UBC Faculty Research and Publications

BCoR-L1 variation and breast cancer Lose, Felicity; Arnold, Jeremy; Young, David B; Brown, Carolyn J; Mann, Graham J; Pupo, Gulietta M; Kum Khanna, Kum; Chenevix-Trench, Georgia; Spurdle, Amanda B Aug 16, 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-13058_2007_Article_1724.pdf [ 285.08kB ]
Metadata
JSON: 52383-1.0215985.json
JSON-LD: 52383-1.0215985-ld.json
RDF/XML (Pretty): 52383-1.0215985-rdf.xml
RDF/JSON: 52383-1.0215985-rdf.json
Turtle: 52383-1.0215985-turtle.txt
N-Triples: 52383-1.0215985-rdf-ntriples.txt
Original Record: 52383-1.0215985-source.json
Full Text
52383-1.0215985-fulltext.txt
Citation
52383-1.0215985.ris

Full Text

Open AccessAvailable online http://breast-cancer-research.com/content/9/4/R54Vol 9 No 4Research articleBCoR-L1 variation and breast cancerFelicity Lose1,2, Jeremy Arnold1, David B Young1, Carolyn J Brown3, Graham J Mann4, Gulietta M Pupo4, The Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer, Kum Kum Khanna1, Georgia Chenevix-Trench1 and Amanda B Spurdle11Cancer and Cell Biology Division, Queensland Institute of Medical Research, 300 Herston Road, Brisbane, Queensland, Australia, 40062School of Medicine, Central Clinical Division, University of Queensland, Royal Brisbane Hospital, Corner Butterfield Street and Bowen Bridge Road, Brisbane, Queensland, Australia, 40293Department of Medical Genetics, Molecular Epigenetics Group, University of British Columbia, 2329 West Mall, Vancouver, BC, Canada, V6T 1Z44Westmead Institute for Cancer Research, University of Sydney at Westmead Millennium Institute, Westmead Hospital, Darcy Road, Westmead, New South Wales, Australia, 2145Corresponding author: Amanda B Spurdle, Amanda.Spurdle@qimr.edu.auReceived: 30 Apr 2007 Revisions requested: 29 Jun 2007 Revisions received: 23 Jul 2007 Accepted: 16 Aug 2007 Published: 16 Aug 2007Breast Cancer Research 2007, 9:R54 (doi:10.1186/bcr1759)This article is online at: http://breast-cancer-research.com/content/9/4/R54© 2007 Lose et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.AbstractIntroduction BRCA1 is involved in numerous essentialprocesses in the cell, and the effects of BRCA1 dysfunction inbreast cancer carcinogenesis are well described. Many of thebreast cancer susceptibility genes such as BRCA2, p53, ATM,CHEK2, and BRIP1 encode proteins that interact with BRCA1.BCL6 corepressor-like 1 (BCoR-L1) is a newly describedBRCA1-interacting protein that displays high homology toseveral proteins known to be involved in the fundamentalprocesses of DNA damage repair and transcription regulation.BCoR-L1 has been shown to play a role in transcriptioncorepression, and expression of the X-linked BCoR-L1 genehas been reported to be dysregulated in breast cancer subjects.BCoR-L1 is located on the X chromosome and is subject to Xinactivation.Methods We performed mutation analysis of 38 BRCA1/2mutation-negative breast cancer families with male breastcancer, prostate cancer, and/or haplotype sharing aroundBCoR-L1 to determine whether there is a role for BCoR-L1 asa high-risk breast cancer predisposition gene. In addition, weconducted quantitative real-time PCR (qRT-PCR) onlymphoblastoid cell lines (LCLs) from the index cases from thesefamilies and a number of cancer cell lines to assess the role ofBCoR-L1 dysregulation in cancer and cancer families.Results Very little variation was detected in the coding region,and qRT-PCR analysis revealed that BCoR-L1 expression ishighly variable in cancer-free subjects, high-risk breast cancerpatients, and cancer cell lines. We also report the investigationof a new expression control, DIDO1 (death inducer-obliterator1), that is superior to GAPDH (glyceraldehyde-3-phosphatedehydrogenase) and UBC (ubiquitin C) for analysis ofexpression in LCLs.Conclusion Our results suggest that BCoR-L1 expressiondoes not play a large role in predisposition to familial breastcancer.IntroductionLess than 40% of familial breast cancer can be attributed tomutations in the high-risk genes BRCA1 and BRCA2 despitetheir high penetrance [1,2]. Syndromes displaying a predispo-sition for breast cancer such as Li-Fraumeni syndrome (result-ing from p53 gene mutations) [3], ataxia telangiectasia (ataxiatelangiectasia-mutated, or ATM, gene) [4], and Cowden syn-drome (phosphatase and tensin homologue, or PTEN, gene)[5] are estimated to account for no more than 10% of familialbreast cancer collectively, and additional moderate-risk genessuch as CHEK2 [6] and the recently reported BRIP1 (alsocalled BACH1) [7] and PALB2 [8,9] account for an evensmaller percentage. This leaves a large proportion of thegenetic basis of familial breast cancer unexplained.ATM = ataxia telangiectasia-mutated; BCoR-L1 = BCL6 corepressor-like 1; BRCAX = BRCA1/2 mutation-negative; DHPLC = denaturing high-per-formance liquid chromatography; DIDO1 = death inducer-obliterator 1; ER = estrogen receptor; ESE = exonic splice enhancer; GAPDH = glyceral-Page 1 of 12(page number not for citation purposes)dehyde-3-phosphate dehydrogenase; HDAC = histone deacetylase; kConFab = Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer; LCL = lymphoblastoid cell line; LOH = loss of heterozygosity; PCR = polymerase chain reaction; PR = progesterone receptor; qRT-PCR = quantitative real-time polymerase chain reaction; UBC = ubiquitin C.Breast Cancer Research    Vol 9 No 4    Lose et al.Interestingly, BRCA2, p53, ATM, CHEK2, and BRIP1 all inter-act with the multifunctional tumour suppressor, BRCA1.BRCA1-interacting proteins are logical breast cancer candi-dates for two reasons. First, they are likely to be involved insome of the important roles of BRCA1 such as genome main-tenance, transcription regulation, and cell cycle control and, ifmutated, may result in the same highly penetrant and damag-ing effect as a BRCA1 mutation. Second, mutations in theseinteracting genes may prevent BRCA1 from performing vitalfunctions, resulting in the same acute effect as a BRCA1mutation itself. Recently, Pagan and colleagues [10]described the characterisation and functional analysis of anovel BRCA1-interacting protein, BCL6 corepressor-like 1(BCoR-L1), that displays homology to several proteinsinvolved in pathways such as DNA damage repair (BARD1and Drosophila recombination repair protein 1) and transcrip-tion regulation (BCoR). Functional analysis thus far hasrevealed a role for BCoR-L1 in transcriptional corepression[10], placing it in a large group of proteins involved in the reg-ulation of proliferation and apoptosis [11]. It is well establishedthat uncontrolled overexpression of oncogenes and repres-sion or mutation of tumour suppressors contribute to tumouri-genesis by