UBC Faculty Research and Publications

Large-scale copy number variants (CNVs): Distribution in normal subjects and FISH/real-time qPCR analysis Qiao, Ying; Liu, Xudong; Harvard, Chansonette; Nolin, Sarah L; Brown, W T; Koochek, Maryam; Holden, Jeanette J; Lewis, ME S; Rajcan-Separovic, Evica Jun 12, 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12864_2006_Article_880.pdf [ 1.73MB ]
Metadata
JSON: 52383-1.0223250.json
JSON-LD: 52383-1.0223250-ld.json
RDF/XML (Pretty): 52383-1.0223250-rdf.xml
RDF/JSON: 52383-1.0223250-rdf.json
Turtle: 52383-1.0223250-turtle.txt
N-Triples: 52383-1.0223250-rdf-ntriples.txt
Original Record: 52383-1.0223250-source.json
Full Text
52383-1.0223250-fulltext.txt
Citation
52383-1.0223250.ris

Full Text

ralssBioMed CentBMC GenomicsOpen AcceResearch articleLarge-scale copy number variants (CNVs): Distribution in normal subjects and FISH/real-time qPCR analysisYing Qiao1,2, Xudong Liu3,4,5,6, Chansonette Harvard1,2, Sarah L Nolin5,7, W Ted Brown5,7, Maryam Koochek2,4, Jeanette JA Holden3,4,5,6,8, ME Suzanne Lewis2,5,6 and Evica Rajcan-Separovic*1,5,6Address: 1Department of Pathology, UBC, Children's and Women's Health Centre of BC, 4480 Oak Street, Vancouver, V6H 3V4, British Columbia, Canada, 2Department of Medical Genetics, UBC, Children's and Women's Health Center of BC C234, 4500 Oak Street, Vancouver, V6H 3N1, British Columbia, Canada, 3Department of Physiology, Queen's University, 191 Portsmouth Avenue, Kingston, K7M 8A6, Ontario, Canada, 4Autism Research Program, Ongwanada, 191 Portsmouth Avenue, Kingston, K7M 8A6, Ontario, Canada, 5Autism Spectrum Disorders – Canadian-American Research Consortium, 6Healthcare Equity for Intellectually Disabled Individuals (HEIDI) Research Program, 7Department of Human Genetics, New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY 10314, USA and 8Department of Psychiatry, Queen's University, 191 Portsmouth Avenue, Kingston, K7M 8A6, Ontario, CanadaEmail: Ying Qiao - yqiao@interchange.ubc.ca; Xudong Liu - liux@post.queensu.ca; Chansonette Harvard - charvard@interchange.ubc.ca; Sarah L Nolin - snolin@mindspring.com; W Ted Brown - wtbibr@aol.com; Maryam Koochek - maryamk@interchange.ubc.ca; Jeanette JA Holden - holdenj@post.queensu.ca; ME Suzanne Lewis - sume@interchange.ubc.ca; Evica Rajcan-Separovic* - eseparovic@cw.bc.ca* Corresponding author    AbstractBackground: Genomic copy number variants (CNVs) involving >1 kb of DNA have recently been found to be widelydistributed throughout the human genome. They represent a newly recognized form of DNA variation in normalpopulations, discovered through screening of the human genome using high-throughput and high resolution methodssuch as array comparative genomic hybridization (array-CGH). In order to understand their potential significance and tofacilitate interpretation of array-CGH findings in constitutional disorders and cancers, we studied 27 normal individuals(9 Caucasian; 9 African American; 9 Hispanic) using commercially available 1 Mb resolution BAC array (SpectralGenomics). A selection of CNVs was further analyzed by FISH and real-time quantitative PCR (RT-qPCR).Results: A total of 42 different CNVs were detected in 27 normal subjects. Sixteen (38%) were not previously reported.Thirteen of the 42 CNVs (31%) contained 28 genes listed in OMIM. FISH analysis of 6 CNVs (4 previously reported and2 novel CNVs) in normal subjects resulted in the confirmation of copy number changes for 1 of 2 novel CNVs and 2 of4 known CNVs. Three CNVs tested by FISH were further validated by RT-qPCR and comparable data were obtained.This included the lack of copy number change by both RT-qPCR and FISH for clone RP11-100C24, one of the mostcommon known copy number variants, as well as confirmation of deletions for clones RP11-89M16 and RP5-1011O17.Conclusion: We have described 16 novel CNVs in 27 individuals. Further study of a small selection of CNVs indicatedconcordant and discordant array vs. FISH/RT-qPCR results. Although a large number of CNVs has been reported to date,quantification using independent methods and detailed cellular and/or molecular assessment has been performed on avery small number of CNVs. This information is, however, very much needed as it is currently common practice toconsider CNVs reported in normal subjects as benign changes when detected in individuals affected with a variety ofdevelopmental disorders.Published: 12 June 2007BMC Genomics 2007, 8:167 doi:10.1186/1471-2164-8-167Received: 16 November 2006Accepted: 12 June 2007This article is available from: http://www.biomedcentral.com/1471-2164/8/167© 2007 Qiao et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 11(page number not for citation purposes)BMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167BackgroundThere is considerable genomic variability among humansthat is not