Open Collections

UBC Faculty Research and Publications

MAP-ping genomic organization and organ-specific expression profiles of poplar MAP kinases and MAP kinase… Nicole, Marie-Claude; Hamel, Louis-Philippe; Morency, Marie-Josée; Beaudoin, Nathalie; Ellis, Brian E; Séguin, Armand Aug 31, 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12864_2006_Article_606.pdf [ 767.19kB ]
Metadata
JSON: 52383-1.0215977.json
JSON-LD: 52383-1.0215977-ld.json
RDF/XML (Pretty): 52383-1.0215977-rdf.xml
RDF/JSON: 52383-1.0215977-rdf.json
Turtle: 52383-1.0215977-turtle.txt
N-Triples: 52383-1.0215977-rdf-ntriples.txt
Original Record: 52383-1.0215977-source.json
Full Text
52383-1.0215977-fulltext.txt
Citation
52383-1.0215977.ris

Full Text

ralssBioMed CentBMC GenomicsOpen AcceResearch articleMAP-ping genomic organization and organ-specific expression profiles of poplar MAP kinases and MAP kinase kinasesMarie-Claude Nicole†1, Louis-Philippe Hamel†1,3, Marie-Josée Morency1, Nathalie Beaudoin3, Brian E Ellis2 and Armand Séguin*1Address: 1Natural Resources Canada, Canadian Forest Service, Laurentian Forestry Centre, 1055 du P.E.P.S., P.O. Box 10380, Stn. Sainte-Foy, Quebec, Quebec, G1V 4C7, Canada, 2Michael Smith Laboratories, University of British Columbia, 2185 East Mall, Vancouver, British Columbia, V6T 1Z4, Canada and 3Département de biologie, Université de Sherbrooke, Sherbrooke, Quebec, J1K 2R1, CanadaEmail: Marie-Claude Nicole - MCNicole@cfl.forestry.ca; Louis-Philippe Hamel - LPHamel@cfl.forestry.ca; Marie-Josée Morency - MJMorency@cfl.forestry.ca; Nathalie Beaudoin - Nathalie.Beaudoin@USherbrooke.ca; Brian E Ellis - bee@interchange.ubc.ca; Armand Séguin* - seguin@cfl.forestry.ca* Corresponding author    †Equal contributorsAbstractBackground: As in other eukaryotes, plant mitogen-activated protein kinase (MAPK) cascadesare composed of three classes of hierarchically organized protein kinases, namely MAPKKKs,MAPKKs, and MAPKs. These modules rapidly amplify and transduce extracellular signals intovarious appropriate intracellular responses. While extensive work has been conducted on thepost-translational regulation of specific MAPKKs and MAPKs in various plant species, there hasbeen no systematic investigation of the genomic organization and transcriptional regulation of thesegenes.Results: Ten putative poplar MAPKK genes (PtMKKs) and 21 putative poplar MAPK genes (PtMPKs)have been identified and located within the poplar (Populus trichocarpa) genome. Analysis of exon-intron junctions and of intron phase inside the predicted coding region of each candidate gene hasrevealed high levels of conservation within and between phylogenetic groups. Expression profilesof all members of these two gene families were also analyzed in 17 different poplar organs, usinggene-specific primers directed at the 3'-untranslated region of each candidate gene and real-timequantitative PCR. Most PtMKKs and PtMPKs were differentially expressed across this developmentalseries.Conclusion: This analysis provides a complete survey of MAPKK and MAPK gene expressionprofiles in poplar, a large woody perennial plant, and thus complements the extensive expressionprofiling data available for the herbaceous annual Arabidopsis thaliana. The poplar genome is markedby extensive segmental and chromosomal duplications, and within both kinase families, somerecently duplicated paralogous gene pairs often display markedly different patterns of expression,consistent with the rapid evolution of specialized protein functions in this highly adaptive species.Published: 31 August 2006BMC Genomics 2006, 7:223 doi:10.1186/1471-2164-7-223Received: 02 May 2006Accepted: 31 August 2006This article is available from: http://www.biomedcentral.com/1471-2164/7/223© 2006 Nicole et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 22(page number not for citation purposes)BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223BackgroundMembers of the mitogen-activated protein kinase familyare involved in major signaling pathways in all eukaryotes[1]. These pathways, which are typically activated by intra-cellular or environmental cues, usually consist of threehierarchically organized protein kinases. The first compo-nent of this module, the MAPK kinase kinase (MAPKKK),activates a downstream MAPK kinase (MAPKK) throughdouble serine-threonine phosphorylation. The phosphor-ylated MAPKK then acts as a dual-specificity proteinkinase to activate the third component of the pathway, i.e.MAPK, via phosphorylation of specific threonine andtyrosine residues in a T-X-Y motif located within the acti-vation loop of the protein. At this point, activated MAPKscan modulate various cellular activities through activationof other protein kinases, or metabolic enzymes, or byphosphorylation of transcription factors and componentsof the cytoskeleton. Important links between MAPK activ-ities and fundamental processes like cell proliferation/dif-ferentiation and defence responses have been establishedfrom extensive studies performed in human, mouse andyeast systems [2].MAPK cascades are also present in plants [3-5], where theyhave been involved in a wide variety of phenomena,including plant responses to biotic, abiotic and oxidativechallenges [6-9], hormone signaling [10-12], plant cytoki-nesis [13] and pollen development [14]. The Arabidopsisthaliana genome encodes at least 60 MAPKKKs, 10 MAP-KKs and 20 MAPKs [4] but most of these proteins have notbeen functionally characterized. The plant MAPKK andMAPK families have both diverged into four major groups(A, B, C and D). MAPKs belonging to groups A, B and Call possess a TEY motif in their activation loop, whilemembers of group D harbor a TDY motif. The most exten-sively studied plant MAPKs are Arabidopsis AtMPK3 andAtMPK6, and their Nicotiana tabacum orthologs, NtWIPKand NtSIPK, respectively. These group A MAPKs have beeninvolved in non-host disease resistance [15,16], gene-for-gene defence signal transduction [17,18], woundingresponse [19] and ethylene production [20,21]. They alsoappear to act as positive regulators of the hypersensitiveresponse (HR) [22], a defence-related form of pro-grammed cell death. In rice (Oryza sativa), several MAPKshave also been characterized and display similar stressresponse functions, as well as developmental regulation[23-25].The cellular functions in which MAPKs participate aremainly dependent on their phosphorylation status. In sin-gle-celled organisms like yeast, post-translational mecha-nisms seem to account for most of the regulation of theMAPK cascades, with little evidence of transcriptional reg-tional, post-transcriptional and post-translational levels[26]. In mammals, the duration of MAPK activation candepend on the nature of the stimulus, and these differ-ences in the temporal pattern of activation can lead to dis-tinct physiological responses in the cell [27]. This has alsobeen demonstrated in tobacco, where transient activationof NtMEK2 (a stress-responsive MAPKK) and its down-stream effector, NtSIPK, induces strong expression ofdefence-related genes, whereas sustained activation of thesame proteins leads to the activation of NtWIPK and sub-sequent cell death [22]. Compartmentalization andorganization of yeast and mammalian MAPK cascadecomponents by scaffolding proteins [28,29]. can also con-tribute to signaling specificity [2]. For plants, there is nopublished data involving scaffolding proteins in MAPKsignaling, but a recent report has described the formationof protein complexes that include stress responsiveMAPKs [30]. Subcellular compartmentalization of MAPKcomponents may also be critical to their function inplants, since treatment of Petroselinum crispum cells with aPhytophthora-derived elicitor resulted in the translocationof three cytosolic MAPKs to the nucleus, where they arethought to interact with transcription factors [31].Regulation of MAPKs at the transcriptional and post-tran-scriptional levels can also play an important role in con-trolling the MAPK cascades function. Alternative splicinghas been observed for the mammalian MAPK ERK1[26,32], as well as for the Arabidopsis MAPKKK gene, ANP1[33], and the rice MAPK gene, OsMPK5 [34]. Moreover,strong up-regulation in the expression of some plantMAPK genes is seen in response to stress, includingtobacco NtWIPK [15], tomato LeMPK3 [8], alfalfaMsMMK4 [35] and rice OsBWMK1 [36] and OsMSRMK3[25]. Finally, some plant MAPKs display organ-specificexpression, suggesting that their function is spatially and/or temporally delimited. For example, the Petunia hybridaMAPK gene, PMEK 1, is preferentially expressed in repro-ductive female organs [37], while the tobacco MAPK geneNtf4 (a close relative of the stress-responsive MAPK geneNtSIPK) is expressed only in certain organs such as pollengrains, developing embryos and mature embryos [38].Transcriptional regulation of MAPK cascade componentsthus appears to provide an important level of control inplants, suggesting that systematic analysis of their tran-scriptional patterning in a given plant species should pro-vide insight into potential biological functions of specificclasses of these signaling components. The developmentof transcriptomic databases (microarray and others) insome model plant species such as Arabidopsis and rice hasmade it possible to track, in silico, the expression profile ofa given MAPK gene. The recent availability of a genomePage 2 of 22(page number not for citation purposes)ulation. On the other hand, in multicellular eukaryotes,MAPK cascades regulation often occurs at the transcrip-sequence from Populus trichocarpa now opens up the pos-sibility to investigate, based on transcriptional regulation,BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223the possible involvement of specific MAPK gene familymember(s) in organ development processes that areunique to woody species. In this paper, we conducted acomprehensive analysis of the organ-specific expressionpatterns for all predicted poplar MAPK and MAPKK genes.Correlation of these data with structural analysis of boththe MAPKK and the MAPK gene families also revealed dis-tinct expression patterns within recently duplicated (par-alogous) gene pairs, suggestive of rapid evolution ofResultsGenomic distribution of poplar MAPK and MAPKK genesPrevious analysis of the genome sequence of poplar (Pop-ulus trichocarpa) had identified robust gene models corre-sponding to all the MAPK (PtMPK) and MAPKK (PtMKK)family members [39]. With this information, we were ableto obtain an overview of the chromosomal