UBC Faculty Research and Publications

Tumor necrosis factor-inducible gene 6 promotes liver regeneration in mice with acute liver injury Wang, Sihyung; Lee, Ji-Seon; Hyun, Jeongeun; Kim, Jieun; Kim, Seung U; Cha, Hyuk-Jin; Jung, Youngmi Mar 11, 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52383-13287_2015_Article_19.pdf [ 2.08MB ]
Metadata
JSON: 52383-1.0132601.json
JSON-LD: 52383-1.0132601-ld.json
RDF/XML (Pretty): 52383-1.0132601-rdf.xml
RDF/JSON: 52383-1.0132601-rdf.json
Turtle: 52383-1.0132601-turtle.txt
N-Triples: 52383-1.0132601-rdf-ntriples.txt
Original Record: 52383-1.0132601-source.json
Full Text
52383-1.0132601-fulltext.txt
Citation
52383-1.0132601.ris

Full Text

RESEARCHTumor necrosis factor-ind1inatavailable organs from donors is vastly insufficient for the patients who suffer from various hepatic diseases [2].Wang et al. Stem Cell Research & Therapy  (2015) 6:20 DOI 10.1186/s13287-015-0019-zshown to contribute to liver regeneration by secreting63-2 Pusandaehak-ro, Kumjeong-gu, Pusan 609-735, KoreaFull list of author information is available at the end of the articlenumber of patients requiring such procedures. Even iftransplant patients receive a whole liver transplantation,several post-transplant complications may arise, such asimmune rejection response and death of the donor orMesenchymal stem cells (MSCs) found in most adult andpostnatal organs are capable of self-renewing and differenti-ating into several lineages of cells, including hepatocytes[3,4]. This differentiation potential of MSCs into hepato-cytes provides new and promising therapeutics for patientswith liver disease. These therapeutic effects of MSCs in thetreatment of liver disease have been reported both in ani-mal and clinical studies [5]. In those studies, MSCs were* Correspondence: hjcha@sogang.ac.kr; y.jung@pusan.ac.kr3Department of Life Science, Sogang University, Seoul 121-742, Korea1Department of Intergrated Biological Science, Pusan National University,however, the hepatoprotective potential of TSG-6 remains unclear. We investigated whether TSG-6 promoted liverregeneration in acute liver failure.Methods: The immortalized hMSC (B10) constitutively over-expressing TSG-6 or empty plasmid (NC: Negative Control) wereestablished, and either TSG-6 or NC-conditioned medium (CM) was intraperitoneally injected into mice with acute liverdamage caused by CCl4. Mice were sacrificed at 3 days post-CM treatment.Results: Higher expression and the immunosuppressive activity of TSG-6 were observed in CM from TSG-6-hMSC. Theobvious histomorphological liver injury and increased level of liver enzymes were shown in CCl4-treated mice with orwithout NC-CM, whereas those observations were markedly ameliorated in TSG-6-CM-treated mice with CCl4. Ki67-positivehepatocytic cells were accumulated in the liver of the CCl4 + TSG-6 group. RNA analysis showed the decrease in both ofinflammation markers, tnfα, il-1β, cxcl1 and cxcl2, and fibrotic markers, tgf-β1, α-sma and collagen α1, in the CCl4 + TSG-6group, compared to the CCl4 or the CCl4 + NC group. Protein analysis confirmed the lower expression of TGF-β1 andα-SMA in the CCl4 + TSG-6 than the CCl4 or the CCl4 + NC group. Immunostaining for α-SMA also revealed theaccumulation of the activated hepatic stellate cells in the livers of mice in the CCl4 and CCl4 + NC groups, but not in thelivers of mice from the CCl4 + TSG-6 group. The cultured LX2 cells, human hepatic stellate cell line, in TSG-6-CM showedthe reduced expression of fibrotic markers, tgf-β1, vimentin and collagen α1, whereas the addition of the TSG-6 antibodyneutralized the inhibitory effect of TSG-6 on the activation of LX2 cells. In addition, cytoplasmic lipid drops, the marker ofinactivated hepatic stellate cell, were detected in TSG-6-CM-cultured LX2 cells, only. The suppressed TSG-6 activity by TSG-6antibody attenuated the restoration process in livers of TSG-6-CM-treated mice with CCl4.Conclusions: These results demonstrated that TSG-6 contributed to the liver regeneration by suppressing the activation ofhepatic stellate cells in CCl4-treated mice, suggesting the therapeutic potential of TSG-6 for acute liver failure.IntroductionAcute liver failure and chronic liver disease are life-threatening diseases for which liver transplantation isthe only permanent remedy. However, the number ofrecipient in worst-case scenarios [1]. Therefore, exten-sive studies are being conducted to develop new treat-ments for liver diseases, and stem cell based therapy hasbeen suggested as an alternative treatment strategy forliver regeneration in miceSihyung Wang1, Ji-Seon Lee3, Jeongeun Hyun1, Jieun KimAbstractIntroduction: Tumor necrosis factor-inducible gene 6 protemesenchymal stem/stromal cells (hMSC), has an anti-inflamm© 2015 Wang et al.; licensee BioMed Central.Commons Attribution License (http://creativecreproduction in any medium, provided the orDedication waiver (http://creativecommons.orunless otherwise stated.Open Accessucible gene 6 promoteswith acute liver injury, Seung U Kim4, Hyuk-Jin Cha3* and Youngmi Jung1,2*(TSG-6), one of the cytokines released by humanory effect and alleviates several pathological conditions;This is an Open Access article distributed under the terms of the Creativeommons.org/licenses/by/4.0), which permits unrestricted use, distribution, andiginal work is properly credited. The Creative Commons Public Domaing/publicdomain/zero/1.0/) applies to the data made available in this article,Wang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 2 of 14tropic and immunomodulatory molecules [6,7]. However,there are still a number of technical limitations or possibleundesirable side effects associated with the therapeutic ap-plication of MSCs to patients with end-stage liver diseases[8]. In particular, engrafted MSCs can differentiate into notonly hepatocytes but also myofibroblasts, a main source ofcollagen fiber in a fibrotic liver, depending on the timeframeof differentiation and route of MSC injection [9]. Hence,further characterization of MSCs may be critical for ensur-ing the safety of MSC-based cell therapy. The beneficialeffect of MSC transplantation is based on autologoustransplantation. However, it is difficult to try MSC trans-plantation with patients with end-stage liver disease [9].Although allogeneic stem cell transplantation might bemore effective for these