UBC Faculty Research and Publications

Identification of a calcitriol-regulated Sp-1 site in the promoter of human CD14 using a combined western… Moeenrezakhanlou, Alireza; Nandan, Devki; Reiner, Neil E Feb 17, 2008

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12575_2008_Article_101029.pdf [ 510.54kB ]
Metadata
JSON: 52383-1.0167826.json
JSON-LD: 52383-1.0167826-ld.json
RDF/XML (Pretty): 52383-1.0167826-rdf.xml
RDF/JSON: 52383-1.0167826-rdf.json
Turtle: 52383-1.0167826-turtle.txt
N-Triples: 52383-1.0167826-rdf-ntriples.txt
Original Record: 52383-1.0167826-source.json
Full Text
52383-1.0167826-fulltext.txt
Citation
52383-1.0167826.ris

Full Text

Biol. Proced. Online 2008; 10(1): 29-35doi:10.1251/bpo140February 17, 2008Identification of a Calcitriol -Regulated Sp-1 Site in the Promoterof Human CD14  using a Combined Western BlottingElectrophoresis Mobil ity Shif t Assay (WEMSA)Alireza Moeenrezakhanlou1,2, Devki Nandan1 and Neil E. Reiner1# 1Department of Microbiology and Immunology, University of British Columbia, Faculties of Medicine and Science, and Vancouver Coastal Health ResearchInstitute (VCHRI), Vancouver, British Columbia, Canada, V5Z 3J5.2School of Medicine, Hamadan University of Medical Sciences, Hamadan, Iran.#Corresponding Author: Neil E. Reiner,  Division of Infectious Diseases, University of British Columbia, Rm 452D, 2733 Heather Street, Vancouver, BC.Canada, V5Z 3J5. Phone: 604-875-4011; Fax: 604-875-4013; E-mail: ethan@interchange.ubc.caSubmitted: March 23, 2007; Revised: December 10, 2007; Accepted: December 12, 2007Indexing terms: Electrophoretic Mobility Shift Assay; Transcription Factors; Antigens, CD14Abbreviations: TF, transcription factor; VDRE, vitamin D response element; WEMSA, western blot electrophoretic mobility shift assayABSTRACTCalcitriol (1 , 25-dihydroxyvitamin D 3) induces the expression of CD14 in mononuclear phagocytes. The mechanismsaccounting for this have been unclear since the promoter of  CD14  does not contain a canonical vitamin D responseelement (VDRE). Calcitriol has been shown to regulate the activity of the transcription factor Sp-1 and our analysis ofthe proximal promoter of CD14 indicated the presence of four Sp-1-like binding sequences. To identify which of thesesites might be involved in the response to calcitriol, we used a system incorporating an electrophoretic mobility shiftassay (EMSA) coupled to Western blot analysis (WEMSA). Using WEMSA, we found that only one of the Sp-1-likebinding sequences, located at position -91 to -79 (relative to the transcription start site), bound the transcription factorSp1. Sp-1 binding to this site was demonstrable using nuclear extracts from control cells. Notably, binding activity wasattenuated  in  nuclear  extracts  prepared  from cells  that  had  been  incubated  with  calcitriol,  thus  suggesting  Sp-1involvement in calcitriol induction of  CD14 expression. Notably, these results show that like EMSA, WEMSA can bebroadly applied to aid in the identification of transcription factors involved in regulating gene expression. WEMSA,however,  offers  a  number  of  distinct  advantages  when  compared  with  conventional  EMSA.  