UBC Faculty Research and Publications

Genetic evidence links invasive monk parakeet populations in the United States to the international pet… Russello, Michael A; Avery, Michael L; Wright, Timothy F Jul 24, 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12862_2008_Article_786.pdf [ 809.28kB ]
Metadata
JSON: 52383-1.0221265.json
JSON-LD: 52383-1.0221265-ld.json
RDF/XML (Pretty): 52383-1.0221265-rdf.xml
RDF/JSON: 52383-1.0221265-rdf.json
Turtle: 52383-1.0221265-turtle.txt
N-Triples: 52383-1.0221265-rdf-ntriples.txt
Original Record: 52383-1.0221265-source.json
Full Text
52383-1.0221265-fulltext.txt
Citation
52383-1.0221265.ris

Full Text

ralssBioMed CentBMC Evolutionary BiologyOpen AcceResearch articleGenetic evidence links invasive monk parakeet populations in the United States to the international pet tradeMichael A Russello*1,2, Michael L Avery3 and Timothy F Wright4Address: 1Department of Biology and Physical Geography, University of British Columbia Okanagan, Kelowna, British Columbia V1V 1V7, Canada, 2Centre for Species at Risk and Habitat Studies, University of British Columbia Okanagan, Kelowna, British Columbia V1V 1V7, Canada, 3USDA Wildlife Services, National Wildlife Research Center, Gainesville, Florida 32641, USA and 4Department of Biology, New Mexico State University, Las Cruces, NM 88003, USAEmail: Michael A Russello* - michael.russello@ubc.ca; Michael L Avery - Michael.L.Avery@aphis.usda.gov; Timothy F Wright - wright@nmsu.edu* Corresponding author    AbstractBackground: Severe ecological and economic impacts caused by some invasive species make itimperative to understand the attributes that permit them to spread. A notorious crop pest acrossits native range in South America, the monk parakeet (Myiopsitta monachus) has become establishedon four other continents, including growing populations in the United States. As a critical first stepto studying mechanisms of invasion success in this species, here we elucidated the geographical andtaxonomic history of the North American invasions of the monk parakeet. Specifically, weconducted a genetic assessment of current monk parakeet taxonomy based on mitochondrial DNAcontrol region sequences from 73 museum specimens. These data supported comparative analysesof mtDNA lineage diversity in the native and naturalized ranges of the monk parakeet and allowedfor identification of putative source populations.Results: There was no molecular character support for the M. m. calita, M. m. cotorra, and M. m.monachus subspecies, while the Bolivian M. m. luchsi was monophyletic and diagnosably distinct.Three haplotypes sampled in the native range were detected within invasive populations in Florida,Connecticut, New Jersey and Rhode Island, the two most common of which were unique to M. m.monachus samples from eastern Argentina and bordering areas in Brazil and Uruguay.Conclusion: The lack of discrete morphological character differences in tandem with the resultspresented here suggest that M. m. calita, M. m. cotorra and M. m. monachus are in need of formaltaxonomic revision. The genetic distinctiveness of M. m. luchsi is consistent with previousrecommendations of allospecies status for this taxon. The geographic origins of haplotypes sampledin the four U.S. populations are concordant with trapping records from the mid-20th century andsuggest that propagule pressure exerted by the international pet bird trade contributed to theestablishment of invasive populations in the United States.Published: 24 July 2008BMC Evolutionary Biology 2008, 8:217 doi:10.1186/1471-2148-8-217Received: 18 January 2008Accepted: 24 July 2008This article is available from: http://www.biomedcentral.com/1471-2148/8/217© 2008 Russello et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 11(page number not for citation purposes)BMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217BackgroundThe introduction of exotic species into native ecosystemshas modified habitats, reduced species diversity andadversely altered ecosystem functioning across the globe[1]. In the United States only habitat degradation poses ahigher threat to endangered taxa [2]. In other regionsaround the world, however, as many as 80% of endan-gered species are threatened due to pressures from non-native species [3]. From an economic perspective, theenvironmental damage caused by the approximately50,000 alien-invasive species in the United States, cou-pled with the costs of controlling these species, exceeds$120 billion per year [1]. The severe ecological and eco-nomic impacts of invasive species render it imperative tounderstand the attributes that permit them to establishand spread within their expanded ranges.The monk parakeet (Myiopsitta monachus) is one of themost successful parrot invaders [4]. It has been histori-cally regarded as an agricultural pest in its native range inSouth America, as noted by Charles Darwin during hisvoyage on the H.M.S. Beagle:"A small green parrot (Conurus murinus; early syno-nym of M. monachus), with a grey breast, appears toprefer the tall trees on the islands to any other situa-tion for its building-place. A number of nests areplaced so close together as to form one great mass ofsticks. These parrots always live in flocks, and commitgreat ravages on the corn-fields. I was told that nearColonia 2500 were killed in the course of one year."