UBC Faculty Research and Publications

Enterohepatic bacterial infections dysregulate the FGF15-FGFR4 endocrine axis Romain, Guillaume; Tremblay, Sarah; Arena, Ellen T; Antunes, L C M; Covey, Scott; Chow, Michael T; Finlay, B B; Menendez, Alfredo Oct 29, 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12866_2013_Article_2110.pdf [ 855.09kB ]
Metadata
JSON: 52383-1.0221453.json
JSON-LD: 52383-1.0221453-ld.json
RDF/XML (Pretty): 52383-1.0221453-rdf.xml
RDF/JSON: 52383-1.0221453-rdf.json
Turtle: 52383-1.0221453-turtle.txt
N-Triples: 52383-1.0221453-rdf-ntriples.txt
Original Record: 52383-1.0221453-source.json
Full Text
52383-1.0221453-fulltext.txt
Citation
52383-1.0221453.ris

Full Text

RESEARCH ARTICLE Open AccessEnterohepatic bacterial infections dysregulate theFGF15-FGFR4 endocrine axisGuillaume Romain1, Sarah Tremblay1, Ellen T Arena2,5, L Caetano M Antunes2,6, Scott Covey3, Michael T Chow4,7,B Brett Finlay2,3 and Alfredo Menendez1*AbstractBackground: Enterohepatic bacterial infections have the potential to affect multiple physiological processes of thebody. Fibroblast growth factor 15/19 (FGF15 in mice, FGF19 in humans) is a hormone that functions as a centralregulator of glucose, lipid and bile acid metabolism. FGF15/19 is produced in the intestine and exert its actions onthe liver by signaling through the FGFR4-βKlotho receptor complex. Here, we examined the in vivo effects ofenterohepatic bacterial infection over the FGF15 endocrine axis.Results: Infection triggered significant reductions in the intestinal expression of Fgf15 and its hepatic receptorcomponents (Fgfr4 and Klb (βKlotho)). Infection also resulted in alterations of the expression pattern of genesinvolved in hepatobiliary function, marked reduction in gallbladder bile volumes and accumulation of hepaticcholesterol and triglycerides. The decrease in ileal Fgf15 expression was associated with liver bacterial colonizationand hepatobiliary pathophysiology rather than with direct intestinal bacterial pathogenesis.Conclusions: Bacterial pathogens of the enterohepatic system can disturb the homeostasis of the FGF15/19-FGFR4endocrine axis. These results open up a possible link between FGF15/19-FGFR4 disruptions and the metabolic andnutritional disorders observed in infectious diseases.Keywords: Endocrine, Metabolism, Enterohepatic, Infection, FGF15, FGF19, FGFR4, βKlotho, Salmonella, ListeriaBackgroundAlteration of the host’s metabolism is common in infec-tious diseases; it can lead to patient malnutrition and theneed for nutritional support [1,2]. Infection-driven meta-bolic changes are characterized by an accelerated flux ofglucose, lipids, proteins and amino acids that may resultin net protein loss and diabetic-like hyperglycemia [1,2].Significant metabolic disorders have been observed innatural and experimental infections with the bacteriumSalmonella enterica, including changes of the lipid andprotein profiles and widespread hormonal imbalances[1,3,4]. In humans, Salmonella enterica serovar Typhicauses typhoid fever, a disease characterized by multi-organ bacterial colonization with common immunopa-thological manifestations in the gastrointestinal tract andthe hepatobiliary system [5].The molecular and physiological bases of the metabolicdisorders observed during infection are not fully under-stood. In this work, we examined the disruption of theenterohepatic fibroblast growth factor 15/19 (FGF15/19)-fibroblast growth factor receptor 4 (FGFR4) endocrineaxis during bacterial infections of the enterohepatic sys-tem. FGF15/19 (FGF15 in mice, FGF19 in humans) is anendocrine factor secreted by intestinal enterocytes [6].FGF15/19 has a crucial role in the control of whole bodyglucose and lipid metabolism and energy expenditure[7,8]. It is also a key regulator of de novo synthesis of bileacids via the repression of cholesterol 7 alpha hydroxylase(CYP7A1) expression in hepatocytes [9]. In addition,FGF15 represses the apical Na+-dependent bile acid trans-porter (ASBT) expression in hepatic cholangiocytes [10]and facilitates gallbladder filling by promoting gallbladdermuscle distension [11]. Through these functions, FGF15/19closes an important negative feedback loop in the regula-tion of bile acid homeostasis. Signaling to hepatic targetcells occurs through the interaction of FGF15/19 with thetyrosine kinase receptor fibroblast growth factor receptor* Correspondence: alfredo.menendez@usherbrooke.ca1Department of Microbiology and Infectious Diseases, Faculty of Medicineand Health Sciences, University of Sherbrooke, Cancer Research Pavilion, RmZ8-1072, 3201, rue Jean-Mignault, Sherbrooke, Québec J1E 4K8, CanadaFull list of author