UBC Faculty Research and Publications

CD248 facilitates tumor growth via its cytoplasmic domain Maia, Margarida; DeVriese, Astrid; Janssens, Tom; Moons, Michaël; Lories, Rik J; Tavernier, Jan; Conway, Edward M May 8, 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


52383-12885_2011_Article_2649.pdf [ 1.26MB ]
JSON: 52383-1.0223545.json
JSON-LD: 52383-1.0223545-ld.json
RDF/XML (Pretty): 52383-1.0223545-rdf.xml
RDF/JSON: 52383-1.0223545-rdf.json
Turtle: 52383-1.0223545-turtle.txt
N-Triples: 52383-1.0223545-rdf-ntriples.txt
Original Record: 52383-1.0223545-source.json
Full Text

Full Text

RESEARCH ARTICLE Open AccessCD248 facilitates tumor growth via itscytoplasmic domainMargarida Maia1,2,3,4, Astrid DeVriese1,2, Tom Janssens1,2, Michaël Moons1,2, Rik J Lories5, Jan Tavernier3,4 andEdward M Conway1,2,6*AbstractBackground: Stromal fibroblasts participate in the development of a permissive environment for tumor growth,yet molecular pathways to therapeutically target fibroblasts are poorly defined. CD248, also known as endosialin ortumor endothelial marker 1 (TEM1), is a transmembrane glycoprotein expressed on activated fibroblasts. Werecently showed that the cytoplasmic domain of CD248 is important in facilitating an inflammatory response in amouse model of arthritis. Others have reported that CD248 gene inactivation in mice results in dampened tumorgrowth. We hypothesized that the conserved cytoplasmic domain of CD248 is important in regulating tumorgrowth.Methods: Mice lacking the cytoplasmic domain of CD248 (CD248CyD/CyD) were generated and evaluated in tumormodels, comparing the findings with wild-type mice (CD248WT/WT).Results: As compared to the response in CD248WT/WT mice, growth of T241 fibrosarcomas and Lewis lungcarcinomas was significantly reduced in CD248CyD/CyD mice. Tumor size was similar to that seen with CD248-deficient mice. Conditioned media from CD248CyD/CyD fibroblasts were less effective at supporting T241fibrosarcoma cell survival. In addition to our previous observation of reduced release of activated matrixmetalloproteinase (MMP)-9, CD248CyD/CyD fibroblasts also had impaired PDGF-BB-induced migration and expressedhigher transcripts of tumor suppressor factors, transgelin (SM22a), Hes and Hey1.Conclusions: The multiple pathways regulated by the cytoplasmic domain of CD248 highlight its potential as atherapeutic target to treat cancer.Keywords: stromal fibroblast suppressor, transgenic, endosialin, tumor endothelial markerBackgroundIn normal tissues, fibroblasts are the major cellular com-ponent of connective tissue and are key participants inmaintaining homeostasis of the extracellular matrix(ECM), regulating epithelial differentiation, inflammationand wound healing. Fibroblasts not only synthesize themajor constituents of the ECM, but they release ECM-degrading proteinases to assure normal matrix turnoverand function. Fibroblasts also secrete multiple growthfactors and support mesenchymal-epithelial interactionsvia paracrine and juxtacrine signaling. Within the tumorstroma, subpopulations of fibroblasts emerge and exhibitan “activated” phenotype, whereupon they acquirecharacteristics that can be distin guished from normalfibroblasts and often portend a bad prognosis [1]. Theseactivated fibroblasts, also referred to as peritumoral fibro-blasts, cancer-associated fibroblasts, reactive stromalfibroblasts and tumor-associated fibroblasts, are charac-terized by the expression of myofibroblast-like cell mar-kers, including alpha smooth muscle actin (a-SMA) anddesmin, and secrete factors that generally promote cellgrowth and proliferation (e.g. hepatocyte growth factor(HGF), epidermal growth factor (EGF), vascular endothe-lial growth factor (VEGF), insulin growth factor 2 (IGF2),fibroblast-like growth factor 2 (FGF2), transforminggrowth factor-beta (TGF-b), ECM-degrading proteinasessuch as MMPs, cytokines such as tumor necrosis factor(TNF)-aand interleukin (IL)-1b and chemokines [2-4].* Correspondence: emconway@exchange.ubc.ca1Vesalius Research Center, VIB, Herestraat 49, 9th floor, 3000 BelgiumFull list of author information is available at the end of the articleMaia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162© 2011 Maia et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.Tumor-associated fibroblasts are believed to originatefrom tissue-resident fibroblasts and mesenchymal stemcells, by recruitment of bone marrow-derived cells fromthe circulation [5] and/or by epithelial-to-mesenchymaltransition [6]. The mechanisms by which fibroblastsbecome activated are not well-defined, although TGF-b,EGF, platelet-derived growth factor (PDGF)-BB, FGF2,reactive oxygen species, complement factors, and integ-rins have all been implicated [7-9]. Although there aremajor gaps in our understanding of the mechanisms bywhich tumor-associated fibroblasts evolve, cell surfacemarkers that are specific to these cells are attractivecandidate targets for therapy.CD248, also referred to as endosialin or tumorendothelial marker 1 (TEM1), is a highly sialylated cellsurface glycoprotein [10-12] that has been shown to berestricted to activated stromal and perivascular fibro-blasts [13-16]}. During normal embryonic development,CD248 is highly expressed [17,18], but by full-term,CD248 has almost entirely disappeared. Postnatally,expression is retained only in the endometrium, in bonemarrow fibroblasts and in the corpus luteum [11,15,19].However, CD248 is frequently upregulated in tumors[10,15,20], with particularly high expression in tumorassociated stromal fibroblasts in sarcomas [19] and pri-mary and secondary brain tumors [21]. CD248 is alsoexpressed in human mesenchymal stem cells from bonemarrow, which may differentiate into tumor stromalfibroblasts [22]. In breast cancer and neuroblastomas,CD248 expression levels have been directly correlatedwith tumor grade, invasiveness and poor prognosis[23,24]. The physiologic importance of CD248 in cancerprogression and its potential utility as a therapeutic tar-get is further highlighted by the finding that lack ofCD248 in mice results in resistance to the growth andmetastasis of some tumors [25]. Therefore, delineatingthe hitherto unknown mechanisms by which CD248regulates tumor growth is important for the develop-ment of therapeutic strategies.The human CD248 gene is intronless and encodes a95-kDa multi-domain type I transmembrane protein of757 amino acids [26]. The protein comprises an N-terminal C-type lectin-like domain, a Sushi domain,three epidermal growth factor (EGF)-like repeats, amucin-like region, a single transmembrane segment anda 51 amino acid residue cytoplasmic tail with potentialsites for phosphorylation [27]. CD248 belongs to afamily of proteins containing C-type lectin-like domainswhich have functions in cell adhesion and regulation ofinflammation [28,29].Few analyses have been performed to elucidate themechanisms by which CD248 regulates tumor growth.In vitro studies suggest that the extracellular region ofCD248 may interact with ECM proteins, therebyfacilitating activation of MMP-9, cell migration andmetastasis formation [30,31]. We recently demon-strated that the highly conserved cytoplasmic domainof