[[5], Chapter VII, p. 101]Over the past century, the widespread introduction ofEucalyptus has facilitated the expansion of M. monachuspopulations in its native range [6-8]. In Argentina, thisrapid increase in native population sizes has been impli-cated in the loss of 2–15% of sunflower and corn yields,crop damages estimated by some sources to be as high asUS$1 billion per year [9,10]. In addition to rapid popula-tion growth within their endemic range, monk parakeetshave become broadly established on four other conti-nents, presumably due to their widespread presence in theinternational pet bird trade. Despite the rapid spread ofmonk parakeets around the globe and their potential asan agricultural pest, little is known about the geographicalhistory of the invasions. Such information may provideimportant insights into the mechanisms of invasion suc-cess and potential for future range expansions.The monk parakeet is distributed in its native range acrossthe lowlands of South America, east of the Andes fromBolivia to Patagonia [[11], Figure 1]. Four subspecies are[12]. The nominate, M. m. monachus, is the largest of thefour subspecies and is found in extreme southeast Brazil(Rio Grande do Sul), Uruguay and northeastern Argentina(provinces of Entre Rios, Santa Fe, Córdoba, south tonorthern Rio Negro). M. m. calita is distributed in westernArgentina from Salta province south to Rio Negro anddescribed as having bluer wings and a darker gray head.M. m. cotorra is distributed in southeast Bolivia (depart-ment of Tarija), Paraguay, southern Brazil (Mato Grossodo Sul), south to northern Argentina (provinces of For-mosa and Chaco). M. m. cotorra has been reported asbrighter green on the upper parts and less yellowish onthe abdomen than M. m. calita [13], yet their general lackof distinctiveness in these characters and their similarityin size has brought their status as separate taxonomic enti-ties into question [13]. Lastly, M. m. luchsi is geographi-cally and altitudinally isolated from the other subspecies,restricted to the arid, intermontane valleys of the eastAndes in Bolivia, from southern Cochabamba to northernChuquisaca [11]. In addition, M. m. luchsi exhibits distinc-tive plumage coloration, reported as generally brighterthan the other subspecies, with a bright yellow lowerbreast, paler underwings, a dark area at the base of theupper mandible, and a breast entirely pale grey withoutthe barred effect observed in the other three subspecies[11]. In contrast to the colonial, tree-nesting behavior ofall other monk parakeets, M. m. luchsi build single-cham-bered nests on cliffs. These behavioral and morphologicaldifferences led del Hoyo [14] to elevate this group toallospecies status (Myiopsitta luchsi), a designation that isnot widely recognized.In addition to the South American populations, natural-ized breeding populations of M. monachus have beenestablished in such disparate regions as the United King-dom, Puerto Rico, Kenya, Japan, Spain, Italy, Belgium,Czech Republic, and throughout the United States includ-ing growing populations in Florida, Texas and Connecti-cut [4,15-18]. The origin of initial invaders in the U.S. hasbeen traced back to purposeful and accidental releases ofindividuals from the pet trade for which approximately64,225 monk parakeets were imported between1968–1972 alone [4]. In general, U.S. naturalized popula-tions are a collection of disjunct colonies, most commonin southern and coastal regions, with an estimated 6,000to 200,000 individuals in residence nationally [19]. Oncefeared as a potentially devastating crop pest, M. monachusis still generally considered a moderate threat as popula-tions continue to grow exponentially [15,19]. A less pub-licized impact of the monk parakeet invasion has beentheir preference for power structures as nesting substrates.In 2001, an estimated 1,027 power outages in south Flor-ida were attributed to monk parakeet activities at anPage 2 of 11(page number not for citation purposes)currently recognized based on geographical variation inwing length, bill size, body mass and plumage colorationapproximate cost of $585,000 [20]. Moreover, the cost ofnest removal alone in south Florida was estimated at $1.3BMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217to $4.7 million over the past five years (2003–2007) [21].In addition to the financial impacts to energy providersand the communities they serve, monk parakeets mayhave ecological effects within the local ecosystems. Over-all, these real and potential impacts have resulted in thepresence of statewide controls or bans in over 15 states[22].The objectives of this study were to identify the taxonomicand geographic source(s) of the invasive populationsalong the eastern seaboard of the United States. As theaccuracy of monk parakeet taxonomy has been ques-tioned, we initially conducted a genetic assessment of thebiological validity of the four currently recognized sub-species of M. monachus by way of historical DNA analysisfrom museum specimens collected throughout the nativerange. This broad sampling of mitochondrial DNA line-mtDNA haplotype diversity in invasive populations inFlorida, Connecticut, New Jersey and Rhode Island. Ourresults suggest that these invasive populations are derivedfrom a localized area in eastern Argentina and borderingareas in Brazil and Uruguay within the described range ofM. m. monachus, the most commonly exported subspeciesfor the international pet trade.MethodsSamplingToepad tissue was obtained from 73 museum specimensof Myiopsitta monachus representing all four subspecies(M. m. calita, n = 9; M. m. cotorra, n = 16; M. m. luchsi, n =14; M. m. monachus, n = 38) courtesy of the AmericanMuseum of Natural History (AMNH). Blood samplesfrom four individuals of M. m. monachus collected in EntreRios, Argentina were also included in the sampling. InDistribution of Myiopsitta monachus across its native range in South AmericaFigure 1Distribution of Myiopsitta monachus across its native range in South America. Alternative shading denotes the indi-vidual ranges of the four subspecies [redrawn from [7]] including M. m. monachus (light gray), M. m. calita (black), M. m. cotorra (dark gray), and M. m. luchsi (striped). Localities of specimens sampled for this study are indicated by dots, with associated abbreviations following Table 1.M. m. luchsiM. m. cotorraM. m. monachusM. m. calitaPage 3 of 11(page number not for citation purposes)age diversity in the endemic range provides a referencedatabase by which to infer the origin and extent ofaddition, feather or tissue samples were obtained from 64individuals from four localities across the naturalizedBMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217range of M. monachus in the eastern United States. Specif-ically, muscle tissue was obtained from individuals culledin Miami, Florida (n = 43) as part of a management pro-gram by the local electric utility company. Feathers wereobtained from colonies sampled from different trees andareas in Bridgeport, Connecticut (n = 9) and Edgewater,New Jersey (n = 11). In addition, we sampled a singlemuseum specimen collected in Kent County, RhodeIsland (AMNH832643). Table 1 includes detailed collec-tion information for all samples while Figure 1 plots theindividual sampling localities within the native range ofM. monachus.Data collectionDNA was extracted from blood, tissue, and feather sam-ples using the DNeasy Tissue kit and manufacturer proto-cols (Qiagen, Inc.). Museum specimens were handled in adedicated ancient DNA facility using a modified QiagenDNeasy Tissue kit protocol [23]. Other necessary precau-tions were taken to prevent and detect contamination bycontemporary specimens, including use of extraction andPCR negative controls, PCR amplification of short, over-lapping fragments (see below), and confirmation of allunique haplotype sequences by way of cloning [24].A 558 basepair segment of the mitochondrial DNA(mtDNA) control region (CR) was amplified as a singlefragment using external primers LGlu and CR522Rb [25]for the DNA extractions from blood and feather samplesor, in the case of the DNA extractions from museum spec-imens, as a set of four overlapping fragments not exceed-ing 180 basepairs in length each [Lglu/MyiopCR1B(TGCCAATGGTTGCCCTAATAA); MyiopCR2A (GACATT-GCATGCTCGTCCTA)/MyiopCR2B (TGGAATTGGAGAG-GAGTGTTTT); MyiopCR3A(AGCAACTAAACCGAATGATCC)/MyiopCR3B(TGGGCCTGAAGCTAGTAACG); MyiopCR4A (CCACT-CACGAGAAACCATCA)/CR522Rb]. All PCR reactionswere carried out on an MJ Research DNA Engine thermalcycler in 25 μl reactions containing: ~20–50 ng of DNA,10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2,200 μM dNTPs, 0.5 μM of each primer and 0.5 U of Ampl-iTaq Gold DNA polymerase (Applied Biosystems).Cycling conditions for all primer pairs consisted of 95°Cfor 10 minutes, 35 cycles of 95°C for 30 seconds, 50°C for30 seconds, 72°C for 30 seconds, and a final extension of72°C for 7 minutes. Double-stranded PCR products weresequenced using Big Dye 3.1 terminators on an ABI 3730DNA sequencer (Applied Biosystems).Population genetic analysesPrevious work revealed duplication and concerted evolu-tion of the control region in Amazona and Pionus parrots[25]. Subsequent surveys of mtDNA gene order across theentire order of parrots via PCR across selected gene junc-tions has revealed that this duplication is absent in manyparrot species, including M. monachus (Schirtzinger E,Gonzalez L, Eberhard JR, Graves G, Wright TF, unpub-lished data). Furthermore, long-range PCR followed bysequencing of the entire mtDNA genome of M. monachusTable 1: Sampling of Myiopsitta monachus subspecies in native and naturalized rangesSubspecies N Country Province/Department/State Abbreviation Accession #†M. m. calita 3 Argentina Santiago del Estero SE 140653, 474808–4748091 Argentina Mendoza ME 1479315 Argentina Tucumán TU 474803–474807M. m. cotorra 5 Brazil Mato Grosso MG 127356–127359, 47480211 Paraguay Concepción PRG 149404, 320771–320777, 748687–748688, 811356M. m. luchsi 12 Bolivia Chuquisaca CH 139094–139096,139098–1391062 Bolivia Cochabamba CO 139107, 148194M. m. monachus 2 Argentina Santiago del Estero SE 140649, 1406512 Argentina Salta SA 474796–47479714* Argentina Entre Rios ER 779017–779019, 779025, 779037, 779059–779061, 779065, 77908313 Argentina Corrientes CR 793580–793581, 793586–793587, 793589, 793597–793598, 793603, 793605, 793616, 793631, 793633, 7936406 Brazil Rio Grande do Sul RGS 321247–321249, 321560–3215621 Uruguay Río Negro URG 474800Unknown†† 9 United States Connecticut CT n/a43 United States Florida FL n/a11 United States New Jersey NJ n/a1 United States Rhode Island RI 832643*Sampling includes four field-collected samples.† Page 4 of 11(page number not for citation purposes)Accession numbers of specimens sampled in the collections at the American Museum of Natural History or, in the case of Florida individuals, at the USDA National Wildlife Research Center.†† Individuals sampled in the naturalized populations are of unknown taxonomic affinity.BMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217has shown that it conforms to a typical avian gene orderwith a single control region (Schirtzinger E, Eberhard JR,Wright TF, unpublished data).Haplotypic (h) [26] and nucleotide (π) [26] diversity esti-mates were calculated based on mtDNA CR sequences asexecuted in ARLEQUIN [27]. Pairwise genetic distanceswere calculated in PAUP*4.0b10 [28] assuming theHKY+G model of nucleotide substitution as selectedaccording to the Akaike information criterion as imple-mented in Modeltest [29]. Levels of genetic divergencebetween samples were calculated with the fixation index(PhiST) [30] as executed in ARLEQUIN [27]. Because theHKY model is not implemented in ARLEQUIN the moreinclusive Tamura-Nei (TrN) [31] model with the sameparameters for ti/tv rate and α was used. Significance ofPhiST for all possible pairwise population comparisonswas assessed using 2,000 