distribution ofthese important signaling components. PtMPK genes aredistributed over 12 of the 19 poplar chromosomes (FigureSchematic view of the scattered distribution of the poplar MAPK genes (PtMPKs) over the Populus trichocarpa genomeFigure 1Schematic view of the scattered distribution of the poplar MAPK genes (PtMPKs) over the Populus trichocarpa genome. Twelve of the 19 poplar chromosomes are presented as vertical bars. In addition, two scaffolds containing a PtMPK gene are shown. PtMPK genes are represented by colored boxes and the color code presented here is also used in the other figures. Recent duplication events between paralogous genes are indicated using dotted lines.XVIIIXVII IIIVIIVVIIIXIV IXXXII Scaf_57Scaf_168PtMPK1PtMPK2PtMPK7PtMPK14PtMPK3-1PtMPK3-2PtMPK6-1PtMPK6-2PtMPK4PtMPK11PtMPK5-1PtMPK5-2PtMPK9-1PtMPK9-2PtMPK17PtMPK18PtMPK19PtMPK16-2PtMPK16-1PtMPK20-1PtMPK20-2Page 3 of 22(page number not for citation purposes)specialized signaling protein functions in this highlyadaptable woody perennial.1). Chromosomes I and II both carry three divergentPtMPK genes, whereas chromosomes V, VII and X displayBMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223two PtMPK genes each. The remaining poplar MAPK genesare unique with respect to their chromosomal location.PtMPK7 and PtMPK18 have not yet been assigned to anylinkage group, and therefore remain positioned on theirrespective scaffolds. Interestingly, although there arenumerous PtMPK paralogs displaying high levels ofsequence similarity, they are distributed all across thegenome and do not form clusters containing closelyrelated genes as may have been expected if they originatedfrom local duplication events. This pattern probablyreflects the series of whole genome, chromosomal andlarge segmental duplication events that typify the poplargenome (G. Tuskan, personal communication).PtMKK genes also display a scattered genomic distribution(Figure 2) across six of the 19 poplar chromosomes, withthree (PtMKK6, PtMKK7 and PtMKK10) of the 11 geneExon and intron organization of poplar MAPK and MAPKK genesAnalysis of the pattern of exon-intron junctions can pro-vide important insights into the evolution of gene fami-lies. Therefore, we extracted data regarding predicted exonand intron distribution for the coding regions of allPtMPKs and PtMKKs (Figures 3 and 4) as well as for allArabidopsis putative orthologs (AtMPKs, Figure 5 and AtM-KKs, Figure 6). Group A PtMPKs exhibit a highly conserveddistribution of exons and introns (Figure 3) consisting ofsix exons of conserved length, and five introns of con-served or variable sizes. PtMPKs belonging to group B alsopossess six exons, with lengths similar to those found ingroup A PtMPKs, while the associated introns vary in sizebetween the different members of group B. Group CPtMPKs are each composed of only two exons with strictlyconserved or very similar sizes. PtMPK14 is the only groupSchematic view of the scattered distribution of the poplar MAPKK genes (PtMKKs) over the Populus trichocarpa genomeFigure 2Schematic view of the scattered distribution of the poplar MAPKK genes (PtMKKs) over the Populus trichocarpa genome. Six of the 19 poplar chromosomes are presented as vertical bars. In addition, three scaffolds containing a PtMKK gene are shown. PtMKK genes are represented by colored boxes and the color code presented here is also used in the other figures. Recent duplication events between paralogous genes are indicated using dotted lines.IVIIIX XIIVIXVIIIScaf_29Scaf_122Scaf_145PtMKK2-1PtMKK2-2 PtMKK3PtMKK6PtMKK4PtMKK5PtMKK7PtMKK9PtMKK10PtMKK11-1PtMKK11-2Page 4 of 22(page number not for citation purposes)models located on unattributed scaffolds. Only chromo-somes VIII and X contain more than one PtMKK gene.C member with a shorter intron (398 vs ~ 1200 base pairsfor the other three members).BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Page 5 of 22(page number not for citation purposes)Intron and exon organization of poplar MAPK genes (PtMPKs)Figure 3Intron and exon organization of poplar MAPK genes (PtMPKs). Introns and exons are represented by black lines and colored boxes respectively. The length in base pairs of each intron and exon is also indicated. Numbers between brackets correspond to the intron phase. PtMPKs have been grouped according to phylogenetic classification [39].PtMPK3-1PtMPK3-2PtMPK6-1PtMPK6-2Group A158 130 138105 595 99333 18448017336515878130 13899333 1844831703724250242 130 138 333 181353 759 458 402 1545173242 130 138 333 181310 686 537 427 1504176PtMPK4PtMPK11PtMPK5-1PtMPK5-2167 167130 138 333609 899 878 747184420167 167130 138 333503 595 708 59118443013 173163 138 3331380 805 801 518184117173130 138 333833 170 1101 641184117215Group BPtMPK7PtMPK14PtMPK1PtMPK2423 696 1114423 711 1128423 684 1285423 684 398Group CPtMPK16-1PtMPK16-2PtMPK9-1PtMPK9-2PtMPK17PtMPK18PtMPK19PtMPK20-1PtMPK20-269 250 10274 13815615060 128237 415 1072 68 515 1335 229 123 89 232 246 38466 250 10274 13515615060 128285 409 1107 74 1285 949 229 122 97 292 205 1129287 161 10221215615060 12824 409 1065 206 122 246 123 76 172 127 839287 161 10221215615060 12824 409 1016 164 123 237 126 83 172 88 845259 84 15619047 128406 110 153 631 110 121 55113811074 105422 521 15615060 128397 178 84 559 87 131 175212106102 164428 564 15615060 128199 88 586 97 211 170212107102 16424 409 1348 458 90 15615060 128222 86 454 209 166 831212115102 17027 409 1337 455 91 15615060 1281010 100 494 219 171 902212122102 17024 409 1443 Group D(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(1) (2) (2) (2) (0)(0)(0)(0)(0)(0) (0)(1) (0) (0) (0) (0) (2) (2) (0)(0) (0)(1) (0) (0) (0) (0) (2) (2) (0)(0) (0)(1) (0) (0) (0) (2) (2) (1)(0) (0)(1) (0) (0) (0) (2) (2) (1)(0) (0)(1) (0) (0) (0) (2) (2) (1)(0) (0)(1) (0) (0) (0) (2) (2) (1)(0) (0)(1) (0) (0) (0) (2) (2) (1)(0) (0)(1) (0) (0)(0)(2) (2) (1)(0) (0)(1) (0)(2) (2) (2)BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Page 6 of 22(page number not for citation purposes)Intron and exon organization of poplar MAPKK genes (PtMKKs)Figure 4Intron and exon organization of poplar MAPKK genes (PtMKKs). Introns and exons are represented by black lines and colored boxes respectively. The length in base pairs of each intron and exon is also indicated. Numbers between brackets correspond to the intron phase. PtMKKs have been grouped according to phylogenetic classification [39].PtMKK6PtMKK2-1PtMKK2-283 85 135 225 183 22498 249 683 94 1124641797241 841783 85 135 225 183 22471 159 713 102 136464078724474 91 135 225 183 22493 95 172 110 2104634193111Group APtMKK3102 92255 219 13876 1106 90 152168236114111108630 401370Group BPtMKK4PtMKK510591071Group CPtMKK7PtMKK9PtMKK10PtMKK11-1PtMKK11-2966963999963963Group D(2) (0) (0) (0) (0) (2) (0) (1)(2) (0) (0) (0) (0) (2) (0)(2) (0) (0) (0) (0) (2) (0)(0)(0) (0) (0) (0) (2)(0)(0)BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Page 7 of 22(page number not for citation purposes)Intron and exon organization of Arabidopsis MAPK genes (AtMPKs)Figure 5Intron and exon organization of Arabidopsis MAPK genes (AtMPKs). Introns and exons are represented by black lines and colored boxes respectively. The length in base pairs of each intron and exon is also indicated. Numbers between brackets cor-respond to the intron phase. AtMPKs have been grouped according to phylogenetic classification [39].AtMPK3AtMPK6AtMPK10Group A158 130 13883 88 101333 1849217082233 130 138 333 181221 449 91 80 188173224 130 138 333 181272 90 83 92 74176AtMPK4AtMPK5AtMPK11AtMPK13173 173130 138 333131 68 189 801847263 17333376 9618476164 130 138 39679 138130 138 35481 69 92143Group BAtMPK7AtMPK14AtMPK1AtMPK2423 69085423 708 92423 684 90423 663 83Group CAtMPK15AtMPK16AtMPK8AtMPK9AtMPK17AtMPK18AtMPK19AtMPK2078 199 11774 13815615060 128267 403 227 92 102 158 112 91 114 87 90 9966 232 10274 13815615060 12818 409 677 92 91 104 312 113 143 91 108 8717415615060 128219 409 83 101 214 176 177287 173 10521215615060 12824 409 156 88 92 142 69 83 84 82 81235 82 15615060 128406 116 117 86 155 88 8213810280 108398 143 15615060 128397 85 101 201 76 154 86209115102 161431 73 15615060 12896 90 336 88 119 206212134102 17624 409 208 437 84 15615060 128326 124 79 97 147 23021280102 14324 409 388Group DAtMPK12167130 138 33386 153 88 961849516780273(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0) (0) (1)(2) (0) (0)(2) (0) (0)(0) (0) (1)(0)(0)(0)(0)(0) (1) (0) (0) (0) (0) (0) (2) (2) (0)(0) (1) (0) (0) (0) (0) (0) (2) (2) (0)(0) (1) (0) (0) (0)(0)(0) (2) (2)(0)(0) (1) (0) (0) (0) (0) (2)(2) (1)(0) (1) (0) (0) (0) (0) (2)(2) (1)(0) (1) (0)(0) (0) (0) (2)(2) (1)(0)(1) (0) (0) (0)(1) (2) (2)(0) (0) (0) (1)BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Page 8 of 22(page number not for citation purposes)Intron and exon organization of Arabidopsis MAPKK genes (AtMKKs)Figure 6Intron and exon organization of Arabidopsis MAPKK genes (AtMKKs). Introns and exons are represented by black lines and colored boxes respectively. The length in base pairs of each intron and exon is also indicated. Numbers between brackets cor-respond to the intron phase. AtMKKs have been grouped according to phylogenetic classification [39].AtMKK6AtMKK1AtMKK271 85 135 225 183 228279 86 99 10877 85 135 225 183 224115 255 142 84 9346841177877 85 135 228 183 224136 99 96 79 10046999390Group AAtMKK3102 255 219 13887 89 98 981682631147710890459Group BAtMKK4AtMKK511011047Group CAtMKK7AtMKK8AtMKK10924882919933Group DAtMKK986(2) (0)(0)(0)(0)(2) (0)(0)(0)(0) (2)(0)(0)(0)(0)(2) (0)(0)(0)(0) (2) (0)(0)(0)(0) (0)BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223In contrast to these three highly conserved structural pat-terns, group D PtMPKs possess a complex distribution ofexons and introns, including different pattern subsetswithin the same phylogenetic group. For instance,PtMPK9-1 and PtMPK9-2 are both composed of 11 exons,whereas PtMPK16-1, PtMPK16-2, PtMPK19, PtMPK20-1and PtMPK20-2 all possess ten. Despite some modest dif-ferences in the length of particular exons, it is clear thatthe exon structural pattern is well conserved not onlybetween close paralogs (e.g. PtMPK16-1 and PtMPK16-2),but also between group D PtMPKs that apparentlydiverged following earlier duplication events (e.g.,PtMPK16-1 and PtMPK19). These same patterns are alsofound in the Arabidopsis MPK gene family with the excep-tion of group B MPKs, which display three different pat-terns of exon-intron distribution (Figure 5).The MKK genes display two strikingly different structuralpatterns in both poplar and Arabidopsis (Figures 