rate MeJA-treated trees based on previously publishedmethods [6,48] with the following modifications forlaser microdissected tissues. Microdissected tissuesAbbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 13 of 16from a single stem piece (~8 mm length) were col-lected in an empty 0.5 ml PCR tube cap and trans-ferred to a GC vial (#5183-2072, Agilent, USA) using awet pipette tip (to reduce static) and stored at -80°Cuntil extraction. Metabolites were extracted in 500 μlMTBE containing 3.0 μM isobutyl benzene as an inter-nal standard and shaken vigorously overnight at roomtemperature. For monoterpene analysis, 400 μl ofMTBE extract was combined with 150 μl of 0.1 Mammonium carbonate (pH 8) and vortexed for 20 sbefore carefully transferring the top ether layer to anew GC vial insert for GC/MS analysis. For diterpeneanalysis, 100 μl of MTBE extract was combined with40 μl methanol and 40 μl TMS-diazomethane andincubated for 45-60 min at room temperature. Samplesfor diterpene analysis were dried under high puritygrade nitrogen and resuspended in 100 μl diethyl ether(inhibitor free, HPLC grade) and transferred to a freshGC vial insert for GC/MS analysis. Standard error isreported for metabolite yields in order to represent thevariation of the extraction protocol.Metabolite analysis by gas chromatography-massspectrometry (GC/MS)The protocol for GC/MS analysis of mono- and diterpe-noids was based on previously published methods [6,48].Metabolites in 1 or 2 μl pentane (extracted from enzymeassays) or MTBE (extracted directly from tissue) wereidentified using a GC (Agilent 6890A series) coupledwith a mass spectrometer (5973N mass selective detec-tor, quadropole analyzer, electron ionization, 70 eV).Metabolite identification was based on comparison ofretention times to authentic standards as well as com-parison to mass spectral libraries (Wiley7Nist05). Mono-terpenes were separated using a DB-WAX capillarycolumn (J&W 122-7032, 0.25 mm diameter, 30 mlength, 0.25 μm film thickness) with the following pro-gram: 4 min at 40°C, increase by 3°C/min to 85°C,increase by 30°C/min to 250°C, hold for 2.5 min (Injec-tor = 250°C, initial flow rate = 1.4 ml He/min, total runtime 27.00 min). Stereochemistry of monoterpenes wasdetermined for compounds where authentic standardswere available by separation on a Cyclodex-B chiralcapillary column (J&W 112-2532, 0.25 mm diameter, 30m length, 0.25 μm film thickness) with the followingprogram: 1 min at 55°C, increase by 1°C/min to 100°C,increase by 10°C/min to 230°C, hold for 10 min (Injec-tor = 250°C, initial flow rate = 1.0 ml He/min, total runtime 69.00 min). Diterpene compounds were separatedusing an AT-1000 capillary column (Alltech A-13783,0.25 mm diameter, 30 m length, 0.25 μm film thickness)with the following program: 1 min at 150°C, increase by1.5°C/min to 220°C, increase by 20°C/min to 240°C,hold for 15 min (Injector = 250°C, initial flow rate = 1.0ml He/min, total run time 63.67 min).Additional materialAdditional file 1: Figure S1 - Effects of drying whole cross-sectionsin a drop of 10 mM DTT on monoterpene yield and relativemonoterpene profile. (A) Monoterpene yield; (B) Relative monoterpeneprofile. Only monoterpenes representing >1% total monoterpene yieldare shown. Error bars represent the standard error of three biologicalreplicates.AcknowledgementsWe thank Dr. Krystyna Klimaszewska (Natural Resources Canada, CanadianForest, Sainte-Foy, Québec) for white spruce seedlings, Dr. Trygve Krekling(UMB, Norway) for training and invaluable advice with histology, Ms. JamiePighin (UBC) for technical assistance, Dr. Alfonso Lara Quesada (UBC) formaintenance of plant materials, and Ms. Karen Reid (UBC) for excellentsupport with project and laboratory management. The work described inthis paper was supported with funding to JB from Genome British Columbiaand Genome Canada for the Treenomix Conifer Forest Health project http://www.treenomix.ca and the Natural Sciences and Engineering ResearchCouncil of Canada (EWR Steacie Memorial Fellowship and Discovery Grant toJB, Canada Graduate Scholarship to EA and a Postdoctoral Fellowship toDH). JB is supported in part by the University of British ColumbiaDistinguished University Scholars program.Author details1Michael Smith Laboratories, University of British Columbia, 2185 East Mall,Vancouver, B.C., V6T 1Z4, Canada. 