UBC Faculty Research and Publications

Upregulation of human PINK1 gene expression by NFκB signalling Duan, Xiaoling; Tong, Jade; Xu, Qin; Wu, Yili; Cai, Fang; Li, Tingyu; Song, Weihong Aug 11, 2014

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


52383-13041_2014_Article_57.pdf [ 1.35MB ]
JSON: 52383-1.0074638.json
JSON-LD: 52383-1.0074638-ld.json
RDF/XML (Pretty): 52383-1.0074638-rdf.xml
RDF/JSON: 52383-1.0074638-rdf.json
Turtle: 52383-1.0074638-turtle.txt
N-Triples: 52383-1.0074638-rdf-ntriples.txt
Original Record: 52383-1.0074638-source.json
Full Text

Full Text

RESEARCHUpregulation of human PINFκB signallingi2raedintnRTidcimdinvolvement of protein misfolding, oxidative stress andmitochondrial dysfunction, the fundamental cause of thetidase and presenilin-associated rhomboid-like protein(PARL) [8]. Δ1-PINK1 was reported to be released toDuan et al. Molecular Brain 2014, 7:57http://www.molecularbrain.com/content/7/1/57cluding Parkin itself and Synphilin-1 [10]. However, inCenter, The University of British Columbia, 2255 Wesbrook Mall, Vancouver,BC V6T 1Z3, Canadadisease, its underlying mechanism remains elusive. the cytosol and interacts with Parkin, a PD-associatedE3 ubiquitin ligase [9]. The binding of Δ1-PINK1 withParkin impairs the recruitment of Parkin to mitochondriaand leads to the degradation of Parkin and PINK1 by pro-teasome pathway in healthy mitochondria [9]. Parkin,PINK1 and DJ-1 formed a complex to promote ubi-quitination and degradation of Parkin substrates, in-* Correspondence: weihong@mail.ubc.ca1Chongqing City Key Lab of Translational Medical Research in CognitiveDevelopment and Learning and Memory Disorders, and Ministry ofEducation Key Lab of Child Development and Disorders, Children’s Hospitalof Chongqing Medical University, Chongqing 400014, China2Townsend Family Laboratories, Department of Psychiatry, Brain Researchstrong activator of NFκB, significantly increased PINK1 expression in SH-SY5Y cells. Taken together, our results clearlysuggested that PINK1 expression is tightly regulated at its transcription level and NFκB is a positive regulator forPINK1 expression.Keywords: PINK1, Mitochondrial function, NFκB, TranscriptionBackgroundParkinson’s disease (PD) is the second most common neu-rodegenerative disease [1]. PD patients commonly sufferfrom muscular dysfunction which resulted in body rigidity,tremors, bradykinesia, posture instability, and Parkinsoniangait. Secondary symptoms such as anxiety, depression, me-mory loss, and dementia may appear over the course ofdisease progression [2,3]. The pathological hallmarks ofPD include neurodegeneration of dopaminergic neuronsspecifically in the substantia nigra [3], and intracellular ag-gregation of misfolded proteins forming lewy bodies [4].Although clinical and experimental studies suggest thePhosphatase and tensin homolog deleted on chromo-some 10 (PTEN)-induced putative kinase 1 (PINK1), ini-tially was identified as a downstream molecule of PTENin cancer cells [5]. PINK1 is a type I transmembraneprotein of 581 amino acids with a putative serine/threo-nine kinase domain and an N-terminal mitochondrialtargeting signal. Upon synthesis, the full-length PINK1(FL-PINK1) is imported into mitochondria with the C-terminus facing the cytosol and undergoes proteolysis toproduce a predominant product of ~55 kDa (Δ1-PINK1)and a minor one of ~45 kDa (Δ2-PINK1) [6,7]. The pro-teolytic process is mediated by matrix processing pep-Xiaoling Duan1,2, Jade Tong2, Qin Xu2, Yili Wu1,2, Fang CaAbstractParkinson’s disease (PD) is one of the major neurodegenePD pathogenesis. Phosphatase and tensin homolog delet(PINK1), a serine/threonine kinase, plays an important rolePINK1 mutations have been identified to cause early-onseremains elusive. In the present study, we identified the traswitching mechanism at 5’end of RNA transcription (SMAthe translation start site ATG. The region with 104 bp wasanalysis followed by dual luciferase assay. Four functionalactivated B cells (NFκB)-binding sites within the PINK1 proup-regulation of PINK1 expression in both HEK293 cells an© 2014 Duan et al.; licensee BioMed Central LCommons Attribution License (http://creativecreproduction in any medium, provided the orDedication waiver (http://creativecommons.orunless otherwise stated.Open AccessNK1 gene expression by, Tingyu Li1 and Weihong Song1,2*tive disorders. Mitochondrial malfunction is implicated inon chromosome 10 (PTEN)-induced putative kinase 1the quality control of mitochondria and more than 70PD. However, the regulation of PINK1 gene expressionscription start site (TSS) of the human PINK1 gene usingRACE) assay. The TSS is located at 91 bp upstream ofentified as the minimal promoter region by deletions-acting nuclear factor kappa-light-chain-enhancer ofoter were identified. NFκB overexpression led to theSH-SY5Y cells. Consistently, lipopolysaccharide (LPS), atd. This is an Open Access article distributed under the terms of the Creativeommons.org/licenses/by/4.0), which permits unrestricted use, distribution, andiginal work is properly credited. The Creative Commons Public Domaing/publicdomain/zero/1.0/) applies to the data made available in this article,Duan et al. Molecular Brain 2014, 7:57 Page 2 of 10http://www.molecularbrain.com/content/7/1/57dysfunctional mitochondria with reduced mitochondrialmembrane potential and mitochondrial oxidative stress,full-length PINK1 is aggregated on the mitochondrialmembrane and recruits Parkin to mitochondria throughthe phosphorylation of Parkin, resulting in mitochon-drial autophagy. PINK1 deficiency reduces mitochon-drial membrane potential and compromises complex Iactivity of the mitochondria respiratory chain [11]. Studiessuggest that PINK1 together with Parkin is critical for thequality control of mitochondria, including mitochondrialintegrity, turnover, and functions. More than 70 mutationsin the PINK1 gene were identified in familial PD inan autosomal recessive manner [12,13]. Most of thesemutations fail to phosphorylate and recruit Parkin tomitochondria, leading to the accumulation of dysfunc-tional mitochondria and eventually neuronal death. Thisstrongly suggests that PINK1 plays a critical role in PDpathogenesis and dysregulation of PINK1 may contributeto the development of PD.Nuclear factor kappa-light-chain-enhancer of activatedB cells (NFκB) is a family of diametric transcriptionfactors, regulating numerous genes involving in cell sur-vival, inflammation and immunity. The NFκB familyconsists of five members, p50, p52, p65 (RelA), RelB andC-Rel. All of them share an N-terminal Rel homologydomain (RHD) responsible for DNA binding and homo-or hetero-dimerization. Only three members includingp65, RelB and C-Rel contain transcription activation do-main (TAD) necessary for the activation of target genes.NFκB exists in forms of homo- or hetero-dimer and themost abundant form is the p65/p50 heterodimer. NFκBdimers bind with inhibitor of κB (IκB) proteins in cyto-plasm, preventing its nuclear translocation and DNAbinding. Once IκB protein degradation is induced, NFκBdimers are released from IκB-NFκB complex and subse-quently translocated from cytoplasm to nucleus [14],thus transcription regulation of its target genes is ini-tialized [15]. NFκB can be activated by stimuli such asoxidative stress, cytokines, free radicals and biologicalantigens. Oxidative stress or free radicals has been shownto be involved in PD. An increase of NFκB translocationto the nucleus and activation have been observed in dopa-minergic neurons from both PD animal models and pa-tient samples as well as other neurodegenerative disorders[16-21]. It has been shown that NFκB plays an importantrole in regulating PD related genes, such as UCHL1 [22],USP24 [23] and RNF11 [24].Although the function of PINK1 is well studied interms of mitochondrial quality control, the regulation ofPINK1 gene expression is barely explored. In the presentstudy, we aimed to understand the transcriptional re-gulation of the PINK1 gene. For the first time, we iden-tified that the transcription start site (TSS) of PINK1is located 91 bp upstream of the translation start site(ATG). The region of 104 bp (−78 to +26) contains theminimal promoter with functional transcriptional activityfor the PINK1 gene. Furthermore, we showed that thePINK1 gene promoter contains 4 functional cis-actingNFκB-binding sites, which promote PINK1 expression.Taken together, our results demonstrated that PINK1 ex-pression is tightly regulated at its transcriptional level andthat NFκB is a positive regulator for PINK1 expression.Results and discussionCloning the human PINK1 gene promoter and mappingits transcription initiation siteThe human PINK1 gene spans a region of 18,056 bp onchromosome 1p36. The human PINK1 gene transcript(NCBI Reference Sequence: NM_032409) is 2680-bp longand composed of 8 exons (Figure 1A). Human genomicDNA samples were extracted from SH-SY5Y cells andan 1825 bp 5’ flanking region of the PINK1 gene wasamplified and cloned. The DNA fragment was sequenced(Figure 1B). To identify the transcription start site of hu-man PINK1 gene, SMART-RACE was performed. The5’ends of PINK1 cDNA with approximate 650 bp in lengthwere amplified (Figure 1C). The sequencing results indi-cated that the transcription start site (TSS), an adenine la-beled as +1, is located 91 bp upstream of the translationstart site (Figure 1D). Further sequence analysis and acomputer-based transcription factor binding site searchusing Genomatix and TFSearch revealed that the hu-man PINK1 gene has a complex transcriptional unit.The human PINK1 gene promoter lacks typical TATAand CAAT boxes, but contains several putative regulatoryelements, such as AP1, MEF, and cAMP-responsive ele-ments (Figure 1B).Functional characterization of the PINK1 promoterTo determine the functional promoter region of PINK1gene, we sub-cloned the 1,825 bp of 5’ flanking region ofthe PINK1 gene into the promoterless plasmid vectorpGL3-basic. The pGL3-basic vector lacks eukaryotic pro-moter and enhancer sequences upstream of a reporter lu-ciferase gene. The luciferase activity in cells transfectedwith this plasmid depends on the presence and properorientation of a functional promoter upstream of the lucif-erase gene. The pPINK1-A plasmid was constructed tocontain the 1,825 bp fragment from −1799 to +26 bp ofPINK1 gene upstream of the luciferase reporter gene.Plasmid DNA was transfected into HEK293 cells, and lu-ciferase activity was measured by a luminometer to reflectpromoter activity. Compared with cells transfected withan empty vector pGL3-basic, pPINK1-A-transfected cellsshowed a robust luciferase activity (113.47 ± 10.63 RLU)(Figure 2B). This result indicated that the 1,825 bpfragment contains the functional promoter region ofthe human PINK1 gene. To further identify the minimalDuan et al. Molecular Brain 2014, 7:57 Page 3 of 10http://www.molecularbrain.com/content/7/1/57promoter region required for PINK1 gene expression, aseries of deletion mutants within the 1,825 bp fragment ofpPINK1-A were generated as indicated in Figure 2A. Theluciferase activity assays of these deletion mutants wereperformed. The results indicated that placing the 1,825 bpFigure 1 Sequence features of the human PINK1 gene promoter. (A)1. E represents exon. ATG is the translation start codon and TGA is the stopfrom −1799 to +97 bp. The adenine +1 represents the transcription start sibold face. (C) SMARTer-RACE was performed to map the PINK1 transcriptioPCR product was cloned into pcDNA4 vector and sequenced to identify thwhich is underlined.fragment in a reverse orientation (pPINK1-B) com-pletely abolished luciferase activities observed in pPINK1-A transfected cells (Figure 2B). Deletion of −1799 to -103 bp in pPINK1-F reduced the luciferase activities ofpPINK1-A moderately (71.16 ± 3.02 RLU). Deletion of theThe genomic organization of human PINK1 gene on chromosomecodon. (B) The