UBC Faculty Research and Publications

Selection of reference genes for gene expression studies in human neutrophils by real-time PCR Zhang, Xiaozhu; Ding, Lily; Sandford, Andrew J Feb 18, 2005

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-12867_2004_Article_71.pdf [ 460.37kB ]
Metadata
JSON: 52383-1.0135715.json
JSON-LD: 52383-1.0135715-ld.json
RDF/XML (Pretty): 52383-1.0135715-rdf.xml
RDF/JSON: 52383-1.0135715-rdf.json
Turtle: 52383-1.0135715-turtle.txt
N-Triples: 52383-1.0135715-rdf-ntriples.txt
Original Record: 52383-1.0135715-source.json
Full Text
52383-1.0135715-fulltext.txt
Citation
52383-1.0135715.ris

Full Text

ralssBioMed CentBMC Molecular BiologyOpen AcceResearch articleSelection of reference genes for gene expression studies in human neutrophils by real-time PCRXiaozhu Zhang, Lily Ding and Andrew J Sandford*Address: The James Hogg iCAPTURE Centre for Cardiovascular and Pulmonary Research, St. Paul's Hospital, University of British Columbia, Vancouver, CanadaEmail: Xiaozhu Zhang - xzhang@mrl.ubc.ca; Lily Ding - dinglily@hotmail.com; Andrew J Sandford* - asandford@mrl.ubc.ca* Corresponding author    AbstractBackground: Reference genes, which are often referred to housekeeping genes, are frequentlyused to normalize mRNA levels between different samples. However the expression level of thesegenes may vary among tissues or cells, and may change under certain circumstances. Thus theselection of reference gene(s) is critical for gene expression studies. For this purpose, 10 commonlyused housekeeping genes were investigated in isolated human neutrophils.Results: Initial screening of the expression pattern demonstrated that 3 of the 10 genes wereexpressed at very low levels in neutrophils and were excluded from further analysis. The range ofexpression stability of the other 7 genes was (from most stable to least stable): GNB2L1 (Guaninenucleotide binding protein, beta polypeptide 2-like 1), HPRT1 (Hypoxanthine phosphoribosyltransferase 1), RPL32 (ribosomal protein L32), ACTB (beta-actin), B2M (beta-2-microglobulin),GAPD (glyceraldehyde-3-phosphate dehydrogenase) and TBP (TATA-binding protein). Relativeexpression levels of the genes (from high to low) were: B2M, ACTB, GAPD, RPL32, GNB2L1, TBP,and HPRT1.Conclusion: Our data suggest that GNB2L1, HPRT1, RPL32, ACTB, and B2M may be suitablereference genes in gene expression studies of neutrophils.BackgroundNeutrophils are the most numerous granulocytes in bloodand are responsible for the first line of host defence. How-ever, neutrophils have frequently been implicated in thepathogenesis of many diseases because they can producevarious cytokines, chemokines and other proinflamma-tory mediators [1,2]. Numerous studies have been per-formed on the mechanisms that regulate the bioactivity ofneutrophils. Understanding patterns of expressed genesmay provide insight into complex regulatory networkscation methods for gene expression analysis. Similar toother methods used in expression studies, data from sam-ples are usually required to be normalized against a set ofdata or references to correct for the difference in theamount of starting materials. The genes used as referencesare often referred to as housekeeping genes, assuming thatthose genes are constitutively expressed in certain tissuesand under certain circumstances. However, the literatureshows that the expression levels of the so called "house-keeping genes" may vary in different tissues, different cellPublished: 18 February 2005BMC Molecular Biology 2005, 6:4 doi:10.1186/1471-2199-6-4Received: 05 July 2004Accepted: 18 February 2005This article is available from: http://www.biomedcentral.com/1471-2199/6/4© 2005 Zhang et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 7(page number not for citation purposes)and help to identify genes implicated in diseases. Quanti-tative real time PCR is one of the most powerful quantifi-types, and different disease stages [3-6]. Therefore, theBMC Molecular Biology 2005, 6:4 