disturbing these vitally important and tightlycontrolled cellular processes [12].Evidence that BCoR-L1 operates primarily as a transcriptioncorepressor includes its ability to dramatically reduce reportergene expression through an interaction with the CtBP (car-boxyl-terminal binding protein) corepressor via a PLDLS motifand the fact that it associates with a number of class II histonedeacetylases (HDACs), factors also involved in transcriptionrepression [10]. Similarly, BRCA1 interacts with a number ofproteins involved in chromatin remodelling and transcriptioncontrol [13]. Like BRCA1, BCoR-L1 is also involved in main-taining genomic stability after DNA damage.In addition to its interaction with BRCA1, there is indirect evi-dence to suggest that BCoR-L1 may behave as a tumour sup-pressor. The BCoR-L1 protein appears to be expressedubiquitously at low levels (including breast tissue), with highlevels in reproductive tissues such as prostate and testes [10].However, BCoR-L1 expression was found to be decreased ina variety of breast cancer subjects, including BRCA1/2 muta-tion carriers and 'sporadic' breast cancer subjects [14]. Inaddition, the BCoR-L1 gene is located at Xq26.1, a regionreported to exhibit loss of heterozygosity (LOH) in manytumour types, including those of the breast [15-17]. BCoR-L1is subject to complete X inactivation [18], and interestingly, anincreased frequency of skewed X inactivation has beenreported in both ovarian [19] and early-onset BRCA1/2 muta-tion-negative (BRCAX) breast [20,21] cancer populations. Ithas been proposed that skewed X inactivation could providea novel mechanism for nonrandom expression of a mutanttumour suppressor gene and thereby contribute toWe sought to determine whether there is a role for BCoR-L1as a high-risk breast cancer predisposition gene by screeningthe coding region of the gene in 38 BRCAX breast cancerfamilies by means of the highly sensitive mutation detectiontechnique, denaturing high-performance liquid chromatogra-phy (DHPLC). The majority of families were chosen specificallyfor the presence of male breast cancer and/or early-onsetprostate cancer, in combination with being a high-risk femalebreast cancer family, for two reasons. We hypothesised thatan X-linked gene may be involved in these male cancerbecause males carry only one copy of the X chromosome andbecause BCoR-L1 has been found to be expressed highly inthe prostate [10]. A small number of breast cancer families inwhich the affected individuals showed haplotype sharingaround the BCoR-L1 locus were also included in this study. Inaddition, we conducted quantitative real-time PCR (qRT-PCR)on lymphoblastoid cell lines (LCLs) from members of thesefamilies and a number of cancer cell lines to assess the role ofBCoR-L1 expression in cancer and cancer families. Weassessed BCoR-L1 expression in LCLs from breast cancercases to determine whether BCoR-L1 expression was alteredin familial breast cancer cases and, if so, whether this wasassociated with the presence of genetic variation. Analysis ofX inactivation status of BCoR-L1 was also undertaken in orderto assess the likely mode of inheritance of BCoR-L1 as a can-didate tumour suppressor gene.Materials and methodsX inactivation status analysisX inactivation status was assessed by comparison of BCoR-L1 mRNA expression with human-specific primers (forward:CATATGATGTGACGGAATCTC; reverse: CCCTGGACTTT-GTTGGGCA) in mouse-human or hamster-human hybrid celllines containing a human active X chromosome (AHA-11aB1,A23-1aC1I5, t60-12, GM06318D, CHO-01416-M) or ahuman inactive X chromosome (LT23-1E2, t48-1a-1Daz4a,t11-4Aaz5, t75-2maz34-1a, t86-B1maz1b-3a, X8-6T2S1,CHO-01416-07). Comparison of expression levels betweenthe two groups of cell lines (containing an inactive versus inac-tive human X chromosome) was used to establish whetherBCoR-L1 is subject to X inactivation.SubjectsMultiple-case breast cancer families were ascertained throughthe Kathleen Cuningham Foundation Consortium for Researchinto Familial Breast Cancer (kConFab) [22]. Inclusion criteriafor all families in this study required that the family be classifiedas category 3 (high-risk) according to the National BreastCancer Centre guidelines [23] and that the family not possessany known mutations in the BRCA1 or BRCA2 genes(BRCAX) at the time of initiation of the study. Ethics approvalswere obtained from the ethics committees of the Peter Mac-Callum Cancer Institute (East Melbourne, Victoria, Australia)and the Queensland Institute of Medical Research (Brisbane,Page 2 of 12(page number not for citation purposes)tumourigenesis. Queensland, Australia), and all subjects gave written informedAvailable online http://breast-cancer-research.com/content/9/4/R54consent. Male breast cancer families selected for study (n =21) all contained one or more male breast cancer cases occur-ring on the same side of the family as at least three femalebreast cancer cases. A total of 11 male breast cancer casesand 16 female index cases (the youngest breast cancer casein the family from which biospecimens were available) werescreened from these families. Prostate/female breast cancerfamilies (n = 12) were chosen to contain at least one 'early-onset' prostate cancer case (cancer diagnosed at not morethan 60 years of age) on the same side of the family as threeor more female breast cancer cases. A total of 2 prostate can-cer cases and 12 index female breast cancer cases were ana-lysed from these families. Pedigrees were examined to ensurethe absence of male-to-male transmission of the disease inthese families because this would imply involvement of anautosomal gene. Additionally, families with female breast can-cer only (n = 7) were selected for analysis because they dem-onstrated haplotype sharing in the same chromosomal regionas BCoR-L1 (DXS1001, DXS1047, and DXS1227; LOD[logarithm of the odds] score greater than 0.5; data notshown) and are referred to as BCoR-L1 haplotype sharingfamilies. Two BCoR-L1 variants were found in one family andwere then genotyped in all family members from whichbiospecimens were available (n = 12). Mutation screening inthe kConFab cohort during the course of the study subse-quently identified BRCA2 mutation carriers in two male breastcancer families. Control subjects (46 females and 55 males)without cancer or a family history of cancer included subjectsascertained via the Queensland Blood Bank and a group ofgeriatric controls (average age of 80 years).Screening for BCoR-L1 variationBCoR-L1 is expressed in two isoforms. The most common iso-form is 1,711 amino acids in size and lacks exon 9, but the full-length protein (1,785 amino acids long) is derived from thealternative