CD248 mediates signals that regulate stromal fibro-blast function in an experimental model of rheumatoidarthritis [32] and hypothesized that it would play asimilarly important role in modulating tumor growth.We show that lack of the cytoplasmic domain ofCD248 in transgenic mice results in reduced tumorgrowth, with alterations in fibroblast signaling viaTGF-b, PDGF-BB, and Notch pathways, and establish-ment of a pattern of gene expression favoring tumorsuppression. The findings extend previous reports ofthe importance of CD248 in tumor growth and pointto the cytoplasmic domain of CD248 as a potentialtherapeutic target in neoplasia.MethodsMiceTransgenic mice lacking CD248 (CD248KO/KO) or thecytoplasmic domain of CD248 (CD248CyD/CyD) werepreviously generated and genotyped as reported [32].Mice were maintained on a C57Bl6 genetic backgroundand corresponding wild-type mice (CD248WT/WT), gen-erated from siblings during breeding of the CD248transgenic lines, were used as controls.In vivo tumor modelsHeterotopic implantation of Lewis Lung Carcinoma(LLC) tumor fragments was performed as described in[25]. Briefly, 0.5 × 106 LLC cells were injected subcuta-neously (s.c.) into the right flank of 5-week-oldCD248WT/WT mice. After 20 days, mice were sacrificedand tumors dissected and cut into 1 mm3 pieces. 6-7week old mice were anaesthetized with isoflurane andthe cecum exteriorized via a small incision parallel tothe midline. A single tumor fragment was implanted onthe serosal surface of the cecum. Tumors were dissected15 days after implantation, and tumor volume andweight were measured. Volume was calculated using theformula, length × width2 × π/6.For T241 fibrosarcoma studies, 1 × 106 cells in 200 μLPBS or 7.5 × 104 LLC cells in 50 μL PBS were injecteds.c. into the right flank or footpad of 7-9 week-old mice.Tumor size was evaluated every 2 days using a caliperand weights were obtained after dissection. Studies wereperformed in a blinded manner to the investigator.The model of orthotopic growth and metastasis ofpancreatic adenocarcinoma in mice was performedexactly as reported [33]. Briefly, mice were anaesthetizedwith isoflurane and the stomach exteriorized via anabdominal midline incision. 1 × 106 PancO2 pancreaticadenocarcinoma cells in 25 μL PBS were injected intothe head of the pancreas. At day 11, primary tumorsMaia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 2 of 12were dissected, and tumor volume and weight weredetermined.Immunohistochemistry and quantification of tumor vesseldensityTissue samples were fixed with 2% paraformaldehydeovernight at 4°C, dehydrated and embedded in paraffin.Serial 7 μm sections were cut for histological analysis.Immunohistochemical detection was performed usingthe following antibodies: rat anti-CD31 (BD Pharmin-gen, Erembodegem, Belgium), mouse anti-SMA-Cy3(Dako, Glostrup, Denmark), phospho-histone H3 (CellSignaling Technology, Bioké, Leiden, the Netherlands)and rabbit anti-caspase 3 (Abcam, Cambridge, MA,USA). Morphometric analyses were performed using aZeiss Imager Z1 or AxioPlan 2 microscope with KS300image analysis software. For all studies, 6-8 optical fieldsper tumor section, at 40× or 80× magnification, wererandomly chosen and analyzed. Cell proliferation wascalculated as the number of phospho-histone H3 permm2. Vessel density was calculated as the number ofCD31-positive vessels per mm2 and pericyte coverage asthe percentage of CD31-positive vessels that are coveredby SMA-positive cells. Vessel distribution was deter-mined by calculating the frequency distribution of ves-sels with different areas.In vitro studies with murine embryonic fibroblastsMurine embryonic fibroblasts were isolated from E13.5embryos as previously reported [32]. Fibroblasts werecultured in DMEM with 10% fetal calf serum (FCS) andused at passages 2-5. To assess the response to exogen-ous growth factors, 1.5 × 105 fibroblasts were seeded in6-well plates. After 18 hours of serum-starvation, cellswere stimulated with 20 ng/mL recombinant rat PDGF-BB (R&D Systems, Abingdon, UK) for 30 minutes or 3ng/mL recombinant human TGF-b1 (R&D Systems) for72 hours. To assess the role of direct contact ofendothelial cells, 1.5 × 105 fibroblasts were mixed withan equal number of the human endothelial cell line,EaHy926 [34] and cultured in DMEM containing 10%FCS for 24 hours. Cells were finally processed forreverse transcription PCR.Murine embryonic fibroblast migration studies2.5 × 104 fibroblasts were seeded in the upper chamberof 8 μm-pore size transwells (Costar, Elscolab, Kruibeke,Belgium). DMEM/1% FBS with or without 20 ng/mLPDGF-BB was added to the bottom well to stimulatemigration. After 18 hours of incubation, cells were fixedin 1% paraformaldehyde and stained with 0.5% crystalviolet solution. The number of migrated cells was quan-tified by counting five high-power magnification fieldsper transwell [14]. All studies were repeated with 3independent clones of fibroblasts from each genotype,yielding comparable results. Thus, representative resultswere reported.Tumor cell survival assays5 × 103 T241 fibrosarcoma cells or PancO2 cells wereseeded in 96-well plates and serum-starved for 6 hoursbefore adding conditioned medium of murine embryo-nic fibroblasts grown in DMEM containing 10% FCS orstimulated with serum-free DMEM containing 3 ng/mLrecombinant human TGF-b1 for 24 hours. The numberof viable cells was determined 24, 48 and 72 hours afterusing the CellTiter 96 Aqueous One Solution (Promega,Leiden, The Netherlands) according to manufacturer’sinstructions.Quantitative reverse transcription (qRT)-PCRRNA was extracted from cells using Qiagen RNeasy kit.0.5-1 μg of total RNA was used for reverse transcriptionwith QuantiTect Reverse Transcription kit (Qiagen, KJVenlo, the Netherlands). qRT-PCR was performed usingTaqMan Fast Universal PCR Master Mix (Applied Bio-systems, Halle, Belgium) and commercially available orhome-made primers and probes for the genes of interest(Table 1). Analyses were performed using ABI7500 FastReal-Time PCR System (Applied Biosystems, Halle, Bel-gium). All experiments were performed a minimum of 3times, each in at least triplicate.StatisticsData represent mean ± standard error of the mean(SEM) of experiments performed at least in duplicate.Statistical significance was calculated by t-test or two-way ANOVA (Prism 5.0), with p < 0.05 considered sta-tistically significant.Animal careAll experimental animal procedures were approved bythe Institutional Animal Care and Research AdvisoryCommittee of the K. U. Leuven.ResultsThe cytoplasmic domain of CD248 is required for thegrowth of some tumorsStudies with CD248-deficient mice indicate that CD248is necessary for tumor growth [25]. In an experimentalmodel of rheumatoid arthritis, we recently determinedthat CD248KO/KO mice and mice lacking the cytoplasmicdomain of CD248 (CD248CyD/CyD mice) develop lesssevere arthritis than CD248WT/WT mice, the differentialresponse likely due to alterations in synovial fibroblastfunction [32]. Based on these data, we predicted that thehighly conserved cytoplasmic domain of CD248 wouldmediate signals that critically contribute to tumorMaia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 