UBC Faculty Research and Publications

Identification of regulatory elements flanking human XIST reveals species differences Chang, Samuel C; Brown, Carolyn J Mar 8, 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12867_2009_Article_501.pdf [ 1.06MB ]
Metadata
JSON: 52383-1.0223080.json
JSON-LD: 52383-1.0223080-ld.json
RDF/XML (Pretty): 52383-1.0223080-rdf.xml
RDF/JSON: 52383-1.0223080-rdf.json
Turtle: 52383-1.0223080-turtle.txt
N-Triples: 52383-1.0223080-rdf-ntriples.txt
Original Record: 52383-1.0223080-source.json
Full Text
52383-1.0223080-fulltext.txt
Citation
52383-1.0223080.ris

Full Text

RESEARCH ARTICLE Open AccessIdentification of regulatory elements flankinghuman XIST reveals species differencesSamuel C Chang, Carolyn J Brown*AbstractBackground: The transcriptional silencing of one X chromosome in eutherians requires transcription of the longnon-coding RNA gene, XIST. Many regulatory elements have been identified downstream of the mouse Xist gene,including the antisense Tsix gene. However, these elements do not show sequence conservation with humans, andthe human TSIX gene shows critical differences from the mouse. Thus we have undertaken an unbiasedidentification of regulatory elements both downstream and upstream of the human XIST gene using DNase Ihypersensitivity mapping.Results: Downstream of XIST a single DNase I hypersensitive site was identified in a mouse undifferentiated ES cellline containing an integration of the human XIC region. This site was not observed in somatic cells. Upstream ofXIST, the distance to the flanking JPX gene is expanded in humans relative to mice, and we observe ahypersensitive site 65 kb upstream of XIST, in addition to hypersensitive sites near the XIST promoter. This -65region has bi-directional promoter activity and shows sequence conservation in non-rodent eutheria.Conclusions: The lack of regulatory elements corresponding to human TSIX lends further support to the argumentthat TSIX is not a regulator of XIST in humans. The upstream hypersensitive sites we identify show sequenceconservation with other eutheria, but not with mice. Therefore the regulation of XIST seems to be differentbetween mice and man, and regulatory sequences upstream of XIST may be important regulators of XIST in non-rodent eutheria instead of Tsix which is critical for Xist regulation in rodents.BackgroundX-chromosome inactivation results in transcriptionalsilencing of one of the two X chromosomes in femalemammals, thereby ensuring dosage equivalence of mostX-linked genes between males and females. The X inac-tivation centre (XIC) is a single locus on the X chromo-some that is required in cis for X-chromosomeinactivation [1]. The XIC contains the X Inactive Speci-fic Transcript (XIST/Xist) gene that produces a large(approximately 17 kb) noncoding RNA [2-4] that isnecessary and sufficient to induce X inactivation [5-7].X inactivation occurs very early in mammalian develop-ment, making analysis of the initial events challenging,particularly in humans. Most analyses have thereforebeen done in mouse, where ES cells not only providethe ability to generate targeted mutations, but alsoprovide an in vitro system modelling X inactivation, asfemale ES cells undergo random X inactivation upondifferentiation [8]. Detailed analyses of the genomicregion downstream of the mouse Xist locus haverevealed several cis-acting regulatory elements for Xist(see Figure 1A), including Tsix [9], DXPas34 and Xite[10].The Tsix gene encodes an untranslated RNA antisenseto Xist that is transcribed across the Xist locus, extend-ing beyond the promoter of the sense strand [9,11]. Acritical role for Tsix in regulating Xist expression wasdemonstrated by augmented Tsix expression resulting ininhibition of Xist accumulation [12] while deletion ofthe Tsix promoter resulted in primary non-randominactivation of the mutant X in females [13]. DXPas34,a 1.2 kb CG-rich region located 750 bp downstream ofthe Tsix major promoter, is critical for Xist and Tsixregulation, and shows bi-directional promoter activity[14,15]. Xite, named as the X-inactivation intergenictranscription element, was identified by DNase I* Correspondence: cbrown@interchange.ubc.caDepartment of Medical Genetics, Molecular Epigenetics Group, Life SciencesInstitute, University of British Columbia 2350 Health Sciences Mall, VancouverBC V6T 1Z3, CanadaChang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20© 2010 Chang and Brown; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.Figure 1 Mapping DNase I hypersensitive sites downstream of XIST. A schematic of the mouse (A) and human (B) Xist/XIST genes andsurrounding regulatory elements shows exons (black boxes) for Xist/XIST and other genes in the region (arrows indicate the direction oftranscription). Grey dots show the location of conserved blocks between mouse and human [15], and triangles mark DNase I hypersensitive(DHS) sites (filled triangles - sites in undifferentiated cells; empty triangles - sites in differentiated cells; HS1, HS5 - HS7 [40], HS2 - HS4 [46,47], HS8- HS15 [55]). DNA from nuclei of ES-10, L1.10.1 and Xa and Xi-containing hybrids exposed to DNaseI was digested with restriction enzymes (ScaI(10 kb); SapI/BlpI (10.2 kb); NsiI (11.1 kb); XmnI (9.3 kb); NcoI (11.1 kb) and BamHI (6.4 kb)) for Southern analysis. All experiments were carried outat least twice and a