http://www.biomedcentral.com/1471-2199/6/4selection of the reference genes is critical for the interpre-tation of the expression data.In this study, we investigated 10 commonly used house-keeping genes (Table 1), and found 5 genes could be pref-erential reference genes for gene expression studies inhuman neutrophils.ResultsRNA quality and quantityRNA analysis by an Agilent 2100 Bioanalyzer provided thesize profiles and the concentration of the samples. All theRNA samples used in this study were of good qualitydespite the long neutrophil isolation procedure. IntactrRNA subunits of 28S and 18S were observed on both thegel electrophoresis and electrophotogram, indicating thatthe degradation of the RNA was minimal (Figure 1).Expression patterns of the candidate genes in neutrophilsInitial screening for the gene expression pattern suggestedthat the 10 candidate housekeeping genes were differen-tially expressed in neutrophils (data not shown). Based onthe band intensity of the PCR products, the two lowestexpressed genes, two medium expressed genes and thethree highest expressed genes were chosen for real-timePCR analysis. ABL1, PBGD and TUBB were excluded fromfurther evaluation due to their extremely low expressionStandard curve and real-time PCRStandard curves were generated by using copy number vs.the threshold cycle (Ct). The linear correlation coefficient(R2) of all the seven genes ranged from 0.976 to 0.999.Based on the slopes of the standard curves, theamplification efficiencies of the standards were from91%~100%, which were derived from the formula E = 101/-slope -1. The Ct values of all the 7 genes in all theunknown samples were within 15.9 to 33.5 cycles, cov-ered by the range of the standard curves. Electrophoresisanalysis of all the amplified products from real-time PCRshowed a single band with the expected sizes, and noprimer dimer was observed. The dissociation plots pro-vided by the ABI Prism 7900HT also indicated a singlepeak in all the reactions.The stability and expression level of reference genes in the neutrophilsThe gene expression levels were measured by real-timePCR, and the expression stabilities were evaluated by theM value of GeNorm. The ranking of the expression stabil-ity in these genes was (from the most stable to the leaststable): GNB2L1, HPRT1, RPL32, ACTB, B2M, GAPD andTBP (Figure 2). The M values of GNB2L1, HPRT1, RPL32,ACTB, and B2M were lower than 0.5, and therefore thesegenes were concluded to be stably expressed housekeep-ing genes in neutrophils.Table 1: 10 selected candidate housekeeping genesGene symbol Gene Name Accession Number Function Gene synonymsmRNA genomic DNAABL1 Abelson murine leukemia viral oncogene homologNM_007313 NT_035014 Cytoplasmic and nuclear protein tyrosine kinaseABL, JTK7, p150, c-ABL, v-ablACTB Beta-actin NM_001101 NT_007819 Cytoskeletal structural proteinB2M Bata-2-microglobulin NM_004048 NT_030828 Cytoskeletal protein involved in cell locomotionGAPD Glyceraldehyde-3-phosphate dehydrogenaseNM_002046 NT_009759 Glycolytic enzyme G3PD, GAPDHGNB2L1 Guanine nucleotide binding protein, β-peptide 2-like 1NM_006098 NT_077451 Involved in binding and anchorage of protein kinase CH12.3, RACK1, Gnb2-rs1HPRT1 Hypoxanthine phosphoribosyltransferase 1NM_000194 NT_011786 Constitutively expressed at low levels, involved in the metabolic salvage of purines in mammals.HPRT, HGPRTPBGD Porphobilinogen deaminase NM_000190 NT_033899 Deficiency of porphobilinogen deaminase results in acute intermittent porphyriaHMBS, AIP, UPSRPL32 Ribosomal protein L32 NM_000994 NT_005927 Member of the 80 different ribosome proteinsTBP TATA-binding protein NM_003194 NT_007583 Involved in the activation of basal transcription from class II promoterGTF2D, SCA17, TFIID, GTF2D1TUBB Beta-tubulin NM_001069 NT_034880 Member of the tubulin family of structural proteinsPage 2 of 7(page number not for citation purposes)level.BMC Molecular Biology 2005, 6:4 http://www.biomedcentral.com/1471-2199/6/4A normalization factor (NF) was calculated