3 of 12growth. To test this hypothesis, we first validated therole of CD248 in tumor growth in CD248KO/KO mice,comparing the response with corresponding CD248WT/WT mice. T241 fibrosarcoma cells were injected s.c. andtumor size was monitored. Over a period of 23 days,tumors in the CD248KO/KO mice were significantly smal-ler than in the CD248WT/WT mice (n = 6, p = 0.0009)(Figure 1A). The findings are confirmatory of an impor-tant role for CD248 in tumor growth.We next assessed whether the cytoplasmic domain ofCD248 is required for growth of the T241 fibrosarco-mas. We observed a significant reduction in tumor sizeand tumor weight of s.c. T241 fibrosarcoma tumors inthe CD248CyD/CyD mice as compared to CD248WT/WTmice (n = 6, p < 0.0001) (Figure 1B). In experimentsreplicating the setup of Nanda and coworkers [25], wealso implanted LLC tumor fragments heterotopically onthe serosal surface of the cecum of CD248WT/WT orCD248CyD/CyD mice. Again, CD248CyD/CyD mice devel-oped tumors that were significantly smaller than in theCD248WT/WT mice (n = 7, p < 0.05) (Figure 1C).Notably, not all tumors were resistant to growth in theCD248CyD/CyD mice, i.e. there were no differences in thegrowth of primary orthotopic PancO2 pancreatic adeno-carcinomas (Figure 1D) or after injection of LLC cellsinto the footpads (Figure 1E). Thus, similar to what wasobserved by others with CD248-deficient mice [25],CD248 does not regulate the growth of all tumors.Angiogenesis-independent reduced tumor growth inCD248CyD/CyD miceAlthough the dependence of tumor progression onangiogenesis is well-documented [35], additional factorsalso modify tumor growth, sometimes apparently inde-pendent of new vessel growth [36,37]. This is relevantto CD248, as two groups have reported a CD248-depen-dent inverse relationship between microvessel densityand size of tumor. Tumors of the large intestine derivedfrom LLC cells [25] and intracranial glioblastomasderived from U87MG cells [21] were reportedly smallerin size and weight in CD248-deficient mice, yet thesetumors had higher vessel density than those in wild-typemice. We assessed the role of the cytoplasmic tail ofCD248 in modulating the relationship between tumorgrowth and angiogenesis by first examining vessel den-sity in the s.c. T241 fibrosarcomas in CD248CyD/CyD andCD248WT/WT mice at the end of the observation period.Endothelial cell-specific CD31 staining of the tumorsrevealed that vessel density was not significantly differ-ent in tumors from CD248WT/WT and CD248CyD/CyDmice (Figure 1F). We also did not detect differencesbased on genotype when we stratified the results accord-ing to the lumen area of the vessels (data not shown).The number of vessels covered by SMA-positive peri-cytes was also not affected by lack of the cytoplasmicdomain of CD248 (Figure 1G). Notably, we did notobserve an inverse relationship between vessel densityand tumor size in our studies with the CD248CyD/CyDversus CD248WT/WT mice, findings that contrast withthose reported in studies using CD248-deficient mice[21,25]. This prompted us to examine T241 tumorangiogenesis in our CD248KO/KO mice, with the aim ofestablishing whether the cytoplasmic domain is themajor determining factor. In spite of significantly smal-ler tumors in the CD248KO/KO versus CD248WT/WTmice at the time of sacrifice at Day 23 (Figure 1A), ves-sel density and pericyte coverage of s.c. T241 fibrosarco-mas in CD248WT/WT and CD248KO/KO mice were notsignificantly different (endothelial-specific CD31 stain-ing, vessels per mm2: 107 ± 18 vessels/mm2 inCD248WT/WT versus 90 ± 8 vessels/mm2 in CD248KO/KO; n = 7, p = 0.40; % vessels covered by smooth muscleactin (SMA)-positive cells: 23.6 ± 5.3 in CD248WT/WTversus 26.7 ± 3.1 in CD248KO/KO; n = 7, p = 0.619).Overall, the preceding findings indicate that loss ofCD248 or its cytoplasmic domain results in an uncou-pling of the link between tumor growth and vessel den-sity, and that alterations in stroma-derived factorsregulated by CD248 may underlie the differences intumor growth.Table 1 List of primers and probes used for qRT-PCRGene Forward Reverse ProbeHes TCAGCGAGTGCATGAACGA CCTCGGTGTTAACGCCCTC TGACCCGCTTCCTGTCCACGTGGene Sequence ID (Commercially available primers)b-actin Mm00607939_s1CD248 Mm0054785_s1Hey1 Mm00468865_m1Jagged1 Mm00496902_m1hJagged1 Hs01070028_g1Notch3 Mm00435270_m1SM22a Mm00441660_m1Maia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 4 of 12Cytoplasmic domain of CD248 modulates stromalfibroblast functionUsing murine embryonic fibroblasts as a model [38-40],we recently established that in spite of having normalantigen levels, fibroblasts from CD248CyD/CyD mice areless adhesive to monocytoid cells and express lowerlevels of placental growth factor (PlGF), VEGF, VEGFreceptor-1 (VEGFR-1) and matrix metalloproteinase(MMP)-9 [32]. These findings are consistent with ourobservation that the CD248CyD/CyD mice are resistant totumor growth, but suggest that there may be multiplepathways by which the cytoplasmic domain of CD248regulates fibroblast function to facilitate tumor progres-sion. We therefore tried to uncover additional CD248-dependent alterations in stromal fibroblasts that couldhelp to explain the smaller tumors in CD248CyD/CyDmice.a. Elevated expression of the tumor suppressor SM22a inCD248CyD/CyD fibroblastsRecent studies support the concept that activated stro-mal fibroblasts co-evolve with tumor cells and that theiractivation and survival is sustained in part by alteredexpression of tumor suppressor genes [41,42].Figure 1 Role of CD248 in tumor growth in mice. A. Growth of T241 tumors is significantly reduced in CD248KO/KO mice (n = 6, p < 0.001). B.Growth of T241 tumors is significantly reduced in CD248CyD/CyD mice (n = 6, p < 0.001). C. LLC tumors implanted in the cecum are significantlysmaller in CD248CyD/CyD mice (n = 7, p < 0.05). D. PancO2 tumors grown orthotopically are not different in size in CD248WT/WT and CD248CyD/CyDmice (n = 4, p = not significant). E. LLC tumor growth in the footpad is similar in CD248WT/WT and CD248CyD/CyD mice (n = 6, p = notsignificant). F-G. Morphometric quantification reveals that there are no genotype-dependent differences in vessel density (F) or PC coverage (G)(n = 7, p = not significant). Data represent the mean ± SEM. Asterisks denote statistical significance.Maia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 5 of 12Transgelin (SM22a) is a cytoplasmic actin-binding pro-tein, expressed by mesenchymal cells and tumor fibro-blasts [43] and which represses TGF-b-induced MMP-9expression [44], reduces cell migration, and has tumorsuppressor properties [45]. We assessed whether expres-sion of SM22a is dependent on the integrity of the cyto-plasmic domain of CD248. Baseline transcript levels ofSM22a were significantly higher in CD248CyD/CyD fibro-blasts as compared to CD248WT/WT fibroblasts (Figure2). Transcript levels of SM22a in the CD248WT/WTfibroblasts increased to a non-significant extent inresponse to TGF-b. In contrast, the transcript levels ofSM22a, already elevated in the CD248CyD/CyD fibro-blasts, increased further upon TGF-b stimulation tolevels significantly higher than in the TGF-b