UBC Faculty Research and Publications

Gene discovery for the bark beetle-vectored fungal tree pathogen Grosmannia clavigera Hesse-Orce, Uljana; DiGuistini, Scott; Keeling, Christopher I; Wang, Ye; Li, Maria; Henderson, Hannah; Docking, T R; Liao, Nancy Y; Robertson, Gordon; Holt, Robert A; Jones, Steven J; Bohlmann, Jörg; Breuil, Colette Oct 4, 2010

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


52383-12864_2010_Article_3233.pdf [ 393.77kB ]
JSON: 52383-1.0221465.json
JSON-LD: 52383-1.0221465-ld.json
RDF/XML (Pretty): 52383-1.0221465-rdf.xml
RDF/JSON: 52383-1.0221465-rdf.json
Turtle: 52383-1.0221465-turtle.txt
N-Triples: 52383-1.0221465-rdf-ntriples.txt
Original Record: 52383-1.0221465-source.json
Full Text

Full Text

RESEARCH ARTICLE Open AccessGene discovery for the bark beetle-vectoredfungal tree pathogen Grosmannia clavigeraUljana Hesse-Orce1, Scott DiGuistini1, Christopher I Keeling2, Ye Wang1, Maria Li2, Hannah Henderson2,T Roderick Docking3, Nancy Y Liao3, Gordon Robertson3, Robert A Holt3, Steven JM Jones3, Jörg Bohlmann2,Colette Breuil1*AbstractBackground: Grosmannia clavigera is a bark beetle-vectored fungal pathogen of pines that causes wooddiscoloration and may kill trees by disrupting nutrient and water transport. Trees respond to attacks from beetlesand associated fungi by releasing terpenoid and phenolic defense compounds. It is unclear which genes areimportant for G. clavigera’s ability to overcome antifungal pine terpenoids and phenolics.Results: We constructed seven cDNA libraries from eight G. clavigera isolates grown under various cultureconditions, and Sanger sequenced the 5’ and 3’ ends of 25,000 cDNA clones, resulting in 44,288 high quality ESTs.The assembled dataset of unique transcripts (unigenes) consists of 6,265 contigs and 2,459 singletons that mappedto 6,467 locations on the G. clavigera reference genome, representing ~70% of the predicted G. clavigera genes.Although only 54% of the unigenes matched characterized proteins at the NCBI database, this dataset extensivelycovers major metabolic pathways, cellular processes, and genes necessary for response to environmental stimuliand genetic information processing. Furthermore, we identified genes expressed in spores prior to germination,and genes involved in response to treatment with lodgepole pine phloem extract (LPPE).Conclusions: We provide a comprehensively annotated EST dataset for G. clavigera that represents a rich resourcefor gene characterization in this and other ophiostomatoid fungi. Genes expressed in response to LPPE treatmentare indicative of fungal oxidative stress response. We identified two clusters of potentially functionally relatedgenes responsive to LPPE treatment. Furthermore, we report a simple method for identifying contig misassembliesin de novo assembled EST collections caused by gene overlap on the genome.BackgroundThe ophiostomatoid fungus Grosmannia clavigera(Robinson-Jeffrey and Davidson) is a fungal pathogenthat discolours wood, and kills pine host trees by dis-rupting the flow of nutrients and water in phloem andsapwood [1,2]. In its ecosystem, G. clavigera is vectoredbetween hosts by the mountain pine beetle (MPB, Den-droctonus ponderosae). This pathogen can kill lodgepolepine (Pinus contorta) when manually inoculated underthe bark at a high enough concentration [3,4]. Likemany bark beetle associated fungi, G. clavigera producesslimy spores that stick to the exoskeleton of the insects,but the fungus is also present in the beetle mycangiaand alimentary canal [5]. During tree colonization, thebeetles spread fungal spores throughout their galleriesbelow the bark. The spores germinate and fungal hyphaecolonize the phloem and sapwood of the tree. Fungibenefit the beetles by improving the host environmentfor the beetle progeny, and serving as food for the larvaeand the teneral adult beetles [6]. In addition, G. clavi-gera may counteract tree defenses that are activatedduring bark beetle attacks.Conifer trees respond to beetle attacks or fungalinoculation by releasing resin from pre-formed andinducible traumatic resin ducts, inducing the synthesisof phenolic compounds in phloem parenchyma cells,and forming a wound periderm tissue [7]. The mainconstituents of conifer resin are terpenoids, many ofwhich have insecticidal and fungicidal properties [8,9].Ophiostomatoid fungi can decrease the concentration of* Correspondence: colette.breuil@ubc.ca1Department of Wood Science, University of British Columbia, Vancouver,CanadaFull list of author information is available at the end of the articleHesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536© 2010 Hesse-Orce et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.terpenoids when inoculated on sapwood [10-12]. How-ever, the molecular and biochemical mechanismsinvolved in these processes are unknown. Previously, weanalyzed a small set of expressed sequence tags (ESTs)from G. clavigera and found putative gene candidatesthat may be involved in terpenoid detoxification [13].Lodgepole pine also constitutively produces a variety ofphenolic compounds, including flavonoids and tannins[14-17]. Many of these chemicals inhibit the growth offungal pathogens [18]. To detoxify phenolic plantdefense compounds, fungi produce a variety of enzymessuch as phenol oxidases that polymerize phenolics [19],peroxidases that degrade polymeric phenolic structures[20], and glucosidases and glucuronidases that areinvolved in metabolism of phenolic glycosides [21,22].As well, fungi may release extracellular proteins thatbind to toxic phenolics preventing their interaction withthe fungal cell wall [23]. Whether G. clavigera encodesand expresses genes necessary for detoxification of phe-nolic compounds has not been determined.The recently published genome of G. clavigera is thefirst reference genome for an insect-vectored fungal treepathogen [24]. The genome sequence provides a funda-mental resource for identifying fungal genes importantfor symbiotic interactions with insect and tree hosts.ESTs support gene discovery and gene structure annota-tion. To cover a broad spectrum of expressed genes, weextended the previous collection of 5,950 ESTs [13], andsequenced the 5’ and 3’ ends of 25,000 cDNA clonesfrom normalized and non-normalized cDNA libraries ofeight G. clavigera isolates grown in various conditions.We conducted a de novo EST assembly and used theresulting set of unique transcripts (unigenes) to