UBC Faculty Research and Publications

Role of epithelial integrin-linked kinase in promoting intestinal inflammation: effects on CCL2, fibronectin… Assi, Kiran; Patterson, Scott; Dedhar, Shoukat; Owen, David; Levings, Megan; Salh, Baljinder Aug 1, 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


52383-12865_2011_Article_391.pdf [ 1.26MB ]
JSON: 52383-1.0223295.json
JSON-LD: 52383-1.0223295-ld.json
RDF/XML (Pretty): 52383-1.0223295-rdf.xml
RDF/JSON: 52383-1.0223295-rdf.json
Turtle: 52383-1.0223295-turtle.txt
N-Triples: 52383-1.0223295-rdf-ntriples.txt
Original Record: 52383-1.0223295-source.json
Full Text

Full Text

RESEARCH ARTICLE Open AccessRole of epithelial integrin-linked kinase inpromoting intestinal inflammation: effects onCCL2, fibronectin and the T cell repertoireKiran Assi1, Scott Patterson2, Shoukat Dedhar3, David Owen4, Megan Levings2 and Baljinder Salh1*AbstractBackground: The role of integrin signaling in mucosal inflammation is presently unknown. Hence, we aimed toinvestigate the role of epithelial-derived integrin-linked kinase (ILK), a critical integrin signaling intermediarymolecule, in colonic inflammation.Methods: Conditional intestinal epithelial cell ILK knockout mice were used for assessment of acute and chronicdextran sodium sulfate (DSS) -induced colitis. Disease activity was scored using standard histological scoring,mucosal cytokines were measured using ELISA, chemokines were determined using reverse-transcriptionpolymerase chain reaction, as well as Q-PCR, and intracellular cytokine staining performed using FACS analysis.Results: In both acute and chronic DSS-induced colitis, compared to wild-type mice, ILK-ko mice exhibit lessweight loss, and have reduced inflammatory scores. In an in vitro model system using HCT116 cells, wedemonstrate that si-RNA mediated down-regulation of ILK results in a reduction in monocyte chemoattractantprotein 1 (MCP1, CCL2) chemokine expression. A reduction in CCL2 levels is also observed in the tissue lysates ofchronically inflamed colons from ILK-ko mice. Examination of mesenteric lymph node lymphocytes from ILK-komice reveals that there is a reduction in the levels of IFN gamma using intracellular staining, together with anincrease in Foxp3+ T regulatory cells. Immunohistochemistry demonstrates that reduced fibronectin expressioncharacterizes the inflammatory lesions within the colons of ILK-ko mice. Intriguingly, we demonstrate thatfibronectin is directly capable of downregulating T regulatory cell development.Conclusions: Collectively, the data indicate for the first time that ILK plays a pro-inflammatory role in intestinalinflammation, through effects on chemokine expression, the extracellular matrix and immune tolerance.Keywords: ILK, colitis, CCL2, fibronectin, T regulatory cellsBackgroundInflammatory bowel diseases are chronic disorders thatcommonly affect individuals in the second to third dec-ades of life. They are relatively common in the northernhemisphere, and are also being increasingly recognizedin the developing world. A number of different geneticmutations are associated with these diseases, and typi-cally result in a dysregulated immune response to thebacteria residing within the host gut [1,2]. The inflam-matory response in IBD is characterized by an influx oflymphocytes, monocytes and polymorphonuclear leuko-cytes, which can all mediate chronic tissue damage.Tumor necrosis factor alpha (TNFa) appears to be akey factor in this process, as neutralization of this criti-cal cytokine is highly efficacious in treating both Crohn’sdisease and ulcerative colitis [3,4].Integrin-linked kinase (ILK) is an adapter protein thatlinks the extracellular matrix with the cell interiorthrough its interactions with the cytoplasmic tails of cer-tain integrins. ILK plays a critical role in development,as its knockdown results in failure of implantation ofthe trophoblast. When ILK is deleted in specific tissues,processes such as cardiac development; angiogenesis;cartilage growth; skin growth; gut development and T-* Correspondence: bsalh@interchange.ubc.ca1Department of Medicine, The Jack Bell Research Centre, 2660 Oak Street,Vancouver, British Columbia, V6H 3Z6, CanadaFull list of author information is available at the end of the articleAssi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42© 2011 Assi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.cell migration can all be impaired [5]. ILK also has animportant role in cancer since it has oncogenic proper-ties when overexpressed in cancer cell lines, and highILK expression in a variety of malignancies is associatedwith a negative prognosis [6]. There is controversy sur-rounding its ability to regulate the activity of proteinkinase B/Akt, but recent findings indicate that ILK actsin concert with other molecules such as Pinch and Ric-tor to achieve this effect [7,8].There is scant data as yet on the role of ILK ininflammation. Although T cell-specific deletion of ILKdid not establish a role in T cell proliferation, impairedmigration was described [9]. We have previouslyobserved that mice with a conditional epithelial cellknockout of ILK develop smaller tumors, in response tochronic inflammation associated with exposure to azox-ymethane and dextran sodium sulfate administration[10] suggesting that ILK may regulate inflammation. Inorder to investigate this hypothesis we investigated therole of epithelial cell-specific expression of ILK in acuteand chronic models of colitis. We report that ILK-komice are significantly protected from colitis; protectionfrom disease is associated with altered expression of thechemokine, CCL2, and fibronectin. Moreover, ILK-komice have increased numbers of mucosal Tregs, consis-tent with the finding that fibronectin can directly impacton T regulatory cell development in vitro.MethodsMaterialsAnti-FoxP3 antibody was obtained from eBiosciences(San Diego, CA); anti-fibronectin antibody from Abcam(Cambridge, MA); anti-alpha 5 integrin antibody, alpha5 integrin si-RNA, and ILK antibody from Santa Cruz(Santa Cruz, CA); anti-CD3, anti-CD28 antibody fromBD Biosciences. ELISA kits for TNFa, IFNg, IL-12p40,CCL2 were obtained from BD Biosciences (Mississauga,ON). QLT0267 was kindly provided by QLT Inc, Van-couver, BC, Canada. Horse-radish peroxidase conjugatedsecondary antibodies were obtained through Calbiochem(San Diego, CA). EGTA, EDTA, MOPS, PMSF, sodiumorthovanadate, leupeptin, aprotinin, benzamidine, dithio-threitol and b-glycerolphosphate, were purchased