transcript. This study screened the entire codingregion of the BCoR-L1 gene, including exon 9. Primersencompassing the 13 coding exons of BCoR-L1 (and sur-rounding intronic regions; GenBank: exons 2 to 8: Z82208;exons 9 to 14: AL136450) were designed using Primer3 [24](Table 1). Exon 4 was too large to be amplified at an optimalsize for DHPLC analysis and was therefore analysed with 10overlapping polymerase chain reaction (PCR) fragments.'Standard' PCR reactions were carried out in a 20-μl mixturecontaining 15 ng of genomic DNA, and a final concentration of20 pmol of each primer, 200 μM each of dATP, dCTP, dGTP,and dTTP (Promega Corporation, Madison, WI, USA), 1.5 mMMgCl2, 1× PCR buffer, and 1 U AmpliTaq Gold polymerase(PE Applied Biosystems, Foster City, CA, USA). Any variationto the reaction is detailed in Table 1, along with a descriptionof 'touchdown' PCR amplification conditions. All products(and H2O controls) were visualised on a 1.5% agarose gel.Male samples were mixed with sequence-confirmed wild-typefemale PCR product (2:1) to encourage heteroduplexes toby heating to 95°C for 5 minutes and cooling to 60°C over aperiod of 30 minutes and then analysed on a Varian HelixDHPLC system (Varian, Inc., Palo Alto, CA, USA) at the rec-ommended melt temperature(s) as determined by the StanfordDHPLC Melt program [25] (Table 1). Analysis of results wascarried out using Star Workstation Reviewer software (version5, Varian) and any aberrant or shifted profiles were reamplifiedfor confirmation of the aberrant profile by repeat DHPLCbefore being sequenced using the Big-Dye (version 3.1)sequencing chemistry and PE Applied Biosystems 377sequencer.Loss of heterozygosity analysisLOH analysis was carried out on tumour blocks from theBCoR-L1 haplotype sharing family carrying the exon 4c.516T>C variant, because genotyping analysis revealed thatthe variant segregated with breast cancer. Macrodissectedtumour and adjacent cancer-uninvolved tissue DNA wasextracted from tumour blocks by means of a modified versionof the method of Levi and colleagues [26], and 2 μl of eachDNA (plus 20 ng of lymphocyte-derived germline DNA fromthe same subject) was then added to separate 20-μl PCRreactions, as detailed above. Primers used were (forward)TCAACACCCAAATGAGCAAA and (reverse) GAACA-GAGTGGGGCACAGAG to give a product of 242 basepairs. 'Touchdown' PCR was used with an annealing temper-ature of 50°C. PCR products were then purified (Qiagen Inc.,Valencia, CA, USA) and sequenced. LOH was evaluated byscoring the absence of the allele in the sequencing trace of thetumour, compared to matching germline DNA.BCoR-L1 expression analysisAll LCLs and normal and cancer cell lines were grown in RPMI1640 media with 10% fetal calf serum and 1% penicillin/strep-tomycin. Cell lines used are detailed in Figure 1a. RNA wasextracted from LCLs and cell lines using TriReagent (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer'sinstructions, and 1 μg of each sample was placed in a reversetranscription-PCR reaction using Superscript III RNAse H-Reverse Transcriptase as directed by the manufacturer (Invit-rogen Corporation, Carlsbad, CA, USA). qRT-PCR was thencarried out in a 15 μl reaction containing a final volume of 20ng of cDNA, 20 pmol of each primer, and 7.5 μl of PlatinumSYBR Green qPCR Supermix UDG (Invitrogen Corporation).Primer sequences used are detailed in Table 2. qRT-PCR con-ditions were 50°C for 2 minutes and 95°C for 2 minutes, 40cycles of 95°C for 20 seconds, 60°C for 15 seconds, and72°C for 20 seconds (acquiring) on a Rotor-Gene RG-3000Real-Time PCR machine (Corbett Research Australia, Mort-lake, New South Wales, Australia). All samples were run induplicate and were repeated if profiles did not replicateaccording to Rotor-Gene analysis software (version 5).Accordingly, the maximum standard deviation allowed for apair of duplicates ('Rep. Ct Std. Dev' in analysis software) wasPage 3 of 12(page number not for citation purposes)form for successful DHPLC analysis. Samples were denatured low (≤0.2). Expression levels were presented as the mean ofBreast Cancer Research    Vol 9 No 4    Lose et al.two duplicates, normalised to expression of either GAPDH (allsamples) or DIDO1 (death inducer-obliterator 1) (LCLs only).Expression levels of different groups were compared using theStudent t test (two-tailed).Assessment of expression controls for lymphoblastoid cell linesRT-PCR expression controls are typically chosen for their sta-bility of expression not only during various phases of the cellcycle, but also between different tissue types. However, it iswell known that these characteristics are very difficult toobtain. It has been reported that widely accepted expressioncontrols such as β-actin and GAPDH show unacceptable var-iation in expression in a large number of tissues and are there-fore not ideal controls [27]. We sought to find a suitableexpression control for analysis of expression in LCLs and com-and ubiquitin C (UBC). Cheung and colleagues [28] usedmicroarray analysis to establish the variability of expression of5,184 genes in LCLs taken from random individuals. We eval-uated the 100 least variably expressed genes for suitability asan LCL expression control for our project via a PubMed [29]search of the literature to identify the genes that (a) had notbeen reported to be associated with cancer of any kind and (b)were not in a region of LOH or linkage to any cancer. DIDO1was chosen according to these criteria.Results and DiscussionBCoR-L1 was selected as an interesting breast cancer candi-date gene for a number of reasons. BCoR-L1 interacts withthe important breast cancer susceptibility gene product,BRCA1, and there is the possibility that BCoR-L1 is involved,with BRCA1, in critical DNA repair and cell growth pathways.Table 1BCOR-L1 polymerase chain reaction conditionsExon PCRfragmentForward primer Reverse primer PCR conditions Annealingtemperaturea(°C)Size(bp)DHPLCtemperature(°C)2 2 GGCTGGCTGCTTTAACATTC CTCCCCAGGCCCTATTGTAT 2 U Taq, 40 pmol primers, 0.5 M betaine54 425 623 3 AGGTGGTGTTGGCTCAAATC CAACTCGACCAACCAGGTCT 40 pmol primers 54 404 624 4a TGTGCATGCTATCCTGTCGT GCTGGCAGAGGACTGAAGTT 40 pmol primers 54 450 624 4b GAACTGGAGTCCCTGTGGAG GAGGGTGGGGGTAGAAGGT 2 U Taq, 1 mM MgCl2, 1 M betaine 54 578 634 4c GTCCCCACTCCGGTTCTG CAGGGAGCGTAAGAGTGGAG Standard 54 442 634 4d TGGTATATATCCCGCCTCCA GTCCCTTCTGTTTGCTGCTC 40 pmol primers 54 436 57, 624 4e CTTCCAACTCCACAGCCTCT AATGGTGCTGATCAGTGCAG 2 mM MgCl2, 0.5 M betaine 58 459 624 4f CTCGCCCTTTGTCATCTTTC GCTGGTAGGTTTCCCATTGA 2 mM MgCl2 54 424 624 4g GACAGCCAAGCACAGTGAAA GCTGAGGGTCAAGAGGACAG Standard 54 452 624 4h CTCCTTCGTTCCAGAGCAGG CCAGGACCAGCTCATGGGAC Standard 