nucleotide sequence of the human PINK1 genete. The putative transcription factor binding sites are underlined inn start site. The PCR product was run on a 1.5% agarose gel. (D) Thee transcription start site. The first base after the adapter is the TSS fromScr. Ateds (RADuan et al. Molecular Brain 2014, 7:57 Page 4 of 10http://www.molecularbrain.com/content/7/1/57Figure 2 Deletion analysis of the human PINK1 gene promoter. (A)5’ flanking region with serial deletions cloned into the pGL3-basic vectoend points of each construct. (B) The deletion plasmids were cotransfecluciferase activity was measured and expressed in relative luciferase unitThe values represent means ± SEM. n = 3, *p < 0.0001, by one-way ANOVidentified transcription initiation site (pPINK1-E) frompPINK1-F occluded the remaining luciferase activities(Figure 2B). Further deletion of the promoter regionto −78 to +26 bp maintained similar luciferase activityin pPINK1-G (78.44 ± 4.74 RLU) comparing to pPINK1-F(p > 0.05). However, additional deletion of 31 bp frompPINK1-G to pPINK1-H (−47 to +26) significantlyreduced the luciferase activity to 11.46 ± 2.50 RLU(p < 0.05). These data suggest that the region from −78to +26, containing the transcription start site, possessesthe minimal promoter activity.The human PINK1 gene promoter contains NFκBbinding sitesComputer-based transcription factor binding site ana-lysis revealed four putative NFκB elements in the 1.8 kbpromoter region of the human PINK1 gene (Figure 1B).To determine whether NFκB signaling regulates PINK1gene transcription by interacting with these putativeNFκB cis-acting elements, the effect of NFκB overex-pression on the promoter activity of the 1.8 kb regionwere examined. Plasmid pPINK1-A, containing 4 NFκBbinding sites, was transfected into HEK293 cells, SH-SY5Y cells or N2A cells with either the NFκB expressionplasmid or the empty vector pMTF. The results showedthat NFκB overexpression significantly increased PINK1promoter activity to 3.43 ± 0.55 folds (Figure 3A), 2.11 ±0.10 folds (Figure 3B) and 1.63 ± 0.01 folds (Figure 3C)hematic diagram of the PINK1 promoter constructs consisting of therrow shows the direction of transcription. The numbers represents thewith pCMV-Luc into HEK293 cells. 24 h after the transfection, theLU). The pCMV-Luc was used to normalize for transfection efficiency.followed by post hoc Tukey’s multiple comparisons test.in HEK293, SH-SY5Y cells and N2A cells, respectively(p < 0.01). These results suggest that NFκB activatesPINK1 gene transcription and the PINK1 promoterfragment contains functional NFκB sites.The four putative NFκB elements in the 1.8-kb PINK1promoter region are located at −1493 to -1474 bp, −814to -794 bp, −111 to -92 bp, and −54 to -35 bp, respect-ively. The sequences of these regions are highly homolo-gous to the NFκB consensus sequence 5’-GGGRNNYYCCin which R stands for purine, Y stands for pyrimidine, andN stands for deoxynucleotides. To determine which puta-tive binding site actually binds with NFκB, EMSA was per-formed using four pairs of synthesized oligonucleotidescontaining the binding sequence. The sequences of thesefour oligonucleotides are: PINK1-NFκB-1, 5’- caaatgg-gaaattcatctat, PINK1-NFκB-2, 5’- ggcatggggatccaccatctt,PINK1-NFκB-3, 5’- gcaaagggaaagtcactgct, and PINK1-NFκB-4, 5’- agtcggggaactgccgcggg, respectively. A NFκBbinding probe (NFκB-Wt-oligo) served as a positivebinding probe and a mutant NFκB binding probe(NFκB-Mu-oligo) which loses the NFκB binding abilityserved as a negative binding probe [25]. NFκB-Wt-oligowas labelled with IRDye-700 and the labelled probe wasnamed NFκBwt-IR700. After 30-min incubation withNFκB enriched nuclear extracts of HEK293 cells, theNFκBwt-IR700 bound to NFκB protein and formed ashifted DNA-protein complex band (Figure 3D, lane2).Adding 10-fold of the unlabelled NFκB-Wt-oligo sharplyDuan et al. Molecular Brain 2014, 7:57 Page 5 of 10http://www.molecularbrain.com/content/7/1/57reduced the intensity of the shifted band, indicating thatthe unlabelled NFκB-Wt-oligo competed with and re-duced the binding of NFκB-wt-IR700 to NFκB protein(Figure 3D, lane 5). Increasing the amount of unlabelledNFκB-Wt-oligo to 100-fold almost completely abolishedthe shifted band (Figure 3D, lane 6). Addition of theNFκB-Mu-oligo, which fails to bind with NFκB, did notaffect the interaction between NFκBwt-IR700 and protein(Figure 3D, lane 3–4). The PINK-NFκB-1 to −4 oligoswere tested for their ability to compete against NFκBwt-IR700 binding with NFκB protein. The results indicatedthat addition of 30-fold excess of the four PINK1-NFκBoligos individually barely reduced the intensity of theshifted band (Figure 3D, lane 7, 9, 11, 13). However, in-creasing the amount to 300-fold significantly reduced theintensity of the shifted band for PINK1-NFκB-1 andPINK1-NFκB-3, with PINK1-NFκB-1 being a strongercompetitor than PINK1-NFκB-3 in binding with NFκBprotein (Figure 3D, lane 8 and 12). PINK1-NFκB-2 andPINK1-NFκB-4 showed limited ability in competingFigure 3 NFκB binds to human PINK1 gene promoter. The effects of N(B) and N2A cells (C) were analyzed by luciferase reporter assays. The PINKco-transfected into cells with NFκB expression plasmid or the empty vectot-test.