UBC Faculty Research and Publications

Low-dose vasopressin infusion results in increased mortality and cardiac dysfunction following ischemia-reperfusion… Indrambarya, Toonchai; Boyd, John H; Wang, Yingjin; McConechy, Melissa; Walley, Keith R Jun 23, 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-13054_2009_Article_7361.pdf [ 248.32kB ]
Metadata
JSON: 52383-1.0223341.json
JSON-LD: 52383-1.0223341-ld.json
RDF/XML (Pretty): 52383-1.0223341-rdf.xml
RDF/JSON: 52383-1.0223341-rdf.json
Turtle: 52383-1.0223341-turtle.txt
N-Triples: 52383-1.0223341-rdf-ntriples.txt
Original Record: 52383-1.0223341-source.json
Full Text
52383-1.0223341-fulltext.txt
Citation
52383-1.0223341.ris

Full Text

Available online http://ccforum.com/content/13/3/R98Open AccessVol 13 No 3ResearchLow-dose vasopressin infusion results in increased mortality and cardiac dysfunction following ischemia-reperfusion injury in miceToonchai Indrambarya, John H Boyd, Yingjin Wang, Melissa McConechy and Keith R WalleyCritical Care Research Laboratories, Heart + Lung Institute, University of British Columbia, 166 – 1081 Burrard Street, Vancouver, British Columbia, V6Z 1Y6, CanadaCorresponding author: John H Boyd, jboyd@mrl.ubc.caReceived: 5 Mar 2009 Revisions requested: 31 Mar 2009 Revisions received: 2 Jun 2009 Accepted: 23 Jun 2009 Published: 23 Jun 2009Critical Care 2009, 13:R98 (doi:10.1186/cc7930)This article is online at: http://ccforum.com/content/13/3/R98© 2009 Indrambarya et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.AbstractIntroduction Arginine vasopressin is a vasoactive drugcommonly used in distributive shock states including mixedshock with a cardiac component. However, the direct effect ofarginine vasopressin on the function of the ischemia/reperfusioninjured heart has not been clearly elucidated.Methods We measured left ventricular ejection fraction usingtrans-thoracic echocardiography in C57B6 mice, both in normalcontrols and following ischemia/reperfusion injury induced by aone hour ligation of the left anterior descending coronary artery.Mice were treated with one of normal saline, dobutamine (8.33μg/kg/min), or arginine vasopressin (0.00057 Units/kg/min,equivalent to 0.04 Units/min in a 70 kg human) delivered by anintraperitoneal micro-osmotic pump. Arterial blood pressure wasmeasured using a micromanometer catheter. In addition,mortality was recorded and cardiac tissues processed for RNAand protein.Results Baseline left ventricular ejection fraction was 65.6%(60 to 72). In normal control mice, there was no difference in leftventricular ejection fraction according to infusion group.Following ischemia/reperfusion injury, AVP treatmentsignificantly reduced day 1 left ventricular ejection fraction46.2% (34.4 to 52.0), both in comparison with baseline and day1 saline treated controls 56.9% (42.4 to 60.2). There were nosignificant differences in preload (left ventricular end diastolicvolume), afterload (blood pressure) or heart rate to account forthe effect of AVP on left ventricular ejection fraction. The seven-day mortality rate was highest in the arginine vasopressin group.Following ischemia/reperfusion injury, we found no change incardiac V1 Receptor expression but a 40% decrease inOxytocin Receptor expression.Conclusions Arginine vasopressin infusion significantlydepressed the myocardial function in an ischemia/reperfusionmodel and increased mortality in comparison with both salineand dobutamine treated animals. The use of vasopressin may becontraindicated in non-vasodilatory shock states associatedwith significant cardiac injury.IntroductionWith the increasing medical complexity of the critically ill,shock due to a combination of vasodilation and cardiac dys-function is increasingly frequent. Two common clinical exam-ples of this are first, vasodilation following cardiopulmonarybypass surgery and, second, the cardiac dysfunction duringseptic shock. These mixed shock conditions are routinelytreated with intravenous fluids plus inotropes combined with avasopressor such as norepinephrine or arginine vasopressin(AVP). AVP is a vasopressor commonly used in intensive careunits and cardiac surgical units due to its efficacy in restorat-ing blood pressure [1-6]. The effects of AVP are mediated viavasopressin 1 receptors (V1R; predominantly vascular), vaso-pressin 2 receptors (V2R; predominantly renal), vasopressin 3receptors (V3R; predominantly central), and the oxytocinreceptors (OTR) [7]. In addition, vasopressin blocks KATPchannels [8] and potentiates the effect of adrenergic agents[9]. Vascular V1R appear to mediate the majority of effects ofvasopressin in reversing vasoplegia and catecholamine toler-ance [4,10].ANOVA: analysis of variance; AVP: arginine vasopressin; DOB: dobutamine; I/R: ischemia/reperfusion; LAD: left anterior descending coronary artery; Page 1 of 8(page number not for citation purposes)LVEF: left ventricular ejection fraction; LVEDV: left ventricular end diastolic volume; OTR: oxytocin receptors; P2R: purinergic receptors; RT-PCR: real-time polymerase chain reaction; SL: normal saline solution; V1R: vasopressin 1 