Antibodies  used  forWEMSA often provide less ambiguous signals than those used in EMSA, and these do not have to recognize epitopesunder native conditions. In addition, WEMSA does not require the use of labeled oligos, thus eliminating a significantexpense associated with EMSA. INTRODUCTIONThe regulation of gene expression in mammalian cells iscontrolled by approximately 200 transcription factors thatinteract with distinct DNA binding sites (1). Transcriptionfactors  (TF)  are  proteins  involved  in  the  negative  andpositive regulation of gene expression. Their mechanismsof  action  may  involve  either  direct  binding  to  specificDNA sequences  in promoter regions of  target  genes,  orindirect  effects  on  gene  expression  through  interactionswith other proteins directly bound to DNA elements. EachTF is defined by the short DNA sequences that reflects itsDNA  binding  motif  (2).  TFs  usually  consist  of  twofunctional  domains,  a  DNA  binding  domain  and  aregulatory domain that interacts with components of thetranscription initiation complex and regulatory proteins,thereby  affecting  the  efficiency  of  DNA  binding  andtranscription.  Typically,  gene  promoters  contain  severalfunctional TF-DNA binding sites and in most cases, thereis more than one specific DNA binding site for a particular© 2008 by Biological Procedures Online. This paper is Open Access. Copying, printing, redistribution and storage permitted. Journal © 1997-2008Biological Procedures Online - www.biologicalprocedures.com30TF  (3).  In  addition,  promoters  of  human  genes  containmany transcription  factor  binding elements  that  have  avaried  range  of  identities  when  compared  to  canonicaltranscription factor binding elements (4).Calcitriol  induces  monocyte  differentiation  and  this  isreflected in increased surface expression of both CD14 andCD11b (5). Since no canonical vitamin D response element(VDRE) has been identified in the human CD14 promoter,the mechanism of CD14 activation in response to calcitriolis  unclear.  Recently,  the  transcription  factor  CREB  hasbeen shown to be activated by calcitriol and to play a rolein the regulation of  CD14 expression (6). It has also beenreported that  calcitriol  modulates  Sp-1  activity  and thistoo may be  involved in regulating  CD14 expression (7).Sp-1 belongs to a family of transcription factors that bindto  GC-rich sequences  and is  involved in regulating  cellgrowth, apoptosis and angiogenesis (reviewed in 8). Ouranalysis  of  the  proximal  promoter  of  human  CD14identified four candidate Sp-1-like sequences. This raisedthe  question  of  which,  if  any,  of  these  sequences  isinvolved in regulating the CD14 response to calcitriol. Conventionally,  electrophoretic  mobility  shift  assays(EMSA) combined with antibody supershifts are used toinvestigate  the  interactions  of  TFs  with  specific  DNAelements (9). EMSAs are carried out using short syntheticlabeled  DNA  probes  corresponding  to  TF  bindingsequences in the promoter region of the gene of interest.These  probes  are  then  incubated  with  crude  nuclearextracts followed by the electrophoretic separation of theresulting  protein-DNA mixture  on  a  polyacryamide  oragarose gel in a low ionic strength buffer which results ina  mobility  shift.  In  general,  an  antibody-  mediatedsupershift  is  then  used  to  confirm  the  identity  of  theparticular TF involved. In most situations, canonical DNAprobes are used for EMSA analysis. However, variabilityin the DNA binding sequences recognized by TF bindingdomains  may  complicate  the  results.  While  supershiftscan be highly informative, they have limitations. In manysupershift assays for example, multiple bands are presentwhich  may  be  diffuse  and  difficult  to  interpret.  