verifythe assembly of the G. clavigera genome [24]. As well,we used the genome sequence to address two problemsassociated with de novo CAP3 EST assembly: 1) incom-plete assembly of ESTs from multiple transcripts of agiven gene into a single contig due to incomplete spli-cing, splice variants, incomplete read overlap, andsequencing errors; and 2) incorrect assembly of ESTsfrom transcripts of different genes as a result ofsequence similarity.Here we describe the G. clavigera unigene dataset, anddiscuss fungal genes upregulated in two biological statesthat are important for G. calvigera-MPB-pine interac-tions: the vectored non-germinating asexual spores, andmycelia treated with lodgepole pine phloem extract(LPPE), which contains tree defense chemicals. Further-more, we show that overlap of neighboring genes on thegenome was the major source for contig misassembliesin this de novo EST assembly, and describe a simplemethod for identifying such cases even in absence of asequenced genome.Results1 EST analysisTo identify a broad spectrum of G. clavigera genesnecessary for fungal growth we grew eight isolates(Table 1) on five media, and for one medium we treatedthe mycelia with LPPE (Table 2). We also harvestedspores from the reference isolate SLKW1407 that wehad used to sequence the G. clavigera genome [24]. Tomaximize sequencing efficiency we pooled the mediaand LPPE treatments, generating three isolate/treatmentcombinations with the reference isolate, and one isolate/treatment combination that contained the seven closelyrelated G. clavigera isolates (Table 3). Furthermore, weprepared normalized cDNA samples for three isolate/treatment combinations. We then constructed sevenunidirectional, full-length enriched cDNA libraries andsequenced a total of 25,000 cDNA clones from both 5’and 3’ ends (Table 3). After trimming vector and lowquality sequences the average PHRED 20 read lengthwas 693 bp. This resulted in 44,288 high quality ESTs(NCBI dbEST GT571598-GT615878). After adding5,950 quality-filtered ESTs from previous analyses withthe reference isolate [13], we reverse-complemented 3’reads, removed polyA tails, and discarded sequenceswith long mononucleotide stretches. The resulting data-set contained 50,167 high quality ESTs.Table 1 G. clavigera strains isolated from Pinus species used for cDNA library constructionID Isolate ATCC/UAMH accession Isolation origin Host Isolated from Year1 SLKW1407 UAMH11150 BC/Kamloops P. contorta Gallery 20032 ATCC18086 ATCC18086 BC/Cache Creek P. ponderosa Sapwood 19653 200-1-14 UAMH11151 BC/Kamloops P. contorta Sexual spore 20044 DPLKGT1B UAMH11152 BC/Kelowna P. contorta MPB body 20075 H55 UAMH11153 BC/Houston P. contorta MPB body 20036 B5 UAMH11154 Alberta/Banff P. contorta MPB body 20037 B10 UAMH11155 Alberta/Banff P. contorta MPB body 20038 DPCHMC3 * Alberta/Cypress Hills P. contorta MPB mycangia 2007*Breuil culture collection, Dept. of Wood Science, University of British Columbia, Vancouver, CanadaHesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 2 of 11Unigene assembly and unigene-locations on the genomeWe assembled the 50,167 ESTs into unigenes and deter-mined their locations on the G. clavigera genome.Assembly resulted in 8,724 unigenes (2,459 singletonsand 6,265 contigs) that joined 91% of the 21,391 5’-3’read pairs. Most of the unigenes (97%) mapped to thegenome at high stringency (>80% sequence similarity;>80% unigene alignment length), while 219 unigenesmapped with a quality below this threshold, and 48 uni-genes did not align to the genome. We evaluated thecontig assembly using two methods. First, we alignedthe unassembled reads to the genome and testedwhether all reads from a contig would map to the samegenome location as the contig. For 74 contigs there wasdisagreement. Manual inspection showed that 28 werecorrectly assembled and could be matched to an NCBIprotein sequence, leaving 46 (0.5%) potentially misas-sembled unigenes. Second, we searched for contigs con-taining forward and reverse reads (FR contigs) despiteunidirectional orientation of the assembled reads. Weidentified 821 such contigs, and in most cases foundindications for transcript overlap between neighboringgenes encoded on opposite genome strands. For all but21 (2.6% of 821) FR contigs, the unassembled readsmapped to the same genome location as their respectivecontig aligning, however, to both strands of the genome.We manually inspected 50 FR contigs and found thatfor 35 of them the reverse assembled reads belonged toan adjacent gene model encoded on the opposite strand.For the remaining 15 FR contigs all reads mapped tothe same region on the genome, but we found no evi-dence for a neighboring gene.We generated 6,467 unigene-locations (ULs) on the G.clavigera reference genome based on strand-specific uni-gene overlap and linking information from unassembled5’-3’ read pairs (Additional file 1: Table S1). Of these,812 ULs (13%) overlapped with another UL encoded onthe opposite strand of the genome, with a 260 bp med-ian overlap length. However, FR contig analysis sug-gested that UL overlap occurs more frequently. For the814 ULs with FR contigs, UL analysis identified 170overlapping ULs (21%). Manual inspection of genomelocations with FR contigs indicated this fraction to be~70% (i.e. ~570 ULs). This suggested that overall ~1212G. clavigera ULs overlapped.Genes represented in the unigene datasetWe predicted ORFs for all but five of the 8,724 uni-genes; 1,584 of these unigenes (18%) were full length,4,806 were truncated at the 5’ end, and 771 were trun-cated at the 3’ end. Seventy-three percent of the uni-genes were similar to NCBI protein sequences (min e-value 1.0 × 10-4). For these unigenes ORF predictionswere based on the best BLAST match, and we foundthat for 1,115 of them the best predicted ORF was notthe longest ORF. We also noted that only 8% of the cor-rectly assembled unigenes had a significant proteinTable 3 cDNA libraries from four G. clavigera isolate-treatment combinations and numbers of high quality ESTsderived from each library.Library Iso-lates Media/treatment combinations Norma-lized Primary titre (cfu/ml) ESTs sequenced ESTs HQ (%)OCL01 1 W:S:ON:IN:OO No 2.1 × 106 6,144 5,272 (86)OCL02 1 W:S:ON:IN:OO Yes 2.1 × 105 15,360 14,075 (92)OCL03 1 ON+LPPE No 4.0 × 105 6,144 5,618 (91)OCL04 1 ON+LPPE Yes 2.5 × 105 9,216 7,794 (85)OCL05 2-8 W:S:ON:IN:OO:ON+LPPE No 2.0 × 106 3,072 2,916 (95)OCL06 2-8 W:S:ON:IN:OO:ON+LPPE