receptor; V2R: vasopressin 2 receptor; V3R: vasopressin 3 recep-tor.Critical Care    Vol 13 No 3    Indrambarya et al.In healthy individuals, AVP administration at low doses (<0.04Units/minute) has little effect on blood pressure. However,there are multiple reports of increased blood pressure respon-siveness to low-dose AVP in both septic shock and distributiveshock after cardiopulmonary bypass surgery [7,11]. Conse-quently, low-dose AVP has been increasingly used to treatthese disorders [1-3,12-17].Despite its widespread use, there remains considerableuncertainty regarding its cardiac effects. When studied at thehigh doses (0.1 to 1 Unit/minute) previously used formesenteric vessel constriction in gastrointestinal bleeding[18], deleterious effects of AVP on myocardial performancewere reported including coronary vasospasm [19-21]. Atthese high doses, AVP may also impair indices of ventricularcontraction and relaxation without overt global ischemia [22].In addition, the baroreflex mediated via V1R might causebradycardia and direct cardiac suppression [23,24]. Althoughthe most highly expressed vasopressin receptor in the heart isV1R, the other receptors are physiologically active. Genetransfer of V2R into failing myocardium increases cardiac con-tractility [25,26], while OTR mediates a calcium-dependentvasodilatory response via stimulation of the nitric oxide path-way in endothelial cells [27]. OTR stimulation also results inrelease of atrial natriuretic peptide from the heart [28,29].Clinically, there are conflicting reports on the effect of AVP oncardiac function. In some series, AVP infusion has beenreported to decrease cardiac output [28,30,31]. Others haveobserved a dramatic restoration of blood pressure without adecrease in stroke volume or other measures of cardiac func-tion [2,30,32,33]. The clinical observation that AVP increasesmean arterial pressure in patients with shock is uniform acrossthese studies, so interpreting any direct effect on myocardialcontractility must be done with caution as alterations in after-load have a significant impact on measures of cardiac perform-ance.The uncertainty as to the in vivo action of AVP on the heartprovides the rationale for this study. Further, as the use of AVPmoves into the mainstream [1,12], it is important to understandits cardiac effects both on the normal heart and in the injuredor ischemic heart. We chose a model of subacute heart failurewithout overt shock as the direct in vivo effects of AVP on con-tractility are extremely difficult to distinguish from indirecteffects due to changes in afterload (blood pressure). In thisstudy, we used a mouse model of ischemia/reperfusion (I/R)induced heart failure to compare the effect of continuous infu-sion of AVP with saline control (SL) or standard inotropic ther-apy (dobutamine (DOB)) on cardiac function in mice. Weassessed cardiac function using trans-thoracic echocardiog-raphy, and in parallel experiments used intra-arterial pressuremeasurements to determine whether cardiac function wasinfluenced by changes in systemic blood pressure.Materials and methodsThese experiments were approved by the UBC Animal CareCommittee and conform to Canadian and National Institutes ofHealth guidelines regarding animal experimentation. All exper-iments were conducted in 10- to 14-week-old male C57B6mice as a control and in mice following I/R injury induced byone hour ligation of the left anterior descending coronaryartery (LAD; see below). Intraperitoneal pumps (1 μL/hour for72 hours, Alzet micro-osmotic pump, Alza Corporation, PaloAlto, CA, USA) delivered normal saline (SL control), DOB at8.33 μg/kg/minute, or arginine vasopressin at 0.00057 Units/kg/minute (equivalent to 0.04 Units/minute in a 70 kg human;AVP treatment). AVP levels in rodents and humans are similar,while in rodents the intraperitoneal route of administration forAVP increases plasma AVP levels in a manner very similar tointravenous dosing in humans [34,35]. At least five mice pertime point in each group were studied.Ischemia-reperfusion of the LADAn open-chest model of I/R using ligation and reperfusion ofthe LAD was modified from Michael and colleagues [36]. Micewere anesthetized using ketamine (75 mg/kg) and xylazine (10mg/kg) in order to facilitate endotracheal intubation using a 22Gauge catheter. Thereafter, deep anesthesia was maintainedwith 1 to 2% isoflurane. Ventilation was controlled usingMouse Ventilator (Model 687, Harvard Instruments, Holiston,MA, USA) with a tidal volume of 0.5 mL and a respiratory rateof 120 breaths/minute. After a left thoracotomy was performedat the level of the second or third intercostal space, the LADwas identified and a 6-0 polypropylene suture was placedaround the LAD. Occlusion of the LAD was accomplished bypulling the suture ends through a small piece of PE-50 tubingand occlusion was confirmed by discoloration of the anteriorleft ventricle wall.Following one hour of ischemia the ligature was released toallow reperfusion, which was visualized. Following the thora-cotomy wound closure, the intraperitoneal pump (see above)was implanted into the