UBC Faculty Research and Publications

LRRK2 knockout mice have an intact dopaminergic system but display alterations in exploratory and motor… Hinkle, Kelly M; Yue, Mei; Behrouz, Bahareh; Dächsel, Justus C; Lincoln, Sarah J; Bowles, Erin E; Beevers, Joel E; Dugger, Brittany; Winner, Beate; Prots, Iryna; Kent, Caroline B; Nishioka, Kenya; Lin, Wen-Lang; Dickson, Dennis W; Janus, Christopher J; Farrer, Matthew J; Melrose, Heather L May 30, 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-13024_2012_Article_343.pdf [ 1.22MB ]
Metadata
JSON: 52383-1.0215981.json
JSON-LD: 52383-1.0215981-ld.json
RDF/XML (Pretty): 52383-1.0215981-rdf.xml
RDF/JSON: 52383-1.0215981-rdf.json
Turtle: 52383-1.0215981-turtle.txt
N-Triples: 52383-1.0215981-rdf-ntriples.txt
Original Record: 52383-1.0215981-source.json
Full Text
52383-1.0215981-fulltext.txt
Citation
52383-1.0215981.ris

Full Text

RESEARCH ARTICLE Open AccessLRRK2 knockout mice have an intactdopaminergic system but display alterations inexploratory and motor co-ordination behaviorsKelly M Hinkle1†, Mei Yue1†, Bahareh Behrouz1, Justus C Dächsel1, Sarah J Lincoln1, Erin E Bowles1, Joel E Beevers1,Brittany Dugger1, Beate Winner2, Iryna Prots2, Caroline B Kent1, Kenya Nishioka1, Wen-Lang Lin1,Dennis W Dickson1, Christopher J Janus3, Matthew J Farrer1,4 and Heather L Melrose1*AbstractMutations in the LRRK2 gene are the most common cause of genetic Parkinson’s disease. Although the mechanismsbehind the pathogenic effects of LRRK2 mutations are still not clear, data emerging from in vitro and in vivo modelssuggests roles in regulating neuronal polarity, neurotransmission, membrane and cytoskeletal dynamics and proteindegradation.We created mice lacking exon 41 that encodes the activation hinge of the kinase domain of LRRK2. We haveperformed a comprehensive analysis of these mice up to 20 months of age, including evaluation of dopaminestorage, release, uptake and synthesis, behavioral testing, dendritic spine and proliferation/neurogenesis analysis.Our results show that the dopaminergic system was not functionally comprised in LRRK2 knockout mice. However,LRRK2 knockout mice displayed abnormal exploratory activity in the open-field test. Moreover, LRRK2 knockout micestayed longer than their wild type littermates on the accelerated rod during rotarod testing. Finally, we confirm thatloss of LRRK2 caused degeneration in the kidney, accompanied by a progressive enhancement of autophagicactivity and accumulation of autofluorescent material, but without evidence of biphasic changes.Keywords: Parkinson’s disease, Knockout, Dopamine, Microdialysis, Neuropathology, Open-field, Motor co-ordination, Kidney, AutophagyBackgroundMutations in the LRRK2 gene, originally described in 2004,have now emerged as the most important genetic finding inParkinson’s disease (PD) [1,2]. Incredibly, the most com-mon mutation LRRK2 G2019S accounts for up to 40 % ofParkinsonism in populations of certain ethnic descent [3-5].LRRK2 mutations also account for around 2% of sporadicParkinsonism and two risk factors have been identified inAsian populations [6-9]. LRRK2-associated PD is a lateonset disease and in general the disease resembles idio-pathic PD both clinically and pathologically.LRRK2 has been linked to neurite outgrowth, vesiculartrafficking, protein translation and autophagy [10]. Ana-lysis of mutant transgenic and knock-in modelsexpressing physiological levels of LRRK2 has led to anemerging theme that aberrant LRRK2 leads to subtlealterations in dopamine neurotransmission, albeit in theabsence of dopaminergic neuronal loss [11]. Imagingstudies in asymptomatic PD patients show the earliestdetectable changes occur in the dopamine transporterand the same holds true for asymptomatic LRRK2[12,13] and SNCA (alpha-synuclein) patients [14-16].Neurotransmission alterations in mutant LRRK2 modelsmay be similar to early preclinical events, suggesting anearly involvement in dopamine dysfunction.The expression profile of LRRK2 mRNA suggests thatLRRK2 is unlikely to be an essential developmental pro-tein [17]. In adult rodent brain, LRRK2 mRNA is foundat highest levels in dopamine receptive areas particularlythe striatum [18-22]. However, protein expression ofLRRK2 is abundant throughout the brain including thesubstantia nigra, striatum, hippocampus, thalamus,* Correspondence: Melrose.heather@mayo.edu†Equal contributors1Department of Neuroscience, Mayo Clinic, Jacksonville, Florida 32224, USAFull list of author information is available at the end of the article© 2012 Hinkle et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.Hinkle et al. Molecular Neurodegeneration 2012, 7:25http://www.molecularneurodegeneration.com/content/7/1/25cerebellum and cortex [23] suggesting it may have a rolein multiple brain functions (i.e. memory, sensory, emo-tion) and not just those involved in motor control.To further study the role of LRRK2 in the brain, we havedeveloped LRRK2 knockout mice by ablating exon 41 inthe kinase domain of LRRK2. We have performed a com-prehensive analysis to study the effect of loss of LRRK2;this includes a thorough investigation of the dopaminergicsystem, extensive behavioral tests to examine motor, co-ordination and emotional behavior, as well as neuropatho-logical analyses. We find little evidence that loss of LRRK2impacts dopaminergic neurotransmission or striatal beha-viors, however we present data showing changes in the ex-ploratory and motor co-ordination behaviors in thesemice. These findings may be an important considerationfor future anti-LRRK2 therapies.ResultsGeneration of murine LRRK2 knockout miceThe targeting strategy for generation of LRRK2 knockout(KO) mice is shown in Figure 1A. Homozygous micereceived from Ozgene PLC were bred to Jackson C57BL6/J mice and subsequent heterozygous offspring were bredtogether to obtain wild type (WT), heterozygous (HET)and KO animals. Northern blotting analysis with a probedesigned to LRRK2 exon 24–27 confirmed the absence ofthe ~9 kb LRRK2 mRNA transcript in KO mice and areduced transcript signal in the HET mice (Figure 1B).Similarly, immunoblotting confirmed absence of LRRK2protein band in the KO mice and a diminished signal inHET mice (Figure 1C). Immunohistochemistry alsorevealed specific signal in the WT compared to KO(Figure 1D).To determine if any compensatory mRNA changes oc-curred in the paralog LRRK1, we used quantitative Taqmanassay with a probe to murine LRRK1 to compare WT, HETand KO mice. No significant alterations in LRRK1 mRNAlevels were observed in any of the brain regions tested. Wealso checked mRNA levels of SNCA, MAPT or PARKINand found no differences (Additional file 1: Figure S1).LRRK2 KO mice were fertile and appeared to be healthyfrom birth, with body weights comparable to WT litter-mates within the study period. HET x HET breedingsyielded Mendelian ratios in line with expected inheritance(from over 70 litters 24.4 % WT, 51.6 % HET, 24 % KO).Subsequent characterization experiments were performedto compare KO and WT mice at different aging timepoints. Due to animal costs and space restraints, weincluded a HET group in some, but not all, of theseanalyses.Dopaminergic system characterizationLRRK2 expression is normally found in high levels in thestriatum so we reasoned that loss of LRRK2 may impactthe functional integrity of the nigro-striatal dopa-minergic pathway. To determine if dopamine neurons ortheir processes were altered in the substantia nigra, weperformed stereological counts of tyrosine hydroxylase(TH) positive neurons and dendrites in KO and WTmice aged 18–20 months. No differences in neuronal esti-mates were observed between KO mice (mean estimate ±SEM; 13,766 ± 471) compared to their WT littermates(12,267 ± 481) (Figure 2A). Similarly, there were no differ-ences between dendritic estimates for WT (149,763 ±6213) and KO (153,873 ± 4351) (Figure 2B). Next, weexamined dopamine axonal neurochemistry by analyzingtotal dopamine content in striatal lysates by HPLC from10 month and 18 month KO mice and WT littermates(Figure 2C-G, data shown only for 18 months) and founddopamine and its metabolite 3,4-dihydroxyphenylaceticacid (DOPAC), and homovanillic acid (HVA) levels wereequivalent in KO and WTanimals at both time points.Since total striatal dopamine includes dopamine that isstored, synthesized, released and taken up, we hypothe-sized that we may observe differences in KO mice byinvestigating these mechanisms independently. First, weperformed microdialysis to measure extracellular releaseof dopamine in vivo. Extracellular dopamine levels weremeasured before and after KCl-evoked dopamine responsein WT, HET and KO mice aged 3–4 months of age(Figure 2H). Baseline levels of dopamine were not foundto differ between WT (0.13 ± 0.06 pg/μl), HET (0.15 ±0.06 pg/μl) or KO mice (0.16 ± 0.07 pg/μl). When post-KCl dopamine levels were normalized to the average oftheir individual basal dopamine levels (i.e. % response) nosignificant differences were observed (Figure 2I). Next, weexamined dopamine uptake in the WT, HET and KO miceusing a radioactive uptake assay with [3H] dopamine. Up-take was comparable across the three groups suggesting afunctionally intact dopamine transporter (Additional file2: Figure S2A). Concluding that release, storage and up-take of dopamine appear to be normal, we then examinedD2-autoreceptor mediated synthesis and release, which isone of the feedback mechanisms in the striatum. It is wellknown that antagonizing pre-synaptic D2 autoreceptorscan remove this feedback inhibition