Yes 9.0 × 104 3,072 2,819 (92)OCL08 1 Sp No 1.3 × 106 6,912 5,794 (84)For the libraries OCL01-OCL06, mycelial cultures from each of the eight isolates were grown on five different media, and for one medium the mycelia weretreated with LPPE (W = wood, S = starch, ON = organic nitrogen, IN = inorganic nitrogen, OO = olive oil, LPPE = treatment with lodgepole pine methanolextract). After extracting total RNA separately from each of the 48 isolate/media/LPPE-treatment variants and from the spore sample (Sp), equal amounts of totalRNA were pooled to obtain four isolate/treatment combinations. From these pooled samples we purified poly(A+) mRNA and generated cDNA. All three non-spore cDNA samples were divided into two fractions, one of which was normalized. The resulting seven cDNA samples were used for library construction. HQ =high quality.Table 2 Media and treatment for growing G. clavigeramycelium for cDNA library constructionMedia compositionwood 10 g/plate lodgepole pine sawduststarch 0.17% YNB, 0.1% PHP, 0.3% asparagine, 1% starchorganicnitrogen0.17% YNB, 0.1% PHP, 0.3% asparagine, 1% maltoseinorganicnitrogen0.17% YNB, 0.1% PHP, 0.3% NaNO3, 1% maltoseolive oil 0.17% YNB, 0.1% PHP, 0.3% asparagine, 1% (v/v) oliveoil emulsified in 0.5% tergitol (olive oil and tergitolwere mixed and autoclaved separately before beingadded to the media)LPPEtreatmentCultures were grown on organic nitrogen medium for48 h and then sprayed with LPPEAll media were solidified with 1.5% granulated agar. LPPE = lodgepole pinemethanol extract, YNB = yeast nitrogen base, PHP = potassium hydrogenphthalateHesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 3 of 11match on the reverse strand, while 56% of the FR con-tigs had a significant hit on the minus frame. UsingInterProScan and KAAS, we assigned InterPro IDs,Gene Ontology terms, and K-numbers with correspond-ing BRITE classifications to 3,730 (43%), 2,504 (29%)and 1,530 (18%) unigenes, respectively. The K-numberannotated unigenes belonged to 1,439 ULs.Hierarchical classification of the unigenes usingKEGG-BRITE allowed mapping ULs to pathways andinfer higher-order functions (Figure 1, Additional file 1:Table S1). Nearly half of the 1,439 ULs that were anno-tated with K-numbers encoded proteins from metabolicpathways, including amino acid metabolism, carbohy-drate metabolism, energy metabolism, as well as lipidand nucleotide metabolism. Proteins encoded by 575ULs are potentially involved in genetic information pro-cessing (i.e. transcription, translation, replication andDNA repair). Furthermore, we verified that this G. clavi-gera unigene collection covers essential metabolic path-ways. Using reciprocal BLAST analysis we identified allgenes of the ergosterol pathway, all but one of the genesof the citrate and pentose phosphate cycles, and 59 of95 genes necessary for primary amino acid biosynthesis.2 Differential gene expressionWe characterized gene expression in the G. clavigerareference isolate (SLKW1407) by assessing EST frequen-cies in the non-normalized cDNA libraries from myce-lial culture (OCL01), spores (OCL08), and culturesexposed to LPPE treatment (OCL03). Transcripts forthe majority of ULs (1699; 65%) appeared to be libraryspecific, 614 ULs (24%) contained transcripts from twolibraries, and only 288 ULs (11%) contained reads fromall three libraries (Figure 2). To identify genes associatedwith processes that were overrepresented under any ofthe three conditions tested, we analyzed the set oflibrary-specific ULs that were annotated with K-num-bers and assigned to KEGG Pathways (Figure 3).Table 4 shows selected pathways for which numbers ofspecifically expressed genes differed between the threecDNA libraries. Among the ULs expressed only in themycelial culture library we found twice as many carbo-hydrate and amino acid metabolism genes than in theother libraries. Spore-library specific ULs encoded ahigher variety of proteins necessary for oxidative phos-phorylation, nucleotide metabolism, and translation. Inthe LPPE library, genes for signal transduction and N-glycan biosynthesis were specifically expressed. Belowwe describe ULs that were identified as differentiallyexpressed by reciprocal comparison of read frequenciesof the three non-normalized cDNA libraries.Spores (OCL08) vs mycelial culture (OCL01)Of the 2,039 ULs with reads from the libraries OCL01and/or OCL08, 66 ULs had significantly (p < 0.05)higher read frequencies in the spore than in the myceliallibrary (Additional file 1: Table S1). Of these, 11 ULs(355, 444, 2425, 2447, 2745, 3423, 3838, 4185, 4783,Amino Acid Metabolism (124) Carbohydrate Metabolism (143) Energy Metabolism (120) Nucleotide Metabolism (75) Lipid Metabolism (88) Metabolism of Cofactors and Vitamins (61) Xenobiotics Biodegradation and Metabolism (63) Biosynthesis of Secondary Metabolites (46) Glycan Biosynthesis and Metabolism (45) Transport and Catabolism (60) Cell Growth and Death (55) Cytoskeleton proteins (19) Membrane Transport (19) Signal Transduction (62) Signalling Molecules and Interaction (32) Transcription (117) Translation (150) Folding, Sorting, Degradation (222) Replication and Repair (171) M C E G Figure 1 Numbers of unigene-locations involved in metabolic pathways (M), cellular processes (C), environmental informationprocessing (E), and genetic information processing (G) based on KEGG-BRITE annotations.Hesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 4 of 115218, 5775) encoded heat shock proteins (HSPs) andother protein chaperones/folding catalysts (e.g. cyclo-phillin D). Other ULs that were overexpressed in sporesmatched proteins involved in energy metabolism andATP-dependent cellular processes: Ca2+ transportingATPase (UL 904), F-type H+-transporting ATPase subu-nit epsilon (UL 2399), arsenite-transporting ATPase (UL4670), ATP-dependent Clp protease (UL 5775). For 73ULs read frequencies were significantly higher in themycelial than in the spore libraries (Additional file 1:Table S1). A high fraction of ULs that were overex-pressed in mycelial culture encoded proteins importantfor carbohydrate and amino acid metabolism: four gly-colytic enzymes (ULs 2601, 4586, 6279, 6391), a glucosetransporter (UL 5108), a subtilase (UL 4937), and pro-teins involved in methionine (ULs 1740, 6245) and mel-anin (UL 4533) biosynthesis.LPPE treatment (OCL03) vs mycelial culture (OCL01)We identified eight ULs (85, 588, 1906, 2850, 3233,3525, 4003, 4803) that were