associated with a recognizable clinical pheno-type. This variability is evident at both the chromosomallevel (as microscopically visible gains or losses of chromo-somal bands or regions) [1] and at the single nucleotidelevel (as single nucleotide polymorphisms (SNPs)) [2].The gains and losses of sub-microscopic DNA segmentslarger than 1 kb are termed copy number variants (CNVs)[3]. They represent a newly recognized class of DNA vari-ation, identified as a result of the introduction of compar-ative genomic hybridization (CGH) array technology thatenables the study of variation in the number of copies ofspecific DNA segments among individuals [4,5]. Thewidespread presence of CNVs in normal individuals hasnow been documented using not only array CGH-con-taining BAC clones [6,7] but also oligonucleotide arrays athigh resolution as well SNP data analysis [8-12] and DNAsequence comparisons between individuals [13].The discovery of CNVs presents investigators with anumber of challenges as CNVs complicate the interpreta-tion of array data and efforts to attribute microdeletionsand microduplications identified in individuals with con-stitutional disorders or in cancerous tissues to the diseaseprocesses. The role of CNVs in causing or influencing thesusceptibility to disease and genome evolution remainslargely unknown. A catalogue of published CNVs can befound in the public database [14], and helps to guide theinterpretation of array CGH findings. However, thenumber and identity of polymorphic loci detected in dif-ferent studies varies considerably [15], likely because ofdifferences across various array platforms, analyticalmethods and the populations investigated. In addition,copy number differences for many of the CNVs listed inthe above database are not confirmed using secondaryindependent quantification methods (FISH or quantita-tive DNA methods). Therefore, further work to identifyand characterize CNVs in human populations and con-firm copy number variability is essential in order to betterunderstand the significance of CNVs and to determinetheir role in common disorders.We studied 27 phenotypically normal individuals anddetected 42 different sub-microscopic CNVs using the 1Mb resolution whole genome array-CGH. We used real-time quantitative PCR (RT-qPCR) and FISH to confirmCNVs. The results of these studies are presented.Results1. Array-CGH findings of CNVs in normal subjectsBy studying 27 phenotypically normal, healthy individu-als (17 females and 10 males; 9 African-American, 9 His-and further classified into 2 subgroups. Group A contains26 CNVs which were previously reported in the publicdatabase [14], either as an identical clone entry or as partof a reported genomic CNV region. The remaining 16CNVs in Group B of Table 1 represent novel CNVs. Intotal, 8 CNVs were observed in two or more individuals;the majority of recurrent CNVs (7/8) belonged to group A.Segmental duplications were found in 8 CNVs (6 inGroup A and 2 in Group B). Of the 42 CNVs, only 13 werefound to contain genes (N = 28) listed in the OMIM data-base; 9/28 genes were found in one CNV in Group A(RP11-144O23 mapping to 12p13.2). In addition togenes primarily involved in functions of the humanimmune or sensory systems, signal transduction andmetabolism, genes involved in transcription regulation,neurotransmitter transport, cell proliferation and differ-entiation or development were also identified (Table 1).The three clones which showed copy number changesmost frequently in our subjects were RP11-259N12(1p13.3), RP11-100C24 (13q21) and RP11-79F15(19p13.2), and were found in 5, 9 and 5 individualsrespectively.2. FISH and RT-qPCR analysis of polymorphic clonesa) FISHIn order to establish the cellular copy number pattern ofknown and novel CNVs, we performed FISH analysis of 6CNVs (Table 2) in subjects for whom a cell pellet wasavailable. For some clones, copy number changes couldbe confirmed by FISH, while for others the FISH patternswere discordant with array-CGH results. For example,array analysis of clones RP5-1011O17 at 2q37.3 andRP11-89M16 at 8p22 both showed a deletion upon arrayanalysis, and both were subsequently confirmed by FISH.However, the FISH signal pattern was different for thesetwo clones: clone RP5-1011O17 had a complete loss ofone copy, demonstrating a complete deletion while cloneRP11-89M16 exhibited a diminished FISH signal on oneof the homologs suggestive of a partial deletion (Figure 1).Conversely, FISH analysis of clone RP11-100C24(13q21.1) showed consistent normal signal patterns (2copies/cell) in multiple subjects regardless of whether theclone was seen as a loss (Figure 2) or gain (Figure 3) onarray analysis. Gains of clones RP11-125A5 and RP11-270M20 could not be confirmed by FISH (Table 2).Finally, gain of the clone RP11-598F7 was seen as multi-ple signals mapping to several