peritoneal cavity. Intra-operatively, 1 mLof normal saline was injected subcutaneously for volumeresuscitation and subcutaneous buprenorphrine for pain con-trol were given. After recovery and resumption of spontaneousventilation, mice were extubated.Myocardial function evaluationLeft ventricular ejection fraction (LVEF) was used to measurecardiac function at baseline, day 1 and day 3 post I/R. Tran-sthoracic echocardiography using a Vevo 770 cardiac ultra-sound (Visualsonics, Toronto, Canada) while anesthetizedwith 1 to 2% inhaled isofluorane. Left ventricular internal diam-eter at end-systole and end-diastole from Short Axis 2D viewsat the level of the papillary muscles were identified and usedfor measurement of LVEF using the manufacturer's software.All echocardiographs were performed by the same qualifiedPage 2 of 8(page number not for citation purposes)Available online http://ccforum.com/content/13/3/R98investigator (TI), and quality control was ensured by the otherinvestigator (JB) blinded from treatment group.Direct blood pressure measurementAs arterial catheterization is a terminal procedure, separatemice were anesthetized in the same way and a number 2French micromanometer catheter (Mikro-tip SPR-838, MillarInstruments Inc., Houston, TX, USA) was advanced via thecarotid artery into the ascending aorta to measure blood pres-sure. The heart was excised, frozen in liquid nitrogen, andstored at -80°C for subsequent study.Quantitative real-time PCRTotal RNA was extracted from frozen heart samples using Tri-zol (Invitrogen, Carlsbad, CA, USA) as per the manufacturer'sinstructions. RNA was obtained from either I/R injured heartsor control, non-injured heart. RNA 1 μg was treated withDNAse I Amplification Grade (Invitrogen, Carlsbad, CA, USA)and the product underwent quantitiative RT-PCR using M-MLV RT (Invitrogen, Carlsbad, CA, USA) followed by PCRamplification with Taq DNA Polymerase (Qiagen, Valencia,CA, USA). PCR was 40 cycles at 94°C for 15 seconds, 58°Cfor 30 seconds, and 72°C for 30 seconds. Primers were as fol-lows, V1R forward; TCGTCCAGATGTGGTCAGTC, V1Rreverse; AGCTGTTCAAGG-AAGCCAGT, V2R forward;CCTGGTGTCTACCACGTCTG, V2R reverse; GGTCTCG-GTCATCCAGTAGC. OTR Forward; AGGAGCTGTTCT-CAACCATC OTR Reverse; QPCRTGCAAACCAATCAATAGGCAC. SYBER green was usedas the fluorescence indicator, which represented quantity ofamplicon production with PCR cycle (Ct value). All quantita-tive RT-PCR reactions were run in triplicate and an average Ctvalue was calculated for each PCR condition. Fold change ofCt value of each sample was calculate using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a background con-trol.Western blot for OTRA 20 μg sample of each protein was mixed with equal volumesof SDS reducing buffer (62.5 mmol Tris l–1, pH 6.8, 2% (w/v)SDS, 10% (v/v) glycerol, 100 mmol dithiothreitol l–1, 0.05%(w/v) bromophenol blue) and incubated in a boiling waterbathfor five minutes before loading. Using the discontinuous buffersystem SDS-PAGE, proteins were separated according tosize on 10% polyacrylamide gels and electroblotted on tonitrocellulose membranes. After blocking non-specific anti-gens with 5% (w/v) skim milk for one hour, western blots wereprobed with rabbit's anti-OTR immunoglobulin (Santa CruzBiotechnology, California, USA), dilute 1:2000 in 5% (w/v)BSA and Tris-Buffered Saline Tween-20 at 4°C overnight.Using the Enzymatic Chemiluminescence (ECL, Amersham™,GE Healthcare, Buckinghamshire, UK) assay, anti-rabbithorseradish peroxidase molecule bound goat immunoglobulinwas used as secondary antibody. The images of ECL reactiongene, Cambridge, UK). The densitometry was performedusing imageJ 1.410 (National Institutes of Health, Maryland,USA).Data analysisAll graphical values are expressed as means ± standard errorof the mean, and to provide more descriptive data in the resultssection we present data as median (inter-quartile range). In thecase of unequal variance, groups were analyzed using Kruskal-Wallis one-way analysis of variance (ANOVA) on Ranks andsubsequent multiple comparisons were performed usingDunn's Method. In groups with equal variance one-wayANOVA determined if differences existed, then pairwise multi-ple comparison procedures used the Holm-Sidak method. Theanalyses were performed using Sigmastat (SPSS, Chicago,IL, USA), and statistical significance was set at P < 0.05. Kap-lan Meier survival was used to demonstrate the survival rate ofeach treatment group, and log rank test was used to test fordifferences between groups.ResultsVasopressin significantly reduces left ventricular ejection fraction following I/R but has no effect in intact miceThe baseline (normal) LVEF obtained from 2D short axis M-mode left ventricular internal diameter trace was 65.6% (60 to72; n = 29). In mice (n = 4 per group) who received intraperi-toneal infusions but were not subjected to I/R of the LAD,there was no statistically significant difference in LVEFbetween SL controls at 62.7% (56.9 to 62.5), DOB 72.94%(73.9 to 56.0), and AVP treatment 54.73% (52.1 to 57.3). Inmice subjected to I/R injury, AVP treatment significantlyreduced day 1 LVEF