fromSigma.Animal handling, processing, colitis induction andanalysisMice on an FVB (Friend virus B-type) background wereused for all the experimental work in this project. Allanimals were kept in conventional housing in the animalcare facility at Jack Bell Research Centre. They were fedchow ad libitum and had liberal access to drinkingwater. All experiments were approved by the UBC Ani-mal Ethics Committee (A05-1580). Colonic epithelialcell specific inactivation of ILK was achieved by crossingthe Fabp -Cre mice with the ILKflox/flox animals. Theresulting offspring were then backcrossed with thehomozygote floxed mice to generate the genotype: ILK-flox/flox,Cre. Genotyping for Cre and ILK were carriedout as previously described [10]. Briefly, tail DNA wasobtained and the following primers used to detect Creexpression: 5’-CCTGGAAAATGCTTCTGTCCG-3’ and5’-CAGGGTGTTATAACAATCCC-3’. ILK genotypewas monitored using: 5’-CCAGGTGGCAGAGG-TAAGTA-3’ and 5’-CAAGAAATAAGGTGAGCTTCA-GAA-3’.Acute and chronic colitis were induced using pre-viously well-described methods [11] in 10 week old miceof mixed gender. In the acute colitis model mice weregiven 3.5% DSS in their drinking water for 1 week andthen terminated after 1 more week (ie at 12 weeks). Inthe chronic colitis model, mice were started on the firstof three cycles of 5 days of 2.5% DSS given in the drink-ing water followed by 1 week of normal tap water. Micewere monitored daily for illness behaviour, weightrecording and sacrificed on day 36 (ie at just over 15weeks of age). Their colons were examined for macro-scopic and H& E for microscopic disease activity as pre-viously described [12]. After removal, the colons werefixed in 10% buffered formalin for immunohistochemis-try, protein lysates were prepared for western analysisand ELISA. Mesenteric lymph nodes and spleens wereremoved, and lymphocytes harvested for intracellularcytokine staining for FoxP3 and IFNg as described below.SDS-Polyacrylamide Gel ElectrophoresisColonic tissue or cultured cells were homogenized in buf-fer containing 20 mM MOPS, 150 mM NaCl, 50 mM b-glycerophosphate, 5 mM EGTA, 50 mM NaF, 1 mM DTT,1 mM sodium vanadate, 0.5% NP40 and 1 mM PMSF.After sonicating for 15 s (x 2) and centrifuging at 14,000RPM for 15 min, the protein concentration in the superna-tant was determined by the Bradford assay (Bio-Rad, Mis-sissauga, Ont). 25 ug of protein from each sample wasresolved using 10% SDS-PAGE before transferring to nitro-cellulose membranes (Bio-Rad). The blots were blocked in5% skim milk in TBST (20 mM Tris-HCl pH 7.4, 250 mMNaCl, 0.05% Tween-20) for 1 h before probing for 2 husing the appropriate primary antibody. The blots werewashed with TBST for 10 min three times, before beingincubated with the appropriate secondary antibody for 1 h.Following 3 further washes in TBST, they were developedusing the enhanced chemiluminescence detection system(ECL, Amersham, Montreal, Quebec).ImmunohistochemistryParaffin-embedded colonic tissue samples were de-waxed in xylene twice for 5 min, rehydrated in a seriesAssi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 2 of 14of ethanol (100% - 70%) for 3 min each followed byrehydration in PBS for 30 min. After rehydration theendogenous peroxidase was blocked with 0.3% hydrogenperoxide followed by antigen retrieval by microwavingsections in citrate buffer pH 6.0 (10 mM Na citrate).Following antigen retrieval, the sections were washedthree times with PBS, blocked in 1% BSA for 1 h, andthen stained using the Vectastain ABC kit (Vectorlaboratories, Burlingame, CA) mentioned below accord-ing to manufacturer’s recommendations but with thefollowing modifications. Sections were incubated withthe following primary antibodies at 4°C overnight: ILK(1:100, Cell Signaling, Pickering, Ontario), fibronectin(1:200, Abcam, Cambridge, MA), anti-Foxp3 (1:100,eBiosciences, San Diego, CA), anti-CD3 (1:100, DakoCanada Inc., Mississauga, ON). Following incubation,the sections were rinsed three consecutive times withPBS and then incubated with the appropriate biotiny-lated secondary antibody for 1 h followed by incubationwith peroxidase-labelled streptavidin. Nova -red andDAB were used as the chromagens, and the sectionswere counterstained with haematoxylin. Three blindedobservers independently examined all stained sections.For detection of Th17 cells by immunofluorescence,the slides were processed as for IHC and the followingantibodies were used: DAPI and IL-17A (eBio 17B7).Sections were stained with Vectastain ABC elite kit andbiotinylated ant-rabbit for DAPI, or eFluor650 Nano-crystal conjugation kit, cat no. 88-7072-98 antibody, andAvidin D-FITC (or Avidin-Texas Red) used for immu-nofluorescence (Vector laboratories, CA, USA). Eachsection had its own control using the secondary anti-body only. Pre-immune serum was initially used toensure specificity of the signal with each of theantibodies.Q-PCR1 ug of RNA, obtained using Trizol from HCT116 cells,was reverse transcribed using random hexamers (Per-kin-Elmer Applied Biosystems, Branchburg, NJ) and 20units of Moloney murine leukemia virus reverse tran-scriptase M-MLV (Invitrogene) in 20 μl of total volumeat 25°C for 10 min and at 37°C for 60 minutes. Theresulting first-strand complementary DNA (cDNA) wasused as template for the real-time quantitative-PCR.The Applied Biosystems 5700 Sequence Detection Sys-tem (Perkin-Elmer Applied Biosystems, Foster City, CA)was used for real time monitoring of PCR amplificationof cDNA using the SYBRO Green Universal PCR MasterMix protocol. Amplification of the following cDNAs wasperformed using the primers listed:CCL2: F: CTCTGCCGCCCTTCTGTG; R: TGCATCTGGCTGAGCGAGCXCL-8: F: GGCACAAACTTTCAGAGACAG; R:ACACAGAGCTGCAGAAATCAGGIBa: F: TTGGGTGCTGATGTCAATGC; R: AGGTCCACTGCGAGGTGAAGRelative quantification of gene expression was per-formed using Beta-Actin as a control. Beta-Actin cDNAwas amplified separately on a duplicate set of samplesusing standard primers from AB Applied Biosystems.The comparative Ct (cycle threshold) method was usedfor relative quantification of gene of interest mRNA.Statistical significance was determined by ANOVA model.The CT value is defined as the cycle number in which thedetected fluorescence exceeds the threshold value.Fold difference = 2−‖CT1(gene of interest)−CT1(Beta - Actin)|−|CT2(gene of interest - C)T2(Beta - Actin)| |Where CT1(gene of interest) and CT1(Beta-Actin)represent the CT values for the treated samples, respec-tively. CT2(gene of interest) and CT2(Beta-Actin) repre-sent