representative Southern blot is shown for each fragment including a lane with no DNase I (parental fragment shown asblack arrow) followed by six lanes of increasing amount of DNase I treatment. One HS site (grey arrow), was detected in the SapI/BlpI fragmentof ES-10 cells, with a size of ~7 kb. No HS site was detected in the XmnI fragment which encompasses the four previously reported transcriptionstart sites of TSIX [32]. No HS site was detected in either the Xa or Xi hybrid downstream of XIST.Chang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 2 of 10hypersensitive mapping, and is also a site of bi-direc-tional transcription, although the transcripts themselvesare not necessary for Xite to promote Tsix persistenceon the active X [10]. Homologous pairing of a regiondownstream of Xist, encompassing Tsix, DXPas34 andXite, is necessary for the initiation of X inactivation[16,17]. This pairing can be recapitulated by sub-fragments which contain a high density of CTCF sites,and CTCF as well as transcription is essential for theestablishment of pairing [16].While the mouse system provides an excellent frame-work from which we can understand the process of Xinactivation, how human fits into this framework is notclear. XIST and Xist share sequence homology [3,4] andare each sufficient to initiate silencing [18,19]; however,there are substantial differences between the two speciesin other aspects of X-chromosome inactivation. Signifi-cantly, X inactivation is imprinted in mouse extraem-bryonic tissues [20] but not in humans (reviewed in[21]) and Tsix is very different from TSIX in patterns ofexpression and extent of transcription across the sensestrand [22-24]. Human TSIX has been observed inembryoid bodies and a human embryonal carcinomacell line, but also in chorionic villus cells [22,24]. TSIXis also expressed in mouse ES-10 cells carrying a multi-copy integration of a 480 kb XIST-containing humanYAC transgene [25] and in L1.10.1, a clone of a somaticmale cell line transfected with a human XIST-containingPAC, which contains at least 50 kb of flanking genomicDNA [26]. While these cells did not show identicalinitiation sites for the TSIX transcript, in all cases theTSIX transcript truncated well before the 5’ end ofXIST. As human ES cells have been variable in their Xinactivation status (e.g. [27]), mouse ES cells with ahuman transgene remain one of the best models forhuman X inactivation. Multi-copy integrations of the480-kb transgene containing human XIST display partialX inactivation center function upon in vitro differentia-tion of male mouse embryonic stem cells, including acti-vation in some cells of the endogenous mouse Xist locus[28,29].Given the importance of XIST for X inactivation, it isperhaps surprising that the X inactivation center regionshows little sequence conservation surrounding XISTbetween mouse and human [30,31]. In addition to XIST,the region contains several conserved genes and a num-ber of non-coding RNAs and pseudogenes. Downstreamof Xist the closest gene is the testes-specific Tsx gene inmouse, however TSX is a pseudogene in human [32].The closest gene upstream of XIST is the JPX (alsoknown as ENOX) non-coding RNA gene. Interestingly,the region between JPX and XIST is ~90 kb in human,which is approximately 9 times larger than that ofmouse. Thus rearrangements downstream of XISTwhere the mouse regulatory elements are found mayhave been compensated for by regulatory regionsupstream of the gene. To identify such regulatory ele-ments in the absence of substantial sequence conserva-tion we have used DNase I hypersensitive site mappingas an unbiased approach to identify cis-acting regulatoryelements in humans. Genomic regions hypersensitive toDNase I digestion (DHS sites) have been shown to har-bour cis-regulatory elements critical for gene regulation[33], and both of the mouse Xist regulatory regionsDXPas34 and Xite show DNase I hypersensitivity [12].Here, we report the identification of three previouslyunknown hypersensitive sites surrounding the humanXIST locus.ResultsIdentification of DHS sites 3’ to human XISTThe critical timing for XIST regulation is early in devel-opment and thus for mapping of DHS sites 3’ to humanXIST we used the mouse undifferentiated embryonicstem cell line ES-10 which contains a human XISTtransgene. We also examined the L1.10.1 cell line whichis a somatic male HT1080 cell line transfected with aPAC containing the XIST region, and which expressesXIST as well as TSIX. Additionally, we examinedmouse/human somatic cell hybrids containing either thehuman active (Xa) or inactive (Xi) chromosome, whichprovide a unique opportunity to compare the chromatinstructure between the Xi and Xa independent of eachother without requiring allele-specific detection. Wegenerated three probes downstream of XIST that wereable to detect six overlapping restriction fragmentsallowing the analysis of a 43 kb region (see Figure 1B).Only one DHS site, located approximately 12 - 13 kbdownstream of XIST, was identified in the ES-10 cells.This DHS site does not correspond to the cluster offour TSIX transcription start sites described in thesecells, which are located approximately 14 kb furtherfrom the 3’ end of XIST [25]. The DHS site is close tothe antisense transcription start in L1.10.1 cells. Inter-estingly, however, the DHS site was not found inL1.10.1 (Figure 1B), nor