patients, it also brings several ob-stacles, such as immune rejection or engraftment of virus-carrying MSCs [1]. The paracrine effect, which resultsfrom biologically active soluble factors secreted from hu-man MSCs (hMSCs), such as angiopoietin-1, interleukin-10, keratinocyte growth factor, and so on, has been shownto be therapeutically valid in both animal and clinicalstudies [10,11]. Since many kinds of tropic and immuno-modulatory factors secreted from MSCs are also known tocreate a favorable micro-environment for liver regener-ation [9], it is necessary to identify and characterize suchbiologically active soluble factors.Tumor necrosis factor-inducible gene 6 protein (TSG-6),a 35 kDa glycoprotein [12], was identified as an inflamma-tory factor as its expression increased in response to in-flammatory mediators [13]. However, upregulated TSG-6during the inflammatory process has been shown to con-tribute to modulate the inflammatory response in adverse[13]. Recent studies demonstrate that TSG-6 is identifiedas an important immune modulator secreted from hMSCsand shown to be responsible for hMSCs’ therapeutic ef-fects, such as improvement of cardiac function, peritonitisand wound healing [14]. However, these associations ofTSG-6 with response in the liver are unknown.Liver inflammation occurs in response to damage [15].Liver injuries stimulate the repair response, such as prolif-eration of hepatocytes and inflammation, and a successfulrepair response reconstitutes a functional liver [16]. How-ever, continued damage perpetuates injury and promotesprogressive fibrogenesis [16]. Liver inflammation also ac-celerates fibrosis [17]. Several inflammatory factors, suchas tumor necrosis factor (TNF-α) and interleukin (Il) -1β,and Il-6, secreted by inflammatory cells are involved inthe recruitment of circulating macrophages into the liverand the transition of hepatic stellate cells into myofibro-blasts [18]. This progressive fibrogenesis ends with deathfrom cirrhosis and/or liver cancer [19]. Thus, the modula-tion of liver inflammation in this setting is a key target forreducing fibrosis. For this reason, we hypothesized thatTSG-6 could influence liver regeneration by reducinginflammation and fibrosis because TSG-6 exerts an anti-inflammatory effect. To prove our hypothesis, we madeimmortalized hMSCs stably expressing TSG-6. Due toconstant secretion of TSG-6 from hMSCs in the condi-tioned medium (CM), TSG-6-rich CM could be readilyapplied to mice with acute liver injury caused by CCl4.Our results showed that TSG-6 promoted liver regener-ation by decreasing fibrosis.MethodsGeneration of hMSCs stably expressing TSG-6We sub-cloned P/I-TSG-6 (kindly provided by Dr. Tae-Hee Lee in Yonsei Univ.) into a CSII-EF-MCS vector.hMSCs stably expressing TSG-6, were generated as pre-viously reported [20]. In detail, each viral plasmid (3 μg)(CSII-EF-MCS and CSII-EF-TSG-6) was transfected into293FT cells with pLP1, pLP2, pLP/VSVG, using lipofec-tamine 2000 (cat. #11668-027, Life Technologies, Inc.Grand Island, NY, USA). After 48 hours, the culturemedia containing the lenti-viruses were collected fromthe transfected 293FT cells. Virus medium was filtered(0.45 μm filter, EMD Millipore, Billerica, MA, USA) andthen treated to hMSCs for an additional 24 hours in thepresence of 4 μg/ml of polybrene (Sigma–Aldrich, St.Louis, MO, USA). B10-hMSCs were maintained as de-scribed previously [21].Preparation of conditioned mediaFor preparation of CM, cells were seeded at more than90% confluence. The next day, cells were washed withPBS twice, changed to 0.2% fetal bovine serum (FBS)-containing media and incubated for another three days.CM were further concentrated with YM-10 (Millipore,Cat. No. 4205).Immune suppression assaySplenocytes, 1.5 × 106 per well (24-well) (freshly isolatedfrom C57BL6 female mice as described previously [22]),were cultured with or without CM supplement for threedays. To stimulate T cells, 1 μg/ml of anti-CD3ε (2C11)(BD Pharmingen, San Jose, CA, USA) was added. Cellswere fluorescence labeled with carboxyfluorescein succini-midyl ester (CFSE) and then proliferation after activationwas determined by flow cytometry (BD, FACS Calibur™).Animal studiesSix-week old male C57BL6 mice were purchased fromHyochang (Dae-gu, Korea), fed with a normal diet, watered,and housed with a 12 hour light-dark cycle. In vivo experi-ments were performed as previously described. Mice wereseven weeks of age and weighed an average of 21 g at thestart of the experiments. To induce acute liver injury, micereceived CCl4 (1.0 mg/kg body weight) (n = 15) intraperito-neally twice for one week as previously described [23]. Ascontrols, animals received the same volume of corn oil ve-hicle (CTRL) (n = 4) intraperitoneally. Those mice werethen injected i.p. with 0.5 ml CM from TSG-6 overexpress-ing MSCs (TSG-6) (n = 6), or empty plasmid-carryingMSCs (NC; negative control) (n = 5) at day 8, and sacrificedat day 3 following the medium treatment (Figure 1A). Toexamine the specificity of TSG-6 for liver, TSG-6-CM wasincubated with TSG-6 antibody (10 μg/ml) (Santa CruzBiotechnology, Santa Cruz, CA, USA) or control immuno-globulin G (IgG) (10 μg/ml) (Sigma-Aldrich) for one hourat room temperature, and 0.5 ml of these CMs was injectedinto CCl4-treated mice (TSG-6-CM+TSG-6 antibodygroup: n = 5/ TSG-6-CM+ IgG group: n = 5) (Figure 1B).Ki67, Novocastra, Leica Microsystems, Newcastle, UponTyne, UK), pancytokeratin (PanCK) (Z0622; Dako), Sox9(AB5535; Millipore), or α-Sma (ab5694; Abcam, Cambridge,Massachusetts, USA), at 4°C overnight. Other sections werealso incubated at 4°C overnight in non-immune sera todemonstrate staining specificity. Polymer horseradish per-oxidase (HRP) anti-rabbit (K 4003; Dako) or anti-mouse(K 4001; Dako) was used as secondary antinody. 