significantly (p < 0.05) over-expressed in the LPPE treated culture library (Additionalfile 1: Table S1). We analyzed the genomic neighbor-hoods of these eight ULs and found that two ULs(annotated as a steroid monoxygenase and a cupindomain protein) co-localized with other ULs that wereexpressed only in the LPPE treated libraries, and so maybe functionally related. The first cluster (Table 5) con-tained the steroid monoxygenase and ULs encoding abeta-lactamase (whose ESTs originated from the288288159167510627562OCL03OCL01OCL08Figure 2 Numbers of unique and shared transcripts in the non-normalized mycelial culture (OCL01), LPPE (OCL03), and spore(OCL08) cDNA libraries of G. clavigera.0 5 10 15 20 25 Carbohydrate Metabolism Amino Acid Metabolism Energy Metabolism Lipid Metabolism Nucleotide Metabolism Glycan Biosynthesis and Metabolism Metabolism of Cofactors and Vitamins Xenobiotics Biodegradation and Metabolism Biosynthesis of Secondary Metabolites Transcription Translation Folding, Sorting and Degradation Replication and Repair Signaling Molecules and Interaction Signal Transduction Membrane Transport Cell Growth and Death Transport and Catabolism Cell Motility Number of library specific ULs culture (OCL01) spores (OCL08) LPPE (OCL03) Figure 3 Library specific unigene-locations (ULs) from the non-normalized mycelial culture (OCL01), LPPE (OCL03), and spore (OCL08)cDNA libraries classified based on KEGG-BRITE annotations (nOCL01 = 141, nOCL03 = 126, nOCL08 = 156).Hesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 5 of 11normalized LPPE library), an MSF transporter, a cyto-chrome P450, and a P450 reductase. RT-PCR confirmedthat transcript abundance for all five of these clusteredULs were increased in response to LPPE treatment atthe 36 h time point (Figure 4). Reciprocal BLASTsearches indicated that this cluster is not conserved inAspergillus spp., Fusarium spp., Magnaporthe grisea,and Neurospora crassa. However, in Aspergillus nidu-lans, the putative orthologues of the cytochrome P450(AN5837) and the P450 reductase (AN5838) are locatednext to each other. The second cluster (Table 6) con-tained the cupin domain protein and ULs for an S15family peptidase, an unknown protein, an aromatic ring-opening dioxygenase, a PutA family dehydrogenase, anda short chain dehydrogenase. Three ULs of this clusterwere specific to the LPPE treatment libraries. This clus-ter was not conserved in the above fungal species. For11 ULs (602, 769, 2601, 3744, 3874, 4487, 4533, 5218,5833, 6220, 6391), read frequencies were significantly (p< 0.05) lower in the LPPE library than in the myceliallibrary (Additional file 1: Table S1). Eight of these,including the ULs for trehalase, scytalone dehydratase 1,and HSP90 were also downregulated in the sporelibrary. Analysis of the genomic regions flanking theseULs did not indicate clustering of functionally relatedgenes.Discussion and ConclusionsESTs can be assembled de novo, or, when a high-qualityreference genome sequence is available, by mappingsequence reads to the genome and assembling them bygenome location. We conducted a de novo EST assem-bly to assess the quality of the G. clavigera genomesequence [24]. For this, we applied CAP3, a widely usedEST assembly program that is a component of recentassembly pipelines [25,26]. Of the 8,457 unigenes, 97%mapped to the genome at high stringency (>80%sequence similarity; >80% unigene alignment length).Only 0.5% of the unigenes contained reads from distantgenome locations, indicating either unigene or genomemisassemblies. These results show that both theassembled genome sequence and the unigene assemblywere of high quality. The unigene collection derivedfrom 50,167 high quality ESTs allowed identification ofTable 4 Numbers of genes in selected KEGG pathways matched by ULs specific to cDNA libraries OCL01 (mycelialculture), OCL03 (LPPE), and OCL08 (spores)Pathway OCL01 OCL03 OCL08Oxidative phosphorylation 1 3 14Amino sugar and nucleotide sugar metabolism 6 2 1Starch and sucrose metabolism 5 1 0Phenylalanine, tyrosine and tryptophan biosynthesis 5 1 1N-Glycan biosynthesis 0 3 2High-mannose type N-glycan biosynthesis 2 0 1O-Mannosyl glycan biosynthesis 0 1 1Biosynthesis of terpenoids and steroids 3 6 0Pyrimidine metabolism 3 6 8Purine metabolism 4 4 11RNA polymerase 0 2 7Spliceosome 3 9 5Aminoacyl-tRNA biosynthesis 2 1 6MAPK signaling pathway - yeast 0 4 1Cell cycle - yeast 1 6 2Table 5 Unigene-locations of cluster 1, which is potentially involved in response to lodgepole pine phloem extractUnigene-location Best annotated protein match from the NCBI nonredundant protein database e-value p-value*3230 MFS sugar transporter [Aspergillus flavus] 4E-92 ns3231 related to ARCA protein [Neurospora crassa] 4E-38 nsGc_00052 benzoate 4 monooxygenase cytochrome P450 [Neosatoria fisherii] 1E-165 nsGc_00102 NADPH-cytochrome P450 reductase (CprA) [Aspergillus fumigatus] 4E-143 ns3232 small s protein [Podospora anserina] 7E-42 ns3233 steroid monooxygenase [Aspergillus flavus] 1E-104 0.023234 beta-lactamase family protein [Pyrenophora tritici-repentis] 2E-58 Ns* Fisher’s exact p-value for the comparative analysis on transcript abundance between the mycelial culture (OCL01) and LPPE (OCL03) libraries.Hesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 6 of 116,467 ULs. In a separate analysis of the G. clavigera gen-ome sequence we estimated ~9,000 genes (unpublishedresults). Based on this number the unigene set repre-sents ~70% of the G. clavigera genes. Unigene annota-tion showed that our dataset covers in depth majormetabolic pathways for general and essential processes,and provides sequence information on genes that maybe unique to G. clavigera. These data will be a usefulresource for future research on this pathogen, in parti-cular for its symbiotic association with mountain pinebeetle and interaction with the chemical defenses ofhost trees.Antisense transcripts may be involved in controllinggene expression [27,28]. We estimated that ~19% of G.clavigera ULs overlap with another UL from the oppo-site genome strand, and so potentially represent anti-sense transcripts. Our analysis indicated, that in mostcases contigs containing forward and reverse assembledreads despite unidirectional read orientation (FR con-tigs) were assemblies of transcripts from overlappinggenes. Therefore, FR-filtering can help identify assemblyproblems as well as potential antisense transcripts in denovo