information is available at the end of the article© 2013 Romain et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.Romain et al. BMC Microbiology 2013, 13:238http://www.biomedcentral.com/1471-2180/13/2384 (FGFR4) and also requires the protein βKlotho. Micegenetically deficient for Fgf15, Fgfr4 or Klb (βKlotho) havesimilar biliary phenotypes with higher levels of CYP7A1and increased synthesis of bile acids [6,12-14]. ReducedFGF19 levels have been observed in patients with inflam-matory bowel disease [15] and chronic idiopathic bile aciddiarrhea [16]. On the other hand, patients with insulinresistance and non-alcoholic fatty liver disease, as well asextrahepatic cholestasis frequently display elevated plasmalevels of FGF19 [17,18].Using a model of murine typhoid fever, we demonstratethat Salmonella enterica infection triggers major alte-rations in the hepatic biliary function gene expression pro-gram, promotes accumulation of hepatic cholesterol andtriglycerides and leads to a significant reduction in physio-logical gallbladder bile volumes. In addition, Salmonellainfection causes a substantial decrease in the expression ofintestinal Fgf15, accompanied by a dramatic loss of hepaticFGFR4 and βKlotho. These disturbances appear to besecondary to hepatic inflammation. Given the importantrole of the FGF15/19-FGFR4 endocrine axis as a centralmetabolic regulator, these alterations may be a major fac-tor underlying the pathophysiology of bacterial infectiousdiseases.MethodsBacterial strains and mouse infectionsSalmonella enterica serovar Typhimurium strains SL1344(Smr) and SB103 (invA) [19] and Listeria monocytogenes10403 s (Smr) [20] were used in this study. Bacteria weregrown overnight at 37°C in LB supplemented with100 μg/mL streptomycin. Inoculum was prepared insterile HEPES 100 mM, NaCl 0.9%, pH 8.0. Animal pro-tocols were approved by the Animal Care Committees ofthe University of British Columbia and the University ofSherbrooke. Eight weeks-old female C57BL/6 mice (TheJackson Laboratory, Bar Harbor, USA) were infected orallywith 5 × 107 Salmonella SL1344, intravenously with5 × 102 Salmonella SB103 or with Listeria 10403 s (2 × 109bacteria orally and 104 intravenously). The animals werekept with food and water ad libitum through the durationof the study and were always sacrificed during the lightperiod (10:00 AM± 60 minutes). The bile was collected bygallbladder resection and draining by puncture. For bac-terial counts, tissues were homogenized using a MixerMill MM400 (Retsch GmbH) followed by plating of serialdilutions in LB plates containing 100 μg/mL streptomycin.All infection experiments were done in duplicate using atotal of 8–10 mice per group.Expression analysesIleum and liver samples were collected for mRNA andprotein analysis. The ileal samples were taken appro-ximately 2 cm away from the ileo-cecal junction; liversamples were taken from the central lobule. RNA was ex-tracted using the RNeasy kit (Qiagen) and cDNA was pre-pared using the Quantitech Reverse Transcription kit(Qiagen). Quantitative PCR (qPCR) were done on anEppendorf RealPlex2 system using the DyNamo SYBRGreen qPCR Kit (Thermo Scientific). All reactions weredone in 10 μl final volume with 40 cycles of 30 secondsdenaturing at 95°C, 30 seconds annealing at 60°C and30 seconds extension at 72°C (except the annealingtemperature for Ostβ: 62°C). The relative expressions werecalculated using the ddCt method and corrected forprimer efficiencies according to Pfaffl et. al. [21]. TheqPCR primers are listed in Table 1. Western blots wereperformed using total liver tissue lysates and anti-bodies against CYP7A1 (Abcam, ab65596, 1:1000),FGFR4 (Abcam, ab119378, 1:500), βKlotho (R&D,AF2619, 1:2000) and actin (SIGMA A4700, 1:1000).MicroscopyFor histological analysis, tissue sections were fixed in 10%buffered formalin, embedded in paraffin and stained withH&E. Alternatively, samples fixed in 3.5% paraformal-dehyde and frozen-embedded in OCT were used forimmunofluorescent microscopy as previously described[22]. Fluorescence was visualized using an Olympus IX81microscope.Cholesterol and triglyceride determinationsCholesterol and triglycerides were assayed in liverlysates. A total of 40-100 mg of liver was homogenizedwith an ultra turrax (setting 5, 4 times for 15 sec) in3 ml of chloroform:methanol (2:1), extracted twice withwater, and centrifuged for 15 minutes at 3000 g. For thetriglyceride assay 200 μl of the organic layer (lowerphase) was removed and evaporated under N2(g). 