4 and 6).Members of group C and D MKKs have a completelyintronless configuration, whereas the group B MKK3s andall group A MKKs possess numerous exon and intron junc-tions. In poplar, PtMKK2-1, PtMKK2-2 and PtMKK6 showquite strong exon length conservation, with the exceptionof an additional 17 base pairs exon in PtMKK2-1. PtMKK3,on the other hand, has a completely unique exonic struc-ture, consistent with both its evolutionary distinctiveness[39] and the presence of an unusual C-terminal NTF2domain that is not found in any other MKK group.Intron phase (i.e., the position of an intron within acodon; phase 0 when lying before the first base, phase 1when lying after the first base and phase 2 when lying afterthe second base) was also assessed for all PtMPK andPtMKK gene models (Figures 3 and 4), as well as for allAtMPK and AtMKK gene models (Figures 5 and 6). Forboth PtMPKs (58%) and PtMKKs (73%), the majority ofintrons are within phase 0, while 23% of introns found inboth poplar protein kinase families are within phase 2.Phase 1 introns represent 19% of all PtMPKs introns andonly 4% of all PtMKKs introns. For Arabidopsis, similarnumbers are found (Figures 5 and 6), except that there areno phase 1 introns predicted within AtMKK genes.The association of two adjacent introns in eukaryoticgenes can be in any of nine different intron phase combi-nations, leading to two classes of exons: symmetric exons(0-0), (1-1), (2-2) and asymmetric exons (0-1), (0-2), (1-0), (1-2), (2-0), (2-1). For poplar MPKs, 51% of all exonsare symmetric and the great majority of these are (0-0)exons (79%). A similar picture is found in Arabidopsis,where 54% of AtMPKs exons are symmetric. Once againthe majority of these are (0-0) exons (85%). No symmet-PtMKK and AtMKK gene families, we respectively found58% and 68% of symmetric exons and for both species, allof these symmetric exons are in the (0-0) configuration.For both plants, the most frequent asymmetric exonsfound in MPKs and MKKs are those belonging to the (0-1), (0-2) and (2-0) configurations.Real-time quantitative PCR data normalization and general considerationsThe real-time, fluorescence-based reverse transcriptionpolymerase chain reaction (RTqPCR) technique hasbecome a method of choice because of its wide dynamicrange, sensitivity and robust quantification of mRNA lev-els. In contrast to microarray profiling, transcript accumu-lation (TA) of closely-related gene members can also beeasily discriminated in RTqPCR by using oligonucleotideprimers specific to unique gene signatures. Such compari-sons are only valid, however, if the chosen primer sets dis-play comparable efficiencies in their ability to amplifytargeted amplicons. We therefore tested all the selectedprimer sets against genomic DNA from three differentgenetic backgrounds, namely Populus trichocarpa (Nis-qually-1), Populus trichocarpa X Populus deltoides (H11-11)and Populus deltoides (ST-70). In these assays, most primersets yielded a very similar Ct value (around 21 for mostgenes) across the three different genetic backgrounds (seeadditional file 1). This indicates that these primer pairscan equally hybridize to the P. trichocarpa alleles in theNisqually-1 background, to the P. deltoides alleles in theST-70 background and most importantly to both the P. tri-chocarpa and the P. deltoides alleles in the H11-11 hybrid,which was used in this study to monitor PtMPK andPtMKK expression profiles. On the other hand, primerpairs specific for PtMPK2, PtMPK4, PtMPK9-2, PtMPK16-2, PtMKK4 and PtMKK7 all display higher Ct values in theP. deltoides background. This reflects that these gene spe-cific primer pairs preferentially hybridize to the P. tri-chocarpa allele in the hybrid genotype, and that TAobtained on cDNA (see below) might slightly underesti-mate the actual level of expression since the P. deltoidesallelic contribution is not perfectly captured. This observa-tion could be related to lower primer set efficiency, result-ing from polymorphism within the 3'UTR region of thedifferent alleles. Nevertheless, melting curve and gel elec-trophoresis analysis confirmed single product amplifica-tion for all respective MPKs and MKKs in the three poplargenotypes (data not shown). Moreover, within one partic-ular genetic background, the steady Ct value obtained forthe different MPKs and MKKs confirmed that for a con-stant number of target sequences (e.g., 5 ng of DNA), eachprimer set gave a similar Ct value (see additional file 1).This clearly demonstrates the similar efficiencies of thevarious primer sets used in this study, and allows directPage 9 of 22(page number not for citation purposes)ric exons harboring the (1-1) configuration are found inany of the poplar or Arabidopsis MPK gene models. For thegene-to-gene comparisons of the levels of expressiondetected in the various organs sampled.BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Finally, the use of internal standard candidate genes thatdisplay relatively stable expression over time and betweentissues or organs allows sample-to-sample normalizationof the RTqPCR expression data. In the present study, theuse of RTqPCR primers specific for a cyclin-dependentkinase 2 (cdc2) gene revealed generally consistent levels ofcdc2 TA in different organs from poplar (Figure 7A, B, C),with less than two-fold variation observed across mostvegetative organs, and in suspension-cultured cells (Figure8). Slightly higher transcript abundance of cdc2 wasdetected in actively growing organs, such as floral andfoliar buds, where CDC2 is likely involved in cell-cycleprogression [40,41]. Therefore, cdc2 expression levels pro-vided a good normalization baseline. In addition, sinceActin 2 (Act2) has been stated to be a good internal controlgene for RTqPCR studies across various poplar organs[42], we have used this candidate as housekeeping gene.TA for Act2 proved to be quite stable across most organs,with a maximum five-fold increase from mature leaf toupper stem (Figure 8). This level of variation seems rela-tively low considering the wide diversity of tissues testedin our survey (from meristematic organs such as buds tomature leaves). Moreover, our results revealed that twopoplar MAPKs (PtMPK6-1/6-2) display quite constant TAin all assayed organs (Figure 8). The highest TA wasdetected in the female floral bud sample, but this level ofexpression represents only a one-fold increase in compar-ison to the average TA in all organs. Finally, PtMKK2-2 wasalso detected at low but constant levels in all testedorgans. The respective TA levels for cdc2, Act2, PtMPK6-1,PtMPK6-2 and PtMKK2-2 across many different organtypes provide confirmation that an appropriate and con-sistent dosage of cDNA was used in the various RTqPCRreactions. In our analysis, TA levels corresponding to <100transcript molecules per ng total RNA were scored as 'verylow', values of 100–400 as 'moderate', values >400 as'high', and values >1000 as 'very high'. Levels <10 weretreated as effectively zero.Poplar MAPK and MAPKK gene expression patternsVirtually all PtMPKs and PtMKKs are expressed in allorgans analyzed, but their level of expression varies con-siderably. Regardless of the phylogenetic groups or organsexamined, the TA for PtMPKs generally fluctuates betweenmoderate to very high levels (See additional file 2). Mem-bers of group D MPKs show TA levels of ~1500 transcriptmolecules per ng of total RNA, while members of thegroup A, B and C MPKs show lower levels, around 400–600. For the PtMKK gene family, the most highlyexpressed members are those belonging to group C (TA>1600, see additional file 3). Group B and D MKK geneshave similar levels of TA (~1100–1600). Finally, group AMKK genes are the most weakly expressed, with on aver-MAPKsGroup A MPKsThe most extensively studied plant MAPKs belong toGroup A which, in Arabidopsis, consists of three members,AtMPK3, AtMPK6 and AtMPK10 [4]. No direct putativeortholog of AtMPK10 has been detected in the poplargenome, but phylogenetic analysis [39] revealed the pres-ence of two closely-related poplar presumed orthologs forthe defense-related genes AtMPK3 (PtMPK3-1 and 3-2)and AtMPK6 (PtMPK6-1 and 6-2). In most organs, theexpression of both PtMPK3-1 and 3-2 is lower than that ofPtMPK6-1 and 6-2 (Figure 9; see additional file 2).PtMPK3-1 is relatively strongly expressed in roots andxylem, in comparison to other samples. In most organsPtMPK3-1 tends to be slightly more expressed thanPtMPK3-2. However, this pattern is reversed in the fourtypes of buds (male and female floral buds, lateral and ter-minal foliar buds) as well as in both types of catkins.PtMPK6-1 and 6-2 both show similar expression profilesacross many organs, but TA for PtMPK6-1 becomesslightly more pronounced than that of its paralog in allfour types of buds, in both types of catkins and in suspen-sion-cultured cells.Group B MPKsThere is less information on the biological roles of theother MAPK groups in plants, although some reports havesuggested the potential involvement of group B MPKgenes in response to environmental stresses as well as incell development [4]. In poplar, PtMPK11 and PtMPK5-2,the most highly expressed of the four group B MAPKgenes, are particularly actively transcribed in male andfemale floral buds (Figure 9). By contrast, the paralogousPtMPK5-1 gene shows the lowest level of TA within thisgroup.Group C MPKsAmong the group C MPKs, it has been reported that thetobacco Ntf3 gene is expressed in pollen [43] and that theArabidopsis AtMPK7 gene has circadian rhythm-regulatedpatterns of expression [44]. The most highly expressed ofthe four poplar group C MPK genes is PtMPK7, with ele-vated TA levels detected in female catkin, buds, phloem,xylem, mature leaves (LPI 12) and roots (Figure 9). Thisgene is also differentially expressed in particular develop-mental stages of specific organs, with more abundanttranscripts detected in floral buds (male and female) thanin either type of catkin. A similar situation is observed forleaves, where PtMPK7 TA is more pronounced in matureleaves than in young leaves. This is similar to what hasbeen reported for the rice putative ortholog OsMAPK4(now annotated as OsMPK7 [39]), whose expression ishigher in mature leaves than in young leaves [45].Page 10 of 22(page number not for citation purposes)age 550 transcript molecules per ng of total RNA.BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Page 11 of 22(page number not for citation purposes)Illustration of some of the harvested poplar organs used in this studyFigu e 7Illustration of some of the harvested poplar organs used in this study. (A) P. trichocarpa X P. deltoides; H11-11 hybrid clone at PI 16 stage.