3,3′-Diaminobenzidine (DAB) was employed in the detectionprocedure.Cell countingTo quantify the number of Ki67-positive cells, 10 centraljeereWang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 3 of 14Animal care and surgical procedures were approved bythe Pusan National University Institutional Animal Careand Use Committee and carried out in accordance withthe provisions of the National Institutes of Health Guidefor the Care and Use of Laboratory Animals.Measurement of AST/ALTSerum aspartate aminotransferase (AST) and alanine ami-notransferase (ALT) were measured using Chemi LabGOT/GPT (IVD Lab Co., Korea) according to the manu-facturer’s instructions.Liver histology and immunohistochemistryLiver specimens were fixed in 10% neutral buffered forma-lin, embedded in paraffin and cut into 4 μm sections. Speci-mens were dewaxed, hydrated, and stained in the usualmanner with standard hematoxylin and eosin (H & E) toexamine morphology. For immunohistochemistry (IHC),sections were incubated for 10 minutes in 3% hydrogenperoxide to block endogenous peroxidase. Antigen retrievalwas performed by heating in 10 mM sodium citrate buffer(pH 6.0) or incubating with pepsin for 10 minutes. Afterwashing with TBS, sections were treated with Dako proteinblock (X9090; Dako Envision, Carpinteria, CA) for 30 mi-nutes and incubated with primary antibody Ki67 (NCL-Figure 1 Design of mouse experimental model. (A) After being i.p. intreated with NC-CM or TSG-6-CM, one time at eight days. These mice wneutralized TSG-6-CM by TSG-6 antibody or the TSG-6-CM + IgG antibody. TCTRL, control; IgG, immunoglobulin G; i.p., intraperitoneally; NC, negative covein (CV) areas were randomly selected per section at ×40 magnification for each mouse. CV chosen for analysisranged from 90 to 150 μm. The Ki67-positive cells werequantified by counting the total number of Ki67-positivecells per field.Quantitative real-time PCRTotal RNA which had been stored at -80°C was extractedwith TRIZOL™ (Ambion® by Life Technologies). After as-suring RNA quality and concentration, gene expressionwas evaluated by QRT-PCR analysis. mRNAs were quanti-fied by real-time RT-PCR according to the manufacturer’sspecifications (Eppendorf, Mastercycler Real-TIme PCR,Effendorf Korea Ltd., Seoul, Korea). The sequences ofprimers for mice are listed in Table 1. Samples were ana-lyzed in duplicate according to the ΔΔCt method. All PCRproducts were directly sequenced for genetic confirmationin Macrogen Inc (Korea).Western blot assayTotal protein was extracted from freeze-clamped liver tis-sue samples that had been stored at -80°C. Whole tissueswere homogenized in RIPA (78510; Thermo, Rockford, IL)supplemented with protease inhibitors (Complete Mini 11836 153 001; Roche, Indianapolis, IN). Equal amounts ofcted with CCl4 or corn oil (CTRL) twice for one week, mice weresacrificed at 11 days. (B) CCl4-treated mice were injected with thehese mice were also sacrificed at 11 days. CM, conditioned medium;ntrol; TSG-6, tumor necrosis factor-inducible gene 6 protein.ATAAGCCGGCGGTTGGWang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 4 of 14Table 1 Sequences of primers used for QRT-PCRMouseGene Forward sequenceg6pc TCCTCCTCAGCCTATGTCTGCtgf-β1 TTGCCCTCTACAACCAACACα-sma AAACAGGAATACGACGAAGcollagen α1 GAGCGGAGAGTACTGGATCtnf-α TCGTAGCAAACCACCAAGTGil-1β ACTCCTTAGTCCTCGGCCAcxcl1 CCCAAACCGAAGTCATAGCCcxcl2 GCCCAGACAGAAGTCATAG9 s GACTCCGGAACAAACGTGARatGene Forward Sequencetsg-6 AGTGATGCGTCCGTCACAGC9 s GACTCCGGAACAAACGTGAHumanGene Forward sequencetgf-β1 TTGACTGAGTTGCGATAATGvimentin CGAAAACACCCTGCAATCTTcollagen α1 CAGATCACGTCATCGCACAA9 s GACTCCGGAACAAACGTGAtotal protein (120 μg) were fractionated by polyacrylamidegel electrophoresis and transferred to polyvinylidenedifluoride (PVDF) membranes. Primary antibodies againstTGF-β (3711S; Cell Signaling) and α-Sma (A5228-200UL;Sigma-Aldrich) were used in this experiment. Membraneswere developed by chemiluminescence (ATTO Corporation,Tokyo, Japan). The blots that were obtained from three in-dependent experiments were scanned and a region ofinterest (ROI) around the band of interest was defined.Band intensities were calculated by using the CS analyzer2.0 program (ATTO Corporation).Cell experimentsThe human hepatic stellate cell line LX2, a well-characterized cell line derived from human hepatic stel-late cells [24], B10-NC and B10-TSG-6 were cultured ata density of 2 × 106 in Minimum Essential Mediumalpha (MEM α, Gibco, Life Technologies) supplementedwith 10% FBS (Gibco, Life Technologies, Grand Island,NY) and 1X antibiotics at 37°C in a humidified atmos-phere containing 5% CO2. LX2 was a generous gift fromWon-il Jung (Korea Advanced Institute of Science andTechnology). When B10-NC or B10-TSG-6 cells were70% to 80% confluent, CM of these cells were collectedto treat LX2. For biochemical analysis of gene expressionchanges, LX2 at 70% to 80% confluence were starved inmedium containing no FBS for six hours. Activation ofReverse sequenceTC GAGAGAAGAATCCTGGGTCTCCTTGGGCTTGCGACCCACGTAGTACAGGAATGATTTCCAAAGGAGCTTCTTTTCCTTGGGGTTCATATAGCAAATCGGCTGACGTGGTTTCTTGTGACCCTGAGCTCAGAAGCCAGCGTTCACCTTCTCTTTGGTTCTTCCGTTGACTTCATCTTGCCCTCGTCCAReverse SequenceAGATGGCTAAACCGTCCAGCTAAGAT CTTCATCTTGCCCTCGTCCAReverse sequenceGGGAAATTGCTCGACGATGTGAGGTCAGGCTTGGAAACTGTGAGGCCACGCATGAGT CTTCATCTTGCCCTCGTCCALX2 was verified by examining the expression of pro-fibrotic signaling genes at 24 and 48 hours after additionof FBS. Based on the gene expression data, we consid-ered LX2 as fully activated cells at 48 hours (data notshown). Fully activated LX2 was cultured in LX2 cellmedium, B10-NC-CM or TSG-6-CM. In addition, thosecells cultured in TSG-6-CM were treated with TSG-6 anti-body (10 μg/ml) or control IgG (10 μg/ml). These experi-ments were repeated three times [25].Statistical analysisResults are expressed as the mean ± standard deviation(SD). Statistical differences were determined by Student’st-test or one-way analysis of variance (ANOVA) using theSPSS statistics 20, followed by Scheffe’ post hoc test. P-values <0.05 were considered to be statistically significant.ResultsGeneration of TSG-6-overrexpressing MSCsTo investigate the effect of TSG-6 in liver injury, we gener-ate hMSCs stably expressing TSG-6 based on immortalizedfetal bone marrow hMSCs (B10) [21], using a lentivirus de-livery system. The stable expression of TSG-6 in hMSCswas confirmed by a higher expression level of TSG-6 mRNA(Figure 2A) and protein (Figure 2B) in TSG-6-hMSCs. Moreimportantly, a detectable level of TSG-6 protein was alsofound in the CM from TSG-6-hMSCs (Figure 2B, lowerWang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 5 of 14panel). Given that TSG-6, a glycoprotein is processed in theGolgi complex, a distinct signal from the Golgi complex(determined by GM130, a typical Golgi marker) in TSG-6-Figure 2 Production of MSC overexpressing TSG-6. (A) The mRNA level odetermined via real-time PCR. (B) TSG-6 stable transfection to hMSCs was conwas