stimulatedCD248WT/WT fibroblasts. The findings indicate that thecytoplasmic domain of CD248 participates in the sup-pression of SM22a expression, providing a mechanismto help explain reduced stromal cell activation, migra-tion and MMP-9 release and thus, less tumor expansionin the CD248CyD/CyD mice.b. The cytoplasmic domain of CD248 facilitates PDGF-BB-induced cell migrationWith altered expression of SM22a, we hypothesized thatCD248CyD/CyD fibroblasts would also exhibit resistanceto factors that promote their migration in a tumor set-ting. PDGF-BB is a potent chemoattractant for stromalcells and a trigger for recruitment of tumor associatedfibroblasts (reviewed in [46]). Experimental evidencesupports a role for PDGF signaling in cancer progres-sion, with rationale for targeting this pathway in tumor-associated stromal fibroblasts [47,48]. Moreover, it hasbeen shown in some studies that fibroblasts requireCD248 for optimal migratory response [14,49]. Todetermine whether the cytoplasmic domain of CD248regulates PDGF-BB-induced cell migration, CD248WT/WT and CD248CyD/CyD fibroblasts were stimulated tomigrate across transwells toward recombinant PDGF-BB. In the absence of PDGF-BB, there were no differ-ences in the number of migrated CD248WT/WT andCD248CyD/CyD fibroblasts. For both genotypes, PDGF-BBinduced a significant increase in fibroblast migration ina dose-dependent manner. However, at the two concen-trations of PDGF-BB tested, CD248CyD/CyD fibroblastmigration was significantly less as compared to themigration of CD248WT/WT fibroblasts (Figure 3). Over-all, these data support the importance of the cytoplas-mic domain of CD248 in facilitating PDGF-BB mediatedstromal fibroblast migration, a process that is importantin tumorigenesis.c. CD248 suppresses Notch3 signaling and dampens Hesand Hey1 gene expressionAlthough activation of Notch may promote cancerdevelopment [50], Notch may also have a tumor sup-pressor function, partly by promoting cellular differen-tiation and maturation of mesenchyme derivedperivascular cells [51,52]. Notch signaling requires acti-vation by the ligand Jagged1, which induces cleavage ofNotch3 and release of Notch intracellular domain(NICD), nuclear translocation of which further activatesNotch3. This is accompanied by transcription of severalgenes, including Hes, Hey1 and SM22a, all of whichmay exhibit tumor suppressor properties [45,53,54].Notch3 also feeds back and promotes Jagged1 expres-sion in pericytes, thereby maintaining their differentiatedstate [55].Figure 2 CD248-dependent expression of SM22a. CD248CyD/CyDfibroblasts express higher transcript levels of SM22a at baseline (n =4, p < 0.0001) and after TGF-b stimulation for 72 hours (n = 4, p =0.0004). Results reflect the mean ± SEM. Asterisks denote statisticalsignificance.Figure 3 CD248 modulates PDGF-BB mediated cell migration.A. Migration of fibroblasts across a transwell was quanitified asdescribed in Methods. PDGF-induced migration of CD248CyD/CyDfibroblasts is significantly reduced as compared with CD248WT/WTfibroblasts (n = 6). Results reflect the mean ± SEM. * p < 0.05; ** p< 0.001.Maia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 6 of 12To determine whether the cytoplasmic domain ofCD248 alters Notch3 signaling, we measured genesinvolved in the Notch pathway in isolated fibroblastsand in fibroblasts that were co-cultured with equalnumbers of human EaHy926 endothelial cells. Baselinelevels of Notch3, Jagged1, Hes and Hey1 transcriptswere significantly increased in CD248CyD/CyD fibroblastsas compared with CD248WT/WT fibroblasts (Figure 4),indicating that Notch3 signaling and transcription ofHes and Hey1 in isolated fibroblasts is dampened viasignals mediated by the cytoplasmic domain of CD248.Human endothelial Jagged1 is known to induceNotch signaling in murine fibroblasts [55] and the useof different species cells in co-culture allowed us todistinguish the cellular source of each gene. Asexpected, contact of endothelial cells with CD248WT/WT fibroblasts resulted in an increase in expression ofthe transcripts for Notch3, Jagged1, Hes and Hey1Figure 4 Effects of CD248 on Notch3 signaling. Baseline transcript levels of Notch3 (A), Jagged1 (B), Hes (C) and Hey1(D), are increased inCD248CyD/CyD fibroblasts as compared with CD248WT/WT fibroblasts(n = 4, p = 0.0139 for Notch3; p = 0.0041 for Jagged1; p = 0.00067 for Hes; p= 0.0051 for Hey1). Fibroblasts were also co-cultured with human EaHy926 endothelial cells for 24 hours (A-D), causing further upregulation ofthe transcripts for both genotypes. E. Transcript levels of CD248 in CD248WT/WT and CD248CyD/CyD fibroblasts are significantly reduced to similarlevels after co-culture with EaHy926 endothelial cells (n = 4).Maia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 7 of 12(Figure 4). When CD248CyD/CyD fibroblasts were co-cultured with endothelial cells, transcript levels ofNotch3, Jagged1, Hes and Hey1 also increased as com-pared with fibroblasts alone. Responses were notaffected by changes in endothelial expression ofJagged1, since Jagged1 was similarly upregulated inendothelial cells co-cultured with either CD248CyD/CyDor CD248WT/WT fibroblasts (copies of human Jagged1per 1000 copies of b-actin: 740 + 70 in co-cultureswith CD248WT/WT fibroblasts versus 710 + 70 in co-cultures with CD248CyD/CyD fibroblasts, n = 4, p = notsignificant). Although Notch3, Hes and Hey1 geneexpression were still higher in CD248CyD/CyD fibroblastthan in CD248WT/WT fibroblasts in the co-culture con-ditions, the differences did not achieve statistical sig-nificance. We considered that this might be an in vitroeffect due to endothelial contact-induced differentia-tion and maturation of the fibroblasts, which wouldthus suppress CD248 expression and diminish the dif-ferential effect of the absent cytoplasmic domain of themolecule on Notch signaling. Indeed, under these co-culture conditions, CD248 transcript levels were signif-icantly reduced by >50% in both the CD248WT/WT andCD248CyD/CyD fibroblasts (Figure 4E).Taken together, the findings support the concept thatsuppression of CD248 or interfering with signaling viaits cytoplasmic domain may be associated with increasedmaturation of tumor stromal or perivascular fibroblastsand expression of tumor suppressor genes.CD248-dependent release of soluble factors fromfibroblasts modulates T241 tumor cell proliferationThe preceding studies underscore the role of the cyto-plasmic domain of CD248 in modulating genes that regu-late stromal fibroblast differentiation, maturation andmigration and the expression of tumor suppressor genes.We recently reported that CD248CyD/CyD fibroblastsexpress reduced amounts of VEGF, PlGF and activeMMP-9 [32] and considered that other soluble factorsmight be secreted in a CD248-dependent manner thatregulate tumor cell proliferation. We therefore assessedthe effects of conditioned media (CM) from the fibro-blasts of CD248WT/WT and CD248CyD/CyD on T241 fibro-sarcoma cell proliferation. After 24 hours, tumor cellviability with CM from the different genotype fibroblastswas not significantly different (Figure 5A). However, at48 hours and 72 hours, the number of T241 fibrosarcomacells exposed