(B) Harvested male catkin from cut branches of 10-year-old field-grown trees (P. trichocarpa X P. deltoides). (C) Harvested female catkin from cut branches of 10-year-old field-grown trees (P. trichocarpa X P. deltoides).Mature leaf (LPI 12)Young leaf (LPI 1)ApexUpper stemStemPhloem XylemRootsPopulus trichocarpa X Populus deltoidesH11-11AB(10 cm)(10 cm)CMale catkin Female catkin(6 days) (11 days)Populus trichocarpa X Populus deltoides Populus trichocarpa X Populus deltoidesBMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Group D MPKsThe group D MPKs represent the largest group of MPKs inpoplar, as they do in Arabidopsis and rice [4,39]. In riceand alfalfa (Medicago sativa), two group D MAPK genes(OsBMWK1 and MsTDY1) are induced transcriptionallyby pathogen challenge and wounding, respectively[36,46] Activated OsBMWK1 (now annotated asOsMPK17-1 [39]) has also been shown to phosphorylatea transcription factor that binds a cis-acting element in thepromoter of defence-related genes [47].In poplar, PtMPK17 is the most highly expressed of thegroup D MPK genes and, indeed, it is the most highlyexpressed among all the MPK and MKK genes (Figure 9).On the other hand, the most weakly expressed group DMPK genes, PtMPK9-1 and PtMPK9-2, display low tran-script levels in all organs with the noteworthy exception ofall types of buds, and cell suspensions. As previouslyobserved in other MPK groups, some members of thegroup D MPK genes seem to represent the paralogousproducts of recent genomic duplication events, since theydirect putative ortholog in Arabidopsis [39]. PtMPK16-1and PtMPK16-2 are particularly interesting paralogs, sincethey have very similar expression profiles in most organs,including male and female catkins. On the other hand,PtMPK16-1 is strongly expressed in male and female floralbuds, whereas expression of PtMPK16-2 is barely detecta-ble in these reproductive organs.MAPKKsGroup A MKKsIn other plant species, some group A MKKs appear to befunctionally associated with group B MPKs [48,49] Thesephosphotransfer relationships have been involved inresponses to abiotic stresses in Arabidopsis, and in celldevelopment in tobacco. As in Arabidopsis, there are threegroup A MKK genes found in poplar. PtMKK2-2 showslow but constant levels of TA in all tested organs (Figure10; see additional file 3), while the paralogous PtMKK2-1is much more highly expressed. Higher expression ofPtMKK6, on the other hand, seems to be associated withproliferating organs such as apex, floral and terminalSteady-state transcript accumulation for cdc2, Act2 and three kinase genes throughout the surveyed organs (indicated at the bottom of the figure)Figure 8Steady-state transcript accumulation for cdc2, Act2 and three kinase genes throughout the surveyed organs (indicated at the bottom of the figure). After determination of RTqPCR primers efficiency and generation of standard curves, RTqPCR analysis was performed for cdc2, Act2, and for two poplar MPKs as well as for one poplar MKK. Twelve nanograms of cDNA were used in each RTqPCR reaction. Results are expressed in number of specific transcripts per ng of total RNA. Values represent the mean of six independent reactions (two repeats for each of three independent samples). Cts were determined using single flu-orescent readings that were taken after each cycle.PrimaryphloemSecondaryxylemXylemcambiumenrichiedFemalecatkinsMalecatkinsApexLeafLPI1LeafLPI12UpperstemXylemSecondaryphloem RootFemalefloralbudMalefloralbudFoliarlateralbudFoliarterminalbudCellsuspensionNboftranscriptmolecules/ngoftotalRNAOrgans5001000150020002500300035006000800010000Cdc2PtMPK6-1PtMPK6-2PtMKK2-2Actin2Page 12 of 22(page number not for citation purposes)possess a very high degree of sequence similarity, arelocated on different chromosomes and have only onebuds, cell suspensions, and young leaves (LPI 1), with a25-fold decrease in PtMKK6 expression levels observedBMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Page 13 of 22(page number not for citation purposes)Steady-state transcript accumulation for all members of the four phylogenetic groups of PtMPK genesFigure 9Steady-state transcript accumulation for all members of the four phylogenetic groups of PtMPK genes. After determination of RTqPCR primers efficiency and generation of standard curves, RTqPCR analysis was performed for each poplar MAPK gene. Twelve nanograms of cDNA were used in each RTqPCR reaction. Results are expressed in number of specific transcripts per ng of total RNA. Values represent the mean of six independent reactions (two repeats for each of three independent samples). Cts were determined using single fluorescent readings that were taken after each cycle. 0100200300400500600700800900100011001800190020002100Nb of transcript molecules / ng of total RNA020030040050060070080090010001100120013001400180020002200Nb of transcript molecules / ng of total RNA0100200300400500600700800900100011001600180020002200Nb of transcript molecules / ng of total RNAGroup AGroup BGroup CPtMPK4PtMPK11PtMPK5-1PtMPK5-2PtMPK3-1PtMPK3-2PtMPK6-1PtMPK6-2PtMPK1PtMPK2PtMPK7PtMPK14 PtMPK17PtMPK18PtMPK19PtMPK20-1PtMPK9-1PtMPK9-2PtMPK16-1PtMPK16-2PtMPK20-2Primary phloemSecondary xylemXylem cambium enrichedFemale catkinsMale catkins ApexLeaf LPI 1Leaf LPI 12Upper stem XylemSecondary phloem RootFemale floral budMale floral budFoliar lateral budFoliar terminal budCell suspension04008001200160020002400270060008000100001200014000Nb of transcript molecules / ng of total RNAOrgans Group DPP          SX        XCE        FC         MC          A          LPI 1     LPI 12      US          X           SP          R          FFB       MFB       FLB        FTB        CSPP         SX        XCE        FC          MC         A          LPI 1     LPI 12      US          X           SP          R          FFB       MFB       FLB       FTB        CSPP         SX         XCE        FC         MC          A         LPI 1     LPI 12      US          X           SP          R          FFB       MFB        FLB       FTB        CS(PP)(SX)(XCE)(FC)(MC)(A)(LPI 1)(LPI 12)(US) (X)(SP) (R)(FFB)(MFB)(FLB)(FTB)(CS)100BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Page 14 of 22(page number not for citation purposes)Steady-state transcript accumulation for all members of the four phylogenetic groups of PtMKK genesFigure 10Steady-state transcript accumulation for all members of the four phylogenetic groups of PtMKK genes. After determination of RTqPCR primers efficiency and generation of standard curves, RTqPCR analysis was performed for each poplar MAPKK gene. Twelve nanograms of cDNA were used in each RTqPCR reaction. Results are expressed in number of specific transcripts per ng of total RNA. Values represent the mean of six independent reactions (two repeats for each of three independent samples). Cts were determined using single fluorescent readings that were taken after each cycle.04008001200160020002400Nb of transcript molecules / ng of total RNA0100020003000400050006000Nb of transcript molecules / ng of total RNA0100020003000400050009000920094009600980010000Nb of transcript molecules / ng of total RNAPtMKK2-1PtMKK2-2PtMKK6PtMKK3PtMKK4PtMKK5PtMKK7PtMKK9Group BGroup CGroup DTissuesGroup A020040060080010001200140016001800Nb of transcript molecules / ng of total RNAPP           SX          XCE          FC          MC           A           LPI 1      LPI 12        US            X            SP            R           FFB        MFB         FLB         FTB         CSPP           SX          XCE         FC          MC             A          LPI 1      LPI 12        US            X            SP            R           FFB        MFB        FLB         FTB          CSPP          SX         XCE          FC           MC            A          LPI 1      LPI 12        US            X            SP            R           FFB        MFB         FLB         FTB         CSPrimary phloemSecondary xylemXylem cambium enrichedFemale catkinsMale catkins ApexLeaf LPI 1Leaf LPI 12Upper stem XylemSecondary phloem RootFemale floral budMale floral budFoliar lateral budFoliar terminal budCell suspensionOrgans(PP)(SX)(XCE)(FC)(MC)(A)(LPI 1)(LPI 12)(US) (X)(SP) (R)(FFB)(MFB)(FLB)(FTB)(CS)BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223along the foliar developmental gradient from young tomature leaves. Interestingly, the presumed Arabidopsis andtobacco orthologs of PtMKK6 have been involved in regu-lation of cytokinesis and cell division [13], suggesting thatthis protein may play an analogous role in poplar tissues.Group B MKKsGroup B MKKs in poplar are represented by a single gene,PtMKK3. This is also seen in Arabidopsis (AtMKK3) andrice (OsMKK3) [39]. MKKs of this class are unique inencoding a characteristic MKK protein kinase domainfused in C-terminal to a putative nuclear transport factor2 (NTF2) domain [4]. No biological functions have yetbeen assigned to plant MKK3s, but PtMKK3 has moderateto relatively high expression levels across all organs (TAbetween 400 to 2600), with the highest levels detected infemale floral buds, lateral foliar buds and cell suspensions(Figure 10).Group C MKKsAmong the plant MKKs, attention has been largelyfocused on those found in group C because of their dem-onstrated roles in stress signaling. Ectopic expression ofconstitutively-activated versions of the tobacco NtMEK2protein, and of other group C MKKs, has been used todemonstrate that they are capable of phosphorylating andthus activating stress-responsive Group A MPKs [50-52].Poplar possesses two group C MKKs, PtMKK4 andPtMKK5, both of which are expressed. Of the two,PtMKK5 shows higher TA in most organs, while theexpression of PtMKK4 only predominates in suspension-cultured cells (Figure 10).Group D MKKsLimited functional information is available for group DMKKs, of which there are five encoded representatives inthe poplar genome (PtMKK7, PtMKK9, PtMKK10,PtMKK11-1 and PtMKK11-2). However, our RTqPCR anal-ysis suggests that only PtMKK7 and PtMKK9 are clearlyexpressed (Figure 10). The other three genes may thereforebe pseudogenes, or be expressed only under circum-stances that were not tested in our survey. The pseudogenehypothesis is also supported by the observation of struc-tural differences in normally conserved motifs within thepredicted PtMKK10, 11-1 and 11-2 protein kinasedomains, and by the apparent absence of expression datafor the Arabidopsis (AtMKK10) and