were any others, despite pre-vious detection of antisense transcript both with RT-PCR and FISH in this cell line [24]. We confirmed theongoing presence of antisense transcript in the L1.10.1cells used for DHS mapping by RT-PCR (data notshown). DHS mapping in both Xi and Xa hybrids didnot show the presence of any DHS site downstream ofXIST, including at the region identified to contain aDHS in ES-10 cells (Figure 1B). It thus appears that,unlike the situation in mouse where there are bothdevelopmental-specific and constitutive DHS sitesdownstream of Xist, in humans there is only a singledevelopmental-specific DHS site downstream of XIST.Chang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 3 of 10Identification of DHS sites 5’ to human XISTThe lack of putative regulatory elements 3’ to XIST,where many of the mouse transcriptional regulatorysites are located, led us to examine the region 5’ toXIST which is larger in humans than it is in mouse [30].We generated three probes to examine the regionupstream of human XIST for DHS sites. Almost 80% ofthe just over 90 kb region upstream of XIST is com-prised of repetitive elements, predominantly LINE1(39.5%) and ALU (27.3%) as identified by repeatmasker(http://www.repeatmasker.org/[34]). This high repeatcontent precluded examination of the entire region andthe restriction fragments assessed by the three probesinterrogate a total of 39 kb in the 90 kb region.We again performed Southern analysis with DNA iso-lated after increasing DNase I treatment from cells ofES-10, an Xa-containing, and an Xi-containing somaticcell hybrid (Figure 2). The presence of multiple bandsfor proximal but not distal probes in ES-10 can beexplained by the individual copies of the XIST transgenepresent in the multi-copy integration transgenes notcontaining the same amount of DNA sequence flankingthe XIST locus. We observed one or more DHS site(s)immediately upstream of XIST in ES-10, as well as inthe Xa-containing hybrid where XIST is silenced. Thesesites were observed variably in Xi-containing hybridswhere XIST continues to be expressed (Figure 2). Whileno other hypersensitive sites were detected upstream ofXIST in ES-10, one DHS site was found approximately65 kb upstream of the XIST transcription start on boththe active and inactive X chromosomes in somatichybrids (Figure 2).The location of the -65 DHS site was refined byrepeating the DHS mapping with two other restrictionenzyme digests for the Xa-containing hybrid (Figure3A), thereby refining the location of the site to between73,053,323 and 73,053,866 (hg18). A dot-plot sequencecomparison of human to cow, and human to mousesequences showed that within the region approximately60 kb upstream of XIST there is a region ofFigure 2 DNase I hypersensitivity mapping upstream of XIST. Below the schematic of the XIST region (see legend in Figure 1) are Southernblots of DNA from ES-10, an Xa hybrid, and an Xi hybrid. Small rectangular boxes are probes for Southern blotting of overlapping restrictionfragments (from left to right: PstI (13.1 kb); BsmI (10.3 kb); NdeI (7.2 kb); SapI (6.7 kb); SpeI (6.3 kb); ScaI (3.8 kb)). All experiments were carried outat least twice. One HS site, highlighted by the open arrow, was detected just upstream of the transcriptional start site, within the SpeI fragment,at somewhat variable positions in the three cell lines. Another HS site was found within the BsmI fragment approximately 65 kb upstream of theXIST transcription start in both Xa and Xi hybrids (grey arrow). No other DNase I hypersensitive sites were observed.Chang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 4 of 10approximately 10 kb that is relatively conserved betweenhuman and cow, but not mouse (Figure 3B and 3C).This region is also conserved in dog (data not shown).The novel -65 DHS site identified with both the Xa andXi in somatic hybrids is located within this conservedregion.To determine the biological relevance of this con-served sequence that results in a DHS in somatic cellswe cloned several regions of XIST into the pGL4 seriesof plasmids to assay promoter and enhancer activity bymonitoring luciferase reporter activity after transienttransfection into HT1080 somatic cells (Figure 4). Wecloned three ~700 bp regions of the XIST promoterregion (named -3, -2, -1) as well as a 1,087 bp region atthe -65 DHS site in both orientations. There was a nota-ble orientation bias for regions around the XIST promo-ter, and in fact -3 could not be cloned in oneorientation. As pGL4.10 lacks a minimal promoter,assaying luciferase activity monitors promoter activity;while pGL4.23 contains a minimal promoter and there-fore monitors enhancer activity. In both assays the -65region showed significant activity, when cloned in bothorientations. Thus, like many of the mouse regulatoryregions, the -65 DHS seems to have bi-directional pro-moter and enhancer activity.DiscussionX-chromosome inactivation in both humans and micerequires the presence in cis of the X-inactivation center,and the XIST/Xist gene contained therein. Interestingly,the XIST gene appears to have evolved in eutheriansfrom a protein-coding gene, Lnx3 [31], and while criticalregions such as the 5’ A repeats required for silencingare conserved [19,35], other regions of XIST are morevariable amongst the eutheria [36]. Extensive studies inmouse models have defined a wide variety of