to CM from the CD248CyD/CyD fibroblastswas significantly lower as compared to those exposed toCM from the CD248WT/WT fibroblasts. Although thereappeared to be a similar CD248-dependent effect onPancO2 cell survival, the differences did not achieve sta-tistical significance (Figure 5B). These findings, which areconsistent with those observed in vivo, indicate that thecytoplasmic domain of CD248 modulates the release offactors from fibroblasts that differentially promote thesurvival of specific tumor cells.DiscussionCD248 was originally believed to be a tumor endothelialcell marker, and thus referred to as endosialin or TEM1[10-12]. CD248 is now recognized to be primarilyexpressed on the surface of mesenchymal stem cells,activated stromal fibroblasts and pericytes [16], cellsthat may contribute to fibrovascular network expansionand tumor progression [5]. While several investigatorshave shown that CD248 plays an important role intumor growth and stromal expansion [13-15,21,25] withexpression levels that have been correlated with tumorprogression [23,24], the mechanisms by which CD248functions and the key structural domains involved, haveremained a mystery. In our studies, we established thatthe cytoplasmic domain of CD248 is a key regulator oftumor growth and that mice lacking this domain areresistant to growth of T241 fibrosarcoma tumors andheterotopic LLC tumors.Figure 5 CD248-dependent fibroblast release of trophic factors that regulate tumor cell survival. T241 fibrosarcoma cells (A) and PancO2pancreatic adenocarcinoma cells (B) were grown in conditioned media (CM) from CD248WT/WT fibroblasts and CD248CyD/CyD fibroblasts and cellviability was quantified at 24, 48 and 72 hours as described in Methods. At 48 hours (n = 3) and 72 hours (n = 6), the number of T241 cellsexposed to CM from the CD248CyD/CyD fibroblasts was significantly lower as compared to those exposed to CM from the CD248WT/WT fibroblasts.No differences in viability were detected with the PancO2 cells. Data represent the mean ± SEM. * p < 0.05; ** p < 0.01.Maia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 8 of 12Activated fibroblasts dynamically interact with consti-tuents of the stromal compartment and participate intumor progression via several mechanisms, including forexample, remodeling the ECM, promoting the recruit-ment of inflammatory cells, enhancing nutritional sup-port of the stromal microenvironment, and by secretingan array of pro-lymph/angiogenic and autocrine andparacrine acting cellular growth factors [6,56-58]. Thecytoplasmic domain of CD248 is a critical enabler forstromal fibroblast activation, endowing the fibroblastwith several tumor-promoting properties. Tumor fibro-blasts can achieve and maintain an activated state in thetumor microenvironment by acquiring epigenetic and/orgenetic changes that mitigate the function of tumor sup-pressor genes, such as p53 and PTEN in breast cancer[41,42]. In this manner, activated fibroblasts can exhibita phenotype that favors proliferation and an enhancedresponse to pro-survival and migratory cues released byneighboring fibroblasts and other tumor and non-tumorstromal cells. In this regard, we evaluated the relation-ship between the cytoplasmic domain of CD248 andSM22a, a tumor suppressor gene that when dysregu-lated, is implicated in the progression and metastasis ofcancers of the colon, breast and prostate [45,59]. SM22awas considered a likely candidate for CD248-dependentexpression because it is known to be upregulated byTGF-b, and because we had previously shown thatCD248CyD/CyD fibroblasts release less TGF-b and areresistant to TGF-b-mediated angiogenic and pro-inflam-matory activities [32]. CD248CyD/CyD fibroblastsexpressed significantly higher transcript levels ofSM22a, further upregulated by TGF-b to levels exceed-ing those seen with CD248WT/WT fibroblasts. Althoughwe have not directly determined whether SM22a dam-pens activation of fibroblasts, it is reasonable to considerthat elevated levels might contribute to the smallertumors in the CD248CyD/CyD mice by maintaining thefibroblasts in a more quiescent state and by indirectlyreducing TGF-b-induced MMP-9 release, overall pre-venting microenvironmental changes that would facili-tate cell migration and cancer progression.Since SM22a is co-ordinately regulated by Notch andTGF-b [60], we hypothesized that the cytoplasmicdomain of CD248 would similarly regulate expression ofHes and Hey1, downstream effectors of Notch that alsoexhibit context-specific tumor suppressor properties[53,54]. Indeed, Hes and Hey1 transcript levels inCD248CyD/CyD fibroblasts were significantly higher thanin CD248WT/WT fibroblasts, in line with the role ofCD248 in promoting tumor growth. Notably from thesestudies, we uncovered a novel mechanism by whichfibroblast CD248 is itself regulated, i.e., it is markedlysuppressed by direct contact with endothelial cells.Although the molecular mechanisms remain to beclarified, identification of strategies to downregulateCD248 will be important for the design of therapies toreduce both tumor growth and inflammation.In addition to the role of the cytoplasmic domain ofCD248 in imparting fibroblast sensitivity to the effects ofTGF-ba, our studies also show that this domain ofCD248 is crucial for optimal migratory response of acti-vated fibroblasts to PDGF-BB. Our observations are inline with recent reports showing that CD248-deficientfibroblasts or pericytes also have defects in migration andproliferation that may [14,61] or may not [49] depend onPDGF-BB. The apparent discordant findings in the litera-ture likely reflect differences in experimental approaches.Studies by Tomkowicz et al. suggest that CD248 mayrecruit Src/PI-3 Kinase and cFos pathways to enhancePDGF-BB-induced signals emanating from the PDGF-receptor [61]. Further study will be necessary to elucidatethe intracellular pathways responsible for the reducedPDGF-BB induced CD248CyD/CyD fibroblast migration.In exploring the mechanisms underlying increasedresistance to arthritis induction in CD248CyD/CyD mice[32], we recently showed that CD248CyD/CyD fibroblastsare less adherent to monocytes and express reducedlevels of VEGF, PlGF and VEGFR-1. These CD248-dependent alterations serve to reduce leukocyte infiltra-tion, synovial fibroblast migration, proliferation andinflammation in arthritis [62,63]. The analogy betweencellular proliferation and metastasis formation in cancerand synovial hyperplasia and invasion in rheumatoidarthritis is well-recognized [64]. For that reason, andbecause tumor associated macrophages also contributeto cancer progression [4], we examined tumors fromCD248WT/WT and CD248CyD/CyD mice for leukocyteinfiltration (data not shown). There were, in fact, fewerleukocytes in the tumors from CD248CyD/CyD mice(1000 + 28 cells/mm2 in CD248CyD/CyD versus 1200 +86 cells/mm2 in CD248WT/WT, n = 7, p = 0.0578),although the differences were not statistically significant.Nonetheless, the findings suggest that the cytoplasmicdomain of CD248 might also participate in the regulatedrelease by activated fibroblasts of pro-inflammatory fac-tors such as IL-1b, monocyte chemotactic protein(MCP)-1 and IL-8 [7], thereby further tipping the bal-ance of the stromal microenvironment toward one thatfavours tumor initiation and progression.A striking observation made by investigators who pre-viously evaluated CD248-deficient mice in tumor modelswas the smaller tumor size associated with a seeminglyparadoxical increase in microvessel density [21,25]. Inspite of their finding that pericyte coverage was notaltered, Nanda et al. postulated that CD248-deficientblood vessels may fail to mature properly, hence favor-ing the sprouting of small-caliber vessels [25]. Surpris-ingly, we did not observe any differences in vesselMaia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 9 of 12density or size distribution, nor in pericyte coverage inT241 fibrosarcoma tumors from the CD248CyD/CyD miceor CD248KO/KO mice. Several factors could explain whythe angiogenic responses were different in our studiesversus others, particularly for the CD248-deficient mice.First and foremost, the xenograft tumor cell lines thatwe examined were different from those of Nanda et al.