UBC Faculty Research and Publications

Differential mRNA expression of seven genes involved in cholesterol metabolism and transport in the liver… Li, Xinrui; Schulte, Patricia; Godin, David V; Cheng, Kimberly M Jun 8, 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12711_2011_Article_2536.pdf [ 459.99kB ]
Metadata
JSON: 52383-1.0223334.json
JSON-LD: 52383-1.0223334-ld.json
RDF/XML (Pretty): 52383-1.0223334-rdf.xml
RDF/JSON: 52383-1.0223334-rdf.json
Turtle: 52383-1.0223334-turtle.txt
N-Triples: 52383-1.0223334-rdf-ntriples.txt
Original Record: 52383-1.0223334-source.json
Full Text
52383-1.0223334-fulltext.txt
Citation
52383-1.0223334.ris

Full Text

RESEARCH Open AccessDifferential mRNA expression of seven genesinvolved in cholesterol metabolism and transportin the liver of atherosclerosis-susceptible and-resistant Japanese quail strainsXinrui Li1,4, Patricia Schulte2, David V Godin3 and Kimberly M Cheng1*AbstractBackground: Two atherosclerosis-susceptible and -resistant Japanese quail (Coturnix japonica) strains obtained bydivergent selection are commonly used as models to study atherosclerosis, but no genetic characterization of theirphenotypic differences has been reported so far. Our objective was to examine possible differences in theexpression of genes involved in cholesterol metabolism and transport in the liver between these two strains and toevaluate the value of this model to analyze the gene system affecting cholesterol metabolism and transport.Methods: A factorial study with both strains (atherosclerosis-susceptible versus atherosclerosis-resistant) and twodiets (control versus cholesterol) was carried out. The mRNA concentrations of four genes involved in cholesterolbiosynthesis (HMGCR, FDFT1, SQLE and DHCR7) and three genes in cholesterol transport (ABCG5, ABCG8 and APOA1)were assayed using real-time quantitative PCR. Plasma lipids were also assayed.Results: Expression of ABCG5 (control diet) and ABCG8 (regardless of dietary treatment) and expression of HMGCR,FDFT1 and SQLE (regardless of dietary treatment) were significantly higher in the atherosclerosis-resistant than in theatherosclerosis-susceptible strain. Plasma triglyceride and LDL levels, and LDL/HDL ratio were significantly higher inthe atherosclerosis-susceptible than in the atherosclerosis-resistant strain fed the cholesterol diet. In theatherosclerosis-susceptible strain, ABCG5 expression regressed significantly and positively on plasma LDL level,whereas DHCR7 and SQLE expression regressed significantly and negatively on plasma triglyceride level.Conclusions: Our results provide support for the hypothesis that the atherosclerosis-resistant strain metabolizes andexcretes cholesterol faster than the atherosclerosis-susceptible strain. We have also demonstrated that these quailstrains are a useful model to study cholesterol metabolism and transport in relation with atherosclerosis.BackgroundAtherosclerosis is a complex pathological process that isaffected by both environmental and genetic factors; it is amajor cause of morbidity and mortality in industrializedsocieties [1,2]. Although surgical and medical treatmentshave progressed, current therapies that slow the formationof atherosclerotic plaques are not totally successful [2].Therefore, it is necessary to continue investigating the fun-damental mechanisms that cause atherosclerosis todevelop more effective forms of treatment e.g. [3].Japanese quail (Coturnix japonica) was first used as aresearch model for atherosclerosis in the early 1960s [4],and since then, numerous studies have demonstrated thevalue of this model to obtain information on the devel-opment of hypercholesterolemia and atherosclerosis inman. One reason why the Japanese quail is a good modelto study atherosclerosis is that it can develop “complex”vascular lesions (focal haemorrhage, calcification andfibrosis) that are very similar to lesions in man [5–7].Divergent selection of Japanese quail for susceptibilityand resistance to atherosclerotic plaque formationinduced by dietary cholesterol have resulted in twostrains i.e. atherosclerosis-susceptible (SUS) and athero-sclerosis-resistant (RES) strains that are valuable models.* Correspondence: kmtc@mail.ubc.ca1Avian Research Centre, Faculty of Land and Food Systems, The University ofBritish Columbia, Vancouver, BC, CanadaFull list of author information is available at the end of the article© 2012 Li et al.; licensee Biomed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.Li et al. Genetics Selection Evolution 2012, 44:20 Ge n e t i c sSe lec t ionEvolut ionhttp://www.gsejournal.org/content/44/1/20The female Japanese quail does not develop atheroscleroticplaques even when exposed to a 0.5% w/w cholesterol diet[7]. Before selection, 8% of the males from a random-bredfoundation population developed atherosclerosis when feda high cholesterol diet (0.5% w/w) [5]. After divergent se-lection during four generations, 80% of the SUS males ascompared to only 4% of the RES males developed athero-sclerosis [5]. However, apart from the characterization ofcertain physiological differences between these two strains,no molecular characterization of the phenotypic differ-ences has been carried out. Previous studies [5,8] haveshown that after cholesterol feeding, plasma cholesterollevels remain high for a significantly longer time in theSUS