based on thegeometric mean of the copy numbers of these 5 selectedreference genes in each sample. After normalizationagainst the NF, the ranking of the relative expression levelswas (from high to low): B2M, ACTB, GAPD, RPL32,GNB2L1, TBP, and HPRT1 (Figure 3).Based on both the expression stability and expressionlevel, our data suggested that B2M and ACTB can be usedas a reference gene for high abundance gene transcripts,RPL32 and GNB2L1 for medium abundance transcripts,and HPRT1 for low abundance transcripts in gene expres-sion studies.DiscussionReal-time PCR is one of the most sensitive and flexiblequantification methods for gene expression analysis. Itprovides simultaneous measurement of gene expressionin many different samples for a number of genes. How-ever, many factors in real-time PCR may affect the results,including the selection of the reference genes. An ideal ref-erence gene should be expressed at a constant level amongdifferent tissues of an organism, at all stages of develop-ment, and should be unaffected by the experimental treat-ment. However, no one single gene is expressed at such aused reference genes, but a number of studies have pro-vided solid evidence that their transcription levels varysignificantly between different individuals, different celltypes, different developmental stages, and differentexperimental conditions [3-6]. Therefore, thorough vali-dation of candidate reference genes is critical for accurateanalysis of gene expression.It is also well known that RNA quality and quantity arecritical for successful gene expression analysis. Degradedand inaccurately quantified RNA would give misleadingresults. In this study, the total RNA was extracted from iso-lated human neutrophils, and usually it takes 2–3 hoursfrom drawing the blood to obtaining the pure neu-trophils. RNA degradation is frequently observed. For thisreason we performed careful RNA analysis by using anAgilent 2100 Bioanalyzer (Agilent Technologies) beforethe gene expression study. The results indicated our RNAsamples were of good quality. Other quantification meth-ods which need a microgram-level of RNA were not prac-tical for our study because the amount of RNA extractedfrom the neutrophils from 10 ml blood was very limited(around 3–5 µg).DNA contamination is another important factor thatThe results of RNA analysis by Agilent bioanalyzerFigu e 1The results of RNA analysis by Agilent bioanalyzer. The first peak is a 20 bp molecular marker. The second and the third peaks are 18S and 28S rRNA.Page 3 of 7(page number not for citation purposes)constant level in all these situations [4,7]. For example,ACTB, GAPD, 18S and 28S rRNA are the most commonlyaffects the accuracy of gene expression analysis. In thisstudy, the following steps were taken to prevent and mon-BMC Molecular Biology 2005, 6:4 http://www.biomedcentral.com/1471-2199/6/4itor DNA contamination: (1) RNase-free DNase I treat-ment on all the RNA samples; (2) The primers weredesigned to be able to distinguish the PCR productderived from mRNA or genomic DNA (Table 2); (3) Dis-sociation analysis by ABI Prism 7900HT; (4) Gel electro-phoresis of all the amplified PCR products. With all theseprecautions in place we were confident that there was nodetectable DNA contamination. The signal from SYBR Iwas specifically from the desired amplicons, not fromartefacts (primer dimers or genomic DNAcontamination).For the reasons discussed above, we have confidence thatour gene expression results were accurate and reliable, andwe further analyzed the expression stability and expres-sion level. The principle that the expression ratio of twoideal reference genes should be identical in all samples iswell established. Based on this principle we foundGNB2L1, HPRT1, RPL32, ACTB, and B2M were stablyexpressed in the neutrophils, and they were used for theexpressed, followed by ACTB, RPL32, GNB2L1, andHPRT1 was the lowest expressed. As the expression levelof the reference genes may be an additional factor for