to 46.2% (34.4 to 52.0) in comparisonwith both baseline and with day 1 SL control 56.9% (42.4 to60.2), while DOB-treated mice did not demonstrate a signifi-cant reduction in day 1 LVEF compared with baseline 53.7%(47.0 to 61.7), as shown in Figure 1. In comparison to day 1,LVEF measured at day 3 demonstrated improvements in allgroups; however, mice receiving AVP remained significantlylower than baseline.The decreased LVEF in vasopressin treated mice is due to altered contractility rather than through influencing heart rate, preload or afterloadBaseline heart rate was similar in AVP, SL, and DOB groupsrespectively, with no statistically significant differencesbetween groups. Following I/R of the LAD there was no statis-tical difference between groups at days 1 and 3 (Table 1). Toassess left ventricular preload, we measured left ventricularend diastolic volume (LVEDV) using transthoracic echocardi-ography. Although there was a trend towards decreasedLVEDV at day 1 and day 3 in all groups compared with theirrespective baseline values, there was no significant differencebetween AVP, SL, and DOB-treated mice at day 1 or day 3Page 3 of 8(page number not for citation purposes)were obtained using Chemigenius2 with CCD camera (Syn- after I/R (Table 1). Afterload was assessed through invasiveCritical Care    Vol 13 No 3    Indrambarya et al.measurement of systolic blood pressure, diastolic blood pres-sure, and mean arterial pressure are shown in Figure 2.Although there was no statistically significant differences inblood pressure, mean arterial pressure trended to lowest inAVP group with a mean arterial pressure of 91.1 mmHg (88.2to 98.6) compared with 104.3 mmHg (91.6 to 110.1) in DOBand 95.9 mmHg (90.8 to 99.8) in SL controls.Vasopressin infusion results in higher mortality following I/R of the LAD than saline or dobutamineWhen compared with infusions of either saline or DOB, vaso-pressin results in dramatically increased mortality (Figure 3).This difference begins as soon as day 1 following I/R and per-sists throughout our seven-day observation period. The micewere no different in appearance (grooming, temperature, activ-ity level) according to infusion group, and in general appearedhealthy during routine monitoring.Only V1R and OTR are expressed in the heart, I/R of the LAD results in changes in expression of OTRVasopressin has minimal effects on cardiac performance inintact animals, while I/R injury results in a dramatic suppres-sion in cardiac ejection fraction when compared with salineinfusion. We therefore verified whether this might be due toregulation of vasopressin receptor subtype in the heart as aresult of I/R. Expression of V1R, V2R, and OTR in the heartwas assessed in four mice per group at baseline and at day 1following I/R of the LAD. Using RT-PCR, we found that normalhearts express only V1R and OTR, while V2R is not detecta-ble. There was no change in V1R expression as a result of I/Rinjury, while OTR expression was reduced by 40% comparedwith controls (Figure 4).DiscussionThe major finding of this study is that although continuous infu-sion of low-dose AVP (equivalent to 0.04 Units/minute in anaverage human) had no effect on hemodynamics or cardiacfunction in the resting state, following one hour of LAD I/R,AVP had a negative inotropic effect and seemed to increaseearly mortality. As previous studies have noted, AVP may exertcardiac suppressive effects through a variety of mecha-nisms[22-24,30,31], therefore, we went on to identify a poten-tial mechanism behind this ischemia-induced cardiacsensitization to vasopressin.Vasopressin is a peptide produced by the hypothalamus. Itseffects are mediated through at least five specific receptorsV1R, V2R, V3R, OTR, and purinergic receptors (P2R) [4,10].V1R is the receptor thought to be primarily responsible forFigure 1Cardiac function as assessed by 2D ECHO at baseline and following I/R of the LADR of the LAD. The baseline (normal) left ventricular ejection fraction (LVEF) obtained from 2D short axis M-mode left ventricular internal diameter trace was 67.52 ± 1.8%, 63.48 ± 2.9%, and 65.47 ± 2.4% in arginine vasopressin (AVP; n = 14), normal saline solution (SL; n = 9), and dobutamine (DOB; n = 6), resepctively. Following ischemia/reper-fusion (I/R) injury, AVP treatment significantly reduced day 1 LVEF (41.1 ± 3.4%) in comparison with SL control (51.6 ± 4.3%), while both group had significant reductions in LVEF vs baseline. DOB mitigated the decrease in LVEF (57.7 ± 6.7%) day 1 post I/R. LVEF measured at day 3 demonstrated improvement in all groups; however, mice receiv-ing AVP remained significantly lower than baseline. * P < 0.05 vs base-line, ** P < 0.05 vs SL-treated mice. Results are present as means ± standard error of the mean. LAD = left anterior descending coronary artery.Table 1Baseline, day 1 and day 3 heart rate and left ventricular end diastolic volume post I/R injury and intraperitoneal pump implantationGroup Parameter Baseline Day 1 post I/R Day 3 post I/RVasopressinn = 14HR (bpm):LVEDV (uL):495 ± 18.167 ± 5517.15 ± 15.6758 ± 8485.11 ± 34.9460 ± 9Dobutaminen = 