(D) EMSA with NFκB p65 consensus probe. Lane 1 is labeled probe aenriched nuclear extracts forms a shifted DNA-protein complex band (lanecompetition oligonucleotides including NFκB-mu, NFκB-wt, and PINK1-NFκNFκB-1 probe only. Addition of NFκB p65 enriched nuclear extracts forms acompetitor NFκB-wt and NFκB-mu were added at 10- or 100-fold. Lane 7 aantibody band (lane7) and NFκB-wt was added for competition (lane 8).with NFκBwt-IR700 to bind with NFκB (Figure 3D,lane 10 and 14).To further confirm the binding between PINK1-NFκB-1in the human PINK1 promoter region and NFκB, we per-formed EMSA with IRDye-700 labelled PINK1-NFκB-1.The probe showed a shifted band (Figure 3E lane 2) afterincubation with nuclear extracts from HEK293 cells over-expressing NFκB. The intensity of the shifted band wasremarkably reduced when a 10-fold excess of NFκB-Wt-oligo was added to the incubation and abolished after theconcentration of the competitor increased to 100-fold(Figure 3E, lane3-4). However, no competition was foundwhen either 10-fold or 100-fold NFκB-Mu-oligo was ad-ded (Figure 3E, lane 5 and 6). A super-shift assay wasfurther performed with the anti-p65 antibody. The super-shifted band containing labelled PINK1-NFκB-1, NFκB,and anti-p65 antibody was observed at the top of the gel(Figure 3E, lane 7), and the band was competed downby NFκB-Wt-oligo (Figure 3E lane 8). Taken together,the EMSA results demonstrate that NFκB binds to theFκB on the human PINK1 promoter in HEK293 cells (A), SH-SY5Y cells1 promoter reporter plasmid (pPINK1-A) or pGL3-promoter wasr pMTF. Values indicate means ± SEM. n = 3, *p < 0.01 by Student’slone without protein extract. Incubation of the probe with NFκB p652). Competition assays were performed by further adding differentB. (E) EMSA with PINK1 NFκB-1 probe. Lane1 is labelled IR700-PINK1-shifted DNA-protein complex band (lane 2). Lane3 to 6, thend 8, addition of anti-p65 antibody forms a super shifted DNA-protein-human PINK1 gene promoter and the −1493 to -1474 bpof PINK1 promoter region is the main binding site.NFκB increases the human PINK1 gene expressionNext we examined the effects of NFκB on PINK1 geneexpression by RT-PCR and Western blot analysis. Thesemi-quantitative RT-PCR was performed to test whe-ther endogenous PINK1 mRNA level was affected byNFκB. Using the human β-actin as an internal control,NFκB overexpression significantly increased endogenoushuman PINK1 transcription by 59.51% ± 15.13% (p < 0.01)(Figure 4A). To examine whether NFκB modulates PINK1expression at the protein level, endogenous PINK1 proteinwas detected by Western blot analysis. The full-lengthhuman PINK1 protein (FL-PINK1, 63 kDa) and its pro-teolytic products, Δ1-PINK1 (55 kDa) and Δ2-PINK1(45 kDa), were detected and analyzed. The endogenousPINK1 expression increased by 114.53% ± 38% (p < 0.01)(Figure 4B) in the NFκB overexpressing HEK293 cellswhen compared with the vector control. Meanwhile, thesame experiment was performed in SH-SY5Y cells andthree PINK1 species were observed. Consistently, theendogenous PINK1 bands were also up-regulated inNFκB overexpressing SH-SY5Y cells by 45.26% ± 19.58%,41.10 ± 6.70% and 48.54 ± 4.50% (p < 0.01), respectively(Figure 4C). Furthermore, when the NFκB activator LPS(Lipopolysaccharide) was used to treat SH-SY5Y cells for16 hours, endogenous PINK1 protein levels were elevatedcompared to the untreated control by 26.77% ± 2.33%,24.46 ± 2.59% and 83.57 ± 4.60% (p < 0.001) (Figure 4D),respectively.Mitochondrial dysfunction plays a critical role in thedevelopment of PD and other neurodegenerative dis-eases such as Alzheimer’s disease [26-29] and multiplesclerosis [30,31]. Mutations in several genes includingUCHL1 [32], LRRK2 [33], PINK1 [12,34], PARKIN [35]are associated with PD pathogenesis. PINK1 is a mito-chondrial targeted protein and has been extensively stu-died because of its crucial role in autosomal recessivefamilial Parkinson’s disease [36] and protective role againstmitochondrial dysfunction, oxidative stress and apoptosis[37,38]. However, the regulation of PINK1 gene expressionhas not been well addressed yet [39]. For the first time,we studied the transcriptional regulation of the humanPINK1 gene in the present study.To investigate the transcription and translation of thehuman PINK1 gene, we first mapped the adenine 91 bpupstream of the first ATG in exon 1 as the transcriptionstart site. Next we cloned the 1.8 kb fragment of 5’ UTRB inF.B itransfected with NFκB were harvested 48 h after transfection for protein decollected by Licor. A significant increase of endogenous PINK1 was observeNFts ΔSHDuan et al. Molecular Brain 2014, 7:57 Page 6 of 10http://www.molecularbrain.com/content/7/1/57increased by NFκB in SH-SY5Y cells. SH-SY5Y cells were transfected withprotein detections. The human PINK1 protein and its proteolysis producas the internal control. (D) LPS treatment facilitated PINK1 expression inFigure 4 NFκB upregulates human PINK1 gene expression. (A) NFκtransfected with either the NFκB expression vector or empty vector pMTPINK1 coding sequence or the human β-actin coding sequence. (B) NFκsubjected to Western blot. The human β-actin level was served as a contromeans ± SEM. n = 3, *p <0.01 by Student’s t-test.creases the endogenous human PINK1 mRNA level. HEK293 cells wereRT-PCRs were performed using either primers specific to the humanncreases the endogenous human PINK1 protein levels. HEK293 cellstection. Cell lysates were run on 10% glycine gel and images wered. (C) The endogenous human PINK1 protein level was dramaticallyκB p65 plasmids or the control vector pMTF and then harvested for1-PINK1 (55kD) and Δ2-PINK1 (45kD) were all increased. β-actin acted-SY5Y cells. Cells were harvested after being treated for 16 h and thenl. Quantification was performed by Image J software. Values indicatepathogenesis and the role of NFκB dysregulation in PDregulated at its transcription level and NFκB signaling isDuan et al. Molecular Brain 2014, 7:57 Page 7 of 10http://www.molecularbrain.com/content/7/1/57of the human PINK1 gene into a promoterless vector up-stream of a reporter luciferase gene. The luciferase assayshowed that this 1.8 kb fragment has strong promoteractivity, indicating that the 1.8 kb fragment functions asthe human PINK1 gene promoter. Subsequently, by dele-tion analysis we found that the 104 bp fragment from −78to 26 serves as the minimal promoter region. The humanPINK1 gene promoter does not have high GC content(<50%) like the human BACE1 and TMP21 promoter[40,41]. Computer-based analysis revealed that the humanPINK1 promoter contains several putative transcriptionalfactor binding elements such as MZF1, AP1F, CREB,NFκB and EGRF. Due to