rice (OsMKK10-1/10-2)putative orthologs [39].While both PtMKK7 and PtMKK9 expression could bedetected, the patterns differ significantly across organsand developmental stages (Figure 10). PtMKK9 expres-sion is generally more pronounced except in secondaryparticularly highly expressed in mature leaves (LPI 12),where it reaches close to 10 000 transcript molecules perng of total RNA, in contrast to the younger leaf sample(LPI1). The levels of transcript accumulation for PtMKK7are on the other hand relatively constant across mostorgans. This striking difference in expression pattern hasalso been observed in Arabidopsis expression databases forAtMKK7 and AtMKK9 [53] where AtMKK9 transcription ismost strongly associated with mature or senescing leaves.DiscussionThe genomic organization of poplar MAPK and MAPKKgenes clearly reflects the impact of whole genome duplica-tions, of chromosomal duplications and of large-scale seg-mental duplications on the expansion of gene families.This is especially true for Populus, since genes representedby individual models in Arabidopsis are frequently foundas unclustered paralogous gene sets in poplar. This modeof expansion is not unique to the MAPK and MAPKKgenes, since a similar phenomenon has been observed forthe poplar cellulose synthase (CesA) gene family [54]. Theabsence of tandemly duplicated gene clusters within thepoplar MAPK and MAPKK gene families is also shared byother plant species including Arabidopsis and rice [39].Comparative analysis of exon-intron junctions within thecoding region of Arabidopsis MAPK and MAPKK gene fam-ilies [55] and their poplar counterparts also highlights theconservation of these signaling components. Hence,group A and group C MPKs in both species display identi-cal numbers of exons (six and two, respectively), and thesizes of the exons as well as the intron phases areextremely well conserved. These findings show that therespective degree of conservation of group A and group CMPK genes extends beyond primary sequence identity andis likely to be a feature of these genes in all eudicots.A more complex situation exists for group B MPKs, whereall group B PtMPKs contain six exons, while only two outof five group B AtMPKs (AtMPK4 and AtMPK12) displaythis organization. Nevertheless, except in PtMPK5-1, thephases of the various introns found in these gene modelsare also perfectly conserved. These gene models mightthus share a common evolutionary history. On the otherhand, AtMPK5, AtMPK11 and AtMPK13 all possess fourexons with variable intron phase combinations. Thesecombinations are not observed in any poplar MPKs. Thissuggests that the Arabidopsis group B MPK gene family hasevolved differently than the corresponding poplar family.It is possible that one of the ancestral genes that gave riseto the present group B AtMPK family was not transmittedto poplar when these species diverged or that the precur-sor gene was lost during poplar evolution. Alternatively,Page 15 of 22(page number not for citation purposes)xylem, cell suspensions, primary phloem and xylem cam-bium-enriched, where PtMKK7 predominates. PtMKK9 isthe generation of the four exon configurations observed inBMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Arabidopsis was the result of a duplication event that fol-lowed species divergence.For group D MPKs, despite more complex configurationsof exons and introns, it is possible to recognize that therespective putative orthologs between Arabidopsis andpoplar display similar or sometimes even identical exonorganization, with very well conserved exon length andintron phase. The only exception in this regard isAtMPK15, which possesses a unique seven exon composi-tion within its coding region. This pattern is not observedfor any other Arabidopsis or poplar MPK genes and indeed,no direct putative ortholog of AtMPK15 can be detected inthe poplar genome. This AtMPK gene might thereforehave arisen in Arabidopsis after species divergence, ormight have been lost during poplar evolution.At the level of MAPKKs, phylogenetic conservation ofexon length and of exon-intron junctions is also generallyobserved. Hence, in group A MKKs, both the AtMKK2 andAtMKK6 coding regions are composed of eight exons,which is identical to the structure of their respective pre-dicted orthologs in poplar, PtMKK2-2 and PtMKK6. Inaddition intron phase configuration is identical amongthese genes. On the other hand, the AtMKK1 codingregion consists of six exons, a pattern that is not conservedin the coding region of the closest poplar putativeortholog, PtMKK2-1, which is constituted of nine exons.For group B MKKs, despite the high level of predicted pro-tein sequence similarity between AtMKK3 and PtMKK3,the number of exons within their respective codingregions differs (eight exons for AtMKK3; nine forPtMKK3). However, this lack of conservation in the exonand intron organization is not caused by the kinasedomain evolutionary status. In fact, the regions encodingthe protein kinase domain are well conserved in terms ofexon count, exon length and intron phase and differencesbetween these two gene models are found at the end ofthe coding regions (within the NTF2 domain of the corre-sponding encoded proteins). Finally, as reported earlier[4], both the Arabidopsis group C and D MKKs display anintronless configuration. This trait is fully conservedwithin both poplar group C and group D MKK gene fam-ilies.Overall, exon lengths in both the Arabidopsis and poplarMPKs and MKKs are clearly more conserved than intronlengths. This indicates stronger negative selection foralteration of corresponding protein sequences. Addition-ally, most variations occurring in exon lengths come at thebeginning or at the end of the coding sequences. Thisreflects that within the protein sequence, the centrallylocated kinase catalytic domain is probably submitted tostrong conservation within the C-terminal enzyme cata-lytic site, with most variable domains observed in the N-terminal part of uncertain functions [56]. For their part,poplar MPK and MKK introns are generally much longerthan those found in the corresponding Arabidopsis genes.This may reflect reduced pressure for genome compactionwithin the larger poplar genome.Transcript abundance at a given time and in particularorgans is an important prerequisite to subsequent produc-tion of the corresponding protein required for proper exe-cution of developmental, metabolic and signalingprocesses. The goal of the present study was to obtain areasonably comprehensive overview of the whole organexpression patterns for all members of the poplar MAPKand MAPKK gene families. These families contain numer-ous recently duplicated members (paralogs), which raisesthe question of the extent to which these copies haveremained functionally redundant. Our data suggest thatwhile these gene families are highly conserved amongeudicot species, individual family members are neverthe-less evolving to display considerable diversity and special-ization in the context of poplar biology. For example,while the paralogous genes PtMPK3-1 and PtMPK3-2share 93% amino acid sequence similarity, and bothgenes are expressed at similar levels in most organs,PtMPK3-2 transcripts are markedly more abundant thanthose of its sister paralog in all four types of bud organ.This association with developmentally distinct juvenileorgans suggests that PtMPK3-2 may be undergoing neo-functionalization for specific developmental roles, per-haps related to meristem development. For organs otherthan buds, the similar transcriptional activity of bothPtMPK3-1 and PtMPK3-2 might simply represent geneticredundancy, where expression of both genes contributesto a common signaling pathway. Alternatively, this couldbe an example of sub-functionalization [57], where bothgenes have become compromised in some of their func-tions, but when operating together, can still provide thefunctionality associated with the ancestral gene. Since theclosest Arabidopsis and tobacco presumed orthologs ofPtMPK3-1 and PtMPK3-2 are AtMPK3 and NtWIPK,respectively, two stress-responsive MAPKs that respond atboth the transcriptional and post-translational levels tobiotic and abiotic stresses [58,15], it will be interesting todetermine whether one or both poplar genes display sim-ilar defence-related functions.The expression profiles of the paralogous PtMPK6-1 and6-2 genes differ from what has been reported for the puta-tive orthologous tobacco genes, NtSIPK and Ntf4. WhileNtSIPK is expressed in leaves [19], stem and pollen [14],Ntf4 expression was found to be restricted to seeds, pollenPage 16 of 22(page number not for citation purposes)more stringent functional conservation. Evolutionaryanalysis of plant terpene synthase genes also revealedand anthers [38] and notably, Ntf4 expression was notdetected in female structures (ovaries and pistil) in theBMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223tobacco hermaphrodite flower. This suggests that special-ized functions might have been acquired by one or bothtobacco paralogs. On the other hand, since both paralogsare expressed in pollen, co-activation by the same MKK,NtMEK2, as well as the absence of phenotype after thesilencing of Ntf4 [14], point to some level of geneticredundancy of these MAPKs in this particular organ. Forpoplar, despite the predominance in TA for PtMPK6-1over PtMPK6-2 in all types of buds, in male and femaleflowers, there is no evidence of strikingly different pat-terns of expression. In fact, PtMPK6-1 and PtMPK6-2 dis-play similar TA for most organs, suggestive of overallredundancy. Further investigation will be needed to eval-uate the impact of this discrepancy in expression profilesbetween presumed orthologous tobacco and poplargenes. Interestingly, in a recent publication, NtSIPK andNtf4 were both detected in leaf extracts using antibodies[59]. This contrasts with previously published data [38]and suggests that at least in leaves, both NtSIPK and Ntf4display redundant expression profiles.Expression of group B and C MPK genes has also beeninvestigated in other species. For example, the phyloge-netically closely related Arabidopsis AtMPK1 and AtMPK2,as well as the Petunia hybrida PhMEK1 gene and thetobacco Ntf3 gene, showed constitutive expression in var-ious organs (leaves, stem, roots and flowers) [37,43,60].Interestingly, AtMPK2 is more highly expressed thanAtMPK1 in the analyzed organs [60], a situation alsoobserved for the poplar predicted ortholog PtMPK1 overPtMPK2.Other members of the group B and C MPK genes also