and cause increasedsynthesis as well as release of dopamine [24]. WT, HETand KO mice were treated with the D2 receptor antagon-ist raclopride, sacrificed 30 min later and HPLC analysisperformed to quantify dopamine and metabolites. Asexpected, dopamine turnover, as measured by the ratio ofdopamine metabolites to stores of dopamine increaseddramatically [One way ANOVA ps< 0.0001 for DOPAC/dopamine and HVA/dopamine] following treatment withraclopride (Additional file 2: Figure S2B, C). However,Tukey’s post hoc comparisons did not reveal differences inthis response between WT, HET or KO mice, suggestingthat autoreceptor-mediated feedback is normal in theHinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 2 of 17http://www.molecularneurodegeneration.com/content/7/1/25absence of LRRK2. A significant increase in levels of serine-40 phosphorylated TH after raclopride treatment was alsoobserved (indicating increased synthesis), but this responsewas not different between WT, HET or KO mice (data notshown). Finally, we examined striatal receptor density forboth dopamine D1 and D2 receptors by autoradiography in10 and 18 month old WT and KO mice and no differenceswere observed (Additional file 3: Figure S3A-D).Analysis of striatal dendritic spinesWe have previously shown that LRRK2 G2019S trans-genic mice have impaired neurite outgrowth in vitro [25]and in vivo [26] as well as a reduced number of maturespines in the hippocampus [26]. We have also reportedthat neurite outgrowth was increased in both midbrainand hippocampal cultures derived from LRRK2 KO mice[25]. As LRRK2 has previously been linked to ERM pro-teins and the actin cytoskeleton [27-31] we hypothesizedthat the loss of LRRK2 in the striatum in KO mice, anarea where it is normally highly expressed, may impacton striatal dendritic spines. We counted spine numberin Golgi-Cox labeled medium spiny neurons (MSN) ofbrains from aged (18+ months) KO and WT mice.Spines were classified into different morphological types[32]. No differences were found in spine numbersbetween in KO and WT mice suggesting that lack ofLRRK2 has no effect on MSN spine dynamics in vivo(Additional file 4: Figure S4).Proliferation / Neurogenesis studiesAs LRRK2 is normally expressed in the hippocampal den-tate gyrus and proliferation, neurogenesis and migrationare impaired in G2019S BAC mice [26], we sought to as-certain whether loss of expression has an impact on cellproliferation. We analyzed the effect of loss of LRRK2 onnewly generated cells in the hippocampal dentate gyrusafter a single injection of BrdU. Unbiased stereologicalcounting methods were applied to estimate the number ofFigure 1 Generation and expression characterization of LRRK2 KO mice. (a) Schematic diagram (courtesy of Ozgene PLC) showing targetedlocus. Exon 41 was flanked with LoxP sites to allow deletion with Cre recombinase. PKG-Neo-pA-SD-IS is Ozgene’s standard selection cassette andwas inserted downstream of exon 41. The PKG-neo cassette was also flanked by FRT sites to allow FLPe recombinase deletion. The targetingvector was constructed from three fragments, the 5’homology arm, the 3’ homology arm and the lox P arm, which were generated by PCR.Splicing of exon 40 to 42 causes a frame shift mutation, with the introduction of an early stop codon (TGA). (b) Northern blot hybridized with aprobe to LRRK2 exon 24–27 showing absence of transcript in KO and diminished transcript in HET. A histone probe was used as loading control.(c) Immunoblot with LRRK2 antibody 1182E, raised to amino acids 841–960 showing the absence of LRRK2 protein in KO and diminished signalin HET. GAPDH was used as a loading control. (d) Immunohistochemistry with MJFF2 c41-2 antibody showing WT and KO brain sections at thelevel of the striatum. Specific signal is seen in the WT compared to KO. Rabbit IgG was used as an isotype control. Boxes depict enlarged imagesto the right. Scale bar 50 microns.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 3 of 17http://www.molecularneurodegeneration.com/content/7/1/25BrdU-labeled cells. No differences were observed inproliferation between KO and WT mice (Additional file 5:Figure S5A). Since doublecortin (DCX) expression levelsin adult brain reflect neurogenesis [33], we also performedcounts on DCX labeled neurons in the hippocampus andthese were also found to be comparable in KO and WTmice (Additional file 5: Figure S5B) suggesting normalneurogenesis occurs in KO mice.NeuropathologyHameotoxylin and eosin revealed morphology of KOmouse brains to be normal up to 20 months of age. Toassess mice for neuropathological alterations we examinedyoung (3–6 months), middle aged (10–13 months) andaged (18+ months) WT, HET and KO mice for a variety ofmarkers associated with Parkinson’s disease pathology in-cluding alpha-synuclein, tau and Iba-1. In agreement with aprevious report [34], no overt differences were observedwith any of these markers between WT, HET and KO mice.As we have previously shown alterations in tau regulationin our BAC mutant LRRK2 G2019S model, we performedquantitative immunoblotting with tau antibodies (tau-5,CP-13 and tau-1) in lysates from aged WT and KO mice.Our results indicate that tau regulation is normal in KOmice (Additional file 6: Figure S6).Behavioral AnalysisOpen-field TestIn the initial characterization, we focused on the analysis ofspontaneous exploratory locomotor behavior evaluated inthe open-field test. The open-field test assesses spontaneousexploration of mice as well as their emotional responseafter being exposed to much larger than a home cage andbrightly illuminated unfamiliar environment [35-37]. Therationale behind this approach was based on evidence thatanxiety disorders, which affect about 40 % of PD patientsFigure 2 Dopaminergic characterization in LRRK2 KO mice. (a,b) Unbiased sterological estimates for TH-positive (a) neurons and (b)dendrites in the substantia nigra reveal no difference between WT and LRRK2 KO mice. Counting was performed using optical fractionator probesin TH stained sections from 18 month old WT and KO mice. (c-e) Dopamine axon terminal neurochemistry is normal in LRRK2 KO mice. HPLCanalysis of total striatal content of dopamine (da) and its metabolites 3,4-dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA). (f-g)Mean of individual animal turnover ratios of DA to metabolites DOPAC and HVA. (h-i) In vivo microdialysis reveals similar baseline and KCl-evokedlevels of extracellular DA in WT, HET and KO mice (i). DA levels were plotted as a percentage of each individual animal’s mean baseline levels tocompare response over time (h) % Response did not differ between WT, HET and KO mice. Dopamine levels were measured by HPLC fromdialysates collected from the striatum. All data are presented as mean ± SEM.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 4 of 17http://www.molecularneurodegeneration.com/content/7/1/25[38,39] and other psychiatric symptoms can precede theonset of motor symptoms, such as bradykinesia, rigidity,resting tremor and postural instability in PD by decades[39]. The open-field test, which combines the evaluation ofanxiety as well as spontaneous locomotor activity, thereforepresents an appropriate paradigm for the phenotypingcharacterization of the KO mice. The test has been success-fully used with other familial Parkinson disease mousemodels, for example mice deficient in parkin gene [40].We characterized the behavior of KO and WT mice inthe open-field test, adopting longitudinal experimental de-sign, at a young (7 months) and older (16 months) timepoint. The evaluation was done in one 5-min session ateach age in order to minimize the saving effect and habitu-ation to the test due to repeated testing. Data was analyzedby repeated measures ANOVA followed by Student’s t-testsfor independent samples (to assess the genotype effect ateach testing age) and matched-pairs samples (to assess theage effect within each genotype).Overall analysis of the exploration of the open-field arenaby KO and WT mice revealed no differences in the lengthof walking distance, walking speed or onset of explorationbetween the genotypes. The KO mice tended to spendmore time on longer (> 5 s) rests than WT mice duringtheir exploration (p< 0.05, ANOVA, genotype effect), how-ever, high variability of this behavior did not yield signifi-cant differences at α = 0.05 at each age of testing(Figure 3A). The number of rests and shorter (< 5 s) stopsdid not differ between the genotypes.Mice of both genotypes explored the center of the arenaless at 16 months than at 7 months test (15.9 s ± 1.6 for 16-month and 25.0 s ± 3.5 for 7-month mice respectively, p<0.001, ANOVA, age effect). However, KO mice exploredthe center of the open-field arena significantly less than theWT mice (15.0 % ± 2.4 and 25.9 % ± 2.8 of time averagedacross age for KO and WT mice respectively, p< 0.01,ANOVA, genotype effect). The difference was significant atboth at 7 (p< 0.05, t-test) and 16 (p< 0.01, t-test) monthsof age (Figure 3B).This shorter time of exploration of the inner areaof the field by the KO mice was likely due to theirincreased thigmotaxic (wall hugging) behavior (p<0.001, ANOVA, genotype effect). The KO mice spentbetween 18 % to 87 % and 53 % to 91 % of their ex-ploratory activity moving within close proximity ofthe wall during 7- and 16-month tests respectively. Incontrast, the WT controls showed thigmotaxic behav-ior within a range of 9 % to 48 % and 36 % to 66 %during respective tests. Representative examples ofthe exploratory paths, reflecting