Inaddition, antibodies capable of mediating a supershift fora particular transcription factor of interest may not alwaysbe  available  because  of  the  requirement  that  theyrecognize epitopes under native conditions (10). The verynature of the supershift assay itself also does not allow there-use  of  antibodies,  thus  making  this  techniquesomewhat  costly.  Moreover,  EMSA-based  supershiftassays are carried out in a manner such that they do notpermit examination of multiple TFs simultaneously. In aprevious  report,  we  used  a  modification  of  EMSA  toincorporate  Western  blotting  in  a  combined  approachwhich we referred to as WEMSA (6).  The present studyagain utilizes WEMSA to examine the regulation of Sp-1binding to the promoter region of CD14 in myeloid cells inresponse to calcitriol. The findings reported illustrate thegeneral  applicability  of  WEMSA  to  identify  activesequences  in  gene  promoters  and  their  cognate  DNAbinding proteins. Because Western blotting is incorporatedin this assay, the recycling of antibodies is possible in mostsituations and this significantly reduces the cost normallyassociated  with  classical  supershift  assays.  Moreover,suitable  antibodies  for  WEMSA  are  more  generallyavailable  since  there  is  no  requirement  that  they  mustrecognize epitopes under native conditions. Importantly,WEMSA also has the advantage of not requiring the use oflabeled  oligos  needed  for  EMSA.  This  along  with  theadvantages  outlined  above,  makes  this  technique  anattractive alternative to classical EMSA to study the rolesof transcription factors in regulating gene expression. MATERIALS AND METHODSReagents and Chemicals1 ,25-dihydroxyvitamin D 3 (calcitriol), was obtained fromCalbiochem  Corporation  (San  Diego,  CA).  RPMI  1640,Hank’s  Balanced  Salt  Solution  (HBSS),penicillin/streptomycin, protease inhibitor cocktail, PMSF,and poly (dI-dC)  were purchased from Sigma ChemicalCo.  (St.  Louis,  MO).  Nitrocellulose  membranes  wereobtained  from  Bio-Rad  Laboratories  (Hercules,  CA).Unlabelled and labelled Sp-1-like oligos for WEMSA andEMSA were from Invitrogen (Carlsbad,  CA).  Unlabelledand labelled canonical  Sp-1 oligos were purchased fromPanomics.  Anti-Sp-1  antibody  was  from  Upstate  CellSignaling Solutions (Lake Placid, NY). Cell CultureThe human promonocytic cell line THP-1 (acquired fromthe  American  Type  Culture  Collection,  Rockville,  MD)was  cultured at  37°C /  5% CO2 in  RPMI  1640  mediumsupplemented with 10% (v/v) heat-inactivated fetal bovineserum  (FBS),  penicillin  (100  units/ml)  and  streptomycin(100 g/ml). For most experiments, prior to use, cells werewashed in HBSS and incubated for 5 h in RPMI/0.5% FBSfor serum starvation. Moeenrezakhanlou et al. – Identification of a Calcitriol-Regulated Sp-1 Sitewww.biologicalprocedures.com31Preparation of Nuclear and Cytoplasmic FractionsNuclear and cytoplasmic fractions were prepared basedon a protocol from the Skirball Institute of BiomolecularMedicine,  NYU  Medical  Center  (6)  with  minormodifications. Briefly, approximately 2 x 107 THP-1 cellswere  used per  assay  and after  treatment  the  cells  werewashed twice with HBSS and collected by centrifugation.Subsequent steps were performed on ice. The cells wereresuspended  in  300  l  of  fractionation  buffer  (10  mMHEPES pH 7.9 containing 50 mM NaCl, 0.5 M sucrose, 0.1mM EDTA, 0.5% Triton-X 100, 1 mM DTT, 10 mM sodiumpyrophosphate, 2 mM NaF, 17.5 mM -glycerophosphate,1 mM PMSF and 4 g/ml aprotinin, 2 g/ml pepstatin A, and 2 g/ml leupeptin  and incubated on ice for 5  min.Nuclei were collected at 4500 x g for 5 min at 4°C. Nucleiwere washed and resuspended in 500 l buffer A (10 mMHEPES pH 7.9 containing 10 mM