2Department of Botany, University ofBritish Columbia, 6270 University Boulevard, Vancouver, B.C., V6T 1Z4,Canada.Authors’ contributionsEA, DH and JB designed experiments, conducted the data analysis andinterpretation of data and results. EA and DH carried out experiments. BHcontributed to LMD method development. EA, DH, and JB wrote themanuscript. All authors read and approved the final manuscript.Received: 7 March 2010 Accepted: 12 June 2010Published: 12 June 2010References1. Esau K: Anatomy of Seed Plants. New York: John Wiley& Sons, Inc.2 1977.2. Franceschi VR, Krokene P, Christiansen E, Krekling T: Anatomical andchemical defenses of conifer bark against bark beetles and other pests.New Phytol 2005, 167(2):353-375.3. Zulak KG, Bohlmann J: Terpenoid biosynthesis and specialized vascularcells of conifer defense. J Integr Plant Biol 2010, 52(1):86-97.4. Krokene P, Solheim H, Krekling T, Christiansen E: Inducible anatomicaldefense responses in Norway spruce stems and their possible role ininduced resistance. Tree Physiol 2003, 23(3):191-197.5. Keeling CI, Bohlmann J: Genes, enzymes and chemicals of terpenoiddiversity in the constitutive and induced defence of conifers againstinsects and pathogens. New Phytol 2006, 170(4):657-675.6. Martin D, Tholl D, Gershenzon J, Bohlmann J: Methyl jasmonate inducestraumatic resin ducts, terpenoid resin biosynthesis, and terpenoidaccumulation in developing xylem of Norway spruce stems. Plant Physiol2002, 129(3):1003-1018.7. Franceschi VR, Krekling T, Christiansen E: Application of methyl jasmonateon Picea abies (Pinaceae) stems induces defense-related responses inphloem and xylem. Am J Bot 2002, 89(4):578-586.8. Miller B, Madilao LL, Ralph S, Bohlmann J: Insect-induced conifer defense.White pine weevil and methyl jasmonate induce traumatic resinosis, denovo formed volatile emissions, and accumulation of terpenoidAbbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 14 of 16synthase and putative octadecanoid pathway transcripts in Sitka spruce.Plant Physiol 2005, 137(1):369-382.9. Sterky F, Regan S, Karlsson J, Hertzberg M, Rohde A, Holmberg A, Amini B,Bhalerao R, Larsson M, Villarroel R, et al: Gene discovery in the wood-forming tissues of poplar: analysis of 5, 692 expressed sequence tags.Proc Natl Acad Sci USA 1998, 95(22):13330-13335.10. Pavy N, Boyle B, Nelson C, Paule C, Giguere I, Caron S, Parsons LS,Dallaire N, Bedon F, Berube H, et al: Identification of conserved corexylem gene sets: conifer cDNA microarray development, transcriptprofiling and computational analyses. New Phytol 2008, 180(4):766-786.11. Tuominen H, Puech L, Fink S, Sundberg B: A radial concentration gradientof indole-3-acetic acid is related to secondary xylem development inhybrid aspen. Plant Physiol 1997, 115(2):577-585.12. Tuominen H, Puech L, Regan S, Fink S, Olsson O, Sundberg B: Cambial-region-specific expression of the Agrobacterium iaa genes in transgenicaspen visualized by a linked uidA reporter gene. Plant Physiol 2000,123(2):531-542.13. Schrader J, Nilsson J, Mellerowicz E, Berglund A, Nilsson P, Hertzberg M,Sandberg G: A high-resolution transcript profile across the wood-formingmeristem of poplar identifies potential regulators of cambial stem cellidentity. Plant Cell 2004, 16(9):2278-2292.14. Gershenzon J, McCaskill D, Rajaonarivony JI, Mihaliak C, Karp F, Croteau R:Isolation of secretory cells from plant glandular trichomes and their usein biosynthetic studies of monoterpenes and other gland products. AnalBiochem 1992, 200(1):130-138.15. Levac D, Murata J, Kim WS, De Luca V: Application of carborundumabrasion