the differences in thethigmotaxic behavior, are presented in Figure 4. Over-all, the thigmotaxic behavior increased with age (p< 0.001,ANOVA age effect), with no significant interaction betweenthe genotype and age factors. The differences inthigmotaxic behavior between the genotypes were signifi-cant at both 7 (p< 0.01, t-test) and at 16 (p< 0.001, t-test)months of age (Figure 3C).Our analysis also revealed that overall, the exploratorypaths of KO mice were less curvy and tortuous as com-pared to the paths of the WT counterparts (p< 0.001,ANOVA, genotype effect) and path tortousity was lowerin mice of both genotypes during tests at 16 months(p< 0.001, ANOVA, age effect). The specific compari-sons revealed a significant genotype effect on pathtortuosity only at 16 months (p< 0.001, t-test,Figure 3D).Lastly, the KO mice approached an object placed in thecenter of the arena with longer latencies than WT mice (p< 0.05, ANOVA, genotype effect). In general, KO micetended to spend less time exploring the object than WTmice (averaged across age 4.96 ± 0.09 and 9.45 ± 0.15 sec-onds respectively, p = 0.06, ANOVA, genotype effect). Theborderline significance of the genotype effect was due tohigh variability in this behavior at 7-months (Figure 3E). At16 months, however, the KO mice explored the object sig-nificantly less (p <0.05, t-test, Figure 3E). The KO mice alsoapproached the object less frequently (p< 0.05, ANOVA,genotype effect), with significant differences at each age oftesting (ps< 0.05, t-test for 7 and 16 months, Figure 3F).All mice approached the object less frequently when testedat the older age (p< 0.05, ANOVA, age effect).In summary, our results indicate that the KO miceshowed abnormal spontaneous exploratory behavior inthe open-field test, which was characterized by signifi-cantly higher thigmotaxic exploration of the arena. Thisresult might be indicative of increased anxiety in the KOmice. Thigmotaxic behavior has been previouslyreported as a reliable measure of anxiety in the pre-clin-ical studies testing anxiolytic drugs [41]. In spite of theobserved differences, we interpret these results cau-tiously, since most of the open-field test measures areinterdependent [37]. We focused our emphasis on thig-motaxic behavior since it is likely that the initial preva-lent engagement in this behavior affects other measures,like the exploration of inner area (r2 = 0.49, and r2 = 0.72for 7 and 16 months respectively, ps = 0.001), and pathtortuosity (r2 = 0.38 – 7 months, and r2 = 0.45 –16 months, ps< 0.001).Motor testsNext, in a separate 7 month old cohort, we examinedmotor behavior in KO mice and compared this to bothWT and HET littermates. Motor co-ordination/balancewas examined by rotarod performance and gait wasexamined by digigait footprint analysis. Since theweights of the mice in each genotype did not differ sig-nificantly (p> 0.2, ANOVA), body weight was not usedas a covariate in the analysis [42]. Analysis ofHinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 5 of 17http://www.molecularneurodegeneration.com/content/7/1/25performance on an accelerating rod revealed significantdifferences between the groups (p< 0.02, ANOVA). Sub-sequent, post-hoc analysis revealed that KO mice per-formed significantly better than their WT littermates,spending ~20 % (p< 0.01, Tukey’s test) longer on the rod(Figure 5).The gait analysis was performed at three differentspeeds (14, 18 and 24 cm/sec) and compared a num-ber of spatial and temporal indices between WT, HETand KO mice. Overall, there were no significant dif-ferences between the genotypes for stride lengths orany other of the recorded indices (Table 1) suggestinggait and thus striatal function remains intact.Inflammatory and degenerative alterations in kidney ofLRRK2 KO miceTwo groups have previously identified abnormalities in thekidneys of LRRK2 KO mice including morphologicalchanges, lysosomal and autophagic alterations, vacuoliza-tion and accumulation of pigment [34,43]. We examinedkidneys from mice aged 3 to 20 months and also observedcoloration (darkening) changes beginning as early as3 months (Figure 6A). Significant enlargement wasobserved in the kidneys from the oldest mice (mean ±SEM; for KO female 0.23 ± 0.01 g and female WT 0.19 ±0.01 g, p< 0.05 t-test; male KO 0.35 ± 0.02 g and male WT0.22 ± 0.01 g, p< 0.001 t-test). At the gross level, kidneysFigure 3 Open-field test reveals abnormal exploratory behavior in LRRK2 KO mice at both 7 and 16 months of age. (a) KO mice tendedto spend longer time on rest stops longer than 5 seconds. (b) KO mice spent significantly less time exploring the inner area of the open-field atboth testing ages. (c) KO mice displayed significantly greater thigmotaxic (wall hugging) behavior at both testing ages. (d) KO mice take lessturns and their travel path is less curvy than WT mice, this was significant at 16 months. (e) Aged KO mice spend less time exploring the objectthan their WT counterparts. (f) KO mice of both age time points approach the object less frequently. Data presented as mean ± SEM. Data wasanalyzed by repeated measures ANOVA (see results section for full details) followed by Student’s t-tests for independent samples (to assess thegenotype effect at each testing age) and matched-pairs samples (to assess the age effect within each genotype). The p-values on the graphsreflect the independent sample t-test results. ** p <0.01, ***p <0.001.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 6 of 17http://www.molecularneurodegeneration.com/content/7/1/25from HET mice did not differ from WT counterparts(Figure 6A) therefore we limited subsequent analysis to KOand WT. Hematoxylin and eosin staining revealed inflam-matory abnormalities, vacuolization and pigmentation inKO kidneys as young as 3 months, which was progressivewith age (Figure 6B). We performed histological stainingfor a number of different markers including p62 (anubiquitin-binding protein involved in cell signaling, oxida-tive stress and autophagy, found to be upregulated in manyneurodegenerative diseases), Periodic acid-Schiff (PAS) stainfor glycoproteins, iron (Gomori's Prussian blue) and mel-anin (Fontana-Masson) staining for pigment and immuno-histochemistry for PD related proteins alpha-synuclein andubiquitin. The KO kidney pigment was negative for ironand melanin. PAS staining revealed abnormal granularstaining reminiscent of lipofuscin in the proximal tubules ofKO mice as young as 3 months of age, progressing at12 months and becoming severe by 18 months (data notshown). These granular inclusions were also auto-fluorescent, the intensity increasing with age (Figure 6B).Increased p62 immunostaining in the same cells in KOmice was observed as early as 3 months of age, althoughquantitative differences were not detectable by immunoblotat this age (Figure 7). The intensity of p62 immunostaining-progressed with age, and by 12 months quantitative differ-ences were evident. By 18 months the KO mice had onaverage a 15-fold increase (p< 0.01, t-test) in immunoblotrelative band density compared to WT controls (Figure 7).We were unable to corroborate the previous reports ofincreases in alpha-synuclein or ubiquitin [34,44] inKO mice neither by immunohistochemistry nor byimmunoblotting.To further examine the granular pathology at the ultra-structural level, we performed electron microscopy inkidneys from 18 months old KO and WT mice (Figure 6C).Tubular epithelial cells in the renal cortex of KO kidneywere found to contain degenerating debris and accumula-tion of pigment resembling lipofuscin, both absent fromFigure 5 Alterations in motor co-ordination behavior in LRRK2KO mice. Motor co-ordination and balance was tested byaccelerating rotarod analysis in a 7-month cohort of WT, HET and KOmice. The speed of the rod was set to 4-40 rpm acceleration,increasing 1 rpm every 5 seconds. KO mice significantlyoutperformed their WT littermates. Data are plotted as mean ± SEMand were analyzed by ANOVA with Tukey’s post-hoc comparisons. **p <0.01.Figure 4 LRRK2 KO mice exhibit thigmotaxic behavior in theopen-field test. Examples of movement traces from open-field trialsshow the range of thigmotaxic behavior from (a) 7 months and (b)16 months old WT and KO mice. This thigmotaxic behavior wastypical of LRRK2 KO mice, although a few displayed normalexploration patterns.