regulatoryelements for Xist including Tsix, DXPas34 and Xite.These elements are all located 3’ to Xist, between Xistand the adjacent testes-specific Tsx gene. In humansTSX is a non-expressed pseudogene, and the blocks ofsequence conservation previously reported betweenhumans and mice 3’ to XIST are ancestral TSX exons[31,32]. The human TSIX region lacks an equivalent tothe mouse CpG island that was shown to be essentialfor function of Tsix [13,32,37]. Other significant differ-ences between mouse and human Tsix/TSIX include alower level of human TSIX transcription and termina-tion of human TSIX prior to the XIST promoter [24,32],while antisense transcription across the mouse Xist pro-moter region is necessary for antisense function [38]. Inaddition, Migeon et al. (2002), using RNA FISH for cel-lular localization of transcripts, showed that humanTSIX transcripts are co-expressed with XIST from theinactive X throughout human embryonic development,Figure 3 Localization of the -65 DNase I hypersensitive siteupstream of XIST. A. Using an Xa hybrid to limit background fromcross-hybridization to human material, two additional restrictiondigests were performed on different DNA preparations afterincreasing DNase I treatments to refine the location of the -65 site.The BglII fragment is 9.3 kb and the fragment resulting from HS andrestriction digestion is 5 kb (grey arrow, left panel). The ScaIfragment is 11.8 kb and the fragment resulting from HS andrestriction digestion is 8 kb (grey arrow, right panel). Dot-plotanalyses http://mulan.dcode.org/ showing comparison of sequenceupstream of XIST between cow (38 kb) and human (92 kb) (panel B)and mouse (10 kb) and human (92 kb) (panel C).Chang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 5 of 10suggesting that this antisense is unable to repress XIST[22] leading to the argument that Tsix regulation of Xistmay be specific to mouse [39].Upstream of XIST/Xist the adjacent gene is JPX/ENOX, which is conserved in humans and mice [30],although the distance to the JPX CpG island and firstexon is larger in humans (~90 kb) than in mice (lessthan 10 kb) [30]. JPX is a non-coding RNA gene includ-ing different repetitive elements in different species, andthe promoter of the mouse Jpx gene has been shown tointeract with the Xist promoter in undifferentiated EScells [40]. No sequence conservation between humansand mice is found in the region between Jpx and Xist;however, there is conservation between humans andcows (and also dogs, data not shown), including an exonof the Rasl11c pseudogene [31].The lack of sequence conservation between humanand mouse in the region flanking XIST/Xist, as well asthe differences in the TSIX/Tsix transcript, led us toundertake this study to identify potential regulatory ele-ments for XIST by using DHS mapping both down-stream and upstream of XIST. Downstream of XIST inthe region where most regulatory elements are observedfor mouse Xist we find only a single DHS, and this isonly observed in undifferentiated mouse ES cells con-taining a human XIC transgene. While this site mappedclose to one of the previously described human TSIXtranscription start sites, the presence of the DHS didnot correlate with TSIX transcription, and thus we con-sider it more likely that this DHS is reflective of a devel-opmental event not regulating antisense transcription.As previously reported there is no substantial sequenceconservation between cow, human and mouse down-stream of XIST [24,30], and dog also fails to showhomologous regions (data not shown). In this regiondownstream of XIST the human sequence is enrichedfor LTR class repetitive elements, while mouse and dogare enriched in LINE elements. It has been demon-strated that in addition to a cis-regulatory role in XISTregulation, the mouse Tsix and Xite regulatory elementsare also involved in a trans-regulation involving a transi-tory pairing of homologous X chromosomes proposedto establish the mutually exclusive choice of the futureactive and inactive X chromosomes in females [41]. AsFigure 4 Dual luciferase reporter assays examining promoter and enhancer activities for DNA fragments containing HS site. ThepGL4.10 vector, which contains the promoterless synthetic firefly luc2, was used in the promoter assay (left). The pGL4.23 vector, which containsthe synthetic firefly luc2 driven by a minimal promoter, was used in the enhancer assay (right). The histograms show a summary of the ratio ofluciferase activity (adjusted by dividing the firefly luciferase with the control Renilla luciferase) for each insert (from the HS sites shown in lowerpanel) relative to the luciferase activity for pGL4.10 or pGL4.23. Each fragment was tested in triplicate and experiments were carried out threetimes independently. Error bars represent the standard deviations of three trials. While fragments upstream of the XIST promoter containing HSsites showed background luciferase activity, fragment -65 displayed five fold and seven fold increases in promoter activity and ten fold and sixfold increases in enhancer activity in the XIST and antisense orientation, respectively.Chang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 6 of 10the human XIC transgene in the ES-10 cells studied iscapable of inducing expression of the single Xist gene inthese male ES cells [29], it is plausible that the DHSidentified in the transgene 