10 μlof Thesit (Sigma-Aldrich, St Louis, MO) was added andmixed under N2(g). Water (50 μl) was added and incu-bated at 37°C for 1 hr with intermittent vortexing. Ali-quots of 5 μl were assayed using the Serum TriglycerideDetermination kit (Sigma-Aldrich, St Louis, MO) modi-fied for a 96-well plate, calibrated with a trioleate(Sigma-Aldrich, St Louis, MO) standard curve. Thecholesterol assay was performed at the same time but500 μl of the organic layer (lower phase) was removedafter the centrifugation step and evaporated under N2(g).50 μl of isopropanol was then added to the dried downlipids and mixed by vortexing. Aliquots of 2 μl were thenassayed using the Cholesterol E kit (Wako ChemicalsUSA, Richmond, USA).Statistical analysesData processing and statistical analyses were performedusing GraphPad Prism5. Student’s t test was appliedto all sets of data for statistical comparisons betweenRomain et al. BMC Microbiology 2013, 13:238 Page 2 of 10http://www.biomedcentral.com/1471-2180/13/238Table 1 The genes analyzed in this study and the sequences of the qPCR primer setsGene Official symbol Product PrimersAbcg5 Abcg5 ATP-binding cassette, sub-family G (WHITE), member 5 TGTCAACAGTATAGTGGCTCTGCGTAAAACTCATTGACCACGAGAbcg8 Abcg8 ATP-binding cassette, sub-family G (WHITE), member 8 CTTGTCCTCGCTATAGCAACCTTTCCACAGAAAGTCATCAAAGCAsbt Slc10a2 Apical sodium-dependent bile acid transporter ACCTTCCCACTCATCTATACTGCAAATGATGGCCTGGAGTCCBsep Abcb11 Bile salt export pump CAACGCATTGCTATTGCTCGGTAGACAAGCGATGAGCAATGACCyp7a1 Cyp7a1 Cholesterol 7 alpha hydroxylase GGGAATGCCATTTACTTGGATCTATAGGAACCATCCTCAAGGTGFabp6 Fabp6 Fatty acid binding protein 6 GAATTACGATGAGTTCATGAAGCTTGCCAATGGTGAACTTGTTGCFgf15 Fgf15 Fibroblast growth factor 15 AGACGATTGCCATCAAGGACGGTACTGGTTGTAGCCTAAACAGFgfR4 Fgfr4 Fibroblast growth factor receptor 4 CTCGATCCGCTTTGGGAATTCCAGGTCTGCCAAATCCTTGTCFXR Nr1h4 Farnesoid X receptor (nuclear receptor subfamily 1, group H, member 4) GTTCGGCGGAGATTTTCAATAAGAGTCATTTTGAGTTCTCCAACACβKlotho Klb Beta Klotho AACAGCTGTCTACACTGTGGGATGGAGTGCTGGCAGTTGATCMdr1a Abcb1a ATP-binding cassette, sub-family B member 1a CCGATAAAAGAGCCATGTTTGCCTTCTGCCTGATCTTGTGTATCMdr1b Abcb1b ATP-binding cassette sub-family B member 1b GGACCCAACAGTACTCTGATCACTTCTGCCTAATCTTGTGTATCMdr2 Abcb4 Multidrug resistance protein 2 TTGTCAATGCTAAATCCAGGAAGAGTTCAGTGGTGCCCTTGATGMrp2 Abcc2 ATP-binding cassette, sub-family C (CFTR/MRP) member 2 GGCTCATCTCAAATCCTTTGTGTTTTGGATTTTCGAAGCACGGCMrp3 Abcc3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 GAACACGTTCGTGAGCAGCCATCCGTCTCCAAGTCAATGGCMrp4 Abcc4 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 TACAAGATGGTTCAGCAACTGGGTCCATTGGAGGTGTTCATAACNtcp Slc10a1 Sodium-taurocholate co-transporting polypeptide CGTCATGACACCACACTTACTGGATGGTAGAACAGAGTTGGACGOsta Osta Organic solute transporter alpha TCTCCATCTTGGCTAACAGTGGATAGTACATTCGTGTCAGCACOstb Ostb Organic solute transporter beta CCACAGTGCAGAGAAAGCTGCACATGCTTGTCATGACCACCAGShp Nr0b2 Small heterodimer partner AGTCTTTCTGGAGCCTTGAGCTTGCAGGTGTGCGATGTGGCRomain et al. BMC Microbiology 2013, 13:238 Page 3 of 10http://www.biomedcentral.com/1471-2180/13/238groups, the graphs show the means and the standarderrors of the mean.ResultsEnterohepatic infections downregulate the expression ofintestinal Fgf15The terminal ileum is the main site of production ofFGF15, it is also a major port of entry for Salmonella andtherefore, an important site for its pathogenesis. To deter-mine the effect of Salmonella infection on the homeo-static synthesis of FGF15, we collected tissue samplesfrom infected animals and analyzed the abundance ofFgf15 transcripts by qPCR. As shown in Figures 1A and1B, the level of Fgf15 transcripts inversely correlated withbacterial counts in the liver and the ileum, with a statis-tically significant decrease observed at mid-high infectionlevels. While H&E-stained sections from the ileum ofinfected animals did not show signs of pathological alte-ration (Figure 1C), staining of liver sections demonstrateda strong inflammatory response evidenced by large lesionswith widespread lymphocytic infiltration, extensive necro-sis often accompanied by local hemorrhage, and zones ofparenchymal degeneration characterized by disappearanceof hepatocytes (Figure 1D).FGF15 is synthesized by enterocytes [6], which can alsobe invaded by Salmonella [23]. However, the decrease inFgf15 expression was not associated with damage to theileal enterocyte layer (Figure 1C). This suggests that lossof ileal enterocytes is not the reason for reduced Fgf15transcript levels. Oral infections with Listeria monocyto-genes, an inefficient invader of the mouse intestinal epithe-lium [24,25], showed no significant liver colonization andTable 1 The genes analyzed in this study and the sequences of the qPCR primer sets (Continued)SrbI Scarb1 Scavenger receptor class B