KCl, 0.1 mM EDTA, 0.1mM  EGTA,  1  mM  DTT,  1  mM  PMSF,  and  4  g/mlaprotinin,  2  g/ml  pepstatin  A,  and 2  g/ml  leupeptin) and pelleted at 4500 x g for 5 min at 4°C. Nuclear pelletswere resuspended in 40 l of buffer B (10 mM HEPES pH7.9, 500 mM NaCl, 0.1  mM EDTA, 0.1  mM EGTA, 0.1%IGEPAL,1 mM DTT, 1 mM PMSF, and 4 g/ml aprotinin, 2g/ml pepstatin A, and 2 g/ml leupeptin  ) and mixed byextensive vortexing over 10-15 min at room temperature.Tubes  were  kept  cold  by  placing  them  on  iceintermittently during vortexing. Samples were centrifugedat  11,600  x  g for  20  min  at  4°C  and  supernatantsrepresenting crude nuclear extracts were then transferredto new tubes and adjusted to a final concentration of 10%glycerol. The aliquots were stored at -70°C. Preparation of the OligonucleotidesThe  promoter  of  CD14 was  analyzed  by  TFSEARCHsoftware  (http://www.cbrc.jp/research/db/TFSEARCH.html)and  four  different  candidate  Sp-1  sequences  wereidentified.  Synthesized  solutions  of  sense  and  antisenseoligonucleotides were prepared at 10 M concentration in20 mM Tris pH 8.0. Sense and antisense oligos were thenannealed by heating at 95°C for 5 min and cooled to roomtemperature for 15 min before storage at -20°C.Electrophoretic-Mobility Shift Assay2-5 g of nuclear extract was used for EMSA according tothe  manufacturer’s  instructions  (Panomics,  EMSA  Gel-Shift  Kit).  Briefly,  nuclear  extracts  containing  equalamounts of protein for each sample were incubated withpoly (dI-dC) (1 g/ l) for 5 min, followed by the addition of binding buffer (20 mM HEPES pH 7.9, 1 mM DTT, 0.1mM EDTA, 50 mM KCl, 5% glycerol and 200 g/ml BSA)and biotinylated oligo (10 ng/ l). To control for specificityof binding,  for selected samples, a 5-fold excess of non-labeled  oligo  was  added  prior  to  the  addition  of  thebiotinylated  probe.  Binding  reaction  mixtures  wereincubated for 30 min at room temperature. Protein-DNAcomplexes  were  separated  on  5%  nondenaturingpolyacrylamide  gels  in  Tris-borate/EDTA buffer  (0.1  MTris,  0.09  M  boric  acid  containing  1mM  EDTA)  at  4°C.After  electrophoresis,  gels  were  transferred  to  nylonmembranes. Transferred oligos were immobilized by UVcrosslinking  for  3  min.  For  detection  of  bound  oligos,membranes were blocked using blocking buffer (PanomicsEMSA  Gel-Shift  Kit)  followed  by  the  addition  ofStreptavidin-HRPO  and  blots  were  developed  by  ECLaccording to the manufacturer’s instructions (Amersham,Arlington  Heights,  IL,  U.S.A.).  Commercially  availablebiotinylated oligonucleotide  encoding the  Sp-1  motif  5'-ATTCGATCGGGGCGGGGCGAG-3'  was  used  as  acanonical probe (Panomics, AY-1043).Combined EMSA and Western blotting (WEMSA)For this assay we used custom synthesized non-labeled,oligonucleotides encoding the Sp-1-like binding sequenceslocated within the  proximal  promoter  of  CD14 (Fig.  1).The  Sp-1-like  oligos  were  as  follows:  (1)  5'-GGGGGGTTGG-3'  at  position  -345  to  -336,  (2)  5'-GTCCCTCCCCCT-3'  at  position  -159  to  -148  ,  (3)  5'-AGGGGGCTGGC-3'  at  position  -113  to  -100  and (4)  5'-AGAGGTGGGGAGG-3'  at position -91 to  -79 .  WEMSAwas  performed essentially  as  described above,  with  theexception  that  separated  DNA-protein  complexes  weretransferred to  nitrocellulose  membrane instead of  nylonmembrane  and  probed  with  anti-Sp-1  for  Westernblotting. Blots were developed by ECL. RESULTS AND DISCUSSIONThe Screening for Calcitriol-Regulated Binding of Sp-1 toDNA Response Elements in Human CD14 by WEMSAIn  many gene  promoters  it  is  possible  to  find  multiplecandidate  binding  sites  for  any  particular  transcriptionfactor.  