UBC Faculty Research and Publications

Apoptosis of viral-infected airway epithelial cells limit viral production and is altered by corticosteroid… Singhera, Gurpreet K; Chan, Tiffany S; Cheng, Jenny Y; Vitalis, Timothy Z; Hamann, Kimm J; Dorscheid, Delbert R May 18, 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


52383-12931_2005_Article_469.pdf [ 1.78MB ]
JSON: 52383-1.0221478.json
JSON-LD: 52383-1.0221478-ld.json
RDF/XML (Pretty): 52383-1.0221478-rdf.xml
RDF/JSON: 52383-1.0221478-rdf.json
Turtle: 52383-1.0221478-turtle.txt
N-Triples: 52383-1.0221478-rdf-ntriples.txt
Original Record: 52383-1.0221478-source.json
Full Text

Full Text

ralssBioMed CentRespiratory ResearchOpen AcceResearchApoptosis of viral-infected airway epithelial cells limit viral production and is altered by corticosteroid exposureGurpreet K Singhera1, Tiffany S Chan1, Jenny Y Cheng1, Timothy Z Vitalis2, Kimm J Hamann3 and Delbert R Dorscheid*1Address: 1The James Hogg iCAPTURE Centre for Cardiovascular and Pulmonary Research/ Critical Care Group, St. Paul's Hospital, University of British Columbia, Vancouver, British Columbia, V6Z-1Y6, Canada, 2Michael Smith Laboratories, 2185 East Mall, Vancouver, BC, V6T 1Z4, Canada and 3Section of Pulmonary and Critical Care Medicine, University of Chicago, Chicago, IL, Zip Code 60637, USAEmail: Gurpreet K Singhera - Gsinghera@mrl.ubc.ca; Tiffany S Chan - tc@interchange.ubc.ca; Jenny Y Cheng - jyc@interchange.ubc.ca; Timothy Z Vitalis - Tvitalis@interchange.ubc.ca; Kimm J Hamann - khamann@medicine.bsd.uchicago.edu; Delbert R Dorscheid* - Ddorscheid@mrl.ubc.ca* Corresponding author    AbstractBackground: Effects of respiratory viral infection on airway epithelium include airway hyper-responsiveness andinflammation. Both features may contribute to the development of asthma. Excessive damage and loss of epithelialcells are characteristic in asthma and may result from viral infection.Objective: To investigate apoptosis in Adenoviral-infected Guinea pigs and determine the role of death receptorand ligand expression in the airway epithelial response to limit viral infection.Methods: Animal models included both an Acute and a Chronic Adeno-infection with ovalbumin-induced airwayinflammation with/without corticosteroid treatment. Isolated airway epithelial cells were cultured to study viralproduction after infection under similar conditions. Immunohistochemistry, western blots and viral DNAdetection were used to assess apoptosis, death receptor and TRAIL expression and viral release.Results: In vivo and in vitro Adeno-infection demonstrated different apoptotic and death receptors (DR) 4 and 5expression in response to corticosteroid exposure. In the Acute Adeno-infection model, apoptosis and DR4/5expression was coordinated and were time-dependent. However, in vitro Acute viral infection in the presence ofcorticosteroids demonstrated delayed apoptosis and prolonged viral particle production. This reduction inapoptosis in Adeno-infected epithelial cells by corticosteroids exposure induced a prolonged virus production viaboth DR4 and TRAIL protein suppression. In the Chronic model where animals were ovalbumin-sensitized/challenged and were treated with corticosteroids, apoptosis was reduced relative to adenovirus-infected orcorticosteroid alone.Conclusion: Our data suggests that apoptosis of infected cells limits viral production and may be mediated byDR4/5 and TRAIL expression. In the Acute model of Adeno-infection, corticosteroid exposure may prolong viralparticle production by altering this apoptotic response of the infected cells. This results from decreased DR4 andTRAIL expression. In the Chronic model treated with corticosteroids, a similar decreased apoptosis wasobserved. This data suggests that DR and TRAIL modulation by corticosteroids may be important in viral infectionof airway epithelium. The prolonged virus release in the setting of corticosteroids may result from reducedPublished: 18 May 2006Respiratory Research 2006, 7:78 doi:10.1186/1465-9921-7-78Received: 06 October 2005Accepted: 18 May 2006This article is available from: http://respiratory-research.com/content/7/1/78© 2006 Singhera et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 13(page number not for citation purposes)apoptosis and suppressed DR4/TRAIL expression by the infected cells.Respiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78BackgroundViral respiratory tract infections have been implicated inseveral ways with the pathogenesis of asthma. Theseinclude the initial onset of asthma, particularly in the con-text of post-bronchiolitis wheezing and asthma after hos-pitalization for respiratory syncytcial virus (RSV) [1] andin asthma chronicity and steroid resistance in Ad5 infec-tions [2]. Ad5 infections are epidemiologically important,and are estimated to cause ~5–10% of childhood respira-tory infections [3]. Despite well-established epidemiolog-ical associations between infections by viruses and thedevelopment of asthma, the mechanisms by which thesepathogens contribute to the etiology of asthma are poorlyunderstood.Apoptosis(programmed cell death) is a common cellularresponse to virus infection [4]. Cell culture studies haveestablished that many common respiratory viruses caninduce apoptosis in epithelial cells [5,6]. Recent work hasdemonstrated that viral infections can activate the tumournecrosis factor (TNF)-related apoptosis-inducing ligand(TRAIL) pathway, which leads to the selective apoptosis ofvirus-infected cells [7]. TRAIL is the ligand for members ofthe TNF-α death receptor (DR) family that includes mole-cules such as DR4 and DR5 [8]. Presently there are limiteddata available about the expression of TRAIL and DR innormal or viral infected airway tissues. These studies wereundertaken to examine the role of Ad5 infection onexpression and function of TRAIL receptors DR4 and DR5.The first objective of this study was to determine the base-line and viral-induced expression of DR4/DR5 in Ad5infected Guinea pig lungs and to correlate this expressionto apoptosis of the infected airway epithelial cells (AEC).In some situations apoptosis can contribute to pathogen-esis, but more typically it is an important factor in the hostdefence mechanism which hastens the death of infectedcells to limit the replication and spread of virus [8]. Inhealthy tissues, apoptosis is highly regulated to maintaintissue integrity, function, and turnover of cells; therefore itis generally viewed as being an anti-inflammatory process.The role for apoptosis in the setting of viral infections con-sequently may be a mechanism to limit the extent of infec-tion, including inflammation.Our next objective was to determine whether DR4/DR5expression and apoptosis of infected epithelial cells has arole in viral infections by Guinea pig airway epitheliumand how this may be altered by corticosteroid exposure.This