for investigating the leaf epidermis: molecular cloning ofCatharanthus roseus 16-hydroxytabersonine-16-O-methyltransferase.Plant J 2008, 53(2):225-236.16. Birnbaum K, Jung JW, Wang JY, Lambert GM, Hirst JA, Galbraith DW,Benfey PN: Cell type-specific expression profiling in plants via cell sortingof protoplasts from fluorescent reporter lines. Nat Methods 2005,2(8):615-619.17. Nelson T, Tausta SL, Gandotra N, Liu T: Laser microdissection of planttissue: what you see is what you get. Annu Rev Plant Biol 2006,57:181-201.18. Hölscher D, Schneider B: Application of laser-assisted microdissection fortissue and cell-specific analysis of RNA, proteins, and metabolites.Progress in Botany Springer Berlin Heidelberg 2008, 141-167.19. Ohtsu K, Smith MB, Emrich SJ, Borsuk LA, Zhou R, Chen T, Zhang X,Timmermans MC, Beck J, Buckner B, et al: Global gene expression analysisof the shoot apical meristem of maize (Zea mays L.). Plant J 2007,52(3):391-404.20. Mustafa D, Kros JM, Luider T: Combining laser capture microdissectionand proteomics techniques. Methods Mol Biol 2008, 428:159-178.21. Moco S, Schneider B, Vervoort J: Plant micrometabolomics: The analysis ofendogenous metabolites present in a plant cell or tissue. J Proteome Res2009, 8(4):1694-1703.22. Emmert-Buck MR, Bonner RF, Smith PD, Chuaqui RF, Zhuang Z,Goldstein SR, Weiss RA, Liotta LA: Laser capture microdissection. Science1996, 274(5289):998-1001.23. Moncada CA, Clarkson A, Perez-Leal O, Merali S: Mechanism and tissuespecificity of nicotine-mediated lung S-adenosylmethionine reduction. JBiol Chem 2008, 283(12):7690-7696.24. Li SH, Schneider B, Gershenzon J: Microchemical analysis of laser-microdissected stone cells of Norway spruce by cryogenic nuclearmagnetic resonance spectroscopy. Planta 2007, 225(3):771-779.25. Murata J, De Luca V: Localization of tabersonine 16-hydroxylase and 16-OH tabersonine-16-O-methyltransferase to leaf epidermal cells definesthem as a major site of precursor biosynthesis in the vindoline pathwayin Catharanthus roseus. Plant J 2005, 44(4):581-594.26. Xie Z, Kapteyn J, Gang DR: A systems biology investigation of the MEP/terpenoid and shikimate/phenylpropanoid pathways points to multiplelevels of metabolic control in sweet basil glandular trichomes. Plant J2008, 54(3):349-361.27. Thiel J, Muller M, Weschke W, Weber H: Amino acid metabolism at thematernal-filial boundary of young barley seeds: a microdissection-basedstudy. Planta 2009, 230(1):205-213.28. Day RC, Herridge RP, Ambrose BA, Macknight RC: Transcriptome analysisof proliferating Arabidopsis endosperm reveals biological implications forthe control of syncytial division, cytokinin signaling, and geneexpression regulation. Plant Physiol 2008, 148(4):1964-1984.29. Schad M, Lipton MS, Giavalisco P, Smith RD, Kehr J: Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem massspectrometry for tissue-specific protein profiling of laser-microdissectedplant samples. Electrophoresis 2005, 26(14):2729-2738.30. Keeling CI, Bohlmann J: Diterpene resin acids in conifers. Phytochemistry2006, 67(22):2415-2423.31. Fleige S, Pfaffl MW: RNA integrity and the effect on the real-time qRT-PCR performance. Mol Aspects Med 2006, 27(2-3):126-139.32. Zulak KG, Lippert DN, Kuzyk MA, Domanski D, Chou T, Borchers CH,Bohlmann J: Targeted proteomics using selected reaction monitoringreveals the induction of specific terpene synthases in a multi-level studyof methyl jasmonate-treated Norway spruce (Picea abies). Plant J 2009,60(6):1015-1030.33. Hudgins JW, Christiansen E, Franceschi VR: Induction of anatomicallybased defense responses in stems of diverse conifers by methyljasmonate: a phylogenetic perspective. Tree Physiol 2004, 24(3):251-264.34. Krokene P, Nagy NE, Krekling T: Traumatic resin ducts and polyphenolicparenchyma cells in conifers. Induced Plant Resistance to Herbivory SpringerNetherlandsSchaller A 2008, 147-169.35. Phillips MA, Walter MH, Ralph SG, Dabrowska P, Luck K, Uros EM, Boland