chromosomes, demon-strating the presence of homologous sequences withinthis clone in several regions of the genome (Figure 4). Thisobservation was also confirmed by the in silico eFISH sim-ulation tool [16].Page 2 of 11(page number not for citation purposes)panic and 9 Caucasian) using commercial array-CGH(Spectral Genomics), 42 different CNVs were identifiedBMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167Table 1: Previously reported (A) and novel (B) CNVsNumber Cytoband Clone NamePosition (Mb)Ethnic originDuplication Deletion Overlap with segmental duplicationsGenes on OMIM listBiological processGroup A 1 1p36.13 RP1-163M9* 16.1 AA 1 Yes2 1p13.3 RP11-259N12103.4 2C, AA, 2H 3 2 Yes AMY2A, AMY1A, AMY1B, AMY1CGlycogen metabolism3 1q42.13 RP5-1016N21229.7 C, H 2 No4 2p12 RP11-345F1382.8 AA 1 No5 2qter RP5-1011O17242.9 C, 2H 3 Yes6 3q26.3 RP11-114M1 178.8 H 1 No7 4q25 RP11-18D18 112.7 H 1 No8 6pter AL035696.140.1 H 1 Yes9 6q12 RP11-80L16 67 AA 1 No10 6q24.1 RP1-69B13 146.7 H 1 No GRM1 G-protein mediated signaling, neuronal activities11 7pter RP1-164D18 0.1 AA 1 No12 7p21.1 IIID11 18.8 C 1 No13 8p22 RP11-89M16 17.2 C 1 No SLC7A2, PDGFRLAmino acid transport, receptor protein tyrosine kinase signaling pathway14 10qter CTC-261B16135.2 AA 1 No15 11q22.3 RP11-179B7 104.4 AA 1 No16 12p13.2 RP11-144O2310.9 H 1 No TAS2R7, TAS2R8, TAS2R9, TAS2R10, PRR4, PRH1, TAS2R13, PRH2, TAS2R14Taste receptor activity, visual perception, cell adhesion-mediated signaling, immunity and defense17 13q21.1 RP11-100C2456.7 4C, AA, 4H 5 4 No18 14q12 RP11-125A5 27.6 C, 3H 2 2 No19 15q11.2 RP11-80H14 20.4 H 1 No CYFIP1 Signal transduction, developmental processes20 16p11.2 RP11-499D5 33.8 H 1 YesPage 3 of 11(page number not for citation purposes)*BMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/16721 16p11.2 RP11-488I20 *35.6 H 1 No22 16p11.1 RP11-80F22 *35.7 C, 2H 3 No23 17pter CTB-68F18 0.1 C 1 No RPH3AL Synaptic transmission24 17q24.3 RP11-300G1368.6 H 1 No KCNJ16, KCNJ2Cation transport, muscle contraction25 19p13.2 RP11-79F15 8.8 C, 2AA, 2H 1 4 Yes MBD3L1, MUC16mRNA transcription26 19qter 1129-c9 76 C 1 NoGroup B 1 2q14.3 RP11-270M20125.3 C 1 No CNTNAP5 Cell adhension-mediated signaling, synaptic transmission2 4q28.1 RP11-77P11 128.2 H 1 No3 4q31.2 RP11-89E4 145.8 H 1 No4 6p24 RP1-103M22 9.5 H 1 No5 7q33 RP11-140I14 134.6 AA 1 No CNOT4 mRNA transcription regulation6 10p12.3 RP11-91D9 19.7 H 1 No7 12pter RP11-598F7 *0 C 1 No SLC6A12 neurotransmitter transport8 13q13.1 RP11-87G1 33 AA 1 No9 19q13.43 F21283 63.7 H 1 No MZF1 regulation of transcription10 Xpter LLNOYCO3M11D20 3C, AA 2 2 No11 Xp11.3 RP11-252K1041.7 H 1 No12 Xp11.21 RP11-266I3 *53.7 AA 1 Yes13 Xp11.1 ICRFC100G1110056.1 C 1 No14 Xq21.1 RP11-192B1884.4 H 1 No15 Xq26.2 CTB-45B24 131.4 H 1 No PCYT1B, PHF6Regulation of metabolism and transcription, ovarian follicle development, spermatogenesis16 Yq11.2 RP11-91A13 *17.7 AA 1 YesNote: * Clone showing multiple sites based on e-FISH.AA: African American; H: Hispanic; C: Caucasian.Table 1: Previously reported (A) and novel (B) CNVs (Continued)Page 4 of 11(page number not for citation purposes)BMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167b) RT-qPCR and FISH comparisonsRT-qPCR analysis was performed for 3/6 clones tested byFISH in order to confirm the array results and to helpresolve the array and FISH discrepancies (Table 2). Com-parable results between FISH and RT-qPCR were obtainedfor all 3 clones tested by both methods – i.e. deletions ofRP11-89M16 and PR5-1011O17 were confirmed by RT-qPCR and the lack of copy number change (both gain andloss) for RP11-100C24 as seen by FISH was also noted byRT-qPCR.DiscussionOur study of 27 normal subjects revealed a total of 42CNVs: 26 previously described CNVs [14] and 16 (38%)novel CNVs. A higher number of known than novel CNVsshowed recurrence in the subjects tested (7/8 recurrentclones were previously described -Table 1). Similarly, evi-dence of segmental duplications was found in 6/8 previ-ously described CNVs. This confirms the observation thatrecurring CNVs are more prevalent in the human popula-tion, and tend to be associated with segmental duplica-tions [7], while our novel CNVs are possibly less frequentand individual specific.The number of CNVs detected in our controls is compara-ble to the number obtained by other investigators usingthe same commercial array-CGH and cut-off levels [17-19]. However, the number is significantly smaller thanthat observed by Iafrate et al [6] who reported 255 CNVsin 59 individuals. Although they used the same array-Table 2: List of polymorphic BAC clones used for FISH/qPCR analysis in controls.Cytoband Clone name Previously reportedSize (kb) Gene(s) containedOverlap with segmental duplicationsARRAY FISH qPCR2q37.3 RP5-1011O17 Y 21.8 No yes deletion complete loss of one copy (Fig1) C13q21.1 