3’ to XIST is involved in suchtrans-interactions. There is now genome-wide mappingof DNase I hypersensitive sites [42] as well as histonemodifications and CTCF binding sites, which oftenmark promoters and enhancers [43,44] in a number ofcultured cell lines or human CD4+ cells. The genome-wide mapping of CTCF sites in somatic cells did notidentify any enrichment in the region of this 3’ DHS.However, we also did not observe this DHS in somaticcells. Enhancer sequences have been reported to showcell-type specific patterns [45], so this region may con-tain an enhancer specific to undifferentiated cells.We found evidence for DHS sites near the transcrip-tional start site of XIST in both somatic and ES-10 cells.XIST is expressed in the ES-10 cells prior to differentia-tion, however it is not expressed in the Xa-containinghybrid cells, thus these sites are observed independentof XIST expression. We did not refine the localization ofthese sites, as they likely correspond to the minimalXIST promoter and regulatory elements. The minimalmouse promoter has been shown to have a cluster ofDHS sites [46,47]. In agreement with the previouslydefined human minimal promoter [48] we detectedstrong promoter activity in our transient luciferase assayusing 1 kb of DNA surrounding the XIST transcriptionstart site (data not shown). Although a CTCF bindingsite has previously been defined at -43 bp of the XISTpromoter [49], genome-wide mapping in CD4+ T cellsonly identified CTCF binding further upstream [43].This would correspond to our fragment 3 which showedlimited promoter or enhancer activity in the ‘reverse’orientation, but was unable to be cloned in the ‘forward’orientation where it would be aligned with the test pro-moter in the same orientation it is aligned to XIST inthe human genome. Genome-wide mapping of DHSsites identified a DHS site approximately three kbupstream of the promoter, in the vicinity of the CTCFsite, as well as sites further within XIST that our analysiswould not have detected [42]. Thus it appears that thereis a regulatory element for human XIST ~three kbupstream of the XIST promoter which includes CTCFbinding sequences.Further 5’ to XIST we find a DHS site in a regionsharing sequence conservation with cow and dog (datanot shown). A DHS site in this region can also beobserved in the genome-wide mapping in CD4+ T cells,and furthermore genome-wide H3K4me1 enrichment,which is characteristic of enhancers, flanks the site [45].We refined the location of the DHS to between73,053,323 and 73,053,866, while the DHS site identifiedby the global mapping is slightly proximal at73,053,237- 73,053,138. This might reflect subtle discre-pancies in mapping, or between cell types. The regioncloned for subsequent enhancer and promoter activityanalysis was 73,054,787 -73,053,643 and would containthe H3K4me1 marked regions [45] and the majority ofthe region to which our DHS site was mapped, but bejust upstream of the DHS site mapped in CD4+ cells[42].Overall we find fewer regulatory elements in humanthan have been identified in mice. This could be due tohigher repetitive element content in human which madeanalyzing the whole region challenging. Furthermore,the repetitive elements themselves might harbour regu-latory elements. Indeed, the TSIX transcription startsmapped by Migeon et al. were to MER58B, AluY andL2 class repetitive elements [32], and conservation ofrepetitive elements between the mouse Tsix transcrip-tion start and humans was noted by Cohen et al. [15].While acquisition of repetitive elements may have led toan expansion of the XIC region in humans compared tomice, the conservation upstream of XIST betweenhumans and other eutheria, including homology to anexon of the Rasl gene of chicken [31] suggests that thisregion was likely lost in rodents.While many XIST regulatory elements do not appearto be conserved between humans and mice, many of thebasic events required for X-chromosome inactivationmust be conserved (reviewed in [21]). The 3’ DHS sitemight demarcate a developmental-specific regulatoryregion that participates in the trans pairing interactionsinvolved in initiation [17,41]. It has been proposed thata critical function of TSIX is to partition chromatindomains in the XIC [50]. Perhaps the 5’ regulatoryregions we have identified are capable of recapitulatingsuch a function in humans. However we did not observea consistent difference between the active and inactiveX chromosomes for these DHS sites, and genome-widechromatin mapping in somatic cells does not show evi-dence for a chromatin domain ending at the -65 DHS.Ultimately testing whether human X inactivationinvolves regulatory processes related to those detailed inmouse will require the challenging investigation ofhuman XIST expression during early development. Ithas been shown that X chromosome inactivation isinitiated in human preimplantation embryos [51]; how-ever, human ES cells have shown considerable variability(e.g. [27]), making mouse ES cells with human XISTtransgenes one of the best current models to study regu-lation of human XIST.ConclusionsDNase I hypersensitivity mapping around the humanXIST gene has identified fewer candidate regulatoryregions than are observed flanking mouse Xist. InChang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 7 of 10particular, 3’ to XIST only a single, developmental-speci-fic DHS site was observed in undifferentiated mouse EScells with an integration of the human XIST domain. 