assembled unigene collections.Control of spore germination may be an importantfactor in G. clavigera bark beetle symbiosis and treepathogenicity. Transcript analysis of the spore libraryindicated that early germination processes may havebeen induced in our spore samples. We identified sev-eral protein chaperones, including two HSP70s (ULs355, 2425) and one cyclophillin D (UL 3423) thatshowed significant similarity to the A. nidulans proteinsXP_663614, XP_662733, and XP_662187, respectively.Proteome analyses revealed that these proteins accumu-lated in A. nidulans within 30 to 60 minutes after coni-dia germination [29]. Other ULs with high transcriptfrequencies in spores of G. clavigera encoded proteins-0.3 0 0.3 0.6 0.9 1.2 1.5 1.8 0 6 12 24 36 72 Log expression ratio Time (h) 3230 Gc_00052 Gc_00102 3233 3234 Figure 4 qRT-PCR results showing the expression levels of five unigene-locations at six time points after LPPE treatment relative totheir expression levels in cultures of G. clavigera treated with a methanol control solution. (3230 - MFS-transporter, Gc_00052 - P450,Gc_00102 - P450 reductase, 3233 - steroid monooxygenase, 3234 - beta-lactamase)Table 6 Unigene-locations of cluster 2, which is potentially involved in response to lodgepole pine phloem extractUnigene-location Best annotated protein match from the NCBI nonredundant protein database e-value p-value*3999 X-Pro dipeptidyl-peptidase (S15 family) protein [Neosartorya fischeri] 8E-113 ns4000 predicted protein [Sclerotinia sclerotiorum] 1E-52 ns4001 aromatic ring-opening dioxygenase family protein [Talaromyces stipitatus] 7E-81 ns4002 PutA family dehydrogenase [Talaromyces stipitatus] 2E-13 ns4003 cupin domain protein [Neosartorya fischeri] 3E-50 0.034004 short chain dehydrogenase [Aspergillus fumigatus] 4E-44 ns* Fisher’s exact p-value for the comparative analysis on transcript abundance between the mycelial culture (OCL01) and LPPE (OCL03) libraries.Hesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 7 of 11involved in energy metabolism and protein biosynthesis,which is consistent with respiration and protein bio-synthesis activated early in germination [30]. The genesidentified in this analysis may serve as markers for earlyspore germination. However, analysis of gene expressionin resting and germinating G. clavigera spores requiresfurther work.Genes whose transcripts were over-represented inresponse to LPPE treatment suggested a fungal oxidativestress response caused by host phenolic or other defensecompounds present in the phloem extract [31,32]. Forexample, we observed a large number of ESTs for Cu/Zn superoxide dismutase (SOD) in the LPPE treatmentlibrary (UL 1906). SOD catalyses the conversion ofsuperoxide radicals to molecular oxygen. SOD1 mutantsof N. crassa are sensitive to superoxide-generating com-pounds and have a high rate of spontaneous mutations[33]. In contrast, deleting SOD1 did not change the sen-sitivity of Claviceps purpurea to paraquat and did notaffect its pathogenicity [34], indicating that other detoxi-fying systems may be involved. Interestingly, our ESTdata revealed a second Cu/Zn superoxide dismutase (UL3288), which does not appear to be upregulated byLPPE treatment, suggesting that the two SODs mayhave different functions. Similarly, a peroxidase (UL588) overexpressed in the LPPE treatment library mayparticipate in scavenging reactive oxygen species. Alter-natively, it may be involved in detoxification of phenoliccompounds, as previous studies have shown that peroxi-dases can oxidize phenolic substrates and cleave aro-matic ring structures [20,35]. EST frequencies in theLPPE treatment library were also high for a nitroreduc-tase (UL 4803), but functions of this gene in host colo-nization are uncertain. Bacterial nitroreductases candetoxify nitrosubstituted compounds [36], includingnitrophenols [37] in reactions that produce superoxidesand induce oxidative stress [38,39]. In S. cerevisiae twonitroreductases have been identified [40], one of whichappears to act in the lipid-signaling pathway. Mutantsfor these enzymes showed extreme sensitivity to nitrosa-tive substances and have reduced superoxide dismutaseactivity [41]. The authors hypothesized that the nitrore-ductases may modulate antioxidant enzymatic activitiesin yeast.In filamentous fungi, functionally related genes andgenes involved in niche adaptation can occur in clus-ters. For example, secondary metabolite genes in A.fumigatus [42] and genes encoding secreted proteins inUstilago maydis [43] are clustered. For G. clavigera, weidentified two clusters of putatively functionally relatedgenes that were upregulated after LPPE treatment. Thefirst cluster contained five genes: a steroid monooxy-genase, a P450, a P450 reductase, a beta lactamase,and an MFS transporter. The steroid monooxygenaseand the P450 may participate in detoxification of LPPEcompounds by adding or altering functions of metabo-lites, similar for example to the P450s involved in fun-gal detoxification of pisatin [44]. The conserved co-localization of the P450 and the P450 reductase hasbeen noted in Aspergillus species [45] and led to thehypothesis that this reductase may be specific for theco-localized P450. The observed co-regulation of thesetwo G. clavigera genes in response to LPPE treatmentis consistent with this hypothesis. Whether the geneshowing high similarity to beta lactamase is involvedin ring cleavage of any LPPE metabolite remains to betested in future work. The second cluster contained anextradiol ring-cleavage dioxygenase and two oxidore-ductases, and may be involved in degrading aromaticcompounds such as phenolics. Further analyses ongenes in these two clusters are necessary to confirmfunctions and relationships.MethodsFungal isolates and culture conditionsThe eight fungal isolates used in this study are listed inTable 1. To induce a broad spectrum of genes, culturesfrom each isolate were grown on five different media(Table 2) that varied in nitrogen and carbon sources.For this, we first obtained young mycelial cultures byinoculating plates containing 1% malt extract agar(MEA, Oxoid, England) overlaid with cellophane with aspore suspension (12 plates/isolate, 5 × 105 spores/plate), and incubating them at ambient conditions for48 h. Then, we transferred the cellophane with theyoung mycelia to new plates that contained the differentmedia (2 plates/isolate/medium). The cultures weregrown for four days, and then