the importance of NFκB in PD,the potential regulation of PINK1 by NFκB was examined.There are four putative NFκB binding sites in the humanPINK1 gene promoter and our results indicate that two ofthem physically bind with NFκB p65 with one strongbinding site at the distal end. The effect of NFκB p65 onhuman PINK1 gene promoter was further confirmed byluciferase assay, where the overexpression of NFκB p65elevated PINK1 promoter activity dramatically. Further-more, we examined the effects of overexpression of NFκBp65 on PINK1 expression at the transcription and transla-tion levels. Indeed, NFκB p65 increased the human PINK1expression significantly at both the mRNA and proteinlevels. Due to the low expression level of the humanPINK1 gene, few commercially available antibodies coulddetect the endogenous PINK1 clearly. We thereforecloned the human PINK1 plasmid, encoding a full-lengthPINK1 protein (~63 kDa) that is proteolytically processedinto at least two shorter forms (~55 kDa and ~45 kDa),into a human dopaminergic neuroblastoma cell line (SH-SY5Y) [6,7,42]. In this cell line, we were able to detectthree PINK1-related bands. Only the full-length PINK1could be detected in the HEK293 cell line. This might bedue to different expression levels and mitochondrial func-tion between the different cell lines.In this study, we clearly showed that NFκB significantupregulates PINK1 expression in both human and ro-dent cell lines, indicating that same regulation pathwayexists in both human and rodents. It provides the strongevidence to support the use of rodent models to studythe regulation of PINK1 expression in vivo, promotingthe investigation of PD pathogenesis and drug develop-ment. Moreover, as SH-SY5Y cells are human dopamin-ergic cells and the dopaminergic neurons are mainlyaffected in PD patients, the results from SH-SY5Y cellscan better represent the possible PINK1 regulation path-way in the brain of PD patients.N-terminal proteolysis of FL-PINK1 produces two frag-ments, Δ1-PINK1 and Δ2-PINK1. After processing theproteolysis productions translocate to cytosol and undergoproteasome degradation [6,7,42]. Although the functionalrole of PINK1 in mitochondria or in Parkinson’s diseasea positive regulator for PINK1 gene expression.MethodsPrimers and plasmid constructionTo amplify the 5’-untranslated region of the PINK1 genefrom DNA extracted from the human neuroblastomacells SH-SY5Y, a forward primer (5’-cgcgagctcgttgcccaggctggtcttg) corresponding to −1799 bp of the transcrip-tional start site on exon 1 and a reverse primer (5’-cccaagcttcacaacaaacttggggcggtgcc) corresponding to +26 bpof the transcriptional start site were used. The PINK1DNA fragment was cloned into a pGL3-basic vector up-stream of a luciferase reporter gene (Promega) to con-struct pPINK1-A. Primers were designed to includerestriction enzyme sites so that the PCR-amplified frag-ments can be inserted into the multiple cloning sites ofthe pGL3-basic vector. A series of deletion mutations(pPINK1-B, pPINK1-C, pPINK1-D, pPINK1-E, pPINK1-F,pPINK1-G, pPINK1-H and pPINK1-I) of PINK1 promoterwere constructed utilizing primers listed as following:26 F-cccaagcttcacaacaaacttggggcggtgcc, and 1799R- cccaagcttgttgcccaggctggtcttg; −795 F -ggcatggggatccaccatcttg,and -339 F-ccgctcgaggacctcgaatgctgccc; −103 F-ccgctcgwarrants further study.ConclusionOur results demonstrate that PINK1 expression is tightlyhas not been well defined, PINK1 has been shown to con-fer a protective effect through preventing mitochondrialdysfunction, anti-apoptosis and promoting cell survival[43]. It has also been reported that FL-PINK1 accumulatesin the brains of patients with sporadic PD or other synu-cleinopathies, and interestingly, the cleavage products ofPINK1 are also increased in PD brains [44-46]. This accu-mulation of Δ-PINK1 might due to the upregulation ofPINK1 expression in response to PD-related stress [44].Given that truncated PINK1 can confer protection, in-creased cleavage of PINK1 may play a role in protectingneurons during PD pathogenesis. Our result showed thatall of the three forms of PINK1 (FL-PINK1, Δ1-PINK1and Δ2-PINK1) were elevated by overexpression or activa-tion of NFκB signaling. Thus, the increase of PINK1 ex-pression by NFκB activation could be neuroprotective. Onthe other hand, previous studies have suggested that theelevation of NFκB in dopaminergic neurons of PD patientsis a reflection of the apoptotic and inflammatory state ofthe diseased brain [16]. These studies suggest that the ac-tivation of NFκB could be a double-edged sword in PDagaaagtcactgctagaggc, and -50R-cccaagcttcgactcggcgcgtggggg; −78 F-ccgctcgagccagcatagcgcccccac, and -47 Fmoter region were amplified using SMARTer IIA oligo-1× passive lysis buffer (Promega) per well. Firefly luci-Duan et al. Molecular Brain 2014, 7:57 Page 8 of 10http://www.molecularbrain.com/content/7/1/57ferase activities and Renilla luciferase activities of thesame sample were sequentially assayed on a lumin-ometer (Turner Designs Model 20/20) following thenucleotide and PINK1 reverse primer and the first standcDNA as template. The resulting PCR products werecloned into pcDNA4/myc-His A vector for sequencingand the first nucleotide linking with the adapter se-quence was identified as the transcription start site ofthe human PINK1 gene.Cell culture, transfection, and luciferase assayHuman embryonic kidney HEK293, mouse neuroblast-oma N2A and human neuroblastoma SH-SY5Y cell lineswere cultured in Dulbecco’s modified Eagle’s medium(DMEM) containing 10% fetal bovine serum (FBS), 1 mMsodium pyruvate, 2 mM L-glutamine, 50 units/ml pe-nicillin G sodium, and 50 μg/ml streptomycin sulfate(Invitrogen). All cells were maintained in a humidified37°C incubator containing 5% CO2. 500 ng plasmid DNAper well of 24-well-plate for luciferase assay or 2 μg plas-mid DNA per 35-mm-diameter plate for RNA extractionand Western blot analysis were used for cell transfection,respectively. For luciferase assay, pCMV-Rluc (Promega,USA) was co-transfected as a control to normalizethe transfection efficiency. The cells were transfectedusing PEI reagent (Cat#. 