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 7 of 17http://www.molecularneurodegeneration.com/content/7/1/25WT kidney. Although the debris was significant, some nor-mal tubular epithelial cells were still present and no evi-dence of abnormal mitochondria was found. Following onfrom conflicting reports of impaired/biphasic or no changeautophagy in LRRK2 KO mice [34,43,44] we performed im-munoblotting with LC-3 antibody in kidney lysates frommice aged 3, 12 and 18 months old. No significant differ-ences were seen at the 3 and 12 month time-point. How-ever in KO mice aged 18 months we observed a significant2.8 fold increase in intensity of the LC-3 II band (p< 0.05,t-test) indicating an increase, rather than the previouslyreported decrease.DiscussionIn this report we present dopaminergic, behavioral andpathogenic characterization of mice lacking LRRK2 to20 months of age. Our most significant findings areobserved at the behavioral level, which reveal normalmotor gait but altered open field and motor co-ordin-ation behavior in LRRK2 KO mice. In the open-field testKO mice displayed an increased thigmotaxic behavior,walking along the wall of the apparatus, which resultedin reduced path tortuousity. This phenotyping profilewas characteristic both at 7 and 16 month of age, withno indication of progressing deterioration in this pheno-type. It has been reported that the measures obtained inthe open-field test are variable and labile [45], whichcould account for the lack of significant interactions be-tween age and genotype in our study. Increased thigmo-taxic behavior is often attributed to an increase inanxiety during the exploration of new environment[35,41] or lack of flexibility in changing ongoing behav-ior [46]. Follow up studies to examine progression ofthese behaviors in KO mice will require larger cohortsizes and will focus on complementary to the open-fieldtests evaluating anxiety in mice, including rescue withanxiolytic agents. Interestingly, we have previouslyreported very similar open field behaviors in our mutantG2019S BAC mice [47] which formulates the idea thisphenotype could be a loss of function behavior. Whilecurrent thinking favors a gain of function role for aber-rant LRRK2, the phenotype reported in LRRK2 KO kid-neys [34,43] has somewhat challenged this, leading tospeculation of cell-specific LRRK2 roles.Surprisingly, our study revealed that LRRK2 KO micestayed persistently longer on the rotating rod, despite noobvious differences in their gait characteristics. Coinciden-tally, the Michael J Fox foundation recently posted onlinedata detailing phenotypic testing of their LRRK2 KOmodel being characterized at Wil Research and this datashowed a trend for enhanced rotarod performance in4 month old KO mice compared with WT controls http://www.pdonlineresearch.org/sites/default/files/MJFF%20Animal%20Models%20Data%20-%20Oct%2031.pdf).The rotarod test is known to be sensitive to cerebellarfunction and deficits in cerebellar purkinje neurons gener-ally result in a reduced rotarod performance. In the litera-ture there are only a few reports of genetic mouse modelsexhibiting enhanced rotarod performance compared withtheir wild type/ non-transgenic littermates. Examples in-clude a mouse model for Down’s syndrome (Ts65DN)[48], heregulin (a ligand for tyrosine receptor kinase) mu-tant mice [49], an epilepsy model deficient in a repair pro-tein L-isoaspartate (d-aspartate)-O-methyltransferase(Pcmt1−/−) [50] and Huntington triplet deletion miceHdh (ΔQ/ΔQ) mice [51]. Both the Ts65DN and heregulinmodel had known cerebellar morphological changes[48,49]. Morphological and pathological analysis of theTable 1 Normal gait in LRRK2 KO mice. Mouse gait dynamics were obtained using a motorized treadmill by ventralplane videography and analyzed with DigiGait® softwareAverage gait dynamics in WT, HET & KO micetreading at a speed of 24cm/secParameter WT (n=9) HET (n=8) KO (n=8) pStride length (cm) 6.42 ± 0.57 6.38 ± 0.71 6.09 ± 0.50 nsStride frequency (steps/sec) 3.84 ± 0.37 3.88 ± 0.46 4.06 ± 0.32 nsStride duration (sec) 0.267 ± 0.023 0.265 ± 0.029 0.254 ± 0.020 ns% Stance duration 58.5% ± 3.3% 59.5% ± 5.5% 59.1% ± 4.4% ns% Swing duration 41.5% ± 6.2% 40.5% ± 6.0% 41% ± 3.9% nsStep angle (deg) 61.1 ± 9.6 64.3 ± 6.5 59.1 ± 6.8 nsFore paw angle (deg) 9.63 ± 1.68 11.76 ± 5.04 12.51 ± 4.13 nsHind paw angle (deg) 18.97 ± 3.13 20.08 ± 1.81 18.43 ± 2.42 nsTotal steps (No./paw) 17 ± 5 18 ± 4 18 ± 4 nsHind limb shared stance (sec) 0.047 ± 0.026 0.050 ± 0.018 0.036 ± 0.013 nsValues are means ± StdDev and were analyzed by one-way ANOVA;ns = p>0.05.Gate indices were not different between WT, HET and KO mice. Data are plotted as mean ± SD and were analyzed by ANOVA.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 8 of 17http://www.molecularneurodegeneration.com/content/7/1/25cerebellum in our LRRK2 KO and HET mice did not re-veal any obvious structural differences, however given thehigh expression of LRRK2 in the cerebellum, further stud-ies examining cerebellar neurochemistry/function may bewarranted. In the heregulin mutant and Pcmt1−/− models,enhanced rod performance was also accompanied byhyperactivity [49,50] which we did not observe. However,like our LRRK2 KO mice, the Pcmt1−/− mice also dis-played significant thigmotaxic behaviors in addition toenhanced rotarod phenotype. Our rotarod result togetherwith the results obtained in the open-field test might indi-cate inability of termination of ongoing behavior, whichresulted in higher ceiling performance of KO mice in therotarod test.It is also important to note that aside from the cere-bellum, enhanced rod performance could also be attrib-uted to central (i.e. heart) and/or peripheral effects (i.e.muscle). Since LRRK2 is expressed in both heart andFigure 6 LRRK2 KO mice develop degeneration in the kidney from an early age. (a) Comparison of perfused kidneys extracted from WT,HET and KO mice at 3, 6, 12 and 20 months of age. Coloration changes were observed as early as 3 months in KO mice. HET kidneys were notaffected. (b) Histopathology of kidney reveals morphological changes. H&E at 3 months shows pigmentation in proximal tubule (arrow). H&E at18 months shows extensive vacuolization (white arrow) and pigmentation (arrowhead). Positive p62 staining can be seen at 3 months in KO andis extensive by 18 months. Pigmentation in tubules, most likely to be lipofuscin, is autofluorescent in rhodamine channel at both 3 and18 months in KO. Scale bar is 50 microns. (c) Electron microscopy in KO kidney reveals degenerative changes at the ultrastructural level in renalcortex tubular epithelial cells from 18 month old KO mouse. (i) Normal epithelial cell in WT mouse. (N) nucleus. (ii) Degenerating debris (d) intubular epithelial cell in KO. (iii) Higher power image from KO showing normal mitochondria (M), lipid (Lp) probably lipofuscin and degenerativestructure, probably lysosomal-containing lipid. (iv) Higher power image from KO of degenerative structure showing extensive debris.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 9 of 17http://www.molecularneurodegeneration.com/content/7/1/25skeletal muscle [17] a closer physiological examinationof heart and muscle may also be revealing.LRRK2 KO mice have normal lifespans and do nothave any compensatory changes in LRRK1 or other PDrelated mRNAs. In agreement with previous reports, andconsistent with the lack of striatal-related motor pheno-types, we did not observe any changes in total striataldopamine levels nor did we observe nigral neuronal loss.Given that several mutant LRRK2 models have normaltotal dopamine levels, but still exhibit subtle defects inextracellular release, we extended on the studies ofothers [34,43] and performed in vivo microdialysis inLRRK2 KO, HET and WT mice. Endogenous extracellu-lar levels of dopamine were found to be normal in KOand HET mice compared with WT, as were post-KClstimulation levels. Taken together, our data suggest thatthe dopamine system is functionally intact in LRRK2 KOmice. Future studies to examine extracellular release ofFigure 7 Quantitative differences in p62 levels and LC3-II/LC3-I ratio in aged LRRK2 KO mice. (a) Representative LC3 and p62 immunoblotsof insoluble fraction kidney lysates from 3-, 12- and 20-month old WT and KO mice. Visibly more p62 is seen in both 12- and 20-month old mice. LC3-IIlevels are also visibly increased in 20-month old KO mice. (b) Graphical presentation of densitometric quantification of immunoblots from N= 5-7 animalsfor each group. Alzheimer (AD) brain lysate was used as a control. LC3 data are expressed as a ratio of LC3-II/LC3-I. The ratio of LC3-II/LC3-I was significantlyincreased by 20 months, indicating an increase in autophagy. p62 data was expressed as % intensity, normalized to the lowest densitometric band oneach blot. A significant increase was observed in KO mice at 12 and 20 months. Data are presented as mean ± SEM and were analyzed by eitherStudent’s t-test or Mann Whitney non-parametric comparisons. ** p <0.01, ***p <0.001.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 10 of 17http://www.molecularneurodegeneration.com/content/7/1/25other neurotransmitters in LRRK2 KO mice, for exampleserotonin in the hippocampus/amygdala may be moreinformative given the abnormal behaviors in the open-field.Curiously, unlike the G2019S BAC mice, LRRK2 KOmice do not appear to have any defect in neurogenesis,since proliferating cells and DCX counts were similar toWT mice. Dentate gyrus neurogenesis is thought to beinvolved in regulation of emotion [52,53] and we previ-ously theorized that the impaired neurogenesis and anx-iety phenotype may be linked in G2019S mice [26].However, in this instance the unaltered neurogenesis inLRRK2 KO mice rules out this idea.Neuropathological analysis of brains from LRRK2 KOmice does not reveal any PD-related pathology or striataldendritic spine alterations and tau regulation alsoappears to be normal in KO mice. In agreement withothers [34,43] we do observe a marked kidney pheno-type, which in our mice is characterized by discoloration,enlargement, inflammatory and degenerative changes.The phenotype occurs in LRRK2 KO (but not HET)from both genders and some features are observed asearly as 3–4 months including discoloration, inflamma-tion, increased p62 immunopositive cells and pigmenta-tion. What is curious is that we observe the opposingeffect on autophagy reported by Tong el al, in that wesee elevated, rather than a decreased levels of LC3 II, in-dicating increased autophagy in the oldest (18–20 months) mice, and no indication of a biphasic re-sponse. Herzig et al recently reported that they saw nochanges in LC3-II in their KO line [43], however thedata presented