the CT values for the untreated samples,respectively.Cell CultureHCT 116 cells were a kind gift of Bert Vogelstein (JohnsHopkins, Baltimore, Maryland) and were cultured inMcCoys 5A Medium (Gibco, Burlington, Ontario) con-taining 10% heat inactivated fetal bovine serum (FBS)(Hyclone, Logan, Utah). Protein lysates were obtainedusing homogenization buffer as described above.Semiquantitative RT-PCR1 ug of RNA, obtained using Trizol from HCT 116 cells(or murine colon), was reverse transcribed using randomhexamers (Perkin-Elmer Applied Biosystems, Branch-burg, NJ) and 20 units of Moloney murine leukemiavirus reverse transcriptase M-MLV (Invitrogene) in 20μl of total volume at 25°C for 10 min and at 37°C for 60min. The resulting first-strand complementary DNA(cDNA) was used as template for the semi-quantitative-PCR. Amplification of the following cDNAs was per-formed using the primers listed: ILK(F): TTTTCACT-CAGTGCCGGGAGG; (R): GTCCCTTGGCTTTGTCCACAG; CCL2 (F):ATGCAGGTCCCTGTCATGCTTCTG; (R):CTAGTTCACTGTCACACTGGTCACTCC;b-actin(F):AGAGGGAAATCGTGCGTGAC; (R):CAA-TAGTGATGACCTGGCGGT. Relative quantification ofgene expression was performed using densitometry andbeta-actin as a control.Si-RNA-mediated knockdown of ILKThis was performed as described previously [13] using a21-mer to transfect HCT116 cells, grown to 60% con-fluency, using Silentfect (Biorad). Two separate ILKsi-RNA and control (scrambled) sequences wereAssi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 3 of 14purchased from Qiagen Inc (Mississauga, ON), and fromSanta Cruz Biotechnology Corporation Inc (Santa Cruz,Ca). Gene knockdown was confirmed using western blot-ting and Q-PCR.Determination of regulatory T cell numbers andintracellular cytokine stainingTo quantify Tregs and IFN-g production ex vivo, mesen-teric lymph nodes were collected, and stimulated withwith phorbol myristate acetate (25 ng/ml) and ionomycin(1 mg/ml) for 6 h in the presence of brefeldin A (10 mg/ml) during the final 4 h. Cells were fixed and permeabi-lised using FOXP3-specific kit reagents (e-biosciences)and stained with anti-IFN-g-PECy-7 (XMG1.2), anti-TNF-a-PE (JES5-16E3) or anti-IL-17-APC (17B7) (e-Bios-ciences). All samples were read on a BD FACS Canto andanalyzed with FCS Express V3 (De Novo Software). Toassess Treg development in vitro, T cells were purifiedand cultured in SFEM medium (StemCell Technologies),supplemented with 10 mM HEPES, 2 mM glutamine, 1mM sodium pyruvate, 1 mM MEM non-essential aminoacid solution and 100 U/ml each of Penicillin G and strep-tomycin. Flat-bottom plates were coated with aCD3 (10mg/ml, 2C11) and serial dilutions of the indicated concen-tration of fibronectin (Sigma). Tregs were differentiatedfrom CD4+CD25- T cells in the absence or presence ofsoluble CD28 (1 mg/ml, 37.51), rhIL-2 (100 U/ml, Chiron)and rhTGF-b (10 ng/ml, R&D systems) as indicated.Statistical analysisAll macroscopic and histological disease scores, as wellas cytokine levels were expressed as mean + SD, with p< 0.05 being considered significant using the Student’st-test (unpaired, two-tailed). Where indicated ANOVAwas performed with Tukey post-hoc testing.ResultsEpithelial cell specific expression of ILK is induced by pro-inflammatory stimuli in a PI3-kinase and stress-activatedprotein kinase-dependent mannerWe first used an in vitro system to determine whetherILK expression is modulated by inflammatory stimuli.SW480 colonic cells were exposed to LPS, and after 24h ILK protein was induced, along with an increase inphosphorylation of Akt at ser473. Expression of Aktitself did not change (Figure 1A). To confirm these find-ings in vivo, colonic explants were exposed to DSS andas seen in Figure 1B, this also led to an increase inexpression ILK protein expression. Histological exami-nation of tissue sections demonstrated that increasedILK expression occurred both in the cytoplasm andnuclei of the epithelial cell compartment (Figure 1C).ILK expression was regulated by phosphatidylinositol 3-kinase, as both Ly294006 and wortmannin were capableof downregulating its induction at the protein levelwhen HCT116 cells were stimulated with interleukin 1beta (IL-1b, Figure 1D). Regulation of its inductionoccurs transcriptionally, as the same inhibitors attenu-ated the induction of ILK mRNA (Figure 1E). In orderto determine whether other pathways were also impli-cated, we observed that both of the stress-activated pro-tein kinase inhibitors SP600125 and SB203580 were alsocapable of a similar downregulation (Figure 1F).ILK regulates weight loss and inflammation in acute DSS-induced colitisEvidence that ILK is highly expressed in inflammationat mucosal surfaces suggests it may be important inmodulating gut immunity. This notion is supported byour previous observations in the colitis-associated can-cer model [10], where ILK-ko mice had reducedinflammation-induced tumors. Hence we initiallyexamined whether ILK-ko mice differed from their lit-termate controls in a model of acute colitis. Wild typeand ILK-ko mice were treated with 3.5% DSS and atthe end of 7 days (Figure 2A) there was a clear differ-ence in the degree of weight loss observed in the ILK-ko mice as compared with the wild-type group. By theend of the second week these mice have recoveredfrom the acute insult and hence the difference is nolonger apparent. Histological examination confirmedthe weight loss data since there was a significantattenuation of the inflammatory response in the ILK-ko mice (Figure 2B).ILK regulates the capacity of epithelial cells to produceCCL2 in vitroBecause of the reduced inflammatory cell infiltrate inthe ILK-ko mice, we postulated that ILK regulates theability of epithelial cells to express pro-inflammatorymediators. Hence we investigated the ability of si-RNAmediated knockdown of ILK to affect the expression ofinflammatory-cytokine induced production of chemo-kines. As the data in Figure 3 indicate, exposure ofHCT116 cells to IL-1b induces expression of IL-8(CXCL8), Rantes (CCL5) and MCP1 (CCL2), but notMIG (CXCL9). Predictably, IL-1b also induces bothIBa and i-NOS. ILK knockdown had no effect oneither IL-1b-induced CXCL8 or CCL5 expression butsignificantly inhibited the expression of CCL2. Thesedata were confirmed not only by si-RNA to knockdownILK and performing Q-PCR for CCL2, but also using aspecific inhibitor of ILK signaling, QLT0267 [14], bothof which resulted in reduced expression of CCL2 mes-sage (Figure 3B). We also investigated another unrelatedsi-RNA to knockdown ILK with similar effects