[25] and Carson-Walter et al. [21]. Second, one of thegroups [21] used immunodeficient mice for their xeno-graft studies. Finally, the mice were exposed to differentenvironmental factors and were generated from distinctgenetic backgrounds. In spite of these differences, theremarkable finding in the CD248CyD/CyD mice and theCD248KO/KO mice (irrespective of the source) was thattumor angiogenesis was not reduced, in spite of thetumors being smaller than in their wild-type counter-parts. This paradoxical lack of reduced tumor angiogen-esis in the setting of smaller tumors is not withoutprecedent. For instance, Gas6-deficient mice grew smal-ler tumors as compared to their wild type counterparts,while microvessel density, vessel lumen area and peri-cyte coverage did not change [37]. In that case, it wasdetermined that tumors cells induce infiltrating leuko-cytes to produce the mitogen Gas6. Since CD248 is notexpressed by tumor cells, but rather by activated fibro-blasts, it is interesting to note that conditioned mediafrom CD248CyD/CyD fibroblasts dampened the prolifera-tive potential of T241 fibrosarcoma cells. Thus, it islikely that the cytoplasmic domain of CD248 facilitatesfibroblast release of soluble factors that promote tumorgrowth. Several candidates could be considered, includ-ing for example, IGF-1, HGF and FGF, all of whichfavor tumor cell survival and proliferation [2-4,65].Interestingly, we and others have shown that not alltumors depend on CD248 for growth. Moreover, thesame tumor does not necessarily progress in the sameCD248-dependent manner in different anatomical sites[25]. Several groups have demonstrated that tumormicroenvironment and location functionally influencetumor growth and metastasis. And tumor stromal het-erogeneity may be associated with multiple factorsincluding differences in hypoxia-induced vascularresponse [66], vessel maturation [67] and activation oftumor associated fibroblasts [68]. Such heterogeneityhas considerable clinical relevance and may explain, atleast to some extent, unresponsiveness of some tumorsto anti-VEGF therapy [69]. The variable contribution ofCD248 to tumor growth highlights the importance ofunderstanding and establishing multiple targets for thedesign of effective therapies for given tumors.ConclusionOverall, our studies confirm that CD248 is an importantcentral regulator of several critical pathways involved instromal fibroblast migration, proliferation and activationthat impact on tumor growth. Although we demonstratedthe importance of the cytoplasmic domain of CD248, astructure that is highly conserved, with a PDZ bindingmotif and potential sites for phosphorylation, no intracel-lular interacting partners have yet been identified. Conver-sely, others have shown that the ectodomain of CD248does interact with components of the ECM, including col-lagen, fibronectin and Mac-2 BP/90 K, and also partici-pates in promoting tumor growth by modulating cellularadhesion and migration and promoting the release ofMMP-9 [30,31]. It is likely that the intra- and extra-cellu-lar domains of CD248 co-operate to achieve the samefunctional endpoint, but the mechanisms and responsibleprotein-protein interactions in the cell and outside the cellremain to be determined. By gaining further insights, onemay ultimately consider therapeutic strategies to interferewith CD248 signaling pathways to “normalize”, i.e. reversethe genotype/phenotype of the tumor associated fibroblast,thereby turning a tumor-permissive stromal environmentinto a tumor-prohibitive one.AcknowledgementsMM was supported by the VIB International PhD Program, Belgium. RJL isthe recipient of a postdoctoral fellowship from the Flanders ResearchFoundation (FWO Vlaanderen). EMC was supported by grants from theFlanders Research Foundation (FWO Vlaanderen), the Canadian Institutes forHealth Research, and the UBC and Vancouver General Hospital Foundations.EMC holds a CSL Behring Research Chair and a Canada Research Chair inEndothelial Cell Biology and is an Adjunct Scientist with the Canadian BloodServices. We thank the VIB-VRC-KUL staff in the ES cell lab and the animaland histology facilities for their invaluable support.Author details1Vesalius Research Center, VIB, Herestraat 49, 9th floor, 3000 Belgium.2Vesalius Research Center, K. U. Leuven, Herestraat 49, 9th floor, 3000Belgium. 3Cytokine Receptor Laboratory, Department of Medical ProteinResearch, VIB, A. Baertsoenkaai 3, 9000 Ghent, Belgium. 4Cytokine ReceptorLaboratory, Department of Biochemistry, Ghent University, A. Baertsoenkaai3, 9000 Ghent, Belgium. 5Laboratory for Skeletal Development and JointDisorders, Division of Rheumatology, K. U. Leuven, Herestraat 49, 3000Belgium. 6Centre for Blood Research, Faculty of Medicine, Division ofHematology, University of British Columbia, 2350 Health Sciences MallVancouver, V6T 1Z3, Canada.Authors’ contributionsMM participated in the design of the project, coordinated and performedmost of the experiments, and helped in the preparation of the manuscript.AV, TJ and MM provided technical support in managing mice, preparingcells, performing assays and analysing data. RJL and JT helped in the designof the studies and preparation of the manuscript. EMC conceived of thestudy and its design, supervised all aspects of the work, and prepared themanuscript. All authors read and approved the final manuscript.Competing interestsThe authors declare that they have no competing interests.Received: 11 February 2011 Accepted: 8 May 2011Published: 8 May 2011References1. Tsujino T, Seshimo I, Yamamoto H, Ngan CY, Ezumi K, Takemasa I, Ikeda M,Sekimoto M, Matsuura N, Monden M: Stromal myofibroblasts predictMaia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 10 of 12disease recurrence for colorectal cancer. Clin Cancer Res 2007,13(7):2082-2090.2. Franco OE, Shaw AK, Strand DW, Hayward SW: Cancer associatedfibroblasts in cancer pathogenesis. Semin Cell Dev Biol 2010, 21(1):33-39.3. Ostman A, Augsten M: Cancer-associated fibroblasts and tumor growth–bystanders turning into key players. Current opinion in genetics &development 2009, 19(1):67-73.4. Chiodoni C, Colombo MP, Sangaletti