5’to XIST a DHS site was identified in a region ofsequence conservation amongst non-rodent eutheria.This region showed bi-directional promoter and enhan-cer activity. The lack of conservation of regulatory ele-ments for XIST lends support to previous conjecturesthat human TSIX is no longer a functional regulator ofXIST.MethodsTissue Culture & Cell LinesES-10 cells, a derivative of J1 male mouse embryonicstem cells with a 480-kb human XIC transgene, weregenerously provided by Dr. B. Migeon and maintainedas described [22]. The L1.10.1 transgenic derivative ofhuman male fibrosarcoma cell line HT-1080 was grownas described [19]. Mouse-human somatic cell hybridst11-4Aaz5 (containing a human Xi as well as six humanautosomes in addition to mouse chromosomes) and t60-12 (containing a human Xa) were maintained asdescribed [52].DNase I Hypersensitivity MappingThe preparation of nuclei and the DNase I digest wereas described [53]. Briefly, cells were harvested andwashed twice in ice-cold PBS, then resuspended at 1 ×107 cells/ml in 10 ml ice-cold sucrose-triton, swelled onice for 15 minutes, and then homogenized 10 times in aDounce homogenizer with a B pestle (7 ml, Wheaton).Homogenized cells were transferred to a 15-ml falcontube and spun at 1,200 rpm for 15 min at 4°C torecover nuclei which were then resuspended in 1.5 mlof ice cold buffer (50 mM Tris-Cl pH7.9, 100 mMNaCl, 3 mM MgCl2, 1 mM dithiothreitol, 0.2 mM phe-nymethylsulfonyl fluoride) and aliquoted into seven 1.5ml eppendorf tubes (200 μl each). Nuclei were digestedwith an increasing amount of DNase I (10 U/μl, RNasefree, Roche) (i.e. 1/128, 1/64, 1/32, 1/16, 1/8, 1/4 U/μl)at 37°C for 20 minutes. The digestions were stoppedand DNA extracted by adding 1 ml DNazol (Invitrogen)following the manufacturer’s protocol. DNase I treatedDNA was digested with restriction enzymes accordingto the manufacturer’s recommendations and analyzed bySouthern blotting with random-primed P32-labelledprobes generated by PCR with primers listed in Table 1[53]. All analyses were repeated at least twice. As thecell lines contain variable proportions of the humangenome they showed differences in cross-hybridization.In order to be identified as a DHS site a band could notbe visible in the undigested lane and needed to bereplicated.Sequence Comparisons, Plasmid Construction andLuciferase AssayFor the dot-plot analyses, we used Mulan (http://mulan.dcode.org/[54]). Five DNA fragments of interest weregenerated by PCR amplification of human genomicDNA from GM01416 for 35 cycles using primers listedin Table 2. PCR fragments were first cloned intopGEM®-T Easy vector (Promega) via TA cloning priorTable 1 Primers for probe generationSymbol Size Name Sequence (5’ to 3’)36 921 bp IP368F CTTGCTCACCAATTGACTCGTAAGIP359R GAGGACGTGTCAAGAAGACACTAGG45 874 bp IP453F CATGGGAAAGCAGCAGACTTCTIP444R GGGCCTGAATGTGAGCATAGAT101 1190 bp IP1011F GAATAGCTCAACTGCCAGTGTTACTIP1000R GGTCCTCAATGTCCTTTACAAAGC86 1041 bp U862F TGGAGTCCAGTCGTTGTGCTU873R ATAATCTTGCTACTGAAGGGGCT105 1209 bp U1056F TGCTTGAAGGGTTTACTGCTGTCU1068R CTATACAATGCTCCTGTGATTCTAGTGC117 1140 bp U1179F CTTCTGCACTCTGCTAAAGTTCTGACU1190R TCTGTGACTTGGCAAGCCTTCTable 2 Primers for cloningFragment Content Name Sequence (5’ to 3’)XIST promoter, positive control 0 F TCGAGCTCCTTGCTCACCAATTGACTCGTAAG0 R CGGGTACCGAGGACGTGTCAAGAAGACACTAGG1 kb upstream of XIST promoter -1 kb F TCGAGCTCCATTTCCACACTTGTAGAAACTTCTAGTAG-1 kb R CGGGTACCCTTACGAGTCAATTGGTGAGCAAG2 kb upstream of XIST promoter -2 kb F TCGAGCTCGAGCCAAGCAGTAGTGAAGGTGA-2 kb R CGGGTACCGGTTGTCCTGGGTTTCTGTGA3 kb upstream of XIST promoter -3 kb F TCGAGCTCCCCCGTGTTCTCTTTTGATAAACTAG-3 kb R CGGGTACCTCACCTTCACTACTGCTTGGCTC65 kb upstream of XIST, covers HS 101 -65 kb F TCGAGCTCGTGGAGTACCCTTTCTATCACAACT-65 kb R CGGGTACCTGGCTTGACTTCTAGGGTAAAGA* underlined is genomic sequence from NCBI; not underlined is adaptor (i.e. SacI &KpnI sites)Chang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 8 of 10to insertion into pGL4.10 and pGL4.23 reporter vectors(Promega) upstream of the firefly luciferase gene. Theidentities of pGL4 clones were confirmed by restrictionenzyme digestion and partial sequence analysis. Transi-ent transfection was performed in 24-well plates with80% confluent HT1080 cells. 0.8 μg of firefly luciferaseplasmid (pGL4, Promega) and 80 ng of the Renilla luci-ferase plasmid (Promega) were co-transfected into cellsusing 2 μl Lipofectamine™ 2000 (Invitrogen). For eachtransfection assay, the pGL4.13 vector, which contains apromoter/enhancer element, was used as positive con-trol and the pGL4.10 vector, which contains neitherpromoter nor enhancer, was used as negative control.Transfection of the pGL4.23 vector with a basal promo-ter also served as a control. After 24 h, cell lysates wereprepared from each transfected culture and were ana-lyzed in a 96-well plate luminometer (Perkin ElmerWallace) according to manufacturer’s protocol in theDual Luciferase Kit (Promega). Each fragment wastested in triplicate, and each experiment was repeated atleast three times. To control for transfection efficiency,the ratio of firefly luciferase signal to Renilla luciferasesignal was calculated for each transfected sample.AcknowledgementsFunding for this study was provided by Canadian Institute of HealthResearch Operating Grant