permutations. Tests for signifi-cant geographic structure among subspecies sampledacross the native range were conducted using analysis ofmolecular variance (AMOVA) [30]. MtDNA CR sequencealignments for all four subspecies were further employedto identify diagnostic nucleotide sites by means of popu-lation aggregation analysis [32]. The presence of charac-ters fixed within and differing among populations wasused as evidence to diagnose distinct units.Network and phylogenetic analysesSequences were unambiguously aligned in Clustal X [33]employing default settings for gap opening and extensioncosts. Genealogical relationships among all sampled hap-lotypes throughout the native range were reconstructed asa haplotype network using the statistical parsimonymethod of Templeton et al. [34] as implemented in TCS,version 1.06 [35]. Gaps were treated as a 5th characterstate. Networks are especially appropriate for inferringintraspecific gene genealogies because of the potential forextant ancestral nodes and multifurcating relationships[29].A Bayesian haplotype tree was reconstructed usingMrBayes 3.1 [36] assuming the HKY+G model of nucle-otide substitution as selected by Modeltest [29] asdescribed above. The orange-chinned parakeet (Brotogerisjugularis) was used as an outgroup to root the tree, as pre-vious phylogenetic studies have revealed species from thisgenus to be sister to M. monachus [37,38]. The Bayesianphylogenetic analysis ran four simultaneous chains for2.0 × 106 total generations, each using a random tree as astarting point, the default heating scheme, and saving atree every 100 generations for a total 20,000 trees. The first2,000 trees were discarded as burn-in samples and theremaining 18,000 trees were used to construct a majority-ues. Violation of a criterion of monophyly was used toindicate incorrect taxonomic assignment.ResultsWithin subspecies variationA total of 17 mtDNA CR haplotypes were recoveredamong the 77 individuals sampled from across the nativerange of the four described subspecies of M. monachus(GenBank Accession No. EU545521-EU545537). Thenumber of haplotypes identified ranged from four (M. m.calita) to eight (M. m. monachus), with levels of haplotypicand nucleotide diversity relatively consistent across thesubspecies (Table 2). Of the 17 detected haplotypes, threewere shared among a combination of M. m. calita, M. m.cotorra, and M. m. monachus. One shared haplotype waswidely distributed, sampled in individuals from all threeof these subspecies in disparate localities ranging fromnorthern (Tucumán province) and central (Entre Rios andMendoza provinces) Argentina, to Concepción, Paraguayand Mato Grosso, Brazil. All five haplotypes recovered forM. m. luchsi in Bolivia were unique to that subspecies.Overall, sequence divergence among M. monachus haplo-types recovered from the four subspecies ranged from0.20% to 1.66% (luchsi01/calita02) based on HKY+G dis-tances.Among subspecies differentiationGenetic variation across the samples was highly structuredwith significant levels of genetic variation distributedamong, rather than within, the four M. monachus subspe-cies (p < 0.0001; Table 3a). When the Bolivian M. m. luchsiwas removed from the AMOVA, the results were reversed,with the vast majority of variation distributed within(96.41%) rather than among (3.59) subspecies (Table3b). A similar pattern was revealed by the fixation indices,Table 2: Genetic variation within Myiopsitta monachus subspeciesSubspecies n No. of Haplotypic NucleotideHaplotypes† Diversity, h Diversity, πM. m. calita 9 4 0.58 0.0031(0.18)‡ (0.0022)M. m. cotorra 16 5 0.73 0.0020(0.079) (0.0015)M. m. monachus 38 8 0.77 0.0028(0.040) (0.0019)M. m. luchsi 14 5 0.66 0.0015(0.12) (0.0013)Unknown (U.S.A.) 64 4 0.52 0.0025(0.042) (0.0017)†Results based on 558 base pairs of the mtDNA control region. All haplotypes recovered for each subspecies are considered. Three haplotypes were shared among M. m. calita, M. m. cotorra, and M. m. Page 5 of 11(page number not for citation purposes)rule consensus tree and derive posterior probability val- monachus. All haplotypes sampled in U.S.A. were also recovered in native range (see text).‡Values in parentheses are the standard errors for h and π.BMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217with all pairwise comparisons involving M. m. luchsihighly significant (Table 3c). None of the pairwise com-parisons of M. m. calita, M. m. cotorra and M. m. monachusapproached significance. Likewise, M. m. luchsi was diag-nosably distinct from each of the other three subspecies,with the number of diagnostic characters detected rangingfrom three (M. m. cotorra, M. m. monachus) to five (M. m.calita) across the 558 basepairs of the mtDNA CR (Table3c).Genealogical relationshipsA single haplotype network was reconstructed withinwhich all haplotypes had a 95% probability of being par-simoniously connected (Figure 2). Overall, the networkwas characterized by reticulation and little structure to therecovered relationships (Figure 2). The only distinct clus-tering was of the four M. m. luchsi haplotypes sampled inBolivia, which were three to four steps different than thenearest M. m. monachus or M. m. cotorra haplotypes (Fig-ure 2). The remaining haplotypes constituted a mixedassemblage, exhibiting neither geographic structure norclustering patterns consistent with currently describedsubspecies boundaries. Results of a Bayesian phylogeneticanalysis mirrored those of the haplotype network, recon-structing a well-supported (posterior probability = 90; Fig-ure 3), monophyletic M. m. luchsi with the remainingthree subspecies forming a paraphyletic assemblage.Origin of naturalized populationsThree haplotypes were recovered from the 64 individualssampled in populations in