suggests they only examined mice up to14 months of age for this marker and we only saw quan-tifiable differences at the 18 month time point. Our datapoints toward a compensatory attempt to counteract thedegeneration and pigment accumulation. Although onewould expect all LRRK2 knockout models to exhibitsimilar phenotypes, it is possible that subtle differencesin strain background, targeting and breeding strategiesmay alter phenotypic progression, and perhaps if wewere able to age our mice long enough, we may well ob-serve a decrease in autophagy and alpha-synuclein accu-mulation in the kidney as the degenerative phenotypeprogresses.ConclusionsIn summary, we report mice lacking LRRK2 via targetedremoval of the kinase domain have a normal dopamin-ergic system and do not develop any pathological fea-tures of PD. Our detailed behavioral analysis hasrevealed open-field phenotypes in KO mice, warrantingfurther study into the role of LRRK2 and limbic systembehaviors/neurochemistry. Loss of LRRK2 has a positiveimpact on rotarod performance, implying possibleinvolvement in cerebellar function and sensory proces-sing, although the mechanisms are unclear at this time.Finally, we confirm the impact of loss of LRRK2 on thekidney, which reiterates the important consideration ofthe role of LRRK2 outside the CNS when designingtherapeutics.Materials and MethodsAnimalsAll animal procedures were approved by the MayoClinic Institutional Animal Care and Use Committeeand were in accordance with the National Institute ofHealth Guide for the Care and Use of Laboratory Ani-mals (NIH Publications No. 80–23) revised 1996.Generation of targeted LRRK2 knockout miceLRRK2 knockout (KO) mice, generated at Ozgene PLC(Australia) were created utilizing a construct designed toablate LRRK2 exon 41. Regions of 5’ homology (4 kb)and 3’ homology (4.7 kb) were used to drive the homolo-gous recombination event by standard gene targetingtechniques in C57BL/6 Bruce4 embryonic stem (ES)cells [54]. Following electroporation of the targetingconstruct, cells were selected for neomycin (Neo) resist-ance. Targeted ES cells were confirmed by Southernblotting and PCR. Euploid, targeted ES cells were thenmicroinjected into Balb/cJ blastocysts and reimplantedinto pseudopregnant dams. Resultant chimeras werebred to C57BL/6 J breeders to establish transmission.Black (i.e. those with the ES cell germline) progeny thatwere heterozygous for the gene-targeted allele were thenbred to Cre recombinase “deleter” mice on C57BL/6 Jbackground (Ozgene) to allow excision of the exon 41and Neo selection cassette, which were flanked by lox Psites. Cre was then removed by breeding to C57BL/6 Jwild type mice. Resultant mice were then transferred toour colony and bred to homozygosity, maintained on theC57BL/6 J background. Single nucleotide polymorphismanalysis with 124 evenly spaced markers covering themouse genome indicated that the strain was congenicon C57BL/6 with no evidence of any contaminating in-bred strain.Routine genotyping was performed by a PCR-basedstrategy utilizing intronic primers that span exon 41(forward 5’CTACCAGGCTTGATGCTTTA’3, reverse5’TCTGTGACAGGCTATATCTC’3) that yielded a471 bp band in wild type (WT), ~220 bp band in KOand both bands in heterozygotes (HETS).Northern BlottingTotal RNA was extracted using Trizol® reagent (Invitro-gen) according to manufacturer’s instructions. Two micefrom each genotype (WT, KO, HET) were used for ana-lysis. Total RNA (12 μg) was prepared in 1X MOPS,Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 11 of 17http://www.molecularneurodegeneration.com/content/7/1/256.5 % (v/v) formaldehyde and 50 % (v/v) de-ionised for-mamide, denatured at 65°C. Samples were electrophor-esed on a denaturing gel (1 % (w/v) agarose 0.7 %, (v/v)formaldehyde, 1X MOPS, 0.005 % (v/v) ethidium brom-ide) for approximately 3–4 hours at 100 Volts. 0.5-10 kb RNA ladder (Invitrogen) was used for sizecomparison. The RNA was then capillary transferred over-night onto Hybond-N+ nylon membrane (Invitrogen) andUV cross-linked. Membranes were probed with a 539bp cDNA probe designed to exons 24–27 of mouse LRRK2(generated by PCR using primers forward 5’ATGCCACGTATCACCAAC’3, reverse 5’TCTAAGGTGCTGATCTGATTC’3). Probes were labeled with [α-32P] dCTP(3000 Ci/mmole) (Perkin Elmer) using Ready to Go label-ing beads (Invitrogen). Cross-linked membranes were pre-incubated at 42°C in hybridization buffer (1X Denhardt’ssolution, 4X SSC, 50 % (w/v) deionised formamide, 10 %(w/v) dextran sulphate, 200 mg/μl herring sperm DNA) forat least 30 minutes and then hybridized with labeled probeovernight at 42°C. Membranes were washed with 1X SSCfor 20 minutes at room temperature to remove excess probeand then 1–2 times in 1X SSC containing 0.1 % SDS at 55°Cfor 15minutes. To visualize bands, membranes were exposedto BioMax film (Kodak) at −80°C for 5–48 hours. A 214 bphistone cDNA probe was used as loading control (generatedusing primers forward 5’ GCGTGCTAGCT GGATGTCTT‘3 and reverse 5’CCACTGAACTTCTGATTCGC ‘3).AntibodiesAntibody 1182E, raised to amino acids 841–960 ofLRRK2 (1:200) was a gift from Dr. Benoit Giasson (Univ.Pennsylvania) was used for immunoblotting. LRRK2immunohistochemistry was performed with MJFF2 at1:4000 (Epitomics, c41-2) raised to amino acids 970–2527. Tyrosine hydroxylase (TH) (Affinity Bioreagents)was used to visualize dopamine neurons by immunohis-tochemistry (1:200) and on immunoblots (1:1000). Phos-pho-TH (Ser40) antibody was used for immunoblottingonly (1:1000, Cell Signalling). Detection of α-synucleinwas with a mouse monoclonal to α-synuclein (clone 42,1:3500 for immunohistochemistry and 1:500 for immu-noblots) from BD Transduction Labs and the phospho-Ser129 antibody (1:1000) was a gift from Dr. TakeshiIwatsubo, University of Tokyo. Activated microglia weredetected by Iba-1 (1:2000, Wako Chemicals). Tau anti-bodies were CP-13 (1:1000 immunohistochemistry,1:200 immunoblots), Tau-5 (1:500 immunoblots) andPHF-1 (1:500 immunoblots) all gifts from Dr. PeterDavies, Albert Einstein College of Medicine, 12E8(1:10,000 immunohistochemistry) a gift from Dr. PeterSeubert, Elan Pharmaceuticals and Tau-1 (1:500 immu-noblots) from Millipore. For autophagy studies we usedLC3 (1:500 immunoblots) from Novus and p62 (1:500for immunoblots and 1:2000 for immunohistochemistry)from Progen. Neurogenesis studies utilized rat α-5-bromo-2-deoxyuridine (BrdU) 1:500 (Oxford Biotech-nology) and goat α-doublecortin (DCX) 1:500, (SantaCruz Biotechnology).ImmunoblottingAnalysis of LRRK2 and tau protein was performed aspreviously described [47]. TH and pTH immunoblottinglysates were prepared in RIPA buffer with Triton X-100containing protease inhibitors. 10 μg (for TH) or 50 μg(pTH) of protein was loaded onto 4-12 % Bis-Tris gels(Invitrogen). For autophagy studies samples were pre-pared as previously described [34], 60 μg of protein wasloaded on 4-20 % Tris-glycine gels for LC3 and 10 %Tris-glycine gels for p62. ImageJ 1.42q (NationalInstitutes of Health) was used to quantify blots.Densitometric values were analyzed statistically by eitherStudent’s t-test or Mann Whitney non-parametriccomparisons.StereologyBrains from 18–20 month old KO (n = 4) and littermateWT mice (n = 4) were post-fixed in 4 % paraformalde-hyde (PFA) for 24 hours followed by 30 % sucrose cryo-protection for 48 hours. Brains were sectionedexhaustively at 50 μm thickness using a freezing sledgemicrotome. For dopamine neuron and dendritic esti-mates, after a random start, every third section wasstained free floating with TH antibody. Free floatingimmunostaining was performed utilizing the VECTAS-TAIN® ABC System (Vector laboratories). Sections weremounted onto glass slides, allowed to dry overnight,lightly counterstained with cresyl-violet and then dehy-drated and cover slipped. Quantification was performedat high magnification (400X) using the optical fractiona-tor number and length probes in Stereo Investigatorsoftware (MicroBrightField). Data was plotted as mean ±SEM and statistically analyzed by Student’s t-test.High performance liquid chromatography (HPLC)HPLC with electrochemical detection was performed aspreviously described [47] in striatal tissue punches fromfrozen brains from mice aged 10 months KO (n = 14; 6males, 8 females) and WT (n = 13; 7 males, 6 females)and 16–18 months KO (n = 7; 4 males, 3 females) andWT controls (n = 8; 4 males, 4 females). The amounts ofmonoamines/metabolites in the tissue samples weredetermined by comparing peak area values with thoseobtained from external standards run on the same day.Neurochemical concentrations were determined by nor-malizing samples to protein concentrations obtainedfrom the pellets (BCA method). Data was plotted (mean± SEM) and statistically analyzed using Mann Whitneynon-parametric comparisons.