con-sideration in the process of reference gene selection, thisranking of the relative expression level of the candidatereference genes may be informative for future gene expres-sion studies in neutrophils.ConclusionTo our knowledge, this is the first detailed study of the sta-bility and level of reference gene expression in neu-trophils. We found GNB2L1, HPRT1, RPL32, ACTB, andB2M are good choices for reference gene(s) selection. B2Mand ACTB can be used for high-abundance mRNA, RPL32and GNB2L1 for medium-abundance mRNA, and HPRT1for low-abundance mRNA in expression studies of neu-trophils. For more accurate normalization, as suggested byother authors [8], we recommend a combination of thestably expressed genes GNB2L1, HPRT1, RPL32, ACTB,and B2M as a panel of reference genes for theGene expression stability of seven candidate reference genes in the neutrophil analyzed by the geNorm programFigur  2Gene expression stability of seven candidate reference genes in the neutrophil analyzed by the geNorm program. The thresh-old for eliminating a gene as unstable was M ≥ 0.5.Page 4 of 7(page number not for citation purposes)calculation of a normalization factor (NF). Afternormalization we found B2M was the most highlynormalization.BMC Molecular Biology 2005, 6:4 http://www.biomedcentral.com/1471-2199/6/4MethodsCandidate genes for expression studiesTen housekeeping genes were selected from commonlyused reference genes (ABL1, ACTB, B2M, GAPD, GNB2L1,HRPT1, PBGD, RPL32, TBP, and TUBB). Gene symbolsand their full names, gene accession numbers as well asfunctions are listed in Table 1. These genes were chosenbecause they have different functions in order to avoidgenes belonging to the same biological pathways that maybe co-regulated. In selecting the genes to be analyzed,preference was given to pseudogene-free genes in theNCBI linked database (Table 1). All the primers weredesigned by the software, Primer 3, http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi.Hairpin structure and primer dimerization were analyzedby NetPrimer. Primers spanning at least one intron werechosen to minimize inaccuracies due to genomic DNAexpected PCR products range from 114 bp to 318 bp. Ifthe genes have pseudogenes, primers were chosen accord-ing to the alignment results between the genes and thepseudogenes, so that the primers were unique to the genesand different from the pseudogenes (Table 2).Subjects and sample preparationA total of 15 volunteers were recruited (Table 3). All par-ticipants signed an informed consent document. 20 ml ofperipheral blood was taken into heparinized tubes. Neu-trophil isolation was performed by a Dextran-Ficoll sedi-mentation and centrifugation method [9]. Briefly, 20 mlblood was mixed with 5% Dextran (100,000–20,000 kDa; Sigma) in RPMI (9:2). After 40 min sedimentation,the white blood cell rich plasma was transferred onto thetop of 10 ml Ficoll (Pharmacia), and centrifuged at 2500rpm for 15 min. The cell pellet contained the neutrophils.The relative expression level normalized against Normalization Factors from the 5 most stable genes (HPRT1, GNB2L1, RPL32, ACTB, and B2M) provided by geNormFigu e 3The relative expression level normalized against Normalization Factors from the 5 most stable genes (HPRT1, GNB2L1, RPL32, ACTB, and B2M) provided by geNorm. HPRT1 was the lowest expressed gene, and B2M was the highest among the candidate genes in neutrophils.Page 5 of 7(page number not for citation purposes)contamination. The length of the primers was from 18-mer to 22-mer, GC content was from 45% to 60%, and theThe contaminating erythrocytes were removed by hypot-onic lysis. The isolated neutrophils were subject to KimraBMC Molecular Biology 2005, 6:4 http://www.biomedcentral.com/1471-2199/6/4staining and microscopic cell differential count. Thepurity of the neutrophils was calculated. Samples withmore than 2% eosinophils were excluded from the study.Half of the isolated neutrophils were used for RNAisolation.RNA extraction and RT-PCRTotal