verified by α-tubulin immunoblotting (middle panel). Secretion of TSG-6for TSG-6 (bottom panel). (C) TSG-6 expression in TSG-6-hMSC was validatedwas counterstained as a Golgi complex marker (middle panel, GM130). DAPI wfrom mouse splenocytes were cultured in the presence of CD3 antibody (1 μg/mstaining. CM either from hMSCs (B10) or TSG-6-hMSCs were incubated for three das the control medium. CFSE, carboxyfluorescein succinimidyl ester; CM, conditioactivated cell sorting; hMSCs, human mesenchymal stem cells; MSCs, mesenchymhMSCs was clearly observed (Figure 2C). To examine theimmune-modulatory activity of TSG-6 secreted from TSG-6-hMSCs, splenocytes freshly isolated from the mousef TSG-6 in CSII-EF-MCS- and CSII-EF-TSG-6-expressing hMSC cells wasfirmed by immunoblotting for Wip1 (top panel). Equal protein loadingin hMSCs was confirmed in the conditioned media by immunoblottingby immunostaining with anti-TSG-6 antibody (left panel, TSG-6). GM130as used for nuclear counterstaining (right panel, DAPI). (D) CD4+ T cellsl of α-CD3). T cells proliferation was determined by FACS analysis after CFSEays in the presence of CD3 antibody. Culture medium for hMSCs was usedned medium; DAPI, 4′,6-diamidino-2-phenylindole; FACS, fluorescenceal stem cells; TSG-6, tumor necrosis factor-inducible gene 6 protein.spleen were treated with CM from hMSCs (B10) or TSG-6-hMSCs (TSG-6 B10). While activated CD4+ T cells by CD3antibody underwent active proliferation, proliferation ofCD4+ T cells was markedly reduced following treatmentwith CM from either hMSC or TSG-6-hMSCs, comparedto control medium even after CD3 stimulation. Of interest,CM from TSG-6-hMSCs appeared to be more effective insuppressing Tcell proliferation (Figure 2D).TSG-6 attenuates liver injuryTo examine whether TSG-6 influenced liver regeneration,mice were treated with CCl4 to induce acute liver injuryand i.p. injected with TSG-6-rich CM (TSG-6-CM) (CCl4 +TSG-6-CM: TSG-6 group) or TSG-6-poor CM (NC-CM) (CCl4 + NC-CM: NC group). Liver sections fromthose mice were examined for the effect of TSG-6 using H& E staining. CCl4-treated mice showed severe cytoplas-mic vacuolation, microvesicular fatty changes, loss of cel-lular boundaries, infiltration of inflammatory cells aroundthe central vein and in the portal areas, congestion in thesinusoids, and necrosis of the liver cells. Interestingly,those abnormal morphological changes were remarkablyameliorated and restored to almost normal morphology inthe TSG-6 group, compared to the NC and CCl4 groups(Figure 3A). The ratio of liver weight versus body weight(LW/BW) declined in mice in the CCl4 and NC groups4-trtivreplivithWang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 6 of 14Figure 3 Effects of TSG-6 on liver histomorphology and function in CClinfiltration of inflammatory cells in CCl4-treated mice with or without NC (negainjuries were reduced in CCl4 mice treated with TSG-6-CM (CCl4 + TSG-6). TheCCl4:CCl4-treated mice/ CCl4 +NC: CCl4-treated mice with NC-CM). (B) Relative(D) QRT-PCR analysis for G6pc of liver mRNA from normal (CTRL), CCl4, CCl4 wversus CTRL, #P <0.05 versus CCl4, $P <0.05 versus CCl4 +NC-CM). ALT, alanine amG6pc, glucose-6-phosphatase; TSG-6, tumor necrosis factor-inducible gene 6 proteated mice. (A) H & E staining shows the extensive cellular damage ande control: mock transfected cell)-conditioned medium (CM). Those cellularresentative images are shown at × 40 (CTRL: corn-oil-treated control mice/er weight / body weight of mice. (C) The values of AST and ALT are graphed.NC-CM (NC) or TSG-6-CM (TSG-6) (n ≥4 mice / group) (ANOVA, *P <0.05inotransferase; ANOVA, analysis of variance; AST, aspartate aminotransferase;ein.(CCl4: 0.836 ± 0.056, NC: 0.788 ± 0.086, compared tocontrol, *P <0.05), whereas there was no significant changeof LW/BW between the control and TSG-6 groups(Figure 3B). In addition, CCl4-treated mice with or withoutNC-CM had elevated serum AST and ALT, whereasCCl4-treated mice withTSG-6-CM had alleviated AST (con-trol-31.32 ± 1.74, CCl4-95.72 ± 7.23, NC-85.09 ± 8.59 andTSG-6-5.84 ± 6.28) and ALT (control-33.95 ± 3.09, CCl4-104.52 ± 3.09, NC-94.33 ± 4.79, and TSG-6-73.25 ± 15.03)(Figure 3C). Furthermore, the RNA level of glucose-6-phosphatase (G6pc), which is known to be an essential en-zyme for glycolysis, was similar between the control andTSG-6 groups (Figure 3D).To determine if these changes in the liver repair processwere associated with the hepatocyte proliferation, liversections from CM-treated mice with CCl4 were stainedfor Ki67, a marker of S phase [26]. The injured livers ofmice with or without NC-CM mainly had Ki67-positivehepatic stellate-looking cells, whereas livers of mice withTSG-6-CM largely contained Ki67-positive hepatocyticcells (Figure 4). Because liver damage leads to expansionof liver progenitors [26,27], it was further investigatedwhether reduced liver injuries influenced the proliferationof liver progenitors. As assessed by IHC for PanCK andSox9, two different markers of liver progenitors [28-30],both the CCl4 and NC groups exhibited an expansion ofhepatic progenitors compared to the control and TSG-6groups (Figure 5). Therefore, these results suggested thatTSG-6 promoted the repair process into the normalrestoration of the liver by contributing to hepatocyteproliferation.Decreased hepatic fibrosis in TSG-6 treated miceBecause CCl4 is a well-known chemical that induceshepatocyte injury and inflammation, promoting collagendeposition, we examined whether TSG-6 might exert ananti-inflammatory effect, thereby decreasing fibrogenesisin this animal model. The expression of inflammationmarkers, such as tnfα, il-1β, cxcl1 and cxcl2, was signifi-cantly higher in the CCl4 and NC groups than in theTSG-6 group (Figure 6). The RNA expression of the fi-brotic markers, tgf-β, α-sma and collagen α1, was greatlyceKi6Wang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 7 of 14Figure 4 Expansion of Ki67-positive hepatocytic cells in liver of mirepresentative control, CCl4, CCl4 + NC, and CCl4 + TSG-6 mice (×40). (B)versus CTRL, #P <0.05 versus CCl4, $P <0.05 versus CCl4 + NC-CM). ANOVA,immunohistochemistry; NC, negative control; TSG-6, tumor necrosis factor-iwith CCl4 + TSG-6 treatment. (A) IHC for Ki67 in liver sections from7-positive hepatocytes were counted and graphed (ANOVA, *P <0.05analysis of variance; CM, conditioned