S: Matricellular proteins: fromhomeostasis to inflammation, cancer, and metastasis. Cancer MetastasisRev 2010, 29(2):295-307.5. Spaeth EL, Dembinski JL, Sasser AK, Watson K, Klopp A, Hall B, Andreeff M,Marini F: Mesenchymal stem cell transition to tumor-associatedfibroblasts contributes to fibrovascular network expansion and tumorprogression. PloS one 2009, 4(4):e4992.6. Pietras K, Ostman A: Hallmarks of cancer: interactions with the tumorstroma. Experimental cell research 2010, 316(8):1324-1331.7. Kalluri R, Zeisberg M: Fibroblasts in cancer. Nat Rev Cancer 2006,6(5):392-401.8. Ronnov-Jessen L, Petersen OW: Induction of alpha-smooth muscle actinby transforming growth factor-beta 1 in quiescent human breast glandfibroblasts. Implications for myofibroblast generation in breastneoplasia. Lab Invest 1993, 68(6):696-707.9. Zeisberg M, Strutz F, Muller GA: Role of fibroblast activation in inducinginterstitial fibrosis. J Nephrol 2000, 13(Suppl 3):S111-120.10. Rettig WJ, Garin-Chesa P, Healey JH, Su SL, Jaffe EA, Old LJ: Identificationof endosialin, a cell surface glycoprotein of vascular endothelial cells inhuman cancer. Proceedings of the National Academy of Sciences of theUnited States of America 1992, 89(22):10832-10836.11. St Croix B, Rago C, Velculescu V, Traverso G, Romans KE, Montgomery E,Lal A, Riggins GJ, Lengauer C, Vogelstein B, et al: Genes expressed inhuman tumor endothelium. Science (New York, NY 2000,289(5482):1197-1202.12. Carson-Walter EB, Watkins DN, Nanda A, Vogelstein B, Kinzler KW, St.Croix B: Cell Surface Tumor Endothelial Markers Are Conserved in Miceand Humans. Cancer research 2001, 61(18):6649-6655.13. Simonavicius N, Robertson D, Bax DA, Jones C, Huijbers IJ, Isacke CM:Endosialin (CD248) is a marker of tumor-associated pericytes in high-grade glioma. Mod Pathol 2008, 21(3):308-315.14. Christian S, Winkler R, Helfrich I, Boos AM, Besemfelder E, Schadendorf D,Augustin HG: Endosialin (Tem1) is a marker of tumor-associatedmyofibroblasts and tumor vessel-associated mural cells. The Americanjournal of pathology 2008, 172(2):486-494.15. MacFadyen JR, Haworth O, Roberston D, Hardie D, Webster MT, Morris HR,Panico M, Sutton-Smith M, Dell A, van der Geer P, et al: Endosialin (TEM1,CD248) is a marker of stromal fibroblasts and is not selectivelyexpressed on tumour endothelium. FEBS letters 2005, 579(12):2569-2575.16. Bagley RG, Honma N, Weber W, Boutin P, Rouleau C, Shankara S, Kataoka S,Ishida I, Roberts BL, Teicher BA: Endosialin/TEM 1/CD248 is a pericytemarker of embryonic and tumor neovascularization. Microvascularresearch 2008, 76(3):180-188.17. MacFadyen J, Savage K, Wienke D, Isacke CM: Endosialin is expressed onstromal fibroblasts and CNS pericytes in mouse embryos and isdownregulated during development. Gene Expr Patterns 2007,7(3):363-369.18. Rupp C, Dolznig H, Puri C, Sommergruber W, Kerjaschki D, Rettig WJ, Garin-Chesa P: Mouse endosialin, a C-type lectin-like cell surface receptor:expression during embryonic development and induction inexperimental cancer neoangiogenesis. Cancer Immun 2006, 6:10.19. Dolznig H, Schweifer N, Puri C, Kraut N, Rettig WJ, Kerjaschki D, Garin-Chesa P: Characterization of cancer stroma markers: in silico analysis ofan mRNA expression database for fibroblast activation protein andendosialin. Cancer Immun 2005, 5:10.20. Rouleau C, Curiel M, Weber W, Smale R, Kurtzberg L, Mascarello J, Berger C,Wallar G, Bagley R, Honma N, et al: Endosialin protein expression andtherapeutic target potential in human solid tumors: sarcoma versuscarcinoma. Clin Cancer Res 2008, 14(22):7223-7236.21. Carson-Walter EB, Winans BN, Whiteman MC, Liu Y, Jarvela S, Haapasalo H,Tyler BM, Huso DL, Johnson MD, Walter KA: Characterization of TEM1/endosialin in human and murine brain tumors. BMC Cancer 2009, 9:417.22. Bagley RG, Weber W, Rouleau C, Yao M, Honma N, Kataoka S, Ishida I,Roberts BL, Teicher BA: Human mesenchymal stem cells from bonemarrow express tumor endothelial and stromal markers. Int J Oncol 2009,34(3):619-627.23. Brady J, Neal J, Sadakar N, Gasque P: Human endosialin (tumorendothelial marker 1) is abundantly expressed in highly malignant andinvasive brain tumors. Journal of neuropathology and experimentalneurology 2004, 63(12):1274-1283.24. Davies G, Cunnick GH, Mansel RE, Mason MD, Jiang WG: Levels ofexpression of endothelial markers specific to tumour-associatedendothelial cells and their correlation with prognosis in patients withbreast cancer. Clin Exp Metastasis 2004, 21(1):31-37.25. Nanda A, Karim B, Peng Z, Liu G, Qiu W, Gan C, Vogelstein B, St Croix B,Kinzler KW, Huso DL: Tumor endothelial marker 1 (Tem1) functions in thegrowth and progression of abdominal tumors. Proceedings of the NationalAcademy of Sciences of the United States of America 2006, 103(9):3351-3356.26. Christian S, Ahorn H, Koehler A, Eisenhaber F, Rodi HP, Garin-Chesa P,Park JE, Rettig WJ, Lenter MC: Molecular cloning and characterization ofendosialin, a C-type lectin-like cell surface receptor of tumorendothelium. The Journal of biological chemistry 2001, 276(10):7408-7414.27. Opavsky R, Haviernik P, Jurkovicova D, Garin MT, Copeland NG, Gilbert DJ,Jenkins NA, Bies J, Garfield S, Pastorekova S, et al: MolecularCharacterization of the Mouse Tem1/endosialin Gene Regulated by CellDensity in Vitro and Expressed in Normal Tissues in Vivo. J Biol Chem2001, 276(42):38795-38807.28. Zelensky AN, Gready JE: The C-type lectin-like domain superfamily. FEBS J2005, 272(24):6179-6217.29. Conway EM, Van de Wouwer M, Pollefeyt S, Jurk K, Van Aken H, DeVriese A, Weitz JI, Weiler H, Hellings PW, Schaeffer P, et al: The lectin-likedomain of thrombomodulin confers protection from neutrophil-mediated tissue damage by suppressing adhesion molecule expressionvia nuclear factor kappaB and mitogen-activated protein kinasepathways. The Journal of experimental medicine 2002, 196(5):565-577.30. Tomkowicz B, Rybinski K, Foley B, Ebel W, Kline B, Routhier E, Sass P,Nicolaides NC, Grasso L, Zhou Y: Interaction of endosialin/TEM1 withextracellular matrix proteins mediates cell adhesion and migration.Proceedings of the National Academy of Sciences of the United States ofAmerica 2007, 104(46):17965-17970.31. Becker R, Lenter MC, Vollkommer T, Boos AM, Pfaff D, Augustin HG,Christian S: Tumor stroma marker endosialin (Tem1) is a binding partnerof metastasis-related protein Mac-2 BP/90 K. Faseb J 2008,22(8):3059-3067.32. Maia M, de Vriese A, Janssens T, Moons M, Van Landuyt K, Tavernier J,Lories RJ, Conway EM: CD248 and its cytoplasmic domain: A therapeutictarget for arthritis. Arthritis and rheumatism 2010, 62(12):3595-3606.33. Fischer C, Jonckx B, Mazzone M, Zacchigna S, Loges S, Pattarini L,Chorianopoulos E, Liesenborghs L, Koch M, De Mol M, et al: Anti-PlGFinhibits growth of VEGF(R)-inhibitor-resistant tumors without affectinghealthy vessels. Cell 2007, 131(3):463-475.34. Edgell CJS, McDonald CC, Graham JB: Permanent cell line expressingfactor VIII related antigen established by hybridization. Proc Natl Acad SciUSA 1983, 80:3734-3737.35. Folkman J: The role of angiogenesis in tumor growth. Semin Cancer Biol1992, 3(2):65-71.36. Noguera-Troise I, Daly C, Papadopoulos NJ, Coetzee S, Boland P, Gale