Prior  analysis  of  the  human  CD14 promoterindicated five CRE-like sites (6) and four candidate Sp-1sites  (sequences  1-4  in  Fig.  1).  These  four  sites  show70-85% homology with canonical Sp-1-binding sequences.Using conventional EMSA, four labeled-oligonucleotidesMoeenrezakhanlou et al. – Identification of a Calcitriol-Regulated Sp-1 Site www.biologicalprocedures.com32based on  each  of  these  putative  sites  would have  beenrequired to examine which, if any, were involved in Sp-1binding.  On  the  other  hand,  WEMSA does  not  requirelabeling  of  oligonucleotides  as  identification  of  the  TFinvolved  is  based  on  Western  blotting  using  specificantibodies.  To  evaluate  further  the  effectiveness  ofWEMSA in screening for candidate DNA binding sites of atranscription  factor  of  interest,  oligonucleotides  weresynthesized based on the four Sp-1-like sequences in thehuman  CD14 promoter.  THP-1  cells  were  treated  withcalcitriol  and  nuclear  extracts  were  prepared  andincubated  with  these  four  Sp-1-like  sequencesindependently.  DNA-protein  complexes  were  thenseparated by 5% polyacrylamide gel electrophoresis, andseparated  DNA-protein  complexes  were  transferred  tonitrocellulose  membranes  for  immunodetection  of  Sp-1.The results shown in Fig. 2 indicate that Sp-1 bound toonly  one  of  the  four  candidate  Sp-1  sites.  This  Sp-1binding  site  (5'-AGAGGTGGGGAGG-3')  located  atpositions -91 to  -79 within the  CD14 promoter  has 85%identity  to  the  canonical  Sp-1  sequence  (5'-ATTCGATCGGGGCGGGGCGAG-3'). Sp-1 binding to thissite  was  apparent  in  nuclear  extracts  from  cells  in  thebasal state and binding activity was negatively regulatedby  calcitriol.  Whereas  conventional  Western  blotting  ofnuclear extracts detected the presence of Sp-1 in proteinDNA complexes (Fig. 2), free Sp-1 not bound to DNA wasnot detected in the WEMSA assay (data was not shown).This  was  as  expected  since  the  5%  polyacrylamide  gelwould be unlikely to retain proteins of relatively smallermolecular  mass  such  as  uncomplexed  free  Sp-1.  As  anadditional  test  for  calcitriol-regulated  Sp-1  bindingactivity,  we  conducted  a  parallel  WEMSA  analysis,  inwhich  the  candidate  Sp-1-like  oligo  from  CD14  and  acanonical Sp-1 oligo were used in parallel. Sp-1 binding toboth  the  candidate  and  canonical  sequences  displayedsimilar  activities  in  control  and  calcitriol-treated  THP-1Moeenrezakhanlou et al. – Identification of a Calcitriol-Regulated Sp-1 Sitewww.biologicalprocedures.comFig. 1: CD14 proximal promoter.  This region spanning 469 bpupstream of the transcriptional start site has been shown to be critical forthe induction of CD14 transcription in response to calcitriol. Putative Sp-1-like transcription factor-binding sites in this region were identified using theTFSEARCH program (http://www.cbrc.jp/research/db/TFSEARCH.html) andare highlighted in boldface, underlined and labeled as (1) 5'-GGGGGGTTGG-3' at position -345 to -336, (2) 5'-GTCCCTCCCCCT-3' atposition -159 to -148 , (3) 5'-AGGGGGCTGGC-3' at position -113 to -100 and(4) 5'-AGAGGTGGGGAGG-3' at position -91 to -79. -469  AGTTAAATATCTGAGGATATTCAGGGACTTGGATTTGGTGGCAGGAGATCAA  CATAAACCAAGACAAGGAAGAAGTCAAAGAAATGAATCAAGTAGATTCTCT     GGGATATAAGGTAGGGGGATTGGGGGGTTGGATAGTGCAGAGTATGGTATG                                                     -345     Sp-1 (1)     -336 