harvested for RNAextraction, pooling the mycelia from the two plates ofeach isolate/medium combination.To identify genes expressed in mycelial culture inresponse to lodgepole pine phloem extract (LPPE) wegrew fungal cultures from the eight isolates on organicnitrogen media (as described above) for 48 h, sprayedthem with 200 μl of crude LPPE, and harvested themycelia for RNA extraction 48 h after initial exposureto LPPE. LPPE was prepared as follows: a lodgepolepine bolt from a freshly cut tree was frozen at -20°Cand cut into disks. The frozen phloem was separatedand ground in a mill with liquid nitrogen. The powderwas extracted in 80:20 methanol:water (2.5 ml/g) andsonicated at 4°C for 2 h. After centrifugation, the super-natant was removed and concentrated by 1/3 under agentle flow of nitrogen gas (final concentration ~50:50,MeOH:H2O). This concentrated crude extract wasstored at -20°C. To ensure uniform treatment of all cul-tures, a single preparation of LPPE was used for theexperiment.Hesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 8 of 11For the spore library, cultures of the reference isolateSLKW1407 were grown for seven days on 1% MEA.Spores were harvested in 5 ml water and filteredthrough a BD Falcon Cell strainer (40 μm) to removemycelial debris from the spore collection. The sporesuspension was centrifuged at 5,000 rpm for 20 min, thepellets were transferred to 1.5 ml microtubes and centri-fuged again for 2 min at 14,000 rpm. These tubes werestored at -80°C until RNA extraction.RNA isolation, cDNA library construction, cDNAsequencingTotal RNA was isolated separately from each of the 48isolate/media/LPPE treatment variants and the spores,respectively, using the RNeasy Mini Plant RNA isolationkit (Qiagen, Mississauga, ON, Canada). The total RNAsamples were then treated with DNaseI (Fisher Scienti-fic, Ottawa, ON, Canada), analyzed for quality by spec-trophotometer and agarose gel analysis, and quantified.To generate comparable treatments for the referenceisolate, and to ensure high sequencing efficiency, wepooled equal amounts of total RNA from the differentisolate/media/LPPE treatment variants and preparedfour isolate/treatment combinations: three treatmentswith the reference isolate, and one pool containing totalRNA from the other seven isolates (Table 3). From theresulting four RNA samples we purified poly(A+)mRNA using the Oligotex mRNA purification kit (Qia-gen), and generated first strand cDNA using SuperScriptIII reverse transcriptase (Invitrogen, Carlsbad, CA,USA), CDS-3M primer (Evrogen, Moscow, Russia), andSMART IV Oligonucleotide (Clontech, Mountain View,CA, USA). Second strand cDNA was prepared by longdistance-PCR with Phusion Hot Start DNA Polymerase(Finnzymes, Espoo, Finland). The cDNA samples weresplit into two fractions and one fraction was normalizedusing the TRIMMER-DIRECT cDNA normalization kit(Evrogen). For library construction, normalized andnon-normalized cDNA was digested with SfiI and sizefractionated. The fractions >500 bp were directionallycloned into the SfiI-digested pDNR-LIB vector (Clon-tech). A set of 25,000 clones randomly selected from alllibraries were partially sequenced on a 3730XL DNAanalyzer (Applied Biosystems, Carlsbad, CA, USA) fromthe 5’ and 3’ ends using the -21 M13 forward and M13reverse primers, respectively. Sequencing was done atthe British Columbia Cancer Agency Genome SciencesCentre (Vancouver, BC, Canada).qRT-PCR analysisFor quantitative real time PCR (qRT-PCR) we grew thereference isolate SLKW1407 on organic nitrogen media(as described above) and treated cultures with eitherLPPE, or a methanol control solution (50:50, MeOH:H2O). We harvested mycelia at 0, 6, 12, 24, 36, 48, and72 h after the beginning of treatment, and proceededwith qRT-PCR analysis following the protocol describedby DiGuistini et al. [13]. For each time point we pre-pared three biological and three technical replicates.The primers used to amplify the transcript of interestare shown in Table 7. Data collection and statistical ana-lysis were conducted with the Roche CFX 96-real-timePCR detection system (Roche, Quebec, CA).EST assemblyWe processed chromatograms and trimmed low qualitysequences using PHRED [46], requiring a minimum of100 bp with quality scores above PHRED 20. Usingcross-match (http://www.phrap.org/), we removed vectorsequences and filtered the remaining sequences forEscherichia coli. To account for possible contaminationfrom the lab environment we also screened for Sacchar-omyces cerevisiae, Agrobacterium, and Aspergillus spp.To the resulting set of 44,288 quality-filtered reads weadded 5,950 quality-filtered G. clavigera reads (isolateSLKW1407) from previous work [13]. Since the cDNAlibraries contained directionally cloned inserts,sequences obtained using the M13 reverse primer (3’reads) had a 3’-5’ orientation with respect to the originalmRNA. These 3’ reads were reverse-complemented toproduce a 5’-3’ oriented read collection. Then weremoved the polyA tails, which interfere in contigassembly, and discarded sequences with long mononu-cleotide stretches. The resulting set of 50,167 high-qual-ity reads was assembled with CAP3 [47] using defaultsettings except for a minimum overlap of 40 bp and aminimum identity of 95%.Because the reads were 5’-3’ oriented prior to assem-bly, most of the unigenes had a 5’-3’ orientation. Thiswas verified by comparing the input fasta files and theassembler’s ACE-format output files. Then, we screenedthe ACE file for contigs that contained reads in bothorientations. Because proteins are encoded on theTable 7 Primers used for quantitative RT-PCR analysis ofunigene locations (ULs)Target UL Primer name 5’-3’ sequence3230 R1718-F1 GTG TCC TCC ACC TTC CTC ACCR1718-R1 CGT GAC TCC CTT GAC TTC TGG GGc_00052 Gc_0052-F1 GCT CTC TCT TTT GCC GGC GGAGc_0052-R1 GAG CCG GCC AGC GTT GAG TAAGc_00102 Gc_00102-F1 TCG GAC GGA CTG CAA ACG CGGc_00102-R1 CGA GCC CCA GAA AAG GAC GAC3233 R1719-F1 CTC AGC AAC GGT CCA ACC TCR1719-R1 GTG CTT CTT CCA CTT GCG GG3234 F1718-F3 GAGCTGCTGACGCTCGATAAF1718-R3 ACCTGACTGCTGTCGTCCATHesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 9 of 11forward strand of the transcript, such contigs potentiallyrepresent misassembled unigenes.Unigene-locations on reference genomeThe unigenes were mapped against the G. clavigera gen-ome [24] using BLAT [48]. For each unigene, weselected the best hit to the genome, and recordedsequence similarity (%) and