than in the RES males. In addition, SUS males havefatty livers and higher amounts of liver cholesterol thanRES males. Shih et al. [5] hypothesized that the RES indivi-duals were more resistant because “they metabolized andexcreted cholesterol faster than the SUS”. Therefore, inour study, we have compared the expression of severalgenes involved in cholesterol metabolism and transport inthe liver of SUS and RES males.The mevalonate pathway (or HMG-CoA reductase path-way) is an important component of the endogenous choles-terol biosynthesis pathway [9] in the liver. During theprocess of converting mevalonate to cholesterol and othersterol isoprenoids, many important enzymes such as 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCRor HMG-CoA reductase), squalene synthase (FDFT1),squalene expoxidase (SQLE), mevalonate kinase (MVK),phosphomevalonate kinase (PMVK) and 7-dehydrocholes-terol reductase (DHCR7) are involved in regulating theoverall process [9]. We examined the individual expressionof the following genes HMGCR, FDFT1, SQLE and DHCR7by quantifying their mRNA levels in liver cells of SUS andRES males.ABCG5 and ABCG8, from the ATP binding cassette(ABC) transporter family, are cholesterol excretiontransporters [3]. Apolipoprotein A1 (APOA1) is themajor protein component of HDL in plasma and isbelieved to have a protective effect against atheroscler-osis by participating in the reverse transport of hepaticcholesterol from tissues to the bile for excretion[10–12]. Therefore, we also included the genes of thesethree proteins in our study.MethodsExperimental birdsThe SUS and RES quail stains were acquired by theUniversity of British Columbia (UBC) Quail GeneticResource Centre from the North Carolina State Universityin 1989. Since then, they have undergone further divergentselection for susceptibility and resistance to atheroscleroticplaque formation induced by dietary cholesterol (0.5%w/w)(KM Cheng, unpublished data).Experimental designAfter hatching, both SUS (N= 50) and RES (N= 50)males were fed a semi-synthetic diet (Table 1) preparedby the feed mill at the Agriculture and Agri-FoodCanada Research Station at Agassiz, British Columbia,according to the NRC nutrient requirement standardsrecommended for quail (http://www.nap.edu/catalog/2114.html). At six weeks of age, 13 birds (6 SUS and 7RES) were euthanized and liver tissues were collected.The remaining birds were divided into two dietary treat-ment groups, fed either a regular synthetic diet or a syn-thetic diet containing cholesterol (0.5% w/w) (Table 1)for another six weeks (Table 2). At twelve weeks of age,24 birds from each dietary treatment group were eutha-nized and liver tissue samples were collected for furtheranalysis. This research was carried out with the approvalof the UBC Animal Care Committee, Certificate # A06-1473.Preparation of total RNA and synthesis of first-strandcDNAThe birds were euthanized by decapitation. Livers werethen quickly removed, dissected and stored in RNAlaterreagent (Qiagen, Valencia, CA, USA) at −20°C until use.Total RNA from liver cells was extracted using RNeasymini columns (Qiagen, Valencia, CA, USA). Concentra-tion and purity were checked by spectrophotometer.cDNA was synthesized using SuperScript™ ІІІ RT (200units/μl) (Invitrogen Corporation, Carlsbad, CA, USA) at50°C using Oligo (dT)18 primers (Fermentas Inc., GlenBurnie, MD, USA) according to the manufacturer'sinstructions. Each 38 μl reaction volume contained 5 μg oftotal RNA, 1 μl Oligo (dT)18 primers (100 mM), 2 μldNTP (10 mM) (Fermentas Inc., Glen Burnie, MD, USA),Table 1 Semi-synthetic dietsIngredients (g/kg) Control diet Cholesterol dietSoy protein flour (50% protein) 340 340Corn starch 400 390Limestone 50 50Mineral premix 5 5Monofos 30 30Sucrose 20 20Alphacel 70 70Vitamin premix 5 5D-L methionine 4 4Choline chloride 3.8 3.8Tallow 50 50Vegetable oil 30 30Cholesterol 0 5Cholic acid 0 2.5Li et al. Genetics Selection Evolution 2012, 44:20 Page 2 of 11http://www.gsejournal.org/content/44/1/208 μl 5x first strand buffer, 4 μl DTT (0.1 M) and 2 μlSuperScript™ ІІІ RT. One μl of RiboLock™ RNase Inhibitor(40 U/μl) (Fermentas Inc., Glen Burnie, MD, USA) wasadded to each reaction mixture in order to inhibit RNAdegradation during reverse transcription. The first-strandcDNA was stored at −20° C for future real-time PCR.Primer designPrimer pairs for each gene selected were designed usingeither Japanese quail (Coturnix japonica) or chicken(Gallus gallus) sequence information from the NationalCenter for Biotechnology Information (NCBI, www.ncbi.nlm.nih.gov) GenBank database. The glyceraldehyde3-phosphate dehydrogenase (GAPDH) gene was used asan internal control [13]. Real-time PCR primers weredesigned using Primer Express version 2.0.0 (AppliedBiosystems, Foster City, CA, USA) and were orderedfrom IDT (Integrated DNA technologies, Coralville, IA,USA). Primer information is shown in Table 3.Real-time PCRAn aliquot of the purified first strand cDNA templates wasused to prepare the standard curve cDNA template mix-ture (calibrated sample), while the remainder was dilutedto half the concentration for the real-time PCR. Real-timePCR was performed using an ABI Prism 7000 (AppliedBiosystems, Foster City, CA, USA). Each sample was runin duplicate. The PCR was carried out in a reaction volumeof 22 μl, containing 2 μl cDNA template (diluted 