objective was based on reports regarding the rate ofviral detection as higher in asthmatic children than non-asthmatics, symptomatic or not, suggesting a possible sus-ceptibility to longer viral infections particularly in cases ofmodels of airway inflammation and viral infection of air-way epithelial cells. Our data suggest a role for DR in lim-iting Acute virus infection through apoptosis of infectedcells. Modulation of DR and its ligand TRAIL expression iseffected by corticosteroids exposure and may be impli-cated as a potential mechanism of viral persistence in theairway epithelium. Steroid treatment prolonged virusrelease from airway epithelial cells coordinate with thereduced DR4 and TRAIL expression and altered the apop-tosis of infected airway cells. Dysregulation of this apop-totic process may contribute to airway remodeling.MethodsAnimalsFemale Guinea pigs Cavia porcellus (Cam Hartley strain),weighing 250–300 g (Charles River, ON, Canada) werehoused in polycarbonate cages fitted with high efficiencyparticulate air filter covers. The animals were providedcare as approved by the University of British ColumbiaAnimal Care Committee, following published guidelinesof the Canadian Council on Animal Care.Adenoviral infectionAcute modelGuinea pigs were anesthetized with 4% halothane bal-anced with oxygen and were either adeno virus (Ad5)infected via intranasal instillation or sham treated as pre-viously described [12]. For the Acute model (Figure 1),animals were sacrificed at 1, 3, 4 and 7 days post-infection(dPi).Chronic model: allergen-induced lung inflammation and Ad5 infectionFor the Chronic model (Figure 1), three weeks after Ad5infection, half of Ad5-infected and Sham-treated animalswere sensitized with ovalbumin (OVA) by exposure for 10minutes to an aerosol spray of 1% OVA with 4% (vol/vol)heat-killed pertussis vaccine in normal saline solution fol-lowed by challenge consisted of delivering an aerosolspray of 0.5% OVA (wt/vol) solution over a 5-minuteperiod. The remaining Sham animals were sensitized tonormal saline containing 4% heat-killed pertussis vaccineand served as control animals for allergen sensitizationand challenged with normal saline solution. Diphenhy-dramine (0.2 ml of 40 mg/ml in normal saline solution)was administered intraperitoneally 1 h before each OVAchallenge to prevent anaphylactic shock. One group ofAd5 infected/OVA sensitized/challenged animals wereinjected with Budesonide (Bud) (20 mg/kg) intra-perito-neal on 12 occasions over 16 days starting 24 hours beforethe first allergen challenge. Three hours after the last OVAchallenge or saline exposure, Guinea pigs were sacrificedwith sodium pentobarbitol administered intra-perito-neally. Lungs from the each treatment group were thenPage 2 of 13(page number not for citation purposes)steroid resistance [9-11]. The present study was designedto determine the role of apoptosis and DR expression inprocessed. Final groups included Sham control, Ad5, Bud,Respiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78OVA, OVA+ Bud, OVA+ Bud+ Ad5 groups in the Chronicmodel.Tissue preparation and immunohistochemistryThe right lung was separated from the main stem bron-chus, weighed and then inflated with 50% Optimal Cut-ting Temperature compound (Tissue Tek, Miles Inc) inPBS (pH 7.4). The inflated right lung lobe was cut into 3blocks in the transverse plane, fixed in buffered 10% for-malin and processed into paraffin. Immunohistochemical(IHC) studies of paraffin-embedded formalin-fixed tissuesections followed standard protocol of antigen retrievalwith autoclaving in 1X Citra buffer (BioGenex, CA) orTrypsin digestion and blocking with Universal blockingsolution from DAKO (ON, Canada). Polyclonal rabbitanti-DR4 and -DR5 antibodies (Cell Sciences Inc, MA)and rabbit anti- PARP p85 fragment antibody (Promega,MA) were used along with normal Rabbit IgG as negativecontrol to measure receptor expression and apoptosisrespectively. p85-PARP antibody is specific for the p85fragment of PARP generated by caspase cleavage and pro-vides a reliable measure of in situ apoptosis [13]. Antibodybinding was detected using avidin-biotin complexmethod with naphthol AS-BI and New fuchsin as sub-strate as per DAKO cytomation protocol. A semi-quantita-sity by scoring from scale of 0–4 (0- being no staining, and4- being maximum staining) depending on stainingintensity in circular, medium sized airways. For p85-PARP, the total number of positive cells in a minimum of3 airways, scored by three independent observers, weredetermined and scored as a percentage. The mean scorefrom 4 sections for each treatment was used to assign thefinal score for the staining of all antibodies on all the sec-tions.Immunohistochemistry for E1A staining of Adeno-infected guinea pig lung tissueImmunohistochemical studies of formalin-fixed paraffinembedded tissue sections followed standard protocol ofantigen retrieval with autoclaving in 6M Urea and block-ing with Universal blocking solution from DAKO (ON,Canada). Anti-adenovirus E1A mouse monoclonal anti-body (Calbiochem) was used along with normal mouseIgG as negative control to detect E1A protein. Antibodybinding was detected using APPAP method (DAKO) withnaphthol AS-BI and New fuchsin as substrate as perDAKO cytomation protocol without any counterstaining.Guinea Pig Tracheal Epithelial Cell (GPTEC) isolationMid-cervical tracheas were dissected under sterile condi-Study design for Ad5 infection and allergic inflammation in Cam Hartley Guinea pigsFigure 1Study design for Ad5 infection and allergic inflammation in Cam Hartley Guinea pigs Animal model as modified from [12]. Animals were Ad5 infected or sham treated. In Acute model animals were sacrificed at d1–d7 post-infection. Other Ad5 infected or Sham treated animals were supported for 3 weeks post-infection (Chronic model). These Guinea pigs were then sensitized with OVA by aerosol administration at day 0 () followed by aerosol challenges as indicated (*). Steroids were given to a subset of these Guinea pigs at the indicated days (•) to permit resolution of the OVA-induced inflammation*** ******** *Sacrifice d1- d7 (Acute Model)Adenovirus or Sham infectionOVA or Saline sensitization3 weeks day 0 7 14 21• • • ••Sacrifice (Chronic Model)Figure 1♦Page 3 of 13(page number not for citation purposes)tive scoring method was used by three independentblinded observers to record DR4 and DR5 staining inten-tions, and placed into 0.1% protease solution (type 25from Bacillus polymyxia Sigma-Aldrich ON, Canada) inRespiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78HBSS for two hrs at 37°C[14]. Tracheal segments werethen transferred to plates containing Ham's F12 medium(Sigma-Aldrich, ON) with 5% FCS. Epithelial cells weredislodged using a micro-spatula, triturated through asmall-bore pipette tip and centrifuged at 850 × g for 11min, then washed twice