unigene alignment length(%). Since all unigenes were 5’-3’ oriented they mappedto the genome strand that encoded the respective gene.To group unigenes that represented the same gene, wegenerated unigene-locations (ULs) based on strand-spe-cific overlap of unigenes on the genome, and linkinginformation from unassembled 5’-3’ clone pairs. We ver-ified unigene assembly by mapping all reads to the gen-ome with BLAT and testing whether the unassembledreads of a contig mapped to the same genome locationas the contig.Unigene annotationFor annotation, all unigenes were compared to thenon-redundant NCBI protein database using BLAST(NCBI, Bethesda, MD, USA; min e-value 1.0 × 10-4).We used custom Perl scripts to capture the bestBLAST hit on the forward frame and determine themost likely open reading frame (ORF) for eachsequence. For the latter, all ORFs longer than 25amino acids were identified using CLC GenomicsWorkbench (CLC bio, Aarhus, Denmark). If thesequence had a significant BLAST match on the for-ward frame, the best ORF covering that match and themost likely transcription start and stop were deter-mined, keeping track of 5’ and 3’ ORF truncations. Ifno BLAST match was available, the longest ORF onthe forward frame was selected for the sequence. Inaddition, unigenes were annotated with InterPro IDsand Gene Ontology terms using InterProScan (EBI,Cambridge, UK), and assigned K-numbers with corre-sponding KEGG-BRITE classifications using KAAS[49]. To evaluate unigene representation in essentialmetabolic pathways, we conducted a reciprocal BLASTanalysis on the translated G. clavigera unigene ORFsagainst the annotated Magnaporthe grisea and Asper-gillus fumigatus protein datasets downloaded from theBroad Institute (http://www.broadinstitute.org/).Statistical analysisWe identified potentially differentially expressed genesby comparing read frequencies in the non-normalized,reference isolate cDNA libraries constructed from(i) mycelial cultures, (ii) cultures treated with LPPE, and(iii) spores. To account for unigene redundancy pergene we assessed library-specific read frequencies perUL rather than per unigene. Also, we counted only oneread per transcript, and ignored reverse-assembled readsin contigs. After normalizing the read counts, we per-formed pair wise comparisons of libraries using a modi-fied Fisher’s exact test.Additional materialAdditional file 1: Table S1. Excel file containing the supplementarytable with all unigene locations, their coordinates on the G. clavigeragenome, the ESTs that mapped to each UL, relevant annotations, andexpression analysis results.AcknowledgementsWe thank Thomas Wang for technical assistance with qRT-PCR and GregTaylor for reviewing the technical part of the manuscript. This work wassupported with grants from the Natural Sciences and Engineering ResearchCouncil of Canada (to JB and CB), and with funds from Genome Canada,Genome British Columbia, and Genome Alberta in support of the Tria 1 andTria 2 projects (http://www.thetriaproject.ca; to JB, CB, CIK, and SJMJ). Salarysupport for JB was provided, in part, by the UBC Distinguished UniversityScholar program.Author details1Department of Wood Science, University of British Columbia, Vancouver,Canada. 2Michael Smith Laboratories, University of British Columbia,Vancouver, Canada. 3BC Cancer Agency Genome Sciences Centre,Vancouver, Canada.Authors’ contributionsUH performed the data analysis and drafted the manuscript. SD designedand performed experiments with the fungi and prepared the mRNA. CIK, MLand HH constructed the cDNA libraries. YW performed the qRT-PCR. TRDand NYL conducted the EST assembly. RAH directed EST sequencing. GRparticipated in drafting the technical parts of the manuscript. SJMJ, CB andJB conceived and directed the project. All co-authors critically reviewed andedited the manuscript. All authors read and approved the final manuscript.Received: 8 May 2010 Accepted: 4 October 2010Published: 4 October 2010References1. Reid RW, Whitney HS, Watson JA: Reactions of lodgepole pine to attackby Dendroctonus ponderosae Hopkins and blue stain fungi. Can J Bot1967, 45:1115-1126.2. Zipfel RD, de Beer ZW, Jacobs K, Wingfield BD, Wingfield MJ: Multi-genephylogenies define Ceratocystiopsis and Grosmannia distinct fromOphiostoma. Stud Mycol 2006, 55:75-97.3. Yamaoka Y, Hiratsuka Y, Maruyama PJ: The ability of Ophiostomaclavigerum to kill mature lodgepole pine trees. Eur J For Pathol 1995,25:401-404.4. Lee S, Kim JJ, Breuil C: Pathogenicity of Leptographium longiclavatumassociated with Dendroctonus ponderosae to Pinus contorta. Can J For Res2006, 36:2864-2872.5. Six DL: A comparison of mycangial and phoretic fungi of individualmountain pine beetles. Can J For Res 2003, 33:1331-1334.6. Paine TD, Raffa KF, Harrington TC: Interactions among scolytid barkbeetles, their associated fungi and live host conifers. Annu Rev Entomol1997, 42:179-206.7. Krokene P, Nagy NE, Krekling T: Traumatic resin ducts and polyphenolicparenchyma cells in conifers. In Induced plant resistance to herbivory.Edited by: Schaller A. Springer, Dordrecht; 2008:147-169.8. Keeling CI, Bohlmann J: Genes, enzymes and chemicals of terpenoiddiversity in the constitutive and induced defense of conifers againstinsects and pathogens. New Phytol 2006, 170:657-675.9. Keeling CI, Bohlmann J: Diterpene resin acids in conifers. Phytochem 2006,67:2415-2423.Hesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 10 of 1110. Blanchette RA, Farrell RL, Burnes TA, Wendler PA, Zimmerman W, Brush TS,Snyder RA: Biological control of pitch in pulp and paper production byOphiostoma piliferum. TAPPI J 1992, 75:102-106.11. Brush TS, Farrell RL, Ho C: Biodetoxification of wood extractives fromsouthern yellow pine by Ophiostoma piliferum. TAPPI J 1994, 77:155-159.12. Wang Z, Chen T, Gao Y, Breuil C, Hiratsuka Y: Biological degradation ofresin acids in wood chips by wood-inhabiting fungi. Appl EnvironMicrobiol 1995, 61:222-225.13. DiGuistini S, Ralph SG, Lim YW, Holt R, Jones S, Bohlmann J, Breuil C:Generation and annotation of lodgepole pine and oleoresin-inducedexpressed sequences from the blue-stain fungus Ophiostoma clavigerum,a mountain pine beetle-associated pathogen. FEMS Microbiol Lett 2007,267:151-158.14. Hergert HL: The flavonoids of lodgepole pine bark. J Org Chem 1956,21:534-53.15. Vercruysse SAR, Delcour JA, Dondeyne P: Isolation of quercetin, myricetin,and their respective dihydro-compounds by Sephadex