6HR (bpm):LVEDV (uL):439 ± 28.764 ± 7475.17 ± 32.3555 ± 7507.1 ± 50.6855 ± 7Normal Salinen = 9HR (bpm):LVEDV (uL):448 ± 15.169 ± 4486.66 ± 16.2960 ± 6438 ± 32.1058 ± 6Heart rate (HR) was determined using limb lead echocardiography pads during echocardiogram, while left ventricular end diastolic volume Page 4 of 8(page number not for citation purposes)(LVEDV) was determined using echocardiography. No significant differences in HR or LVEDV exist between groups infused with saline (n = 9), dobutamine (n = 6), or vasopressin (n = 14). Results are present as means ± standard error of the mean. I/R = ischemia/reperfusion.Available online http://ccforum.com/content/13/3/R98increased vascular tone because it mediates vasoconstrictionin vascular smooth muscle. It has also been found to beexpressed on cardiac myocytes and the kidney. V2Rs arefound mainly in the renal collecting duct and are responsiblefor the antidiuretic effect of vasopressin. OTRs are found dif-fusely throughout the body and are thought to mediate vasodi-lation. Thus vasopressin is able to cause eithervasoconstriction or vasodilation depending on the tissue spe-cific distribution of V1R vs OTR and is able to enhance theeffect of vasoconstrictor agents such as norepinephrinethrough mechanisms yet to be identified [9].Although its mechanism of action on the vasculature is wellunderstood, vasopressin has dose-dependent effects on bothcardiac contractility and coronary arterial tone. It appears thatat low doses vasopressin may act mainly through the P2R witha shifting of physiologic effect from coronary smooth muscleV1R-mediated vasoconstriction to P2R-mediated vascularendothelial vasodilation. At higher doses this relation isreversed with V1R-mediated coronary arterial vasoconstrictionpredominating, with a resultant drop in cardiac output. Due tosafety concerns at higher doses, most clinical data relating todirect cardiac effects are using low doses of vasopressin (≤0.04 Units/minute), often in conjunction with inotropes.Patients with vasodilatory shock increase systemic vascularresistance twofold, while only diminishing cardiac output by14% in response to vasopressin – indirect evidence of somepositive inotropy [37]. Similarly, when co-infused with thephosphodiesterase inhibitor milrinone in patients withadvanced heart failure, vasopressin resulted in increased vas-cular tone and blood pressure with no resultant change in car-diac output [38]. In hypotensive post-cardiotomy patients whoremain in shock despite catecholamine infusions, the additionof low-dose vasopressin resulted in a significant increase inleft ventricular work index and a decrease in vasopressor use,inotrope usage, and heart rate [2]. It is of great interest to theclinician that the hemodynamic effects of vasopressin arepotentiated by the shock state, because in normal subjectsvasoconstriction only occurs at high doses, while fluid unre-sponsive shock confers a powerful vasopressor effect at lowdoses. This may reflect an acute depletion of circulating vaso-pressin with subsequent hypersensitivity to its effects [37,39].Because of these theoretical and practical benefits, vaso-pressin has come into widespread use for shock states,Figure 2Intra-arterial blood pressure at day 1 following I/R of the LAD. Systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean arte-rial pressure (MAP) are shown. Although there was no statistically sig-nificant differences in blood pressure, MAP trended to lowest in arginine vasopressin (AVP) group (n = 5) with a MAP of 89.7 ± 1.7 mmHg compared with 100.1 ± 6.0 in dobutamine (DOB; n = 5) and 94.8 ± 3.4 in normal saline solution (SL) control (n = 5). Results are present as means ± standard error of the mean. I/R = ischemia/reper-fusion; LAD = left anterior descending coronary artery.Figure 3Kaplan Meier survival curve for mice in the three treatment groups. When compared with infusions of either saline (n = 6) or dobutamine (n = 6), vasopressin (n = 12) results in dramatically increased mortality. This difference begins as soon as day 1 following ischemia/reperfusion Figure 4Western blot of left ventricular OTR levels at baseline and day 1 follow-ing I/R of the LADing I/R of the LAD. Left ventricular tissue was dissected and flash fro-zen for protein extraction both in control (baseline) animals and at day 1 following ischemia/reperfusion (I/R) of the left anterior descending cor-onary artery (LAD). We chose this timepoint as the enhanced physio-logic effect (cardiac suppression) was observed by day 1. In those animals subjected to I/R of the LAD, oxytocin receptor (OTR) expres-sion normalized to β-actin was reduced by 40% compared with con-trols.Page 5 of 8(page number not for citation purposes)including shock in which myocardial injury plays a contributiveand persists throughout our seven day observation period.Critical Care    Vol 13 No 3    Indrambarya et al.role [1-3,12-17]. However, the cardiovascular effect of vaso-pressin on the injured myocardium has yet to be elucidated.In this study we found that low-dose vasopressin did not sig-nificantly alter arterial blood