1:1 inwater), 0.4 μl forward primer (10 μM), 0.4 μl reverse pri-mer (10 μM) (Integrated DNA technologies, Coralville, IA)and 10 μl SYBR Green universal PCR Master Mix (AppliedBiosystems, Foster City, CA, USA), and water was addedto a final volume of 22 μl. The following PCR conditionswere applied: 50° C for 2 min, 95° C for 10 min, and 40cycles of denaturation at 95° C for 15 s and annealing andextension at 60° C for 1 min. Fluorescence measurementswere recorded using SYBR as the reporter dye and theresults were normalized to the endogenous control,GAPDH. A standard curve was produced for all primersusing serial dilutions of cDNA (2x, 1x, 1/2x, 1/4x and 1/8x).The 2x mixture was prepared with the first-strand cDNAproducts (which had twice the concentration of templatecDNA). Raw data analyses were done with the 7000 SystemSoftware (Applied Biosystems, Foster City, CA, USA). Ex-pression levels were quantified by comparing the results ofeach real-time PCR to the standard curve produced by ser-ial dilutions. Normalized mRNA levels were then calculatedas the ratio of the measured amount of target gene mRNAto the amount of GAPDHmRNA.Plasma lipid assaysPlasma samples (N= 56; including samples from birdsused for the real-time PCR analysis) from 6-week old(6 SUS/control and 7 RES/control) and 12-week oldTable 2 Dietary treatments (between weeks 7 and 12)and number of birds analyzedDiet treatments SUS RESRegular diet 6 males 6 malesCholesterol diet (0.5% w/w) 6 males 6 malesTable 3 Real-time PCR primer combinationsPrimer name Gene ID Species Primer Primer sequence (5’- 3’)GAPDH Z19086 C. coturnix Forward GGCACTGTCAAGGCTGAGAATReverse GCATCTCCCCACTTGATGTTGHMGCR NM_204485 G. gallus Forward GCAGAGGGCCTTACAACReverse GGAGGAGCAAGCCGTATFDFT1 NM_001039294 G. gallus Forward GCCATCATGTACCAGTATGTG GAAReverse GCTGCGTCTTGTTGGAGGAASQLE NM_001030953 G. gallus Forward GAGGTAGAAATTCCTTTTCCAACATCTReverse GCCGTGATGGAAGGACCTTDHCR7 XM_420914 G. gallus Forward GGGAAAGATTGGAAACGCTACAReverse CAGATTCTGTGTCAGCCTTAAAACAABCG5 XM_419457 G. gallus Forward ATTACAAGATCCCAAGGTCATGCTReverse GAGACGATCTGGTTTGCAGTCAABCG8 XM_419458 G. gallus Forward GCCTTCCAGCATGTTTTTCAGReverse CGCAACCGTAGCTCTGCTATTAPOA1 D85133 C. coturnix Forward TCTGGTGCAGGAATTCAAGGAReverse TCATCCAGGAGGTCGATCAAGLi et al. Genetics Selection Evolution 2012, 44:20 Page 3 of 11http://www.gsejournal.org/content/44/1/20(16 SUS/control, 20 SUS/cholesterol, 7 RES/control, 6RES/cholesterol) SUS and RES males fed both dietarytreatments were sent to the Department of Pathology andLaboratory Medicine at St. Paul’s Hospital (Vancouver, BC)and assayed for total cholesterol, HDL, and triglyceridesusing enzymatic methods on an ADVIA 1650 ChemistrySystem. HDL was assessed by the direct method withoutprecipitation of apolipoprotein B [14–16]. LDL values weredetermined by Friedewald’s formula, using measured valuesfor total cholesterol, HDL and triglycerides [17,18].Statistical analysisLeast squares analysis of variance was performed usingJMP 8.0 (SAS Institute, North Carolina, 2008). The statis-tical model for mRNA levels was:Yijkl ¼ μþ Si þ Dj þ Ak þ SDð Þij þ SAð Þik þ Eijklwhere Yijkl is the measure for the lth individual of the ithstrain, jth diet from kth age group; Si indicates whether thebird was RES or SUS; Ak represents the two age groupsi.e. 6-week or 12-week old; Dj indicates whether the birdwas on a regular diet or a cholesterol diet; (SD)ij and (SA)ikare interaction terms; and Eijkl is the error term. The datawere log-transformed before analysis. The results werereported as the least square mean values for each dataset ±standard error of means (SEM) and the level of statisticalsignificance was defined at P< 0.05. Tukey’s HSD was usedfor mean separation.For plasma lipid parameters, the following model wasused:Yijk ¼ μþ Si þ Dj þ SDð Þij þ EijkThe mRNA levels of the seven candidate genes werealso regressed on the plasma lipid parameters with mul-tiple regression analysis (JMP 8.0).ResultsThe effects of strain and diet on the mRNA expression ofthe seven genes examined are shown in Table 4. Becausenone of the 6-week old birds were fed the cholesterol-enhanced diet, we could examine the effects of strain andage on gene expression only for the birds fed the regulardiet (Table 5).Mevalonate pathway genesHMGCRThe expression of HMGCR was significantly (P< 0.01)higher in RES (1.08 ± 0.07 HMGCR/GAPDH) than inSUS birds (0.82 ± 0.07 HMGCR/GAPDH), regardless ofdietary treatment and age (Table 4). No significant inter-action effect was detected.FDFT1The expression of FDFT1 was significantly (P< 0.04)higher in RES (0.89 ± 0.11 FDFT1/GAPDH) than in SUSbirds (0.56 ± 0.11 FDFT1/GAPDH), regardless of dietarytreatment and age (Table 4). No significant interactioneffect was detected.SQLEThe expression of SQLE was significantly (P< 0.02) higherin RES than in SUS individuals when the birds were fedthe regular diet (Table 5), and its expression in both strainswas significantly (P< 0.01) suppressed when the birdswere fed the cholesterol diet (Table 4). However, the strainx diet interaction was not significant (P= 0.51).DHCR7There were no strain differences (P= 0.35) in the expres-sion of DHCR7 when the birds were fed the control diet(Table 5). When challenged by the cholesterol diet, its ex-pression was significantly (P< 0.04) higher in RES(1.012±0.01 DHCR7/GAPDH) than in SUS