and GPTEC were maintained andepithelial cell origin was confirmed as per protocol [15].At 90–100% confluency cultured GPTEC were infectedwith Ad5 at the multiplicity of infection of 10 (MOI 10).Uninfected GPTEC served as a Sham control. Conditionedmedia was collected daily to analyze the released viral par-ticle production and fresh media was added.Western blotsWestern blots were done as previously described [16].Membranes were probed for DR4, TRAIL and PARP pro-teins using polyclonal anti-DR4 antibody (BD Pharmin-gen), polyclonal anti-TRAIL antibody (eBiosciences) andmonoclonal anti -PARP antibody (BioMol Research labs)respectively. Membranes were reprobed with an antibodyfor β-actin (Sigma) when appropriate to control for equalprotein loading. Densitometry was performed to quanti-tate expression.Picogreen assay for nucleic acid quantitaion to determine viral particle numberThe amount of Ad5 released into the conditioned mediawas determined by the quantity of detected viral DNA[17] using Picogreen (Invitrogen Canada, ON) as per kitinstructions. The viral DNA concentration was convertedto viral particles/ml (VP/ml) using the equation: VP/ml=DNA conc. (ng/ml) X (2.6 × 108 VP/ml/10.3 ng/ml).Adenoviral PCRPCR was performed on the conditioned media collectedfrom the Ad5 infected GPTEC to confirm the detectedDNA was viral in origin. Primers were specific for Ad5virus [F-primer: 5' – GCCGCGTGGTTTACATGCACATC 3'and R-primer: 5' – CAGCACGCCGCGGATGTCAAA GT3'][18].Statistical analysisValues are presented as means ± SE. The significance ofdifferences between means was assessed by Mann-Whit-ney test with the level of significance set at p ≤ 0.05 tocompare the unpaired populations where sample size issmall and therefore Gaussian distribution cannot beassumed. All statistical analyses were performed usingPrism 3 software.ResultsGuinea pig model of ovalbumin (OVA)-induced inflammation and corticosteroid treatment in 6-weeks Ad5 infected Guinea pigsAnimals were created per model described in the Methodsand used by others [12]. The model of OVA-inducedinflammation generates changes in the airway compatibleto inflammatory diseases such as asthma.Hematoxylin and eosin (H&E) stained Guinea pig lungtissue sections demonstrated histological changes coordi-nate with the various treatment groups (Figure 2). Shamtreated control lung sections demonstrated normal histol-ogy (panel A). All shams (either single or in combination)demonstrated no histological changes. Similarly there wasno change in DR expression; hence only one ''representa-tive'' sham is shown. Adeno-viral infection generated aneosinophilic infiltration and inflammation in the Acutemodel (panel B). In the Chronic model of infection dam-age in the alveolar parenchyma was noted along withmore extensive inflammation (panel C). Bud treatmentyielded Guinea pig lung sections with near normal histol-ogy and no significant inflammation (panel D), whereasinflammation and smooth muscle hypertrophy wasobserved in the OVA-sensitized/challenged lung sections(panel E). OVA+Bud treated Guinea pig lung section hadlittle eosinophilic infiltration, and no smooth musclehypertrophy compared to OVA alone group (panel F). Thecombination of Ad5+OVA+Bud in the Guinea pig lungdemonstrated damage in the alveolar parenchyma,inflammation and smooth muscle hypertrophy (panelG). Viral persistence in terms of E1A protein expressionwas detected in the Chronic model of Guinea pig airwayepithelial cells as indicated by pink staining of the nuclei(panel H) compared to no stain for the isotype control(panel I). Arrows indicated positive staining for E1A pro-tein in the airways.Apoptosis and DR4/DR5 expression in acute model of adenoviral infectionBoth DR4 and DR5 were expressed in the airway epithe-lium of Guinea pigs after viral infection and OVA sensiti-zation and challenge as demonstrated by representativeimages of DR4, DR5 and p85-PARP immunohistochemi-cal staining (Figure 3). Apoptosis and death receptorexpression were observed as a result of Acute Ad5 infec-tion of the airway epithelium. For this model lung tissueswere collected up to 7 days after the initial Ad5 infectionand assessed for p85-PARP staining as a marker of apop-tosis. Positive staining for the p85 fragment (Figure 4A)increased from 1 day post-infection (dPi) (3.7% ± 2.4%)to 4 dPi (8.3% ± 2.6%) and reduced by 7 dPi (3.2% ±1.1%). There was a significant increase (* p < 0.05) inPage 4 of 13(page number not for citation purposes)apoptosis for 1 dPi, 3 dPi and 4 dPi samples compared touninfected Sham control. After its peak expression at 4Respiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78dPi, apoptosis decreased significantly by 7 dPi († p < 0.05)compared to 4 dPi and this 7 dPi apoptosis was not signif-Both DR4 and DR5 were detected in the Acute infection.No DR4 expression was detected at baseline in the ShamHematoxylin and eosin-stained representative lung sections from the Guinea pig modelsFigure 2Hematoxylin and eosin-stained representative lung sections from the Guinea pig models. Guinea pig lungs sec-tions from sham control (A); lung section after 7 days post-Ad5 infection (Acute model) (B); and after 6 weeks post-Ad5 infec-tion (Chronic model) (C). Arrow indicate regions of inflammation and eosinophilic infiltration, also noted in the Chronic model is the damage to the alveolar parenchyma as indicated by *. Guinea pig airways showing normal histology in Budesonide (Bud) treated lungs (D), whereas ovalbumin (OVA) sensitized/challenged lung sections show airway inflammation and smooth muscle hypertrophy (E). OVA+Bud treated lung section had little eosinophilic infilteration, and no hypertrophy (F). The Ad5+OVA+Bud treated lungs (G) demonstrate damage in the alveolar space, inflammation and alterations of other airway wall components. E1A protein was detected in chronically infected lung sections, arrows indicate positive staining for E1A protein in the nuclei of airway epithelial cells (H) when compared to no staining for isotype control (I). Scale bar represent 100 µm in panels A through G, and 10 µm for panel H and panel I.Page 5 of 13(page number not for citation purposes)icantly different from Sham (Figure 4A). controls. However, after Acute Ad5 infection DR4 expres-sion peaked at 3 dPi (1.3 ± 0.7) and returned towardsRespiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78baseline at 7 dPi (Figure 4B). DR5 was expressed in theSham control and from 1–7 dPi (Figure 4B). Thisincreased expression is noted after Ad5 infection, andmaximal expression occurred at 3 dPi. The apoptosisobserved in the Acute model was in concordance with theDR4/DR5 expression (Figure 4A/4B). The apoptoticresponse lags behind the increased DR4/DR5 expression,as might be expected. When the DR4/5 expression wascorrelated with apoptosis at the succeeding time point,there was a significant positive correlation (p = 0.01 forDR4 vs. apoptosis and p = 0.0001 for DR5 vs. apoptosis).This data suggests that apoptosis in Acute vial infectionmay be mediated by DR4/DR5 signaling.In vitro apoptosis and death receptor expression after acute Ad5 virus infectionFrom the Acute animal studies we observed that apoptosisof the viral infected cells may be a mechanism to limit theinfection. DR4 and DR5 were noted to be expressed andregulated in response to the Acute viral infection. To vali-date this model we established a cell culture system usingGPTEC isolated from the Cam Hartley Guinea pigs.GPTEC were infected with Ad5 virus at MOI10 to effectmaximal infection of ~20% of the cultured cells. At 1 dPi(Ad5 or Sham) the GPTEC were treated with +/- Bud toexamine the effect of corticosteroids. Untreated culturedAd5 infection when compared to uninfected Sham con-trols (Figure 5A). The detection of the p85 fragment at 4dPi was higher than the uninfected cells (0.9 ± 0.01 vs. 0.6± 0.02; * p ≤ 0.05). Bud-treated GPTEC had the highestp85-PARP detection (1.8 ± 0.07 Bud 2d, 1.6 ± 0.05 Bud3d, and 1.8 ± 0.1 Bud 4d) and all time points were signif-icantly increased from Sham (* p ≤ 0.05). This is consist-ent with corticosteroid-induced apoptosis of AEC asdemonstrated previously [16] and is independent fromdeath receptor expression and function. The Ad5+Budgroup demonstrated a reduction in apoptosis († p ≤ 0.05)when compared to Bud alone. The early trend of apopto-sis in Acute Ad5 infection was absent in the Ad5+Budgroup, although by day 4 (4 dPi) apoptosis was signifi-cantly increased (1.2 + 0.03 * p ≤ 0.05) compared to Sham(Figure 5A). Overall with a low infection rate the absolutechanges in detected apoptosis may remain low; howeverany change in the timing of apoptosis could have signifi-cant effects later. To observe the affect of Bud exposure onthe Ad5 infection and related apoptosis, p85 affect forboth Ad5 and Ad5+Bud groups was normalized to thebaseline (Ad5 1 dPi). Table 1 demonstrates that Ad5 infec-tion demonstrated an "early" initiation of apoptosis:11.3% increase at 2 dPi, 18.2% at 3 dPi and 57% by 4 dPi,whereas Ad5+Bud demonstrated a "late" initiation ofapoptosis effect starting at 7% at 2 dPi, only 1.6% at 3 dPiRepresentative images of airway epithelial immunostaining of Cam Hartley Guinea pigsFigure 3Representative images of airway epithelial immunostaining of Cam Hartley Guinea pigs Semi-quantitative scoring was utilized to determine the expression for DR4(A), DR5 (C) and p85-PARP (E) in immunohistochemically stained lung sec-tions. Panels B, D and F were the isotype controls for the respective antibodies. Arrows indicate the stained epithelial cells. Scale bar represent 10 µm in panels A through F.Page 6 of 13(page number not for citation purposes)cells served as Sham controls. As determined by detectionof p85-PARP protein expression, apoptosis increased afterand 107% at 4 dPi. Overall apoptosis is similar betweenAd5 and Ad5+Bud; however the trend for increasing apop-Respiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78tosis over 4 days after Ad5 infection was significantlyaltered. This alteration by Bud in the pattern of apoptosisof Ad5 infected GPTEC is in association with Bud sup-pressing DR4 and TRAIL expression when compared toAd5 alone (Figure 5B, 5C).Our Guinea pig Acute infection model, suggested a rolefor both DR4 and DR5 in the modulation of apoptosis.We focused on DR4 as a major candidate in our in vitroAd5-infection model as the magnitude of change in DR4expression was much higher than that of DR5. There wasbaseline DR4 expression in the uninfected Sham controlsthat was significantly less than the Ad5 infected cells forall time points. Figure 5B demonstrates that DR4 proteinwas significantly increased (* p < 0.05) in Ad5 alone andBud alone groups from Sham baseline at 2–4 dPi. The Ad5infected group demonstrated the highest DR4 expressionat 4 dPi (1.5 ± 0.1). DR4 expression was altered in thepresence of corticosteroids. Bud (1 µM) was added to thecultured GPTEC at 1 dPi to model the treatment for theresolution of the virus-induced inflammation. As demon-strated in Figure 5B there is an initial increase in DR4expression after 2d of Bud exposure (1.16 ± 0.09 vs. 0.68+ 0.02 p < 0.05) however the magnitude of increase inDR4 expression did not persist over time (3d 0.93 ± 0.09vs. Sham * p ≤ 0.05; 4d 0.83 ± 0.03 vs. Sham p < 0.05),and at all time points expression was greater than Sham (*p < 0.05). Ad5+Bud demonstrated a significant reductionin DR4 expression when compared to either Ad5 alone (†p < 0.05) or Bud alone (§p < 0.05). The DR4 expression inAd5+Bud was not different from the Sham control. Theindividual challenges of either Ad5 or Bud increased DR4expression within 1d; however the combination was notsynergistic.TRAIL is the ligand for the receptors DR4 and DR5. TRAILprotein expression was determined in the total proteinlysates obtained from the Ad5, Bud and Ad5+Bud treatedGPTEC. Ad5 alone treated cells demonstrated the signifi-cant increase in TRAIL expression (Figure 5C) at 2–3 dPiincreasing further at 4 dPi (0.75 ± 0.05 * p ≤ 0.05) whichmirrors the effect on DR4 expression. TRAIL expressionwas not increased by Bud alone and Bud+Ad5 treatmentsdemonstrated a significant reduction in TRAIL expressionat day 3 and day 4 when compared to Ad5 alone († p ≤0.05). This alteration by Bud in the pattern of apoptosis ofAd5 infected GPTEC is in association with Bud suppress-ing both DR4 and TRAIL expression when compared toTable 1: Groups Day 2 Day 3 Day 4Ad5 11.3 18.2 56.9Ad + Bud 6.9 1.6 107Acutely infected GPTEC demonstrate apoptosis coordinate with DR4 and DR5 expressionFigure 4Acutely infected GPTEC demonstrate apoptosis coordinate with DR4 and DR5 expression Semi-quantitative scoring was utilized to determine the expression of p85-PARP, DR4 and DR5 in the Guinea pig lung sections by immunohisto-chemistry. p85-PARP was significantly higher in 1 -4 dPi lung sections compared to Sham controls, peaked at 4 dPi and decreas-ing significantly by 7 dPi (Figure 4A). This trend in apoptosis in the Acute model was coordinate with the changes in DR4 and DR5 expression (Figure 4B). * p < 0.05 compared to Sham and †p < 0.05 compared to 4 dPi.Figure 4BStaining Intensity Sham1 dPi3 dPi4 dPi7 dPiDR4 DR5Figure 4Ap85 positive Cells (%)121086420Sham 1 dPi 3 dPi 4 dPi 7 dPi∗ †∗∗∗∗∗Page 7 of 13(page number not for citation purposes)Ad5 alone.Respiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78Page 8 of 13(page number not for citation purposes)in vitro model of Ad5-infected GPTEC demonstrate p85-PARP, DR4 and TRAIL expressionFigu e 5in vitro model of Ad5-infected GPTEC demonstrate p85-PARP, DR4 and TRAIL expression. Western blotting of total protein lysates collected from Ad5 infected GPTEC demonstrated elevated apoptosis in Ad5 infected cells by 4 dPi and Bud treated cells from 2- 4 dPi compared to Sham cells. Ad5+ Bud group had significantly less apoptosis compared to Bud alone. The inset shows protein bands corresponding to p85-PARP and house keeping β-Actin protein for respective groups (Figure 5A). Ad5 induced apoptosis corresponds to DR4 expression (Figure 5B) and to DR ligand TRAIL (Figure 5C). Ad5+Bud group demonstrated suppressed DR4 and TRAIL protein expression compared to Ad5 alone and Bud alone for respective treatment days (Figure 5B, 5C), * p < 0.05 compared to Sham, §p < 0.05 compared to Bud alone, † p < 0.05 compared to Ad5 alone.TRAIL Protein relative to β−Actin1. 