medium; CTRL, control; IHC,nducible gene 6 protein.Wang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 8 of 14upregulated in the CCl4 and CCl4 + NC-CM-treatedlivers, whereas those genes were downregulated in in-jured livers treated with TSG-6-CM (Figure 7A). In linewith mRNA expression, the protein level of TGF-β andα-SMA decreased in the TSG-6 treated group, showingthe baseline TGF-β and α-SMA expression in healthylivers (Figure 7B, C). In addition, IHC staining for α-SMA clearly showed that the accumulation of activatedhepatic stellate cells in livers of the CCl4 and NC groupswas reduced in the livers of the TSG-6 group (Figure 7D).Therefore, these results demonstrated that the TSG-6attenuated both inflammation and the expansion offibrous matrix in the injured liver.Figure 5 TSG-6 decreases the proliferation of hepatic progenitors in thefrom representative control, CCl4, CCl4 + NC, and CCl4 + TSG-6 mice (×40). IHCTSG-6, tumor necrosis factor-inducible gene 6 protein.TSG-6 induced inactivation of hepatic stellate cellsFibrosis is the excessive accumulation of collagen and otherextracellular matrix components, and the accumulated fi-brotic tissues disarrange the liver constitution. A change inthe hepatic structure induces hepatic dysfunction, leading tothe death of the patient. Several types of cells, such as bonemarrow-derived cells, circulating fibrocytes, and portal fibro-blasts, are known to contribute to hepatic fibrosis by transi-tioning to myofibroblasts. Particularly, activated hepaticstellate cells are primary sources of myofibroblastic cellspromoting fibrogenesis. Hence, we investigated whetherTSG-6 was involved in the activation of hepatic stellate cellsbecause our data showed regressed fibrosis in the TSG-6liver damaged with CCl4. IHC for PanCK and Sox9 in liver sections, immunohistochemistry; NC, negative control; PanCK, pancytokeratin;CCl5 von;Wang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 9 of 14treated group. LX2 cells cultured in TSG-6-CM showeddecreased expression of activated markers of hepatic stellatecells, such as tgf-β, vimentin and collagen α1, whereas cellscultured in NC-CM or LX2 cell medium had greatly in-creased expression of those markers. In addition,neutralization of TSG-6 by the TSG-6 antibody effect-ively induced the expression of those markers in LX2cells (Figure 8A). Oil Red O staining showed cytoplasmiclipid droplets, the morphologic hallmark of inactivatedhepatic stellate cells, in the LX2 cells cultured in TSG-6-CM, whereas those lipid droplets were not seen in cellscultured in NC-CM or LX2 cell medium (Figure 8B).To assess whether TSG-6 directly influenced liver res-toration in mice with CCl4 damage, TSG-6-CM neutral-Figure 6 TSG-6 decreases the inflammation in the liver damaged withresults are graphed (n ≥4 mice/group) (ANOVA, *P <0.05 versus CTRL, # P <0.0conditioned medium. CTRL, control; NC, negative control; SD, standard deviatiized with TSG-6 antibody was injected in CCl4-treatedmice (TSG-6 + Ab group) (Figure 1B). The livers of theTSG-6 + Ab group had severe hepatic injuries, whereasthe livers from the TSG-6 or TSG-6 + IgG groups showedalmost normal morphology without distinct morpho-logical differences between the two groups, as examinedby H & E staining (Figure 9A). The ratio of liver weight/body weight (LW/BW) decreased and serum AST andALT increased in mice in the TSG-6 + Ab group, com-pared with mice in the TSG-6 or TSG-6 + IgG group(Figure 9B, C, D). The RNA expression of g6pc was alsodown-regulated in the TSG-6 + Ab group (Figure 9E). Fur-thermore, the neutralization of TSG-6 by TSG-6 antibodyled to an increase in the fibrotic markers, tgf-β, α-sma andcollagen α1, as assessed by quantitative real-time PCR(Figure 9F). In addition, the expression of inflammationmarkers, tnf-α, il-1β, cxcl1 and cxcl2, was higher in theTSG-6 neutralized group than in the TSG-6 or TSG-6 +IgG groups. Taken together, these data suggested thatTSG-6 induced the inactivation of hepatic stellate cells,contributing to the ameliorated fibrosis in mice.DiscussionAcute liver failure shows a higher inflammatory responseto liver damage, which impairs the parenchymal functionthat extends into systemic organ failure, eventually leadingto death [16,31]. Thus, researchers must develop new treat-ments for acute liver disease. The potential for MSCs to dif-ferentiate into hepatocytes and their immunomodulatorycapabilities make MSCs an attractive choice in the therapyof acute or chronic liver diseases [9]. Several clinical trialsare currently being performed to investigate the therapeuticpotential of MSCs in the treatment of chronic liver diseases,such as Hepatitis B or C virus-infected liver or alcoholicliver with cirrhosis [32-34]. Previous studies have shownthat transplanted MSCs replace the damaged cells and re-4. QRT-PCR analysis of mouse liver for tnfα, il-1β, cxcl1 and cxcl2. Mean± SDersus CCl4, $P <0.05 versus CCl4 +NC-CM). ANOVA, analysis of variance; CM,TSG-6, tumor necrosis factor-inducible gene 6 protein.populate in the injured tissues or organs [35]. However, thenumber of long-term substituted MSCs is open to disputebecause those numbers differed depending on the injurymodels, the transplant route and time, and so on [8].Nevertheless, it seems to be uncontroversial that MSCs andthe CM from MSCs contribute to improving damage fromliver injuries [9,36]. The transplanted MSCs help or allowthe survival or proliferation of endogenous cells by directcontact or modulating inflammation [9]. MSCs are knownto alleviate acute and chronic liver injury by changing thedisease environment; for example, they decreased inflam-mation and cell death, but they increased cell proliferation[9]. In the present study, TSG-6 released by MSCssuppressed the proinflammatory signal and reduced thecollagen accumulation which was likely due to the inactiva-tion of hepatic stellate cells by TSG-6 in the acute liver in-jury of mice.Although the anti-inflammatory action of TSG-6 isshown to promote improvement in the damaged tissue[14,37], this effect of TSG-6 in the liver remains unknown.Thus, we investigated whether TSG-6 might be involved inFigure 7 Reduced fibrosis in the TSG-6 treated liver. (A) QRT-PCR analysis of liver mRNA for tgf-β, α–sma and collagen-α1 (n ≥4 mice/group). Mean±SD results are graphed. (B) and (C). Western blot analysis of TGF-β (25 kDa: processed