type 1 GAACTGTTCTGTGAAGATGCAGGCGTGTAGAACGTGCTCAGG36B4 Rplp0 Ribosomal protein, large, P0 TCTGGAGGGTGTCCGCAACCTTGACCTTTTCAGTAAGTGGThe top sequence of each set corresponds to the forward primer and the bottom one to the reverse. All reactions were done in 10 μl final volume with 40 cyclesof 30 seconds denaturing at 95°C, 30 seconds annealing at 60°C and 30 seconds extension at 72°C (except annealing temperature for Ostβ, which was 62°C).Figure 1 Oral infection with Salmonella typhimurium SL1344 decreases the expression of Fgf15 in the ileum. (A) bacterial counts ininfected ilea and livers; animals were arbitrarily grouped into low, medium and high infection levels (100-103, 104-105 and >106 cfu/mg,respectively roughly corresponding to 72, 96 and 120 hours post-infection; UI: uninfected). (B) relative levels of Fgf15 transcripts in the ilea ofinfected mice (data by qPCR). (C) H&E staining of ileum sections from representative uninfected and orally Salmonella-infected animals (ilealcolonization of the infected animal = 2.2 × 106 cfu/mg); scale bars are 200 μm. (D) H&E staining of liver sections from representative uninfectedand orally Salmonella-infected animals (liver colonization of the infected animal = 1.7 × 105 cfu/mg); scale bars are 800 and 400 μm.Romain et al. BMC Microbiology 2013, 13:238 Page 4 of 10http://www.biomedcentral.com/1471-2180/13/238large numbers of intestinal bacteria but not downregu-lation of Fgf15 expression (Figure 2A). In contrast, intra-venous infections with Listeria, which colonized the liverrapidly and triggered deccreases in the transcript levels ofbiliary function genes (Figure 2B), caused a significant re-duction in ileal Fgf15 expression (Figure 2A). These resultspoint to hepatic pathophysiology, rather than intestinalbacterial colonization, as the primary event driving down-regulation of intestinal Fgf15 expression.To establish the role of hepatic colonization and toprobe the involvement of bacterial enterocyte invasionin repressing Fgf15 expression, we carried out intrave-nous infections with the Salmonella invasion-deficientstrain SB103 following Menendez et al. [22]. In this typeof infection, Salmonella colonization of the hepatobiliarysystem occurs immediately whereas colonization of thegut is delayed by 72 to 96 hours [22]. Furthermore, thebacteria that eventually reach the intestines are unableto invade the enterocytes due to the invA mutation ofthis strain. As shown in Figure 2C, intravenous infectionwith Salmonella SB103 caused a reduction of Fgf15 tran-scripts abundance. Notably, such a decrease was observedwith a much lower intestinal bacterial burden than thosein oral infections with the wild-type strain (average 102 vs.107 cfu/mg, respectively). These results demonstrate thatcolonization of the hepatobiliary system by Salmonellarepresses the expression of intestinal Fgf15 and show thatenterocyte invasion by intestinal bacteria does not play amajor role on this effect.Transcription of Fgf15 in ileal enterocytes is trans-activated by the nuclear receptor FXR (Farnesoid XReceptor), upon its activation by bile acids [7]. Expressionof the FXR gene (Nr1h4) was not affected by Salmonella,regardless of the intestinal bacterial burden (data notshown). In contrast, the expression of other known intes-tinal FXR target genes, Fabp6 (Fatty acid binding protein6), Nr0b2 (Small heterodimer partner, Shp) [26] and Osta(Organic solute transporter alpha) [27], was decreased bySalmonella infection in a pattern similar to that of Fgf15with maximal, significant drops in highly-infected animals(Figure 3A). This suggests that activation of gene expres-sion mediated by FXR is impaired during infection.Colonization of the hepatobiliary system by Salmonellainduces local pathological damage and inflammation [22],Figure 2 Liver colonization drives the downregulation of ileal Fgf15 expression. (A) relative levels of Fgf15 transcripts in the ileum of miceinfected orally or intravenously with Listeria monocytogenes. (B) transcript levels of genes involved in liver biliary metabolism in mice infectedintravenously with Listeria monocytogenes, relative to the levels of uninfected animals (defined as 1, dashed line). (C) relative levels of Fgf15transcripts in the ilea of mice infected intravenously with Salmonella typhimurium SB103 (invA), at 120 hours post-infection. Data byqPCR, *p < 0.05.Romain et al. BMC Microbiology 2013, 13:238 Page 5 of 10http://www.biomedcentral.com/1471-2180/13/238which can result in impaired synthesis of bile acids andinflammation-induced cholestasis [28]. This may in turn,compromise intestinal FXR activation and lead to inhi-bition of Fgf15, Fabp6, Nr0b2 