3 4 2 3 4 2 3 4dPi ←***††Figure 5B1.0Sham Ad5 Bud Ad5+Bud2 3 4 2 3 4 2 3 4DR4 Protein relative to β−Actin2.*†*****†† §§§dPi ←← protein relative to β−Actinp85-PARPβ-ActinSham Ad5 Bud Ad5+Bud†Figure 5A2 3 4 2 3 42 3 4∗∗††  dPi ∗∗∗←Figure 5C Respiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78Viral particle release by Ad5 infected GPTEC in vitroApoptosis of viral infected AEC could limit ongoing infec-tion and the resulting inflammation. Infected GPTEC 1dPi were divided into two pools, one was treated with thecorticosteroid Bud, the other not. As demonstrated in Fig-ure 6 viral particle (VP) release into the conditionedmedia peaked at 2 dPi and then significantly decreased by4 dPi (2 dPi, 11 × 106 ± 1.8 × 106 vs. 4 dPi 3.8 × 10 6 ± 1.3× 106 §p < 0.05). In contrast, Ad5 infection treated withBud 1dPi (Ad5+Bud) demonstrated a marked suppressionof VP release within 24 hrs of corticosteroid exposure (4.9× 106 ± 1.2 × 106* p < 0.05). With in the first 24 h of Budtreatment (2 dPi)VP released by the Ad5+Bud group wasnot different from the untreated pool at 1 dPi. In the sub-sequent two days VP detection continued to increase inthe Ad5+Bud group while the Ad5 alone group demon-released per day into the media in the Bud treated groupwhen compared to Ad5 alone (8.3 × 106 ± 0.7 × 106 vs. 3.8× 106 ± 1.3 × 106 † p < 0.05). This increase in VP release iscoordinate with the altered timing of apoptosis of the Ad5infected GPTEC in the Ad5+Bud group (Figure 5A). Theinset shows amplification of DNA from the conditionedmedia. Amplification is noted only for Ad5 and nothousekeeping genes common to Guinea pigs and human.This result confirmed that the DNA detected by thepicogreen assay was indeed Ad5 specific and was not con-tamination from GPTEC DNA.DR4/DR5 expression in the Chronic model of Guinea pig ovalbumin (OVA) induced inflammation and corticosteroid treatmentApoptosis and DR4 expression of airway epithelium wereassociated in the Acute model of viral infection and alsodemonstrated in the in vitro GPTEC model. There was sup-pressed apoptosis and DR4 and TRAIL expression as aresult of Bud treated Ad5 infected cells when compared toAd5 infection alone. We went on to investigate a model ofallergic airway inflammation where persistent viral infec-tion may contribute significantly to the Chronic airwayremodeling identified in this condition. The identificationof apoptotic cells and death receptor expression was deter-mined as for the Chronic model (Figure 7A, 7B). Apopto-sis, as detected by positive staining for the p85 fragmentof PARP (Figure 7A) was observed for all the groups exceptSham control. Persistent Ad5 infection demonstrated thegreater extent of apoptosis (6.1% + 0.78%), followed byBud (3.9% + 0.48%) and OVA (1.8% + 0.21%) as individ-ual challenges. Bud treatment of OVA- allergic inflamma-tion (OVA+Bud) demonstrated decreased apoptosiscompared to Bud only (Figure 7A). Airway epithelial cellspositive for p85-PARP were significantly reduced in theAd5+OVA+Bud group (2.0% + 0.6%) when compared tothe Ad5 group (* * p < 0.005)(Figure 7A). A coordinateand consistent response of DR expression to apoptosiswas observed only for the groups not infected with Ad5.Sham control had 0% apoptosis and no detectable DR4;OVA and OVA+Bud had increasing apoptosis and DR4expression. The apoptosis generated by Bud alone is DRindependent and thus the reduced DR expression is con-sistent.DR4 was not detected at baseline where DR5 was detectedat baseline. OVA, Bud, Ad5 individual treatmentsincreases DR4 compared to Sham control, whereas DR5 isunchanged by OVA and decreased by Bud and Ad5 (Figure7B). OVA+Bud group is unchanged from OVA alone forboth DR4 and DR5. DR4 expression is less inAd5+OVA+Bud compared to OVA+Bud but greater thanAd5 alone. DR5 expression has returned to baselineProlonged viral particle release into culture media is coordi-nate with exposure to corticoster idsFigure 6Prolonged viral particle release into culture media is coordinate with exposure to corticosteroids Picogreen assay performed on the condition media collected from Ad5 infected GPTEC with/out Bud exposure show an early reduction in viral particle release as determined by the detection of Ad5 DNA in the conditioned media. However beyond this initial 24 h period of treatment the detection of viral DNA continued to increase while in the untreated Ad5 infected GPTEC the detection of viral DNA significantly reduced. The insert demonstrates amplification of WtAd5 gene (Lane 1), and housekeeping β-actin (Lane 2) from the conditioned media, and WtAd5 gene (Lane 3), and human β-actin (Lane 4) from the Sham infected human airway epithe-lial cells. This demonstrates that amplified signal in Lane 1 is specific from the viral DNA and not from the epithelial cells in the supernatant. * p < 0.05 compared to Ad5+Bud 2 dPi, §p < 0.05 compared to Ad5 2dPi and † p < 0.05 compared to Ad5+Bud 4 dPi. particles (VP)/ml X1061 dPi 2 dPi 3 dPi 4 dPi1 2 3 4Ad5Ad5+BudFigure 6*†§Page 9 of 13(page number not for citation purposes)strated a significant reduction in VP release § p < 0.05. By4 dPi there was significantly more viral DNA particlesexpression. This demonstrates that each receptor is regu-lated differently by these challenges.Respiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78What is most interesting is the reduced detection of apop-totic AEC in the Ad5+OVA+Bud group. The Ad5 alone hasextensive apoptosis with a relatively small but significantincrease in DR4 expression relative to baseline andreduced DR5. This suggests the relative importance ofDR4 in viral-induced AEC apoptosis. OVA+Bud demon-strate increased DR4 expression and still significant apop-tosis relative to Sham baseline. However Ad5+OVA+Buddemonstrates significant increases in both DR4 (0.67 ±0.22 * p < 0.05) and DR5 (2.83 ± 0.11 * p < 0.05) expres-sion relative to Ad5 alone, but detectable apoptosis ismarkedly lower than what be expected. As demonstratedin the Acute model, decreased expression of TRAIL the lig-and for DR4/ DR5 may account for this effect.DiscussionIn this study our objective was to determine what roleapoptosis and death receptor expression may play in viralinfection of AEC. Viral production from infected AEC maybe limited by apoptosis, and if