birds(0.673±0.01 DHCR7/GAPDH) (Table 4). However, thestrain x diet interaction was not significant (P= 0.6). Six-week old birds (1.36 ± 0.18 DHCR7/GAPDH) had asignificantly (P< 0.01) higher DHCR7 expression than12-week old birds (0.88 ± 0.10 DHCR7/GAPDH) (Table 5).ATP-cassette binding transporter genesABCG5There was a significant (P< 0.05) diet x strain interactionin ABCG5 gene expression. When fed the regular diet,expression of ABGC5 was significantly higher in RES thanin SUS birds. When challenged with the cholesterol diet,the difference in expression level in the two strains be-came non-significant (Table 4). There was a significant(P< 0.0005) strain x age interaction for birds on the regulardiet (Table 5); the expression of ABCG5 significantlyincreased with age in RES birds but not in SUS birds.ABCG8The expression of ABCG8 was significantly (P< 0.02)higher in RES (1.50± 0.14 ABCG8/GAPDH) than in SUSbirds (0.97 ± 0.15 ABCG8/GAPDH) (Table 4). Birds fedthe cholesterol diet (1.59 ± 0.17 ABCG8/GAPDH) had sig-nificantly (P< 0.002) higher ABCG8 expression than birdson the control diet (0.88 ± 0.12 ABCG8/GAPDH) (Table 4).Twelve-week old birds (1.38 ± 0.11 ABCG8/GAPDH) onregular diet had a significantly (P< 0.004) higher ABCG8expression than 6-week old birds (0.82 ± 0.19 ABCG8/GAPDH) on the same diet (Table 5).APOA1There was no significant (P = 0.46) strain effect on theexpression of APOA1. Both RES and SUS birds fed theLi et al. Genetics Selection Evolution 2012, 44:20 Page 4 of 11http://www.gsejournal.org/content/44/1/20cholesterol diet (1.40 ± 0.06 APOA1/GAPDH) had a sig-nificantly (P< 0.001) higher expression compared tobirds fed the regular diet (0.82 ± 0.05 APOA1/GAPDH)(Table 4). Twelve-week old birds (1.12 ± 0.07 APOA1/GAPDH) on regular diet had a significantly (P< 0.0001)higher APOA1 expression than 6-week old birds(0.54 ± 0.07 APOA1/GAPDH) on the same diet (Table 5).Plasma total cholesterol and LDL levelsThere was a significant strain x diet interaction forplasma total cholesterol (P< 0.013) and LDL (P< 0.01)levels. Plasma total cholesterol and LDL levels in SUSand RES birds fed the regular diet were not different butthey were significantly (P< 0.0001) higher when thebirds were fed the cholesterol diet, with levels in SUSbirds significantly (P< 0.05) higher than those in RESbirds (Tables 6 and 7).Plasma triglyceride levelsThere was a significant (P< 0.02) strain x diet inter-action in plasma triglyceride levels. Plasma triglyceridelevels in SUS and RES birds fed the regular diet were notdifferent. When the birds were fed the cholesterol diet,plasma triglyceride levels increased significantly(P< 0.05) in SUS but not in the RES birds (Table 6).Plasma HDL levels and LDL/HDL ratioThere was a significant (P< 0.028) strain x diet inter-action in plasma HDL levels. Plasma HDL levels weresignificantly (P< 0.05) higher in SUS than in RES birdswhen they were on the regular diet. Plasma HDL levelsdid not change significantly when the birds were fed thecholesterol diet; however, the difference between theSUS and RES birds became non-significant (Table 7).These small changes in the HDL level did not affect theLDL/HDL ratio (see Table 8 and Table 7).Regression of gene expression on plasma lipid levelsBecause regulation of gene expression may differ be-tween the two strains, they were analysed separately(Table 9). APOA1 expression regressed (r2 = 0.36) signifi-cantly (P< 0.009) on plasma triglyceride level in the SUSbut not in the RES birds (Table 9, Figure 1A and C). InRES birds, APOA1 expression tended (P< 0.06; r2 = 0.24)to regress on LDL (Table 9, Figure 1D) and regressed sig-nificantly (P< 0.04; r2 = 0.28) on the LDL/HDL ratio(Figure 2).Table 4 Liver mRNA expressions} in SUS and RES quail fed regular or cholesterol dietsGene Effect Regular diet Cholesterol dietRES (N= 13) SUS (N= 12) RES (N= 6) SUS (N= 6)HMGCR *P< 0.01 1.059 ± 0.080 0.776 ± 0.080 1.082 ± 0.127 0.946 ± 0.127FDFT1 *P< 0.04; †P< 0.02 1.220 ± 0.125 0.598 ± 0.125 0.563 ± 0.177 0.529 ± 0.177DHCR7 1.209 ± 0.157 1.094 ± 0.157 1.012 ± 0.222a 0.673 ± 0.222bSQLE †P< 0.01 1.782 ± 0.308 0.392 ± 0.320 0.044 ± 0.453 0.008 ± 0.453ABCG5 *† P< 0.05 0.914 ± 0.088a 0.566 ± 0.092b 0.959 ± 0.130ab 1.064 ± 0.130aABCG8 *P< 0.01; †P< 0.001 1.153 ± 0.163 0.609 ± 0.169 1.856 ± 0.240 1.331 ± 0.240APAO1 †P< 0.001 0.857 ± 0.097 0.785 ± 0.101 1.382 ± 0.143 1.412 ± 0.143N=number of individuals measured; total number of individuals = 37; *denotes significant strain effect; †denotes significant diet effect; *†denotes significant strainx diet interaction; }all values (± SEM) indicate the gene of interest relative to GAPDH (arbitrary units).Table 5 - Liver mRNA expressions} in 6-week old and 12-week old SUS and RES quail fed the regular dietGene Effect 6-week old 12-week oldRES (N= 7) SUS (N= 6) RES (N= 6) SUS (N= 6)HMGCR *P< 0.02 1.110 ± 0.110 0.688 ± 0.110 1.009 ± 0.110 0.864 ± 0.110FDFT1 *P< 0.01 1.359 ± 0.217 0.558 ± 0.217 1.082 ± 0.217 0.638 ± 0.217DHCR7 †P< 0.01 1.423 ± 0.250 1.359 ± 0.250 0.995 ± 0.250 0.829 ± 0.250SQLE *P< 0.02 2.430 ± 0.483 0.414 ± 0.522 1.026 ± 0.522 0.370 ± 0.522ABCG5 *†P< 0.0005 0.594 ± 0.076b 0.547 ± 0.082b 1.288 ± 0.082a 0.586 ± 0.082bABCG8 *P< 0.01; † P< 0.01 0.724 ± 0.189 0.531 ± 0.204 1.654 ± 0.204 0.687 ± 0.204APAO1 †P< 0.0001 0.626 ± 0.093 0.448 ± 0.101 1.126 ± 0.101 1.123 ± 0.101N=number of individuals measured; total