RNA was isolated using RNeasy Mini Kit (Qiagen) asdescribed by the manufacturer. Genomic DNA was elimi-nated by RNase-free DNase I digestion (Qiagen) duringthe isolation procedure. Isolated total RNA was analyzedon an Agilent 2100 Bioanalyzer using the RNA 6000 picolabchip Kit (Agilent Technologies). First strand cDNA syn-thesis was carried out with SuperScript RNase H- ReverseTranscriptase (Invitrogen) and random primers (Invitro-gen) in a total volume of 20 µl. Reverse transcription wasperformed at 37°C for 1 hour followed by 72°C for 15Amplification of gene transcriptsTo screen the basal expression patterns of the candidategenes in neutrophils, three randomly selected sampleswere tested by PCR with the ten primer pairs (Table 2).The expression study was performed using a 384 wellplate on an ABI Prism 7900HT Sequence Detection Sys-tem (Applied Biosystems) with QuantiTect SYBR GreenPCR Kit (Qiagen). The reactions were performed accord-ing to the manufacturer's instructions with minor modifi-cations. The PCR program was initiated at 95°C for 10min to activate Taq DNA polymerase, followed by 45 ther-mal cycles of 15 seconds at 94°C, 30 seconds at 58°C and30 seconds at 72°C. Size analysis of the PCR products(dissociation analysis or meting curve analysis) was per-formed immediately after the real-time PCR. The temper-ature range used for the melting curve generation wasTable 2: Primers for Real-Time PCRGene symbol Length Position in cDNA Sequence (5'-3')ABL1 20 Exon 7 1217-1236 TGACAGGGGACACCTACACA20 Exon 9 1535-1516 TCAAAGGCTTGGTGGATTTCACTB 20 Exon 2 210-229 CATCGAGCACGGCATCGTCA21 Exon 3 420-400 TAGCACAGCCTGGATAGCAACB2M 19 Exon 2 268-287 ACTGAATTCACCCCCACTGA20 Exon 4 381-362 CCTCCATGATGCTGCTTACAGAPD 20 Exon 7 728-747 TGGACCTGACCTGCCGTCTA22 Exon 8 970-948 CCCTGTTGCTGTAGCCAAATTCGNB2L1 20 Exon 3 327-346 GAGTGTGGCCTTCTCCTCTG20 Exon 5 550-531 GCTTGCAGTTAGCCAGGTTCHRPT1 20 Exon 4 322-341 GACCAGTCAACAGGGGACAT22 Exon 7 516-495 AACACTTCGTGGGGTCCTTTTCPBGD 18 Exon 11-12 764-781 AGGATGGGCAACTGTACC20 Exon 13 995-976 GTTTTGGCTCCTTTGCTCAGRPL32 19 Exon 1/2 33-51 CATCTCCTTCTCGGCATCA20 Exon 3 185-166 AACCCTGTTGTCAATGCCTCTBP 20 Exon 4 623-642 GAACCACGGCACTGATTTTC20 Exon 5 780-761 CCCCACCATGTTCTGAATCTTUBB 20 Exon 3 240-259 CTTCGGCCAGATCTTCAGAC20 Exon 4 416-397 AGAGAGTGGGTCAGCTGGAATable 3: Characteristics of the study subjectsNo. Gender (F/M) Age DiagnosisAllergy Asthma HealthyAsian 6 4/2 33 ± 3 3 - 3Caucasian 9 3/6 33 ± 9 3 2 4Page 6 of 7(page number not for citation purposes)min. from 60°C to 95°C. Each sample was analyzed in tripli-cate wells. In addition, all the reactions were further sub-Publish with BioMed Central   and  every scientist can read your work free of charge"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."Sir Paul Nurse, Cancer Research UKYour research papers will be:available free of charge to the entire biomedical communitypeer reviewed and published immediately upon acceptancecited in PubMed and archived on PubMed Central BMC Molecular Biology 2005, 6:4 http://www.biomedcentral.com/1471-2199/6/4ject to electrophoresis on 2.5% agarose gels stained withethidium bromide to confirm the expected PCR products.Standard curvesThe amplified fragments from each primer pair were puri-fied with QIAquick PCR purification Kit (Qiagen), andconfirmed by DNA sequencing (University of BritishColumbia, NAPS Unit). The concentrations of the PCRproducts were quantified by a spectrophotometer (Perkin-Elmer Lambda 2 UV/VIS Spectrometer), which were fur-ther transformed to copy numbers based on the lengthand base composition of the PCR products. A ten-foldseries dilution was made and 10 to 1,000,000 copies wereused for generating standard curves in the real-time PCR,plotted as Ct values (cycle numbers of threshold or cross-ing points) versus logarithms of the given concentrationsof the DNA templates.Determination of Gene stability and expression levels in human neutrophilsGene stability was also evaluated using the geNorm soft-ware program