dysregulated, in diseasestates such as asthma, this may lead to longer viral persist-ence and inflammation. Insight into possible mecha-nisms for the persistent inflammation would help todevelop new therapeutic targets. We studied two modelsof Acute viral infection and one of asthma post-viral infec-tion of the AEC. This report is the first demonstrating thatin the setting of corticosteroid treated inflammation,apoptosis might be dysregulated leading to longer viralteroid exposure. This resulting apoptosis of AEC suggest amechanism to limit the viral infection.Reported differences in DR4 and DR5 expression prima-rily depend on tissue origin [19-21]. The role for thisaltered regulation of DR expression in pulmonary tissueand in particular in asthmatics as it relates to epithelialdamage, apoptosis, and persistence of viral infection andinflammation is unknown. If DR4 expression is responsi-ble for limiting Acute viral infection by being pro-apop-totic in a model of Acute viral infection of AEC we wouldexpect that DR4 expression and apoptosis would beincreased. In Guinea pigs the airway epithelium of unin-fected, unsensitized animals does not express immunore-active DR4 protein (Figure 4B). In contrast, in response toAcute Ad5 infection, DR4 expression in Guinea pig lungtissues increases and is maximal at 3 dPi returning to base-line expression at 7 dPi (Figure 4B). Coordinate with theDR4 expression post-Ad5 infection, apoptosis demon-strated a similar trend as detected by cleaved p85-PARP.The increased apoptosis is compatible with DR4 expres-sion as an initiating factor in Ad5 infection as the detecta-ble DR4 expression precedes apoptosis detection. This isin accordance with the other reports that the death recep-tor system plays an important role in the elimination ofvirus-infected cells [7,19,22,23]. Cells infected by humancytomegalovirus, Ad5, reovirus, measles, or HIV demon-strate increased DR4 and DR5 expression rendering themGuinea pig AEC apoptosis and DR expression as detected by Immunohistochemistry of the Chronic model of Guinea pig viral infection and airway inflammationFigure 7Guinea pig AEC apoptosis and DR expression as detected by Immunohistochemistry of the Chronic model of Guinea pig viral infection and airway inflammation Semi-quantitative scoring was utilized to determine the expression of p85-PARP, DR4 and DR5 in the Guinea pig lung sections by immunohistochemistry. Significant reduction in the detection of p85-PARP for Ad5+OVA+Bud group (** p < 0.005) was observed when compared to Ad5 alone group (Figure 7A). However, DR4/DR5 expression for Ad5+OVA+Bud group was higher compared to Ad5 alone group * p < 0.05 (Figure 7B).Figure 7Ap85-PARP positive cells (%)**Figure 7BDR4 DR5Expression of DR4/DR5**Page 10 of 13(page number not for citation purposes)persistence. This effect may be mediated by modulation ofDR4 and TRAIL regulation in AEC in response to corticos-more sensitive to TRAIL-induced apoptosis by autocrineor T-cell derived TRAIL This indicates that DR4 expressionRespiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78corresponds to Acute viral infection leading to apoptosisof infected cells. We confirmed the role for DR4 andTRAIL in an in vitro model. Our data demonstrated that inthe situation of only Acute Adeno-infection, culturedGPTEC establish an apoptotic pathway via increasedreceptor (DR4) expression and its ligand (TRAIL) expres-sion, leading to clearance of virally infected cells (Figures5A, 5B, 5C).The effects of corticosteroid exposure on Ad5 infection ofAEC were investigated further in a cell culture model todetermine what role altered AEC apoptosis would have onviral particle production. GPTEC were treated with Budwith or without Ad5 infection. Some DR4 protein expres-sion was observed at baseline for the Sham controls, likelya consequence of epithelial disruption and subsequentculturing but was significantly higher in the Ad5 infectedGPTEC (Figure 5B). This is coordinate with the Ad5 induc-tion of DR4 expression in the Acute animal model. Budalone did not change DR4 expression from baseline butwhen Bud was added to Ad5 infected cultures DR4 expres-sion was markedly reduced. Bud-induced apoptosis dem-onstrated the expected steroid effect [24,16] and showedthat it is death-receptor independent. However, Ad5+Buddemonstrated suppressed apoptosis and less DR4 expres-sion compared to Bud treatment or Ad5 infection alone.Apoptosis observed as p85-PARP protein expression wasless in the early stages of treatment, leading to delayedviral particle production which was compatible with ourVP production data in Figure 6. Ad5+Bud group demon-strate "early" vs. "later" effect of induced-apoptosis viasuppressed DR4 expression in the setting of corticoster-oids. The "shape" of the apoptosis curve as represented byp85-PARP protein in the Ad5 group demonstrate thatapoptosis started early is consistent with increased DR4expression and correlates to early viral particle releasewhich then decreases over time as shown in Figure 6.Ad5+Bud group showed late apoptosis with extendedtime during which VP release was also detected (Figure5A, Figure 6). Since the DR4 expression was suppressed inthe Ad5+Bud (Figure 5B) group, the maximum p85 pro-tein expression at 4 dPi might be a result of DR-independ-ent Bud effect.Table 1 data shows that "net" apoptosis by day 4 isapproximately the same but timing to onset this apoptosisis altered by Bud. This change in DR4 expression by corti-costeroid treatment of viral-infected AEC and the resultingaltered regulation of apoptosis would have effects on viralclearance and the resulting inflammation. Initial reduc-tion in VP release in Ad5+Bud group at 2 day compared toAd5 alone is compatible clinically with corticosteroidstreatment used to treat bronchiolitis associated inflamma-totic response to viral infection resulting in longer VPproduction.The combination of Ad5+OVA+Bud in the animal modelgenerated a condition where apoptosis was decreased(Figure 7A) relative to what was expected considering theresponse to Ad5 infection in the Acute model (Figure 4A).However, the mechanism established in the Acute animalmodel (Figure 4A, 4B) and also in the in vitro Adeno infec-tion of GPTEC (Figures 5A, 5B) was altered in the case ofallergic airway inflammation and corticosteroid exposurewhere both DR4 and apoptosis are markedly decreased.While there was no change in the DR5 expression in theGuinea pigs of allergic airway inflammation (Figure 7B),DR4 demonstrated a regulation of expression in responseto allergic inflammation, viral infection and corticoster-oid treatment. DR4 expression was not detected in thecontrol, but was observed in the Ad5 infected/ sham sen-sitized/challenged group. OVA-sensitized group as allergicmodel and Bud treatment also demonstrated increase inDR4 expression. This increase may be in response to