the eastern United States, all ofwhich were identical to haplotypes detected in the nativerange of M. monachus. The most common haplotype,detected in the naturalized range at a frequency of 0.63,was one previously found unique to M. m. monachus(monachus01; Figure 3). Initially sampled in Entre Rios,Argentina and Rio Grande do Sul, Brazil, this haplotypewas fixed in the Bridgeport, CT (n = 9) and Kent County,RI (n = 1) samplings and was likewise detected at high fre-quencies in the Miami, FL (0.56) and Edgewater, NJ(0.55) populations. A second high frequency haplotypeunique to the M. m. monachus subspecies (monachus02;Figure 3) was found in the Miami, FL (0.40) and Edgewa-ter, NJ (0.45) populations. In the native range, themonachus02 haplotype was recovered over a wide geo-graphic area, found in Rio Grande do Sul, Brazil, Soriano,Uruguay, and throughout sampling localities in northernand central Argentina (Figure 3). Lastly, a haplotypeshared by M. m. monachus, M. m. calita and M. m. cotorrain the native range (shared01; Figure 3) was also found atvery low frequency in the Miami, FL population (0.03).Discussion and conclusionIn this study we employed extensive geographic samplingand historical DNA analysis to describe patterns of geneticTable 3: Genetic divergence among Myiopsitta monachus subspeciesa. Analysis of molecular variance including all subspeciesSubspecies Source of d.f. % of P-valuevariation‡ variationM. m. calita Among 3 61.23 <0.0001M. m. cotorra Within 74 38.77M. m. monachus Total 77M. m. luchsib. Analysis of molecular variance excluding M. m. luchsiSubspecies Source of d.f. % of P-valuevariation‡ variationM. m. calita Among 2 3.59 0.1369M. m. cotorra Within 61 96.41M. m. monachus Total 63c. Diagnostic characters and fixation indices*Subspecies M. m. calita M. m. cotorra M. m. monachus M. m. luchsiM. m. calita - -0.0370 0.0500 0.8062**M. m. cotorra 0 - 0.0422 0.8266**M. m. monachus 0 0 - 0.7757**M. m. luchsi 5 3 3 -‡ Among populations, within populations or total.* Number of diagnostic characters (below diagonal) and PhiST (above diagonal) based on mtDNA control region sequence data.** Indicates statistical significance (p < 0.001).Page 6 of 11(page number not for citation purposes)variation among subspecies of the invasive monk parakeetin its native range, assess current taxonomic designations,BMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217and infer the source(s) of introduced populations in theUnited States.Myiopsitta monachus taxonomyThe biological relevance of subspecies has been widelygrappled with the concept of subspecies. Although in earlywritings he clearly assigned evolutionary status to subspe-cies [40], later work directly acknowledged the subjectivityassociated with this level of taxonomic classification,explicitly stating that subspecies are not units of evolutionNetwork showing genealogical relationships among Myiopsitta monachus haplotypes sampled in the native rangeFigure 2Network showing genealogical relationships among Myiopsitta monachus haplotypes sampled in the native range. Haplotypes are connected with a 95% confidence limit. The size of each oval is proportional to the frequency of the haplotype in the analysis. White dots represent mutational steps separating the observed haplotypes. Different shades repre-sent the proportion of individuals of each subspecies exhibiting that particular haplotype (colors as in Figure 1).Page 7 of 11(page number not for citation purposes)debated since the 1950s [39]. Ernst Mayr, who wrote themost influential book on speciation analysis [40], also[41]. Continentally distributed avian subspecies are aprime example, with a recent survey finding that 97% lackBMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217the population genetic structure indicative of historicallyindependent units [42].We share the view of many that an accurate taxonomyshould reflect evolutionary history. The phylogenetic spe-cies concept (PSC) offers such an approach, directly link-ing patterns of evolution with species status [43]. Underthere is a parental pattern of ancestry and descent. Appliedto the monk parakeets, three (M. m. calita, M. m. cotorra,M. m. monachus) of four M. monachus subspecies lackeddiagnostic character support and violated a criterion ofmonophyly. The absence of genetic distinctiveness ofthese three taxa reflects the uncertainty surrounding thedifferences in size and plumage characteristics uponBayesian haplotype tree depicting relationships among sampled Myiopsitta monachus haplotypes relative to their geographic and taxonomic distributionsFigure 3Bayesian haplotype tree depicting relationships among sampled Myiopsitta monachus haplotypes relative to their geographic and taxonomic distributions. The names of each haplotype are as in Figure 2. Bayesian posterior prob-abilities (> 50%) are indicated above the branches. Each column in the associated table is a locality sorted by country with abbreviations following Table 1. Each row is a haplotype according to its placement in the tree on the left; the number of indi-viduals at that sampling locality exhibiting that particular haplotype is indicated in each cell. Shading represents the subspecies designation for the distribution of haplotypes according to Figure 1. Bolded italicized numbers indicate the distribution of indi-viduals collected in the naturalized range in the United States. Total number of sampled individuals exhibiting each haplotype (N) is denoted in the last column. For illustration purposes, accurate branch lengths leading to the outgroup are not shown (indicated by dashed line).Page 8 of 11(page number not for citation purposes)the PSC sensu Cracraft [43], a species is the smallest diag-nosable cluster of individual organisms