23966, Polysciences Inc.) orLipofectamine-™ 2000 reagent (Invitrogen). Cells wereharvested 24 hrs after transfection and lysed with 100 μl-ccgctcgaggaactgccgcgggggccg, and -19 F-ccgctcgagccagcgcctgcgcctgcg, respectively.Switching mechanism at 5’end of RNA transcription(SMART) RACE cDNA amplificationTotal RNA was extracted from SH-SY5Y cells using TRIreagent (Sigma) following the manufacturer’s protocol.SMART-RACE was performed using the SMARTer™RACE cDNA Amplification Kit (Clontech) following theuser’s manual. Simply, the first stand cDNA was syn-thesized from total RNA extracted from SH-SYHY cellswith oligo (dT) primer in the presence of SMARTer IIAoligonucleotide (5’-aagcagtggtatcaacgcagagtacxxxxx (X isundisclosed base in the proprietary SMARTer oligo se-quence). The SMARTer IIA oligonucleotide is able toanneal to the 5’-end of the first stand cDNA and serveas template to extend the 5’-end cDNA tail. A PINK1 re-verse primer (5’-ccgaagcttgccctgcaagcgtctcgtgt) was spe-cifically designed to recognize the +431 to +450 bp ofhuman PINK1 gene downstream of the translation startsite (ATG). The PCR products containing PINK1pro-protocol of the Dual-luciferase Reporter Assay System(Promega). The firefly luciferase activity was normalizedto the Renilla luciferase activity and the resulted valuereflected the promoter activity.Electrophoretic mobility shift assay (EMSA)HEK293 cells were transiently transfected with NFκBp65 and nuclear extracts were collected. Cells were rinsedand harvested with 1 × phosphate-buffered saline. Aftercentrifugation, cell pellets were resuspended with 5 × vol-ume of buffer A [10 mM HEPES pH 7.9, 10 mM KCl,0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol(DTT), 0.5 mM phenylmethylsulfonyl fluoride (PMSF)].Cells were pipetted up and down gently and maintainedon ice for 15 minutes. The cell suspension was transferredto a Kontes all glass Dounce tissue grinder and rupturedby 10 strokes. 10% NP40 was added into the cell suspen-sion for a final concentration of 0.5%. The samples wereplaced on ice for 15 minutes and stroked 5 more times.Crude nuclei were collected by centrifugation at 2000 gfor 10 minutes and washed three times with buffer A con-taining 0.5% NP40 and resuspended in buffer C [20 mMHEPES pH 7.9, 0.4 mM NaCl, 1 mM EDTA, 1 mM EGTA,1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonylfluoride (PMSF), 10% Glycerol] at 4°C for 15 min. Thesamples were centrifuged at 12000 g for 4 min at 4°C, andthe supernatant containing nuclear proteins was collected.EMSA was performed as previously described [40]. Fourpairs of oligonucleotides containing the putative NFκBbinding site on human PINK1 promoter region were syn-thesized for detecting the binding ability of NFκB toPINK1 promoter. The sequences of the oligos were listedas following: NFκB-54-35, forward, agtcggggaactgccgcgggand reverse, cccgcggcagttccccgact; NFκB-111-92, forward,gcaaagggaaagtcactgct and reverse, agcagtgactttccctttgc;NFκB-814-794, forward, ggcatggggatccaccatctt and reverseaagatggtggatccccatgcc; NFκB-1493-1474, forward, caaatgggaaattcatctat and reverse atagatgaatttcccatttg. The probeswere labeled with IRDye-700 (IDT). Prior to incubationwith nuclear extract, oligonucleotide probes were heatedat 98°C for 5 minutes and annealed at 65°C for 10 minutes.0.5 pmol of annealed probes were incubated with 2 μl ofnuclear extract for 20 minutes at 22°C and the reactionmixtures were separated on a 4% Tris-glycine-EDTA gelin darkness. The mobility of probes on the gel was visual-ized using the LI-COR Odyssey (LI-COR Biosciences). Forthe competition assay, wild-type NFκB consensus oligonu-cleotides (forward: agttgaggggactttcccaggc, and reverse:gcctgggaaagtcccctcaact) and mutant NFκB consensus oli-gonucleotides (forward: agttgaggccactttcccaggc, and re-verse: gcctgggaaagtggcctcaact) were used as positive andnegative controls, respectively. For the super shift assay,the nuclear extract was incubated in 10 × EMSA bindingbuffer (100 mM Tris, 500 mM KCl, 10 mM dithiothreitol,pH 7.5) with monoclonal anti-NFκBp65 antibody (Sigma)for 10 minutes prior to the probe adding.Duan et al. Molecular Brain 2014, 7:57 Page 9 of 10http://www.molecularbrain.com/content/7/1/57Semi-quantitative RT-PCRHEK293 cells and SH-SY5Y cells transfected with NFκBp65 were harvested 48 hours after the transfection andtotal RNA was extracted using TRI reagent (Sigma).Reverse transcription was sequentially performed usingThermoScript™ RT-PCR system kit following the manufac-turer’s protocol (Invitrogen). The PINK1 gene specificprimer PINK1 776 F-taccagtgcaccaggagaag and PINK1984R- gcttgggacctctcttggat were used to amplify a 208 bpfragment of human PINK1 gene. The β-actin gene wasalso amplified using the forward primer (hActin-662fBamHI: cgaggatccggacttcgagcaagagatgg) and reverseprimer (hActin-1124rXbaI: cagtctagagaagcatttgcggtggacg),which produced a 500 bp fragment. The PCR productswere analyzed on 2% agarose gels.Western blot analysisWestern blot was performed as described previously[47,48]. NFκB p65 plasmid DNAs (2 μg/35 mm dish)were transfected into HEK293 cells and SH-SY5Y cells.48 hours after transfection, cells were harvested byRIPA-DOC buffer (1% Triton X-100, 0.1% sodium dode-cylsulphate, 1% sodium deoxycholate, 0.15 mM NaCl,0.05 M Tris–HCl pH 7.2, 0.5 mM phenylmethylsulfonylfluoride) containing protease inhibitors (Roche). Cell ly-sates were separated on 10% Tris-glycine gel and pro-teins were transferred onto PVDF membrane, followedby primary antibody incubation overnight at 4°C. Theprimary antibodies were rabbit anti-PINK1 polyclonalantibody (1:500 dilution, Novus BC100-494), anti-p65(1:1000 dilution, Cell Signaling), monoclonal anti-NFκBp65 antibody (1:1000 dilution, Sigma), and anti-β-actinantibody AC-15 (1:100, 000 dilution, Sigma). The pro-tein bands were visualized