NW,Lin HC, Yancopoulos GD, Thurston G: Blockade of Dll4 inhibits tumourgrowth by promoting non-productive angiogenesis. Nature 2006,444(7122):1032-1037.37. Loges S, Schmidt T, Tjwa M, van Geyte K, Lievens D, Lutgens E,Vanhoutte D, Borgel D, Plaisance S, Hoylaerts M, et al: Malignant cells fueltumor growth by educating infiltrating leukocytes to produce themitogen Gas6. Blood 2010, 115(11):2264-2273.38. Lu Y, Yang W, Qin C, Zhang L, Deng J, Liu S, Qin Z: Responsiveness ofstromal fibroblasts to IFN-gamma blocks tumor growth via angiostasis. JImmunol 2009, 183(10):6413-6421.39. Efeyan A, Murga M, Martinez-Pastor B, Ortega-Molina A, Soria R, Collado M,Fernandez-Capetillo O, Serrano M: Limited role of murine ATM inoncogene-induced senescence and p53-dependent tumor suppression.PloS one 2009, 4(5):e5475.40. Zhang Y, Wen G, Shao G, Wang C, Lin C, Fang H, Balajee AS, Bhagat G,Hei TK, Zhao Y: TGFBI deficiency predisposes mice to spontaneous tumordevelopment. Cancer research 2009, 69(1):37-44.Maia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 11 of 1241. Kurose K, Gilley K, Matsumoto S, Watson PH, Zhou XP, Eng C: Frequentsomatic mutations in PTEN and TP53 are mutually exclusive in thestroma of breast carcinomas. Nature genetics 2002, 32(3):355-357.42. Wallace JA, Li F, Leone G, Ostrowski MC: Pten in the breast tumormicroenvironment: modeling tumor-stroma coevolution. Cancer research2011, 71(4):1203-1207.43. Untergasser G, Gander R, Lilg C, Lepperdinger G, Plas E, Berger P: Profilingmolecular targets of TGF-beta1 in prostate fibroblast-to-myofibroblasttransdifferentiation. Mech Ageing Dev 2005, 126(1):59-69.44. Nair RR, Solway J, Boyd DD: Expression cloning identifies transgelin(SM22) as a novel repressor of 92-kDa type IV collagenase (MMP-9)expression. The Journal of biological chemistry 2006, 281(36):26424-26436.45. Yeo M, Park HJ, Kim DK, Kim YB, Cheong JY, Lee KJ, Cho SW: Loss of SM22is a characteristic signature of colon carcinogenesis and its restorationsuppresses colon tumorigenicity in vivo and in vitro. Cancer 2010,116(11):2581-2589.46. Andrae J, Gallini R, Betsholtz C: Role of platelet-derived growth factors inphysiology and medicine. Genes & development 2008, 22(10):1276-1312.47. Pietras K, Pahler J, Bergers G, Hanahan D: Functions of paracrine PDGFsignaling in the proangiogenic tumor stroma revealed bypharmacological targeting. PLoS Med 2008, 5(1):e19.48. Shen J, Vil MD, Prewett M, Damoci C, Zhang H, Li H, Jimenez X, Deevi DS,Iacolina M, Kayas A, et al: Development of a fully human anti-PDGFRbetaantibody that suppresses growth of human tumor xenografts andenhances antitumor activity of an anti-VEGFR2 antibody. Neoplasia 2009,11(6):594-604.49. Lax S, Hardie DL, Wilson A, Douglas MR, Anderson G, Huso D, Isacke CM,Buckley CD: The pericyte and stromal cell marker CD248 (endosialin) isrequired for efficient lymph node expansion. European journal ofimmunology 2010, 40(7):1884-9.50. Dufraine J, Funahashi Y, Kitajewski J: Notch signaling regulates tumorangiogenesis by diverse mechanisms. Oncogene 2008, 27(38):5132-5137.51. Dotto GP: Notch tumor suppressor function. Oncogene 2008,27(38):5115-5123.52. Domenga V, Fardoux P, Lacombe P, Monet M, Maciazek J, Krebs LT,Klonjkowski B, Berrou E, Mericskay M, Li Z, et al: Notch3 is required forarterial identity and maturation of vascular smooth muscle cells. Genes &development 2004, 18(22):2730-2735.53. Sang L, Roberts JM, Coller HA: Hijacking HES1: how tumors co-opt theanti-differentiation strategies of quiescent cells. Trends in molecularmedicine 2010, 16(1):17-26.54. Villaronga MA, Lavery DN, Bevan CL, Llanos S, Belandia B: HEY1 Leu94Metgene polymorphism dramatically modifies its biological functions.Oncogene 2010, 29(3):411-420.55. Liu H, Kennard S, Lilly B: NOTCH3 expression is induced in mural cellsthrough an autoregulatory loop that requires endothelial-expressedJAGGED1. Circulation research 2009, 104(4):466-475.56. Baglole CJ, Ray DM, Bernstein SH, Feldon SE, Smith TJ, Sime PJ, Phipps RP:More than structural cells, fibroblasts create and orchestrate the tumormicroenvironment. Immunol Invest 2006, 35(3-4):297-325.57. Joyce JA, Pollard JW: Microenvironmental regulation of metastasis. NatRev Cancer 2009, 9(4):239-252.58. Kitano H, Kageyama S, Hewitt SM, Hayashi R, Doki Y, Ozaki Y, Fujino S,Takikita M, Kubo H, Fukuoka J: Podoplanin expression in cancerousstroma induces lymphangiogenesis and predicts lymphatic spread andpatient survival. Archives of pathology & laboratory medicine 2010,134(10):1520-1527.59. Assinder SJ, Stanton JA, Prasad PD: Transgelin: an actin-binding proteinand tumour suppressor. The international journal of biochemistry & cellbiology 2009, 41(3):482-486.60. Tang Y, Urs S, Boucher J, Bernaiche T, Venkatesh D, Spicer DB, Vary CP,Liaw L: Notch and transforming growth factor-beta (TGFbeta) signalingpathways cooperatively regulate vascular smooth muscle celldifferentiation. The Journal of biological chemistry 2010,285(23):17556-17563.61. Tomkowicz B, Rybinski K, Sebeck D, Sass P, Nicolaides NC, Grasso L, Zhou Y:Endosialin/TEM-1/CD248 regulates pericyte proliferation through PDGFreceptor signaling. Cancer biology & therapy 2010, 9(11).62. Yoo SA, Kwok SK, Kim WU: Proinflammatory role of vascular endothelialgrowth factor in the pathogenesis of rheumatoid arthritis: prospects fortherapeutic intervention. Mediators Inflamm 2008, 2008:129873.63. Yoo SA, Yoon HJ, Kim HS, Chae CB, De Falco S, Cho CS, Kim WU: Role ofplacenta growth factor and its receptor flt-1 in rheumatoidinflammation: a link between angiogenesis and inflammation. Arthritisand rheumatism 2009, 60(2):345-354.64. Okamoto H, Cujec TP, Yamanaka H, Kamatani N: Molecular aspects ofrheumatoid arthritis: role of transcription factors. FEBS J 2008,275(18):4463-4470.65. Henriksson ML, Edin S, Dahlin AM, Oldenborg PA, Oberg A, Van Guelpen B,Rutegard J, Stenling R, Palmqvist R: Colorectal Cancer Cells ActivateAdjacent Fibroblasts Resulting in FGF1/FGFR3 Signaling and IncreasedInvasion. The American journal of pathology 2011, 178(3):1387-1394.66. Blouw B, Song H, Tihan T, Bosze J, Ferrara N, Gerber HP, Johnson RS,Bergers G: The hypoxic response of tumors is dependent on theirmicroenvironment. Cancer Cell 2003, 4(2):133-146.67. Eberhard A, Kahlert S, Goede V, Hemmerlein B, Plate KH, Augustin HG:Heterogeneity of angiogenesis and blood vessel maturation in humantumors: implications for antiangiogenic tumor therapies. Cancer research2000, 60(5):1388-1393.68. Xing F, Saidou J, Watabe K: Cancer associated fibroblasts (CAFs) in tumormicroenvironment. Front Biosci 2010, 15:166-179.69. Jain RK, Duda DG, Clark JW, Loeffler JS: Lessons from phase III clinicaltrials on anti-VEGF therapy for cancer. Nat Clin Pract Oncol 2006,3(1):24-40.Pre-publication historyThe pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/11/162/prepubdoi:10.1186/1471-2407-11-162Cite this article as: Maia et al.: CD248 facilitates tumor growth via itscytoplasmic domain. BMC Cancer 2011 11:162.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitMaia et al. BMC Cancer 2011, 11:162http://www.biomedcentral.com/1471-2407/11/162Page 12 of 12


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items