59 314 614 4i AGAGAGCCACCTCTGCTCTG ACCCCTACGCTTTCCTGTTT Standard 54 435 624 4j AAGGTGGATGGTGATGTGGT GAGGGGACAGCAGGTCATTA Standard 54 457 625 5 GCAGCTCATGCCTCTAGGTC ATCCTTGCTCGCTCACCTTA Standard 54 446 626 6 GCAAAAGCGACCAAACTCTC AATTCCCAACTCGACACCTG 2 U Taq 56 423 607 7 TCCTCTGTACATCCCATCCAC GTAGAGATGCCCGAGGGTTC 2 mM MgCl2 63 483 628 8 AGGCGTTGCTTTTCTGTGTT CGCCACACACACCTTCTACA 2 mM MgCl2 57 332 609 9 ATGACCCTGGTGGATGGATA GGTTCAAGCACCAGAAGAGC Standard 62 378 6110 10 TGGGCAACAGAGTGAGACTG GCAGGCAAGGTCTTTTGAGT Standard 54 488 6211 11 CAGGTGGTTCCCTTGTCCTA GAGCTGTTCAAGGTGGAAGG Standard 54 399 6112 12 CTTCTCCCAATTCCCTTAGCC AAAGCCAGGGAGAAGAAAGG 0.5 M betaine 54 454 6013 13 CCCCTATATGCTCCCCTTACA TTGCCAGGTCTTCACTTCCT Standard 54 273 6014 14 TTCCTCCAGCCTCCTTCAAT CCCGGGACCTCTTGTCCT 40 pmol primers 54 595 62a'Touchdown' polymerase chain reaction (PCR) amplification conditions were as follows: denaturation at 94°C for 10 minutes, followed by two cycles of 94°C for 30 seconds, 30 seconds at the fragment annealing temperature (TA) + 6°C, and 72°C for 30 seconds. The conditions remained the same for the rest of the PCR except for the TA, which consisted of two cycles at (TA + 4°C), then two cycles at (TA + 2°C), and (finally) 35 cycles at the TA. A final extension step was conducted at 72°C for 7 minutes. bp, base pairs; DHPLC, denaturing high-performance liquid chromatography.Page 4 of 12(page number not for citation purposes)pared this with two widely used expression controls, GAPDH Indeed, mutations in repressor proteins have been implicatedAvailable online http://breast-cancer-research.com/content/9/4/R54in several diseases, including cancer [30]. For example, func-tional mutations in the transcriptional repressor Rb gene resultin dysregulation of cell cycle control [31]. In addition, theBCoR-L1 gene is located at Xq26.1, a region that exhibitsLOH in cancers, including breast cancer, and there is someevidence that BCoR-L1 mRNA expression is deregulated inbreast cancer. Skewed X inactivation has been reported inbreast and ovarian cancer subjects, indicating the possiblepresence of an X-linked cancer predisposition gene.X inactivation status analysisAnalysis of the hybrid cell lines showed that BCoR-L1 was notexpressed in 4/5 hybrid cell lines containing an inactive Xchromosome and was expressed at very low levels in the fifthcell line t48-1a-1Daz4a, using hybrids containing an active Xchromosome as reference. These results indicate that BCoR-L1 is subject to X chromosome inactivation in humans, whichis in agreement with the study of Carrel and Willard [18], whoshowed that the proximal UTP14A gene was expressed in 3/9 hybrids whereas BCOR-L1 (FLJ11362) was silent in all 9.As some of the hybrids in this study overlap, BCOR-L1 issilenced in 11/11 hybrids studied to date. The fact that BCoR-L1 is subject to X inactivation suggests that only a single muta-tional event in the BCoR-L1 gene would be required to initiatetumourigenesis.Variation in the BCoR-L1 geneDHPLC analysis of the coding region of BCoR-L1 in 48 mem-bers of 38 high-risk BRCAX breast cancer families revealedonly four different sequence variations (Table 3). A nucleotidevariation in exon 4 (c.516T>C; p.N172N) was found in onebreast cancer family known to share a haplotype at the BCoR-L1 locus. This variant was carried primarily by breast cancercases from this family (Figure 2). However, this c.516T>Cnucleotide substitution is not likely to be functional because itdoes not result in an amino acid change and is not predictedby in silico modelling to have any effect on mRNA structure(MFOLD [32]) and the wild-type T allele is not conserved ineither mouse or rat (PipMaker [33]). Investigation of exonicsplice enhancer (ESE) sites by means of ESEfinder (version2.0) [34] revealed that the variant allele produces an SC35site (of value 2.455), but this score is very close to the SC35revealed no change. Additionally, analysis of codon usage ofthe AAT codon (wild-type) in the human genome versus theAAC codon (variant) showed that the two codons are used atsimilar frequencies (16.8 versus 19.1/1,000 codons) [36].Finally, LOH analysis of the c.516T>C variant gave no evi-dence of the change being involved in tumourigenesis. LOHanalysis of tumour blocks and germline DNA from all fourbreast cancer cases in this family revealed either loss of thevariant allele or no LOH (data not shown), indicating that thisvariant is unlikely to be pathogenic.The intron 5 c.3608-156C>T variant was found only in mem-bers of the family who carried the exon 4 synonymous variantp.N172N (Figure 2). Due to its deeply intronic location,c.3608-156C>T is not predicted to have any functional effect.SpliceSiteFinder did not predict any changes to splicing as aresult of this nucleotide substitution [37]. Furthermore, mRNAexpression analysis (see below) of BCoR-L1 in two of the var-iant-carrying breast cancer cases and one wild-type non-breast cancer subject from this family revealed no evidence forconsistent differences in expression in LCLs. Relative to theunaffected wild-type family control, one variant carrier dis-played increased expression and the other displayeddecreased expression (Figure 3a,b; subjects marked with #).The two other variants detected in and around the BCoR-L1coding region in this study, c.625G>A (p.G209S) andc.5075+21C>T, were found in similar frequencies in the con-trol sample. Similarly, there were no major differencesbetween groups when the study sample was divided into malebreast, prostate, or BCoR-L1 haplotype sharing families.Although the exon 4 p.G209S variant is a missense aminoacid substitution, this change is predicted by SIFT (SortingIntolerant From Tolerant) to be 'tolerated' [38]. p.G209S isalso located in a region of BCoR-L1 that is not thought to beinvolved in BRCA1 interaction or transcription repression [10].Additionally, qRT-PCR analysis of BCoR-L1 expression inbreast cancer cases carrying the p.G209S andc.5075+21C>T variants showed no differences when com-pared with controls (Figure 3c,d), with overlapping standarddeviations for expression. Furthermore, both variants werepresent in individuals found to carry pathogenic BRCA2 muta-Table 2Quantitative real-time polymerase chain reaction primer sequencesGene GenBank ID Forward primer Reverse primerBCoR-L1 AL136450 GACCGACATCCTGAACATCC ATAGGACAGCAGGAGCCAGAGAPDH NT_009759 CTGCACCACCAACTGCTTAG GTCTTCTGGGTGGCAGTGATUBC NM_021009 CTTGTTTGTGGATCGCTGTG GTGTCACTGGGCTCAACCTCDIDO1 NT_011333 GCCTGAATGTGAGGGTTACG ACAATCGCCATGAAACCATTBCoR-L1, BCL6 corepressor-like 1; DIDO1, death inducer-obliterator 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; UBC, ubiquitin C.Page 5 of 12(page number not