theOVA-induced airway inflammation, which produces an"asthmatic" phenotype in Guinea pigs characterized bynon-specific airway hyper-reactivity and airway eosi-nophilia [25]. However this increase was not synergistic incombination with Bud and Ad5 treatment. Therefore,DR4 expression and resulting apoptosis may be a mecha-nism to limit epithelial hyperplasia and metaplasia thatcan occur in chronic airway inflammation. Uninfected,OVA-sensitized animals have an increase in DR4 andcleaved p85-PARP detection in AEC. In vivo DR4 expres-sion as detected in the Ad5 group did not correspond intime to observed apoptotic effect. This effect of time isidentified in the in vitro GPTEC model too (Figures 5A,5B). DR expression should correlate to apoptosis and inour model allergic airway inflammation induces not onlyDR4 expression but the resultant apoptosis of AEC. Whenthe OVA-sensitized animals were treated with the corticos-teroid Bud to reduce the eosinophilic inflammation, DR4expression remained constant relative to that detected inOVA alone. However, the detection of apoptotic AEC byp85-PARP increased dramatically (Figure 7A). Theincreased apoptosis in the OVA+Bud group reflects thecorticosteroid induced apoptosis of AEC as shown previ-ously [24,16] as additive to that generated by inflamma-tion alone. If the mechanism to control AEC survival isdysregulated or disrupted by certain treatments this maycontribute to altered cell numbers or other specific struc-tural changes in the airway.Cells undergo programmed cell death as an initialresponse to infections by pathogens, such as viruses. Thecellular response against viral infection includes produc-Page 11 of 13(page number not for citation purposes)tion. This however may be at the expense of altered apop- tion of inflammatory and anti-viral cytokines, as well asthe induction of apoptosis. Many viruses have evolvedRespiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/78mechanisms that inhibit inflammation and prevent apop-tosis and, as a consequence, are able to establish aChronic phase [26]. DR4 regulation can be the naturalmechanism pre-disposing the infected cells to undergoapoptosis. Balance between this pro-apoptotic effect tolimit infection in the host and the natural anti-apoptoticviral response will determine the clearance of viral-infected cells and persistence of inflammation. In the ani-mal model, another set of Guinea pigs were Ad5 infectedfollowed by OVA-sensitization and corticosteroid-treat-ment. This set of experiments demonstrated that DR4expression is dysregulated by the combination of allergicairway inflammation and corticosteroid treatment in thesetting of Ad5 infection. Whereas OVA alone or OVA+Budincrease both apoptosis of AEC (Figure 7A) and DR4expression (Figure 6B) relative to baseline, the addition ofAd5 suppressed apoptosis and DR4 expression from thatdetected in OVA+Bud. This reduction in AEC apoptosiscould contribute to viral-induced airway inflammation.Corticosteroids are used clinically to reduce inflammationin viral bronchiolitis and asthma. Reduced viral clearancecharacteristic in asthmatics [27] may be explained by thecorticosteroid use. Recently, decreased apoptosis has beenreported in rhinovirus-infected asthmatic airway epithe-lial cells [28] suggesting an additional innate defect inviral-induced apoptosis of AEC that may also contributeto the asthmatic condition. These are important points asother studies report contradictory results regarding theextent of any anti-inflammatory benefit from corticoster-oid therapy. The steroid effects may be dependent on thetype of infecting virus [29,30]. Figure 6 demonstratesdecreased viral production by infected AEC when treatedwith corticosteroid only after one day of corticosteroidtreatment of the infected culture. Ad5 particle productionincreased over the subsequent number of days. After 3days of corticosteroid treatment the GPTEC infected withAd5 were producing more viral particles than theuntreated cultures. The supposed benefit of corticosteroidtreatment for viral bronchiolitis may then only be recog-nized with the first day of treatment and thereafter viralproduction increases and persists. To what extent this ster-oid effect contributes to persistent or excessive airwayinflammation remains to be determined. These resultssuggest that DR regulation may be affected by the presenceof steroids in the setting of adenoviral infection. To ourknowledge, no study has investigated whether viral-induced epithelial damage is improved or worsened bycorticosteroid treatment. The overall effects of corticoster-oids and how they contribute to the airway remodeling isbeyond scope of this study but should be considered infuture studies particularly in the setting of viral exacerba-tions to airway inflammation.ConclusionOur study concludes that in normal AEC, apoptosis is amechanism to limit viral particle release. DR4 is regulatedin response to viral infection. DR4 and TRAIL expressionis coordinated with an increase in AEC apoptosis in theAcute model of viral infection and corresponds to virusparticle release. However, in the setting of airway inflam-mation or in the presence of corticosteroids, this mecha-nism limiting viral particle release is disrupted. Furtherunderstanding the mechanism of airway epithelialresponse to viral infection in the setting of allergic inflam-mation or steroid exposure would suggest changes in ourpresent therapies for airway inflammation.AbbreviationsDeath receptors (DR), Adeno virus (Ad5), Guinea Pig Tra-cheal Epithelial Cells (GPTEC), Airway Epithelial Cells(AEC), Budesonide (Bud)Competing interestsThe author(s) declare that they have no competing inter-ests.Authors' contributionsDRD conceived the idea, DRD and GKS participated in itsdesign, coordination and drafting of the experiments andpreparation of the manuscript. KJH contributed by formu-lation of the initial concept and in editing the manuscript.GKS and TZV participated in the in vivo and in vitro sam-pling, analysis, and statistics, TSC contributed in vivoacquisition of data (IHC), analysis and interpretation ofdata, JYC contributed in cell culturing, western blotting,and PCR studies. TZV and GKS participated in the design-ing and in vivo sampling for analysis. TSC and JYC wereundergraduate students. GKS, TSC, JYC, TZV, KJH, DRDgave final approval for the submission.AcknowledgementsWe would like to thank Dr. James Hogg and Dr. Shizu Hayashi for providing the expertise and technical resources, Dr. Rick Hegele and Dr. Ruth McRedmond for editing the manuscript. This work was supported by the Canadian Institutes of Health Research (DRD) and National Institute of Health HL66026 (DRD, KJH), CIHR/Allergen 79632 (DRD). DRD is a Scholar from the Michael Smith Foundation for Health Research and a Parker B Francis Fellow in Pulmonary Research. These funds helped in the conception and execution of this project.References1. Gern JE: Viral respiratory infection and the link to asthma.Pediatr Infect Dis J 2004, 23(1 Suppl):S78-86.2. Wilson NM: Virus infections, wheeze and asthma.  