within whichwhich they were initially described [11,13]. The lack ofdiscrete morphological character differences in tandemBMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217with the results presented here suggest that M. m. calita,M. m. cotorra and M. m. monachus are in need of formaltaxonomic revision.In contrast to the uncertainty associated with the descrip-tions of the other three subspecies, the controversy sur-rounding M. m. luchsi has been related to its relativedistinctiveness, and proposed elevation to allospecies sta-tus [14]. Restricted to the intermontane valleys in Bolivia,M. m. luchsi is morphologically distinct from the othersubspecies [11], including M. m. cotorra, despite the factthat their known ranges come within 175 km of eachother [44]. Moreover, M. m. luchsi is altitudinally distrib-uted between 1300–3000 m, in sharp contrast to othermonk parakeet taxa, which are routinely found below1000 m. Another unique characteristic involves the cliff-nesting behavior of M. m. luchsi, which contrasts with thecolonial, tree-nesting exhibited across the remainder ofthe range of M. monachus. This assorted evidence has beenused to elevate M. luchsi to allospecies status, forming asuperspecies with the remaining taxa of M. monachus [14].Although this taxonomic revision is not generally recog-nized, the results of the current study further highlight theuniqueness of this taxon. In addition to displayingbetween three and five diagnostic molecular charactersrelative to M. m. calita, M. m. cotorra, and M. m. monachus(Table 2), the Bolivian luchsi formed a well-supported,monophyletic group based on the mtDNA control regionsequence data (Figure 3). Collectively, the morphological,behavioral and genetic data support M. luchsi as a distinct,phylogenetic species [32,43] and suggest that a formal tax-onomic revision is in order.Origin of North American populationsOver the past 35 years, monk parakeets have beenrecorded on U.S. Christmas Bird Counts in 14 states: Con-necticut, Delaware, Florida, Georgia, Illinois, Massachu-setts, Nebraska, New Jersey, New York, Ohio, Oregon,Pennsylvania, Texas, and Washington D.C./Virginia [13].Other states where monk parakeet nesting has beenobserved include Alabama [45], California [46], Louisi-ana [18], North Carolina [47], South Carolina [48], andRhode Island [49]. The United States Fish and WildlifeService conducted an eradication campaign from 1970 to1975 that effectively eliminated populations in Californiaand reduced the naturalized range of monk parakeets inthe U.S. to seven localities in five states [50]. Since 1975,M. monachus populations in the U.S. grew exponentiallyand spread throughout the country to its present distribu-tion [19]. Currently, two of the largest naturalized popu-lations of M. monachus reside in Florida and southernConnecticut. Both appear to be expanding in size and geo-graphic distribution. The Florida population, in particu-recent study by Pruett-Jones et al. [51] estimating astatewide population size of 18,025 to 32,044.Despite multiple introductions and the widespread distri-bution of M. monachus in the U.S., we detected a low levelof haplotype diversity across four sampling localities inConnecticut, Florida, New Jersey and Rhode Island. Onlythree different haplotypes were recovered, the most com-mon of which (monachus01; 0.63) was found in all fourlocalities and was identical to a haplotype sampled fromM. m. monachus in a localized area in eastern Argentina inEntre Rios to Rio Grande do Sul, Brazil on the Uruguayanborder. The other high-frequency haplotype in the natu-ralized range (monachus02; 0.34) was also specific to M.m. monachus and was likewise sampled in Rio Grande doSul, Brazil, Soriano, Uruguay and a number of localities incentral and northern Argentina. These results are consist-ent with preliminary morphometric analyses (M. Avery,unpublished) as well as trapping records that indicate thatthe vast majority of birds captured for the pet trade wereM. m. monachus exported from eastern Argentina and Uru-guay [13]. The concordance between the trapping recordsand our genetic results support the idea that the invasionof monk parakeets has been facilitated, at least initially, bytheir widespread presence in the international pet birdtrade. As a likely source of large and repeated releaseevents, the international trade in parrots may have histor-ically exerted significant propagule pressure, generally akey determinant of invasion success in birds and othertaxa [52,53]. Nuclear data and additional geographicalsampling may provide important sources of historicalinformation for further testing this hypothesis.The Wild Bird Conservation Act of 1992 prohibits theimportation of monk parakeets into the United States,reducing the chances of future introductions of wild-caught individuals [54]. However, monk parakeets,known as Quaker parakeets in the pet trade, remain oneof the most popular cage birds and are widely bred andsold by aviculturists in the U.S. At the state level, locallaws vary, with some states banning the possession ofmonk parakeets while others placing no restrictions onthem. Nevertheless, this domestic trade in monk para-keets remains the most likely source of introductions intostates not currently reporting self-sustaining breedingpopulations [22].By and large, it is likely that non-native populations ofmonk parakeets will continue to grow. One reason is thatthe popularity of monk parakeets has in recent yearsextended to introduced populations. Efforts to removebirds and nests from electric utility structures in Connecti-cut, Illinois, Florida, Washington and New Jersey havePage 9 of 11(page number not for citation purposes)lar, continues to increase at an exponential rate, with a often met