form) (inducer of fibrosis) and α-SMA (fibrogenic marker) (GAPDH wasused as an internal control) (n ≥4 mice/group). Data shown represent one of three experiments with similar results (B: Immunoblot/ C: Band density of TGF-βand α-SMA). Data represent the mean± SD of three independent experiments. (D) IHC for α-SMA in liver sections from representative control, CCl4, CCl4 +NC, and CCl4 + TSG-6 mice (×40) (ANOVA, *P <0.05 versus CTRL, #P <0.05 versus CCl4, $P <0.05 versus CCl4 +NC-CM). ANOVA, analysis of variance; CM,conditioned medium; CTRL, control; IHC, immunohistochemistry; NC, negative control; SD, standard deviation; TSG-6, tumor necrosis factor-inducible gene6 protein.Wang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 10 of 14Wang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 11 of 14liver regeneration, and how it contributed to this process.Our results demonstrated that TSG-containing CM led toliver regeneration. This protective effect of TSG-6 was alsoobserved in another experimental model; specifically, chori-onic plate-derived MSCs (CP-MSCs) that shared commoncharacteristics and differentiation potentials with bonemarrow-MSCs promoted liver regeneration in rat livers thathad been chronically damaged by CCl4 [38,39]. In thismodel, the CP-MSCs contained a greater expression ofTSG-6, and the regenerating liver transplanted with CP-MSC showed a higher expression of TSG-6, compared to anon-transplanted liver (Additional file 1: Figure S1). Thisevidence strongly supported the regenerative effect of TSG-6 in the liver.In this experimental model, acutely injured livers showeddistorted histomorphology, changes in LW/BW, and in-creased levels of the liver enzymes, ALT and AST, but TSG-6-CM treatment attenuated those abnormalities and evenFigure 8 TSG-6 blocks activation of hepatic stellate cells. (A) QRT-PCRcultured in LX2 cell medium (LX2), NC-CM (LX2 + NC), TSG-6-CM with (LX2as a negative control for TSG-6 antibody (LX2 + TSG-6 + IgG). Mean ± SD reexperiments (ANOVA, *P <0.05 versus LX2, #P <0.05 versus NC, $P <0.05 veNC-CM, or TSG-6-CM (original magnification × 40). ANOVA, analysis of variancontrol; SD, standard deviation; TSG-6, tumor necrosis factor-inducible genecontributed to restoring the liver function which wasevidenced by g6pc expression. G6pc hydrolyzes glucose-6-phosphate, which is the central metabolite of glucose metab-olism [40]. The data showing almost normal glucose meta-bolic homeostasis in TSG-6-CM treated livers stronglysupport the restoration of liver function through the actionof TSG-6. In addition, the downregulated proinflammatoryfactors in the TSG-6-CM group demonstrated that TSG-6exerted an anti-inflammatory effect on the CCl4-treatedmouse livers.Liver injury induces activation of hepatic stellate cells andproliferation of progenitors [16,26]. Activated stellate cellshave been shown to be associated with the proliferation ofhepatic progenitors [27,41]. In Ki67 staining, more Ki67-positive hepatocytic cells and fewer Ki67–positive hepaticstellate cells were observed in livers of the TSG6 group.Compared with liver of CCl4 +TSG-6-treated mice, livers ofCCl4 or CCl4 +NC-treated mice contained more PanCK-analysis for tgf-β, vimentin and collagen-α1 in LX2 cells which were+ TSG-6 + Ab) or without TSG-6 antibody (LX2 + TSG-6). IgG was usedsults are graphed. Data represent the mean ± SD of three independentrsus TSG-6 + Ab). (B) Oil Red O staining in LX2 cells cultured in LX2,ce; CM conditioned medium; IgG, immunoglobulin G; NC, negative6 protein.Figure 9 Neutralization of TSG-6 by TSG-6 antibody attenuates the restoration effect of TSG-6 in liver of CCl4 + TSG-6-treated mice. (A) H & Estaining shows the histomorphological changes in CCl4 + TSG-6-treated mice with (CCl4 + TSG-6 + TSG-6 antibody) (CCl4 + TSG-6 + IgG) without TSG-6antibody (CCl4 + TSG-6) or IgG. The representative images were shown at × 40. (B) Relative liver weight/body weight of mice. (C), (D) The values of AST andALT are graphed. (E, F, G) QRT-PCR analysis for G6pc (E), the fibrotic markers (F), tgf-β, α–sma and collagen-α1, the inflammation markers (G), tnfα, il-1β, cxcl1and cxcl2, of liver mRNA from the treated mice (n ≥4 mice / group). Mean± SD results are graphed (ANOVA, *P <0.05 versus TSG-6, #P <0.05 versus TSG-6 +Ab). ALT, alanine aminotransferase; ANOVA, analysis of variance; AST, aspartate aminogransferase; G6pc, glucose-6-phosphatase; IgG, immunoglobulin G; SD,standard deviation; TSG-6, tumor necrosis factor-inducible gene 6 protein.Wang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 12 of 14Wang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 13 of 14expressing cells and more SoX9-expressing cells (Figure 5).We examined if these changes in the activation and /or pro-liferation of hepatic stellate cells and the reduced liver dam-age influenced the proliferation of progenitors. As weexpected, decreased expansion of progenitors was ob-served in livers of the TSG-6 group, compared to theCCl4 and NC groups. Therefore, these results indicatedthat micro-environmental changes by TSG-6 mightcontribute to the proliferation of hepatocytes by pro-tecting hepatocytes from injury. Also, it could be pos-sible that TSG-6 might promote differentiation ofprogenitors into hepatocytes. However, neither the direct ef-fects of TSG-6 on progenitors nor the progenitor prolifera-tion at the early time point after CM injection wasinvestigated in the present studies. Hence, further studiesare required to provide the evidence for this possibility.The degree of inflammatory response parallels thefibrotic severity in the liver [42]. The activated hepaticstellate cells play a key role in hepatic fibrogenesis[43,44]. Both RNA and the protein level of fibroticmarkers were downregulated in the livers of TSG-6-CM-treated mice. Activated LX2 cultured in TSG-6-CMshowed a decreased expression of fibrotic markers andan increased number of lipid drops. Conversely, theaddition of the TSG-6 antibody neutralized these inhibi-tory effects of TSG-6 on the activation of LX2, althoughthis addition was less effective than NC-CM. It is pos-sible that the TSG-6 antibody does not block all TSG-6,and the amount of TSG-6 that escaped blocking by theantibody is higher than it is in NC-CM. One explanationis that the TSG-6-overexpressing MSCs and the CM ofthose cells show a greater expression of TSG-6, butTSG-6 is