number of individuals = 25; *denotes significant strain effect; †denotes significant age effect; *†denotes significant strainx age interaction; }all values (± SEM) indicate the gene of interest relative to GAPDH (arbitrary units).Li et al. Genetics Selection Evolution 2012, 44:20 Page 5 of 11http://www.gsejournal.org/content/44/1/20In the SUS birds, ABCG5 expression regressed(r2 = 0.48) significantly (P< 0.008) and positively onplasma LDL level (Table 9, Figure 3), whereas DHCR7 andSQLE expression regressed significantly (P< 0.04 andP< 0.02, respectively) and negatively on plasma triglycer-ide level (Table 9, Figures 4A and 5A).No other significant regression of gene expression onplasma lipid levels was found in the RES birds. However,given the fact that only a few individuals showed highlevels of plasma lipid, a linear relation between geneexpression and plasma lipid levels may not be valid.Examination of the regression plots revealed that in boththe SUS and RES birds, SQLE and FDFT1 expressionswere completely or drastically suppressed when plasmatriglycerides or LDL reached a threshold level (Figures 5and 6). DHCR7 expression appears to follow the samepattern (Figure 4).DiscussionThe RES and SUS quail strains have been developedthrough divergent selective breeding from the same foun-dation population [5], and thus should be genetically simi-lar except for the changes induced by selection. Previously,it has been reported that one of the observable differencesbetween RES and SUS individuals is that after being fed ona cholesterol-enhanced diet, plasma cholesterol levelsremain elevated in SUS individuals significantly longer thanin RES individuals [5]. Since the liver plays a key role inregulating cholesterol homeostasis by acting as the mainsite for lipid metabolism and bile salt formation, we havefocused our study on this organ and more specifically onthe expression in liver of several cholesterol biosynthesisand transporting genes. Although gene expression is aphenotype and not a genotype, it probably reflects moredirectly genotypic changes than morphological or physio-logical phenotypes.Strain differences in gene expressionABCG8 expression was significantly higher in the liver ofRES as compared to SUS individuals under all dietaryconditions, while ABCG5 expression was higher only undersome dietary conditions. Evidence from both animal mod-els and research on man supports the important role ofthese two ABC transporters in the regulation of theexcretion of sterols from the liver via bile to prevent theaccumulation of dietary sterols [19]. In human, mutationsin either of these genes cause sitosterolemia, a disorder thatis characterized by intestinal hyper-absorption of all sterolsand impaired ability to excrete sterols into bile. Patientsdevelop tendon and tuberous xanthomas, acceleratedatherosclerosis, and premature coronary artery disease[19–21]. Sitosterolemia is caused by an abnormal expres-sion pattern of the ABC transporters (heterodimers of ster-olin-1 and sterolin-2), which function as gatekeepers forTable 6 Plasma total cholesterol levels* and triglyceridelevels** in SUS and RES quail fed regular or cholesteroldietsDiet SUS RESTotalcholesterol(mmol/L)Triglycerides(mmol/L)Totalcholesterol(mmol/L)Triglycerides(mmol/L)Regular 7.45 ± 2.58 c 0.98 ± 0.32 B 6.15 ± 3.90 c 1.18 ± 0.48 BCholesterol 42.43 ± 1.98 a 3.32±0.24 A 24.11±4.21b 1.54 ± 0.52 BTotal number of individuals measured N= 56; P< 0.01 and P< 0.02,respectively *total cholesterol means followed by different lower case lettersare significantly different by Tukey’s HSD; **plasma triglycerides meansfollowed by different capital letters are significantly different by Tukey’s HSD.Table 7 Plasma LDL levels* (N=51; P< 0.01) and HDLlevels)** (N=56; P< 0.028) in SUS and RES quail fedregular or cholesterol dietsDiet SUS RESLDL(mmol/L)HDL(mmol/L)LDL(mmol/L)HDL(mmol/L)Regular 1.75 ± 2.03 c 5.25 ± 0.21 A 1.64 ± 3.07 c 3.96 ± 0.32 BCholesterol 32.82 ± 1.73 a 4.81 ± 0.16 AB 18.64 ± 3.32 b 4.75 ± 0.35 B*plasma LDL means followed by different lower case letters are significantlydifferent by Tukey’s HSD; **plasma HDL means followed by different capitalletters are significantly different by Tukey’s HSD.Table 8 Plasma LDL/HDL ratio in SUS and RES quail fedregular or high cholesterol diets (N= 51; P< 0.0042)Diet SUS RESRegular 0.34 ± 0.43 c 0.42 ± 0.66 cCholesterol 7.16 ± 0.37 a 3.84 ± 0.71 b*means followed by different letters are significantly different by Tukey’s HSD.Table 9 Regression of gene expression on plasma lipidlevelsmRNA expression* SUS RESHMGCR PlasmatriglycerideP = 0.60 NS P= 0.94 NSLDL P= 0.30 NS P= 0.39 NSFDFT1 PlasmatriglycerideP = 0.99 NS P= 0.26 NSLDL P= 0.71 NS P= 0.12 NSDHCR7 Plasmatriglycerider2 =−0.23; P< 0.04 P = 0.80 NSLDL P= 0.29 NS P= 0.63 NSSQLE Plasmatriglycerider2 =−0.29; P< 0.02 P = 0.09 NSLDL r2 =−0.25; P< 0.04 P = 0.16 NSABCG5 PlasmatriglycerideP = 0.11 NS P= 0.47 NSLDL r2 =+0.48; P< 0.008 P = 0.84 NS*There was no significant regression of mRNA expression on HDL levels;NS=not significant.Li et al. Genetics Selection Evolution 2012, 44:20 Page 6 of 11http://www.gsejournal.org/content/44/1/20dietary sterol uptake and excretion [19]. A point mutationin exon 8 of the ABCG5 gene causes premature terminationof translation resulting in a truncated and non-functionalsterolin-1 protein. It has also