pressure or cardiac ejection frac-tion in the uninjured state. This experimental observationcorrelates with the clinical finding that normotensive patientsdo not exhibit a physiologic response to low-dose vasopressin[37,39]. In contrast, we found AVP significantly decreasedLVEF in a model of ischemia reperfusion. Our model used onehour of LAD ischemia and reproducibly depressed day 1 car-diac ejection fraction by approximately 13% in mice treatedwith saline infusions (control animals). We compared thesesaline-infused mice with the standard drug used for cardio-genic shock (DOB) and noted a significant increase in cardiacejection fraction. This served as both a positive control toassure good absorption of the intra-peritoneal medication aswell as a standard of care arm with which to compare cardiacfunction and mortality. Vasopressin, on the other hand, demon-strated a markedly different effect following LAD I/R than in theintact animal. During the infusion the mean cardiac ejectionfraction dropped by 10% when compared with saline, and by24% compared with baseline. This decrease in cardiac con-tractility appeared to be through a direct cardiac effect asthere was no significant change in either preload (LVEDV) orafterload (arterial blood pressure) due to vasopressin.Vasopressin had no significant effect on cardiac function inintact mice, while following I/R injury vasopressin was cardio-suppressive. We speculated that this may have resulted fromalterations in vasopressin receptor expression as a result of I/R. We found that V1R and OTR were expressed in the heart,while V2R was not detectable. V1R expression was notaltered as a result of I/R, while OTR expression was reducedby 40% (Figure 4). This stable expression of V1R combinedwith decreased OTR expression could result in predominantvasoconstriction in the injured heart, potentially worsening car-diac ischemia and resulting in dysfunction.In addition to a decline in cardiac contractility, vasopressinresulted in a marked increase in early mortality compared withboth saline and DOB-treated mice. The moderate reduction incardiac ejection fraction and non-statistically significant trendtowards a 5 mmHg decrease in blood pressure in the vaso-pressin-infused group essentially excludes cardiogenic shockas a cause of the excess mortality. Further support for thiscomes from routine monitoring of the post-operative appear-ance (grooming, temperature, activity level), with all groupsappearing healthy with no evidence of general medical deteri-oration as would be expected with cardiac insufficiency. Vaso-pressin and its analogue terlipressin have been reported toinduce cardiac arrhythmia (bradycardia and Torsade dePointes) not associated with clear evidence of myocardial inf-arction [40-45]. Given the generally healthy clinical conditionrelated to sudden cardiac events (arrhythmia). How might thisoccur? Vasopressin has been found to block KATP channels inthe vascular endothelium, where this reverses vasoplegia inthe systemic circulation [8], but may contribute to suddenvasospasm in the coronary circulation [46]. KATP channelsexpressed on cardiomyocytes are thought to decrease mem-brane excitability when activated through stress and thus maybe key mediators of ischemic tolerance [46]. Increased mem-brane excitability as a result of vasopressin acting to closeKATP channels could increase the risk of arrhythmia.Limitations of this study include a lack of continuous cardiacand hemodynamic monitoring. Transient changes in afterloadmay have influenced the extent of ischemic cardiac damagebut may not have been detected by our single measurement,while a lack of continuous cardiac rhythm monitoring did notallow us to determine whether arrhythmia was in fact the majorcause of death. Other limitations were the lack of quantifica-tion of ischemic myocardium as a result of the I/R, and that weused whole left ventricular tissue rather than isolated cardio-myocyte digestion, and were thus not able to assess fromwhich cell type the vasopressin receptors were derived. There-fore, the down-regulation of OTR must be regarded as hypoth-esis generating rather than a proof of mechanism.In summary, we found that low-dose vasopressin infusion hadno significant cardiovascular effect in normal mice. In contrast,following ischemic injury to the myocardium vasopressinexerted a strong negative inotropic effect on the heart, result-ing in a significant decline in cardiac ejection fraction as meas-ured by echocardiogram. This decline was not mediatedthrough changes in left ventricular preload or afterload at thetime point assayed and the possibility of a direct cardiac effectis raised. We speculate that I/R, by decreasing OTR expres-sion in the heart, may result in vasopressin-inducing vasocon-striction and cardiac dysfunction in the injured heart.ConclusionsAVP infusion significantly depressed the myocardial functionin I/R injured model and increased the mortality rate in compar-ison with SL and DOB. The use of vasopressin may be asso-ciated with cardiac suppression in non-vasodilatory shockstates involving significant cardiac injury.Key messages• Vasopressin infusion decreases cardiac ejection frac-tion and increases mortality after I/R injury.