GCCTAAGGCACTGAGGATCATCCTTTTCCCACACCCACCAGAGAAGGCTTAG                   GCTCCCGAGTCAACAGGGCATTCACGCCTGGGGCGCCTGAGTCATCAGGACA                                                                                   CTGCCAGGAGACACAGAACCCTAGATGCCCTGCAGAATCCTTCCTGTTACGG                                                                                                                                   -159 TCCCCCTCCCTGAAACATCCTTCATTGCAATATTTCCAGGAAAGGAAGGGGGC       Sp-1 (2)     -148                                                                                           -113   Sp-1 (3)  TGGCTCGGAGGAAGAGAGGTGGGGAGGTGATCAGGGTTCACAGAGGAGGGA           - 100                   -91     Sp-1 (4)                -79            ACTGAATGACATCCCAGGATTACATAAACTGTCAGAGGCAGCCGAAGAGTT  CACA -1 Fig. 2: WEMSA shows that Sp-1 binding to a specif ic site in theCD14  promoter is regulated by calcitriol.  Serum starved THP-1 cellswere either treated or not with 100 nM calcitriol for 30 min followed bypreparation of nuclear extracts for WEMSA as described in Materials andMethods. Nuclear extracts were incubated with four unlabelled oligosdenoting putative Sp-1-like transcription factor-binding sites in CD14promoter (A) and DNA protein complexes were separated by non-denaturinggel electrophoresis followed by transfer to nitrocellulose for Westernblotting for Sp-1 (B). The results shown are from one of three independentexperiments that yielded similar results.A. Sp-1-like oligos   1. 5’-GGGGGGTTGG              2.  5’-TCCCCCTCCCT               3.  5’-GGGGGCTGGC             4.   5’-AGAGGTGGGGAGG                                     B.   WEMSA                       Sp-1-like oligos        1           2                3             4                                                                               Calcitriol              -      +    -     +      -     +        -       + Sp-1 Fig.  3:  Sp-1 displays similar binding activ ity  for both canonicaland candidate CD14 promoter Sp-1 DNA binding sequences.Nuclear extract from calcitriol-treated and untreated THP-1 cells were usedfor WEMSA analysis using non-labeled canonical (A) and (B) the candidateCD14 promoter Sp-1 like oligo (sequence #4 from Fig. 1).A.     WEMSA (Sp-1 canonical oligo)                                                                                       B.   WEMSA (Sp-1-like oligo)                                                                                 Sp-1 Cacitriol                   -                                    + Cacitriol              -                               +    Sp-1 33cells (Figs. 3A and B).Validation of WEMSA Analysis of Calcitriol-Regulated Sp-1Binding to a Site in the CD14 Promoter by Classical EMSAThe  analysis  of  calcitriol-regulated  Sp-1  binding  to  thissite in the  CD14 promoter using WEMSA suggested thatcalcitriol  negatively regulated Sp-1 binding to  a  specificDNA sequence  (Figs.  2  and 3).  In  order  to  validate  theresults of WEMSA, we used the same candidate Sp-1-likeoligo  (5'-AGAGGTGGGGAGG-3')  in  a  classical  EMSA.THP-1  cells  were  treated  with  or  without  calcitriol  andnuclear  extracts  were  prepared and incubated with thisSp-1-like  sequence.  DNA-protein  complexes  were  thenseparated  by  polyacrylamide  gel  electropheresis  forEMSA.  