RP11-100C24 Y 129.3 No No gain 2 copies (Fig3) NCloss 2 copies (Fig2) NC14q12 RP11-125A5 Y 186.5 No No gain/loss 2 copies (not shown) NT2q14.3 RP11-270M20 N 140.4 No No gain 2 copies (not shown) NT8p22 RP11-89M16 Y 176 MTMR7; SLC7A2; PDGFRLNo deletion partial deletion of one copy (Fig 1) C12p13.33 RP11-598F7 N 0.5 SLC6A12 No gain multiple sites on non-homologous chromosomes (Fig 4)NTC = confirmedNC = not confirmedNT = not testedFISH confirmation of deletions detected by array-CGHigure 1FISH confirmation of deletions detected by array-CGH. i. Deletion of clone RP5-1011O17 (2q27.3) as demonstrated by a single signal in both metaphase chromosomes (arrowhead) (i) and interphase cells (ii). Partial deletion of clone RP11-89M16 (8p22) is seen as a diminished signal on one of the homologues (iii). A control probe at 8qter, RP11-17M8, was used to eliminate difference in signal intensities due to artifacts. One of the signals on 8p22 was consistently smaller (arrow) than any of Page 5 of 11(page number not for citation purposes)the 3 remaining signals on the two chromosome 8 homologues.BMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167CGH platform, a different dynamic website-based analyt-ical method was applied, instead of our fixed cut-off levelsof 1.2 for duplications and 0.8 for deletions, suggestingthat the analytical method used plays a significant role inthe number of apparent CNVs detected among individu-als. Recently, a number of studies addressed the questionof global genomic variation using different approachesincluding tiling BAC array [7,12,20], SNP polymorphismsand oligo arrays [9-11]. The number of CNVs and chro-mosomal regions affected varied among studies evenwhen the same array platform was used. For example, theBAC tiling arrays detected 3654 autosomal segmentalCNVs in 95 controls [7], 913 CNVs in 270 controls [12]ferences in the populations studied may have contributedto the observed discrepancies, however, even when thesame individuals were examined using a differentapproach (BAC array vs. SNPs) less than half (43%) of theCNVs were detected on both platforms [12]. It is now evi-dent that none of the existing technologies can capture allhuman variation.One of the pre-requisites for understanding global humanvariation is the confirmation of CNVs using alternativemethods. Their recurrence and presence as detected usingdifferent platforms supports that these are true differencesamong individuals. However, a large number of CNVs areArray and FISH analysis of BAC clone RP11-100C24 (loss)Figure 2Array and FISH analysis of BAC clone RP11-100C24 (loss). (i) The array detected deletion of RP11-100C24 could not be confirmed in interphase (ii) and metaphase cells by FISH (iii). The details of profile interpretation are described in Tyson et al [24]. Briefly, deletion of a clone was considered if the red and the blue array profiles show separation for that clone and the red profile is above the line corresponding to the value of 1. On the other hand, if the blue array profile is above the line cor-responding to the value of 1, a gain for the clone is considered.Page 6 of 11(page number not for citation purposes)and 258 CNVs in 100 individuals with intellectual disabil-ity and their phenotypically normal parents [20]. The dif-still "unique", i.e. specific for a control subject/family orstudy. Independent quantification methods such as FISHBMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167or RT-qPCR should ideally be performed on many CNVs,particularly those appearing in one individual, as these arethe most likely ones to be false positives [7]. Consideringthe large number of CNVs reported (>6000 entries in thedatabase of human variation) the number of validatedCNVs using independent quantification methods such asRT-qPCR or FISH is still proportionally very small due tothe time consuming or limited throughput of single locusanalysis. For example, in two recent larger studies report-ing a total of >5000 CNVs, less than 300 CNVs were vali-Array and FISH analysis of BAC clone RP11-100C24 (gain)Figure 3Array and FISH analysis of BAC clone RP11-100C24 (gain). (i) The array detected gain of RP11-100C24 could not be confirmed in interphase (ii) and metaphase cells by FISH (iii).Duplication of clone RP11-598F7 in a normal subjectFigure 4Duplication of clone RP11-598F7 in a normal subject. Gain of a terminal clone from 12p on the array is indicated with an arrow (i). FISH probe for this clone hybridizes to multiple non-homologous chromosomes (chromosome 12-arrow; chro-Page 7 of 11(page number not for citation purposes)mosome 20-arrowhead, ii)BMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167dated using quantification methods [7,12]. Using FISHwe have confirmed array-detected copy number changesof 3/6 selected CNVs (Table 2), while for 3/6 CNVs a nor-mal two