• The decrease in cardiac ejection fraction is not caused by an increase in afterload, but rather through a decrease in cardiac contractility.• Vasopressin should be used with caution in patients who may have a cardiac component contributing to Page 6 of 8(page number not for citation purposes)of the mice, we speculate that the majority of deaths may have their shock.Available online http://ccforum.com/content/13/3/R98Competing interestsThe authors declare that they have no competing interests.Authors' contributionsTI drafted the manuscript, performed echocardiography andmolecular experiments, and assisted with animal experiments.JB designed the experiments, wrote the manuscript and per-formed echocardiography. YW performed animal experiments.MM performed molecular experiments. KW designed theexperiments and wrote the manuscript. All authors read andapproved the final manuscript.AcknowledgementsThis project was funded by Canadian Institutes of Health Research (CIHR), Heart and Stroke Foundation and Providence Health Care Research Institute. KW is a Michael Smith Foundation for Health Research Distinguished Scholar. JB is a Providence Health Care Research Institute Physician Scholar. TI is a Faculty of Medicine, Chu-lalongkorn University Scholar.References1. Russell JA, Walley KR, Singer J, Gordon AC, Hebert PC, CooperDJ, Holmes CL, Mehta S, Granton JT, Storms MM, Cook DJ, Pres-neill JJ, Ayers D: Vasopressin versus norepinephrine infusion inpatients with septic shock.  N Engl J Med 2008, 358:877-887.2. Dunser MW, Mayr AJ, Stallinger A, Ulmer H, Ritsch N, Knotzer H,Pajk W, Mutz NJ, Hasibeder WR: Cardiac performance duringvasopressin infusion in postcardiotomy shock.  Intensive CareMed 2002, 28:746-751.3. Patel BM, Chittock DR, Russell JA, Walley KR: Beneficial effectsof short-term vasopressin infusion during severe septicshock.  Anesthesiology 2002, 96:576-582.4. Holmes CL, Landry DW, Granton JT: Science review: Vaso-pressin and the cardiovascular system part 1 – receptor phys-iology.  Crit Care 2003, 7:427-434.5. Dunser MW, Mayr AJ, Ulmer H, Ritsch N, Knotzer H, Pajk W, Luck-ner G, Mutz NJ, Hasibeder WR: The effects of vasopressin onsystemic hemodynamics in catecholamine-resistant septicand postcardiotomy shock: a retrospective analysis.  AnesthAnalg 2001, 93:7-13.6. Gold JA, Cullinane S, Chen J, Oz MC, Oliver JA, Landry DW: Vaso-pressin as an alternative to norepinephrine in the treatment ofmilrinone-induced hypotension.  Crit Care Med 2000,28:249-252.7. Holmes CL, Patel BM, Russell JA, Walley KR: Physiology of vaso-pressin relevant to management of septic shock.  Chest 2001,120:989-1002.8. Landry DW, Oliver JA: The ATP-sensitive K+ channel mediateshypotension in endotoxemia and hypoxic lactic acidosis indog.  J Clin Invest 1992, 89:2071-2074.9. Noguera I, Medina P, Segarra G, Martinez MC, Aldasoro M, VilaJM, Lluch S: Potentiation by vasopressin of adrenergic vaso-constriction in the rat isolated mesenteric artery.  Br J Pharma-col 1997, 122:431-438.10. Holmes CL, Landry DW, Granton JT: Science Review: Vaso-pressin and the cardiovascular system part 2 – clinical physi-ology.  Crit Care 2004, 8:15-23.11. Landry DW, Levin HR, Gallant EM, Seo S, D'Alessandro D, OzMC, Oliver JA: Vasopressin pressor hypersensitivity invasodilatory septic shock.  Crit Care Med 1997, 25:1279-1282.12. Dellinger RP, Levy MM, Carlet JM, Bion J, Parker MM, Jaeschke R,Reinhart K, Angus DC, Brun-Buisson C, Beale R, Calandra T, Dhai-naut JF, Gerlach H, Harvey M, Marini JJ, Marshall J, Ranieri M, Ram-say G, Sevransky J, Thompson BT, Townsend S, Vender JS,Zimmerman JL, Vincent JL: Surviving Sepsis Campaign: Interna-tional guidelines for management of severe sepsis and septicshock: 2008.  Crit Care Med 2008, 36:296-327.14. Albanese J, Leone M, Delmas A, Martin C: Terlipressin or nore-pinephrine in hyperdynamic septic shock: a prospective, rand-omized study.  Crit Care Med 2005, 33:1897-1902.15. Dubois MJ, De Backer D, Creteur J, Anane S, Vincent JL: Effect ofvasopressin on sublingual microcirculation in a patient withdistributive shock.  Intensive Care Med 2003, 29:1020-1023.16. Dunser MW, Mayr AJ, Ulmer H, Knotzer H, Sumann G, Pajk W,Friesenecker B, Hasibeder WR: Arginine vasopressin inadvanced vasodilatory shock: a prospective, randomized, con-trolled study.  Circulation 2003, 107:2313-2319.17. Iijima T, Oguchi T, Kashimoto S: Does vasopressin infusionimprove the outcome of severe septic-shock without anyadverse effects?  Anesthesiology 2003, 98:793. author reply793.18. Shelly MP, Greatorex R, Calne RY, Park GR: The physiologicaleffects of vasopressin when used to control intra-abdominalbleeding.  Intensive Care Medicine 1988, 14:526-531.19. Boyle WASL 3rd: Direct cardiac effects of vasopressin andtheir reversal by a vascular antagonist.  Am J Physiol 1986,251:H734-741.20. Zenteno-Savin T, Sada-Ovalle I, Ceballos G, Rubio R: Effects ofarginine vasopressin in the heart are mediated by specificintravascular endothelial receptors.  