The  results  shown in Fig.  4  clearly  demonstrateclacitriol-mediated down-regulation of Sp-1 binding to thecandidate Sp-1 binding sequence in the  CD14  promoter,thereby  corroborating  the  results  obtained  by  WEMSA.Taken together,  these  results  confirm that the  candidateSp-1-like  binding site  located at  position  -91 to  -79 is  abona fide site for Sp-1 binding and that calcitriol reducesSp-1 binding to this position in the CD14 promoter.The broad applicability of WEMSA is demonstrated by itsuse  in  identifying  the  involvement  of  Sp-1,  and  in  anearlier study,  the transcription factor CREB, in calcitriol-mediated  CD14 expression  (6).  This  demonstrates  thatWEMSA provides a suitable substitute for classical EMSAas a method to directly detect the potential involvement oftranscription  factors  and  their  cognate  DNA  bindingelements in gene regulation.  In addition, WEMSA offersseveral advantages over classical EMSA which make thistechnique  an  attractive  alternative  to  electrophoreticmobility shift assays.  WEMSA is highly cost effective ascompared to  EMSA-based  supershifts,  as  WEMSA doesnot  require  the  use  of  modified  oligonucleotides  andantibodies can be used and recycled.It is difficult to calculate the precise cost savings affordedby  WEMSA  over  EMSA.  However,  our  best  estimatewould  be  around  30%.  This  is  based  on  the  cost  ofbiotinylated  oligonucleotides  in  EMSA as  compared  tounlabelled oligonucleotides in WEMSA and recycling ofprimary  antibody  in  WEMSA  as  compared  to  EMSA.Moreover,  antibodies  suitable  for  conducting  supershiftassays in EMSA are often limited, as these are required torecognize epitopes under native conditions.  In WEMSA,however,  any  antibody  that  is  suitable  for  conventionalWestern blotting can be used. Thus, WEMSA provides anattractive  option to classical  EMSA as a  method for  theidentification  of  transcription  factors  and  their  cognateDNA  binding  elements  involved  in  regulating  geneexpression.ACKNOWLEDGMENTSThis  work  was  supported  by  Canadian  Institutes  ofHealth Research  (CIHR)  grants MOP-8633 & MOP-83063(NER)  and  FRN-38005  (DN).  We  thank  Emily  Thi(University  of  British  Columbia,  BC  Canada)  forreviewing the manuscript. Moeenrezakhanlou et al. – Identification of a Calcitriol-Regulated Sp-1 Site www.biologicalprocedures.comFig. 4: EMSA analysis confirms results obtained throughWEMSA. EMSA using labeled Sp-1-like oligo spanning positions –91 to -79of the CD14 promoter. Serum starved THP-1 cells were either untreated ortreated with 100 nM calcitriol for 30 min followed by preparation of nuclearextracts for EMSA as described in Materials and Methods. Lane 1, freelabeled oligo. Lane 2, nuclear extract of untreated cells combined withSp-1-like oligo. Lane 3, nuclear extract of calcitriol-treated cells combinedwith Sp-1-like oligo. Lane 4 represents nuclear extract from untreated cellscombined with Sp-1-like oligo and unlabelled excess of Sp-1-like oligo. 34REFERENCES1. Yu  X,  Lin  J,  Zack  DJ,  and  Qian  J.  Computationalanalysis  of  tissue-specific  combinatorial  generegulation:  predicting  interaction  betweentranscription factors in human tissues.  Nucleic AcidsRes 2006;34:4925-4936.2. Messina  DN,  Glasscock  J,  Gish  W,  and  Lovett  M.Expression  and  the  Construction  of  a  Microarray  toInterrogate  Their  An  ORFeome-based  Analysis  ofHuman  Transcription  Factor  Genes.  Genome  Res2004;14:2041-2047.3. Matys V, Fricke E, Geffers R,  Gößling E, Haubrock M,Hehl R, Hornischer K, Karas D, Kel AE, Kel-MargoulisOV, Kloos DU, Land S, Lewicki-Potapov B, Michael H,Münch R, Reuter I, Rotert S, Saxel H, Scheer M, ThieleS, and  Wingender  E.  