been reported that severalmutations in ABCG8 result in a truncated non-functionalprotein [19,22]. Besides, another point mutation in thehuman ABCG5 gene enhancing the ABCG5/8 pathway hasbeen shown to protect against atherosclerosis by increasingcholesterol elimination in the bile and reducing plasmacholesterol levels [23]. Furthermore, a study on the mousehas shown that over-expression of ABCG5 and ABCG8decreases diet-induced atherosclerosis, in association withreduced liver and plasma cholesterol levels [20]. Anotherstudy of a partially inbred strain of opossums (Monodelphisdomestica) with low levels of ABCG5 and ABCG8 expres-sion was associated with an elevation in diet-induced VLDLand LDL cholesterol [24]. In our study, the lower ABCG8and ABCG5 expression in the SUS individuals may be atSUS QUAIL RES QUAIL A BC D Figure 1 APOA1 expression in SUS and RES liver relative to plasma triglyceride and LDL levels. In part A: r2 = +0.36; P< 0.009.Figure 2 APOA1 expression in RES liver relative to LDL/HDLratio. r2 = 0.28; P< 0.04.Figure 3 ABCG5 expression in SUS liver relative to plasma LDLlevels. r2 = 0.48; P< 0.008.Li et al. Genetics Selection Evolution 2012, 44:20 Page 7 of 11http://www.gsejournal.org/content/44/1/20SUS QUAIL RES QUAIL A B C D Figure 4 DHCR7 expression in SUS and RES liver relative to to plasma triglyceride and LDL levels. In part A: r2 =−0.23; P< 0.04.SUS QUAILRES QUAILADBCFigure 5 SQLE expression in SUS and RES liver relative to plasma triglyceride and LDL levels. In part A: r2 =−0.29; P< 0.02.Li et al. Genetics Selection Evolution 2012, 44:20 Page 8 of 11http://www.gsejournal.org/content/44/1/20least partially responsible for the greater susceptibility ofthis strain to diet-induced atherosclerosis [24].In the RES birds, ABCG5 expression remained highregardless of dietary treatment, whereas in the SUS birds,an increased level of ABCG5 expression could be inducedby a cholesterol-enhanced diet. Selection for atheroscler-osis susceptibility may have altered the regulation of theABCG5 gene in the RES strain. Studies on mice have pro-vided evidence for the direct control of ABCA1, ABCG5,and ABCG8 mRNA expression by the liver X receptor(LXR) pathway. Indeed, in mice fed with a cholesterol-enhanced diet, ABCA1, ABCG5, and ABCG8 mRNAexpressions were up-regulated [25,26]. Liver X receptorsand retinoid X receptors (RXR) form RXR/LXR heterodi-mer transcription factors that act as intracellular sterolsensors [27]. Accordingly, selection for atherosclerosisresistance may not have altered the expression of ABCG5but rather the expression of some of these receptor genes[26,28,29] thus permitting expression of ABCG5 to remainin an up-regulated state in the RES individuals. It would beinteresting to examine the expression of the LXR and RXRgenes in the two quail strains under similar and differentdietary conditions.While we have measured the levels of plasma cholesteroland triglycerides, we have not determined their intracellu-lar levels. The LDL receptor gene is regulated by the sterolregulatory element-binding protein (SREBP) pathway vianegative feedback [30–32]. When intracellular cholesterollevels are high, the LDL receptor gene is down-regulated[31]. With fewer receptors, the liver takes up the LDL fromblood less efficiently, and as a result, plasma LDL levels in-crease. It is possible that selection has altered the expres-sion of the LDL receptor gene in the SUS and RES strains.SUS individuals are less efficient in removing excess chol-esterol from the liver, thus they may have a down-regu-lated expression of the LDL receptor gene resulting in ahigher level of dietary cholesterol remaining in circulation.Therefore, it would be relevant to examine the expressionof the LDL receptor gene in the two quail strains fed withdifferent diets.The expression of three genes involved in cholesterolbiosynthesis, HMGCR, FDFT1 and SQLE, was foundlower in SUS than in RES birds, regardless of diet andage. As a counteraction effect to the selective pressurefor susceptibility to atherosclerosis, natural selection mayhave caused a permanent down-regulation of these genesin the SUS individuals to decrease endogenous choles-terol synthesis to maintain homeostasis. Apparently, thismechanism to maintain homeostasis became ineffectivewhen the birds are fed a diet containing an extremelyhigh level of cholesterol. These mevalonate pathwaygenes are also regulated by the intracellular cholesterolSUS QUAILRES QUAILDBCAFigure 6 FDFT1 expression in SUS and RES liver relative to plasma triglyceride and LDL levels.Li et al. Genetics Selection Evolution 2012, 44:20 Page 9 of 11http://www.gsejournal.org/content/44/1/20via the SREBP pathway [31]. For example, HMGCR hasbeen shown to be regulated by sterol and non-sterol meta-bolites derived from mevalonate in a negative feedback loop[31,33,34]. Similar to HMGCR, FDFT1 and SQLE are tran-scriptionally regulated via the SREBP pathway [25]. Wehave also found that the expression level of some of thesegenes regressed negatively on plasma LDL and triglyceridelevels. A very high level of plasma cholesterol is associatedwith suppressed or strongly reduced expression of FDFT1,SQLE and DHCR7. Although they may not be the primaryrate-limiting enzymes in cholesterol biosynthesis [24], sup-pression of their expression may also be a protective actionto turn off the endogenous