on CCL2expression (data not shown). ELISA further corrobo-rated these results using the ILK inhibitor to detect IL-Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 4 of 14ILKser473AktAktbeta-actinControlLPS 1—/mlbeta - actinILKC   DSSILKGAPDHIL-1beta  (5ng/ml) - +           +         +          +          +         +          +LY294002 (ug/ml) - - 2.5      10        25          - - -Wortmannin (nmol) - - - - - 10        50      100 ILKIL-1beta (5ng/ml) - +          +         +           +          +         +          +LY294002 (ug/ml) - - 2.5      10          25         - - -Wortmannin (nmol) - - - - - 100      50        10 ß-ActinEControl 2.5% DSS (48h)A BCDIL-1beta (5ng/ml)SP600125 (20 uM)PD98059 (25 uM)SB203580 (10 uM)- +     - +      - +      - +- - - - +      +      - -- - +      +      - - - -- - - - - - +     +ILKGAPDHFFigure 1 ILK is induced by pro-inflammatory stimuli. A. Colonic SW480 cells were stimulated with 1 ug/ml LPS for 24 h, and after harvestingthe cells, western immunoblotting was performed. Membranes were probed with antibodies for ILK, ser473Akt, Akt and beta-actin. ILK proteininduction is accompanied by an increase in the phosphorylation of Akt at ser473, but not the protein level of this kinase. The beta-actin isshown as an internal control. B. This shows the response of a murine colonic explant to exposure with 2.5% DSS for 48 h. There is an increase inthe expression of ILK. The lower panel shows equivalent levels of beta-actin. C. Colons of control and DSS treated mice (48 h) were probed witha polyclonal antibody to ILK. Besides an increase in the intensity of the signal generally, more than 50% of the epithelial cell nuclei stainpositively for ILK. D and E. Colonic HCT116 cells were stimulated with 5 ng/ml IL-1b for 4 h. Protein was obtained by lysing cells inhomogenization buffer and western blotting performed for ILK expression (D). Alternatively, RNA was obtained by Trizol and used for cDNAsynthesis; semi-quantitative RT-PCR for ILK was then performed using the primers indicated in materials and methods. Wortmannin andLy294002 were both capable of inhibiting the IL-1b-induced ILK protein and mRNA. The b-actin signal is shown as the internal control. F. Theexperiment was repeated as in D with the addition of inhibitors of the MAPK pathway. Specifically PD98059, SP600125 and SB203580 were usedto inhibit the p42/44 ERK, P54/45 JNK and p38SAPKs respectively, and GAPDH used as the loading control. Data are representative of 3independent experiments for each panel.Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 5 of 141b generated CCL2 protein. After a 4 h or 24 h expo-sure to QLT0267 there was a significant (> 70%) reduc-tion in IL-1b-induced CCL2. These findings indicatethat ILK is potentially capable of regulating epithelialcell function by modulating the expression of a well-described immune cell chemoattractant.Expression of ILK in epithelial cells influences chronic gutinflammation and production of CCL2 in vivoWe next investigated the impact of loss of ILK inepithelial cells in a model of chronic colitis, as this isconsidered to be more representative of human IBD. Inthis model, mice were treated with 3 cycles of 2.5% DSSfor 5 days followed by 7 days without DSS treatment.As the weight chart indicates (Figure 4A), with eachsuccessive round of DSS there is a notable increasingseparation between ILK-ko mice and wild-type mice.Specifically, after 36 days the amount of weight loss inthe ILK-ko mice was significantly less than that of theirwild-type counterparts. When the animals were sacri-ficed we observed reduced macroscopic disease scoresin the ILK-ko group. These data were confirmed uponexamination of histological sections where ILK-ko micehad significantly reduced inflammation and mucosaldamage (Figure 4B, C). Based on our finding that ILKregulates expression of CCL2, we also measured expres-sion of CCL2 mRNA and confirmed significantlyreduced expression in the ILK-ko mice (Figure 4D, E).WT + 3.5% DSS    KO + 3.5% DSS808590951001051       2       3       4               1       2       3       4GroupDay 7                                   Day  15110P<0.05ABP<0.01Figure 2 Epithelial ILK provides a pro-inflammatory stimulus in acute colitis. A. Acute colitis was induced in mice using 3.5% DSS in thedrinking water. Mice were weighed daily, and the results after 7 days of DSS treatment, and following a further 8 days off DSS are shown. Theweights expressed as the percentage of original (mean ± SEM) are shown (1 = WT control, 2 = WT+DSS, 3 = ILK-ko (C), 4 = ILK-ko + DSS). Thereis a significant attenuation of the normally observed weight loss in the ILK-ko mice at day 7 (p < 0.05, ANOVA, Tukey post-test). B. Representativehistological slides for each of the DSS treated groups are shown. The inflammatory infiltrate, surface epithelial disruption and edema are reducedin the ILK-ko animals. There was a significant reduction in the inflammatory scores in the ILK-ko mice (n = 6 per group).Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 6 of 14IL-8 (CXCL8)MIG (CXCL9) Rantes (CCL5)I BiNOSMCP-1 (CCL2)Beta Actin1            2            3           4            5             60100200300400C     IL-1b  IL-1b + Q0267 C     IL-1b   IL-1b + Q0267 4 hours 24 hoursP<0.01P<0.01AB00.511.522.533.5Scrambled siRNA ILK siRNACCL2/b-actin ratio **0123450 uM 50 uMCCL2/b-actin ratioQLT00267**CFigure 3 ILK regulates CCL2 expression. A. Si-RNA was used to knockdown ILK and a scrambled oligonucleotide was used as a control. RNAwas extracted from HCT116 cells after 4 h of stimulation with IL-1b and reverse transcribed to make cDNA. This was used to determine themessage of the molecules shown using RT-PCR. CCL2 induction in response to the cytokine IL-1b was the only molecule whose expression wasblocked by si-RNA knockdown of ILK (see CCL2 panel, lane 4). This result was reproduced on 2 further occasions. B. The experiment wasrepeated as in A except Q-PCR used to determine the expression of CCL2, either following si-RNA knockdown of ILK (left panel) or using theQLT0267 inhibitor (right panel). C. HCT116 cells were pretreated with the specific ILK inhibitor QLT0267 for 1 hour before being stimulated withIL-1b for the times indicated. CCL2 concentrations were determined in the culture supernatent using ELISA. The data are representative of twoseparate experiments, each performed in triplicate (*p < 0.01).Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 7 of 14024681012WT KOBWT KOCWT1   WT2    WT 3     KO1     KO2      KO3CCL2-actinEDF***9094981021061101 4 7 10 13 16 19 22 25 28 31 34% of initial body weightDAYSA * * * *Group00. KORatio CCL2 /Actin*GroupFigure 4 ILK regulates wasting disease and CCL2 expression in chronic colitis. A. Chronic DSS (2.5%) colitis was induced in 6 animals pergroup using 3 rounds of 2.5% DSS in the drinking water. Animal weights were monitored and the data in A show that there was a significantattenuation of the weight loss in the ILK-ko animals (squares), compared with the wild-type group (diamonds), (*p < 0.05). B. Assessment ofmicroscopic damage in these mice indicated a significant reduction in the ILK-ko mice (*p < 0.05). Representative histology is shown in C, wherean obvious loss of crypts, mucosal edema and inflammatory infiltrate are shown in the control sample. D. Total RNA was extracted from sectionsof distal colon and reverse transcribed to make cDNA. This was used to determine the message levels of CCL2 using semi-quantitative RT-PCR.As can be seen from this figure, CCL2 induction was significantly (*p < 0.05) reduced in the ILK-ko animals (the barchart E shows the messagelevels corrected for b-actin, and are for the entire sets of 6 mice per treatment group). F. Distal colonic lysates were obtained usinghomogenization buffer and then used to determine CCL2 levels by ELISA. The data are for 6 mice per group and show a reduction in levels ofCCL2 in the ILK-ko mice (**p < 0.01).Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 8 of 14Tissue homogenates examined for protein levels ofCCL2 further confirmed these data (Figure 4F). Collec-tively these data indicate that ILK normally promotesintestinal inflammation, and that ILK-mediated regula-tion of CCL2 production by epithelial cells may beinvolved in this response.Interconnection between ILK and fibronectinCCL2 is a chemokine with a role in mediating fibrosis inseveral systems, including the colon [15]. Intriguingly,one of the interesting facets of ILK function is its capacityto affect modulation of the extracellular matrix compo-nent, fibronectin [16]. Since fibronectin is associated withcolitis and its expression levels undergo biphasic modula-tion during induction of inflammation and during healing[17], we speculated that loss of ILK in epithelial cells mayalso have an impact on this protein. We initially askedwhether fibronectin is capable of regulating CCL2expression by cultured epithelial cells. By plating cells ontissue culture plates coated with increasing levels offibronectin we observed that there was an increase in theamount of CCL2 detected in the medium by ELISA (Fig-ure 5A). We also wanted to determine whether fibronec-tin regulates the expression of its receptor (a5) and ILK.Using the same in vitro system we found that fibronectinstimulated a dose-dependent increase in expression ofILK and a5, peaking at 20 ug/ml (Figure 5B). Next, usingimmunohistochemistry we observed that there is animpressive reduction in fibronectin expression in theILK-ko mice in comparison with the wild-type mice (Fig-ure 5C). We also determined that QLT0267 was capableof preventing the fibronectin-mediated expression of a5integrin (Figure 5D). Collectively, these data indicate theexistence of a bidirectional pathway whereby an ILK-dependent mechanism is capable of regulating fibronec-tin expression levels in the ECM, which is itself capableof regulation ILK and its receptor a5 integrin, as well asCCL2, by epithelial cells.Expression of ILK in epithelial cells affects the infiltratingT cell profileWe next investigated whether the development of T cellresponses was altered in ILK-ko mice. First, we analyzedproduction of pro-inflammatory cytokines in the colonichomogenates of the chronic DSS-induced colitis mice,and found that ILK-ko mice had significant reductions(up to 50%) in their levels of TNF-a, IFN-g and IL-12p40 (Figure 6A). To specifically address the cytokineprofiles within the T cell compartment, mesentericlymph nodes were collected and intracellular stainingwas performed on CD4+ T cells. As shown in Figure6B, the data indicate a significant reduction in the intra-cellular staining for IFNg, in ILK-ko mice (Figure 6B,right panel), confirming an attenuated Th1 response.Foxp3+ Tregs are critical regulators of the intestinalimmunity [18]. Based on the reduction in IFN-g-producingT cells, were hypothesized that there may be a correspond-ing increase in Tregs. Indeed we found that the proportionof Tregs was significantly increased in mesenteric lymphnodes (Figure 6B, left panel). Based on these ex vivoresults, we next used immunohistochemistry to examinethe ratio of FoxP3 positive cells to total CD3 positive cellsin mice affected with chronic colitis. These data confirmedthat ILK-ko mice have a proportionately increased numberof Tregs infiltrating their intestinal mucosa (Figure 6C, D).To determine the effect on Th17 cells, which are also criti-cal determinants of colonic inflammation, immunofluores-cence was performed. As the data indicate (Figure 6E and6F) there is a significant reduction in the numbers of IL-17A positive T cells within the ILK-ko mice.Fibronectin is capable of regulating the development of Tregulatory cellsBased on our findings that ILK-ko mice have reducedfibronectin and an increase in mucosal Tregs, andrecent evidence that Treg function can be regulated bycomponents of the extracellular matrix [19], we specu-lated that these two observations may be linked. To testwhether the levels of fibronectin may directly affectTreg development, we isolated CD4+CD25- T cells andstimulated them under Treg-inducing conditions (TGF-b and IL-2) in the absence or presence of increasingamounts of fibronectin. Remarkably, we found thatfibronectin directly inhibits the development of Foxp3+Tregs in a dose-dependent manner (Figure 7). Thesedata not only reveal an inverse link between the levelsof a major ECM component, fibronectin, and the differ-entiation of Tregs, but they also provide a possiblemechanistic basis for the resistance of ILK-ko mice tocolitis.DiscussionThis work shows for the first time that the epithelialexpression of ILK, a molecule with a critical role inbidirectional cellular signaling, impacts significantly onmucosal immunity. ILK-ko mice consistently exhibitedless wasting disease in response to DSS-induced colitis,had reduced macroscopic and histological scores of dis-ease, and reduced pro-inflammatory cytokine produc-tion. Not only was there a reduction in the levels ofcolonic tissue cytokines in the ILK-ko mice, but also aconsistent reduction in the numbers of IFNg stainingcells in the MLN (and splenic) lymphocytes. These datademonstrate that ILK normally functions to promotepro-inflammatory effects on epithelial cells, at least inpart, via stimulating expression of CCL2 and fibronectinexpression, the latter of which acts on T cells to sup-press the development of Tregs. Knowledge that TregAssi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 9 of 14Alpha 5 integrin0      2.5        5      10       20       40Fibronectin (ug/ml, x4h)ILKǺeta actinABWTKOC0. 