signal FISH pattern was seen. We tested twoFISH-confirmed CNVs using RT-qPCR, one partially andone fully deleted (RP11-89M16 and RP5-1011O17,respectively), and observed concordance between all 3methods (array-CGH, FISH and RT-qPCR). As two of thethree FISH non-confirmed CNVs (RP11-125A5 and RP11-100C24) are recognized as being very common and recur-mation of both gain and loss. It is possible that this CNVis composed of tightly packed repeats which can be dis-cerned only by fiber FISH, as noted for clone RP11-259N12 from chromosome 1 [6]. Additional cause of thearray-CGH vs. FISH/RT-qPCR discrepancy may be due tothe fact that array-CGH assays evaluate the relative ratio ofsegmental DNA copy number in the test DNA vs. refer-ence DNA, and do not provide an absolute number ofcopies, as explained in Figure 5.Correlation of FISH patterns with array detected copy number variabilityFigure 5Correlation of FISH patterns with array detected copy number variability. The discordant results between the array and FISH/RT-qPCR findings may be due to the fact that array CGH uses the relative ratio of segmental DNA copy number in the test DNA and the reference DNA, the latter being a pool of genomic DNA from several different normal individuals. The copy number of a specific clone in the reference DNA pool determines the outcome of an array analysis (typical gain (i) and loss (ii) on the array and FISH are shown in Figure 5A). For clones with a very variable copy number, a loss on the array may simply be the result of fewer copies in the test individual compared to the pool of reference DNA (Figure 5B), and if the number of copies in the test individual is 2, confirmation by any of the methods (FISH or qPCR) may not be possible. Con-versely, the gain on the array is the result of the presence of more copies of the specific DNA segment in the test DNA com-pared to the reference (Figure 5C). If the gain occurred as a tandem duplication (or multiplication) of the DNA segment, its detection may not be possible by FISH due to limited resolution. Alternatively, if the gain involved only some sections of the DNA segment, then it may not be detectable by RT-qPCR as typically only a small number of short sequences within non-repeated DNA segments within each region are used for analysis.Page 8 of 11(page number not for citation purposes)rent on multiple platforms [6,12], we further evaluatedRP11-100C24 using RT-qPCR but failed to achieve confir-The information on new CNVs is expanding dramatically,and cataloguing clones for which independent quantifica-BMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167tion is performed are desirable, as only detailed analysisof a large number of CNVs will help better understandtheir basic structure, DNA content and reasons for varia-bility. Currently, the significance of CNVs remains puz-zling, as many of these genomic regions contain genes andcoding sequences associated with known genetic disor-ders [6,8,21]. In our subjects 13/42 different CNVs wereassociated with OMIM genes; the number was usually nothigher than 2 genes/CNV, except for CNV RP11-144O23which had 9 genes involved in sensory perception, celladhesion-mediated signaling, immune and defense proc-esses (Table 1A). This clone was noted in one of our His-panic individuals and was reported as one of the moredivergent clones in the 4 populations reported by Redonet al [12]. Many of the genes in CNVs are described as"environmental sensor genes" and are associated withmechanisms mediating immune responsiveness(defensin, interferon regulatory factor 4, etc.), cellularmetabolism (cytochrome P450 genes and carboxyesterasegene families), and membrane surface interactions (Rhe-sus blood group gene families, melanoma antigen gene).It is now established that the copy number variability ofsome genes can influence susceptibility to some diseases[22,23]. For example, it has been reported that peoplewith fewer copy numbers of CCL3L1, a gene involved inimmunity, are more susceptible to HIV infection [22]. Theextent of associations of CNVs with disease susceptibilitywill become clearer as we learn more about the distribu-tion of well characterized CNVs in individuals whosehealth and medical histories are fully evaluated.ConclusionSubmicroscopic CNVs are a common form of humangenomic variation, which can be readily identified byarray-CGH technology in phenotypically normal individ-uals. The number of CNVs detected in each study is influ-enced by several factors, especially the array platform andmethod of analysis. Our results confirm the wide distribu-tion of CNVs in three different ethnic populations andwould facilitate their interpretation and understanding oftheir significance in the future.MethodsSubjectsNormal controls: A total of 27 normal individuals werestudied. Nine Caucasian volunteers were recruited