using the LI-COR Odyssey(LI-COR Biosciences) after secondary antibody (goatanti-mouse, goat anti-rabbit, LI-COR Biosciences) label-ing. The resulted protein bands were quantified by ImageJ software. The experiment was done in triplicate tominimize experimental errors.Competing interestsThe authors declare that they have no competing interests.Authors’ contributionsXD and WS conceived and designed the experiments; XD, JT, QX, YWperformed the experiments; XD, YW, TL and WS analyzed the data; FC, WScontributed reagents/materials/analysis tools; XD, YW and WS wrote thepaper. All authors read and approved the final manuscript.AcknowledgementsWe thank Si Zhang, Juelu Wang, Yi Yang and Zhe Wang for providingvaluable comments and technique supports. This work was supported byCanadian Institutes of Health Research (CIHR) Operating Grant TAD-117948(W.S), and National Natural Science Foundation of China (NSFC) Grant81161120498 (T.L.). WS is the holder of the Canada Research Chair inAlzheimer’s Disease (Tier 1). X.D. is supported by the Chinese ScholarshipCouncil awards.Received: 4 June 2014 Accepted: 29 July 2014Published: 11 August 2014References1. Van Den Eeden SK, Tanner CM, Bernstein AL, Fross RD, Leimpeter A, BlochDA, Nelson LM: Incidence of Parkinson's disease: variation by age,gender, and race/ethnicity. Am J Epidemiol 2003, 157(11):1015–1022.2. Parkinson J: An essay on the shaking palsy. 1817. J Neuropsychiatry ClinNeurosci 2002, 14(2):223–236. discussion 222.3. Shulman JM, De Jager PL, Feany MB: Parkinson's disease: genetics andpathogenesis. Annu Rev Pathol 2011, 6:193–222.4. Lewy F: Paralysis agitans. I. Pathologische anatomie. Handbuch derNeurologie 1912, 3:920–933.5. Unoki M, Nakamura Y: Growth-suppressive effects of BPOZ and EGR2, twogenes involved in the PTEN signaling pathway. Oncogene 2001,20(33):4457–4465.6. Lin W, Kang UJ: Characterization of PINK1 processing, stability, andsubcellular localization. J Neurochem 2008, 106(1):464–474.7. Takatori S, Ito G, Iwatsubo T: Cytoplasmic localization and proteasomaldegradation of N-terminally cleaved form of PINK1. Neurosci Lett 2008,430(1):13–17.8. Greene AW, Grenier K, Aguileta MA, Muise S, Farazifard R, Haque ME,McBride HM, Park DS, Fon EA: Mitochondrial processing peptidaseregulates PINK1 processing, import and Parkin recruitment. EMBO Rep2012, 13(4):378–385.9. Fedorowicz MA, de Vries-Schneider RL, Rub C, Becker D, Huang Y, Zhou C,Alessi Wolken DM, Voos W, Liu Y, Przedborski S: Cytosolic cleaved PINK1represses Parkin translocation to mitochondria and mitophagy. EMBORep 2014, 15(1):86–93.10. Xiong H, Wang D, Chen L, Choo YS, Ma H, Tang C, Xia K, Jiang W, Ronai Z,Zhuang X, Zhang Z: Parkin, PINK1, and DJ-1 form a ubiquitin E3 ligasecomplex promoting unfolded protein degradation. J Clin Invest 2009,119(3):650–660.11. Morais VA, Verstreken P, Roethig A, Smet J, Snellinx A, Vanbrabant M,Haddad D, Frezza C, Mandemakers W, Vogt-Weisenhorn D, Van Coster R,Wurst W, Scorrano L, De Strooper B: Parkinson's disease mutations inPINK1 result in decreased Complex I activity and deficient synapticfunction. EMBO Mol Med 2009, 1(2):99–111.12. Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S,Ali Z, Del Turco D, Bentivoglio AR, Healy DG, Albanese A, Nussbaum R,Gonzalez-Maldonado R, Deller T, Salvi S, Cortelli P, Gilks WP, Latchman DS,Harvey RJ, Dallapiccola B, Auburger G, Wood NW: Hereditary early-onsetParkinson's disease caused by mutations in PINK1. Science 2004,304(5674):1158–1160.13. Valente EM, Bentivoglio AR, Dixon PH, Ferraris A, Ialongo T, Frontali M,Albanese A, Wood NW: Localization of a novel locus for autosomalrecessive early-onset parkinsonism, PARK6, on human chromosome1p35-p36. Am J Hum Genet 2001, 68(4):895–900.14. Shembade N, Harhaj NS, Liebl DJ, Harhaj EW: Essential role for TAX1BP1 inthe termination of TNF-alpha-, IL-1- and LPS-mediated NF-kappaB andJNK signaling. EMBO J 2007, 26(17):3910–3922.15. Liu S, Chen ZJ: Expanding role of ubiquitination in NF-kappaB signaling.Cell Res 2011, 21(1):6–21.16. Mogi M, Kondo T, Mizuno Y, Nagatsu T: p53 protein, interferon-gamma,and NF-kappaB levels are elevated in the parkinsonian brain. NeurosciLett 2007, 414(1):94–97.17. Hunot S, Brugg B, Ricard D, Michel PP, Muriel MP, Ruberg M, Faucheux BA,Agid Y, Hirsch EC: Nuclear translocation of NF-kappaB is increased indopaminergic neurons of patients with parkinson disease. Proc Natl AcadSci U S A 1997, 94(14):7531–7536.18. Cao JP, Wang HJ, Yu JK, Liu HM, Gao DS: The involvement of NF-kappaBp65/p52 in the effects of GDNF on DA neurons in early PD rats. Brain ResBull 2008, 76(5):505–511.19. Ly PT, Wu Y, Zou H, Wang R, Zhou W, Kinoshita A, Zhang M, Yang Y, Cai F,Woodgett J, Song W: Inhibition of GSK3beta-mediated BACE1expression reduces Alzheimer-associated phenotypes. J Clin Invest2013, 123(1):224–235.20. Chen CH, Zhou W, Liu S, Deng Y, Cai F, Tone M, Tone Y, Tong Y, Song W:Increased NF-kappaB signalling up-regulates BACE1 expression and itstherapeutic potential in Alzheimer's disease. Int J Neuropsychopharmacol2012, 15(01):77–90.and localization of PINK1 to aggresomes in the presence of proteasomalstress. J Neurochem 2006, 98(1):156–169.45. Gandhi S, Muqit MM, Stanyer L, Healy DG, Abou-Sleiman PM, Hargreaves I,Heales S, Ganguly M, Parsons L, Lees AJ, Latchman DS, Holton JL, WoodNW, Revesz T: PINK1 protein in normal human brain and Parkinson'sdisease. Brain 2006, 129(Pt 7):1720–1731.46. Murakami T, Moriwaki Y, Kawarabayashi T, Nagai M, Ohta Y, Deguchi K,Kurata T, Morimoto N, Takehisa Y, Matsubara E, Ikeda M, Harigaya Y, Shoji M,Takahashi R, Abe K: PINK1, a gene product of PARK6, accumulates inalpha-synucleinopathy brains. J Neurol Neurosurg Psychiatry 2007,78(6):653–654.47. Qing H, Zhou W, Christensen MA, Sun X, Tong Y, Song W: Degradation ofBACE by the ubiquitin-proteasome pathway. Faseb J 2004, 18(13):1571–1573.48. Zhang Z, Nadeau P, Song W, Donoviel D, Yuan M, Bernstein A, Yankner BA:Presenilins are required for gamma-secretase