TRANSFAC1:  transcriptionalregulation, from patterns to profiles. Nucleic Acids Res2003;31:374-378.4. Yan  Y,  Dalmasso  G,  Sitaraman  S,  and  Merlin  D.Characterization  of  the  Human  Intestinal  CD98Promoter  and  its  Regulation  by  Interferon  Gamma.Am J Physiol Gastrointest Liver Physiol 2007;292:G535-G545.5. Hmama Z, Nanda D, Sly L, Knutson KL, Herrera-VelitP  and  Reiner  N.  1,25  dihydroxyvitamin  D3 inducedmyeloid cell differentiation is regulated by a vitamin dreceptor  phosphatidylinositol  3  kinase  signalingcomplex. J Exp Med 1999;190(11):1583-1594.6. Moeenrezakhanlou  A,  Nandan  D,  Shephard  L,  andReiner  NE.  1 ,25-Dihydroxycholecalciferol  activatesbinding of CREB to a CRE site in the  CD14  promoterand  drives  promoter  activity  in  aphosphatidylinositol-3  kinase-dependent  manner.  JLeukoc Biol 2007;81:1311-1321.7. Zhang DE, Hetherington JC, Gonzalez AD, Chen HMand Tenen GD. Regulation of CD14 Expression DuringMonocytic  Differentiation  Induced  with  1,  25-Dihydroxyvitamin D3. J Immunol 1994;153:3276. 8. Black RA,  Black  DJ  and Azizkan-Clifford J.  Sp1  andKruppel-like Factor Family of Transcription Factors inCell  Growth  Regulation  and  Cancer.  J  Cell  Physiol2001;188:143-160.9. Giraudo E, Primo L, Audero E, Gerber HP, Koolwijk P,Soker  S,  Klagsbrun  M,  Ferrara  N  and  Bussolino  F.Tumor  necrosis  factor-  regulates  expression  ofvascular endothelial growth factor receptor-2 and of itsco-receptor neuropilin-1 in human vascular endothelialcells. J Biol Chem 1998;273:22128-22135.10. Colmone  A,  Li  Sh,  and  Wang  Ch.  ActivatingTranscription Factor/cAMP Response Element BindingProtein  Family  Member  Regulated  Transcription  ofCD1A. J Immunol 2006;177:7024-7032.PROTOCOLSWestern Blotting Electrophoresis Mobility Shift Assay (WEMSA) Reagents:= Unlabelled and biotinylated Sp-1-like oligos for WEMSA and EMSA were from Invitrogen (Carlsbad,  CA).Unlabelled and biotinylated canonical  Sp-1  oligos and EMSA kit  (EMSA Gel-Shift  Kit  #  AY 1288  P)  werepurchased from Panomics (Fremont, CA). Anti-Sp-1 antibody was from Upstate Cell Signaling Solutions (LakePlacid, NY) = The human promonocytic cell line THP-1 was from American Type Culture Collection, Rockville, MD = Cell culture medium: RPMI 1640 medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum(FBS), penicillin (100 units/ml) and streptomycin (100 g/ml).  = 1 , 25-dihydroxyvitamin D 3 (calcitriol) was obtained from Calbiochem (San Diego, CA). Methods: Nuclear extract: = Nuclear fractions were prepared based on a protocol from the Skirball Institute of Biomolecular Medicine,NYU Medical Center with minor modifications (6). Non-denaturing PAGE:= Prepare 5% non-denaturing polyacrylamide gels in Tris-borate/EDTA buffer (0.1  M Tris,  0.09 M boric acidcontaining 1mM EDTA) and store at 4°C. = Mix 5-10 g of nuclear extracts from treated and control cells with relevant oligos and poly (dI-dC) (1 g/ l) in  Moeenrezakhanlou et al. – Identification of a Calcitriol-Regulated Sp-1 Sitewww.biologicalprocedures.com35binding buffer (20 mM HEPES pH 7.9, 1 mM DTT, 0.1 mM EDTA, 50 mM KCl, 5% glycerol and 200 g/mlBSA). = Add loading buffer to the above mixture to fractionate samples on gel at 4°C for 2-3 hrs using 100V. Western blotting:= Transfer  PAGE separated proteins  onto  nitrocellulose  membrane  using  Western  blotting  semi-dry  transferapparatus. = Block the membrane and probe with anti-Sp-1-antibody as per the manufacturer’s instructions (Upstate CellSignaling Solutions). = Develop with ECL system.Moeenrezakhanlou et al. – Identification of a Calcitriol-Regulated Sp-1 Site www.biologicalprocedures.com

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0167826/manifest

Comment

Related Items