for thestudy and their DNA extracted and chromosomesobtained using routine methodology. Eighteen previouslybanked DNA samples from African-American and His-panic individuals were also examined. All samples wereanonymized for all personal identifiers.Array CGHArray-CGH methods were performed as previouslydescribed [24]. Briefly, we used the commercially availa-ble genomic DNA array comprising 2,600 BAC cloneswith an average of 1 Mb resolution throughout the humangenome (Spectral Genomics™, Houston, TX). The list ofclones on this array can be obtained from website [25].Genomic DNA from the tested subjects was extracted fromperipheral venous blood using Puregene DNA IsolationKit (Gentra Systems Inc., Minneapolis, MN, USA) accord-ing to the manufacturer's protocol. The reference DNAwas purchased from Promega and represents a pool ofgenomic DNA from four normal control samples. Bothforward (test DNA labeled with Cy3, reference DNAlabeled with Cy5) and reverse labeling experiments (testDNA labeled with Cy5, reference DNA labeled with Cy3)were performed for each patient. Following hybridization,slides were scanned on a GENEPIX 4000B scanner (AxonInstruments, Union City, CA) and the 16-bit TIFF imagescaptured using GENEPIX Pro 4.0 software. The imageswere analyzed using SPECTRALWARE TM BAC ArrayAnalysis Software v2.0 (Spectral Genomics) as describedpreviously [24]. In all cases except one, the test and refer-ence DNA were sex matched. For the sex unmatched case,the clones on the X and Y chromosome were not consid-ered. We have used cut-off values of 1.2 for gain and 0.8Table 3: Primers used in RT-qPCR.Cytoband Clone name Primer name Forward primer (5'-3') Reverse Primer (5'-3')2q37.3 RP5-1011O17 RP5-1011O17-ARP5-1011O17-BRP5-1011O17-CAAATGGTGACTCTTGTGAATTTGGTGGGAAGGTGGGTGGCTACAACACTGATGAAGGTTTTCCTTGTGGGGAAGCTGTGGCCAAAACAAGCAGGCCTTGGTAACACAGGCAGCACTGAACTACAGCAGTT13q21.1 RP11-100C24 RP11-100C24-ARP11-100C24-BRP11-100C24-CCCACCTCCCAACTCTGTGTGTCTGCTTTATGGTGCCTTTTGCTGTTTTGGCTTTCTGGCAGTTCCCTCCAGAGATAGCACGTTCTGTCAGAGAGGACTGCGGAAACTCAAAGGCAGGAGGCTGTTCT8p22 RP11-89M16 RP11-89M16-ARP11-89M16-BRP11-89M16-CTTCCCAGCTCGTGCTCTCATGGATGGTGCTAGAGAGGTAGATGCAGGATCACCCAAGGCAGTAACAGTGGAAGGCTCTTCATGCTTGCAGGAATGTGCTGGTTTGTCTAAACTCCCTTTTTGAGGCATTPage 9 of 11(page number not for citation purposes)expand the number of recognized CNVs. Cataloguing ofconfirmed CNVs, quantified using independent methods,for loss as determined previously by ourselves and others[17-19,24]. In addition, we performed one self hybridiza-BMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167tion array experiment to detect the number of artifactualgains/losses. In this latter experiment, no copy numberchanges were observed.The database of human genomic variants [14] was used tocheck if the CNV has been previously reported and thepresence of segmental duplications within it. The genecontent strictly within the CNV was established using thesame database as well as the NCBI and UCSC databases(build 35.1).FISHBAC DNA clones that were identified to show copynumber change by array-CGH were purchased from Spec-tral Genomics (Houston, TX), labeled directly by Spec-trum Red or Green (Vysis, Downers Grove, IL) using nicktranslation and hybridized to metaphase chromosomesand interphase nuclei from human peripheral blood lym-phocytes according to the manufacturer's instructions andas previously published [26]. Slides were viewed on aZeiss Axioplan 2 fluorescence microscope and images cap-tured using Macprobe software (Applied Imaging, SantaClara, CA). For each FISH probe, at least 10 metaphasecells and 50–100 interphase nuclei were counted blindlyby two observers. The normal pattern of FISH signal dis-tribution was determined using 3 single copy BAC clones(RP1-3K23 on 7q36.3, RP11-58F7 on 7q36.3 and RP11-143E20 on Xp22.31), which showed no copy numberchanges in any of the control individuals on array analy-sis. The normal signal counts in 3 control experimentsshowed that most of the interphase nuclei had a concord-ant 1:1 and 2:2 signal pattern, while a discrepant signalnumber (mainly 1:2) was seen in around 20% of cells(due to asynchronous replication and/or FISH artifacts).This signal pattern is consistent with other publicationsusing FISH with single copy clones [8].Based on these values and our experience in FISH confir-mation of microduplications [24], the predominance ofcells (>50%) with a pattern different than 1:1 or 2:2 wasdetermined arbitrarily to represent true copy number var-iability. Increase of DNA clone copy number was consid-ered if a discrepant number of FISH signals (eg.1:2; 2:3),or more than 4 signals/interphase nucleus were predomi-nantly observed (>50 % cells). A loss of the DNA clonesequences was considered if >50% interphase nuclei/met-aphase chromosomes had one signal, or one of the signalswas consistently