and Osta expression. To testwhether the depletion of bile acids would be sufficientto decrease Fgf15 expression in vivo, we fed uninfectedC57BL/6 mice with a diet supplemented with the bile acidsequestrant cholestyramine. As shown in Figure 3B micefed with cholestyramine did have significantly lower levelsof Fgf15 transcripts than mice fed with a normal diet.Second, we evaluated the effects of Salmonella infectionin bile production and flow. Gallbladder bile volumes weremeasured before and during infection; a significant reduc-tion in volume was observed 24 hours post-infection,which did not improved over the next 4 days (Figure 4A).An expression analysis of hepatic genes involved in bilesynthesis and secretion (Figure 4B), showed striking re-ductions in the transcript levels of the major transportersof bile acid and cholesterol (Abcb11, Slc10a1, Abcb1a,Abcg5 and Abcg8) and the induction of several genes in-volved in rescue from cholestasis. The mRNA (Figure 5A)and protein levels (Figure 5B) of CYP7A1, the rate-limiting enzyme in the neutral pathway of bile acids syn-thesis, were decreased by infection. This was accompaniedby a significant accumulation of hepatic cholesterol andtriglycerides (Figure 5C and Figure 5D), which collectivelysuggest interruption of bile synthesis and flow.Salmonella infection leads to depletion of the hepaticFGF15 receptor complexSignaling of FGF15 in hepatocytes requires the tyrosinekinase membrane receptor FGFR4 and the proteinFigure 3 Infection with Salmonella decreases the expression of FXR-target genes in the ileum. (A) Relative levels of Fabp6, Nr0b2 and Ostatranscripts in the ileum of mice orally infected with Salmonella typhimurium SL1344. Animals were arbitrarily grouped into low, medium and highinfection levels (100-103, 104-105 and >106 cfu/mg, respectively roughly corresponding to 72, 96 and 120 hours post-infection; UI: uninfected).(B) Fgf15 transcript levels in the ilea of uninfected mice fed 5% cholestyramine diet. Data by qPCR, **p < 0.01; ***p < 0.001; ****p < 0.0001.Figure 4 Salmonella infection perturbs the host’s hepatobiliary homeostasis. (A) bile volumes recovered from the gallbladders of miceorally infected with Salmonella at the indicated hours post-infection (hpi). (B) Transcript levels of hepatic genes involved in liver biliarymetabolism in mice infected with Salmonella, relative to the levels of uninfected animals (defined as 1, dashed line) at 24, 72 and 120 hourspost-infection. Data by qPCR.Romain et al. BMC Microbiology 2013, 13:238 Page 6 of 10http://www.biomedcentral.com/1471-2180/13/238βKlotho. To determine if Salmonella infection disturbsthe homeostasis of this pathway, we analyzed the levelsof FGFR4 and βKlotho in infected and uninfected livers.Figures 6A and 6B show that the transcript levelsof both Fgfr4 and Klb (βKlotho) were significantly de-creased by infection. In addition, the protein levels werealso reduced, as evidenced by western blot (Figure 6C).Two major FGFR4 bands were detected in uninfectedanimals, with apparent molecular weights of 115 and125 KDa, likely corresponding to the core-glycosylated(FGFR4115) and fully-glycosylated, functional (FGFR4125)forms of FGFR4, respectively [29]. Infection led to thedisappearance of FGFR4125 and a decrease of FGFR4115.Immunofluorescent staining of liver sections confirmedthe reduction of FGFR4 and βKlotho. Both proteins wereclearly detected in uninfected hepatocytes (Figure 6D);in contrast, hepatocytes from Salmonella-infected liverswere devoid of FGFR4 and βKlotho.DiscussionThe FGF19-FGFR4 endocrine axis is currently consid-ered a potential intervention point for the therapy ofcancer, gallstone disease, and metabolic disorders asso-ciated to the metabolic syndrome [7,30]. Experimentaladministrations of FGF19 and transgenic FGF19 micehave shown decreased liver fat content, improved hepa-tic and serum lipid profiles, and resistance to high-fatdiet-induced obesity [31-33]. In addition, FGF15/19 in-duces hepatocyte proliferation [34] and has been recentlyidentified as an important mediator of liver regenerationafter liver resection surgery [35]. Here we show thatSalmonella infection disturbs the homeostasis of theFGF15/19-FGFR4 axis by down-regulating the expressionof Fgf15, Fgfr4 and Klb. To our knowledge, these resultsconstitute the first demonstration of a pathophysiologicaleffect of bacterial infections over the FGF15/19-FGFR4endocrine axis.Infection modified both the ileal expression of Fgf15 andthe components of its hepatic receptor, which suggests asignificant functional shutdown of the pathway. Our datarules out a direct cytopathic effect of bacteria over ilealenterocytes