rarely detected in NC and NC-CM. Hence,these results proved that TSG-6 influenced the activa-tion of hepatic stellate cells, suggesting that TSG-6 con-tributed to the reduced fibrosis in damaged livers ofmice.CM obtained from empty plasmid-transfected MSC wasless protective in the damaged liver. In line with our finding,Herrera et al. [7], demonstrated that both human liver stemcells (HLSCs) and HLSC-CM improved liver injury and hada protective effect for liver, but MSC-CM was totally inef-fective in their experimental model [7]. In addition, theyemployed the concentrated CM in their experimental modelof liver injury, like other researchers did. However, the CMused in the present studies was not concentrated. MSC-CMincludes many kinds of cytokines, growth factors, and evenmicroparticles [37,45]. Because we used 0.5 ml CM permouse from a total 12 ml CM which was collected at 70%to 80% confluent cells, this small volume of CM seemed tocontain a significantly lower amount of those factors, com-pared to the concentrated CM. Hence, the effects of otherfactors were likely negligible in this model. Also, we exam-ined the regulation of hepatic stellate cells by TSG-6, notthe apoptosis of hepatocytes, and demonstrated that hepaticstellate cells were inactivated in TSG-6-CM, but not in NC-CM or TSG-6-CM with the TSG-6 antibody. Furthermore,CCl4-treated mice injected with TSG-6-CM incubated withTSG-6 antibody induced the liver damage which was ame-liorated in CCl4-treated mice with TSG-6-CM. These resultssuggest that the reduced inflammation and fibrosis causedby TSG-6 might provide a beneficial microenvironmentwhich contributes to the proliferation or survival of hepato-cytes, leading to liver regeneration.ConclusionsOur results first demonstrate that TSG-6 influences liverregeneration and place TSG-6 into the central position inthe regulation of liver regeneration. The protective and/orimproving effects of TSG-6 on the damaged liver throughattenuating inflammation and fibrosis help to develop noveltherapeutic approaches to treat acute liver failure. However,further studies are required to examine the underlyingmechanism for the regenerative actions of TSG-6 and thoseeffects in other liver diseases, including chronic diseases.Additional fileAdditional file 1: Figure S1. Chorionic plate-derived MSCs expressTSG-6. (A) QRT-PCR analysis for TSG-6 in CP-MSCs (B) QRT-PCR analysis forCP-MSCs-transplanted rat liver which had been chronically damaged byCCl4 (*P <0.05, **P <0.005) (Transplantation: CCl4-treated rats with CP-MSCstransplantation).AbbreviationsALT: alanine aminotransferase; ANOVA: analysis of variance; AST: aspartateaminotransferase; CFSE: carboxyfluorescein succinimidyl ester;CM: conditioned medium; FBS: fetal bovine serum; G6pc: glucose-6-phosphatase; H & E: hematoxylin and eosin; hMSC: human mesenchymalstem/stromal cells; IHC: immunohistochemistry; IL: interleukin; NC: negativecontrol; PanCK: pancytokeratin; PBS: phosphage-buffered saline; SD: standarddeviation; TGF-β: transforming growth factor-β; TNF-α: tumor necrosisfactor-α; TSG-6: tumor necrosis factor-inducible gene 6 protein; α-SMA:α-smooth muscle actin.Competing interestsThe authors declare that they have no competing interests.Authors’ contributionsSW performed the animal, cell culture and molecular experiments, analyzed thedata, and drafted the manuscript. JSL and SK carried out the immune suppressionassay. JH and JK participated in the cell culture experiments and help to OROstaining imaging. HJC and YJ conceived and designed the study and analyzed thedata. YJ contributed reagents/materials/analysis tools and helped to draft themanuscript. All authors read and approved the final manuscriptAcknowledgmentsThe authors thank Dr. Gi Jin Kim (Cha University, Korea) for providing theCP-MSC and rat liver tissue. This work was supported by the NationalResearch Foundation (NRF) of Korea funded by the Korean government(MEST) (2013R1A2A2A01068268) to YJ.Author details1Department of Intergrated Biological Science, Pusan National University,263-2 Pusandaehak-ro, Kumjeong-gu, Pusan 609-735, Korea. Department ofBiological Sciences, Pusan National University, 63-2 Pusandaehak-ro,Kumjeong-gu, Pusan 609-735, Korea. 3Department of Life Science, Sogangintrinsic stress signaling pathways. Stem Cells. 2009;27:1963–75.24. Xu L, Hui AY, Albanis E, Arthur MJ, O’Byrne SM, Blaner WS, et al. HumanWang et al. Stem Cell Research & Therapy  (2015) 6:20 Page 14 of 1421. Nagai A, Kim WK, Lee HJ, Jeong HS, Kim KS, Hong SH, et al. Multilineagepotential of stable human mesenchymal stem cell line derived from fetalmarrow. PloS One. 2007;2:e1272.22. Lowe JM, Cha H, Yang Q, Fornace Jr AJ. Nuclear factor-kappaB (NF-kappaB)is a novel positive transcriptional regulator of the oncogenic Wip1phosphatase. J Biol Chem. 2010;285:5249–57.University, Seoul 121-742, Korea. 4Division of Neurology, Department ofMedicine, University of British Columbia, Vancouver, BC, Canada.Received: 11 December 2014 Revised: 16 February 2015Accepted: 24 February 2015References1. Foley DP, Fernandez LA, Leverson G, Anderson M, Mezrich J, Sollinger HW,et al. Biliary complications after liver transplantation from donation aftercardiac death donors: an analysis of risk factors and long-term outcomesfrom a single center. Ann Surg. 2011;253:817–25.2. Zhang Z, Wang FS. Stem cell therapies for liver failure and cirrhosis.J Hepatol. 2013;59:183–5.3. Aurich I, Mueller LP, Aurich H, Luetzkendorf J, Tisljar K, Dollinger MM, et al.Functional integration of hepatocytes derived from human mesenchymalstem cells into mouse livers. Gut. 2007;56:405–15.4. Sgodda M, Aurich H, Kleist S, Aurich I, Konig S, Dollinger MM, et al.Hepatocyte differentiation of mesenchymal stem cells from rat peritonealadipose tissue in vitro and in vivo. Exp Cell Res. 2007;313:2875–86.5. Christ B, Stock P. Mesenchymal stem cell-derived hepatocytes for functionalliver replacement. Front Immunol. 2012;3:168.6. Parekkadan B, van Poll D, Suganuma K, Carter EA, Berthiaume F, Tilles AW,et al. Mesenchymal stem cell-derived molecules reverse fulminant hepaticfailure. PLoS One. 2007;2:e941.7. Herrera MB, Fonsato V, Bruno S, Grange C, Gilbo N, Romagnoli R, et al.Human liver stem cells improve liver injury in a model of fulminant liverfailure. Hepatology. 