dis-play notable differences in their expression profiles. Thepoplar group C PtMPK7 is generally much more highlyexpressed than its paralog, PtMPK14, in all tested organsexcept cell cultures. As well, expression of the group BPtMPK5-2 is generally higher than that of PtMPK5-1. Thephysiological impact of these differences in levels of tran-script accumulation among paralogs remains to beresolved. Such a pattern could however be an indicator ofpseudogenization of one member of a recently duplicatedgene pair, even though signal transduction genes are oftenthought to be subject to strong conservation constraints[61].Although extensive microarray data are available, no sys-tematic analysis of expression profiles of group D MPKgenes in plants has been reported. However, OsWJUMK1,the rice putative ortholog of PtMPK20-1/20-2, was foundto be expressed in both vegetative and reproductiveorgans [25] as are the poplar putative orthologs, withPtMPK20-1 expression dominating over PtMPK20-2. Thefemale floral buds, whereas transcripts corresponding toPtMPK16-2 are barely detectable in these organs. Takentogether with the PtMPK3-1/3-2 patterns, this points toparticularly rapid divergence of functional specificity thathighly similar paralogous genes appear to have evolvedwithin the context of reproductive organ development inpoplar.Among the poplar MKKs, we found that PtMKK6 isstrongly expressed in most of the actively proliferatingorgans we investigated. Consistent with this, the closestortholog of PtMKK6 in tobacco, NtMEK1, encodes a pro-tein that has been shown to be part of a MAPK cascadeinvolved in the progression of the cell cycle [62]. A similarrole has been identified for the Arabidopsis putativeortholog, AtMKK6 [13], which suggests that MKK6s couldbe highly conserved players in plant cytokinesis and stemcell development. PtMKK3, a group B MKK, is expressed atrelatively high levels in all vegetative organs in poplar andis moderately expressed in all types of post-dormancybuds, as well as in male and female catkins. Likewise, inArabidopsis, the orthologous AtMKK3 mRNA is detected invegetative organs and also in the hermaphrodite flower[63].ConclusionOverall, our work demonstrates that differential spatio-temporal transcript accumulation patterns exist for mostmembers of both the MPK and the MKK gene families inpoplar. Although virtually all poplar MPK and MKK genesare expressed during development, there are striking dif-ferences in steady-state TA in specific cases, some of whichcould be associated with functional divergence betweenrecently duplicated paralogs. However, it is also critical tonote that while RTqPCR data provide an estimate ofwhole organ gene expression levels, more pronouncedlocal patterns of differential expression associated withregions composed of specialized cells will not be detected.More fine-grained analyses such as in situ hybridization orpromoter:reporter phenotyping will be required to definethe exact pattern of expression of these paralogous genepairs, particularly in biological contexts uniquely relevantto dioecious woody perennials, such as gender specifica-tion, male and female flower maturation or wood forma-tion. Finally, while the focus of the present study was onMPKs and MKKs expression profiling in a developmentalcontext, plant MAPK cascade components also play cen-tral roles in responses to environmental cues. It will there-fore be interesting to monitor the expression of thesegenes in physiological contexts such as tree defence sign-aling during biotrophic or necrotrophic pathogen infec-tions, or adaptation to environmental stresses.Page 17 of 22(page number not for citation purposes)PtMPK16-1/16-2 pair of paralogs is particularly interest-ing, since PtMPK16-1 is highly expressed in both male andBMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223Experimental proceduresPlant material and organ samplingHybrid poplar cell suspension cultures (Populus tri-chocarpa X Populus deltoides H11-11) were maintained asdescribed previously [64]. Four days after transfer to freshmedium, cells were harvested by vacuum filtration, imme-diately frozen in liquid nitrogen and stored at -80°C toawait analysis. Hybrid poplar cuttings (P. trichocarpa X P.deltoides H11-11) were grown in Promix soil under con-trolled greenhouse conditions (22°C/19°C day/night,16-h day) for 2 weeks. Thereafter, young trees were placedin a growth chamber (Conviron, Environmental GrowthChambers Inc., Chagrin Falls, OH) where conditions wereas follows: 26°C/22°C day/night, 20-h day, 60% RH,light intensity 100 µmol m-2 s-1. Plants were fertilized onceevery 2 weeks alternatively with 10/52/10 (0.5 g/l) plus15.5/0/0 (Ca 19% 0.5 g/l) or with 20/20/20 (1 g/l) untilPI 16 stage was reached [65]. Apex, young (LPI 1) andmature (LPI 12) leaves, upper stem (10 cm below theapex), primary phloem and xylem (10 cm above theground) and roots were simultaneously removed from thetrees, frozen in liquid nitrogen and stored at -80°C. Eachspecific organ was harvested from 12 different trees. Threebiological samples were thus created by pooling eachorgan sample from four different trees. Ten-year-old field-grown trees (P. trichocarpa X P. deltoides) located in Sainte-Croix-de-Lotbinière (46° 39'55"N 71° 51' 13" W) wereused for sampling various bud types. Post-dormancy budswere collected on April 8 2005 on male and female treesby quickly removing them from previously cut branches.Bud samples were then flash frozen in liquid nitrogen andstored at -80°C. Other cut branches from male and femaletrees (P. trichocarpa X P. deltoides) were also brought backto greenhouses to induce bud flush using the followingconditions; 22°C/19°C day/night, 16-h day. Brancheswere placed in plastic buckets half-filled with water andbuds were allowed to develop. Male and female catkins(P. trichocarpa X P. deltoides) were collected when the com-pleted developmental state was reached; 6 days for malesand 11 days for females. At this stage, male catkins har-bored pollenic bags and female catkins harbored fruitingcapsules (Figure 7B,C). Other 10-year-old field-grown tree(P. trichocarpa X P. deltoides) organs (primary phloem, sec-ondary xylem and xylem cambium-enriched) were kindlyprovided by Dr. Janice Cooke, Université Laval.RNA purification and amplification of 3' non-coding regions of poplar MPK and MKK genesThe poplar genomic sequences and predicted codingsequences are available from the DOE Joint Genome Insti-tute database [66]. As described elsewhere [39] gene mod-els for MPKs and MKKs were targeted for phylogeneticstudy and a nomenclature based on predicted proteinused to manually establish chromosome position, exon-intron junctions and intron phase for each PtMPK andPtMKK gene family member. Given the high degree ofgene conservation among MPK and MKK genes, it wasessential to develop gene-specific probes based on therespective 3' non-coding regions. To do this, a cDNAlibrary was prepared from mRNA isolated from poplar cellsuspensions. Frozen poplar cell suspensions were groundinto powder in liquid nitrogen and RNA samples wereprepared as previously described [67]. From 1.3 mg totalRNA, mRNA was isolated and subsequently purified usingthe Oligotex mRNA Maxi kit (Qiagen, Mississauga ON).Subsequently, 3'-RACE PCR reactions were performed fol-lowing the manufacturer's instructions (SMART™ RACEcDNA Amplification Kit, Clonetech, Palo Alto, CA). Basedon the genomic and the predicted coding sequences of thepoplar MPK and MKK genes, we designed one gene-spe-cific sense primer at the end of the coding sequence ofeach gene (Tables 1 and 2). This allowed us to amplify thecorresponding 3' untranslated region (UTR). Ampliconswere analyzed by agarose gel electrophoresis, and theseproducts were then ligated into pCR2.1 vector (OriginalTA Cloning Kit, Invitrogen, Carlsbad, CA), and electro-transformed into E. coli XL1 blue (Stratagene, La Jolla, CA).Plasmid DNA was subsequently purified using the QIA-prep-8 Plasmid Kit (Qiagen) and sequenced using thedideoxy nucleotide termination method with an ABI 373Stretch XL sequencer (Applied Biosystems, Foster City,CA). 3'UTR sequences were aligned using Multalin [68]with the genomic and the predicted coding sequences ofthe corresponding poplar MPK and MKK genes.All poplar organ-specific samples were ground into a pow-der in liquid nitrogen and total RNA was isolated as pre-viously described [67]. To remove DNA traces in totalRNA samples, we performed DNase treatments as recom-mended in the manufacturer's instructions (DNase 1Deoxyribonuclease I digests, Invitrogen). cDNAs weresynthesized from 500 ng total RNA (SuperScript™ III First-Strand Synthesis System, Invitrogen).Real-Time quantitative PCR (RTqPCR) analysisIn order to confirm the efficiencies of the RTqPCR primersets, genomic DNA from Populus trichocarpa (Nisqually-1),Populus trichocarpa X Populus deltoides (H11-11) and Popu-lus deltoides (ST-70) was extracted using 150 mg of leaf tis-sue (LPI 3). Briefly, plant material from each geneticbackground was ground into powder in liquid nitrogen.DNA extractions were then conducted using DNeasy sys-tem (Qiagen), according to the manufacturer's instruc-tions. Five nanograms of DNA were used in each RTqPCRreaction that was carried out using the Opticon2 DNAEngine (MJResearch, Waltham, MA). After an initial 15Page 18 of 22(page number not for citation purposes)sequence similarity with Arabidopsis and rice was adoptedto reflect putative orthology. This information was alsomin activation step at 95°C, 45 cycles (94°C, 15 s; 57°C,1 min; 72°C, 30 s) were performed and a single fluores-BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223cence reading was taken after each cycle immediately fol-lowing the elongation period at 72°C. A melting curvewas performed at the end of the cycling procedure toensure single product amplification. Cycle threshold (Ct)values were determined by the Opticon Monitor 2 soft-ware at a manually set fluorescence threshold of 0.016.Agarose gel electrophoresis (1.2%) was also performed tocompare amplicons obtained from the various geneticbackgrounds.To quantify organ-specific TA for the corresponding pop-lar MPK and MKK genes, standard curves were producedbased on serial dilution of each of the pCR2.1 plasmidscontaining the cloned 3'UTR of each gene, and used todetermine the number of transcript molecules asdescribed in [69]. Twelve nanogram aliquots of cDNAwere used in each RTqPCR reaction. Amplifications wereconducted in 1× QuantiTect™ SYBR Green mix (Qiagen)with 0.25 µM