with substantial resistance by a vocal subset ofthe local communities. In addition, current control strate-BMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217gies have not effectively prevented the establishment andcontinued growth of naturalized populations in the U.S.and Western Europe, most notably in Spain [17]. Unlikeother psittacines, monk parakeets are not constrained bythe availability of nesting cavities. Rather, they constructnests of sticks and branches and they tend to select man-made structures as nesting substrates [55]. Furthermore,by exploiting feeding opportunities provided by humans,monk parakeets persist in even cold temperate winters[56]. Population growth and expansion seems assured, asimpractically large management efforts would be neededto reverse the trend [57]. Consequently, broader under-standing of the mechanisms of monk parakeet invasionsuccess and local adaptation constitute important areasfor future basic and applied research.Authors' contributionsMAR designed the study, collected samples (museum col-lections, Connecticut and Rhode Island invasive popula-tions), carried out the molecular studies, performed dataanalyses, and drafted the manuscript. MLA facilitatedsample collection in the U.S. populations, aided in inter-pretation of results, and helped draft the manuscript. TFWparticipated in the design of the study, aided in interpre-tation of results, and helped draft the manuscript. Allauthors read and approved the final manuscript.AcknowledgementsThis work was funded by an American Philosophical Society grant to MR. We thank the American Museum of Natural History for granting access to their collections and P. Sweet for his assistance sampling the specimens. J. Eberhard provided field-collected samples from Argentina and offered help-ful comments on the manuscript. J. Wright, D. Hoffmeier, and J. Lindsay with Florida Power and Light Company provided samples from south Flor-ida. The work further benefited from discussions with G. Amato and A. Caccone. C. Hyseni, S. Glaberman and E. Moseman aided in data and sample collection. An internal grant awarded by UBC Okanagan (MR) assisted in covering publication costs.References1. Pimentel D, Zuniga R, Morrison D: Update on the environmentaland economic costs associated with alien-invasive species inthe United States.  Ecological Economics 2005, 52(3):273-288.2. Wilcove DS, Rothstein D, Dubow J, Phillips A, Losos E: Quantifyingthreats to imperiled species in the United States.  Bioscience1998, 48(8):607-615.3. Armstrong S: Rare Plants Protect Capes Water-Supplies.  NewScientist 1995, 145(1964):8-8.4. Lever C: Naturalized birds of the world.  3rd edition. London ,Longman Scientific & Technical; 1987. 5. Darwin C: Journal of researches into the natural history andgeology of the countries visited during the voyage of H.M.S.Beagle.  London , Henry Colburn; 1839. 6. Gibson E: Further ornithological notes from the neighbour-hood of Cape San Antonio, Buenos Ayres. Part II.  Ibis 1919,11:495–537.7. Forshaw JM: Parrots of the world.  New Jersey , Princeton Univer-sity Press; 2006. 8. Navarro JL, Martella MB, Bucher EH: Breeding-Season and Pro-ductivity of Monk Parakeets in Cordoba, Argentina.  Wilson9. Davis LR: The monk parakeet: a potential threat to agricul-ture: University of California, Davis.   Edited by: Johnson WV,Marsh RE. ; 1974:253-256. 10. Iriarte JA, Lobos GA, Jaksic FM: Invasive vertebrate species inChile and their control and monitoring by governmentalagencies.  Revista Chilena De Historia Natural 2005, 78(1):143-154.11. Juniper T, Parr M: Parrots: a guide to parrots of the world.  NewHaven , Yale University Press; 1998. 12. Peters J: Checklist of birds of the world.  Volume III. Cambridge ,Harvard University Press; 1937. 13. Spreyer MF, Bucher EH: Monk Parakeet (Myiopsitta monachus).In The Birds of North America, No 322 Edited by: Poole A, Gill F. Phila-delphia , The Birds of North America, Inc.; 1998. 14. del Hoyo J, Elliott A, Sargatal J: Handbook of the birds of theworld, Volume 4. Sandgrouse to Cuckoos.  Cambridge , BirdlifeInternational; 1997. 15. Pruett-Jones S, Tarvin KA: Monk Parakeets in the United States:population growth and regional patterns of distribution: Uni-versity of California, Davis.   Edited by: Baker RO, Crabb AC. ;1998:55–58. 16. Butler CJ: Feral parrots in the continental United States andUnited Kingdom: Past, present, and future.  Journal of AvianMedicine and Surgery 2005, 19(2):142-149.17. Munoz AR, Real R: Assessing the potential range expansion ofthe exotic monk parakeet in Spain.  Diversity and Distributions2006, 12(6):656-665.18. Buhrman-Deever SC, Rappaport AR, Bradbury JW: Geographicvariation in contact calls of feral North American popula-tions of the Monk Parakeet.  Condor 2007, 109(2):389-398.19. Van Bael S, Pruett-Jones S: Exponential population growth ofMonk Parakeets in the United States.  Wilson Bulletin 1996,108(3):584-588.20. Avery ML, Greiner EC, Lindsay JR, Newman JR, Pruett-Jones S: Monkparakeet management at electric utility facilities in southFlorida: University of California, Davis.   Edited by: Timm RM,Schmidt RH. ; 2002:140-145. 21. Avery ML, Yoder CA, Tilman EA: Diazacon inhibits reproductionin invasive monk parakeet populations.  Journal of Wildlife Man-agement In press:.22. Stafford T: Pest risk assessment for the monk parakeet inOregon.   Oregon Department of Agriculture; 2003. 23. Russello MA, Brazaitis P, Gratten J, Watkins-Colwell GJ, Caccone A:Molecular assessment of the genetic integrity, distinctive-ness and phylogeographic context of the Saltwater crocodile(Crocodylus porosus) on Palau.  Conservation Genetics 2007,8(4):777-787.24. Wandeler P, Hoeck PEA, Keller LF: Back to the future: museumspecimens in population genetics.  