2013;57:311–9.8. Meier RP, Muller YD, Morel P, Gonelle-Gispert C, Buhler LH. Transplantationof mesenchymal stem cells for the treatment of liver diseases, is thereenough evidence? Stem Cell Res. 2013;11:1348–64.9. Volarevic V, Nurkovic J, Arsenijevic N, Stojkovic M. Concise review:therapeutic potential of mesenchymal stem cells for the treatment of acuteliver failure and cirrhosis. Stem Cells. 2014;32:2818–23.10. Lee JW, Fang X, Krasnodembskaya A, Howard JP, Matthay MA. Concisereview: mesenchymal stem cells for acute lung injury: role of paracrinesoluble factors. Stem Cells. 2011;29:913–9.11. Song SH, Lee MO, Lee JS, Jeong HC, Kim HG, Kim WS, et al. Geneticmodification of human adipose-derived stem cells for promoting woundhealing. J Dermatol Sci. 2012;66:98–107.12. Tsukahara S, Ikeda R, Goto S, Yoshida K, Mitsumori R, Sakamoto Y, et al.Tumour necrosis factor alpha-stimulated gene-6 inhibits osteoblasticdifferentiation of human mesenchymal stem cells induced by osteogenicdifferentiation medium and BMP-2. Biochem J. 2006;398:595–603.13. Milner CM, Day AJ. TSG-6: a multifunctional protein associated withinflammation. J Cell Sci. 2003;116:1863–73.14. Prockop DJ, Oh JY. Mesenchymal stem/stromal cells (MSCs): role asguardians of inflammation. Mol Ther. 2012;20:14–20.15. Syn WK, Oo YH, Pereira TA, Karaca GF, Jung Y, Omenetti A, et al.Accumulation of natural killer T cells in progressive nonalcoholic fatty liverdisease. Hepatology. 2010;51:1998–2007.16. Bataller R, Brenner DA. Liver fibrosis. J Clin Invest. 2005;115:209–18.17. Syn WK, Agboola KM, Swiderska M, Michelotti GA, Liaskou E, Pang H, et al.NKT-associated hedgehog and osteopontin drive fibrogenesis innon-alcoholic fatty liver disease. Gut. 2012;61:1323–9.18. De Minicis S, Svegliati-Baroni G. Fibrogenesis in nonalcoholic steatohepatitis.Expert Rev Gastroenterol Hepatol. 2011;5:179–87.19. Fujii H, Kawada N. Inflammation and fibrogenesis in steatohepatitis.J Gastroenterol. 2012;47:215–25.20. Lee JS, Lee MO, Moon BH, Shim SH, Fornace AJ, Cha HJ. Senescent growth arrestin mesenchymal stem cells is bypassed by Wip1-mediated downregulation of23. Datta S, Basu K, Sinha S, Bhattacharyya P. Hepatoprotective effect of aprotein isolated from Cajanus indicus (Spreng) on carbon tetrachlorideinduced hepatotoxicity in mice. Indian J Exp Biol. 1998;36:175–81.hepatic stellate cell lines, LX-1 and LX-2: new tools for analysis of hepaticfibrosis. Gut. 2005;54:142–51.25. Omenetti A, Porrello A, Jung Y, Yang L, Popov Y, Choi SS, et al. Hedgehogsignaling regulates epithelial-mesenchymal transition during biliary fibrosisin rodents and humans. J Clin Invest. 2008;118:3331–42.26. Jung Y, Witek RP, Syn WK, Choi SS, Omenetti A, Premont R, et al. Signalsfrom dying hepatocytes trigger growth of liver progenitors.Gut. 2010;59:655–65.27. Jung Y, Yang L, Omenetti A, Witek RP, Choi S, Vandongen HM, et al.Fate-mapping evidence that hepatic stellate cells are epithelial progenitorsin adult mouse livers. Stem Cells. 2008;26:2104–13.28. Fausto N. Involvement of the innate immune system in liver regenerationand injury. J Hepatol. 2006;45:347–9.29. Wang S, Lee K, Hyun J, Lee Y, Kim Y, Jung Y. Hedgehog signaling influencesgender-specific response of liver to radiation in mice. Hepatol Int.2013;7:1065–74.30. Dorrell C, Erker L, Schug J, Kopp JL, Canaday PS, Fox AJ, et al. Prospectiveisolation of a bipotential clonogenic liver progenitor cell in adult mice.Genes Dev. 2011;25:1193–203.31. Rolando N, Wade J, Davalos M, Wendon J, Philpott-Howard J, Williams R.The systemic inflammatory response syndrome in acute liver failure.Hepatology. 2000;32:734–9.32. El-Ansary M, Abdel-Aziz I, Mogawer S, Abdel-Hamid S, Hammam O,Teaema S, et al. Phase II trial: undifferentiated versus differentiatedautologous mesenchymal stem cells transplantation in Egyptian patientswith HCV induced liver cirrhosis. Stem Cell Rev. 2012;8:972–81.33. Wang HM, Hung CH, Lu SN, Chen CH, Lee CM, Hu TH, et al. Liver stiffnessmeasurement as an alternative to fibrotic stage in risk assessment ofhepatocellular carcinoma incidence for chronic hepatitis C patients.Liver Int. 2013;33:756–61.34. Amin MA, Sabry D, Rashed LA, Aref WM, el-Ghobary MA, Farhan MS, et al.Short-term evaluation of autologous transplantation of bone marrow-derivedmesenchymal stem cells in patients with cirrhosis: Egyptian study.Clin Transplant. 2013;27:607–12.35. Wu XB, Tao R. Hepatocyte differentiation of mesenchymal stem cells.Hepatobiliary Pancreat Dis Int. 2012;11:360–71.36. Rashid T, Takebe T, Nakauchi H. Novel strategies for liver therapy using stemcells. Gut. 2015;64:1–4.37. Wang N, Li Q, Zhang L, Lin H, Hu J, Li D, et al. Mesenchymal stem cellsattenuate peritoneal injury through secretion of TSG-6. PLoS One.2012;7:e43768.38. Lee MJ, Jung J, Na KH, Moon JS, Lee HJ, Kim JH, et al. Anti-fibrotic effect ofchorionic plate-derived mesenchymal stem cells isolated from humanplacenta in a rat model of CCl(4)-injured liver: potential application to thetreatment of hepatic diseases. J Cell Biochem. 2010;111:1453–63.39. Jung J, Choi JH, Lee Y, Park JW, Oh IH, Hwang SG, et al. Human placenta-derivedmesenchymal stem cells promote hepatic regeneration in CCl4 -injured rat livermodel via increased autophagic mechanism. Stem Cells. 2013;31:1584–96.40. Ghafoory S, Breitkopf-Heinlein K, Li Q, Scholl C, Dooley S, Wolfl S. Zonationof nitrogen and glucose metabolism gene expression upon acute liverdamage in mouse. PLoS One. 2013;8:e78262.41. Choi SS, Omenetti A, Syn WK, Diehl AM. The role of Hedgehog signaling infibrogenic liver repair. Int J Biochem Cell Biol. 2011;43:238–44.42. Tsui TY, Lau CK, Ma J, Wu X, Wang YQ, Farkas S, et al. rAAV-mediated stableexpression of heme oxygenase-1 in stellate cells: a new approach toattenuate liver fibrosis in rats. Hepatology. 2005;42:335–42.43. Wang S, Lee Y, Kim J, Hyun J, Lee K, Kim Y, et al. Potential role of Hedgehogpathway in liver response to radiation. PLoS One. 2013;8:e74141.44. Hyun J, Choi SS, Diehl AM, Jung Y. Potential role of Hedgehog signalingand microRNA-29 in liver fibrosis of IKKbeta-deficient mouse. J Mol Histol.2014;45:103–12.45. Lee RH, Pulin AA, Seo MJ, Kota DJ, Ylostalo J, Larson BL, et al. IntravenoushMSCs improve myocardial infarction in mice because cells embolized inlung are activated to secrete the anti-inflammatory protein TSG-6.Cell Stem Cell. 2009;5:54–63.

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52383.1-0132601/manifest

Comment

Related Items