40 60CCL2pg/ml/mg of proteinFibronectin (ug/ml, x4h)DǺeta actinAlpha 5 integrin0        10        10     20       40 Fibronectin (ug/ml, x4h)QLT0267 (50 um)Figure 5 Fibronectin regulates CCL2, ILK and a5 integrin. HCT116 cells were plated on tissue culture plates coated with increasing levels offibronectin for 4 h. In A, the CCL2 levels were measured in the medium using ELISA. In B, the cells were subsequently lysed and equivalentamounts of protein resolved using SDS page. After transfer the membranes were probed with the antibodies indicated. The data indicateincreased ILK and a5 integrin expression with increasing fibronectin exposure, peaking at 20 ug/ml. C. Immunohistochemistry was performed oncolonic sections using a fibronectin antibody on 3 different mice in each group. There is a clear reduction in fibronectin expression in the ILKknockout mice (a representative slide is shown). D. HCT116 cells were exposed to the doses of fibronectin indicated and the QLT 0267compound added at the start of the experiment. The cell lysates were then resolved using SDS-PAGE and probed with either the a5 integrin orbeta actin (loading control) antibodies. The data are representative of 3 separate experiments.Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 10 of 14** ** KOFoxp3+/CD3 ratio ABCD****KOWT KO020406080100120WT ILK-koIL-17A positive cells/hpf ***E FWTFigure 6 Epithelial ILK regulates tissue expression of inflammatory cytokines. A. Interferon gamma, tumor necrosis factor alpha andinterleukin-12p40 cytokine levels were determined in colonic homogenates from 6 ILK-knockout animals and 6 wild-type controls (**p < 0.01). B.Lymphocytes were obtained from mesenteric lymph nodes of wild-type and ILK-ko mice. Intracellular staining for FoxP3 and IFNg was performedas described in materials and methods. After stimulation with PMA (25 ng/ml) and ionomycin (1 mg/ml) for 6 h, cells were fixed andpermeabilized. Then they were stained with the indicated antibodies and read on a BD FACS Canto. The data are from 6 ILK-ko and 6 wild-typemice (*p < 0.05). C. Tissue sections were obtained from control and ILK-ko mice at the end of 3 rounds of DSS treatment, and processed forimmunohistochemistry. Using anti-CD3 and anti-FoxP3 antibodies, the number of positively staining cells were counted in 3 fields from 6separate animals, in each group. The ratios obtained are shown in D (*p < 0.05). E. IL-17A staining was performed using immunofluorescence asdescribed in methods for tissue sections from the same sets of mice as in C. The red staining cells are clearly observed to be more numerous inthe control samples, and the data is graphically represented in F.Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 11 of 14development is directly regulated by ECM proteins, pro-vides a new paradigm in mucosal immunity and offersmechanistic insight into why ILK-ko mice are resistantto colitis.We found that ILK regulates the expression of thechemokine CCL2, both in vitro using an epithelial cellline and possibly in vivo in colitic mice. This is impor-tant not only because this chemokine is upregulated inhuman IBD, with increased CCL2 levels having beenreported in the mucosa of IBD patients as determinedby immunohistochemistry and ELISA [20] but also,because mice with either this chemokine geneticallydeleted [21], or with its receptor (CCR2) deleted [22]are protected from developing experimental colitis. Thenet result of reduced CCL2 expression would be areduction in the influx of monocytes and lymphocytes,leading to reduced inflammation in comparison to wild-type mice. Of especial interest is the recent descriptionof an MCP-1 (CCL2) polymorphism that is associatedwith Crohn’s disease [23], which may have implicationsfor disease pathogenesis.Fibronectin is a large (250 kDa) molecular weight gly-coprotein present in various tissue compartments, withdefined roles in cell adhesion, migration and prolifera-tion. It exists as a dimer with each monomer con-structed of repeating type I, II and III protein domains.Alternative splicing at extra domains A and B as well asat a connecting segment III leads to the occurrence ofover 20 different forms [24]. Previously it has beenshown that there is enhanced expression of fibronectinin inflamed ulcerative colitis mucosa and in fibroticCrohn’s disease, but a reduced expression in inflamedCrohn’s disease mucosa [25]. Interestingly, it was vir-tually absent in intestinal fistulae from the latter popula-tion [26]. It is known that ILK regulates the epithelialexpression of fibronectin, which is an important compo-nent of the extracellular matrix, both by means of over-expression and also gene knockdown studies [16,27].ABFigure 7 Fibronectin regulates Treg differentiation. T lymphocytes (CD4+CD25-) were obtained from the mesenteric lymph nodes of miceand exposed to plate bound anti-CD3 (10 mg/ml) and fibronectin, as well as soluble anti-CD28 (1 mg/ml), rIL-2 (100 u/ml) and TGFb (10 ng/ml)as described in materials and methods. After 24 h the proportion of FoxP3+ cells were determined using FACS analysis. In A, i: representativeneutral, 1000 ng/ml fibronectin; ii: iTreg, 0 ng/ml fibronectin; iii: iTreg, 125 ng/ml fibronectin; iv: iTreg, 1000 ng/ml fibronectin. The barchart in Brepresents the overall dose-response relationship, performed in triplicate and repeated twice. (*p < 0.05, **p < 0.01, using ANOVA).Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 12 of 14Also, epithelial fibronectin is known to increase duringboth the acute and healing phases of colitis [17]. Wehave added to this by demonstrating that reducedinflammation in the ILK-ko mice is attended by a reduc-tion in levels of fibronectin expression. Because fibro-nectin may mediate leucocyte binding [28], as thesecells traverse the extracellular matrix, part of the expla-nation for reduced inflammation is simply that there arefewer lymphocytes present to mediate tissue damage. Asmany different cells are able to synthesize fibronectinwe can conclude that at least a part of this is due to itsreduced epithelial expression in ILK-ko mice. Ourobservation that ILK, CCL2 and a5 integrin are inducedin response to fibronectin exposure, indicates an impor-tant connection between these molecules, possiblythrough a positive feedback loop.Reconciling observations in chronic intestinal inflam-mation, where CCL2 is increased in both UC and CD,and changes in fibronectin expression, which appears toonly undergo an increase in UC (and fibrotic Crohn’sdisease), is not straightforward. Furthermore, the DSS-induced colitis model utilized in this study is not onewhere fibrosis is generally recognized to occur. Thissuggests that another non-fibrosis associated, ILK-CCL2-fibronectin pathway exists in early inflammation,and that interference with any of these three compo-nents is capable of attenuating the inflammatoryresponse. It is quite likely that alternative or additionalmechanism(s) operate(s) to effect inflammation inCrohn’s disease, and consequently changes in fibronec-tin expression are not observed. Future work willaddress the role of ILK on other components of theextracellular matrix that undergo changes in IBD.Whilst changes in CCL2 and fibronectin may offerplausible explanations for the reduction in inflamma-tion seen in the ILK-ko mice, we were keen to investi-gate potential additional immune mechanisms. Thereduction in the level of gamma-interferon indicates areduction in the Th1 response, and this observationwas seen in tissue homogenates, as well as in CD4(+)cells harvested from the mesenteric lymph nodes. Wenext turned to T regulatory cells, which are known tohave a fundamental role in regulation of mucosalimmunity [18]. Indeed, we found that protection ofILK-ko mice from colitis correlated with a relativeincrease in Foxp3+ Tregs in both the colon and inmesenteric lymph nodes. Peripheral Treg developmentin the gut can be driven by many different tolerogenicsignals such as TGF-b, retinoic acid and IL-10. Wefound that under the influence of TGF-b, fibronectindirectly inhibited the development of Foxp3+ cells, forthe first time providing a link between this and thedevelopment of immune tolerance. This finding com-plements recent data showing that another ECMprotein, high molecular weight hyaluronan, the ligandfor CD44, can promote the expression of FoxP3 [19],further supporting the notion that the integrity of thetissue matrix has a direct role in directing mucosalimmune responses. Moreover, the direct effects offibronectin on Treg development provide a mechanismby which the loss of ILK in epithelial cells could leadto a reduced susceptibility to colitis. Future researchwill be required to define how this novel aspect ofTreg development is regulated at the molecular level.There is considerable support for the involvement ofanother T cell population in the pathogenesis of IBD,specifically the Th17 cell [29]. In contrast to Th1(requiring IFNg, and IL-12), Th2 (requiring IL-4) andTreg (requiring TGFb and IL-2) cells, this particular cellis dependent upon TGFb, IL-6 and IL-23 for its differ-entiation [30]. It produces a different set of cytokinesthat include IL-17, IL-22 and TNFa, and is character-ized by the expression of the transcription factor RORgt.An inverse relationship between a genetic polymorphismof its surface IL-23 receptor (IL-23R) and Crohn’s dis-ease has been described [31]. Recent work indicatessome degree of T cell plasticity in that T cells thatexpress both IL-17 and RORgt have been described [32].Our work indicates that the increased FoxP3+ cellpopulation in the ILK-ko mice is associated with a con-comitant reduction in the IL-17+ cell population, inresponse to induction of chronic colitis. The presence ofa smaller population of dual IL-17+/FoxP3+ cells cannotbe excluded. Furthermore we do not observe any com-parable change in the Th17 cell fraction (as comparedto Tregs) upon plating onto fibronectin coated plates,indicating a specific effect for Treg generation.ConclusionOur work provides the first striking example of anintestinal epithelial cell molecule ILK, capable of influ-encing the surrounding inflammatory milieu (throughCCL2), as well as the ECM (through fibronectin), whichin turn may impact on the mucosal inflammatoryresponse (via Th1, Th17 and Treg cells). We thereforeconclude that modulation of ILK signaling may have animpact on human IBD, and that this merits attention.AbbreviationsILK: integrin-linked kinase; ILK-ko: ILK-intestinal epithelial cell knockout; CCL2:chemokine (C-C motif) ligand 2.AcknowledgementsThis study was supported in part by funding from the Canadian Society ofIntestinal Research, and BS is supported by a VCHRI In-it-for life clinician-scientist award.Author details1Department of Medicine, The Jack Bell Research Centre, 2660 Oak Street,Vancouver, British Columbia, V6H 3Z6, Canada. 2Department of Surgery, TheAssi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 13 of 14Jack Bell Research Centre, 2660 Oak Street, Vancouver, British Columbia,V6H3Z6, Canada. 3British Columbia Cancer Research Centre, 10-110 675 West10th Avenue, Vancouver, British Columbia, V5Z 1L3, Canada. 4Department ofAnatomical Pathology, The Jack Bell Research Centre, 2660 Oak Street,Vancouver, British Columbia, V6H 3Z6, Canada.Authors’ contributionsKA and SP performed the experimental work; DO provided input intointerpretation of pathology; SD provided essential reagents; ML providedinput into experimental design and edited the manuscript; BS wasresponsible for conception and design, as well as writing the first and finalversions of the manuscript. All authors have read and approve of the finalversion of the manuscript.Competing interestsThe authors declare that they have no competing interests.Received: 18 April 2011 Accepted: 1 August 2011Published: 1 August 2011References1. Xavier RJ, Podolsky DK: Unravelling the pathogenesis of inflammatorybowel disease. Nature 2007, 448:427-34.2. Cho JH: The genetics and immunopathogenesis of inflammatory boweldisease. Nat Rev Immunol 2008, 8:458-66.3. Targan SR, Hanauer SB, van Deventer SJ, Mayer L, Present DH, Braakman T,DeWoody KL, Schaible TF, Rutgeerts PJ: A short-term study of chimericmonoclonal antibody cA2 to tumor necrosis factor alpha for Crohn’sdisease. Crohn’s Disease cA2 Study Group. N Engl J Med 1997,337:1029-35.4. Baumgart DC, Sandborn WJ: Inflammatory bowel disease: clinical aspectsand