fainter than the other.RT-qPCRAll array-detected deletions and duplications are con-firmed using real-time quantitative PCR (RT-qPCR) withSYBR Green I detection [27], using 3 non-polymorphicspanning the target clones were retrieved from on-linesequence databases and repositories, and checked for thepresence of repeated DNA sequences using RepeatMasker[28]. This allowed us to identify unique sequences withinthe target regions, whilst avoiding DNA segments withcomplex repetitive elements. Primer sets were designedwithin these unique sequences using the Primer Express v3.0 program (Applied Biosystems). Primers were checkedfor any potential SNPs located within them using onlineSNP blasting.Real-time detection of PCR products was performed usingthe ABI Prism 7900HT system which allows one to see thethreshold cycle (CT) during the exponential phase ofamplification (i.e. when none of the PCR reagents are lim-iting), and quantify each allele, such that a single allele ata test locus in a person with a deletion would show lessamplification (i.e. ~50%) than in a person with two cop-ies of that allele. We compared the amplification of testmarker loci (i.e. within the region suspected of beingdeleted or duplicated) with that of non-contiguous mark-ers (i.e. from another chromosomal region) performed atthe same time. The list of primers used is shown in Table3.Authors' contributionsYQ conducted the array CGH and FISH experiments forthe majority of cases, analyzed the data and drafted themanuscript. XL conducted real-time qPCR experiments.CH conducted FISH experiments, and reviewed the man-uscript. SN and WTB provided DNA samples andreviewed the manuscript. MK conducted array CHG exper-iments and reviewed the manuscript. ERS, SL and JHdesigned and supervised the research study, supervisedstaff and students, and reviewed the manuscript. Allauthors read and approved the final manuscript.AcknowledgementsThis work was supported by grants from the Canadian Institutes for Health Research grants (MOP-74502-ERS principal investigator and RT-64217, MESL-principal investigator), Vancouver Foundation, a CIHR Interdiscipli-nary Health Research Team grant (RT-43820) to the Autism Spectrum Dis-orders Canadian-American Research Consortium [29] (JJAH, principal investigator), and a research grant from the Ontario Mental Health Foun-dation (JJAH, principal investigator); Y. Qiao is a trainee with the CIHR/NAAR STIHR Inter-Institute Autism Spectrum Disorders Training Program (PI:JJAH). E. Rajcan-Separovic is supported by a CIHR Institute of Genetics Clinician Investigator Award (2005–09). M.E.S Lewis sincerely appreciates the support provided by a Michael Smith Foundation for Health Research Career Investigator (Scholar) Award (2005–10).References1. Wyandt HE, Tonk VS: Atlas of Human Chromosome Hetero-morphisms.  , Kluwer Academic Publishers; 2005. 2. Wang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolsky R, GhandourG, Perkins N, Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L,Page 10 of 11(page number not for citation purposes)markers evenly distributed within the deleted/duplicatedclones. To ensure optimal primer design, DNA sequencesTopaloglou T, Hubbell E, Robinson E, Mittmann M, Morris MS, ShenN, Kilburn D, Rioux J, Nusbaum C, Rozen S, Hudson TJ, Lipshutz R,Chee M, Lander ES: Large-scale identification, mapping, andPublish with BioMed Central   and  every scientist can read your work free of charge"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."Sir Paul Nurse, Cancer Research UKYour research papers will be:available free of charge to the entire biomedical communitypeer reviewed and published immediately upon acceptancecited in PubMed and archived on PubMed Central BMC Genomics 2007, 8:167 http://www.biomedcentral.com/1471-2164/8/167genotyping of single-nucleotide polymorphisms in thehuman genome.  Science 1998, 280:1077-1082.3. Feuk L, Carson AR, Scherer SW: Structural variation in thehuman genome.  Nat Rev Genet 2006, 7:85-97.4. Carter NP: As normal as normal can be?  Nat Genet 2004,36:931-932.5. Freeman JL, Perry GH, Feuk L, Redon R, McCarroll SA, Altshuler DM,Aburatani H, Jones KW, Tyler-Smith C, Hurles ME, Carter NP,Scherer SW, Lee C: Copy number variation: new insights ingenome diversity.  Genome Res 2006, 16:949-961.6. Iafrate AJ, Feuk L, Rivera MN, Listewnik ML, Donahoe PK, Qi Y,Scherer SW, Lee C: Detection of large-scale variation in thehuman genome.  Nat Genet 2004, 36:949-951.7. Wong KK, deLeeuw RJ, Dosanjh NS, Kimm LR, Cheng Z, HorsmanDE, MacAulay C, Ng RT, Brown CJ, Eichler EE, Lam WL: A compre-hensive analysis of common copy-number variations in thehuman genome.  Am J Hum Genet 2007, 80:91-104.8. Sebat J, Lakshmi B, Troge J, Alexander J, Young J, Lundin P, Maner S,Massa H, Walker M, Chi M, Navin N, Lucito R, Healy J, Hicks J, Ye K,Reiner A, Gilliam TC, Trask B, Patterson N, Zetterberg A, Wigler M:Large-scale copy number polymorphism in the humangenome.  