for citation purposes)threshold of 2.383. Similar analysis using Rescue ESE [35] tions during the course of the study.Breast Cancer Research    Vol 9 No 4    Lose et al.Overall, we detected very little variation in the coding region(and surrounding intronic region) of the BCoR-L1 gene in ourpopulation of familial cancer cases. The low level of variationdetected in the BCoR-L1 gene is consistent with reports thatthe X chromosome carries very little variation when comparedwith autosomal chromosomes [39-41].BCoR-L1 expression analysisTo further investigate the role of BCoR-L1 in familial breastcancer and male cancers, we undertook qRT-PCR expressionanalysis on LCLs from subjects previously screened forBCoR-L1 coding region variation. Alteration of BCoR-L1expression in LCLs from breast cancer-affected family mem-bers may indicate the presence of a regulatory mutation in anoncoding region of the gene. In addition, since variousHDACs are aberrantly expressed in a number of cancers sus-ceptible to treatment using HDAC inhibitors [42], includingbreast cancer [43], we speculated that BCoR-L1, given itsassociation with HDACs, might also be abnormally expressedin breast cancer cases. We thus assessed BCoR-L1 expres-sion in a range of breast, ovarian, and prostate cancer lines.DIDO1 expression in lymphoblastoid cell lines and cell linesTo investigate the suitability of DIDO1 as an LCL expressioncontrol, we analysed expression of DIDO1, GAPDH, andUBC in all LCLs and cell lines tested (Figure 4a,b).Interestingly, we found that DIDO1 expression varies consid-erably less in LCLs than GAPDH or UBC, with GAPDH andUBC showing similar levels of expression variation (Figure 4a).The interquartile range for DIDO1 was 2.5-fold and 2.7-foldless than those for UBC and GAPDH, respectively. In cancercell lines, all three expression control genes showed largeranges of expression levels across lines, with GAPDH per-haps showing the least variation (Figure 4b). Therefore,DIDO1 is an improved expression control for LCLs but hasvariability similar to the commonly used GAPDH control in nor-mal and cancer cell lines.BCoR-L1 expression in lymphoblastoid cell lines from breast cancer familiesTwenty-nine LCLs from breast cancer cases and their familymembers (23 families in total, including 14 with male breastcancer, 7 with prostate cancer, and 2 BCoR-L1 haplotypesharing families) were analysed for changes in BCoR-L1expression when compared with LCLs from 6 healthy controls(Figure 3a–d). Although expression of BCoR-L1 appeared tobe greatly variable, there were no apparent differences inexpression levels between breast cancer cases and controls,nor were there any differences between groups when segre-gated by family cancer type (that is, male breast, prostate, andso on). Likewise, there was no indication of any associationbetween BCoR-L1 genotype and expression. Skewed X chro-mosome inactivation data were available for a limited numberFigure 1BCoR-L1 expression in cancer and normal cell lines-  sion in cancer and normal cell lines. (a) BCoR-L1 expression in cancer and normal cell lines. (b) Mean and standard devi-ation of BCoR-L1 expression in cancer and normal cell lines. Normal cell lines: ovarian – OSE 64/96, HOSE 17.1; breast – SVCT, Page 6 of 12(page number not for citation purposes)of samples (n = 8). However, skewing did not correlate withBre80hTERT; prostate – RWPE1. BCoR-L1, BCL6 corepressor-like 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.Available online http://breast-cancer-research.com/content/9/4/R54Table 3Variation detected in the BCoR-L1 geneGeneregionPolymerasechain reactionfragmentNucleotidechangeAminoacidchangeNumberof totalheterozygousacasesMalebreastcancerfamiliesProstatecancerfamiliesBCoR-L1haplotypesharingfamiliesNumber ofheterozygouscontrolsPreviouslyreportedbExon 4 4a c.516T>C p.N172N 2/48 4.2% - - 2/9 22.2% 0/101 0% NoExon 4 4b c.625G>A p.G209S 6/48 12.5% 2/29c 6.9% 3/15 20.0% 2/9 22.2% 18/73 24.6% YesIntron 5 6 c.3608-156C>T - 2/48 4.2% - - 2/9 22.2% 0/99 0% NoIntron 13 13 c.5075+21C>T - 10/48 20.8% 5/29c 17.2% 3/15 20.0% 2/9 22.2% 26/102 25.5% YesThree samples were included in both the male breast cancer family and prostate cancer family categories because they fitted both criteria. Two samples were similarly included in both male breast cancer family and BCoR-L1 haplotype sharing family categories. aMales carrying a variant are homozygous. bReported in dbSNP or SNPper databases. cOne of the variant-carrying subjects possesses a mutation in BRCA2. BCoR-L1, BCL6 corepressor-like 1.Figure 2BCoR-L1 haplotype sharing family pedigree detailing carriers of the c.516T>C and c.3608-156C>T variantsBCoR-L1 haplotype sharing family pedigree detailing carriers of the c.516T>C and c.3608-156C>T variants.  = breast cancer-positive; c.516T>C and c.3608-156C>T-positive.  = breast cancer-negative; c.516T>C and c.3608-156C>T-positive.  = breast cancer-negative; c.516T>C and c.3608-156C>T-negative. Circle = female, square = male; subjects marked by small shapes were not available for genotyping. *** *0100,000200,000300,000400,000500,000600,000700,000wildtypewildtypewildtypewildtypewildtypewildtypewildtypewildtypewildtypewildtypewildtypec.5075+21C>Tc.5075+21C>Tc.5075+21C>Tc.5075+21C>Tc.5075+21C>Tc.625G>A (p.G209S)wildtypewildtypewildtypewildtypewildtype ND NDc.5075+21C>Twildtypec.625G>A (p.G209S)c.516T>C (p.N172N); c.3608-156C>T#c.516T>C (p.N172N); c.3608-156C>T; c.5075+21C>T#(breast cancer neg) wildtype#NDNDNDNDNDNDBCoR-L1 genotypeBCoR-L1expression(normalisedtoGAPDH)Male breast cancer families ControlsBCoR-L1 haplotypesharing familiesProstate cancer families0200,000400,000600,000800,0001,000,0001,200,0001,400,000wildtypewildtypewildtypewildtypewildtypewildtypewildtypewildtypewildtypewildtypewildtypec.5075+21C>Tc.5075+21C>Tc.5075+21C>Tc.5075+21C>Tc.5075+21C>Tc.625G>A (p.G209S)wildtypewildtypewildtypewildtypewildtype ND NDc.5075+21C>Twildtypec.625G>A (p.G209S)c.516T>C (p.N172N); c.3608-156C>T#c.516T>C (p.N172N); c.3608-156C>T; c.5075+21C>T#(breast cancer neg) wildtype#NDNDNDNDNDNDBCoR-L1 genotypeBCoR-L1expression(normalisedtoDIDO-1)Male breast cancer families ControlsBCoR-L1 haplotypesharing familiesProstate cancer families0100,000200,000300,000400,000500,000600,000Controls (6) All breast cancercases (29)Male breastcancer families(16)Prostate andbreast cancerfamilies (7)BCoR-L1haplotypesharing families(4)Wildtype BCoR-L1 cases (17)Cases withBCoR-L1c.5075+21C>T(5)Cases withBCoR-L1c.625G>A (2)Cases withBCoR-L1 varianthaplotype (2)BCoR-L1expression0100,000200,000300,000400,000500,000600,000700,000800,000Controls (6) All breast cancercases (29)Male breastcancer families(16)Prostate andbreast