established and evolving therapies. Lancet 2007, 369:1641-57.5. McDonald PC, Fielding AB, Dedhar S: Integrin-linked kinase - essentialroles in physiology and cancer biology. J Cell Sci 2008, 121:3121-32.6. Hannigan G, Troussard AA, Dedhar S: Integrin-linked kinase: a cancertherapeutic target unique among its ILK. Nat Rev Cancer 2005, 5:51-63.7. Fukuda T, Chen K, Shi X, Wu C: PINCH-1 is an obligate partner of integrin-linked kinase (ILK) functioning in cell shape modulation, motility, andsurvival. J Biol Chem 2003, 278:51324-33.8. McDonald PC, Oloumi A, Mills J, Dobreva I, Maidan M, Gray V, Wederell ED,Bally MB, Foster LJ, Dedhar S: Rictor and integrin-linked kinase interactand regulate Akt phosphorylation and cancer cell survival. Cancer Res2008, 68:1618-24.9. Liu E, Sinha S, Williams C, Cyrille M, Heller E, Snapper SB, Georgopoulos K,St-Arnaud R, Force T, Dedhar S, et al: Targeted deletion of integrin-linkedkinase reveals a role in T-cell chemotaxis and survival. Mol Cell Biol 2005,25:11145-55.10. Assi K, Mills J, Owen D, Ong C, St Arnaud R, Dedhar S, Salh B: Integrin-linked kinase regulates cell proliferation and tumour growth in murinecolitis-associated carcinogenesis. Gut 2008, 57:931-40.11. Elson CO, Sartor RB, Tennyson GS, Riddell RH: Experimental models ofinflammatory bowel disease. Gastroenterology 1995, 109:1344-67.12. Assi K, Pillai R, Gomez-Munoz A, Owen D, Salh B: The specific JNK inhibitorSP600125 targets tumour necrosis factor-alpha production and epithelialcell apoptosis in acute murine colitis. Immunology 2006, 118:112-21.13. Troussard AA, Mawji NM, Ong C, Mui A, St-Arnaud R, Dedhar S: Conditionalknock-out of integrin-linked kinase demonstrates an essential role inprotein kinase B/Akt activation. J Biol Chem 2003, 278:22374-8.14. Oloumi A, Syam S, Dedhar S: Modulation of Wnt3a-mediated nuclearbeta-catenin accumulation and activation by integrin-linked kinase inmammalian cells. Oncogene 2006, 25:7747-57.15. Motomura Y, Khan WI, El-Sharkawy RT, Verma-Gandhu M, Verdu EF,Gauldie J, Collins SM: Induction of a fibrogenic response in mouse colonby overexpression of monocyte chemoattractant protein 1. Gut 2006,55:662-70.16. Wu C, Keightley SY, Leung-Hagesteijn C, Radeva G, Coppolino M,Goicoechea S, McDonald JA, Dedhar S: Integrin-linked protein kinaseregulates fibronectin matrix assembly, E-cadherin expression, andtumorigenicity. J Biol Chem 1998, 273:528-36.17. Kolachala VL, Bajaj R, Wang L, Yan Y, Ritzenthaler JD, Gewirtz AT, Roman J,Merlin D, Sitaraman SV: Epithelial-derived fibronectin expression,signaling, and function in intestinal inflammation. J Biol Chem 2007,282:32965-73.18. Izcue A, Coombes JL, Powrie F: Regulatory lymphocytes and intestinalinflammation. Annu Rev Immunol 2009, 27:313-38.19. Bollyky PL, Falk BA, Long SA, Preisinger A, Braun KR, Wu RP, Evanko SP,Buckner JH, Wight TN, Nepom GT: CD44 costimulation promotes FoxP3+regulatory T cell persistence and function via production of IL-2, IL-10,and TGF-beta. J Immunol 2009, 183:2232-41.20. Banks C, Bateman A, Payne R, Johnson P, Sheron N: Chemokine expressionin IBD. Mucosal chemokine expression is unselectively increased in bothulcerative colitis and Crohn’s disease. J Pathol 2003, 199:28-35.21. Khan WI, Motomura Y, Wang H, El-Sharkawy RT, Verdu EF, Verma-Gandhu M, Rollins BJ, Collins SM: Critical role of MCP-1 in thepathogenesis of experimental colitis in the context of immune andenterochromaffin cells. Am J Physiol Gastrointest Liver Physiol 2006, 291:G803-11.22. Andres PG, Beck PL, Mizoguchi E, Mizoguchi A, Bhan AK, Dawson T,Kuziel WA, Maeda N, MacDermott RP, Podolsky DK, et al: Mice with aselective deletion of the CC chemokine receptors 5 or 2 are protectedfrom dextran sodium sulfate-mediated colitis: lack of CC chemokinereceptor 5 expression results in a NK1.1+ lymphocyte-associated Th2-type immune response in the intestine. J Immunol 2000, 164:6303-12.23. Palmieri O, Latiano A, Salvatori E, Valvano MR, Bossa F, Latiano T,Corritore G, di Mauro L, Andriulli A, Annesec V: The -A2518Gpolymorphism of monocyte chemoattractant protein-1 is associatedwith Crohn’s disease. Am J Gastroenterol 105:1586-94.24. Hynes RO, George EL, Georges EN, Guan JL, Rayburn H, Yang JT: Toward agenetic analysis of cell-matrix adhesion. Cold Spring Harb Symp Quant Biol1992, 57:249-58.25. Brenmoehl J, Lang M, Hausmann M, Leeb SN, Falk W, Scholmerich J,Goke M, Rogler G: Evidence for a differential expression of fibronectinsplice forms ED-A and ED-B in Crohn’s disease (CD) mucosa. Int JColorectal Dis 2007, 22:611-23.26. Bataille F, Rohrmeier C, Bates R, Weber A, Rieder F, Brenmoehl J, Strauch U,Farkas S, Furst A, Hofstadter F, et al: Evidence for a role of epithelialmesenchymal transition during pathogenesis of fistulae in Crohn’sdisease. Inflamm Bowel Dis 2008, 14:1514-27.27. Gagne D, Groulx JF, Benoit YD, Basora N, Herring E, Vachon PH, Beaulieu JF:Integrin-linked kinase regulates migration and proliferation of humanintestinal cells under a fibronectin-dependent mechanism. J Cell Physiol222:387-400.28. Alon R, Cahalon L, Hershkoviz R, Elbaz D, Reizis B, Wallach D, Akiyama SK,Yamada KM, Lider O: TNF-alpha binds to the N-terminal domain offibronectin and augments the beta 1-integrin-mediated adhesion ofCD4+ T lymphocytes to the glycoprotein. J Immunol 1994, 152:1304-13.29. Kullberg MC, Jankovic D, Feng CG, Hue S, Gorelick PL, McKenzie BS, Cua DJ,Powrie F, Cheever AW, Maloy KJ, et al: IL-23 plays a key role inHelicobacter hepaticus-induced T cell-dependent colitis. J Exp Med 2006,203:2485-94.30. Weaver CT, Harrington LE, Mangan PR, Gavrieli M, Murphy KM: Th17: aneffector CD4 T cell lineage with regulatory T cell ties. Immunity 2006,24:677-88.31. Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly MJ,Steinhart AH, Abraham C, Regueiro M, Griffiths A, et al: A genome-wideassociation study identifies IL23R as an inflammatory bowel diseasegene. Science 2006, 314:1461-3.32. Voo KS, Wang YH, Santori FR, Boggiano C, Arima K, Bover L, Hanabuchi S,Khalili J, Marinova E, Zheng B, et al: Identification of IL-17-producingFOXP3+ regulatory T cells in humans. Proc Natl Acad Sci USA 2009,106:4793-8.doi:10.1186/1471-2172-12-42Cite this article as: Assi et al.: Role of epithelial integrin-linked kinase inpromoting intestinal inflammation: effects on CCL2, fibronectin and theT cell repertoire. BMC Immunology 2011 12:42.Assi et al. BMC Immunology 2011, 12:42http://www.biomedcentral.com/1471-2172/12/42Page 14 of 14


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items