as the major cause of Fgf15 mRNA reductions.Instead, it is apparent that the decline in Fgf15 expressionresults from impaired activation of FXR in the enterocytes.Our interpretation is strongly supported by the observedlow volumes of gallbladder bile and the decreased expres-sion of Fabp6, Ostα and Nr0b2 (Shp), all well-known FXRtargets. In addition, we show that the depletion of theintestinal bile acids pool by oral administration of the bileacid sequestrant cholestyramine is sufficient to signifi-cantly decrease ileal Fgf15 expression. Furthermore, intra-venous infections with a Salmonella invasion mutant andwith Listeria monocytogenes, both resulting in rapid hepa-tic colonization and pathophysiology, lead to reductions inFigure 5 Salmonella infection downregulates the neutral bile acid synthesis pathway. (A) relative levels of liver Cyp7a1 transcripts in miceinfected with Salmonella. (B) CYP7A1 western blot of liver lysates. (C) Cholesterol and (D) triglycerides accumulation in the liver of Salmonella-infected vs.uninfected mice, (*p < 0.05; ****p < 0.0001).Romain et al. BMC Microbiology 2013, 13:238 Page 7 of 10http://www.biomedcentral.com/1471-2180/13/238Fgf15 expression in the absence of significant ileal bac-terial colonization or enterocyte invasion.Salmonella infection induced a massive alteration of thehepatobiliary gene expression program. Remarkably, themRNA and protein levels of CYP7A1, the rate-limitingenzyme in the neutral pathway of bile acids synthesis weredecreased during infection, in spite of the lower levels ofFGF15 which would be expected to promote the upregu-lation of Cyp7a1 expression. These results reveal thecomplexities in the regulation of Cyp7a1 expression andindicates that the mechanisms of Cyp7a1 expression con-trol are hierarchical. Infection also triggered a significantreduction of FGFR4 and βKlotho, the two proteins in-volved in assembling the functional receptor for FGF15 inhepatocytes. The biology of FGFR4 and βKlotho had neverbefore been studied in the context of a bacterial insult,and our data suggest that their function can be severelycompromised by bacterial infections in vivo. The mecha-nisms underlying their downregulation are unclear atpresent but we anticipate that they are related to the pro-inflammatory cytokine burst that follows liver colonizationby bacteria. It has been recently reported that TNFαrepresses βKlotho expression in adipocytes [36]; thus it ispossible that a similar mechanism acts in hepatocytes.It is apparent that the dysregulation of the FGF15/19-FGFR4 endocrine axis components is not a generalpathogenic feature of all bacteria, as infections withthe enteric pathogen Citrobacter rodentium, the mousemodel for human EPEC and EHEC [37], did not modifythe expression of ileal Fgf15 (data not shown). Instead,this pathophysiological effect may be restricted to infec-tions displaying a relevant liver involvement. Furtherwork is still necessary to define the full impact of infec-tions in FGF15/19 function and to determine the under-lying molecular mechanisms.ConclusionsThrough the alteration of the hepatobiliary function,bacterial pathogens of the enterohepatic system dysregu-late the homeostasis of the FGF15/19-FGFR4 endocrineaxis. These revealing findings have important implica-tions for the understanding of the pathophysiology ofmicrobial diseases. Disruption of the FGF15/19-FGFR4pathway may be a contributing factor to the metabolicFigure 6 Salmonella infection causes the loss of the hepatic FGF15 receptor complex. (A) relative levels of Fgfr4 and (B) Klb (βKlotho)transcripts in the livers of mice infected with Salmonella. The animals analyzed in (A) and (B) are from the high-infection group in Figure 1, thedata is by qPCR, (**p < 0.01; ***p < 0.001). (C) FGFR4 and βKlotho western blots of liver lysates. (D) FGFR4 and βKlotho immunostaining ofuninfected (top panel) and Salmonella-infected (bottom panel) liver samples. The figure shows a single, representative hepatocyte in each case.Scale bar is 5 μm.Romain et al. BMC Microbiology 2013, 13:238 Page 8 of 10http://www.biomedcentral.com/1471-2180/13/238and nutritional disorders associated with infectiousdiseases.Competing interestsThe authors declare that they have no competing interests.Authors’ contributionsGR, ST, ETA and LCMA carried out Salmonella infections. GR performed thegene expression analysis, western blots and immunofluorescent microscopy.SC and ETA performed the cholesterol and triglyceride determinations. MTCcarried out the Listeria infections. BBF participated in the supervision of thestudy. GR and AM drafted the manuscript. AM conceived the study andsupervised its