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 12 of 17http://www.molecularneurodegeneration.com/content/7/1/25MicrodialysisKO (n = 10 males), HET (n = 6 males) and WT litter-mates (n = 13 males) aged 3–4 months were anesthetizedwith 1-2 % isoflurane. Guide cannulae (CMA Microdia-lysis) were surgically implanted into the striatum using astandard stereotaxic frame (Kopf Instruments, Tujunga,CA) utilizing coordinates (from Bregma anterior-poster-ior +0.1 cm, lateral-medial +0.2 cm, dorso-ventral−0.2 cm) according to the Mouse Brain Atlas [55]. Micewere allowed to recover for at least 24 hours. Microdia-lysis experiments were carried out on conscious, freelymoving mice with surgically implanted guide cannulae.On the day of the experiment, the stylet in the guidecannula was replaced with the microdialysis probe(CMA/7 with 2 mm membrane, CMA Microdialysis).The probe was perfused at 2 μl/min with artificial cere-brospinal fluid (aCSF; 145 mM NaCl, 1.2 mM CaCl2,3 mM KCl, 1.0 mM MgCl2) for a two hour equilibrationperiod before collection. Dialysate samples were auto-matically collected every 15 minutes into vials contain-ing 2 μl perchloric acid (0.1 %) to retard oxidation ofmonoamines. Four baseline collections were taken at 15minute intervals, and then the perfusate was switched tohigh KCl aCSF (103 mM NaCl, 1.2 mM CaCl2, 45 mMKCl, 1.0 mM MgCl2). After 30 minutes the perfusatewas switched back to the original aCSF and four subse-quent samples were collected every 15 minutes. Sampleswere analyzed by HPLC for dopamine content. Data wasplotted (mean ± SEM) and statistically analyzed usingMann Whitney non-parametric comparisons.Pathological analysisAt least six mice from each genotype (KO, HET, WT)were analyzed per time point (3, 6, 12, 18 months). For-malin fixed, paraffin embedded tissue sections weredewaxed in xylene and rehydrated in descending alco-hols and water. For antigen retrieval in paraffin sections,tissue was pressure cooked (10 minutes) in distilledwater (all antibodies, except α-synuclein). Appropriatedisease/tissue positive controls were included for eachantibody (diffuse Lewy body disease for α-synuclein,Alzheimer for tau antibodies, Alzheimer/vascular de-mentia for Iba-1). Immunohistochemistry was performedusing the Dako Autostainer. Tissue was quenched forendogenous peroxidases in 0.03 % H2O2 and blocked inDako All-purpose blocking solution for 30 minutes.Primary antibody was incubated for 45 min at roomtemperature. All secondary antibodies were from theEnvision+ System Labeled Polymer HRP (Dako), fol-lowed with DAB substrate (Dako), with the exception ofp62 immunostaining which utilized an anti-guinea pigsecondary and DAB kit (both Vector Labs). Sectionswere lightly counter stained in Gills 3 hematoxylin.Standard histological staining was also used (haemotoxylinand eosin, Gomori's Prussian blue, Periodic acid-Schiff andMasson Fontana).Transmission electron microscopy18 month old KO and WT mice, were perfused transcar-dially with 2.5 % gutaraldehyde-2 % PFA in 0.1 M caco-dylate buffer. Kidneys were removed, split in halves andimmersed in the same fixative for two hours at roomtemperature. Small pieces of the cortex were furtherfixed in aqueous 2 % OsO4 and 2 % uranyl acetate, dehy-drated in ethanols and propylene oxide, infiltrated andembedded in Epon 812 (Polysciences). Ultrathin sectionswere stained with uranyl acetate and lead citrate, andexamined with a Philips 208 S electron microscope (FEI)fitted with a Gatan 831 Orius CCD camera (Gatan).Digital images were processed with Adobe PhotoshopCS2 software.Behavioral studiesOpen-field (OF) testTwenty eight littermate mice (N = 8 KO males KO; 8KO females, and N = 6 WT males; 6 WT females)were used for the evaluation of the exploratory activ-ity in the open-field test. Open-field behavior of themice was evaluated in a longitudinal experiment, withthe first test applied at the age of 7 months and thesecond at the age of 16 months. Mice were habitu-ated to the behavioral room for one week before test-ing. The OF apparatus consisted of a circular arena,120 cm in diameter, surrounded by a 30 cm highwall. The apparatus, build of white plastic, was ele-vated 86 cm off the floor level. The arena was illumi-nated by 4 sets of in ceiling fluorescent lightsavailable in a testing room and no additional illumin-ation was used. An object (a plastic water bottle,10 cm in diameter, 25 cm high) painted with blackand white horizontal stripes was placed in the centreof the arena. All mice were individually exposed tothe arena in one 5-min session. At the onset of thesession, a mouse was placed near the wall of thearena and its movement on the arena throughout theduration of the session was recorded by a videotracking system (HVS Image Advanced TrackerVP200, HVS Image, Buckingham, UK). The data wereextracted off-line using a Wintrack program [56].XIn our analysis we focused on measures of motor ac-tivity in the arena and the exploration of a novel object.The following behavioral categories were used to evalu-ate the exploratory motor activity of mice in the open-field: walking path length (m) – the distance a mousecovered during the exploration of the arena, walkingspeed (m/s) – averaged speed of active walking, exclud-ing period of rests, latency to move – the onset (s) of ac-tive locomotor exploration after placing a mouse in theHinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 13 of 17http://www.molecularneurodegeneration.com/content/7/1/25arena, number of stops – a stop was defined as a periodof inactivity lasting between 1 and 5 s which was sepa-rated by at least 1 s of locomotion, number of rests – arest was defined as a period of inactivity lasting longerthan 5 s which was separated by at least 1 s of locomo-tion, time spent resting – total time (s) spent by mice onresting, % time in the central zone – the percent of timespend in the central zone of the arena (50 cm radiusfrom the centre), thigmotaxis – percent of time a mousecontinuously walked within the close vicinity (7.5 cm) ofthe wall of the apparatus, path tortuosity (°/m) – themeasure was derived by dividing the path into straightsegments and curves with consistent change in direction.Following, absolute changes in direction of all curveswere summed and divided by total path length. Thenovel object exploration was evaluated by the latency (s) ofthe first approach to the object, the total time of object ex-ploration – a mouse was considered exploring an object ifits nose was within a direct contact or 1 cm from an ob-ject and the body of a mouse was within a distance of5 cm from the object perimeter, and by the number ofcrosses of an object zone – a 5 cm virtual zone surroundingan object.A factorial model analysis of variance (ANOVA) with thegenotype as between subject, and age of testing (7 and16 months) as within subject (repeated measure) factorswas used in the analysis of open-field data. While perform-ing all repeated measures ANOVAs, departures from theassumption of compound sphericity were evaluated byMauchly test [SPSS statistical package (SPSS Inc. Chicago)v. 19 run on a Macintosh computer] with α level set to0.05. In cases when sphericity was significantly violated,degrees of freedom were adjusted by Greenhouse-Geisserε-correction. Due to considerable variability of the mea-sures obtained in the open-field [45] and relatively smallsample size of mice, the interaction effect in our 2 × 2 fac-torial design often did not reach significance at α = 0.05.Consequently, we followed the overall ANOVAs by the apriori identified analysis focused on genotype effect at eachtesting age, utilizing Student’s t-tests for independent andmatched-pairs samples. Correlations between the variablesobtained in the open-field test were done using Pearsonproduct–moment correlation. The critical α level for allanalyses was set to 0.05. Due to space limitation, only sig-nificant results pertaining to the hypotheses testing the ef-fect of the genotype and age are reported.RotarodMotor co-ordination was measured using an automatedrotarod system (Rotamex-5 Columbus instruments). Fol-lowing a 3 day habituation period in the behavioral suite,littermate mice (7 months KO n= 9; HET n = 8 and WT n= 12) were trained for two days prior to testing. The spindledimensions were 3.0 cm x 9.5 cm and the speed of the rodwas set to 4-40 rpm acceleration, increasing 1 rpm every 5seconds. The equipment was equipped with a sensor thatautomatically stops the timer if the mice cling and rollaround on the rod. On the third day, mice were tested for 4consecutive trials, allowing 10 minutes rest per trail. Datafrom the testing day was plotted as mean trail time anddata was statistically analyzed using one way ANOVA fol-lowed by Tukey’s multiple comparisons.Gait dynamicsMice (KO n = 8; HET n = 8 and WT n= 9) were selectedfrom the same group of animals described above forrotarod testing. Mouse gait dynamics were obtained using amotorized treadmill (with a transparent belt and digitalvideo camera mounted underneath) by ventral plane vide-ography [57-59] and analyzed with DigiGait® Version 9 soft-ware (Mouse Specifics, Inc). Each mouse was individuallyplaced in the treadmill compartment for a few seconds andthen the belt was turned on at a low speed (4 cm/sec) justprior to testing [previous studies show that C57BL/6 J micedo not require extended acclimatization to the treadmill[57-59]]. The motor speed was then set to 14 cm/s and atleast 4 seconds of videography was collected for eachmouse to obtain at least 8 sequential step images. Thespeed was then increased to 18 cm/s, and then 24 cm/sec,collecting an average 4 seconds of videography to obtain atleast 12 or 15 sequential step images, respectively. Micethat did not have stride regularity indices (alternate stepsequences) at 100 % [58,60] were still included in the studyto evaluate inter-limb coordination.Each individual gait signal per limb consists of a stanceduration (time in contact with surface) and swing duration(time not in contact with surface) which together are thestride duration. Stride frequency is calculated by measuringthe number of strides over time. Stride length is calculatedby dividing the belt speed over the stride frequency. Pawangles and step angles at full stance are determined by soft-ware geometry calculations (fitting ellipses to the paws) ofellipse centers, major axes and vertices. The left and rightgait measurements were combined for all forelimb andhindlimb data analysis. Gait indices were plotted as mean ±standard deviation and analyzed by one way ANOVA.Supplemental methodology is also available in Additionalfile 7.Additional filesAdditional file 1: Figure S1. No compensatory changes are observed inthe expression levels of murine LRRK1, SNCA (MAPT or PARKIN genes inLRRK2 KO mice. Real-time PCR was performed with ABI TaqMan® probesto murine (A) LRRK1 (Mm00713303_m1), (B) murine SNCA(Mm00447333_m1), (C) MAPT (Mm00521988_m1) and (D) PARKIN(Mm00450187_m1). Mouse GAPDH (Mm99999915_m1) as theendogenous reference gene. Data plotted as mean ± SEM. In eachgraph/region the first column is WT, second column HET and thirdcolumn is KO.