cancerfamilies (7)BCoR-L1haplotypesharing families(4)Wildtype BCoR-L1 cases (17)Cases withBCoR-L1c.5075+21C>T(5)Cases withBCoR-L1c.625G>A (2)Cases withBCoR-L1 varianthaplotype (2)BCoR-L1expressionPage 7 of 12(page number not for citation purposes)BCoR-L1, BCL6 corepressor-like 1.Breast Cancer Research    Vol 9 No 4    Lose et al.BCoR-L1 expression or genotype (data not shown). Resultscorrelating expression with sample source or samplegenotype were similar using GAPDH (Figure 3a,c) or DIDO1(Figure 3b,d) normalisation, although the decreased variabilityobserved in normal controls for DIDO1 normalisation sup-ported our earlier observations that DIDO1 is an improvedcontrol for LCL expression analysis. The standard deviation ofexpression in control LCLs was approximately 20% less forDIDO1 compared with GAPDH. Overall, it appears thatBCoR-L1 expression is not altered in familial breast cancercases, even for subgroups defined by male cancer type, and itis unlikely that there is any variation in the BCoR-L1 gene(detected or otherwise) which has a profound effect onexpression.BCoR-L1 expression in cancer and normal cell linesTo assess a possible role for BCoR-L1 in tumourigenesis, wealso analysed BCoR-L1 expression in various ovarian, breast,and prostate cancer and normal cell lines (Figure 1a,b). Mostnormal and cancer cell lines exhibited increased expressionlevels compared with LCLs. Once again, it was observed thatBCoR-L1 expression is highly variable in both cancer and nor-observed. There were no significant differences between themean BCoR-L1 expression in normal cell lines compared withcancer cell lines, but individual ovarian and breast cancer celllines showed significantly increased expression comparedwith the mean expression in normal cell lines. Markedly ele-vated levels of BCoR-L1 (P < 0.05) were observed for a totalof 4/10 ovarian cancer cell lines (OVCAR3, SKOV3, A2780,27/87; 4-fold to 13-fold upregulation compared with theHOSE17.1 normal ovarian epithelial control) and 2/13 breastcancer cell lines (BT20 and T47D; 3-fold and 4-fold upregula-tion compared with SVCT normal breast control). This wasinteresting, considering that skewed X inactivation has beenreported in ovarian cancer cases [19]. It would also seem tosuggest that dysregulation of expression in the form of upreg-ulation may play a role in tumourigenesis. However, a studyusing a BCoR-L1-containing Affymetrix microarray (Affymetrix,Santa Clara, CA, USA) did not provide any evidence forBCoR-L1 deregulation in ovarian cancers [44]. Comparison ofgene expression between 37 advanced-stage serous ovariancarcinomas and normal ovarian surface epithelium cytobrush-ings revealed that BCoR-L1 was not one of 1,191 genes thatwere significantly differentially regulated (defined as greaterFigure 3BCoR-L1 expression in lymphoblastoid cell lines (LCLs) from breast cancer families-  ion in lymphoblastoid cell lines ( CLs) from breast ancer families. (a) BCoR-L1 expression in LCLs from breast cancer fam-ilies (normalised to GAPDH). (b) BCoR-L1 expression in LCLs from breast cancer families (normalised to DIDO-1). (c) Mean and standard devia-tion of BCoR-L1 expression in samples, grouped according to type of family cancer or BCoR-L1 genotype (normalised to GAPDH). (d) Mean and standard deviation of BCoR-L1 expression in samples, grouped according to type of family cancer or BCoR-L1 genotype (normalised to DIDO-1). *Subject also carries a BRCA2 mutation. #Subjects from the same BCoR-L1 haplotype sharing family. BCoR-L1, BCL6 corepressor-like 1; DIDO-1, death inducer-obliterator 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.0200,000400,000600,000800,0001,000,0001,200,000UBC GAPDH DIDO-1expression control genesraw expression0200,000400,000600,000800,0001,000,0001,200,0001,400,0001,600,0001,800,000UBC GAPDH DIDO-1expression control genesraw expressionPage 8 of 12(page number not for citation purposes)mal cell lines, with up to 13-fold differences in expression than or equal to 1.5-fold change in expression). This contrastsAvailable online http://breast-cancer-research.com/content/9/4/R54Figure 402,000,0004,000,0006,000,0008,000,00010,000,00012,000,00014,000,000control LCL averageOSE 64/96HOSE 17.1OVCAR3OVCAR5OVCAR8SKOV3CAOV3HEYA2780JAMPEO-127/87SVCTBre80hTERTMCF-721MT-121MT-221NTBT20BT474BT483MDAMB231SKBR3T47DZR75-1BC312NB88RWPE1PC3DU145RWPE2LNCaPCell lineBCoR-L1expression (normalisedtoGAPDH)Ovarian cell lines Prostate cell linesBreast cell lines0500,0001,000,0001,500,0002,000,0002,500,0003,000,0003,500,0004,000,000Control LCL (6) Normal ovarian (2) Ovarian cancer (10) Normal breast (2) Breast cancer (13) Normal prostate (1) Prostate cancer (4)BCoR-L1expression Page 9 of 12(page number not for citation purposes)Variation in control gene expressioni tion in control gen  expression. (a) Variation in control gene expression in lymphoblastoid cell lines. (b) Variation in control gene expression in cell lines. DIDO-1, death inducer-obliterator 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; UBC, ubiquitin C.Breast Cancer Research    Vol 9 No 4    Lose et al.with the 4- to 13-fold increased expression we observed forspecific cancer lines compared with normal ovarian epithelialcell lines.There was no evidence that the hormone receptor status ofeach cell line correlated with these BCoR-L1 expression dif-ferences because the highly estrogen receptor (ER)- and pro-gesterone receptor (PR)-positive breast cancer cell line T47Dshowed similar BCoR-L1 expression to BT20, a breast cancercell line that does not express ER or PR [45]. In addition, theovarian cancer cell lines OVCAR3 (ER-positive) and SKOV3(ER-negative) expressed similar levels of BCoR-L1 [46].Investigation of the X chromosome karyotype of these ovariancancer cell lines did reveal a possible relationship with BCoR-L1 expression. Karyotype data were available for OVCAR3,SKOV3, OVCAR5, and OVCAR8 [47], with the BCoR-L1-overexpressing lines OVCAR3 and SKOV3 found to possessthree copies of Xq and four X chromosomes, respectively.Conversely, OVCAR5 and OVCAR8 each possess only one Xchromosome and express normal levels of BCoR-L1. Informa-tion on the X chromosome karyotype of breast cancer cell lineswas limited, but there was no indication of an associationbetween karyotype and BCoR-L1 expression [47,48]. Thefinding that BCoR-L1 expression tends to correlate withsupernumary X chromosomes suggests that this overexpres-sion probably does not contribute to carcinogenesis but mayoccur as a result of carcinogenesis. Although it is unknownwhether the superfluous X chromosomes in OVCAR3 andSKOV3 are active, it has been reported that ovarian (andbreast) tumours can possess multiple active