MOP-13690. The ES-10 cells were generouslyprovided by Dr. B. Migeon. The authors would like to thank Drs. Hugh Brockand Dixie Mager for helpful suggestions and Jakub Minks and othermembers of the Brown laboratory for advice and critical review of themanuscript.Authors’ contributionsSC carried out the molecular studies and drafted the manuscript. CBparticipated in the design of the study and revised the manuscript. Bothauthors read and approved the final manuscript.Received: 28 October 2009Accepted: 8 March 2010 Published: 8 March 2010References1. Russell LB: Mammalian X-chromosome action: inactivation limited inspread and in region of origin. Science 1963, 140:976-978.2. Brown CJ, Ballabio A, Rupert JL, Lafreniere RG, Grompe M, Tonlorenzi R,Willard HF: A gene from the region of the human X inactivation centre isexpressed exclusively from the inactive X chromosome. Nature 1991,349:38-44.3. Brockdorff N, Ashworth A, Kay GF, McCabe VM, Norris DP, Cooper PJ,Swift S, Rastan S: The product of the mouse Xist gene is a 15 kb inactiveX-specific transcript containing no conserved ORF and located in thenucleus. Cell 1992, 71:515-526.4. Brown CJ, Hendrich BD, Rupert JL, Lafreniere RG, Xing Y, Lawrence J,Willard HF: The human XIST gene: analysis of a 17 kb inactive X-specificRNA that contains conserved repeats and is highly localized within thenucleus. Cell 1992, 71:527-542.5. Penny GD, Kay GF, Sheardown SA, Rastan S, Brockdorff N: Requirement forXist in X chromosome inactivation. Nature 1996, 379:131-137.6. Marahrens Y, Panning B, Dausman J, Strauss W, Jaenisch R: Xist-deficientmice are defective in dosage compensation but not spermatogenesis.Genes & Dev 1997, 11:156-166.7. Lee JT, Strauss WM, Dausman JA, Jaenisch R: A 450 kb transgene displaysproperties of the mammalian X-inactivation center. Cell 1996, 86:83-94.8. Rastan S, Robertson EJ: X-chromosome deletions in embryo-derived (EK)cell lines associated with lack of X-chromosome inactivation. J EmbryolExp Morph 1985, 90:379-388.9. Lee JT, Davidow LS, Warshawsky D: Tsix, a gene antisense to Xist at the X-inactivation center. Nat Genet 1999, 21:400-404.10. Ogawa Y, Lee JT: Xite, X-inactivation intergenic transcription elementsthat regulate the probability of choice. Mol Cell 2003, 11:731-743.11. Mise N, Goto Y, Nakajima N, Takagi N: Molecular cloning of antisensetranscripts of the mouse Xist gene. Biochem Biophys Res Comm 1999,258:537-541.12. Stavropoulos N, Lu N, Lee JT: A functional role for Tsix transcription inblocking Xist RNA accumulation but not in X-chromosome choice. ProcNatl Acad Sci USA 2001, 98:10232-10237.13. Lee JT, Lu N: Targeted mutagenesis of Tsix leads to nonrandom Xinactivation. Cell 1999, 99:47-57.14. Debrand E, Chureau C, Arnaud D, Avner P, Heard E: Functional analysis ofthe DXPas34 locus, a 3’ regulator of Xist expression. Mol Cell Biol 1999,19:8513-8525.15. Cohen DE, Davidow LS, Erwin JA, Xu N, Warshawsky D, Lee JT: TheDXPas34 repeat regulates random and imprinted X inactivation. Dev Cell2007, 12:57-71.16. Xu N, Donohoe ME, Silva SS, Lee JT: Evidence that homologous X-chromosome pairing requires transcription and Ctcf protein. Nat Genet2007, 39:1390-1396.17. Bacher CP, Guggiari M, Brors B, Augui S, Clerc P, Avner P, Eils R, Heard E:Transient colocalization of X-inactivation centres accompanies theinitiation of X inactivation. Nat Cell Biol 2006, 8:293-299.18. Wutz A, Jaenisch R: A shift from reversible to irreversible X inactivation istriggered during ES cell differentiation. Mol Cell 2000, 5:695-705.19. Chow JC, Hall LL, Baldry SE, Thorogood NP, Lawrence JB, Brown CJ:Inducible XIST-dependent X-chromosome inactivation in human somaticcells is reversible. Proc Natl Acad Sci USA 2007, 104:10104-10109.20. Takagi N, Sasaki M: Preferential inactivation of the paternally derived Xchromosome in the extraembryonic membranes of the mouse. Nature1975, 256:640-642.21. Migeon BR: X chromosome inactivation: theme and variations. CytogenetGenome Res 2002, 99:8-16.22. Migeon BR, Lee CH, Chowdury AK, Carpenter H: Species differences inTSIX/Tsix reveal the roles of these genes in X-chromosome inactivation.Am J Hum Genet 2002, 71:286-293.23. Shibata S, Lee JT: Characterization and quantitation of differential Tsixtranscripts: implications for Tsix function. Hum Mol Genet 2003,12:125-136.24. Chow JC, Hall LL, Clemson CM, Lawrence JB, Brown CJ: Characterization ofexpression at the human XIST locus in somatic, embryonal carcinoma,and transgenic cell lines. Genomics 2003, 82:309-322.25. Migeon BR, Winter H, Kazi E, Chowdhury AK, Hughes A, Haisley-Royster C,Morrison H, Jeppesen P: Low-copy-number human transgene isrecognized as an X inactivation center in mouse ES cells, but fails toinduce cis-inactivation in chimeric mice. Genomics 2001, 71:156-162.26. Chow JC, Hall LL, Lawrence JB, Brown CJ: Ectopic XIST transcripts inhuman somatic cells show variable expression and localization.Cytogenet Genome Res 2002, 99:92-98.27. Hall LL, Byron M, Butler J, Becker KA, Nelson A, Amit M, Itskovitz-Eldor J,Stein J, Stein G, Ware C, Lawrence JB: X-inactivation reveals epigeneticanomalies in most hESC but identifies sublines that initiate as expected.J Cell Physiol 2008, 216:445-452.28. Heard E, Mongelard F, Arnaud D, Chureau C, Vourc’h C, Avner P: HumanXIST yeast artificial chromosome transgenes show partial X inactivationcenter function in mouse embryonic stem