Science 2004, 305:525-528.9. Hinds DA, Kloek AP, Jen M, Chen X, Frazer KA: Common dele-tions and SNPs are in linkage disequilibrium in the humangenome.  Nat Genet 2006, 38:82-85.10. Conrad DF, Andrews TD, Carter NP, Hurles ME, Pritchard JK: Ahigh-resolution survey of deletion polymorphism in thehuman genome.  Nat Genet 2006, 38:75-81.11. McCarroll SA, Hadnott TN, Perry GH, Sabeti PC, Zody MC, BarrettJC, Dallaire S, Gabriel SB, Lee C, Daly MJ, Altshuler DM: Commondeletion polymorphisms in the human genome.  Nat Genet2006, 38:86-92.12. Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, Fie-gler H, Shapero MH, Carson AR, Chen W, Cho EK, Dallaire S, Free-man JL, Gonzalez JR, Gratacos M, Huang J, Kalaitzopoulos D, KomuraD, MacDonald JR, Marshall CR, Mei R, Montgomery L, Nishimura K,Okamura K, Shen F, Somerville MJ, Tchinda J, Valsesia A, WoodwarkC, Yang F, Zhang J, Zerjal T, Armengol L, Conrad DF, Estivill X, Tyler-Smith C, Carter NP, Aburatani H, Lee C, Jones KW, Scherer SW,Hurles ME: Global variation in copy number in the humangenome.  Nature 2006, 444:444-454.13. Tuzun E, Sharp AJ, Bailey JA, Kaul R, Morrison VA, Pertz LM, HaugenE, Hayden H, Albertson D, Pinkel D, Olson MV, Eichler EE: Fine-scale structural variation of the human genome.  Nat Genet2005, 37:727-732.14. Database of Genomic Variants    [http://projects.tcag.ca/variation/]15. Eichler EE: Widening the spectrum of human genetic varia-tion.  Nat Genet 2006, 38:9-11.16. eFISH   [http://projects.tcag.ca/efish/]17. Schoumans J, Ruivenkamp C, Holmberg E, Kyllerman M, Anderlid BM,Nordenskjold M: Detection of chromosomal imbalances inchildren with idiopathic mental retardation by array basedcomparative genomic hybridisation (array-CGH).  J Med Genet2005, 42:699-705.18. Schoumans J, Nordgren A, Ruivenkamp C, Brondum-Nielsen K, TehBT, Anneren G, Holmberg E, Nordenskjold M, Anderlid BM:Genome-wide screening using array-CGH does not revealmicrodeletions/microduplications in children with Kabukisyndrome.  Eur J Hum Genet 2005, 13:260-263.19. Lapierre JM, Sanlaville D, Kang J, Ozilou C, Le Lorc'h M, Waill MC,Prieur M, Colleaux L, Munnich A, Turleau C, Benkhalifa M, Moham-med M, Vekemans M, Romana S: A preliminary study to assessthe value of the DNA chips SpectralChip to detect subtleconstitutional chromosome imbalances.  Ann Biol Clin (Paris)2004, 62:203-212.20. de Vries BB, Pfundt R, Leisink M, Koolen DA, Vissers LE, Janssen IM,Reijmersdal S, Nillesen WM, Huys EH, Leeuw N, Smeets D, Sister-mans EA, Feuth T, van Ravenswaaij-Arts CM, van Kessel AG, Schoen-makers EF, Brunner HG, Veltman JA: Diagnostic genome profilingin mental retardation.  Am J Hum Genet 2005, 77:606-616.21. Sharp AJ, Locke DP, McGrath SD, Cheng Z, Bailey JA, Vallente RU,Pertz LM, Clark RA, Schwartz S, Segraves R, Oseroff VV, AlbertsonDG, Pinkel D, Eichler EE: Segmental duplications and copy-22. Gonzalez E, Kulkarni H, Bolivar H, Mangano A, Sanchez R, Catano G,Nibbs RJ, Freedman BI, Quinones MP, Bamshad MJ, Murthy KK, RovinBH, Bradley W, Clark RA, Anderson SA, O'Connell R J, Agan BK,Ahuja SS, Bologna R, Sen L, Dolan MJ, Ahuja SK: The influence ofCCL3L1 gene-containing segmental duplications on HIV-1/AIDS susceptibility.  Science 2005, 307:1434-1440.23. Aitman TJ, Dong R, Vyse TJ, Norsworthy PJ, Johnson MD, Smith J,Mangion J, Roberton-Lowe C, Marshall AJ, Petretto E, Hodges MD,Bhangal G, Patel SG, Sheehan-Rooney K, Duda M, Cook PR, Evans DJ,Domin J, Flint J, Boyle JJ, Pusey CD, Cook HT: Copy number poly-morphism in Fcgr3 predisposes to glomerulonephritis in ratsand humans.  Nature 2006, 439:851-855.24. Tyson C, Harvard C, Locker R, Friedman JM, Langlois S, Lewis ME,Van Allen M, Somerville M, Arbour L, Clarke L, McGilivray B, YongSL, Siegel-Bartel J, Rajcan-Separovic E: Submicroscopic deletionsand duplications in individuals with intellectual disabilitydetected by array-CGH.  Am J Med Genet A 2005, 139:173-185.25. DECIPHER   [http://www.sanger.ac.uk/PostGenomics/decipher/]26. Rajcan-Separovic E, Mahadevan MS, Lefebvre C, Besner-Johnston A,Ikeda JE, Korneluk RG, MacKenzie A: FISH detection of chromo-some polymorphism and deletions in the spinal muscularatrophy (SMA) region of 5q13.  Cytogenet Cell Genet 1996,75:243-247.27. Weksberg R, Hughes S, Moldovan L, Bassett AS, Chow EW, SquireJA: A method for accurate detection of genomic microdele-tions using real-time quantitative PCR.  BMC Genomics 2005,6:180.28. RepeatMasker    [http://repeatmasker.com]29. ASD-CARC   [http://www.autismresearch.ca]yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralPage 11 of 11(page number not for citation purposes)number variation in the human genome.  Am J Hum Genet 2005,77:78-88.

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0223250/manifest

Comment

Related Items