X chromosomes[48-51].ConclusionThe aim of the present study was to attempt to elucidate a rolefor BCoR-L1 as a high-risk breast cancer predisposition geneby mutation screening of well-characterised non-BRCA1/2familial breast cancer subjects who were selected to maximisethe probability of identifying a mutation. We detected minimalvariation in the coding region of BCoR-L1, which may implythe importance of maintaining the structural integrity of theBCoR-L1 protein. It is also unlikely that noncoding region var-iation in the BCoR-L1 gene is involved in breast cancer pre-disposition as we did not detect any significant changes inexpression between cancer cases and cell lines and controls.The absence of pathogenic coding mutations or expressionderegulation in this set of familial cases indicates that BCoR-L1 is extremely unlikely to be a major high-risk familial breastcancer predisposition gene. However, it is still possible thatBCoR-L1 could be involved in breast cancer predisposition asa moderate- or low-penetrance risk gene, as has been foundwith CHEK2 [6], BRIP1 [7], and PALB2 [8,9] in large studiesof BRCAX cases and controls. The involvement of BCoR-L1in ovarian cancer may also be worthy of investigation, and fur-ther functional analysis of the BCoR-L1 protein will help to elu-cidate the involvement of BCoR-L1 in various essentialpathways.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsFL carried out the screening of the gene and the LOH andexpression analysis and drafted the manuscript. JA providedRNA from all of the breast and ovarian cell lines. GJM andGMP performed haplotype sharing analysis. CJB performedthe X inactivation status analysis and drafted the relevant sec-tion of the manuscript. DBY contributed to the experimentalstudy design and provided sequence data on BCoR-L1.kConFab recruited and collected subjects for the study. GC-Tand KKK participated in the design and coordination of thestudy. ABS conceived the study, participated in its design andcoordination, and helped to draft the manuscript. All authorsread and approved the final manuscript.AcknowledgementsThe authors thank Heather Thorne, Eveline Niedermayr, Lynda Williams, Danni Surace, and all the kConFab research nurses and staff, the heads and staff of the Family Cancer Clinics, and the Clinical Follow Up Study (funded by National Health and Medical Research Council [NHMRC] grants 145684 and 288704) for their contributions to this resource and the many families who contribute to kConFab. kConFab is supported by grants from the National Breast Cancer Foundation and the NHMRC and by the Queensland Cancer Fund, the Cancer Councils of New South Wales, Victoria, Tasmania, and South Australia, and the Cancer Foundation of Western Australia. The authors thank Helene Holland for supplying data and Anna Marsh for technical advice and assistance on DHPLC. Judith Clements and Ying Dong supplied prostate cancer cell lines used in this study, and Vivien G Cheung kindly made available unpublished data on mRNA expression levels in LCLs. This research was supported by grants from the Queensland Cancer Fund and National Breast Cancer Foundation. GC-T and KKK are NHMRC Princi-pal Research Fellows, and ABS is funded by an NHMRC Career Devel-opment Award.References1. Peto J, Collins N, Barfoot R, Seal S, Warren W, Rahman N, EastonDF, Evans C, Deacon J, Stratton MR: Prevalence of BRCA1 andBRCA2 gene mutations in patients with early-onset breastcancer.  J Natl Cancer Inst 1999, 91:943-949.2. Ford D, Easton DF, Stratton M, Narod S, Goldgar D, Devilee P,Bishop DT, Weber B, Lenoir G, Chang-Claude J, et al.: Geneticheterogeneity and penetrance analysis of the BRCA1 andBRCA2 genes in breast cancer families. The Breast CancerLinkage Consortium.  Am J Hum Genet 1998, 62:676-689.3. Sidransky D, Tokino T, Helzlsouer K, Zehnbauer B, Rausch G,Shelton B, Prestigiacomo L, Vogelstein B, Davidson N: Inheritedp53 gene mutations in breast cancer.  Cancer Res 1992,52:2984-2986.4. Chenevix-Trench G, Spurdle AB, Gatei M, Kelly H, Marsh A, ChenX, Donn K, Cummings M, Nyholt D, Jenkins MA, et al.: Dominantnegative ATM mutations in breast cancer families.  J Natl Can-cer Inst 2002, 94:205-215.5. Lynch ED, Ostermeyer EA, Lee MK, Arena JF, Ji H, Dann J,Swisshelm K, Suchard D, MacLeod PM, Kvinnsland S, et al.:Inherited mutations in PTEN that are associated with breastPage 10 of 12(page number not for citation purposes)cancer, cowden disease, and juvenile polyposis.  Am J HumGenet 1997, 61:1254-1260.Available online http://breast-cancer-research.com/content/9/4/R546. Bernstein JL, Teraoka SN, John EM, Andrulis IL, Knight JA, LapinskiR, Olson ER, Wolitzer AL, Seminara D, Whittemore AS, et al.: TheCHEK2*1100delC allelic variant and risk of breast cancer:screening results from the Breast Cancer Family Registry.Cancer Epidemiol Biomarkers Prev 2006, 15:348-352.7. Seal S, Thompson D, Renwick A, Elliott A, Kelly P, Barfoot R,Chagtai T, Jayatilake H, Ahmed M, Spanova K, et al.: Truncatingmutations in the Fanconi anemia J gene BRIP1 are low-pene-trance breast cancer susceptibility alleles.  Nat Genet 2006,38:1239-1241.8. Erkko H, Xia B, Nikkila J, Schleutker J, Syrjakoski K, Mannermaa A,Kallioniemi A, Pylkas K, Karppinen SM, Rapakko K, et al.: A recur-rent mutation in PALB2 in Finnish cancer families.  Nature2007, 446:316-319.9. Rahman N, Seal S, Thompson D, Kelly P, Renwick A, Elliott A, ReidS, Spanova K, Barfoot R, Chagtai T, et al.: PALB2, which encodesa BRCA2-interacting protein, is a breast cancer susceptibilitygene.  Nat Genet 2007, 39:165-167.10. Pagan JK, Arnold J, Hanchard KJ, Kumar R, Bruno T, Jones MJ,Richard DJ, Forrest A, Spurdle A, Verdin E, et al.: A novel core-pressor, BCoR-L1, represses transcription through an interac-tion with CtBP.  J Biol Chem 2007, 282:15248-15257.11. Jepsen K, Rosenfeld MG: Biological roles and mechanisticactions of co-repressor complexes.  J Cell Sci 2002, 115(Pt4):689-698.12. Hanahan D, Weinberg RA: The hallmarks of cancer.  Cell 2000,100:57-70.13. Rosen EM, Fan S, Pestell RG, Goldberg ID: BRCA1 gene inbreast cancer.  J Cell Physiol 2003, 196:19-41.14. van 't Veer LJ, Dai H, van de Vijver MJ, He YD, Hart AA, Mao M,Peterse HL, van der Kooy K, Marton MJ, Witteveen AT, et al.: Geneexpression profiling predicts clinical outcome of breastcancer.  Nature 2002, 415:530-536.15. Loupart ML, Adams S, Armour JA, Walker R, Brammar W, Varley J:Loss of heterozygosity on the X chromosome in human breastcancer.  Genes Chromosomes Cancer 1995, 13:229-238.16. Choi C, Cho S, Horikawa I, Berchuck A, Wang N, Cedrone E,Jhung SW, Lee JB, Kerr J, Chenevix-Trench G, et al.: Loss of het-erozygosity at chromosome segment Xq25-26.1 in advancedhuman ovarian carcinomas.  