cholesterol synthesis.Thus, it is reasonable to hypothesize that the high intra-cellular cholesterol levels in the liver cells of the SUS birdsmay be related to the sub-normal functioning of the trans-porter genes ABCG8 and ABCG5. The down-regulation ofthe mevalonate pathway genes may be an ineffectiveattempt to normalize intracellular cholesterol levels in theliver cells of the SUS birds.ConclusionsCholesterol metabolism and transport are regulated by acomplicated gene system. The number of genes that wehave sampled in this study remains small and from asingle tissue, thus we cannot draw any conclusion onhow this gene system works or how this gene system hasbeen affected by selective breeding. However, the SUSstrain responded to selection in a short time (i.e. fourgenerations) and then reached a plateau, which is an in-dication that only a few genes have been altered. Ourresults do provide some explanation for the plasmacholesterol levels remaining high for a significantlylonger time in the SUS males than in the RES males.With the progress in micro-array technology andtranscriptome pyrosequencing [35], this quail model willbe useful to study the ramification effects of a few genesin the complicated gene system that affectsatherosclerosis.AbbreviationsABC: ATP binding cassette; ABCG5: ATP-binding cassette sub-family Gmember 5; ABCG8: ATP-binding cassette sub-family G member 8;ABCA1: member 1 of human transporter sub-family; ABCA: also known ascholesterol efflux regulatory protein; APOA1: apolipoprotein A1; BC: BritishColumbia; DHCR7: 7-dehydrocholesterol reductase; FDFT1: squalene synthase;GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; HDL: high densitylipoprotein; HMGCR: 3-hydroxy-3-methylglutaryl-coenzyme A reductase;LDL: low density lipoprotein; MVK: mevalonate kinase; NCBI: National Centerfor Biotechnology Information; NRC: National research council, USA;PMVK: phosphomevalonate kinase; RES: atherosclerosis-resistant quail strain;SUS: atherosclerosis-susceptible quail strain; SQLE: squalene expoxidase;UBC: University of British Columbia; w/w: weight/weight.Competing interestsThe authors declare that they have no competing interests.AcknowledgementsWe thank Carol Ritland (Genetic Data Centre, Faculty of Forestry, UBC) andFred Silversides (Agassiz Poultry Research Centre, Agriculture and Agri-FoodsCanada) for valuable inputs and Wendy Tymchuk (Department of Zoology,UBC) for her advice and assistance on the RT-PCR protocol. Darin Bennett(Avian Research Centre, UBC) provided technical assistance. This research wassupported by a grant from the BC Ministry of Agriculture and Lands,administered by the Specialty Birds Research Committee, to KMC.Author details1Avian Research Centre, Faculty of Land and Food Systems, The University ofBritish Columbia, Vancouver, BC, Canada. 2Department of Zoology, Faculty ofScience, The University of British Columbia, Vancouver, BC, Canada.3Department of Anesthesiology, Pharmacology and Therapeutics, Faculty ofMedicine, The University of British Columbia, Vancouver, BC, Canada.4Novozymes (China) Investment Co. Ltd., 14 Xinxi Road, Shangdi Zone,Haidian District, Beijing, China.Authors’ contributionsThis manuscript is an extension of the thesis research carried out by Xinrui Li.David Godin provided expertise in cholesterol metabolism andatherosclerosis. Patricia Schulte provided expertise in gene expressionanalysis and the laboratory facility for carrying out the research. KimberlyCheng contributed in writing and editing the manuscript. All authors readand approved the final manuscript.Received: 28 October 2011 Accepted: 8 June 2012Published: 8 June 2012References1. Braunwald E: Shattuck lecture - cardiovascular medicine at the turn ofthe millennium: triumphs, concerns, and opportunities. New Engl J Med1997, 337:1360–1369.2. Glass CK, Witztum JL: Atherosclerosis: the road ahead. Cell 2001,104:503–516.3. Jakulj L, Vissers MN, Tanck MWT, Hutten BA, Stellaard F, Kastelein JJP,Dallinga-Thie GM: ABCG5/G8 polymorphisms and markers of cholesterolmetabolism: systematic review and meta-analysis. J Lipid Res 2010,51:3016–3023.4. Clarkson TB, Middleton CC, Prichard RW, Lofland HB: Naturally-occurringatherosclerosis in birds. Ann NY Acad Sci 1965, 127:685–693.5. Shih JC, Pullman EP, Kao KJ: Genetic selection, general characterization,and histology of atherosclerosis-susceptible and -resistant Japanesequail. Atherosclerosis 1983, 49:41–53.6. Godin DV, Cheng KM, Garnett ME, Nichols CR: Antioxidant status ofJapanese quail: comparison of atherosclerosis-susceptible and -resistantstrains. Can J Cardiol 1994, 10:221–228.7. Godin DV, Garnett ME, Cheng KM, Nichols CR: Sex-related alterations inantioxidant status and susceptibility to atherosclerosis in Japanese quail.Can J Cardiol 1995, 11:945–951.8. Godin DV, Nichols CR, Hoekstra KA, Garnett ME, Cheng KM: Alterations inaortic antioxidant components in an experimental model ofatherosclerosis: a time-course study. Mol Cell Biochem 2003, 252:193–203.9. Lu K, Lee MH, Patel SB: Dietary cholesterol absorption; more than just bile.Trends Endocrinol Metab 2001, 12:314–320.10. Navab M, Hama SY, Anantharamaiah GM, Hassan K, Hough GP, Watson AD,Reddy ST, Sevanian A, Fonarow GC, Fogelman AM: Normal high densitylipoprotein inhibits three steps in the formation of mildly oxidized lowdensity lipoprotein: steps 2 and 