design, coordination and execution. All authors read andapproved the final manuscript.AcknowledgmentsWe thank Catherine Desrosiers, Melisange Roux and Elora Midavaine fortechnical help. This work was supported by grants to A.M. from the Fondsde Recherche du Québec-Santé (26710) and the Natural Sciences andEngineering Research Council of Canada (401949–2011), and to B.B.F. fromthe Canadian Institutes for Health Research. L. C. M. A. was funded by apostdoctoral fellowship from the Canadian Institutes of Health Research.A. M. is a member of the FRQS-funded Centre de Recherche CliniqueÉtienne-Le Bel.Author details1Department of Microbiology and Infectious Diseases, Faculty of Medicineand Health Sciences, University of Sherbrooke, Cancer Research Pavilion, RmZ8-1072, 3201, rue Jean-Mignault, Sherbrooke, Québec J1E 4K8, Canada.2Michael Smith Laboratories, The University of British Columbia, Vancouver,BC V6T 1Z4, Canada. 3Department of Biochemistry and Molecular Biology,The University of British Columbia, Vancouver, BC V6T 1Z3, Canada.4Department of Microbiology and Immunology, University of BritishColumbia, Vancouver, BC V6T 1Z3, Canada. 5Present address: Unité dePathogénie Microbienne Moléculaire Institut Pasteur, 28 rue du Dr Roux,F – 75724, Paris Cédex 15, France. 6Present address: Escola Nacional deSaúde Pública Sergio Arouca, Fundação Oswaldo Cruz, Rua LeopoldoBulhões, 1480, Rio de Janeiro, RJ 21041-210, Brazil. 7Present address: QuBiologics Inc, 887 Great Northern Way, Suite 138, Vancouver, BC V5T 4T5,Canada.Received: 18 June 2013 Accepted: 26 October 2013Published: 29 October 2013References1. Powanda MC, Beisel WR: Metabolic effects of infection on protein andenergy status. J Nutr 2003, 133(1):322S–327S.2. McGuinness OP: Defective glucose homeostasis during infection.Annu Rev Nutr 2005, 25:9–35.3. Khosla SN: Typhoyd fever. Its cause, transmission and prevention. New Delhi:Atlantic Publishers; 2008.4. Antunes LC, Arena ET, Menendez A, Han J, Ferreira RB, Buckner MM, Lolic P,Madilao LL, Bohlmann J, Borchers CH, et al: Impact of salmonella infectionon host hormone metabolism revealed by metabolomics. Infect Immun2011, 79(4):1759–1769.5. Parry CM: Epidemiological and clinical aspects of human typhoid fever.In Salmonella infections: clinical, immunological and molecular aspects.Edited by Mastroeni P, Maskell D. Cambridge, New York: CambridgeUniversity Press; 2006.6. Inagaki T, Choi M, Moschetta A, Peng L, Cummins CL, McDonald JG, Luo G,Jones SA, Goodwin B, Richardson JA, et al: Fibroblast growth factor 15functions as an enterohepatic signal to regulate bile acid homeostasis.Cell Metab 2005, 2(4):217–225.7. Jones SA: Physiology of FGF15/19. In Endocrine FGFs and Klothos. Edited byKuro-o M. New York: Landes Bioscience and Springer Science; 2012:171–182.8. Potthoff MJ, Kliewer SA, Mangelsdorf DJ: Endocrine fibroblast growthfactors 15/19 and 21: from feast to famine. Genes Dev 2012,26(4):312–324.9. Chiang JY: Bile acids: regulation of synthesis. J Lipid Res 2009,50(10):1955–1966.10. Sinha J, Chen F, Miloh T, Burns RC, Yu Z, Shneider BL: Beta-Klotho andFGF-15/19 inhibit the apical sodium-dependent bile acid transporter inenterocytes and cholangiocytes. Am J Physiol Gastrointest Liver Physiol2008, 295(5):G996–G1003.11. Choi M, Moschetta A, Bookout AL, Peng L, Umetani M, Holmstrom SR,Suino-Powell K, Xu HE, Richardson JA, Gerard RD, et al: Identification of ahormonal basis for gallbladder filling. Nat Med 2006, 12(11):1253–1255.12. Yu C, Wang F, Kan M, Jin C, Jones RB, Weinstein M, Deng CX, McKeehanWL: Elevated cholesterol metabolism and bile acid synthesis in micelacking membrane tyrosine kinase receptor FGFR4. J Biol Chem 2000,275(20):15482–15489.13. Ito S, Fujimori T, Furuya A, Satoh J, Nabeshima Y: Impaired negativefeedback suppression of bile acid synthesis in mice lacking betaKlotho.J Clin Invest 2005, 115(8):2202–2208.14. Kuro-o M: Klotho and betaKlotho. Adv Exp Med Biol 2012, 728:25–40.15. Lenicek M, Duricova D, Komarek V, Gabrysova B, Lukas M, Smerhovsky Z,Vitek L: Bile acid malabsorption in inflammatory bowel disease:assessment by serum markers. Inflamm Bowel Dis 2011, 17(6):1322–1327.16. Walters JR, Tasleem AM, Omer OS, Brydon WG, Dew T, le Roux CW: A newmechanism for bile acid diarrhea: defective feedback inhibition of bileacid biosynthesis. Clin Gastroenterol Hepatol 2009, 7(11):1189–1194.17. Schaap FG, van der Gaag NA, Gouma DJ, Jansen PL: High expression of thebile salt-homeostatic hormone fibroblast growth factor 19 in the liver ofpatients with extrahepatic cholestasis. Hepatology 2009, 49(4):1228–1235.18. Schreuder TC, Marsman HA, Lenicek M, van Werven JR, Nederveen AJ,Jansen PL, Schaap