Genes Chromosomes Cancer1997, 20:234-242.17. Choi C, Kim MH, Juhng SW: Loss of heterozygosity on chromo-some XP22.2-p22.13 and Xq26.1-q27.1 in human breastcarcinomas.  J Korean Med Sci 1998, 13:311-316.18. Carrel L, Willard HF: X-inactivation profile reveals extensivevariability in X-linked gene expression in females.  Nature2005, 434:400-404.19. Buller RE, Sood AK, Lallas T, Buekers T, Skilling JS: Associationbetween nonrandom X-chromosome inactivation and BRCA1mutation in germline DNA of patients with ovarian cancer.  JNatl Cancer Inst 1999, 91:339-346.20. Kristiansen M, Langerod A, Knudsen GP, Weber BL, Borresen-Dale AL, Orstavik KH: High frequency of skewed X inactivationin young breast cancer patients.  J Med Genet 2002, 39:30-33.21. Kristiansen M, Knudsen GP, Maguire P, Margolin S, Pedersen J,Lindblom A, Orstavik KH: High incidence of skewed X chromo-some inactivation in young patients with familial non-BRCA1/BRCA2 breast cancer.  J Med Genet 2005, 42:877-880.22. Mann GJ, Thorne H, Balleine RL, Butow PN, Clarke CL, Edkins E,Evans GM, Fereday S, Haan E, Gattas M, et al.: Analysis of can-cer risk and BRCA1 and BRCA2 mutation prevalence in thekConFab familial breast cancer resource.  Breast Cancer Res2006, 8:R12.23. National Breast Cancer Centre: Advice about familial aspects ofbreast cancer and epithelial ovarian cancer: a guide for healthprofessionals.   [http://www.nbcc.org.au/bestpractice/resources/BOG182_adviceaboutfamiliala.pdf].24. Rozen S, Skaletsky HJ: Primer3 on the WWW for general usersand for biologist programmers.  Bioinformatics: Methods andProtocols (Methods in Molecular Biology) 2000:365-386 [http://frodo.wi.mit.edu/primer3/input.htm]. Totowa, NJ: Humana PressInc25. Jones AC, Austin J, Hansen N, Hoogendoorn B, Oefner PJ, Chea-dle JP, O'Donovan MC: Optimal temperature selection for26. Levi S, Urbano-Ispizua A, Gill R, Thomas DM, Gilbertson J, FosterC, Marshall CJ: Multiple K-ras codon 12 mutations in cholangi-ocarcinomas demonstrated with a sensitive polymerase chainreaction technique.  Cancer Res 1991, 51:3497-3502.27. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, DePaepe A, Speleman F: Accurate normalization of real-timequantitative RT-PCR data by geometric averaging of multipleinternal control genes.  Genome Biol 2002, 3:RESEARCH0034.28. Cheung VG, Conlin LK, Weber TM, Arcaro M, Jen KY, Morley M,Spielman RS: Natural variation in human gene expressionassessed in lymphoblastoid cells.  Nat Genet 2003,33:422-425.29. PubMed   [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=pubmed]30. Gabellini D, Green MR, Tupler R: When enough is enough:genetic diseases associated with transcriptionalderepression.  Curr Opin Genet Dev 2004, 14:301-307.31. Thiel G, Lietz M, Hohl M: How mammalian transcriptionalrepressors work.  Eur J Biochem 2004, 271:2855-2862.32. Zuker M: Mfold web server for nucleic acid folding and hybrid-ization prediction.  Nucleic Acids Res 2003, 31:3406-3415.33. Schwartz S, Zhang Z, Frazer KA, Smit A, Riemer C, Bouck J, GibbsR, Hardison R, Miller W: PipMaker – a web server for aligningtwo genomic DNA sequences.  Genome Res 2000, 10:577-586.34. Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR: ESEfinder: aweb resource to identify exonic splicing enhancers.  NucleicAcids Res 2003, 31:3568-3571.35. Fairbrother WG, Yeh RF, Sharp PA, Burge CB: Predictive identi-fication of exonic splicing enhancers in human genes.  Science2002, 297:1007-1013.36. Nakamura Y, Gojobori T, Ikemura T: Codon usage tabulated frominternational DNA sequence databases: status for the year2000.  Nucleic Acids Res 2000, 28:292.37. Alex Dong Li's SpliceSiteFinder   [http://www.genet.sickkids.on.ca/~ali/splicesitefinder.html]38. Ng PC, Henikoff S: Predicting deleterious amino acidsubstitutions.  Genome Res 2001, 11:863-874.39. Ross MT, Grafham DV, Coffey AJ, Scherer S, McLay K, Muzny D,Platzer M, Howell GR, Burrows C, Bird CP, et al.: The DNAsequence of the human X chromosome.  Nature 2005,434:325-337.40. Tsui C, Coleman LE, Griffith JL, Bennett EA, Goodson SG, ScottJD, Pittard WS, Devine SE: Single nucleotide polymorphisms(SNPs) that map to gaps in the human SNP map.  NucleicAcids Res 2003, 31:4910-4916.41. International HapMap Consortium: A haplotype map of thehuman genome.  Nature 2005, 437:1299-1320.42. Johnstone RW: Histone-deacetylase inhibitors: novel drugs forthe treatment of cancer.  Nat Rev Drug Discov 2002, 1:287-299.43. Kawai H, Li H, Avraham S, Jiang S, Avraham HK: Overexpressionof histone deacetylase HDAC1 modulates breast cancer pro-gression by negative regulation of estrogen receptor alpha.  IntJ Cancer 2003, 107:353-358.44. Donninger H, Bonome T, Radonovich M, Pise-Masison CA, BradyJ, Shih JH, Barrett JC, Birrer MJ: Whole genome expression pro-filing of advance stage papillary serous ovarian cancer revealsactivated pathways.  Oncogene 2004, 23:8065-8077.45. Walsh MD, Luckie SM, Cummings MC, Antalis TM, McGuckin MA:Heterogeneity of MUC1 expression by human breast carci-noma cell lines in vivo and in vitro.  Breast Cancer Res Treat1999, 58:255-266.46. Treeck O, Haldar C, Ortmann O: Antiestrogens modulate MT1melatonin receptor expression in breast and ovarian cancercell lines.  Oncol Rep 2006, 15:231-235.47. Roschke AV, Tonon G, Gehlhaus KS, McTyre N, Bussey KJ, Lab-abidi S, Scudiero DA, Weinstein JN, Kirsch IR: Karyotypic com-plexity of the NCI-60 drug-screening panel.  Cancer Res 2003,63:8634-8647.48. Sirchia SM, Ramoscelli L, Grati FR, Barbera F, Coradini D, Ros-sella F, Porta G, Lesma E, Ruggeri A, Radice P, et al.: Loss of theinactive X chromosome and replication of the active X inBRCA1-defective and wild-type breast cancer cells.  CancerRes 2005, 65:2139-2146.49. Kimmel VM: Clinical-cytological correlations of mammary car-Page 11 of 12(page number not for citation purposes)mutation detection by denaturing HPLC and comparison tosingle-stranded conformation polymorphism and heterodu-plex analysis.  Clin Chem 1999, 45(8 Pt 1):1133-1140.cinoma based upon sex-chromatin counts.  Cancer 1957,10:922-927.Breast Cancer Research    Vol 9 No 4    Lose et al.50. Wang N, Cedrone E, Skuse GR, Insel R, Dry J: Two identicalactive X chromosomes in human mammary carcinoma cells.Cancer Genet Cytogenet 1990, 46:271-280.51. Benoit MH, Hudson TJ, Maire G, Squire JA, Arcand SL, Pro-vencher D, Mes-Masson AM, Tonin PN: Global analysis of chro-mosome X gene expression in primary cultures of normalovarian surface epithelial cells and epithelial ovarian cancercell lines.  Int J Oncol 2007, 30:5-17.Page 12 of 12(page number not for citation purposes)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0215985/manifest

Comment

Related Items