cells. Proc Natl Acad Sci USA1999, 96:6841-6846.29. Migeon BR, Kazi E, Haisley-Royster C, Hu J, Reeves R, Call L, Lawler A,Moore CS, Morrison H, Jeppesen P: Human X inactivation center inducesrandom X chromosome inactivation in male transgenic mice. Genomics1999, 59:113-121.30. Chureau C, Prissette M, Bourdet A, Barbe V, Cattolico L, Jones L, Eggen A,Avner P, Duret L: Comparative sequence analysis of the X-inactivationChang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 9 of 10center region in mouse, human and bovine. Genome Res 2002,12:894-908.31. Duret L, Chureau C, Samain S, Weissenbach J, Avner P: The Xist RNA geneevolved in eutherians by pseudogenization of a protein-coding gene.Science 2006, 312:1653-1655.32. Migeon BR, Chowdury AK, Dunston JA, McIntosh I: Identification of TSIX,encoding an RNA antisense to human XIST, reveals differences from itsmurine counterpart: implications for X inactivation. Am J Hum Genet2001, 69:951-960.33. Elgin SCR: DNAase I-hypersensitive sites of chromatin. Cell 1981,27:413-415.34. RepeatMasker Open-3.0. http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker.35. Wutz A, Rasmussen TP, Jaenisch R: Chromosomal silencing andlocalization are mediated by different domains of Xist RNA. Nat Genet2002, 30:167-174.36. Yen ZC, Meyer IM, Karalic S, Brown CJ: A cross-species comparison of X-chromosome inactivation in Eutheria. Genomics 2007, 90:453-463.37. Lee JT: Homozygous Tsix mutant mice reveal a sex-ratio distortion andrevert to random X-inactivation. Nat Genet 2002, 32:195-200.38. Ohhata T, Hoki Y, Sasaki H, Sado T: Crucial role of antisense transcriptionacross the Xist promoter in Tsix-mediated Xist chromatin modification.Development 2008, 135:227-235.39. Migeon BR: Is Tsix repression of Xist specific to mouse?. Nat Genet 2003,33:337.40. Tsai CL, Rowntree RK, Cohen DE, Lee JT: Higher order chromatin structureat the X-inactivation center via looping DNA. Dev Biol 2008, 319:416-425.41. Xu N, Tsai CL, Lee JT: Transient homologous chromosome pairing marksthe onset of X inactivation. Science 2006, 311:1149-1152.42. Boyle AP, Davis S, Shulha HP, Meltzer P, Margulies EH, Weng Z, Furey TS,Crawford GE: High-resolution mapping and characterization of openchromatin across the genome. Cell 2008, 132:311-322.43. Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, Wei G,Chepelev I, Zhao K: High-resolution profiling of histone methylations inthe human genome. Cell 2007, 129:823-837.44. Heintzman ND, Stuart RK, Hon G, Fu Y, Ching CW, Hawkins RD, Barrera LO,Van Calcar S, Qu C, Ching KA, et al: Distinct and predictive chromatinsignatures of transcriptional promoters and enhancers in the humangenome. Nat Genet 2007, 39:311-318.45. Heintzman ND, Hon GC, Hawkins RD, Kheradpour P, Stark A, Harp LF, Ye Z,Lee LK, Stuart RK, Ching CW, et al: Histone modifications at humanenhancers reflect global cell-type-specific gene expression. Nature 2009,459:108-112.46. Sheardown SA, Newall AET, Norris DP, Rastan S, Brockdorff N: Regulatoryelements in the minimal promoter region of the mouse Xist gene. Gene1997, 203:159-168.47. Newall AE, Duthie S, Formstone E, Nesterova T, Alexiou M, Johnston C,Caparros ML, Brockdorff N: Primary non-random X inactivation associatedwith disruption of Xist promoter regulation. Hum Mol Genet 2001,10:581-589.48. Hendrich BD, Plenge RM, Willard HF: Identification and characterization ofthe human XIST gene promoter: implications for models of Xchromosome inactivation. Nucl Acids Res 1997, 25:2661-2671.49. Pugacheva EM, Tiwari VK, Abdullaev Z, Vostrov AA, Flanagan PT,Quitschke WW, Loukinov DI, Ohlsson R, Lobanenkov VV: Familial cases ofpoint mutations in the XIST promoter reveal a correlation between CTCFbinding and pre-emptive choices of X chromosome inactivation. HumMol Genet 2005, 14:953-965.50. Navarro P, Chantalat S, Foglio M, Chureau C, Vigneau S, Clerc P, Avner P,Rougeulle C: A role for non-coding Tsix transcription in partitioningchromatin domains within the mouse X-inactivation centre. EpigeneticsChromatin 2009, 2:8.51. Berg van den IM, Laven JS, Stevens M, Jonkers I, Galjaard RJ, Gribnau J, vanDoorninck JH: X chromosome inactivation is initiated in humanpreimplantation embryos. Am J Hum Genet 2009, 84:771-779.52. Brown CJ, Powers VE, Monroe DM, Sheinin R, Willard HF: A gene on theshort arm of the human X chromosome complements the murinetsA1S9 DNA synthesis mutation. Som Cell Mol Genet 1989, 15:173-178.53. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A laboratorymanual. Cold Spring Harbor: Cold Spring Harbor Laboratory 1989, 2.54. Ovcharenko I, Loots GG, Giardine BM, Hou M, Ma J, Hardison RC, Stubbs L,Miller W: Mulan: multiple-sequence local alignment and visualization forstudying function and evolution. Genome Res 2005, 15:184-194.55. Stavropoulos N, Rowntree RK, Lee JT: Identification of developmentallyspecific enhancers for Tsix in the regulation of X chromosomeinactivation. Mol Cell Biol 2005, 25:2757-2769.doi:10.1186/1471-2199-11-20Cite this article as: Chang and Brown: Identification of regulatoryelements flanking human XIST reveals species differences. BMCMolecular Biology 2010 11:20.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitChang and Brown BMC Molecular Biology 2010, 11:20http://www.biomedcentral.com/1471-2199/11/20Page 10 of 10

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0223080/manifest

Comment

Related Items