FG: The hepatic response to FGF19 is impaired inpatients with nonalcoholic fatty liver disease and insulin resistance.Am J Physiol Gastrointest Liver Physiol 2010, 298(3):G440–G445.19. Galan JE, Curtiss R 3rd: Distribution of the invA, -B, -C, and -D genes ofSalmonella typhimurium among other Salmonella serovars: invAmutants of Salmonella typhi are deficient for entry into mammaliancells. Infect Immun 1991, 59(9):2901–2908.20. Bishop DK, Hinrichs DJ: Adoptive transfer of immunity to Listeriamonocytogenes. The influence of in vitro stimulation on lymphocytesubset requirements. J Immunol 1987, 139(6):2005–2009.21. Pfaffl MW: A new mathematical model for relative quantification inreal-time RT-PCR. Nucleic Acids Res 2001, 29(9):e45.22. Menendez A, Arena ET, Guttman JA, Thorson L, Vallance BA, Vogl W,Finlay BB: Salmonella infection of gallbladder epithelial cells drives localinflammation and injury in a model of acute typhoid fever. J Infect Dis2009, 200(11):1703–1713.23. van Asten AJ, Koninkx JF, van Dijk JE: Salmonella entry: M cells versusabsorptive enterocytes. Vet Microbiol 2005, 108(1–2):149–152.24. Okamoto M, Nakane A, Minagawa T: Host resistance to an intragastricinfection with Listeria monocytogenes in mice depends on cellularimmunity and intestinal bacterial flora. Infection and immunity 1994,62(8):3080–3085.25. Lecuit M: Understanding how Listeria monocytogenes targets andcrosses host barriers. Clin Microbiol Infect 2005, 11(6):430–436.26. De Gottardi A, Touri F, Maurer CA, Perez A, Maurhofer O, Ventre G,Bentzen CL, Niesor EJ, Dufour JF: The bile acid nuclear receptor FXR andthe bile acid binding protein IBABP are differently expressed in coloncancer. Dig Dis Sci 2004, 49(6):982–989.27. Frankenberg T, Rao A, Chen F, Haywood J, Shneider BL, Dawson PA:Regulation of the mouse organic solute transporter alpha-beta,Ostalpha-Ostbeta, by bile acids. Am J Physiol Gastrointest Liver Physiol 2006,290(5):G912–G922.28. Kosters A, Karpen SJ: The role of inflammation in cholestasis: clinical andbasic aspects. Semin Liver Dis 2010, 30(2):186–194.29. Triantis V, Saeland E, Bijl N, Oude-Elferink RP, Jansen PL: Glycosylation offibroblast growth factor receptor 4 is a key regulator of fibroblastgrowth factor 19-mediated down-regulation of cytochrome P450 7A1.Hepatology 2010, 52(2):656–666.30. Wu X, Li Y: Therapeutic utilities of fibroblast growth factor 19. Expert OpinTher Targets 2011, 15(11):1307–1316.31. Tomlinson E, Fu L, John L, Hultgren B, Huang X, Renz M, Stephan JP,Tsai SP, Powell-Braxton L, French D, et al: Transgenic mice expressinghuman fibroblast growth factor-19 display increased metabolic rate anddecreased adiposity. Endocrinology 2002, 143(5):1741–1747.32. Fu L, John LM, Adams SH, Yu XX, Tomlinson E, Renz M, Williams PM,Soriano R, Corpuz R, Moffat B, et al: Fibroblast growth factor 19 increasesRomain et al. BMC Microbiology 2013, 13:238 Page 9 of 10http://www.biomedcentral.com/1471-2180/13/238metabolic rate and reverses dietary and leptin-deficient diabetes.Endocrinology 2004, 145(6):2594–2603.33. Bhatnagar S, Damron HA, Hillgartner FB: Fibroblast growth factor-19, anovel factor that inhibits hepatic fatty acid synthesis. J Biol Chem 2009,284(15):10023–10033.34. Wu X, Ge H, Lemon B, Vonderfecht S, Weiszmann J, Hecht R, Gupte J,Hager T, Wang Z, Lindberg R, et al: FGF19-induced hepatocyteproliferation is mediated through FGFR4 activation. J Biol Chem 2010,285(8):5165–5170.35. Uriarte I, Fernandez-Barrena MG, Monte MJ, Latasa MU, Chang HC, Carotti S,Vespasiani-Gentilucci U, Morini S, Vicente E, Concepcion AR, et al:Identification of fibroblast growth factor 15 as a novel mediator of liverregeneration and its application in the prevention of post-resection liverfailure in mice. Gut 2013, 62(6):899–910.36. Diaz-Delfin J, Hondares E, Iglesias R, Giralt M, Caelles C, Villarroya F:TNF-alpha represses beta-Klotho expression and impairs FGF21 action inadipose cells: involvement of JNK1 in the FGF21 pathway. Endocrinology2012, 153(9):4238–4245.37. Diez E, Zhu L, Teatero SA, Paquet M, Roy MF, Loredo-Osti JC, Malo D,Gruenheid S: Identification and characterization of Cri1, a locuscontrolling mortality during Citrobacter rodentium infection in mice.Genes Immun 2011, 12:280–290.doi:10.1186/1471-2180-13-238Cite this article as: Romain et al.: Enterohepatic bacterial infectionsdysregulate the FGF15-FGFR4 endocrine axis. BMC Microbiology2013 13:238.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitRomain et al. BMC Microbiology 2013, 13:238 Page 10 of 10http://www.biomedcentral.com/1471-2180/13/238

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.52383.1-0221453/manifest

Comment

Related Items