PaediatrRespir Rev 2003, 4(3):184-192.3. Chuang YY, Chiu CH, Wong KS, Huang JG, Huang YC, Chang LY, LinTY: Severe adenovirus infection in children.  J Microbiol ImmunolInfect 2003, 36(1):37-40.4. Lyles DS: Cytopathogenesis and inhibition of host geneexpression by RNA viruses.  Microbiol Mol Biol Rev 2000,Page 12 of 13(page number not for citation purposes)64(4):709-724.Publish with BioMed Central   and  every scientist can read your work free of charge"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."Sir Paul Nurse, Cancer Research UKYour research papers will be:available free of charge to the entire biomedical communitypeer reviewed and published immediately upon acceptancecited in PubMed and archived on PubMed Central Respiratory Research 2006, 7:78 http://respiratory-research.com/content/7/1/785. Kotelkin A, Prikhod'ko EA, Cohen JI, Collins PL, Bukreyev A: Respi-ratory syncytial virus infection sensitizes cells to apoptosismediated by tumor necrosis factor-related apoptosis-induc-ing ligand.  J Virol 2003, 77(17):9156-9172.6. Zhang HG, Xie J, Xu L, Yang P, Xu X, Sun S, Wang Y, Curiel DT, HsuHC, Mountz JD: Hepatic DR5 induces apoptosis and limits ade-novirus gene therapy product expression in the liver.  J Virol2002, 76(11):5692-5700.7. Clarke P, Meintzer SM, Gibson S, Widmann C, Garrington TP, John-son GL, Tyler KL: Reovirus-induced apoptosis is mediated byTRAIL.  J Virol 2000, 74(17):8135-8139.8. Barber GN: Host defense, viruses and apoptosis.  Cell Death Dif-fer 2001, 8(2):113-126.9. Yamada K, Elliott WM, Brattsand R, Valeur A, Hogg JC, Hayashi S:Molecular mechanisms of decreased steroid responsivenessinduced by latent adenoviral infection in allergic lung inflam-mation.  J Allergy Clin Immunol 2002, 109(1):35-42.10. Thomas LH, Sharland M, Friedland JS: Steroids fail to down-regu-late respiratory syncytial virus-induced IL-8 secretion ininfants.  Pediatr Res 2002, 52(3):368-372.11. Azevedo AM, Durigon EL, Okasima V, Queiroz DA, de Moraes-Vas-concelos D, Duarte AJ, Grumach AS: Detection of influenza,parainfluenza, adenovirus and respiratory syncytial virusduring asthma attacks in children older than 2 years old.Allergol Immunopathol (Madr) 2003, 31(6):311-317.12. Yamada K, Elliott WM, Hayashi S, Brattsand R, Roberts C, Vitalis TZ,Hogg JC: Latent adenoviral infection modifies the steroidresponse in allergic lung inflammation.  J Allergy Clin Immunol2000, 106(5):844-851.13. Duriez PJ, Shah GM: Cleavage of poly(ADP-ribose) polymerase:a sensitive parameter to study cell death.  Biochem Cell Biol1997, 75(4):337-349.14. Kim JS, Rabe KF, Magnussen H, Green JM, White SR: Migration andproliferation of guinea pig and human airway epithelial cellsin response to tachykinins.  Am J Physiol 1995, 269(1 Pt1):L119-26.15. Davidson DJ, Kilanowski FM, Randell SH, Sheppard DN, Dorin JR: Aprimary culture model of differentiated murine tracheal epi-thelium.  Am J Physiol Lung Cell Mol Physiol 2000, 279(4):L766-78.16. Dorscheid DR, Wojcik KR, Sun S, Marroquin B, White SR: Apopto-sis of airway epithelial cells induced by corticosteroids.  Am JRespir Crit Care Med 2001, 164(10 Pt 1):1939-1947.17. Murakami P, McCaman MT: Quantitation of adenovirus DNAand virus particles with the PicoGreen fluorescent Dye.  AnalBiochem 1999, 274(2):283-288.18. Dakhama A, Hegele RG, Laflamme G, Israel-Assayag E, Cormier Y:Common respiratory viruses in lower airways of patientswith acute hypersensitivity pneumonitis.  Am J Respir Crit CareMed 1999, 159(4 Pt 1):1316-1322.19. Strater J, Walczak H, Pukrop T, Von Muller L, Hasel C, Kornmann M,Mertens T, Moller P: TRAIL and its receptors in the colonic epi-thelium: a putative role in the defense of viral infections.  Gas-troenterology 2002, 122(3):659-666.20. Koornstra JJ, Kleibeuker JH, van Geelen CM, Rijcken FE, Hollema H,de Vries EG, de Jong S: Expression of TRAIL (TNF-relatedapoptosis-inducing ligand) and its receptors in normalcolonic mucosa, adenomas, and carcinomas.  J Pathol 2003,200(3):327-335.21. Spierings DC, de Vries EG, Vellenga E, van den Heuvel FA, KoornstraJJ, Wesseling J, Hollema H, de Jong S: Tissue distribution of thedeath ligand TRAIL and its receptors.  J Histochem Cytochem2004, 52(6):821-831.22. Lum JJ, Pilon AA, Sanchez-Dardon J, Phenix BN, Kim JE, Mihowich J,Jamison K, Hawley-Foss N, Lynch DH, Badley AD: Induction of celldeath in human immunodeficiency virus-infected macro-phages and resting memory CD4 T cells by TRAIL/Apo2l.  JVirol 2001, 75(22):11128-11136.23. Servet-Delprat C, Vidalain PO, Bausinger H, Manie S, Le Deist F, Azo-car O, Hanau D, Fischer A, Rabourdin-Combe C: Measles virusinduces abnormal differentiation of CD40 ligand-activatedhuman dendritic cells.  J Immunol 2000, 164(4):1753-1760.24. Dorscheid DR, Low E, Conforti A, Shifrin S, Sperling AI, White SR:Corticosteroid-induced apoptosis in mouse airway epithe-lium: effect in normal airways and after allergen-induced air-25. Ishida K, Kelly LJ, Thomson RJ, Beattie LL, Schellenberg RR:Repeated antigen challenge induces airway hyperresponsive-ness with tissue eosinophilia in guinea pigs.  J Appl Physiol 1989,67(3):1133-1139.26. Bensaude E, Turner JL, Wakeley PR, Sweetman DA, Pardieu C, DrewTW, Wileman T, Powell PP: Classical swine fever virus inducesproinflammatory cytokines and tissue factor expression andinhibits apoptosis and interferon synthesis during the estab-lishment of long-term infection of porcine vascular endothe-lial cells.  J Gen Virol 2004, 85(Pt 4):1029-1037.27. Papadopoulos NG, Papi A, Psarras S, Johnston SL: Mechanisms ofrhinovirus-induced asthma.  Paediatr Respir Rev 2004,5(3):255-260.28. Wark PA, Johnston SL, Bucchieri F, Powell R, Puddicombe S, Laza-Stanca V, Holgate ST, Davies DE: Asthmatic bronchial epithelialcells have a deficient innate immune response to infectionwith rhinovirus.  J Exp Med 2005, 201(6):937-947.29. Grunberg K, Sharon RF, Sont JK, In 't Veen JC, Van Schadewijk WA,De Klerk EP, Dick CR, Van Krieken JH, Sterk PJ: Rhinovirus-induced airway inflammation in asthma: effect of treatmentwith inhaled corticosteroids before and during experimentalinfection.  Am J Respir Crit Care Med 2001, 164(10 Pt 1):1816-1822.30. Buckingham SC, Jafri HS, Bush AJ, Carubelli CM, Sheeran P, HardyRD, Ottolini MG, Ramilo O, DeVincenzo JP: A randomized, dou-ble-blind, placebo-controlled trial of dexamethasone insevere respiratory syncytial virus (RSV) infection: effects onRSV quantity and clinical outcome.  J Infect Dis 2002,185(9):1222-1228.yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralPage 13 of 13(page number not for citation purposes)way inflammation.  J Allergy Clin Immunol 2003, 111(2):360-366.


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items