cleavage of beta-APP andtransmembrane cleavage of Notch-1. Nat Cell Biol 2000, 2(7):463–465.doi:10.1186/s13041-014-0057-yCite this article as: Duan et al.: Upregulation of human PINK1 geneexpression by NFκB signalling. Molecular Brain 2014 7:57.Duan et al. Molecular Brain 2014, 7:57 Page 10 of 10http://www.molecularbrain.com/content/7/1/5721. Zheng L, Liu H, Wang P, Song W, Sun X: Regulator of calcineurin 1 genetranscription is regulated by nuclear factor-kappaB. Curr Alzheimer Res2014, 11(2):156–164.22. Wang R, Zhang M, Zhou W, Ly PT, Cai F, Song W: NF-kappaB signalinginhibits ubiquitin carboxyl-terminal hydrolase L1 gene expression.J Neurochem 2011, 116(6):1160–1170.23. Wang K, Liu S, Wang J, Wu Y, Cai F, Song W: Transcriptional regulation ofhuman USP24 gene expression by NF-kappa B. J Neurochem 2014,128(6):818–828.24. Pranski E, Van Sanford CD, Dalal N, Orr AL, Karmali D, Cooper DS, Gearing M,Lah JJ, Levey AI, Betarbet R: NF-kappaB activity is inversely correlated toRNF11 expression in Parkinson's disease. Neurosci Lett 2013, 547:16–20.25. Hellweg CE, Baumstark-Khan C, Horneck G: Generation of stablytransfected Mammalian cell lines as fluorescent screening assay forNF-kappaB activation-dependent gene expression. J Biomol Screen 2003,8(5):511–521.26. Wu Z, Zhu Y, Cao X, Sun S, Zhao B: Mitochondrial toxic effects of abetathrough mitofusins in the early pathogenesis of alzheimer's disease.Mol Neurobiol 2014. (Epub ahead of printing) PMID:24710686.27. Hauptmann S, Scherping I, Drose S, Brandt U, Schulz KL, Jendrach M, LeunerK, Eckert A, Muller WE: Mitochondrial dysfunction: an early event inAlzheimer pathology accumulates with age in AD transgenic mice.Neurobiol Aging 2009, 30(10):1574–1586.28. Reddy PH: Amyloid beta, mitochondrial structural and functionaldynamics in Alzheimer's disease. Exp Neurol 2009, 218(2):286–292.29. Aliev G, Palacios HH, Walrafen B, Lipsitt AE, Obrenovich ME, Morales L:Brain mitochondria as a primary target in the development oftreatment strategies for Alzheimer disease. Int J Biochem Cell Biol2009, 41(10):1989–2004.30. Bonora M, De Marchi E, Patergnani S, Suski JM, Celsi F, Bononi A, Giorgi C,Marchi S, Rimessi A, Duszynski J, Pozzan T, Wieckowski MR, Pinton P: Tumornecrosis factor-alpha impairs oligodendroglial differentiation through amitochondria-dependent process. Cell Death Differ 2014, 21:1198–1208.31. Ghafourifar P, Mousavizadeh K, Parihar MS, Nazarewicz RR, Parihar A, ZenebeWJ: Mitochondria in multiple sclerosis. Front Biosci 2008, 13:3116–3126.32. Leroy E, Boyer R, Auburger G, Leube B, Ulm G, Mezey E, Harta G, BrownsteinMJ, Jonnalagada S, Chernova T, Dehejia A, Lavedan C, Gasser T, SteinbachPJ, Wilkinson KD, Polymeropoulos MH: The ubiquitin pathway inParkinson's disease. Nature 1998, 395(6701):451–452.33. Paisan-Ruiz C, Jain S, Evans EW, Gilks WP, Simon J, van der Brug M, Lopezde Munain A, Aparicio S, Gil AM, Khan N, Johnson J, Martinez JR, Nicholl D,Carrera IM, Pena AS, de Silva R, Lees A, Marti-Masso JF, Perez-Tur J, WoodNW, Singleton AB: Cloning of the gene containing mutations that causePARK8-linked Parkinson's disease. Neuron 2004, 44(4):595–600.34. Valente EM, Salvi S, Ialongo T, Marongiu R, Elia AE, Caputo V, Romito L,Albanese A, Dallapiccola B, Bentivoglio AR: PINK1 mutations are associatedwith sporadic early-onset parkinsonism. Ann Neurol 2004, 56(3):336–341.35. Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S,Yokochi M, Mizuno Y, Shimizu N: Mutations in the parkin gene causeautosomal recessive juvenile parkinsonism. Nature 1998, 392(6676):605–608.36. Criscuolo C, Volpe G, De Rosa A, Varrone A, Marongiu R, Mancini P,Salvatore E, Dallapiccola B, Filla A, Valente EM Criscuolo C, Volpe G, De RosaA, Varrone A, Marongiu R, Mancin P, Salvatore E, Dallapiccola B, Filla A,Valente EM, De Michele G: PINK1 homozygous W437X mutation in apatient with apparent dominant transmission of parkinsonism.Movement disorders: official journal of the Movement Disorder Society 2006,21(8):1265–1267.37. Gautier CA, Kitada T, Shen J: Loss of PINK1 causes mitochondrialfunctional defects and increased sensitivity to oxidative stress. Proc NatlAcad Sci U S A 2008, 105(32):11364–11369.38. Wang X, Winter D, Ashrafi G, Schlehe J, Wong YL, Selkoe D, Rice S, Steen J,LaVoie MJ, Schwarz TL: PINK1 and Parkin target Miro for phosphorylationand degradation to arrest mitochondrial motility. Cell 2011, 147(4):893–906.39. Tufi R, Gandhi S, de Castro IP, Lehmann S, Angelova PR, Dinsdale D, Deas E,Plun-Favreau H, Nicotera P, Abramov AY Willis AE, Mallucci GR, Loh SH,Martins LM: Enhancing nucleotide metabolism protects againstmitochondrial dysfunction and neurodegeneration in a PINK1 model ofParkinson's disease. Nat Cell Biol 2014, 16(2):157–166.40. Christensen MA, Zhou W, Qing H, Lehman A, Philipsen S, Song W:Transcriptional regulation of BACE1, the beta-amyloid precursor proteinbeta-secretase, by Sp1. Mol Cell Biol 2004, 24(2):865–874.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color figure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistribution41. Liu S, Zhang S, Bromley-Brits K, Cai F, Zhou W, Xia K, Mittelholtz J, Song W:Transcriptional regulation of TMP21 by NFAT. Mol Neurodegeneration2011, 6:21.42. Deas E, Plun-Favreau H, Gandhi S, Desmond H, Kjaer S, Loh SH, Renton AE,Harvey RJ, Whitworth AJ, Martins LM, Abramov AY, Wood NW: PINK1cleavage at position A103 by the mitochondrial protease PARL. Hum MolGenet 2011, 20(5):867–879.43. Sanchez-Mora RM, Arboleda H, Arboleda G: PINK1 overexpression protectsagainst C2-ceramide-induced CAD cell death through the PI3K/AKTpathway. J Mol Neurosci 2012, 47(3):582–594.44. Muqit MM, Abou-Sleiman PM, Saurin AT, Harvey K, Gandhi S, Deas E, EatonS, Payne Smith MD, Venner K, Matilla A, Healy DG, Gilks WP, Lees AJ, HoltonJ, Revesz T, Parker PJ, Harvey RJ, Wood NW, Latchman DS: Altered cleavageSubmit your manuscript at www.biomedcentral.com/submit


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items