of both forward (5') and reverse (3') oligo-Table 2: Sequences of PtMKKs " 3'RACE and RTqPCR primers used for 3'UTR MAPKK gene isolation and expression profiling.Group Gene name 3' RACE Primers(5' to 3')Forward RTqPCR Primers(5' to 3')Reverse RTqPCR Primers(5' to 3')A PtMKK2-1 TGGTATTGCTGGAGTGTGCAACAGGCCA TGCAAATGCATCAAACTCCTG CCACCCAAAAGAGACATCAGPtMKK2-2 CTCCACCTTCTGCACCACCAGACCAATT AGCTTGCAAACTATGAGGAAC CGATTCTGTCAGGGAAAACCPtMKK6 GCTGCAACCCTCCAGCTCAGGTCCC GGGAAGGTTGTCATCTTTGG TGGGTAATTCACAGGAGGTTCB PtMKK3 GCAGTTGCAATCCGCGTTTCAGGATCC GCTCTATGTTCCTCCAGTTAC GAAATGGTTTCATATCTGTCACGC PtMKK4 ATTGCTTGTTGTTTGCAGAGGGAGCCGG GAATTGTTGTGGGTTATTGTTG GGTCAGAACTAAAGGTGCTGTGPtMKK5 CCCAATAACCGCATCACTGTCGATGAGG AGCATCCGTTTATTGTGAGAAG AACTACCTACTAAGCAATTGGCD PtMKK7 CGAGCTTGCCGGAGGGAGCATCTGAGGA TGACCCGAATGCCCAGTTAA TTCCTCTCATTTCAAGAGCAGPtMKK9 GCGTCGGAGGAGTTTCGGGACTTTATTC ACTTTATTCAGTGTTGCCTGC GGGTCAAATCACAAGTCCACPtMKK10 TGTGGAGAGAAACCAGACTGGGCAGCAT TTTGGTCTGGATATAAGCTGTG TGCAAAACCAGCATCATCTTCPtMKK11-1 GGGAGTGCTCTGCAGTTGTTGCAACACC TGCAACACCCTTTTATACTGC TGATGGAAGTGACAGGATGGTable 1: Sequences of PtMPKs 3'RACE and RTqPCR primers used for 3'UTR MAPK gene isolation and expression profiling.Group Gene name 3' RACE Primers(5' to 3')Forward RTqPCR Primers(5' to 3')Reverse RTqPCR Primers(5' to 3')A PtMPK3-1 CCCACTTGTTCACCCTCTGGCCATTG CCATAAGCACTACCAGTCC TCA GATACAGAGGAGTGCPtMPK3-2 AGCATTGGCTCATCCATACCTTGCAAGG CTTTAGCACTACCAATCCCG TGAACAATTAGCAAGTCCAGGPtMPK6-1 TCCCAACTGTCCACCCGGCAGCTATTG CATTGTGACTGGTCAGCTTGA GTTCCCCTGAATTCTGTCCPtMPK6-2 GATCCCAGACAGAGGATTACTGTTGAGG ATGAGTCGACCAGCGTGGC CACTACATTGACGCCGATACB PtMPK4 AGTCGATGAGGCACTGTGCCATCCATAC TGGTGTGCAGTTGGGAAGG GAACCTTCATAGAGATTCTGCPtMPK5-1 TCGCATCACTGTTGATGAGGCCCTTTGT CGTCATTTCCTGGAGAATATG ACAATGCAATTCACTTCAGGCPtMPK5-2 CCCAATAACCGCATCACTGTCGATGAGG CATAACTTCTGACACATTTGGG CATACAACACATGATCCTTGCPtMPK11 GAGGCATTGTGCCATCCATACTTGGCAC GTTTGCTGAGCAGAATCTCC GCGTCCTCAAAACCATGAAGC PtMPK1 CCGGAGCACTGGAACACCCTTACATGTC AAGAAGCACGCACAAGCCAG TACAAGCTGAAAGGGCCACCPtMPK2 GCTGCAACCCTCCAGCTCAGGTCCC GTGTGTTTTTGTACGTGTCTG AGAACTAGAAGCTCACTGCCPtMPK7 CAGGGCTGTACGATCCAAGACGCGACCC CTAGTGTGTCTGTGAGATCAG GGATGCCATAGTCCGGCTCPtMPK14 ACCCTTACATGTCAGGGCTGCACGATCC TGCACGATCCAAGACACGAC TGCGAAAACAACTTCTGGGTGD PtMPK9-1 CCAGGGTCACAGCAACCAGATGGTTCAG GATTCAGATGGCTGCCTTTG ACAAGCTACTGCCTGATCTTCPtMPK9-2 GCAGCTCAAAGCACTGATATTGAGAGGC CCAGCGTAGTGTGGATAGTG TCACATCTCCTCTCTGCAATCPtMPK16-1 CGGTGCTGCGTTACAACAATTGTGGAGC AATCTGTGCCATTTTGTCTGTG TGGCCTTATGAATACAGCCACPtMPK16-2 GTGGAGCAGCAGCAGCAGAGAATCTTGA CAGCAGCAGAGAATCTTGAC CCATTGGAACCTTCAACCACPtMPK17 CTCTTTCTCGTGCAGCTAAGCAGAGCCC CCTATTTGCACATCTTGGAGG GCGGTAGTACATTTAGTGAGGPtMPK18 CCTCCCCAAACCAGCTCTCCACACCACTGCT GATAAATCCTTTCCACCCTCG GTTGACTACACCCTTGAAACCPtMPK19 CTGGGATGGCCATGGATGTGAACGCCTA GTTGGTATCACGATCAATTATG TGACTAGATACAGGACGTGGPtMPK20-1 GGGAGGGAGCAAGGAAGAACATGTGGAT GGACTGAGGAGATCCACTTG CCCCCTCTTTTTACACAATCCPtMPK20-2 GTGGCATGGCAGCCAAATATGCACCAGA GGTTGGAGCTGTTCAATATGG GACACGTTGATCTTCTGAGTCPage 19 of 22(page number not for citation purposes)PtMKK11-2 GGAGAATCCCCTAGCTTCCCAAAGGAAG CCTATGTTTGCTTAGGGGAG TTGGTCCAAGAGCCATTTCGBMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223nucleotide RTqPCR primers. Specific 5'- and 3'-oligonu-cleotides were designed to target the previously sequenced3' UTR regions of each poplar MPK and MKK gene (Tables1 and 2), and RTqPCR reactions were carried out asdescribed above, except that the manually set fluorescencethreshold was 0.03.In order to obtain consistent and reproducible RTqPCRdata, accurate measurement of RNA concentrations andthe preparation of samples that are free from any inhibi-tors of the reverse transcription and PCR processes are crit-ical steps. Moreover, since we have analyzed manydifferent organs in parallel, it was necessary to normalizethe data by employing internal standard candidate genesthat show consistent expression over a wide array of tis-sues or organ samples. To validate proper dosage ofcDNA, cdc2 RTqPCR primers were included in the analysisas a control gene. Primer sequences were as follows: for-ward primer sequence: 5'ATTCCCCAAGTGGCCT-TCTAAG 3'; reverse primer sequence: 5'TATTCATGCTCCAAAGCACTCC 3'). Act2 was alsoemployed as a control housekeeping gene and RTqPCRprimer sequences were as follows: forward primersequence: 5' TTCTACAAGTGCTTTGATGGTGAGTTC 3';reverse primer sequence: 5' CTATTCGATACATAGAAGAT-CAGAATGTTC 3').To simplify graphical presentation, standard deviationsare not included in Figures 8 to 10. However, all the cor-responding data together with respective standard devia-tion are available in the additional files 2 and 3. Eachvalue of transcript accumulation for a specific PtMPK orPtMKK gene represents the average of six independentPCR reactions; two technical repetitions of three biologi-cal samples. Overall, regardless of organs or phylogeneticclassification, technical variation within one sample was,on average, < 0.25 Ct. This means that our quantificationof transcript accumulation was highly reproduciblewithin one sample and that technical error has littleimpact on the values reported here. The variation fromone biological sample to another within a specific organwas also consistently < 1.0 Ct. Samples that showedgreater variation than 1.0 Ct were reamplified, with usu-ally smaller disparity. The highest variations on transcriptsnumbers were found in leaf samples (LPI 1 and 12) aswell as in xylem and secondary phloem, for both MPKand MKK gene families. The underlying reason for thisfinding remains unclear, but it could be associated withhigher concentrations of potent inhibitors of the reversetranscription and/or PCR processes.Competing interestsThe author(s) declare that they have no competing inter-Authors' contributionsM-CN and L-PH designed and performed all the in silicoanalysis and laboratory experiments, and drafted themanuscript. M-JM participated to the real time RT-qPCRexperiments. NB and BEE critically revised the manuscriptand provided important intellectual content. AS con-ceived the analysis, participated in its coordination andhelped to draft the manuscript. All authors read, helped toedit, and approved the final manuscript.Additional materialAcknowledgementsWe are grateful to Dr. Brian Boyle (Canadian Forest Service) who provided help for RTqPCR analysis. We also thank Dr. Janice Cooke (Université Laval) who provided some of the 10-year-old field-grown tree organs, and Dr. Steven Strauss and Dr. Amy M. Brunner (Oregon State University) who supplied total RNA extracts from early stage floral organs (data not shown). Finally, special thanks go to Caroline Côté (Université Laval) for her help with the poplar cuttings and to Serge Morin (Minitère de Res-sources naturelles et de la Faune du Québec) for helpful discussions and assistance with collection of the various bud types. This work was sup-ported by a grant from the National Biotechnology Strategy of Canada and NSERC to A. Séguin, and an NSERC scholarship to L.-P. Hamel.References1. Widmann C, Gibson S, Jarpe MB, Johnson GL: Mitogen-activatedprotein kinase: conservation of a three-kinase module fromyeast to human.  Physiol Rev 1999, 79:143-180.2. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Ber-man K, Cobb MH: Mitogen-activated protein (MAP) kinaseAdditional File 1Evaluation of each RTqPCR primer set efficiency using genomic DNA from three different genetic backgrounds: Populus trichocarpa (T), Populus trichocarpa X Populus deltoides (TXD) and Populus del-toides (D).Click here for file[http://www.biomedcentral.com/content/supplementary/1471-2164-7-223-S1.xls]Additional File 2Raw values, standard deviations and means of the number of transcript molecules per ng of total RNA obtained for each PtMPK gene in the var-ious poplar organs surveyed.Click here for file[http://www.biomedcentral.com/content/supplementary/1471-2164-7-223-S2.xls]Additional File 3Raw values, standard deviations and means of the number of transcript molecules per ng of total RNA obtained for each PtMKK gene in the var-ious poplar organs surveyed.Click here for file[http://www.biomedcentral.com/content/supplementary/1471-2164-7-223-S3.xls]Page 20 of 22(page number not for citation purposes)ests. pathways: regulation and physiological functions.  Endocr Rev2001, 22:153-183.BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/2233. Nakagami H, Pitzschke A, Hirt H: Emerging MAP kinase path-ways in plant stress signalling.  Trends Plant Sci 2005, 10:339-346.4. Ichimura K: Mitogen-activated protein kinase cascades inplants: a new nomenclature.  Trends Plant Sci 2002, 7:301-308.5. Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-GomezL, Boller T, Ausubel FM, Sheen J: MAP kinase signalling cascadein Arabidopsis innate immunity.  Nature 2002, 415:977-983.6. Zhang S, Klessig DF: MAPK cascades in plant defense signaling.Trends Plant Sci 2001, 6:520-527.7. Samuel MA, Miles GP, Ellis BE: Ozone treatment rapidly acti-vates MAP kinase signalling in plants.  Plant J 2000, 22:367-376.8. Mayrose M, Bonshtien A, Sessa G: LeMPK3 is a mitogen-acti-vated protein kinase with dual specificity induced duringtomato defense and wounding responses.  J Biol Chem 2004,279:14819-14827.9. Jonak C, Nakagami H, Hirt H: Heavy metal stress. Activation ofdistinct mitogen-activated protein kinase pathways by cop-per and cadmium.  Plant Physiol 2004, 136:3276-3283.10. Mockaitis K, Howell SH: Auxin induces mitogenic activatedprotein kinase (MAPK) activation in roots of Arabidopsisseedlings.  Plant J 2000, 24:785-796.11. Knetsch M, Wang M, Snaar-Jagalska BE, Heimovaara-Dijkstra S:Abscisic Acid Induces Mitogen-Activated Protein KinaseActivation in Barley Aleurone Protoplasts.  Plant Cell 1996,8:1061-1067.12. Burnett EC, Desikan R, Moser RC, Neill SJ: ABA activation of anMBP kinase in Pisum sativum epidermal peels correlates withstomatal responses to ABA.  J Exp Bot 2000, 51:197-205.13. Soyano T, Nishihama R, Morikiyo K, Ishikawa M, Machida Y: NQK1/NtMEK1 is a MAPKK that acts in the NPK1 MAPKKK-medi-ated MAPK cascade and is required for plant cytokinesis.Genes Dev 2003, 17:1055-1067.14. Voronin V, Aionesei T, Limmongkon A, Barinova I, Touraev A, Lau-riere C, Coronado MJ, Testillano PS, Risueno MC, Heberle-Bors E,Wilson C: The MAP kinase kinase NtMEK2 is involved intobacco pollen germination.  FEBS Lett 2004, 560:86-90.15. Zhang S, Liu Y, Klessig DF: Multiple levels of tobacco WIPK acti-vation during the induction of cell death by fungal elicitins.Plant J 2000, 23:339-347.16. Zhang S, Du H, Klessig DF: Activation of the tobacco SIP kinaseby both a cell wall-derived carbohydrate elicitor and purifiedproteinaceous elicitins from Phytophthora spp.  