Trends in Ecology & Evolution2007, 22(12):634-642.25. Eberhard JR, Wright TF, Bermingham E: Duplication and con-certed evolution of the mitochondrial control region in theparrot genus Amazona.  Molecular Biology and Evolution 2001,18(7):1330-1342.26. Nei M: Molecular Evolutionary Genetics.  New York , ColumbiaUniversity Press; 1987. 27. Schneider S, Roessli D, Excoffier L: Arlequin v2.000: A softwarefor population genetics data analysis.  Switerland , Genetics andBiometry Laboratory, University of Geneva; 2000. 28. Swofford DL: PAUP*: Phylogenetic Analysis Using Parsimony,v.4.0b10 .  Illinois Natural History Survey, Champaign ; 2002. 29. Posada D, Crandall KA: MODELTEST: testing the model ofDNA substitution.  Bioinformatics 1998, 14(9):817-818.30. Excoffier L, Smouse PE, Quattro JM: Analysis of Molecular Vari-ance Inferred from Metric Distances among DNA Haplo-types - Application to Human Mitochondrial-DNARestriction Data.  Genetics 1992, 131(2):479-491.31. Tamura K, Nei M: Estimation of the Number of NucleotideSubstitutions in the Control Region of Mitochondrial-DNAin Humans and Chimpanzees.  Molecular Biology and Evolution1993, 10(3):512-526.32. Davis JI, Nixon KC: Populations, Genetic-Variation, and theDelimitation of Phylogenetic Species.  Systematic Biology 1992,41(4):421-435.33. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: ThePage 10 of 11(page number not for citation purposes)Bulletin 1992, 104(3):413-424. CLUSTAL_X windows interface: flexible strategies for mul-Publish with BioMed Central   and  every scientist can read your work free of charge"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."Sir Paul Nurse, Cancer Research UKYour research papers will be:available free of charge to the entire biomedical communitypeer reviewed and published immediately upon acceptancecited in PubMed and archived on PubMed Central BMC Evolutionary Biology 2008, 8:217 http://www.biomedcentral.com/1471-2148/8/217tiple sequence alignment aided by quality analysis tools.Nucleic Acids Research 1997, 25(24):4876-4882.34. Templeton AR, Crandall KA, Sing CF: A Cladistic-Analysis of Phe-notypic Associations with Haplotypes Inferred from Restric-tion Endonuclease Mapping and DNA-Sequence Data .3.Cladogram Estimation.  Genetics 1992, 132(2):619-633.35. Clement M, Posada D, Crandall KA: TCS: a computer programto estimate gene genealogies.  Molecular Ecology 2000,9(10):1657-1659.36. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogeneticinference under mixed models.  Bioinformatics 2003,19(12):1572-1574.37. de Kloet RS, de Kloet SR: The evolution of the spindlin gene inbirds: Sequence analysis of an intron of the spindlin W and Zgene reveals four major divisions of the Psittaciformes.Molecular Phylogenetics and Evolution 2005, 36(3):706-721.38. Tavares ES, Baker AJ, Pereira SL, Miyaki CY: Phylogenetic relation-ships and historical biogeography of Neotropical parrots(Psittaciformes : Psittacidae : Arini) inferred from mitochon-drial and nuclear DNA sequences.  Systematic Biology 2006,55(3):454-470.39. Wilson EO, Brown WL: The subspecies concept and its taxo-nomic application.  Systematic Zoology 1953, 2:97-111.40. Mayr E: Systematics and the Origin of Species.  New York ,Columbia University Press; 1942. 41. Mayr E: Animal Species and Evolution.  Cambridge , Harvard Uni-versity Press; 1963. 42. Zink RM: The role of subspecies in obscuring avian biologicaldiversity and misleading conservation policy.  Proceedings of theRoyal Society of London Series B-Biological Sciences 2004,271(1539):561-564.43. Cracraft J: Species concepts and speciation analysis.  CurrentOrnithology 1983, 1:159–187.44. Lanning DV: Distribution and Nest Sites of the Monk Parakeetin Bolivia.  Wilson Bulletin 1991, 103(3):366-372.45. Summerour B: Monk parakeets (Myiopsitta monachus) nestingin Huntsville.  Alabama Birdlife 1990, 37:9-10.46. Hardy JW: Feral Exotic Birds in Southern-California.  WilsonBulletin 1973, 85(4):506-512.47. Simpson MB, Ruiz RC: Monk-Parakeets Breeding in Buncombe-County, North-Carolina.  Wilson Bulletin 1974, 86(2):171-172.48. McNair DB, Post W: Supplement to status and distribution ofSouth Carolina birds.  Charleston Museum Ornithological ContributionNo 8 1993.49. Enser RW: The atlas of breeding birds in Rhode Island (1982-1987).   Rhode Island Department of Environmental Management;1992. 50. Neidermeyer WJ, Hickey JJ: The monk parakeet in the UnitedStates, 1970-75.  American Birds 1977, 31(3):273-278.51. Pruett-Jones S, Newman JR, Newman CM, Lindsay JR: Populationgrowth of monk parakeets in Florida.  Florida Field Naturalist2005, 33:1-14.52. Blackburn TM, Duncan RP: Determinants of establishment suc-cess in introduced birds.  Nature 2001, 414(6860):195-197.53. Lockwood JL, Cassey P, Blackburn T: The role of propagule pres-sure in explaining species invasions.  Trends in Ecology & Evolution2005, 20(5):223-228.54. Wild Bird Conservation Act.  U.S.A. ; 1992. 55. Avery ML, Lindsay JR, Newman JR, Pruett-Jones S, Tillman EA:Reducing monk parakeet impacts to electric utility facilitiesin south Florida.  In Advances in Vertebrate Pest Management Volume4. Edited by: Feare CJ, Cowan DP. Fürth , Filander Verlag;2006:125-136. 56. South JM, Pruett-Jones S: Patterns of flock size, diet, and vigi-lance of naturalized Monk Parakeets in Hyde Park, Chicago.Condor 2000, 102(4):848-854.57. Pruett-Jones S, Newman JR, Newman CM, Avery ML, Lindsay JR:Population viability analysis of monk parakeets in the UnitedStates and examination of alternative management strate-gies.  Human-Wildlife Conflicts 2007, 1:35-44.yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralPage 11 of 11(page number not for citation purposes)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0221265/manifest

Comment

Related Items