http://www.wzw.tum.de/gene-quantification/[8]. Briefly, this approach relies on the principle thatthe expression ratio of two perfect reference genes wouldbe identical in all samples in all experimental conditionsor cell types. Variation in the expression ratios betweendifferent samples reflects the fact that one or both of thegenes are not stably expressed. Therefore, increasing vari-ation in this ratio corresponds to decreasing expressionstability. The geNorm program can be used to calculatethe gene expression stability measure (M), which is themean pair-wise variation for a gene compared with allother tested control genes. Genes with higher M valueshave greater variation in expression. The stepwise exclu-sion of the gene with the highest M value allows the rank-ing of the tested genes according to their expressionstability. The proposed threshold for eliminating a gene asunstable was M ≥ 0.5. In the final analysis, genes with Mvalue lower than 0.5 were considered as stably expressedgenes, and were used for normalization factor (NF) calcu-lation. Using the NF we calculated and ranked the expres-sion level of all the seven genes in our samples.AbbreviationsACTB, beta-actin; ALB1, Abelson murine leukemia viraloncogene homolog 1; B2M, beta-2-microglobulin; cDNA,complementary DNA; GAPDH, glyceraldehyde-3-phos-phate dehydrogenase; GNB2L1 (Guanine nucleotidebinding protein, beta polypeptide 2-like 1; HPRT1,Hypoxanthine phosphoribosyltransferase 1; NCBI,National Center for Biotechnology Information; PCR,polymerase chain reactions; PBGD, porphobilinogendeaminase; RPL32, ribosomal protein L32; RT-PCR,Authors' contributionsXZ performed all the experimental procedures and wasthe primary author of the manuscript. LD participated inthe study design and data analysis. AS conceived of thestudy, participated in the study design and coordination.All authors read and approved the final manuscript.AcknowledgementsThis work was supported by grants from the British Columbia Lung Asso-ciation and the American Thoracic Society. AJS is the recipient of a Canada Research Chair in genetics. The authors would like to thank Drs. Peter Paré and James Hogg for their expert reviews of the manuscript.References1. Cassatella MA: The production of cytokines by polymorphonu-clear neutrophils. Immunol Today 1995, 16:21-26.2. Cassatella MA: Neutrophil-derived proteins: selling cytokinesby the pound. Adv Immunol 1999, 73:369-509.3. Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M: Compari-son of human adult and fetal expression and identification of535 housekeeping/maintenance genes. Physiol Genomics 2000,2:143-147.4. Thellin O, Zorzi W, Lakaye B, De Borman B, Coumans B, Hennen G,Grisar T, Igout A, Heinen E: Housekeeping genes as internalstandards: use and limits. J Biotechnol 1999, 75:291-295.5. Bustin SA: Absolute quantification of mRNA using real-timereverse transcription polymerase chain reaction assays. J MolEndocrinol 2000, 25:169-193.6. Suzuki T, Higgins PJ, Crawford DR: Control selection for RNAquantitation. Biotechniques 2000, 29:332-337.7. Haberhausen G, Pinsl J, Kuhn CC, Markert-Hahn C: Comparativestudy of different standardization concepts in quantitativecompetitive reverse transcription-PCR assays. J Clin Microbiol1998, 36:628-633.8. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, DePaepe A, Speleman F: Accurate normalization of real-timequantitative RT-PCR data by geometric averaging of multi-ple internal control genes. Genome Biol 2002, 3:RESEARCH0034.9. Le Cabec V, Maridonneau-Parini I: Annexin 3 is associated withcytoplasmic granules in neutrophils and monocytes andtranslocates to the plasma membrane in activated cells. Bio-chem J 1994, 303 ( Pt 2):481-487.yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralPage 7 of 7(page number not for citation purposes)reverse transcription-polymerase chain reactions; TBP,TATA-binding protein; TUBB, beta-tubulin

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0135715/manifest

Comment

Related Items