Plant Cell 1998,10:435-450.17. Zhang S, Klessig DF: Resistance gene N-mediated de novo syn-thesis and activation of a tobacco mitogen-activated proteinkinase by tobacco mosaic virus infection.  Proc Natl Acad Sci USA1998, 95:7433-7438.18. Romeis T, Piedras P, Zhang S, Klessig DF, Hirt H, Jones JD: RapidAvr9- and Cf-9-dependent activation of MAP kinases intobacco cell cultures and leaves: convergence of resistancegene, elicitor, wound, and salicylate responses.  Plant Cell 1999,11:273-287.19. Zhang S, Klessig DF: The tobacco wounding-activated mitogen-activated protein kinase is encoded by SIPK.  Proc Natl Acad SciUSA 1998, 95:7225-7230.20. Liu Y, Zhang S: Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsivemitogen-activated protein kinase, induces ethylene biosyn-thesis in Arabidopsis.  Plant Cell 2004, 16:3386-3399.21. Kim CY, Liu Y, Thorne ET, Yang H, Fukushige H, Gassmann W, Hilde-brand D, Sharp RE, Zhang S: Activation of a stress-responsivemitogen-activated protein kinase cascade induces the bio-synthesis of ethylene in plants.  Plant Cell 2003, 15:2707-2718.22. Liu Y, Jin H, Yang KY, Kim CY, Baker B, Zhang S: Interactionbetween two mitogen-activated protein kinases duringtobacco defense signaling.  Plant J 2003, 34:149-160.23. Huang HJ, Fu SF, Tai YH, Chou WC, Huang DD: Expression ofOryza sativa MAP kinase gene is developmentally regulatedand stress-responsive.  Physiol Plant 2002, 114:572-580.24. Agrawal GK, Iwahashi H, Rakwal R: Rice MAPKs.  Biochem BiophysRes Commun 2003, 302:171-180.25. Agrawal GK, Agrawal SK, Shibato J, Iwahashi H, Rakwal R: Novel riceMAP kinases OsMSRMK3 and OsWJUMK1 involved inencountering diverse environmental stresses and develop-26. Aebersold DM, Shaul YD, Yung Y, Yarom N, Yao Z, Hanoch T, SegerR: Extracellular signal-regulated kinase 1c (ERK1c), a novel42-kilodalton ERK, demonstrates unique modes of regula-tion, localization, and function.  Mol Cell Biol 2004,24:10000-10015.27. Marshall CJ: Specificity of receptor tyrosine kinase signaling:transient versus sustained extracellular signal-regulatedkinase activation.  Cell 1995, 80:179-185.28. Whitmarsh AJ, Davis RJ: Structural organization of MAP-kinasesignaling modules by scaffold proteins in yeast and mam-mals.  Trends Biochem Sci 1998, 23:481-485.29. Elion EA: The Ste5p scaffold.  J Cell Sci 2001, 114:3967-3978.30. Lieberherr D, Thao NP, Nakashima A, Umemura K, Kawasaki T, Shi-mamoto K: A sphingolipid elicitor-inducible mitogen-acti-vated protein kinase is regulated by the small GTPaseOsRac1 and heterotrimeric G-protein in rice 1.  Plant Physiol2005, 138:1644-1652.31. Lee J, Rudd JJ, Macioszek VK, Scheel D: Dynamic changes in thelocalization of MAPK cascade components controllingpathogenesis-related (PR) gene expression during innateimmunity in parsley.  J Biol Chem 2004, 279:22440-22448.32. Yung Y, Yao Z, Hanoch T, Seger R: ERK1b, a 46-kDa ERK isoformthat is differentially regulated by MEK.  J Biol Chem 2000,275:15799-15808.33. Nishihama R, Banno H, Kawahara E, Irie K, Machida Y: Possibleinvolvement of differential splicing in regulation of the activ-ity of Arabidopsis ANP1 that is related to mitogen-activatedprotein kinase kinase kinases (MAPKKKs).  Plant J 1997,12:39-48.34. Xiong L, Yang Y: Disease resistance and abiotic stress toler-ance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase.  Plant Cell 2003,15:745-759.35. Bogre L, Ligterink W, Meskiene I, Barker PJ, Heberle-Bors E, Huskis-son NS, Hirt H: Wounding induces the rapid and transientactivation of a specific MAP kinase pathway.  Plant Cell 1997,9:75-83.36. He C, Fong SH, Yang D, Wang GL: BWMK1, a novel MAP kinaseinduced by fungal infection and mechanical wounding in rice.Mol Plant-Microbe Interact 1999, 12:1064-1073.37. Decroocq-Ferrant V, Decroocq S, Van Went J, Schmidt E, Kreis M: Ahomologue of the MAP/ERK family of protein kinase genes isexpressed in vegetative and in female reproductive organs ofPetunia hybrida.  Plant Mol Biol 1995, 27:339-350.38. Voronin V, Touraev A, Kieft H, van Lammeren AA, Heberle-Bors E,Wilson C: Temporal and tissue-specific expression of thetobacco ntf4 MAP kinase.  Plant Mol Biol 2001, 45:679-689.39. Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, Ehlting J,Beaudoin N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, OhashiY, Scheel D, Sheen J, Xing T, Zhang S, Seguin A, Ellis BE: Ancient sig-nals: Comparative genomics of plant MAPK and MAPKKgene families.  Trends Plant Sci 2006, 11:192-198.40. Hartwell LH, Kastan MB: Cell cycle control and cancer.  Science1994, 266:1821-1828.41. Nurse P: Universal control mechanism regulating onset of M-phase.  Nature 1990, 344:503-508.42. Brunner AM, Yakovlev IA, Strauss SH: Validating internal con-trols for quantitative plant gene expression studies.  BMC PlantBiol 2004, 4:14.43. Wilson C, Eller N, Gartner A, Vicente O, Heberle-Bors E: Isolationand characterization of a tobacco cDNA clone encoding aputative MAP kinase.  Plant Mol Biol 1993, 23:543-551.44. Schaffer R, Landgraf J, Accerbi M, Simon V, Larson M, Wisman E:Microarray analysis of diurnal and circadian-regulated genesin Arabidopsis.  Plant Cell 2001, 13:113-123.45. Fu SF, WC C, Huang DD, Huang HJ: Transcriptional regulationof a rice mitogen-activated protein kinase gene, OsMAPK4,in response to environmental stresses.  Plant Cell Physiol 2002,43:958-963.46. Schoenbeck MA, Samac DA, Fedorova M, Gregerson RG, Gantt JS,Vance CP: The alfalfa (Medicago sativa) TDY1 gene encodes amitogen-activated protein kinase homolog.  Mol Plant MicrobeInteract 1999, 12:882-893.47. Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY,Page 21 of 22(page number not for citation purposes)mental regulation.  Biochem Biophys Res Commun 2003,300:775-783.Kim JC, Park BO, Koo SC, Yoon HW, Chung WS, Lim CO, Lee SY,Cho MJ: BWMK1, a rice mitogen-activated protein kinase,Publish with BioMed Central   and  every scientist can read your work free of charge"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."Sir Paul Nurse, Cancer Research UKYour research papers will be:available free of charge to the entire biomedical communitypeer reviewed and published immediately upon acceptancecited in PubMed and archived on PubMed Central BMC Genomics 2006, 7:223 http://www.biomedcentral.com/1471-2164/7/223locates in the nucleus and mediates pathogenesis-relatedgene expression by activation of a transcription factor.  PlantPhysiol 2003, 132:1961-1972.48. Calderini O, Glab N, Bergounioux C, Heberle-Bors E, Wilson C: Anovel tobacco mitogen-activated protein (MAP) kinasekinase, NtMEK1, activates the cell cycle-regulated p43Ntf6MAP kinase.  J Biol Chem 2001, 276:18139-18145.49. Melikant B, Giuliani C, Halbmayer-Watzina S, Limmongkon A,Heberle-Bors E, Wilson C: The Arabidopsis thaliana MEKAtMKK6 activates the MAP kinase AtMPK13.  FEBS Lett 2004,576:5-8.50. Katou S, Yamamoto A, Yoshioka H, Kawakita K, Doke N: Func-tional analysis of potato mitogen-activated protein kinasekinase, StMEK1.  J Gen Plant Pathol 2003, 69:161-168.51. Kiegerl S, Cardinale F, Siligan C, Gross A, Baudouin E, Liwosz A, EklofS, Till S, Bogre L, Hirt H, Meskiene I: SIMKK, a mitogen-activatedprotein kinase (MAPK) kinase, is a specific activator of thesalt stress-induced MAPK, SIMK.  Plant Cell 2000, 12:2247-2258.52. Yang KY, Liu Y, Zhang S: Activation of a mitogen-activated pro-tein kinase pathway is involved in disease resistance intobacco.  Proc Natl Acad Sci USA 2001, 98:741-746.53. Genvestigator®  2006 [https://www.genevestigator.ethz.ch/].54. Djerbi S, Lindskog M, Arvestad L, Sterky F, Teeri TT: The genomesequence of black cottonwood (Populus trichocarpa) reveals18 conserved cellulose synthase (CesA) genes.  Planta 2005,221:739-746.55. The Arabidopsis Information Resource  2006 [http://www.arabidopsis.org/].56. Trapp SC, Croteau RB: Genomic organization of plant terpenesynthases and molecular evolution implications.  Genetics2001, 158:811-832.57. Grotewold E: Plant metabolic diversity: a regulatory perspec-tive.  Trends Plant Sci 2005, 10:57-62.58. Mizoguchi T, Irie K, Hirayama T, Hayashida N, Yamaguchi-ShinozakiK, Matsumoto K, Shinozaki K: A gene encoding a mitogen-acti-vated protein kinase kinase kinase is induced simultaneouslywith genes for a mitogen-activated protein kinase and an S6ribosomal protein kinase by touch, cold, and water stress inArabidopsis thaliana.  Proc Natl Acad Sci USA 1996, 93:765-769.59. Ren D, Yang KY, Li GJ, Liu Y, Zhang S: Activation of Ntf4, atobacco MAPK, during plant defense response and itsinvolvement in hypersensitive response-like cell death.  PlantPhysiol 2006, 141:1482-1493.60. Mizoguchi T, Gotoh Y, Nishida E, Yamaguchi-Shinozaki K, HayashidaN, Iwasaki T, Kamada H, Shinozaki K: Characterization of twocDNAs that encode MAP kinase homologues in Arabidopsisthaliana and analysis of the possible role of auxin in activatingsuch kinase activities in cultured cells.  Plant J 1994, 5:111-122.61. Moore RC, Purugganan MD: The evolutionary dynamics of plantduplicate genes.  Curr Opin Plant Biol 2005, 8:122-128.62. Soyano T, Ishikawa M, Nishihama R, Araki S, Ito M, Ito M, Machida Y:Control of plant cytokinesis by an NPK1-mediated mitogen-activated protein kinase cascade.  Philos Trans R Soc Lond B BiolSci 2002, 357:767-775.63. Ichimura K, Mizoguchi T, Hayashida N, Seki M, Shinozaki K: Molecu-lar cloning and characterization of three cDNAs encodingputative mitogen-activated protein kinase kinases (MAP-KKs) in Arabidopsis thaliana.  DNA Res 1998, 5:341-348.64. Hamel LP, Miles GP, Samuel MA, Ellis BE, Séguin A, Beaudoin N: Acti-vation of stress-responsive mitogen-activated protein kinasepathways in hybrid poplar (Populus trichocarpa × Populus del-toides).  Tree Physiol 2005, 25:277-288.65. Larson PR, Isebrands JG: The plastochron index as applied todevelopmental studies of cottonwood.  Can J For Res 1971,1:1-11.66. Eukaryotic Genomics  2006 [http://genome.jgi-psf.org].67. Chang S, Puryear J, Cairney J: A simple and efficient method forisolating RNA from pine trees.  Plant Mol Biol Rep 1993,11:113-116.68. Multiple sequence alignment with hierarchicalclustering2006 [http://prodes.toulouse.inra.fr/multalin/multalin.html].69. Rutledge RG, Côté C: Mathematics of quantitative kinetic PCRand the application of standard curves.  Nucl Acids Res 2003,31:e93. yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralPage 22 of 22(page number not for citation purposes)

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0215977/manifest

Comment

Related Items