Eur J Pharmacol 2000,410:15-23.21. Cheng CP, Igarashi Y, Klopfenstein HS, Applegate RJ, Shihabi Z,Little WC: Effect of vasopressin on left ventricular perform-ance.  Am J Physiol 1993, 264:H53-60.22. Wilson MF, Brackett DJ, Archer LT, Hinshaw LB: Mechanisms ofimpaired cardiac function by vasopressin.  Ann Surg 1980,191:494-500.23. Oikawa R, Nasa Y, Ishii R, Kuwaki T, Tanoue A, Tsujimoto G, TakeoS: Vasopressin V1A receptor enhances baroreflex via the cen-tral component of the reflex arc.  Eur J Pharmacol 2007,558:144-150.24. Luk J, Ajaelo I, Wong V, Wong J, Chang D, Chou L, Reid IA: Roleof V1 receptors in the action of vasopressin on the baroreflexcontrol of heart rate.  American Journal of Physiology 1993,265:R524-529.25. Weig HJ, Laugwitz KL, Moretti A, Kronsbein K, Stadele C, BruningS, Seyfarth M, Brill T, Schomig A, Ungerer M: Enhanced cardiaccontractility after gene transfer of V2 vasopressin receptors invivo by ultrasound-guided injection or transcoronary delivery.Circulation 2000, 101:1578-1585.26. Laugwitz KL, Ungerer M, Schoneberg T, Weig HJ, Kronsbein K,Moretti A, Hoffmann K, Seyfarth M, Schultz G, Schomig A: Aden-oviral gene transfer of the human V2 vasopressin receptorimproves contractile force of rat cardiomyocytes.  Circulation1999, 99:925-933.27. Thibonnier M, Conarty DM, Preston JA, Plesnicher CL, Dweik RA,Erzurum SC: Human vascular endothelial cells express oxy-tocin receptors.  Endocrinology 1999, 140:1301-1309.28. D'Souza SP, Davis M, Baxter GF: Autocrine and paracrineactions of natriuretic peptides in the heart.  Pharmacol Ther2004, 101:113-129.29. Gutkowska J, Jankowski M, Mukaddam-Daher S, McCann SM:Oxytocin is a cardiovascular hormone.  Braz J Med Biol Res2000, 33:625-633.30. Luckner G, Dunser MW, Jochberger S, Mayr VD, Wenzel V, UlmerH, Schmid S, Knotzer H, Pajk W, Hasibeder W, Mayr AJ, Friese-necker B: Arginine vasopressin in 316 patients with advancedvasodilatory shock.  Crit Care Med 2005, 33:2659-2666.31. Holmes CL, Walley KR, Chittock DR, Lehman T, Russell JA: Theeffects of vasopressin on hemodynamics and renal function insevere septic shock: a case series.  Intensive Care Med 2001,27:1416-1421.32. Jolly S, Newton G, Horlick E, Seidelin PH, Ross HJ, Husain M, Dza-vik V: Effect of vasopressin on hemodynamics in patients withrefractory cardiogenic shock complicating acute myocardialinfarction.  Am J Cardiol 2005, 96:1617-1620.33. Holmes CL, Walley KR: Arginine vasopressin in the treatmentof vasodilatory septic shock.  Best Pract Res Clin Anaesthesiol2008, 22:275-286.34. Yasujima M, Abe K, Tanno M, Omata K, Kasai Y, Sato M, Kimura T,Yoshinaga K: Decreased urinary active and inactive kallikreinPage 7 of 8(page number not for citation purposes)13. Lange M, Ertmer C, Westphal M: Vasopressin vs. terlipressininthe treatment of cardiovascular failure in sepsis.  IntensiveCare Med 2008, 34:821-832.by chronic infusion of vasopressin in conscious rats.  Tohoku JExp Med 1985, 145:215-222.Critical Care    Vol 13 No 3    Indrambarya et al.35. Leclerc F, Walter-Nicolet E, Leteurtre S, Noizet O, Sadik A, CremerR, Fourier C: Admission plasma vasopressin levels in childrenwith meningococcal septic shock.  Intensive Care Med 2003,29:1339-1344.36. Michael LH, Entman ML, Hartley CJ, Youker KA, Zhu J, Hall SR,Hawkins HK, Berens K, Ballantyne CM: Myocardial ischemia andreperfusion: a murine model.  Am J Physiol 1995,269:H2147-2154.37. Landry DW, Levin HR, Gallant EM, Ashton RC Jr, Seo S, D'Ales-sandro D, Oz MC, Oliver JA: Vasopressin deficiency contributesto the vasodilation of septic shock.  Circulation 1997,95:1122-1125.38. Gold J, Cullinane S, Chen J, Seo S, Oz MC, Oliver JA, Landry DW:Vasopressin in the treatment of milrinone-induced hypoten-sion in severe heart failure.  Am J Cardiol 2000, 85:506-508.A511.39. Chen JM, Cullinane S, Spanier TB, Artrip JH, John R, Edwards NM,Oz MC, Landry DW: Vasopressin deficiency and pressor hyper-sensitivity in hemodynamically unstable organ donors.  Circu-lation 1999, 100:II244-246.40. Kelly KJ, Stang JM, Mekhjian HS: Vasopressin provocation ofventricular dysrhythmia.  Ann Intern Med 1980, 92:205-206.41. Klein GJ: Vasopressin, "torsades de pointes," and QT syn-drome.  Ann Intern Med 1980, 93:511-512.42. Fitz JD: Vasopressin induction of ventricular ectopy.  Arch InternMed 1982, 142:644.43. Solanki P, Chawla A, Garg R, Gupta R, Jain M, Sarin SK: Benefi-cial effects of terlipressin in hepatorenal syndrome: a pro-spective, randomized placebo-controlled clinical trial.  JGastroenterol Hepatol 2003, 18:152-156.44. Urge J, Sincl F, Prochazka V, Urbanek K: Terlipressin-inducedventricular arrhythmia.  Scand J Gastroenterol 2008,43:1145-1148.45. Hobo R, Netsu S, Koyasu Y, Tsutsumi O: Bradycardia and car-diac arrest caused by intramyometrial injection of vasopressinduring a laparoscopically assisted myomectomy.  ObstetGynecol 2009, 113:484-486.46. Marban E: The surprising role of vascular K(ATP) channels invasospastic angina.  J Clin Invest 2002, 110:153-154.Page 8 of 8(page number not for citation purposes)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0223341/manifest

Comment

Related Items