LH-20chromatography. J Chrom 1985, 324:495-497.16. Matthews S, Mila I, Scalbert A, Pollet B, Lapierre C, Herve’ du Penhoat CLM,Rolando C, Donnelly DMXL: Method for estimation of proanthocyanidinsbased on their acid depolymerization in the presence of nucleophiles. JAgric Food Chem 1997, 45:1195-1201.17. Stolter C, Niemela P, Ball JP, Julkunen-Tiitto R, Vanhatalo A, Danell K,Varvikko T, Ganzhorn JU: Comparison of plant secondary metabolites anddigestibility of three different boreal coniferous trees. Basic Appl Ecol2009, 10:19-26.18. Witzell J, Martin JA: Phenolic metabolites in the resistance of northernforest trees to pathogens - past experiences and future prospects. Can JFor Res 2008, 38:2711-2727.19. Kocabas DS, Bakir U, Phillips SE, Mcpherson MJ, Ogel ZB: Purification,characterization and identification of a novel bifunctional catalase-phenol oxidase from Scytalidium thermophilum. New Biotechnol 2009, 25:S92-93.20. Band L, Ciofi-Baffoni S, Tien M: Lignin and Mn-peroxidase-catalyzedoxidation of phenolic lignin oligomers. Biochem 1999, 38:3205-3210.21. Hammer E, Schoefer L, Schäfer A, Hundt K, Schauer F: Formation ofglucoside conjugates during biotransformation of dibenzofuran bypenicillium canescens SBUG-M 1139. Appl Microbiol Biotechnol 2001,57:390-394.22. McCue P, Shetty K: Role of carbohydrate-cleaving enzymes in antioxidantmobilization from whole soybean fermented with Rhizopus oligosporus.Food Biotechnol 2003, 17:27-37.23. Nicholson RL, Hipskind J, Hanau RM: Protection against phenol toxicity bythe spore mucilage of Colletotrichum graminicola, an aid to secondaryspread. Physiol Mol Plant Pathol 1989, 35:243-252.24. DiGuistini S, Liao NY, Platt D, Robertson G, Seidel M, Chan SK, Birol I,Holt RA, Hirst M, Mardis E, Marra MA, Hamelin RC, Bohlmann J, Breuil C,Jones SJM: De novo genome sequence assembly of a filamentousfungus using Sanger, 454 and Illumina sequence data. Genome Biol 2009,10:R94.25. Nagaraj SH, Deshpande N, Gasser RB, Ranganathan S: ESTExplorer: anexpressed sequence tag (EST) assembly and annotation platform. NucleicAcids Res 2007, 35:W143-147.26. Tang Z, Choi JH, Hemmerich C, Sarangi A, Colbourne JK, Dong Q: ESTPiper- a web-based analysis pipeline for expressed sequence tags. BMCGenomics 2009, 10:174.27. Makalowska I, Lin CF, Makalowski W: Overlapping genes in vertebrategenomes. Comput Biol Chem 2005, 29:1-12.28. Smith CA, Robertson D, Yates B, Nielsen DM, Brown D, Dean RA, Payne GA:The effect of temperature on Natural Antisense Transcript (NAT)expression in Aspergillus flavus. Curr Genet 2008, 54:241-69.29. Oh YT, Ahna CS, Kima JG, Roa HS, Lee CW, Kim JW: Proteomic analysis ofearly phase of conidia germination in Aspergillus nidulans. Fungal GenetBiol 2010, 47:246-253.30. Taubitz A, Bauer B, Heesemann J, Ebel F: Role of respiration in thegermination process of the pathogenic mold Aspergillus fumigatus. CurrMicrobiol 2007, 54:354-360.31. Takatsume Y, Maeta K, Izawa S, Inoue Y: Enrichment of yeast thioredoxinby green tea extract through activation of Yap1 transcription factor inSaccharomyces cerevisiae. J Agric Food Chem 2005, 53:332-337.32. Kim JH, Campbell BC, Mahoney N, Chan KL, May GS: Targetingantioxidative signal transduction and stress response system: control ofpathogenic Aspergillus with phenolics that inhibit mitochondrialfunction. J Appl Microbiol 2005, 101:181-189.33. Chary P, Dillon D, Schroeder AL, Natvig DO: Superoxide dismutase (sod-1)null mutants of Neurospora crassa: oxidative stress sensitivity,spontaneous mutation rate and response to mutagens. Genetics 1994,137:723-730.34. Moore S, De Vries OMH, Tudzynski P: The major Cu,Zn SOD of thephytopathogen Claviceps purpurea is not essential for pathogenicity.Molec Plant Pathol 2002, 3:9-22.35. Xia Z, Yoshida T, Funaoka M: Enzymatic degradation of highly phenoliclignin-based polymers (lignophenols). Eur Polym J 2003, 39:909-914.36. Bryant C, McElroy WD: Nitroreductases. In Chemistry and Biochemistry ofFlavoenzymes. Volume II. Edited by: Muller F. CRC Press: Boca Raton, FL;1991:291-304.37. Dai R, Chen J, Lin J, Xiao S, Chen S, Deng Y: Reduction of nitro phenolsusing nitroreductase from E. coli in the presence of NADH. J HazardMater 2009, 170:141-143.38. Peterson FJ, Mason RP, Hovespian J, Holtzman JL: Oxygen-sensitive and-insensitive nitroreduction by Escherichia coli and rat hepaticmicrosomes. J Biol Chem 1979, 254:4009-4014.39. Angermaier L, Simon H: On nitroaryl reductase activities in severalclostridia. H-S Z Physiol Chem 1983, 364:1653-1663.40. de Oliveira IM, Henriques JA, Bonatto D: In silico identification of a newgroup of specific bacterial and fungal nitroreductases-like proteins.Biochem Biophys Res Commun 2007, 355:919-925.41. de Oliveira IM, Zanotto-Filho A, Fonseca Moreira JC, Bonatto D, PegasHenriques JA: The role of two putative nitroreductases, Frm2p andHbn1p, in the oxidative stress response in Saccharomyces cerevisia. Yeast2010, 27:89-102.42. Nierman WC, Pain A, Anderson MJ, Wortman JR, Kim HS, Arroyo J,Berriman B, Abe K, Archer DB, Bermejo C, et al: Genomic sequence of thepathogenic and allergenic filamentous fungus Aspergillus fumigatus..Nature 2005, 438:1151-1156.43. Kämper J, Kahmann R, Bölker M, Ma LJ, Brefort T, Saville BJ, Banuett F,Kronstad JW, Gold SE, Müller O, et al: Insights from the genome of thebiotrophic fungal plant pathogen Ustilago maydis. Nature 2006,444:97-101.44. Matthews DE, VanEtten HD: Detoxification of the phytoalexin pisatin by afungal cytochrome P-450. Arch Biochem Biophys 1983, 224:494-505.45. Kelly DE, Krasevec N, Mullins J, Nelson DR: The CYPome (Cytochrome P450complement) of Aspergillus nidulans. Fungal Genet Biol 2009, 46:S53-61.46. Ewing B, Green P: Base-calling of automated sequencer traces usingphred. II. Error probabilities. Genome Res 1998, 8:186-194.47. Huang X, Madan A: CAP3: a DNA sequence assembly program. GenomeRes 1999, 9:868-877.48. Kent WJ: BLAT–the BLAST-like alignment tool. Genome Res 2002,12:656-664.49. Moriya Y, Itoh M, Okuda S, Yoshizawa A, Kanehisa M: KAAS: an automaticgenome annotation and pathway reconstruction server. Nucleic Acids Res2007, 35:W182-185.doi:10.1186/1471-2164-11-536Cite this article as: Hesse-Orce et al.: Gene discovery for the bark beetle-vectored fungal tree pathogen Grosmannia clavigera. BMC Genomics2010 11:536.Hesse-Orce et al. BMC Genomics 2010, 11:536http://www.biomedcentral.com/1471-2164/11/536Page 11 of 11


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items