3. J Lipid Res 2000, 41:1495–1508.11. Navab M, Anantharamaiah GM, Reddy ST, Van Lenten BJ, Datta G, Garber D,Fogelman AM: Human apolipoprotein A-I and A-I mimetic peptides:potential for atherosclerosis reversal. Curr Opin Lipidol 2004, 15:645–649.12. Ansell BJ, Watson KE, Fogelman AM, Navab M, Fonarow GC: High-densitylipoprotein function recent advances. J Am Coll Cardiol 2005, 46:1792–1798.13. Mori R, Wang Q, Danenberg KD, Pinski JK, Danenberg PV: Both beta-actinand GAPDH are useful reference genes for normalization of quantitativeRT-PCR in human FFPE tissue samples of prostate cancer. Prostate 2008,68:1555–1560.14. Warnick GR, Albers JJ: A comprehensive evaluation of the heparin-manganese precipitation procedure for estimating high densitylipoprotein cholesterol. J Lipid Res 1978, 19:65–76.Li et al. Genetics Selection Evolution 2012, 44:20 Page 10 of 11http://www.gsejournal.org/content/44/1/2015. Warnick GR, Nauck M, Rifa NI: Evolution of methods for measurement ofHDL-cholesterol: from ultracentrifugation to homogeneous assays. ClinChem 2001, 47:1579–1596.16. Gootjes J, Tel RM, Bergkamp FJ, Gorgels JP: Laboratory evaluation of anovel capillary blood sampling device for measuring eight clinicalchemistry parameters and HbA1c. Clin Chim Acta 2009, 401:152–157.17. Friedewald WT, Levy RI, Fredrickson DS: Estimation of the concentration oflow-density lipoprotein cholesterol in plasma, without use of thepreparative ultracentrifuge. Clin Chem 1972, 18:499–502.18. Okada M, Matsui H, Ito Y, Fujiwara A, Inano K: Low-density lipoproteincholesterol can be chemically measured: a new superior method. J LabClin Med 1998, 132:195–201.19. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J, Kwiterovich P, Shan B,Barnes R, Hobbs HH: Accumulation of dietary cholesterol in sitosterolemiacaused by mutations in adjacent ABC transporters. Science 2000,290:1771–1775.20. Wilund KR, Yu L, Xu F, Hobbs HH, Cohen JC: High-level expression ofABCG5 and ABCG8 attenuates diet-induced hypercholesterolemia andatherosclerosis in Ldlr−/− mice. J Lipid Res 2004, 45:1429–1436.21. Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta AK, YuH, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda N, Salen G,Patel SB: A mouse model of sitosterolemia: absence of Abcg8/sterolin-2results in failure to secrete biliary cholesterol. BMC Med 2004, 2:5.22. Heimerl S, Langmann T, Moehle C, Mauerer R, Dean M, Beil F-U, von BergmannK, Schmitz G: Mutations in the human ATP-binding cassette transportersABCG5 and ABCG8 in sitosterolemia. Human Mutat 2002, 20:151.23. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC, Hobbs HH:Overexpression of ABCG5 and ABCG8 promotes biliary cholesterolsecretion and reduces fractional absorption of dietary cholesterol. J ClinInvest 2002, 110:671–680.24. Chan J, Donalson LM, Kushwaha RS, Ferdinandusse S, VandeBerg JF,VandeBerg JL: Differential expression of hepatic genes involved incholesterol homeostasis in high- and low-responding strains oflaboratory opossums. Metabolism 2008, 57:718–724.25. Nagai M, Sakakibara J, Nakamura Y, Gejyo F, Ono T: SREBP-2 and NF-Y areinvolved in the transcriptional regulation of squalene epoxidase. BiochemBiophys Res Commun 2002, 295:74–80.26. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ:Regulation of ATP-binding cassette sterol transporters ABCG5 andABCG8 by the liver X receptors alpha and beta. J Biol Chem 2002,277:18793–18800.27. Baranowski M: Biological role of liver X receptors. J Physiol Pharmacol 2008,59:31–55.28. Oram JF, Vaughan AM: ATP-Binding cassette cholesterol transporters andcardiovascular disease. Circ Res 2006, 99:1031–1043.29. Plosch T, Bloks VW, Terasawa Y, Berdy S, Siegler K, Van Der Sluijs F, Kema IP,Groen AK, Shan B, Kuipers F, Schwarz M: Sitosterolemia in ABC-transporterG5-deficient mice is aggravated on activation of the liver-X receptor.Gastroenterology 2004, 126:290–300.30. Goldstein JL, Brown MS: Regulation of the mevalonate pathway. Nature1990, 343:425–430.31. Brown MS, Goldstein JL: Cholesterol feedback: from Schoenheimer'sbottle to Scap's MELADL. J Lipid Res 2009, 50:S15–S27.32. Horton JD, Goldstein JL, Brown MS: SREBPs: activators of the completeprogram of cholesterol and fatty acid synthesis in the liver. J Clin Invest2002, 109:1125–1131.33. Meigs TE, Roseman DS, Simoni RD: Regulation of 3-hydroxy-3-methylglutaryl-coenzyme A reductase degradation by the nonsterolmevalonate metabolite farnesol in vivo. J Biol Chem 1996, 271:7916–7922.34. Meigs TE, Simoni RD: Farnesol as a regulator of HMG-CoA reductasedegradation: characterization and role of farnesyl pyrophosphatase. ArchBiochem Biophys 1997, 345:1–9.35. Vera JC, Wheat CW, Fescemyer HW, Frilander MJ, Crawford DL, Hanski I,Marden JH: Rapid transcriptome characterization for a nonmodelorganism using 454 pyrosequencing. Mol Ecol 2008, 17:1636–1647.doi:10.1186/1297-9686-44-20Cite this article as: Li et al.: Differential mRNA expression of seven genesinvolved in cholesterol metabolism and transport in the liver ofatherosclerosis-susceptible and -resistant Japanese quail strains. GeneticsSelection Evolution 2012 44:20.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitLi et al. Genetics Selection Evolution 2012, 44:20 Page 11 of 11http://www.gsejournal.org/content/44/1/20

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0223334/manifest

Comment

Related Items