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 14 of 17http://www.molecularneurodegeneration.com/content/7/1/25Additional file 2: Figure S2. Dopamine uptake and D2 autore ceptorfunction is normal in LRRK2 KO mice. (A) Dopamine uptake wasmeasured in freshly prepared synaptosomes using [2,5,6,7,8-3H]-DA. Eachexperiment included N=3 mice per genotype (8 months of age) andthree independent experiments were performed. Specific DA uptakevalues (pmol/mg/min) were averaged and expressed as % of WT control.Data plotted as mean ± SEM. (B, C) To examine D2 autoreceptorfunction, mice were treated with D2 receptor antagonist raclopride andsacrificed 30 minutes later. Dopamine and dopamine metabolite levelswere measured by HPLC. Dopamine turnover, defined by the ratio of (B)DOPAC/DA or (C) HVA/DA significantly increased, as expected, in all threegroups (p < 0.001 ANOVA for both ratios) however post-hoccomparisons revealed the extent of this turnover increase did not differbetween WT, HET and KO groups. Data plotted as mean ± SEM.Additional file 3: Figure 3. Post synaptic D1 and D2 receptor density iscomparable in LRRK2 KO and WT mice. Quantitative autoradiography wasperformed with D1 receptor ligand [3H] SCH 23390 and D2 receptorligand [3H] methylspiperone in serial striatal sections in mice aged 10months (A,B) and 18 month (C,D). D1 and D2 binding was equivalent inKO and WT mice at both age points. Data plotted as mean ± SEM.Additional file 4: Figure 4. Loss of LRRK2 does not impact on striataldendritic spine density. Dendritic spines were visualized in 18 month oldWT and KO mice by Golgi-Cox impregnantion and counted usingMetamorph software. (A) Representative lower magnification image of atypical MSN selected for quantification - only dendrites clearly associatedwith an MSN-like cell body were quantified (B) High magnification of adendrites captured by Z-stack shows that KO and WT spines appear tobe comparable (C) Quantification of spines, classified by morphologicaltype, revealed no difference between WT and KO dendrites. Data plottedas mean ± SEM.Additional file 5: Figure 5. Subgranular zone proliferation andneurogenesis are unaffected in LRRK2 KO mice. (A) Proliferation wasmeasured by counting BrdU positive cells in sections prepared from miceaged 4 months (N=4 per group) sacrificed 24 hours after IP BrdUinjection (100mg/kg) (B) Neurogenesis was quantified in the samesections by counting doublecortin (DCX) positive neurons. Data plottedas mean ± SEM.Additional file 6: Figure 6. Tau regulation in LRRK2 KO mice does notdiffer from WT. Cortical and hippocampal lysates were prepared from 18month old WT and KO mice and immunoblots probed with tauantibodies. Graph shows representative blots for Tau-5 tau, CP-13(pSer202) and Tau-1 in alkaline phosphatase (dephosphorylated) treatedlysates. Densitometric quantification of N=6 mice per group (not shown)did not reveal any significant differences in either region for KO versusWT mice.Additional file 7: Supplemental Methodology [26,47,61-63].AbbreviationsLRRK2/LRRK2: leucine rich repeat kinase 2; PD: Parkinson’s disease; WT: Wildtype; HET: Heterozygous; KO: Knockout; BAC: Bacterial artificial chromosome;PCR: Polymerase chain reaction; TH: Tyrosine hydroxylase; DCX: Doublecortin;HPLC: High performance liquid chromatography; DA: Dopamine; DOPAC: 3,4-dihydroxyphenylacetic acid; HVA: Homovanillic acid; MSN: Medium spinyneurons.Competing interestsHLM, SJL and MJF have received royalties from commercial licensing ofLRRK2 KO mice. All other authors declare they have no competing interests.Authors’ contributionsKMH and MY performed the bulk of the husbandry and technical (molecularcharacterization, behavior, microdialysis surgeries and collections, HPLC, DAuptake, receptor binding, immunoblotting etc) work and contributed tomanuscript writing. HLM performed microdialysis and dialysate HPLC. BB andJEB performed tissue HPLC and dendrite stereology. JCD performedimmunoblotting. BB and JCD provided intellectual input to experiments andmanuscript. SJL contributed intellectually to targeting design and molecularcharacterization. EEB performed HPLC and Golgi impregnation and analysis.CBK performed immunohistochemistry. KN performed taqman studies. IPand BW performed neurogenesis studies. CJ performed and analyzed open-field behavior and contributed to manuscript writing. WLL and DWDperformed EM and pathological interpretation. HLM and MJF conceived thestudy. HLM designed experiments, interpreted data and wrote themanuscript. All authors read and approved the final manuscript.AcknowledgementsWe would like to thank Peter Ash, John Fryer, John Howard, MonicaCastanedes-Casey, Linda Rousseau and Virginia Philips for technicalassistance. Funding support was provided by the Mayo Clinic, NIH GrantsNINDS NS065860 (HLM), NINDS NS40256 and NS072187 (DWD, MJF),Lundbeck A/S (MJF, HLM, JCD), the Michael J Fox Foundation (MJF, JCD,HLM) and Interdisziplinäres Zentrum für Klinische Forschung (BW).Author details1Department of Neuroscience, Mayo Clinic, Jacksonville, Florida 32224, USA.2Junior Group III, Interdisciplinary Center for Clinical Research, Nikolaus-Fiebiger Center for Molecular Medicine, FAU, Erlangen-Nürnberg, Germany.3Department of Neuroscience, Center for Translational Research inNeurodegenerative Disease, University of Florida, Gainesville, Florida 32610,USA. 4Department of Medical Genetics, University of British Columbia,Vancouver V6T 285, Canada.Received: 06 February 2012 Accepted: 27 April 2012Published: 30 May 2012References1. Zimprich A, et al: Mutations in LRRK2 cause autosomal-dominantparkinsonism with pleomorphic pathology. Neuron 2004, 44:601–607.2. Paisan-Ruiz C, Evans EW, Jain S, Xiromerisiou G, Gibbs JR, Eerola J, GourbaliV, Hellstrom O, Duckworth J, Papadimitriou A, Tienari PJ, Hadjigeorgiou GM,Singleton AB: Testing association between LRRK2 and Parkinson's diseaseand investigating linkage disequilibrium. J Med Genet 2006, 43:e9.3. Kachergus J, Mata IF, Hulihan M, Taylor JP, Lincoln S, Aasly J, Gibson JM,Ross OA, Lynch T, Wiley J, Payami H, Nutt J, Maraganore DM, Czyzewski K,Styczynska M, Wszolek ZK, Farrer MJ, Toft M: Identification of a novelLRRK2 mutation linked to autosomal dominant parkinsonism: evidenceof a common founder across European populations. Am J Hum Genet2005, 76:672–680.4. Ozelius LJ, Senthil G, Saunders-Pullman R, Ohmann E, Deligtisch A, TagliatiM, Hunt AL, Klein C, Henick B, Hailpern SM, Lipton RB, Soto-Valencia J, RischN, Bressman SB: LRRK2 G2019S as a cause of Parkinson's disease inAshkenazi Jews. N Engl J Med 2006, 354:424–425.5. Ishihara L, et al: Screening for Lrrk2 G2019S and clinical comparison ofTunisian and North American Caucasian Parkinson's disease families.Mov Disord 2007, 22:55–61.6. Di Fonzo A, Wu-Chou YH, Lu CS, van Doeselaar M, Simons EJ, Rohe CF,Chang HC, Chen RS, Weng YH, Vanacore N, Breedveld GJ, Oostra BA,Bonifati V: A common missense variant in the LRRK2 gene, Gly2385Arg,associated with Parkinson's disease risk in Taiwan. Neurogenetics 2006,7:133–138.7. Tan EK: Identification of a common genetic risk variant (LRRK2Gly2385Arg) in Parkinson's disease. Ann Acad Med Singapore 2006,35:840–842.8. Farrer MJ, Stone JT, Lin CH, Dachsel JC, Hulihan MM, Haugarvoll K, Ross OA,Wu RM: Lrrk2 G2385R is an ancestral risk factor for Parkinson's disease inAsia. Parkinsonism & related disorders 2007, 13:89–92.9. Ross OA, Wu YR, Lee MC, Funayama M, Chen ML, Soto AI, Mata IF, Lee-ChenGJ, Chen CM, Tang M, Zhao Y, Hattori N, Farrer MJ, Tan EK, Wu RM: Analysisof Lrrk2 R1628P as a risk factor for Parkinson's disease. Ann Neurol 2008,64:88–92.10. Daniels V, Baekelandt V, Taymans JM: On the road to leucine-rich repeatkinase 2 signalling: evidence from cellular and in vivo studies.Neurosignals 2011, 19:1–15.11. Yue Z, Lachenmayer ML: Genetic LRRK2 models of Parkinson's disease:Dissecting the pathogenic pathway and exploring clinical applications.Mov Disord 2011, 26:1386–1397.12. Nandhagopal R, Mak E, Schulzer M, McKenzie J, McCormick S, Sossi V, RuthTJ, Strongosky A, Farrer MJ, Wszolek ZK, Stoessl AJ: Progression ofdopaminergic dysfunction in a LRRK2 kindred: a multitracer PET study.Neurology 2008, 71:1790–1795.