W,Strack D, Rodriguez-Concepcion M, Bohlmann J, et al: Functionalidentification and differential expression of 1-deoxy-D-xylulose 5-phosphate synthase in induced terpenoid resin formation of Norwayspruce (Picea abies). Plant Mol Biol 2007, 65(3):243-257.36. Ralph SG, Chun HJ, Kolosova N, Cooper D, Oddy C, Ritland CE, Kirkpatrick R,Moore R, Barber S, Holt RA, et al: A conifer genomics resource of 200,000spruce (Picea spp.) ESTs and 6,464 high-quality, sequence-finished full-length cDNAs for Sitka spruce (Picea sitchensis). BMC Genomics 2008,9:484.37. Pavy N, Paule C, Parsons L, Crow JA, Morency MJ, Cooke J, Johnson JE,Noumen E, Guillet-Claude C, Butterfield Y, et al: Generation, annotation,analysis and database integration of 16,500 white spruce EST clusters.BMC Genomics 2005, 6:144.38. Ralph SG, Yueh H, Friedmann M, Aeschliman D, Zeznik JA, Nelson CC,Butterfield YS, Kirkpatrick R, Liu J, Jones SJ, et al: Conifer defence againstinsects: microarray gene expression profiling of Sitka spruce (Piceasitchensis) induced by mechanical wounding or feeding by sprucebudworms (Choristoneura occidentalis) or white pine weevils (Pissodesstrobi) reveals large-scale changes of the host transcriptome. Plant CellEnviron 2006, 29(8):1545-1570.39. Lippert D, Chowrira S, Ralph SG, Zhuang J, Aeschliman D, Ritland C,Ritland K, Bohlmann J: Conifer defense against insects: proteome analysisof Sitka spruce (Picea sitchensis) bark induced by mechanical woundingor feeding by white pine weevils (Pissodes strobi). Proteomics 2007,7(2):248-270.40. Lippert DN, Ralph SG, Phillips M, White R, Smith D, Hardie D, Gershenzon J,Ritland K, Borchers CH, Bohlmann J: Quantitative iTRAQ proteome andcomparative transcriptome analysis of elicitor-induced Norway spruce(Picea abies) cells reveals elements of calcium signaling in the earlyconifer defense response. Proteomics 2009, 9(2):350-367.41. Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U,Putnam N, Ralph S, Rombauts S, Salamov A, et al: The genome of blackcottonwood, Populus trichocarpa (Torr. & Gray). Science 2006,313(5793):1596-1604.42. Jansson S, Douglas CJ: Populus: a model system for plant biology. AnnuRev Plant Biol 2007, 58:435-458.43. Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N,Aubourg S, Vitulo N, Jubin C, et al: The grapevine genome sequencesuggests ancestral hexaploidization in major angiosperm phyla. Nature2007, 449(7161):463-467.44. Velasco R, Zharkikh A, Troggio M, Cartwright DA, Cestaro A, Pruss D,Pindo M, Fitzgerald LM, Vezzulli S, Reid J, et al: A high quality draftconsensus sequence of the genome of a heterozygous grapevinevariety. PLoS One 2007, 2(12):e1326..45. Zhao S, Fernald RD: Comprehensive algorithm for quantitative real-timepolymerase chain reaction. J Comput Biol 2005, 12(8):1047-1064.46. Lewinsohn E, Gijzen M, Savage TJ, Croteau R: Defense mechanisms ofconifers: Relationship of monoterpene cyclase activity to anatomicalAbbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 15 of 16specialization and oleoresin monoterpene content. Plant Physiol 1991,96(1):38-43.47. O’Maille PE, Chappell J, Noel JP: A single-vial analytical and quantitativegas chromatography-mass spectrometry assay for terpene synthases.Anal Biochem 2004, 335(2):210-217.48. Lewinsohn E, Savage TJ, Gijzen M, Croteau R: Simultaneous analysis ofmonoterpenes and diterpenoids of conifer oleoresin. PhytochemicalAnalysis 1993, 4(5):220-225.doi:10.1186/1471-2229-10-106Cite this article as: Abbott et al.: Laser microdissection of conifer stemtissues: Isolation and analysis of high quality RNA, terpene synthaseenzyme activity and terpenoid metabolites from resin ducts andcambial zone tissue of white spruce (Picea glauca). BMC Plant Biology2010 10:106.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitAbbott et al. BMC Plant Biology 2010, 10:106http://www.biomedcentral.com/1471-2229/10/106Page 16 of 16

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0223547/manifest

Comment

Related Items