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 15 of 17http://www.molecularneurodegeneration.com/content/7/1/2513. Sossi V, de la Fuente-Fernandez R, Nandhagopal R, Schulzer M, McKenzie J,Ruth TJ, Aasly JO, Farrer MJ, Wszolek ZK, Stoessl JA: Dopamine turnoverincreases in asymptomatic LRRK2 mutations carriers. Mov Disord 2010,25:2717–2723.14. Bostantjopoulou S, Katsarou Z, Gerasimou G, Costa DC, Gotzamani-PsarrakouA: (123)I-FP-CIT SPET striatal uptake in parkinsonian patients with thealpha-synuclein (G209A) mutation A. Hell J Nucl Med 2008, 11:157–159.15. Perani D, Garibotto V, Hadjigeorgiou GM, Papadimitriou D, Fazio F,Papadimitriou A: Positron emission tomography changes in PARK1mutation. Mov Disord 2006, 21:127–130.16. Samii A, Markopoulou K, Wszolek ZK, Sossi V, Dobko T, Mak E, Calne DB,Stoessl AJ: PET studies of parkinsonism associated with mutation in thealpha-synuclein gene. Neurology 1999, 53:2097–2102.17. Biskup S, Moore DJ, Rea A, Lorenz-Deperieux B, Coombes CE, Dawson VL,Dawson TM, West AB: Dynamic and redundant regulation of LRRK2 andLRRK1 expression. BMC Neurosci 2007, 8:102.18. Biskup S, Moore DJ, Celsi F, Higashi S, West AB, Andrabi SA, Kurkinen K, YuSW, Savitt JM, Waldvogel HJ, Faull RL, Emson PC, Torp R, Ottersen OP,Dawson TM, Dawson VL: Localization of LRRK2 to membranous andvesicular structures in mammalian brain. Ann Neurol 2006, 60:557–569.19. Galter D, Westerlund M, Carmine A, Lindqvist E, Sydow O, Olson L: LRRK2expression linked to dopamine-innervated areas. Ann Neurol 2006,59:714–719.20. Melrose H, Lincoln S, Tyndall G, Dickson D, Farrer M: Anatomicallocalization of leucine-rich repeat kinase 2 in mouse brain. Neuroscience2006, 139:791–794.21. Simon-Sanchez J, Herranz-Perez V, Olucha-Bordonau F, Perez-Tur J: LRRK2 isexpressed in areas affected by Parkinson's disease in the adult mousebrain. Eur J Neurosci 2006, 23:659–666.22. Taymans JM, Van den Haute C, Baekelandt V: Distribution of PINK1 andLRRK2 in rat and mouse brain. J Neurochem 2006, 98:951–961.23. Melrose HL, Kent CB, Taylor JP, Dachsel JC, Hinkle KM, Lincoln SJ, Mok SS,Culvenor JG, Masters CL, Tyndall GM, Bass DI, Ahmed Z, Andorfer CA, RossOA, Wszolek ZK, Delldonne A, Dickson DW, Farrer MJ: A comparativeanalysis of leucine-rich repeat kinase 2 (Lrrk2) expression in mouse brainand Lewy body disease. Neuroscience 2007, 147:1047–1058.24. Shi WX, Pun CL, Smith PL, Bunney BS: Endogenous DA-mediated feedbackinhibition of DA neurons: involvement of both D(1)- and D(2)-likereceptors. Synapse 2000, 35:111–119.25. Dachsel JC, Behrouz B, Yue M, Beevers JE, Melrose HL, Farrer MJ: Acomparative study of Lrrk2 function in primary neuronal cultures.Parkinsonism Relat Disord 2010, 16:650–655.26. Winner B, Melrose HL, Zhao C, Hinkle KM, Yue M, Kent C, Braithwaite AT,Ogholikhan S, Aigner R, Winkler J, Farrer MJ, Gage FH: Adult neurogenesisand neurite outgrowth are impaired in LRRK2 G2019S mice. Neurobiol Dis2011, 41:706–716.27. Parisiadou L, Xie C, Cho HJ, Lin X, Gu XL, Long CX, Lobbestael E, BaekelandtV, Taymans JM, Sun L, Cai H: Phosphorylation of ezrin/radixin/moesinproteins by LRRK2 promotes the rearrangement of actin cytoskeleton inneuronal morphogenesis. J Neurosci 2009, 29:13971–13980.28. Parisiadou L, Cai H: LRRK2 function on actin and microtubule dynamics inParkinson disease. Commun Integr Biol 2010, 3:396–400.29. Chan D, Citro A, Cordy JM, Shen GC, Wolozin B: Rac1 protein rescuesneurite retraction caused by G2019S leucine-rich repeat kinase 2(LRRK2). J Biol Chem 2011, 286:16140–16149.30. Kicka S, Shen Z, Annesley SJ, Fisher PR, Lee S, Briggs S, Firtel RA: TheLRRK2-related Roco kinase Roco2 is regulated by Rab1A and controlsthe actin cytoskeleton. Mol Biol Cell 2011, 22:2198–2211.31. Meixner A, Boldt K, Van Troys M, Askenazi M, Gloeckner CJ, Bauer M, MartoJA, Ampe C, Kinkl N, Ueffing M: A QUICK screen for Lrrk2 interactionpartners–leucine-rich repeat kinase 2 is involved in actin cytoskeletondynamics. Mol Cell Proteomics 2011, 10(M110):001172.32. Jedynak JP, Uslaner JM, Esteban JA, Robinson TE: Methamphetamine-induced structural plasticity in the dorsal striatum. Eur J Neurosci 2007,25:847–853.33. Couillard-Despres S, Winner B, Schaubeck S, Aigner R, Vroemen M,Weidner N, Bogdahn U, Winkler J, Kuhn HG, Aigner L: Doublecortinexpression levels in adult brain reflect neurogenesis. Eur J Neurosci2005, 21:1–14.34. Tong Y, Yamaguchi H, Giaime E, Boyle S, Kopan R, Kelleher RJ 3rd, Shen J:Loss of leucine-rich repeat kinase 2 causes impairment of proteindegradation pathways, accumulation of alpha-synuclein, and apoptoticcell death in aged mice. Proc Natl Acad Sci U S A 2010, 107:9879–9884.35. Hall C, Ballachey EL: A Study of the Rat's behavior in a field: AContribution to Method in Comparative Psychology. Univ Calif Publ Psych1932, 6:1–12.36. Corman CD, Shafer JN: Open-field activity and exploratory behavior.Psychonomic Science 1968, 13:55–56.37. Royce JR: On the construct validity of open-field measures.Psychological Bulletin 1977, 84:1098–1106.38. Lauterbach EC, Duvoisin RC: Anxiety disorders in familial parkinsonism.Am J Psychiatry 1991, 148:274.39. Nilsson FM, Kessing LV, Bolwig TG: Increased risk of developingParkinson's disease for patients with major affective disorder: a registerstudy. Acta Psychiatr Scand 2001, 104:380–386.40. Zhu XR, Maskri L, Herold C, Bader V, Stichel CC, Gunturkun O, Lubbert H:Non-motor behavioural impairments in parkin-deficient mice.Eur J Neurosci 2007, 26:1902–1911.41. Treit D, Fundytus M: Thigmotaxis as a test for anxiolytic activity in rats.Pharmacol Biochem Behav 1988, 31:959–962.42. Brown RE: Behavioural phenotyping of transgenic mice. Can J Exp Psychol2007, 61:328–344.43. Herzig MC: LRRK2 protein levels are determined by kinase function andare crucial for kidney and lung homeostasis in mice. Hum Mol Genet2011, 40:4209–4223.44. Tong Y, Giaime E, Yamaguchi H, Ichimura T, Liu Y, Si H, Cai H, Bonventre JV, ShenJ: Loss of leucine-rich repeat kinase 2 causes age-dependentbi-phasic alterations of the autophagy pathway. Mol Neurodegener 2012, 7:2.45. Wahlsten D, Metten P, Phillips TJ, Boehm SL 2nd, Burkhart-Kasch S, Dorow J,Doerksen S, Downing C, Fogarty J, Rodd-Henricks K, Hen R, McKinnon CS,Merrill CM, Nolte C, Schalomon M, Schlumbohm JP, Sibert JR, Wenger CD,Dudek BC, Crabbe JC: Different data from different labs: lessons fromstudies of gene-environment interaction. J Neurobiol 2003, 54:283–311.46. Lipp HP, Wolfer DP: Genetically modified mice and cognition. Curr OpinNeurobiol 1998, 8:272–280.47. Melrose HL, et al: Impaired dopaminergic neurotransmission andmicrotubule-associated protein tau alterations in human LRRK2transgenic mice. Neurobiol Dis 2010, 40:503–517.48. Hyde LA, Crnic LS, Pollock A, Bickford PC: Motor learning in Ts65Dn mice,a model for Down syndrome. Dev Psychobiol 2001, 38:33–45.49. Gerlai R, Pisacane P, Erickson S: Heregulin, but not ErbB2 or ErbB3,heterozygous mutant mice exhibit hyperactivity in multiple behavioraltasks. Behav Brain Res 2000, 109:219–227.50. Vitali R, Clarke S: Improved rotorod performance and hyperactivity inmice deficient in a protein repair methyltransferase. Behav Brain Res 2004,153:129–141.51. Clabough EB, Zeitlin SO: Deletion of the triplet repeat encodingpolyglutamine within the mouse Huntington's disease gene results insubtle behavioral/motor phenotypes in vivo and elevated levels of ATPwith cellular senescence in vitro. Hum Mol Genet 2006, 15:607–623.52. Sahay A, Drew MR, Hen R: Dentate gyrus neurogenesis and depression.Prog Brain Res 2007, 163:697–722.53. Sahay A, Hen R: Adult hippocampal neurogenesis in depression. NatNeurosci 2007, 10:1110–1115.54. Kontgen F, Suss G, Stewart C, Steinmetz M, Bluethmann H: Targeteddisruption of the MHC class II Aa gene in C57BL/6 mice. Int Immunol1993, 5:957–964.55. Paxinos G, Franklin K: The Mouse Brain in Stereotaxic Coordinates. 2ndedition. San Diego: Academic; 2001.56. Wolfer DP, Madani R, Valenti P, Lipp HP: Extended analysis of path datafrom mutant mice using the public domain software Wintrack. PhysiolBehav 2001, 73:745–753.57. Kale A, Amende I, Meyer GP, Crabbe JC, Hampton TG: Ethanol's effects ongait dynamics in mice investigated by ventral plane videography. AlcoholClin Exp Res 2004, 28:1839–1848.58. Amende I, Kale A, McCue S, Glazier S, Morgan JP, Hampton TG: Gaitdynamics in mouse models of Parkinson's disease and Huntington'sdisease. J Neuroeng Rehabil 2005, 2:20.59. Goldberg NR, Hampton T, McCue S, Kale A, Meshul CK: Profiling changes ingait dynamics resulting from progressive 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced nigrostriatal lesioning. J Neurosci Res 2011,89:1698–1706.Hinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 16 of 17http://www.molecularneurodegeneration.com/content/7/1/2560. Hamers FP, Lankhorst AJ, van Laar TJ, Veldhuis WB, Gispen WH: Automatedquantitative gait analysis during overground locomotion in the rat: itsapplication to spinal cord contusion and transection injuries.J Neurotrauma 2001, 18:187–201.61. Morel P, Fauconneau B, Page G, Mirbeau T, Huguet F: Inhibitory effects ofascorbic acid on dopamine uptake by rat striatal synaptosomes:relationship to lipid peroxidation and oxidation of protein sulfhydrylgroups. Neurosci Res 1998, 32:171–179.62. Bradford MM: A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Anal Biochem 1976, 72:248–254.63. Moron JA, Perez V, Fernandez-Alvarez E, Marco JL, Unzeta M: "In vitro"effect of some 5-hydroxy-indolalkylamine derivatives on monoamineuptake system. J Neural Transm Suppl 1998, 52:343–349.doi:10.1186/1750-1326-7-25Cite this article as: Hinkle et al.: LRRK2 knockout mice have an intactdopaminergic system but display alterations in exploratory and motorco-ordination behaviors. Molecular Neurodegeneration 2012 7:25.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitHinkle et al. Molecular Neurodegeneration 2012, 7:25 Page 17 of 17http://www.molecularneurodegeneration.com/content/7/1/25

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0215981/manifest

Comment

Related Items